Science.gov

Sample records for prokaryotic 5s ribonucleic

  1. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  2. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  3. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  4. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  5. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  6. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  7. The quantitative histochemistry of ribonucleic acid using gallocyanin.

    PubMed

    Brown, A; Scholtz, C L

    1979-03-01

    A method for the cytophotometric estimation of ribonucleic acid in tissue sections using gallocyanin-chrome alum is described. The dye obeys Beer's law in gelatin sections. The effect of deoxyribonuclease on the staining of ribonucleic acid is also investigated. The results indicate that this method is of value in the quantitation of ribonucleic acid. PMID:91237

  8. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  9. Evolution of prokaryote and eukaryote lines inferred from sequence evidence

    NASA Technical Reports Server (NTRS)

    Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.

    1984-01-01

    This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

  10. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  11. The Precarious Prokaryotic Chromosome

    PubMed Central

    2014-01-01

    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other “precarious” features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction. PMID:24633873

  12. The precarious prokaryotic chromosome.

    PubMed

    Kuzminov, Andrei

    2014-05-01

    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other "precarious" features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction. PMID:24633873

  13. Bioinformatics of prokaryotic RNAs

    PubMed Central

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  14. Bioinformatics of prokaryotic RNAs.

    PubMed

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  15. Ribonucleic acid interference (RNAi) and control of citrus pests

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...

  16. [Prokaryotic expression systems].

    PubMed

    Porowińska, Dorota; Wujak, Magdalena; Roszek, Katarzyna; Komoszyński, Michał

    2013-01-01

    For overproduction of recombinant proteins both eukaryotic and prokaryotic expression systems are used. Choosing the right system depends, among other things, on the growth rate and culture of host cells, level of the target gene expression and posttranslational processing of the synthesized protein. Regardless of the type of expression system, its basic elements are the vector and the expression host. The most widely used system for protein overproduction, both on a laboratory and industrial scale, is the prokaryotic system. This system is based primarily on the bacteria E. coli, although increasingly often Bacillus species are used. The prokaryotic system allows one to obtain large quantities of recombinant proteins in a short time. A simple and inexpensive bacterial cell culture and well-known mechanisms of transcription and translation facilitate the use of these microorganisms. The simplicity of genetic modifications and the availability of many bacterial mutants are additional advantages of the prokaryotic system. In this article we characterize the structural elements of prokaryotic expression vectors. Also strategies for preparation of the target protein gene that increase productivity, facilitate detection and purification of recombinant protein and provide its activity are discussed. Bacterial strains often used as host cells in expression systems as well as the potential location of heterologous proteins are characterized. Knowledge of the basic elements of the prokaryotic expression system allows for production of biologically active proteins in a short time and in satisfactory quantities.  PMID:23475488

  17. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  18. Distribution of ribonucleic acid coliphages in animals.

    PubMed Central

    Osawa, S; Furuse, K; Watanabe, I

    1981-01-01

    To determine the distribution pattern of ribonucleic acid (RNA) coliphages (classified by serological groups I through IV) in animal sources, we isolated RNA phages from (i) feces samples from domestic animals (cows, pigs, horses, and fowls), some other animals in a zoological garden, and humans, (ii) the gastrointestinal contents of cows and pigs, and (iii) sewage samples from treatment plants in slaughter houses. These samples were then analyzed serologically. The concentration of RNA phages in the first and second kinds of material was fairly low (10 to 10(3) plaque-forming units per original phage sample), whereas that in the third kind of material was fairly high (10(3) to 10(5) plaque-forming units per original phage sample). Concerning the group types of the RNA phages in the first and second kinds of material, human feces contained RNA phages of groups II and III almost equally, the gastrointestinal contents of pigs included those of groups I and II equally, and the feces or gastrointestinal contents of other mammals other than humans and pigs had those of group I exclusively. In the third type of material we found mostly group I phages with a minor fraction of group II phages. Thus, the prominent features of the distribution pattern of RNA phages are the predominance of groups III and II in humans and the predominance of group I in animals. PMID:7224619

  19. Ecology of prokaryotic viruses.

    PubMed

    Weinbauer, Markus G

    2004-05-01

    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment. PMID:15109783

  20. Prokaryote and eukaryote evolvability.

    PubMed

    Poole, Anthony M; Phillips, Matthew J; Penny, David

    2003-05-01

    The concept of evolvability covers a broad spectrum of, often contradictory, ideas. At one end of the spectrum it is equivalent to the statement that evolution is possible, at the other end are untestable post hoc explanations, such as the suggestion that current evolutionary theory cannot explain the evolution of evolvability. We examine similarities and differences in eukaryote and prokaryote evolvability, and look for explanations that are compatible with a wide range of observations. Differences in genome organisation between eukaryotes and prokaryotes meets this criterion. The single origin of replication in prokaryote chromosomes (versus multiple origins in eukaryotes) accounts for many differences because the time to replicate a prokaryote genome limits its size (and the accumulation of junk DNA). Both prokaryotes and eukaryotes appear to switch from genetic stability to genetic change in response to stress. We examine a range of stress responses, and discuss how these impact on evolvability, particularly in unicellular organisms versus complex multicellular ones. Evolvability is also limited by environmental interactions (including competition) and we describe a model that places limits on potential evolvability. Examples are given of its application to predator competition and limits to lateral gene transfer. We suggest that unicellular organisms evolve largely through a process of metabolic change, resulting in biochemical diversity. Multicellular organisms evolve largely through morphological changes, not through extensive changes to cellular biochemistry. PMID:12689728

  1. Photoregulation in prokaryotes.

    PubMed

    Purcell, Erin B; Crosson, Sean

    2008-04-01

    The spectroscopic identification of sensory rhodopsin I by Bogomolni and Spudich in 1982 provided a molecular link between the light environment and phototaxis in Halobacterium salinarum, and thus laid the foundation for the study of signal transducing photosensors in prokaryotes. In recent years, a number of new prokaryotic photosensory receptors have been discovered across a broad range of taxa, including dozens in chemotrophic species. Among these photoreceptors are new classes of rhodopsins, BLUF-domain proteins, bacteriophytochromes, cryptochromes, and LOV-family photosensors. Genetic and biochemical analyses of these receptors have demonstrated that they can regulate processes ranging from photosynthetic pigment biosynthesis to virulence. PMID:18400553

  2. PolyGuanine methacrylate cryogels for ribonucleic acid purification.

    PubMed

    Köse, Kazım; Uzun, Lokman

    2016-05-01

    The isolation and purification of ribonucleic acid have attracted attention recently for the understanding of the functions in detail because of the necessity for the treatment of genetic diseases. In this study, guanine-incorporated polymeric cryogels were developed to obtain highly purified ribonucleic acid. The satisfactory purification performance was achieved with the guanine-incorporated poly (2-hydroxyethyl methacrylate-guanine methacrylate) cryogels. The most crucial advantages to use guanine as a functional monomer are to obtain a real natural interaction between guanine on the polymeric material and cytosine on the ribonucleic acid. Moreover, using cryogel with a highly porous structure and high swelling ratio provide advantages of getting more water within the structure to get more analyte to interact. The characterization of cryogels has proved the success of the synthesis and the perfect natural interaction to be taken place between the ligand (guanine methacrylate) and the cytosine in the ribonucleic acid molecules. Although the pores within the structure of cryogels are small, they provide efficient and fast adsorption. The chromatographic separation performance was investigated for different conditions (pH, temperature etc.). The desorption ratio and reusability were also analyzed at the end of the five adsorption-desorption cycles with no significant changes. PMID:27004613

  3. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  4. Cell Biology of Prokaryotic Organelles

    PubMed Central

    Murat, Dorothee; Byrne, Meghan; Komeili, Arash

    2010-01-01

    Mounting evidence in recent years has challenged the dogma that prokaryotes are simple and undefined cells devoid of an organized subcellular architecture. In fact, proteins once thought to be the purely eukaryotic inventions, including relatives of actin and tubulin control prokaryotic cell shape, DNA segregation, and cytokinesis. Similarly, compartmentalization, commonly noted as a distinguishing feature of eukaryotic cells, is also prevalent in the prokaryotic world in the form of protein-bounded and lipid-bounded organelles. In this article we highlight some of these prokaryotic organelles and discuss the current knowledge on their ultrastructure and the molecular mechanisms of their biogenesis and maintenance. PMID:20739411

  5. Thiol biochemistry of prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, Robert C.

    1986-01-01

    The present studies have shown that GSH metabolism arose in the purple bacteria and cyanobacteria where it functions to protect against oxygen toxicity. Evidence was obtained indicating that GSH metabolism was incorporated into eucaryotes via the endosymbiosis giving rise to mitochrondria and chloroplasts. Aerobic bacteria lacking GSH utilize other thiols for apparently similar functions, the thiol being coenzyme A in Gram positive bacteria and chi-glutamylcysteine in the halobacteria. The thiol biochemistry of prokaryotes is thus seen to be much more highly diversified than that of eucaryotes and much remains to be learned about this subject.

  6. Do prokaryotes contain microtubules?

    NASA Technical Reports Server (NTRS)

    Bermudes, D.; Hinkle, G.; Margulis, L.

    1994-01-01

    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins.

  7. Promoter propagation in prokaryotes.

    PubMed

    Matus-Garcia, Mariana; Nijveen, Harm; van Passel, Mark W J

    2012-11-01

    Transcriptional activation or 'rewiring' of silent genes is an important, yet poorly understood, phenomenon in prokaryotic genomes. Anecdotal evidence coming from experimental evolution studies in bacterial systems has shown the promptness of adaptation upon appropriate selective pressure. In many cases, a partial or complete promoter is mobilized to silent genes from elsewhere in the genome. We term hereafter such recruited regulatory sequences as Putative Mobile Promoters (PMPs) and we hypothesize they have a large impact on rapid adaptation of novel or cryptic functions. Querying all publicly available prokaryotic genomes (1362) uncovered >4000 families of highly conserved PMPs (50 to 100 long with ≥80% nt identity) in 1043 genomes from 424 different genera. The genomes with the largest number of PMP families are Anabaena variabilis (28 families), Geobacter uraniireducens (27 families) and Cyanothece PCC7424 (25 families). Family size varied from 2 to 93 homologous promoters (in Desulfurivibrio alkaliphilus). Some PMPs are present in particular species, but some are conserved across distant genera. The identified PMPs represent a conservative dataset of very recent or conserved events of mobilization of non-coding DNA and thus they constitute evidence of an extensive reservoir of recyclable regulatory sequences for rapid transcriptional rewiring. PMID:22933716

  8. Do prokaryotes contain microtubules?

    PubMed Central

    Bermudes, D; Hinkle, G; Margulis, L

    1994-01-01

    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins. Images PMID:7968920

  9. Desiccation tolerance of prokaryotes.

    PubMed

    Potts, M

    1994-12-01

    The removal of cell-bound water through air drying and the addition of water to air-dried cells are forces that have played a pivotal role in the evolution of the prokaryotes. In bacterial cells that have been subjected to air drying, the evaporation of free cytoplasmic water (Vf) can be instantaneous, and an equilibrium between cell-bound water (Vb) and the environmental water (vapor) potential (psi wv) may be achieved rapidly. In the air-dried state some bacteria survive only for seconds whereas others can tolerate desiccation for thousands, perhaps millions, of years. The desiccated (anhydrobiotic) cell is characterized by its singular lack of water--with contents as low as 0.02 g of H2O g (dry weight)-1. At these levels the monolayer coverage by water of macromolecules, including DNA and proteins, is disturbed. As a consequence the mechanisms that confer desiccation tolerance upon air-dried bacteria are markedly different from those, such as the mechanism of preferential exclusion of compatible solutes, that preserve the integrity of salt-, osmotically, and freeze-thaw-stressed cells. Desiccation tolerance reflects a complex array of interactions at the structural, physiological, and molecular levels. Many of the mechanisms remain cryptic, but it is clear that they involve interactions, such as those between proteins and co-solvents, that derive from the unique properties of the water molecule. A water replacement hypothesis accounts for how the nonreducing disaccharides trehalose and sucrose preserve the integrity of membranes and proteins. Nevertheless, we have virtually no insight into the state of the cytoplasm of an air-dried cell. There is no evidence for any obvious adaptations of proteins that can counter the effects of air drying or for the occurrence of any proteins that provide a direct and a tangible contribution to cell stability. Among the prokaryotes that can exist as anhydrobiotic cells, the cyanobacteria have a marked capacity to do so. One

  10. Desiccation tolerance of prokaryotes.

    PubMed Central

    Potts, M

    1994-01-01

    The removal of cell-bound water through air drying and the addition of water to air-dried cells are forces that have played a pivotal role in the evolution of the prokaryotes. In bacterial cells that have been subjected to air drying, the evaporation of free cytoplasmic water (Vf) can be instantaneous, and an equilibrium between cell-bound water (Vb) and the environmental water (vapor) potential (psi wv) may be achieved rapidly. In the air-dried state some bacteria survive only for seconds whereas others can tolerate desiccation for thousands, perhaps millions, of years. The desiccated (anhydrobiotic) cell is characterized by its singular lack of water--with contents as low as 0.02 g of H2O g (dry weight)-1. At these levels the monolayer coverage by water of macromolecules, including DNA and proteins, is disturbed. As a consequence the mechanisms that confer desiccation tolerance upon air-dried bacteria are markedly different from those, such as the mechanism of preferential exclusion of compatible solutes, that preserve the integrity of salt-, osmotically, and freeze-thaw-stressed cells. Desiccation tolerance reflects a complex array of interactions at the structural, physiological, and molecular levels. Many of the mechanisms remain cryptic, but it is clear that they involve interactions, such as those between proteins and co-solvents, that derive from the unique properties of the water molecule. A water replacement hypothesis accounts for how the nonreducing disaccharides trehalose and sucrose preserve the integrity of membranes and proteins. Nevertheless, we have virtually no insight into the state of the cytoplasm of an air-dried cell. There is no evidence for any obvious adaptations of proteins that can counter the effects of air drying or for the occurrence of any proteins that provide a direct and a tangible contribution to cell stability. Among the prokaryotes that can exist as anhydrobiotic cells, the cyanobacteria have a marked capacity to do so. One

  11. Evolution of small prokaryotic genomes

    PubMed Central

    Martínez-Cano, David J.; Reyes-Prieto, Mariana; Martínez-Romero, Esperanza; Partida-Martínez, Laila P.; Latorre, Amparo; Moya, Andrés; Delaye, Luis

    2015-01-01

    As revealed by genome sequencing, the biology of prokaryotes with reduced genomes is strikingly diverse. These include free-living prokaryotes with ∼800 genes as well as endosymbiotic bacteria with as few as ∼140 genes. Comparative genomics is revealing the evolutionary mechanisms that led to these small genomes. In the case of free-living prokaryotes, natural selection directly favored genome reduction, while in the case of endosymbiotic prokaryotes neutral processes played a more prominent role. However, new experimental data suggest that selective processes may be at operation as well for endosymbiotic prokaryotes at least during the first stages of genome reduction. Endosymbiotic prokaryotes have evolved diverse strategies for living with reduced gene sets inside a host-defined medium. These include utilization of host-encoded functions (some of them coded by genes acquired by gene transfer from the endosymbiont and/or other bacteria); metabolic complementation between co-symbionts; and forming consortiums with other bacteria within the host. Recent genome sequencing projects of intracellular mutualistic bacteria showed that previously believed universal evolutionary trends like reduced G+C content and conservation of genome synteny are not always present in highly reduced genomes. Finally, the simplified molecular machinery of some of these organisms with small genomes may be used to aid in the design of artificial minimal cells. Here we review recent genomic discoveries of the biology of prokaryotes endowed with small gene sets and discuss the evolutionary mechanisms that have been proposed to explain their peculiar nature. PMID:25610432

  12. The chromosome cycle of prokaryotes

    PubMed Central

    Kuzminov, Andrei

    2013-01-01

    Summary In both eukaryotes and prokaryotes, chromosomal DNA undergoes replication, condensation-decondensation and segregation, sequentially, in some fixed order. Other conditions, like sister-chromatid cohesion (SCC), may span several chromosomal events. One set of these chromosomal transactions within a single cell cycle constitutes the “chromosome cycle”. For many years it was generally assumed that the prokaryotic chromosome cycle follows major phases of the eukaryotic one: -replication-condensation-segregation-(cell division)-decondensation-, with SCC of unspecified length. Eventually it became evident that, in contrast to the strictly consecutive chromosome cycle of eukaryotes, all stages of the prokaryotic chromosome cycle run concurrently. Thus, prokaryotes practice “progressive” chromosome segregation separated from replication by a brief SCC, and all three transactions move along the chromosome at the same fast rate. In other words, in addition to replication forks, there are “segregation forks” in prokaryotic chromosomes. Moreover, the bulk of prokaryotic DNA outside the replication-segregation transition stays compacted. I consider possible origins of this concurrent replication-segregation and outline the “nucleoid administration” system that organizes the dynamic part of the prokaryotic chromosome cycle. PMID:23962352

  13. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  14. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  15. INFECTIVITY OF HISTONE-POLIOVIRUS RIBONUCLEIC ACID PREPARATIONS.

    PubMed

    LUDWIG, E H; SMULL, C E

    1963-06-01

    Ludwig, Ernest H. (The Pennsylvania State University, University Park) and Christine E. Smull. Infectivity of histone-poliovirus ribonucleic acid preparations. J. Bacteriol. 85:1334-1338. 1963.-Some properties of histone-poliovirus ribonucleic acid (RNA) preparations, as relate to infectivity for HeLa cell monolayers, were investigated. The histone-RNA preparations were found to lose their infectivity rapidly at room temperature. They were considerably more stable at ice-bath temperature. Dilution of a histone-RNA preparation in a diluent containing an appropriate amount of histone yielded a plaque count which was proportional to the dilution factor, and which regressed linearly through the point of origin. Dilution of a histone-RNA preparation in a diluent containing no histone resulted in a rapidly decreasing plaque count which was not proportional to the dilution factor. The ability of histone to enhance the infectivity of poliovirus RNA was found to be dependent upon the presence of a low concentration of a monovalent salt in the histone-RNA preparations. Histone-RNA preparations containing approximately isotonic levels of NaCl exhibited a high degree of infectivity. When concentrations of NaCl outside this range were used, a great loss in infectivity of the histone-RNA preparations occurred. The NaCl could be replaced by KCl but not by CaCl(2), MgCl(2), or MgSO(4). PMID:14047226

  16. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  17. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  18. The Epigenomic Landscape of Prokaryotes

    PubMed Central

    Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.; Deutschbauer, Adam M.; Fomenkov, Alexey; Fries, Roxanne; Froula, Jeff; Kang, Dongwan D.; Malmstrom, Rex R.; Morgan, Richard D.; Posfai, Janos; Singh, Kanwar; Visel, Axel; Wetmore, Kelly; Zhao, Zhiying; Rubin, Edward M.; Korlach, Jonas; Pennacchio, Len A.; Roberts, Richard J.

    2016-01-01

    DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities of 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems. PMID:26870957

  19. ASM Conference on Prokaryotic Development

    SciTech Connect

    Kaplan, H. B.

    2005-07-13

    Support was provided by DOE for the 2nd ASM Conference on Prokaryotic Development. The final conference program and abstracts book is attached. The conference presentations are organized around topics that are central to the current research areas in prokaryotic development. The program starts with topics that involve relatively simple models systems and ends with systems that are more complex. The topics are: i) the cell cycle, ii) the cytoskeleton, iii) morphogenesis, iv) developmental transcription, v) signaling, vi) multicellularity, and vii) developmental diversity and symbiosis. The best-studied prokaryotic development model systems will be highlighted at the conference through research presentations by leaders in the field. Many of these systems are also model systems of relevance to the DOE mission including carbon sequestration (Bradyrizobium, Synechococcus), energy production (Anabaena, Rhodobacter) and bioremediation (Caulobacter, Mesorhizobium). In addition, many of the highlighted organisms have important practical applications; the actinomycetes and myxobacteria produce antimicrobials that are of commercial interest. It is certain that the cutting-edge science presented at the conference will be applicable to the large group of bacteria relevant to the DOE mission.

  20. NCBI prokaryotic genome annotation pipeline.

    PubMed

    Tatusova, Tatiana; DiCuccio, Michael; Badretdin, Azat; Chetvernin, Vyacheslav; Nawrocki, Eric P; Zaslavsky, Leonid; Lomsadze, Alexandre; Pruitt, Kim D; Borodovsky, Mark; Ostell, James

    2016-08-19

    Recent technological advances have opened unprecedented opportunities for large-scale sequencing and analysis of populations of pathogenic species in disease outbreaks, as well as for large-scale diversity studies aimed at expanding our knowledge across the whole domain of prokaryotes. To meet the challenge of timely interpretation of structure, function and meaning of this vast genetic information, a comprehensive approach to automatic genome annotation is critically needed. In collaboration with Georgia Tech, NCBI has developed a new approach to genome annotation that combines alignment based methods with methods of predicting protein-coding and RNA genes and other functional elements directly from sequence. A new gene finding tool, GeneMarkS+, uses the combined evidence of protein and RNA placement by homology as an initial map of annotation to generate and modify ab initio gene predictions across the whole genome. Thus, the new NCBI's Prokaryotic Genome Annotation Pipeline (PGAP) relies more on sequence similarity when confident comparative data are available, while it relies more on statistical predictions in the absence of external evidence. The pipeline provides a framework for generation and analysis of annotation on the full breadth of prokaryotic taxonomy. For additional information on PGAP see https://www.ncbi.nlm.nih.gov/genome/annotation_prok/ and the NCBI Handbook, https://www.ncbi.nlm.nih.gov/books/NBK174280/. PMID:27342282

  1. Interferon action on parental Semliki forest virus ribonucleic acid.

    PubMed

    Friedman, R M; Fantes, K H; Levy, H B; Carter, W B

    1967-12-01

    Actinomycin D-treated chick fibroblasts were infected with purified (32)P-labeled Semliki forest virus, and ribonucleic acid (RNA) was extracted after 1 or 2 hr. Within 1 hr, viral RNA forms sedimenting in sucrose gradients at 42S, 30S, and 16S were present. The 42S form corresponded to the RNA of the virion. The 16S form appeared to be a double-stranded template for the formation of new viral RNA, since nascent RNA was associated with it and the molecule could be heat-denatured and subsequently reannealed by slow cooling. Interferon treatment before infection, or puromycin (50 mug/ml) or cycloheximide (200 mug/ml) added at the time of virus infection, had no effect on the formation of the 30S RNA but inhibited the production of the 16S form. Several findings made it unlikely that these results were due to breakdown of parental RNA and reincorporation of (32)P into progeny structures. The results suggested that the mechanism of interferon action involves inhibition of protein synthesis by parental viral RNA, since a specific viral RNA polymerase had previously been demonstrated to be necessary for production of 16S RNA. No protein synthesis appears necessary for formation of 30S RNA from parental virus RNA. PMID:5621488

  2. Ribonucleic acid synthesis in normal and immune macrophages after antigenic stimulus.

    PubMed

    Soderberg, L S; Tewari, R P; Solotorovsky, M

    1976-06-01

    Macrophage ribonucleic acid (RNA) synthesis is an important metabolic process intimately related to the function of these cells. Mouse peritoneal macrophage RNA was extracted with phenol in the presence of bentonite and electrophoresed on composite agarose-polyacrylamide gels. The pulse-chase technique was used to follow the precursor relationships in macrophage ribosomal RNA (rRNA) maturation. The rRNA species at 18S and 28S appeared at 15 and 45 min, respectively, after RNA synthesis was halted. Their appearance corresponded closely to decreases in the rRNA precursors at 45S, 36S, and 34S. Studies of RNA methylation aided in confirming the identity of these ribosomal species. Unmethylated RNA species appeared as messenger RNA between 5S and 15S, and at about 55S probably represented heterodisperse nuclear RNA. When normal macrophages were incubated with heat-killed Salmonella enteritidis, an acceleration in the maturation of RNA was observed. The accelerated maturation was indicated by the earlier appearance of 28S rRNA and the more rapid development of an equilibrium state, where further labeling did not change the RNA profile. In macrophage RNA from mice immunized with S. enteritidis, rRNA species appeared rapidly but did not accumulate to the same extent as observed for normal macrophages. Precursor rRNA and other RNA species developed as usual, suggesting specific degradation of mature rRNA. Such rRNA wastage could indicate a mechanism controlling ribosome assembly in the non-proliferating activated macrophage. The pattern of RNA synthesis in immune macrophages was essentially unchanged by the presence of heat-killed S. enteritidis in vitro. PMID:971940

  3. Eukaryotic vs. prokaryotic chemosensory systems.

    PubMed

    Sbarbati, Andrea; Merigo, Flavia; Osculati, Francesco

    2010-04-01

    In the last decades, microbiologists demonstrated that microorganisms possess chemosensory capabilities and communicate with each other via chemical signals. In parallel, it was demonstrated that solitary eukaryotic chemosensory cells are diffusely located on the mucosae of digestive and respiratory apparatuses. It is now evident that on the mucosal surfaces of vertebrates, two chemoreceptorial systems (i.e. eukaryotic and prokaryotic) coexist in a common microenvironment. To date, it is not known if the two chemosensory systems reciprocally interact and compete for detection of chemical cues. This appears to be a fruitful field of study and future researches must consider that the mucosal epithelia possess more chemosensory capabilities than previously supposed. PMID:20347567

  4. The evolution of ecological tolerance in prokaryotes

    NASA Technical Reports Server (NTRS)

    Knoll, A. H.; Bauld, J.

    1989-01-01

    The ecological ranges of Archaeobacteria and Eubacteria are constrained by a requirement for liquid water and the physico-chemical stability limits of biomolecules, but within this broad envelope, prokaryotes have evolved adaptations that permit them to tolerate a remarkable spectrum of habitats. Laboratory experiments indicate that prokaryotes can adapt rapidly to novel environmental conditions, yet geological studies suggest early diversification and long-term stasis within the prokaryotic kingdoms. These apparently contradictory perspectives can be reconciled by understanding that, in general, rates and patterns of prokaryotic evolution reflect the developmental history of the Earth's surface environments. Our understanding of modern microbial ecology provides a lens through which our accumulating knowledge of physiology, molecular phylogeny and the Earth's history can be integrated and focussed on the phenomenon of prokaryotic evolution.

  5. Stygofauna enhance prokaryotic transport in groundwater ecosystems

    PubMed Central

    Smith, Renee J.; Paterson, James S.; Launer, Elise; Tobe, Shanan S.; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G.

    2016-01-01

    More than 97% of the world’s freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The “hitch-hiking” prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  6. Stygofauna enhance prokaryotic transport in groundwater ecosystems.

    PubMed

    Smith, Renee J; Paterson, James S; Launer, Elise; Tobe, Shanan S; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G

    2016-01-01

    More than 97% of the world's freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The "hitch-hiking" prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  7. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  8. Comparison of methods of extracting messenger Ribonucleic Acid from ejaculated Porcine (Sus Scrofa) Spermatozoa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    H. D. Guthrie, G.R. Welch, and L. A. Blomberg. Comparison of Methods of Extracting Messenger Ribonucleic Acid from Ejaculated Porcine (Sus Scrofa) Spermatozoa. Biotechnology and Germplasm Laboratory, Agricultural Research Service U. S. Department of Agriculture, Beltsville, MD 20705 The purpos...

  9. Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....

  10. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  11. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  14. A critique of prokaryotic species concepts.

    PubMed

    Thane Papke, R

    2009-01-01

    Developments in DNA sequencing and population genetics analyses have revealed unanticipated complexity in prokaryotic variation. The observation that genetic traits are horizontally inherited at unexpected rates within and between closely related asexually reproducing lineages impacts our comprehension of prokaryotic evolution and ecology. As a result, the concepts that point to species as being discrete clusters or monophyletic lineages are at odds with most of the data, suggesting that taxon circumscription can only proceed by informed compromise, pragmatism, and subjectivity. PMID:19271197

  15. Characterization of a Ribonucleic Acid Polymerase Activity Associated with Purified Cytoplasmic Polyhedrosis Virus of the Silkworm Bombyx mori1

    PubMed Central

    Lewandowski, L. J.; Kalmakoff, J.; Tanada, Y.

    1969-01-01

    Purified cytoplasmic-polyhedrosis virus has been found to have associated with it a polymerase activity capable of catalyzing the synthesis of virus-specific, single-stranded ribonucleic acid (RNA) from the double-stranded RNA genome. PMID:16789118

  16. Prokaryotic and eukaryotic unicellular chronomics

    PubMed Central

    Halberg, F.; Cornélissen, G.; Faraone, P.; Poeggeler, B.; Hardeland, R.; Katinas, G.; Schwartzkopff, O.; Otsuka, K.; Bakken, E. E.

    2008-01-01

    An impeccable time series, published in 1930, consisting of hourly observations on colony advance in a fluid culture of E. coli, was analyzed by a periodogram and power spectrum in 1961. While the original senior author had emphasized specifically periodicity with no estimate of period length, he welcomed further analyses. After consulting his technician, he knew of no environmental periodicity related to human schedules other than an hourly photography. A periodogram analysis in 1961 showed a 20.75-h period. It was emphasized that “… the circadian period disclosed is not of exactly 24-h length.” Confirmations notwithstanding, a committee ruled out microbial circadian rhythms based on grounds that could have led to a different conclusion, namely first, the inability of some committee members to see (presumably by eyeballing) the rhythms in their own data, and second, what hardly follows, that there were “too many analyses” in the published papers. Our point in dealing with microbes and humans is that analyses are indispensable for quantification and for discovering a biologically novel spectrum of cyclicities, matching physical ones. The scope of circadian organization estimated in 1961 has become broader, including about 7-day, about half-yearly, about-yearly and ex-yearly and decadal periodisms, among others. Microbial circadians have become a field of their own with eyeballing, yet time-microscopy can quantify characteristics with their uncertainties and can assess broad chronomes (time structures) with features beyond circadians. As yet only suggestive differences between eukaryotes and prokaryotes further broaden the perspective and may lead to life’s sites of origin and to new temporal aspects of life’ s development as a chronomic tree by eventual rhythm dating in ontogeny and phylogeny. PMID:16275493

  17. Isolation and analysis of (Gp)nXp sequences of rat liver 5S RNA by means of restricted ribonuclease T2 hydrolysis

    PubMed Central

    Willems, R.; Avdonina, T.; Lund, A.; Kisselev, L.L.

    1974-01-01

    Essentual difficulties arise when base number in oligoguanylic blocks and location of these blocks along the polynucleotide chain need to be determined in the course of determination of the nucleotide sequences in ribonucleic acids. To overcome this difficulty it is suggested to take advantage of a recently discovered resistance of phosphodiester bond between kethoxalated G and its 3′-neighbour against T2 RNase hydrolysis 1,2. The approach is illustrated by analysis of 5S RNA from rat liver. Sequences of general formula (Gp)nXp were isolated from T2 RNase hydrolysate of 5 S RNA rapidly and quantitatively. The information obtained greatly facilitates the whole procedure of sequencing. It is expected that the method proposed would be effective for analysis of 5 S and 4 S RNA and for highmolecular weight fragments of ribosomal and viral RNAs. PMID:4453523

  18. [Role of non-coding regulatory ribonucleic acids in chronic inflammatory diseases].

    PubMed

    Heinz, G A; Mashreghi, M-F

    2016-05-01

    Non-coding regulatory ribonucleic acids (RNA), including microRNA, long non-coding RNA and circular RNA, can influence the expression of genes mediating inflammatory processes and therefore affect the course and progression of chronic inflammatory diseases. Recent studies using antisense oligonucleotides suggest that such non-coding regulatory RNAs are suitable as novel therapeutic target molecules for the treatment of inflammatory rheumatic diseases. PMID:27115697

  19. Evolutionary assembly patterns of prokaryotic genomes.

    PubMed

    Press, Maximilian O; Queitsch, Christine; Borenstein, Elhanan

    2016-06-01

    Evolutionary innovation must occur in the context of some genomic background, which limits available evolutionary paths. For example, protein evolution by sequence substitution is constrained by epistasis between residues. In prokaryotes, evolutionary innovation frequently happens by macrogenomic events such as horizontal gene transfer (HGT). Previous work has suggested that HGT can be influenced by ancestral genomic content, yet the extent of such gene-level constraints has not yet been systematically characterized. Here, we evaluated the evolutionary impact of such constraints in prokaryotes, using probabilistic ancestral reconstructions from 634 extant prokaryotic genomes and a novel framework for detecting evolutionary constraints on HGT events. We identified 8228 directional dependencies between genes and demonstrated that many such dependencies reflect known functional relationships, including for example, evolutionary dependencies of the photosynthetic enzyme RuBisCO. Modeling all dependencies as a network, we adapted an approach from graph theory to establish chronological precedence in the acquisition of different genomic functions. Specifically, we demonstrated that specific functions tend to be gained sequentially, suggesting that evolution in prokaryotes is governed by functional assembly patterns. Finally, we showed that these dependencies are universal rather than clade-specific and are often sufficient for predicting whether or not a given ancestral genome will acquire specific genes. Combined, our results indicate that evolutionary innovation via HGT is profoundly constrained by epistasis and historical contingency, similar to the evolution of proteins and phenotypic characters, and suggest that the emergence of specific metabolic and pathological phenotypes in prokaryotes can be predictable from current genomes. PMID:27197212

  20. How crowded is the prokaryotic cytoplasm?

    PubMed

    Spitzer, Jan; Poolman, Bert

    2013-07-11

    We consider biomacromolecular crowding within the cytoplasm of prokaryotic cells as a two-phase system of 'supercrowded' cytogel and 'dilute' cytosol; we simplify and quantify this model for a coccoid cell over a wide range of biomacromolecular crowding. The key result shows that the supercrowded cytogel extends the vectorial character of the plasma membrane deeper into the cytoplasm by about 20-70 nm. We discuss useful physiological insights that this model gives into the functioning of a prokaryotic cell on the micrometer scale. PMID:23735698

  1. Microcompartments and Protein Machines in Prokaryotes

    PubMed Central

    Saier, Milton H.

    2013-01-01

    The prokaryotic cell was once thought of as a “bag of enzymes” with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, non-random collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (i) the bacterial cytoskeleton and the apparati allowing DNA segregation during cells division, (ii) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis, (iii) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces, (iv) machines of protein folding, secretion and degradation, (v) metabolasomes carrying out specific chemical reactions, (vi) 24 hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle and (vii) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bounded prokaryotic organelles were considered in a recent JMMB written symposium concerned with membraneous compartmentalization in bacteria [Saier and Bogdanov, 2013]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple non-compartmentalized cell. PMID:23920489

  2. Stochastic evolution and multifractal classification of prokaryotes

    NASA Astrophysics Data System (ADS)

    Berryman, Matthew J.; Allison, Andrew G.; Abbott, Derek

    2003-05-01

    We introduce a model for simulating mutation of prokaryote DNA sequences. Using that model we can then evaluated traditional techniques like parsimony and maximum likelihood methods for computing phylogenetic relationships. We also use the model to mimic large scale genomic changes, and use this to evaluate multifractal and related information theory techniques which take into account these large changes in determining phylogenetic relationships.

  3. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  4. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  5. Prokaryotic Diacylglycerol Kinase and Undecaprenol Kinase

    PubMed Central

    Van Horn, Wade D.; Sanders, Charles R.

    2013-01-01

    Prokaryotic diacylglycerol kinase (DAGK) and undecaprenol kinase (UDPK) are the lone members of a family of multispan membrane enzymes that are very small, lack relationships to any other family of proteins—including water soluble kinases, and that exhibit an unusual structure and active site architecture. Escherichia coli DAGK plays an important role in recycling diacylglycerol produced as a byproduct of biosynthesis of molecules located in the periplasmic space. UDPK seems to play an analogous role in Gram-positive bacteria, where its importance is evident by the fact that UDPK is essential for biofilm formation by the oral pathogen Streptococcus mutans. DAGK has also long served as a model system for studies of membrane protein biocatalysis, folding, stability, and structure. This review explores our current understanding of the microbial physiology, enzymology, structural biology, and folding of the prokaryotic diacylglycerol kinase family, which is based on over 40 years of studies. PMID:22224599

  6. Microcompartments and protein machines in prokaryotes.

    PubMed

    Saier, Milton H

    2013-01-01

    The prokaryotic cell was once thought of as a 'bag of enzymes' with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, nonrandom collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (1) the bacterial cytoskeleton and the apparati allowing DNA segregation during cell division; (2) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis; (3) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces; (4) machines of protein folding, secretion and degradation; (5) metabolosomes carrying out specific chemical reactions; (6) 24-hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle, and (7) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bound prokaryotic organelles were considered in a recent Journal of Molecular Microbiology and Biotechnology written symposium concerned with membranous compartmentalization in bacteria [J Mol Microbiol Biotechnol 2013;23:1-192]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple noncompartmentalized cell. PMID:23920489

  7. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals' actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a "forgotten organ," functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host's biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID:26664911

  8. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed Central

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals’ actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a “forgotten organ,” functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host’s biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID

  9. Effect of Ethionine on the Ribonucleic Acid, Deoxyribonucleic Acid, and Protein Content of Escherichia coli

    PubMed Central

    Smith, Robert C.; Salmon, W. D.

    1965-01-01

    Smith, Robert C. (Auburn University, Auburn, Ala.), and W. D. Salmon. Effect of ethionine on the ribonucleic acid, deoxyribonucleic acid, and protein content of Escherichia coli. J. Bacteriol. 89:687–692. 1965.—The addition of ethionine to cultures of Escherichia coli K-12 W6, a methionine-requiring auxotroph, led to inhibition of the rate of increase in optical density when the ratio of ethionine to methionine was 200:1. When the ratio was 600:1, the increase in optical density became linear. When ethionine was substituted for methionine in the medium, the optical density of the culture increased, and there was a parallel increase in protein content. There was no cell division in these cultures. The rate of synthesis of ribonucleic acid (RNA) in a culture containing ethionine was similar to that of a culture deprived of methionine, but the synthesis of deoxyribonucleic acid in a culture with ethionine was about twice that of a culture deprived of methionine. No detectable radioactivity from ethionine-ethyl-1-C14 was incorporated into RNA. Ethionine-ethyl-1-C14 was readily incorporated into the protein fraction. PMID:14273646

  10. A quest for indigenous truffle helper prokaryotes.

    PubMed

    Gryndler, Milan; Soukupová, Lucie; Hršelová, Hana; Gryndlerová, Hana; Borovička, Jan; Streiblová, Eva; Jansa, Jan

    2013-06-01

    Tuber aestivum is the most common European truffle with significant commercial exploitation. Its production originates from natural habitats and from artificially inoculated host tree plantations. Formation of Tuber ectomycorrhizae in host seedling roots is often inefficient. One possible reason is the lack of indigenous associative microbes. Here we aimed at metagenetic characterization and cultivation of indigenous prokaryotes associated with T. aestivum in a field transect cutting through the fungus colony margin. Several operational taxonomic units (OTUs) showed close association with the T. aestivum in the ectomycorrhizae and in the soil, but there was no overlap between the associative prokaryotes in the two different habitats. Among those positively associated with the ectomycorrhizae, we identified several bacterial genera belonging to Pseudonocardineae. Extensive isolation efforts yielded many cultures of ectomycorrhizae-associative bacteria belonging to Rhizobiales and Streptomycineae, but none belonging to the Pseudonocardineae. The specific unculturable Tuber-associated prokaryotes are likely to play important roles in the biology of these ectomycorrhizal fungi, including modulation of competition with other symbiotic and saprotrophic microbes, facilitation of root penetration and/or accessing mineral nutrients in the soil. However, the ultimate proof of this hypothesis will require isolation of the microbes for metabolic studies, using novel cultivation approaches. PMID:23754715

  11. Metabolic Adaptation and Protein Complexes in Prokaryotes

    PubMed Central

    Krüger, Beate; Liang, Chunguang; Prell, Florian; Fieselmann, Astrid; Moya, Andres; Schuster, Stefan; Völker, Uwe; Dandekar, Thomas

    2012-01-01

    Protein complexes are classified and have been charted in several large-scale screening studies in prokaryotes. These complexes are organized in a factory-like fashion to optimize protein production and metabolism. Central components are conserved between different prokaryotes; major complexes involve carbohydrate, amino acid, fatty acid and nucleotide metabolism. Metabolic adaptation changes protein complexes according to environmental conditions. Protein modification depends on specific modifying enzymes. Proteins such as trigger enzymes display condition-dependent adaptation to different functions by participating in several complexes. Several bacterial pathogens adapt rapidly to intracellular survival with concomitant changes in protein complexes in central metabolism and optimize utilization of their favorite available nutrient source. Regulation optimizes protein costs. Master regulators lead to up- and downregulation in specific subnetworks and all involved complexes. Long protein half-life and low level expression detaches protein levels from gene expression levels. However, under optimal growth conditions, metabolite fluxes through central carbohydrate pathways correlate well with gene expression. In a system-wide view, major metabolic changes lead to rapid adaptation of complexes and feedback or feedforward regulation. Finally, prokaryotic enzyme complexes are involved in crowding and substrate channeling. This depends on detailed structural interactions and is verified for specific effects by experiments and simulations. PMID:24957769

  12. Dissecting the Molecular Properties of Prokaryotic Flotillins

    PubMed Central

    Bach, Juri Niño; Bramkamp, Marc

    2015-01-01

    Flotillins are universally conserved proteins that are present in all kingdoms of life. Recently it was demonstrated that the B. subtilis flotillin YuaG (FloT) has a direct influence on membrane domain formation by orchestrating lipid domains. Thereby it allocates a proper environment for diverse cellular machineries. YuaG creates platforms for signal transduction, processes crucial for biofilm formation, sporulation, competence, secretion, and others. Even though, flotillins are an emerging topic of research in the field of microbiology little is known about the molecular architecture of prokaryotic flotillins. All flotillins share common structural elements and are tethered to the membrane N’- terminally, followed by a so called PHB domain and a flotillin domain. We show here that prokaryotic flotillins are, similarly to eukaryotic flotillins, tethered to the membrane via a hairpin loop. Further it is demonstrated by sedimentation assays that B. subtilis flotillins do not bind to the membrane via their PHB domain contrary to eukaryotic flotillins. Size exclusion chromatography experiments, blue native PAGE and cross linking experiments revealed that B. subtilis YuaG can oligomerize into large clusters via the PHB domain. This illustrates an important difference in the setup of prokaryotic flotillins compared to the organization of eukaryotic flotillins. PMID:25635948

  13. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  14. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola

    1970-01-01

    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  15. Regulation of the Tyrosine Biosynthetic Enzymes in Salmonella typhimurium: Analysis of the Involvement of Tyrosyl-Transfer Ribonucleic Acid and Tyrosyl-Transfer Ribonucleic Acid Synthetase1

    PubMed Central

    Heinonen, J.; Artz, S. W.; Zalkin, H.

    1972-01-01

    Mutants of Salmonella typhimurium were isolated that require tyrosine for growth because of an altered tyrosyl-transfer ribonucleic acid (tRNA) synthetase. Extracts of one strain (JK10) contain a labile enzyme with decreased ability to transfer tyrosine to tRNATyr and a higher Km for tyrosine than the wild-type enzyme. Strain JK10 maintains repressed levels of the tyrosine biosynthetic enzymes when the growth rate is restricted due to limitation of charged tRNATyr. Several second-site revertants of strain JK10 exhibit temperature-sensitive growth due to partially repaired, heat-labile tyrosyl-tRNA synthetase. The tyrosine biosynthetic enzymes are not derepressed in thermosensitive strains grown at the restrictive temperature. A class of tyrosine regulatory mutants, designated tyrR, contains normal levels of tyrosyl-tRNA synthetase and tRNATyr. These results suggest that charging of tRNATyr is not necessary for repression. This conclusion is substantiated by the finding that 4-aminophenylalanine, a tyrosine analogue which causes repression of the tyrosine biosynthetic enzymes, is not attached to tRNATyr in vivo, nor does it inhibit the attachment reaction in vitro. A combined regulatory effect due to the simultaneous presence of tyrS and tyrR mutations in the same strain was detected. The possibility of direct participation of tyrosyl-tRNA synthetase in tyrosine regulation is discussed. PMID:4404819

  16. Advantages and limitations of genomics in prokaryotic taxonomy.

    PubMed

    Sentausa, E; Fournier, P-E

    2013-09-01

    Taxonomic classification is an important field of microbiology, as it enables scientists to identify prokaryotes worldwide. Although the current classification system is still based on the one designed by Carolus Linnaeus, the currently available genomic content of several thousands of sequenced prokaryotic genomes represents a unique source of taxonomic information that should not be ignored. In addition, the development of faster, cheaper and improved sequencing methods has made genomics a tool that has a place in the workflow of a routine microbiology laboratory. Thus, genomics has reached a stage where it may be used in prokaryotic taxonomic classification, with criteria such as the genome index of average nucleotide identity being an alternative to DNA-DNA hybridization. However, several hurdles remain, including the lack of genomic sequences of many prokaryotic taxonomic representatives, and consensus procedures to describe new prokaryotic taxa that do not, as yet, accommodate genomic data. We herein review the advantages and disadvantages of using genomics in prokaryotic taxonomy. PMID:23490121

  17. Control of larval and egg development in Aedes aegypti with Ribonucleic acid interference (RNAi) against juvenile hormone acid methyl transferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi) is a powerful approach for elucidating gene functions in a variety of organisms, including mosquitoes and many other insects. Little has been done, however, to harness this approach in order to control adult and larval mosquitoes. Juvenile hormone (JH) plays a pi...

  18. Simple sequence repeats in prokaryotic genomes

    PubMed Central

    Mrázek, Jan; Guo, Xiangxue; Shah, Apurva

    2007-01-01

    Simple sequence repeats (SSRs) in DNA sequences are composed of tandem iterations of short oligonucleotides and may have functional and/or structural properties that distinguish them from general DNA sequences. They are variable in length because of slip-strand mutations and may also affect local structure of the DNA molecule or the encoded proteins. Long SSRs (LSSRs) are common in eukaryotes but rare in most prokaryotes. In pathogens, SSRs can enhance antigenic variance of the pathogen population in a strategy that counteracts the host immune response. We analyze representations of SSRs in >300 prokaryotic genomes and report significant differences among different prokaryotes as well as among different types of SSRs. LSSRs composed of short oligonucleotides (1–4 bp length, designated LSSR1–4) are often found in host-adapted pathogens with reduced genomes that are not known to readily survive in a natural environment outside the host. In contrast, LSSRs composed of longer oligonucleotides (5–11 bp length, designated LSSR5–11) are found mostly in nonpathogens and opportunistic pathogens with large genomes. Comparisons among SSRs of different lengths suggest that LSSR1–4 are likely maintained by selection. This is consistent with the established role of some LSSR1–4 in enhancing antigenic variance. By contrast, abundance of LSSR5–11 in some genomes may reflect the SSRs' general tendency to expand rather than their specific role in the organisms' physiology. Differences among genomes in terms of SSR representations and their possible interpretations are discussed. PMID:17485665

  19. Evolution of gene order conservation in prokaryotes

    PubMed Central

    Tamames, Javier

    2001-01-01

    Background As more complete genomes are sequenced, conservation of gene order between different organisms is emerging as an informative property of the genomes. Conservation of gene order has been used for predicting function and functional interactions of proteins, as well as for studying the evolutionary relationships between genomes. The reasons for the maintenance of gene order are still not well understood, as the organization of the prokaryote genome into operons and lateral gene transfer cannot possibly account for all the instances of conservation found. Comprehensive studies of gene order are one way of elucidating the nature of these maintaining forces. Results Gene order is extensively conserved between closely related species, but rapidly becomes less conserved among more distantly related organisms, probably in a cooperative fashion. This trend could be universal in prokaryotic genomes, as archaeal genomes are likely to behave similarly to bacterial genomes. Gene order conservation could therefore be used as a valid phylogenetic measure to study relationships between species. Even between very distant species, remnants of gene order conservation exist in the form of highly conserved clusters of genes. This suggests the existence of selective processes that maintain the organization of these regions. Because the clusters often span more than one operon, common regulation probably cannot be invoked as the cause of the maintenance of gene order. Conclusions Gene order conservation is a genomic measure that can be useful for studying relationships between prokaryotes and the evolutionary forces shaping their genomes. Gene organization is extensively conserved in some genomic regions, and further studies are needed to elucidate the reason for this conservation. PMID:11423009

  20. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  1. Emerging spatial patterns in Antarctic prokaryotes.

    PubMed

    Chong, Chun-Wie; Pearce, David A; Convey, Peter

    2015-01-01

    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  2. Emerging spatial patterns in Antarctic prokaryotes

    PubMed Central

    Chong, Chun-Wie; Pearce, David A.; Convey, Peter

    2015-01-01

    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  3. Transcription In Vitro by Reovirus-Associated Ribonucleic Acid-Dependent Polymerase 1

    PubMed Central

    Banerjee, A. K.; Shatkin, A. J.

    1970-01-01

    Digestion of purified reovirus type 3 with chymotrypsin degrades 70% of the viral protein and converts the virions to subviral particles (SVP). The SVP contain 3 of the 6 viral structural proteins and all 10 double-stranded ribonucleic acid (RNA) genome segments but not adenine-rich, single-stranded RNA. An RNA polymerase which is structurally associated with SVP transcribes one strand of each genome segment by a conservative mechanism in vitro. The single-stranded products include large (1.2 × 106 daltons), medium (0.7 × 106 daltons), and small (0.4 × 106 daltons) molecules which hybridize exclusively with the corresponding genome segments. The enzyme obtained by heating virions at 60 C synthesizes similar products. Kinetic and pulse-chase studies indicate that the different-sized products are synthesized simultaneously but at rates which are in the order: small > medium > large. Images PMID:5529847

  4. Inhibition of ribonucleic acid polymerase by a bacteriocin from Bacteroides fragilis.

    PubMed Central

    Mossie, K G; Robb, F T; Jones, D T; Woods, D R

    1981-01-01

    The Bacteroides fragilis bacteriocin which inhibits ribonucleic acid (RNA) polymerase activity had a narrow activity spectrum in vivo and only inhibited the growth of certain B. fragilis strains. In vitro the bacteriocin was not specific and inhibited RNA polymerases from widely diverse bacterial genera. RNA polymerases from rifampin-resistant strains of Bacteroides thetaiotaomicron and Clostridium acetobutylicum were resistant to the bacteriocin in vitro. Purified bacteriocin bound to partially purified RNA polymerase, and both proteins were cosedimented in a glycerol gradient. In the RNA polymerase reaction, the bacteriocin acted as a competitive inhibitor for adenosine, cytidine, and uridine 5'-triphosphates and as a noncompetitive inhibitor for guanosine 5'-triphosphate. The bacteriocin did not inhibit RNA polymerase from chicken embryos. PMID:6177280

  5. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    SciTech Connect

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2014-09-15

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitated lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.

  6. The role of renin-angiotensin aldosterone system related micro-ribonucleic acids in hypertension

    PubMed Central

    Wang, Hui-Bo; Yang, Jun

    2015-01-01

    Micro-ribonucleic acids (miRNAs) are small (21-25 nucleotide) single-stranded, evolutionarily conserved non-protein-coding RNAs, which control diverse cellular functions by interacting with the 3’ untranslated region of specific target messenger RNAs at the post-transcriptional level. Research shows that an aberrant expression profile of miRNAs has been linked to a series of diseases, including hypertension. In the past few decades, it has been demonstrated that excessive activation of the renin-angiotensin aldosterone system (RAAS) involves in the pathogenesis of hypertension. This article reviews the latest insights in the identification of RAAS-correlative miRNAs and the potential mechanisms for their roles in hypertension. PMID:26446323

  7. Prokaryotic silicon utilizing microorganisms in the biosphere

    NASA Astrophysics Data System (ADS)

    Gupta, D.; Das, S.

    2012-12-01

    Although a little study has been done to determine the silicon utilizing prokaryotes, our previous experiments indicated that almost all Gram-positive bacteria are silicon utilizing; one of them, Streptococci survived exposure on the lunar surface for a long period in experiment done by others. Our initial experiments with these Gram positive microorganisms showed that there were limited growths of these microorganisms on carbon free silicate medium probably with the help of some carry over carbon and nitrogen during cultivation procedures. However, increase in growth rate after repeated subcultures could not be explained at present. The main groups of prokaryotes which were found silicon utilizing microorganisms were Mycobacterium, Bacillus, Nocardia, Streptomyces, Staphylococcus, Streptococcus, Lactobacillus, and Clostridium. In a another previous study by us when silicon level was studied in such grown up cells on carbon "free" silicate medium by electron prove microanalyser, it was found that silicon in cells grown on carbon "free" silicate medium was much higher (24.9%) than those grown on conventional carbon based medium (0.84%). However, these initial findings are encouraging for our future application of this group of organisms on extraterrestrial surfaces for artificial micro-ecosystem formation. It was found that when electropositive elements are less in extraterrestrial situation, then polymerization of silicon-oxygen profusion may occur easily, particularly in carbon and nitrogen paucity in the rocky worlds of the Universe.

  8. Prokaryotic Ubiquitin-Like Protein Modification

    PubMed Central

    Maupin-Furlow, Julie A.

    2016-01-01

    Prokaryotes form ubiquitin (Ub)-like isopeptide bonds on the lysine residues of proteins by at least two distinct pathways that are reversible and regulated. In mycobacteria, the C-terminal Gln of Pup (prokaryotic ubiquitin-like protein) is deamidated and isopeptide linked to proteins by a mechanism distinct from ubiquitylation in enzymology yet analogous to ubiquitylation in targeting proteins for destruction by proteasomes. Ub-fold proteins of archaea (SAMPs, small archaeal modifier proteins) and Thermus (TtuB, tRNA-two-thiouridine B) that differ from Ub in amino acid sequence, yet share a common β-grasp fold, also form isopeptide bonds by a mechanism that appears streamlined compared with ubiquitylation. SAMPs and TtuB are found to be members of a small group of Ub-fold proteins that function not only in protein modification but also in sulfur-transfer pathways associated with tRNA thiolation and molybdopterin biosynthesis. These multifunctional Ub-fold proteins are thought to be some of the most ancient of Ub-like protein modifiers. PMID:24995873

  9. PEPR: pipelines for evaluating prokaryotic references.

    PubMed

    Olson, Nathan D; Zook, Justin M; Samarov, Daniel V; Jackson, Scott A; Salit, Marc L

    2016-04-01

    The rapid adoption of microbial whole genome sequencing in public health, clinical testing, and forensic laboratories requires the use of validated measurement processes. Well-characterized, homogeneous, and stable microbial genomic reference materials can be used to evaluate measurement processes, improving confidence in microbial whole genome sequencing results. We have developed a reproducible and transparent bioinformatics tool, PEPR, Pipelines for Evaluating Prokaryotic References, for characterizing the reference genome of prokaryotic genomic materials. PEPR evaluates the quality, purity, and homogeneity of the reference material genome, and purity of the genomic material. The quality of the genome is evaluated using high coverage paired-end sequence data; coverage, paired-end read size and direction, as well as soft-clipping rates, are used to identify mis-assemblies. The homogeneity and purity of the material relative to the reference genome are characterized by comparing base calls from replicate datasets generated using multiple sequencing technologies. Genomic purity of the material is assessed by checking for DNA contaminants. We demonstrate the tool and its output using sequencing data while developing a Staphylococcus aureus candidate genomic reference material. PEPR is open source and available at https://github.com/usnistgov/pepr . PMID:26935931

  10. Biophysical Adaptations of Prokaryotic Voltage-Gated Sodium Channels.

    PubMed

    Vien, T N; DeCaen, P G

    2016-01-01

    This chapter describes the adaptive features found in voltage-gated sodium channels (NaVs) of prokaryotes and eukaryotes. These two families are distinct, having diverged early in evolutionary history but maintain a surprising degree of convergence in function. While prokaryotic NaVs are required for growth and motility, eukaryotic NaVs selectively conduct fast electrical currents for short- and long-range signaling across cell membranes in mammalian organs. Current interest in prokaryotic NaVs is stoked by their resolved high-resolution structures and functional features which are reminiscent of eukaryotic NaVs. In this chapter, comparisons between eukaryotic and prokaryotic NaVs are made to highlight the shared and unique aspects of ion selectivity, voltage sensitivity, and pharmacology. Examples of prokaryotic and eukaryotic NaV convergent evolution will be discussed within the context of their structural features. PMID:27586280

  11. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  12. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  13. International code of nomenclature of prokaryotes

    SciTech Connect

    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.

    2015-11-20

    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate application of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.

  14. International code of nomenclature of prokaryotes

    DOE PAGESBeta

    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.

    2015-11-20

    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate applicationmore » of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.« less

  15. Evolution of thiol protective systems in prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, R. C.; Newton, G. L.

    1986-01-01

    Biological thiols are essential elements in most aspects of cell function but undergo rapid oxidation to disulfides in the presence of oxygen. The evolution of systems to protect against such oxygen toxicity was essential to the emergence of aerobic life. The protection system used by eukaryotes is based upon glutathione (GSH) and GSH-dependent enzymes but many bacteria lack GSH and apparently use other mechanisms. The objective of this research is to elaborate the thiol protective mechanisms employed by prokaryotes of widely divergent evolutionary origin and to understand why GSH became the central thiol employed in essentially all higher organisms. Thiol-selective fluorescent labeling and HPLC analysis has been used to determine key monothiol components.

  16. Magnetite as a prokaryotic biomarker: A review

    NASA Astrophysics Data System (ADS)

    Jimenez-Lopez, Concepcion; Romanek, Christopher S.; Bazylinski, Dennis A.

    2010-06-01

    Over the years, nanometer-sized magnetite (Fe3O4) crystals have been recovered from many modern and ancient environments including sediments and soils and even meteorites. In some cases these crystals have been used as "magnetofossils" for evidence of the past presence of specific microbes. Magnetite nanocrystals can be formed by a number of different biological and inorganic mechanisms resulting in crystals with different physical and magnetic characteristics. Prokaryotes (bacteria) biomineralize magnetite through two methods that differ mechanistically, including: biologically induced mineralization (BIM) and biologically controlled mineralization (BCM). Magnetite nanocrystals produced by BIM are known to be synthesized by the dissimilatory iron-reducing bacteria, are deposited external to the cell, and generally are physically indistinguishable from magnetite particles formed inorganically. BCM magnetites, in contrast, are synthesized by the magnetotactic bacteria and some higher organisms and are precipitated intracellularly as membrane-bounded structures called magnetosomes. These magnetites appear to have unique crystal morphologies and a narrow size range leading to their original use as magnetofossils. Because of the discovery of nanometer-sized crystals of magnetite in the Martian meteorite ALH84001, the use of these criteria for the determination of whether magnetite crystals could constitute a prokaryotic biomarker was questioned. Thus, there is currently great debate over what criteria to use in the determination of whether specific magnetite crystals are biogenic or not. In the last decade, additional criteria have been established (e.g., the Magnetite Assay for Biogenicity), and new tools and technologies have been developed to determine the origin of specific types of magnetite crystals.

  17. Translational Selection Is Ubiquitous in Prokaryotes

    PubMed Central

    Supek, Fran; Škunca, Nives; Repar, Jelena; Vlahoviček, Kristian; Šmuc, Tomislav

    2010-01-01

    Codon usage bias in prokaryotic genomes is largely a consequence of background substitution patterns in DNA, but highly expressed genes may show a preference towards codons that enable more efficient and/or accurate translation. We introduce a novel approach based on supervised machine learning that detects effects of translational selection on genes, while controlling for local variation in nucleotide substitution patterns represented as sequence composition of intergenic DNA. A cornerstone of our method is a Random Forest classifier that outperformed previous distance measure-based approaches, such as the codon adaptation index, in the task of discerning the (highly expressed) ribosomal protein genes by their codon frequencies. Unlike previous reports, we show evidence that translational selection in prokaryotes is practically universal: in 460 of 461 examined microbial genomes, we find that a subset of genes shows a higher codon usage similarity to the ribosomal proteins than would be expected from the local sequence composition. These genes constitute a substantial part of the genome—between 5% and 33%, depending on genome size—while also exhibiting higher experimentally measured mRNA abundances and tending toward codons that match tRNA anticodons by canonical base pairing. Certain gene functional categories are generally enriched with, or depleted of codon-optimized genes, the trends of enrichment/depletion being conserved between Archaea and Bacteria. Prominent exceptions from these trends might indicate genes with alternative physiological roles; we speculate on specific examples related to detoxication of oxygen radicals and ammonia and to possible misannotations of asparaginyl–tRNA synthetases. Since the presence of codon optimizations on genes is a valid proxy for expression levels in fully sequenced genomes, we provide an example of an “adaptome” by highlighting gene functions with expression levels elevated specifically in thermophilic

  18. Detecting uber-operons in prokaryotic genomes

    PubMed Central

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: , the first of its kind. PMID:16682449

  19. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  20. Aggregates of Small Nuclear Ribonucleic Acids (snRNAs) in Alzheimer’s Disease’

    PubMed Central

    Hales, Chadwick M.; Dammer, Eric B.; Diner, Ian; Yi, Hong; Seyfried, Nicholas T.; Gearing, Marla; Glass, Jonathan D.; Montine, Thomas J.; Levey, Allan I.; Lah, James J.

    2014-01-01

    We recently discovered that protein components of the ribonucleic acid (RNA) spliceosome form cytoplasmic aggregates in Alzheimer’s disease (AD) brain, resulting in widespread changes in RNA splicing. However, the involvement of small nuclear RNAs (snRNAs), also key components of the spliceosome complex, in the pathology of AD remains unknown. Using immunohistochemical staining of post-mortem human brain and spinal cord, we identified cytoplasmic tangle-shaped aggregates of snRNA in both sporadic and familial AD cases but not in aged controls or other neurodegenerative disorders. Immunofluorescence using antibodies reactive with the 2,2,7-trimethylguanosine cap of snRNAs and transmission electron microscopy demonstrated snRNA localization with tau and paired helical filaments, the main component of neurofibrillary tangles. Quantitative real-time polymerase chain reaction (PCR) showed U1 snRNA accumulation in the insoluble fraction of AD brains whereas other U snRNAs were not enriched. In combination with our previous results, these findings demonstrate that aggregates of U1 snRNA and U1 small nuclear ribonucleoproteins represent a new pathological hallmark of AD. PMID:24571648

  1. Kinetic models of ribonucleic acid fermentation and continuous culture by Candida tropicalis no.121.

    PubMed

    Li, Bingbing; Chen, Xiaochun; Ren, Huajing; Li, Lei; Xiong, Jian; Bai, Jianxin; Chen, Yong; Wu, Jinglan; Ying, Hanjie

    2012-03-01

    During ribonucleic acid fermentation, the fermentative processes were researched at pH controlled at 4.0 and under natural conditions. Unstructured models in a 50-L airlift fermentor were established for batch RNA production at pH 4.0 using the Verhulst equation for microbial growth, the Luedeking-Piret equation for product formation and a Luedeking-Piret-like equation for substrate uptake. Parameters of the kinetic models were determined using origin 7.5. Based on the models estimated above, another batch fermentation experiment was conducted in a 300-L airlift fermentor, which demonstrated that the models could be useful for RNA production on an industrial scale. Additionally, continuous fermentation based on kinetic models was proposed to make full use of substrates and reduce the cost of waste water treatment. As a result, although the DCW and RNA concentration were 11.5 and 1.68 g L(-1), which were lower than that of batch fermentation, the sugar utilization increased by 14.3%, while the waste water decreased by more than 90%. PMID:21853330

  2. Ribosomal ribonucleic acid isolated from Salmonella typhimurium: absence of the intact 23S species.

    PubMed Central

    Winkler, M E

    1979-01-01

    Ribonucleic acid (RNA) isolated by four distinct methods and from a variety of Salmonella typhimurium strains lacked intact 23S ribosomal RNA (rRNA). On sucrose gradients which minimize aggregation, the vast majority of S. typhimurium rRNA sedimented as a 16S peak with a 14S shoulder. RNA from this region of the gradient was resolved into three discrete bands by electrophoresis in formamide. Two very minor S. typhimurium RNA peaks were resolved at 21S and 10S on sucrose gradients, and each peak formed discrete bands in electrophoresis. It is concluded that if S. typhimurium does possess an intact 23S rRNA species, this species is extremely "labile." The absence of isolatable S. typhimurium 23S rRNA possibly reflected in vivo processing of the rRNA before isolation. Under certain conditions, S. typhimurium rRNA formed discrete aggregates which sedimented similarly to intact Escherichia coli 23S rRNA. Images PMID:383696

  3. Evaluating the reproducibility of quantifying modified nucleosides from ribonucleic acids by LC-UV-MS.

    PubMed

    Russell, Susan P; Limbach, Patrick A

    2013-04-01

    Post-transcriptional chemical covalent modification of adenosine, guanosine, uridine and cytidine occurs frequently in all types of ribonucleic acids (RNAs). In ribosomal RNA (rRNA) and transfer RNA (tRNA) these modifications make important contributions to RNA structure and stability and to the accuracy and efficiency of protein translation. The functional dynamics, synergistic nature and regulatory roles of these posttranscriptional nucleoside modifications within the cell are not well characterized. These modifications are present at very low levels and isolation of individual nucleosides for analysis requires a complex multi-step approach. The focus of this study is to characterize the reproducibility of a liquid chromatography method used to isolate and quantitatively characterize modified nucleosides in tRNA and rRNA when nucleoside detection is performed using ultraviolet and mass spectrometric detection (UV and MS, respectively). Despite the analytical challenges of sample isolation and dynamic range, quantitative profiling of modified nucleosides obtained from bacterial tRNAs and rRNAs is feasible at relative standard deviations of 5% RSD or less. PMID:23500350

  4. Mutants of Salmonella typhimurium with an Altered Leucyl-Transfer Ribonucleic Acid Synthetase

    PubMed Central

    Alexander, Renee R.; Calvo, J. M.; Freundlich, M.

    1971-01-01

    Two trifluoroleucine-resistant mutants of Salmonella typhimurium, strains CV69 and CV117, had an altered leucyl-transfer ribonucleic acid (tRNA) synthetase. The mutant enzymes had higher apparent Km values for leucine (ca. 10-fold) and lower specific activities (ca. twofold) than the parent enzyme when tested in crude extracts. Preparations of synthetase purified ca. 60-fold from the parent and strain CV117 differed sixfold in their leucine Km values. In addition, the mutant enzyme was inactivated faster than the parent enzyme at 50 C. The growth rates of strains CV69 and CV117 at 37 C were not significantly different from that of the parent, whereas at 42 C strain CV69 grew more slowly than the parent. Leucine-, valine-, and isoleucine-forming enzymes were partially derepressed when the mutants were grown in minimal medium; the addition of leucine repressed these enzymes to wild-type levels. During growth in minimal medium, the proportion of leucine tRNA that was charged in the mutants was about 75% of that in the parent. The properties of strain CV117 were shown to result from a single mutation located near gal at minute 18 on the genetic map. These studies suggest that leucyl-tRNA synthetase is involved in repression of the enzymes required for the synthesis of branched-chain amino acids. PMID:4928008

  5. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  6. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  7. Regulation of prokaryotic gene expression by eukaryotic-like enzymes

    PubMed Central

    Burnside, Kellie; Rajagopal, Lakshmi

    2011-01-01

    Summary A growing body of evidence indicates that serine/threonine kinases (STK) and phosphatases (STP) regulate gene expression in prokaryotic organisms. As prokaryotic STKs and STPs are not DNA binding proteins, regulation of gene expression is accomplished through post-translational modification of their targets. These include two-component response regulators, DNA binding proteins and proteins that mediate transcription and translation. This review summarizes our current understanding of how STKs and STPs mediate gene expression in prokaryotes. Further studies to identify environmental signals that trigger the signaling cascade and elucidation of mechanisms that regulate cross-talk between eukaryotic-like signaling enzymes, two-component systems, and components of the transcriptional and translational machinery will facilitate a greater understanding of prokaryotic gene regulation. PMID:22221896

  8. Horizontal Transfer and Evolution of Prokaryote Transposable Elements in Eukaryotes

    PubMed Central

    Gilbert, Clément; Cordaux, Richard

    2013-01-01

    Horizontal transfer (HT) of transposable elements (TEs) plays a key role in prokaryotic evolution, and mounting evidence suggests that it has also had an important impact on eukaryotic evolution. Although many prokaryote-to-prokaryote and eukaryote-to-eukaryote HTs of TEs have been characterized, only few cases have been reported between prokaryotes and eukaryotes. Here, we carried out a comprehensive search for all major groups of prokaryotic insertion sequences (ISs) in 430 eukaryote genomes. We uncovered a total of 80 sequences, all deriving from the IS607 family, integrated in the genomes of 14 eukaryote species belonging to four distinct phyla (Amoebozoa, Ascomycetes, Basidiomycetes, and Stramenopiles). Given that eukaryote IS607-like sequences are most closely related to cyanobacterial IS607 and that their phylogeny is incongruent with that of their hosts, we conclude that the presence of IS607-like sequences in eukaryotic genomes is the result of several HT events. Selection analyses further suggest that our ability to detect these prokaryote TEs today in eukaryotes is because HT of these sequences occurred recently and/or some IS607 elements were domesticated after HT, giving rise to new eukaryote genes. Supporting the recent age of some of these HTs, we uncovered intact full-length, potentially active IS607 copies in the amoeba Acanthamoeba castellani. Overall, our study shows that prokaryote-to-eukaryote HT of TEs occurred at relatively low frequency during recent eukaryote evolution and it sets IS607 as the most widespread TE (being present in prokaryotes, eukaryotes, and viruses). PMID:23563966

  9. Identification of replication origins in prokaryotic genomes.

    PubMed

    Sernova, Natalia V; Gelfand, Mikhail S

    2008-09-01

    The availability of hundreds of complete bacterial genomes has created new challenges and simultaneously opportunities for bioinformatics. In the area of statistical analysis of genomic sequences, the studies of nucleotide compositional bias and gene bias between strands and replichores paved way to the development of tools for prediction of bacterial replication origins. Only a few (about 20) origin regions for eubacteria and archaea have been proven experimentally. One reason for that may be that this is now considered as an essentially bioinformatics problem, where predictions are sufficiently reliable not to run labor-intensive experiments, unless specifically needed. Here we describe the main existing approaches to the identification of replication origin (oriC) and termination (terC) loci in prokaryotic chromosomes and characterize a number of computational tools based on various skew types and other types of evidence. We also classify the eubacterial and archaeal chromosomes by predictability of their replication origins using skew plots. Finally, we discuss possible combined approaches to the identification of the oriC sites that may be used to improve the prediction tools, in particular, the analysis of DnaA binding sites using the comparative genomic methods. PMID:18660512

  10. Eukaryotic and Prokaryotic Cytoskeletons: Structure and Mechanics

    NASA Astrophysics Data System (ADS)

    Gopinathan, Ajay

    2013-03-01

    The eukaryotic cytoskeleton is an assembly of filamentous proteins and a host of associated proteins that collectively serve functional needs ranging from spatial organization and transport to the production and transmission of forces. These systems can exhibit a wide variety of non-equilibrium, self-assembled phases depending on context and function. While much recent progress has been made in understanding the self-organization, rheology and nonlinear mechanical properties of such active systems, in this talk, we will concentrate on some emerging aspects of cytoskeletal physics that are promising. One such aspect is the influence of cytoskeletal network topology and its dynamics on both active and passive intracellular transport. Another aspect we will highlight is the interplay between chirality of filaments, their elasticity and their interactions with the membrane that can lead to novel conformational states with functional implications. Finally we will consider homologs of cytoskeletal proteins in bacteria, which are involved in templating cell growth, segregating genetic material and force production, which we will discuss with particular reference to contractile forces during cell division. These prokaryotic structures function in remarkably similar yet fascinatingly different ways from their eukaryotic counterparts and can enrich our understanding of cytoskeletal functioning as a whole.

  11. How prokaryotes deal with arsenic(†).

    PubMed

    Slyemi, Djamila; Bonnefoy, Violaine

    2012-12-01

    Arsenic is a notorious poison classified as a carcinogen, a teratogen and a clastogen that ranks number one on the Environmental Protection Agency's priority list of drinking water contaminants. It is ubiquitous and relatively abundant in the Earth's crust. Its mobilization in waters by weathering, volcanic, anthropogenic or biological activities represents a major hazard to public health, exemplified in India and Bangladesh where 50 million people are acutely at risk. Since basically the origin of life, microorganisms have been exposed to this toxic compound and have evolved a variety of resistance mechanisms, such as extracellular precipitation, chelation, intracellular sequestration, active extrusion from the cell or biochemical transformation (redox or methylation). Arsenic efflux systems are widespread and are found in nearly all organisms. Some microorganisms are also able to utilize this metalloid as a metabolic energy source through either arsenite oxidation or arsenate reduction. The energy metabolism involving redox reactions of arsenic has been suggested to have evolved during early life on Earth. This review highlights the different systems evolved by prokaryotes to cope with arsenic and how they participate in its biogeochemical cycle. PMID:23760928

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  13. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  14. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    PubMed

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  15. Mining featured micro ribonucleic acids associated with lung cancer based on bioinformatics

    PubMed Central

    Su, Lin; Li, Na; Huo, Xueyun

    2015-01-01

    Background Few genetic markers useful for the screening of lung cancer risk exist. Although related research has shown that certain expression profiles of micro ribonucleic acids (miRNAs) are different in lung cancer versus the normal lung, such as miR-29a and miR-29s, the precise molecular mechanism of lung cancer remains obscure. In order to get a better understanding of the pathogenetic mechanism of lung cancer, we analyzed the differentially expressed genes (DEGs) and identified featured miRNAs in lung cancer tissues. Methods We used the gene expression profile GSE10072, including 49 gene chips of non-tumor tissues and 58 gene chips of lung tumor specimens. The DEGs between these two groups were identified by Limma package in R language. The TarBase database was used to construct the networks of miRNA regulating DEGs related to lung cancer. After ordering miRNAs regulating DEGs, we further screened featured miRNAs combined with the miR2Disease database. Results A total of 5572 DEGs were obtained between lung cancer and control specimens. After constructing a miRNA regulatory network, a total of 398 regulations between 57 miRNAs and 321 target genes existed. By intergrating the miR2Disease database and using a sorting algorithm, a total of six featured miRNAs related to lung cancer were identified, including miR-520h, miR-133a, miR-34, miR-103, miR-370, and miR-148. They might be involved in lung cancer progression by regulating ABCG2, PKM2, VAMP2, GPD1, MAP3K8, and DNMT3B, respectively. Conclusion The top 10 significant miRNAs, such as miR-520h, miR-133a, miR-34, and miR-103 may be potential therapeutic targets for lung cancer. PMID:26273407

  16. The bacterial magnetosome: a unique prokaryotic organelle.

    PubMed

    Lower, Brian H; Bazylinski, Dennis A

    2013-01-01

    The bacterial magnetosome is a unique prokaryotic organelle comprising magnetic mineral crystals surrounded by a phospholipid bilayer. These inclusions are biomineralized by the magnetotactic bacteria which are ubiquitous, aquatic, motile microorganisms. Magnetosomes cause cells of magnetotactic bacteria to passively align and swim along the Earth's magnetic field lines, as miniature motile compass needles. These specialized compartments consist of a phospholipid bilayer membrane surrounding magnetic crystals of magnetite (Fe3O4) or greigite (Fe3S4). The morphology of these membrane-bound crystals varies by species with a nominal magnetic domain size between 35 and 120 nm. Almost all magnetotactic bacteria arrange their magnetosomes in a chain within the cell there by maximizing the magnetic dipole moment of the cell. It is presumed that magnetotactic bacteria use magnetotaxis in conjunction with chemotaxis to locate and maintain an optimum position for growth and survival based on chemistry, redox and physiology in aquatic habitats with vertical chemical concentration and redox gradients. The biosynthesis of magnetosomes is a complex process that involves several distinct steps including cytoplasmic membrane modifications, iron uptake and transport, initiation of crystallization, crystal maturation and magnetosome chain formation. While many mechanistic details remain unresolved, magnetotactic bacteria appear to contain the genetic determinants for magnetosome biomineralization within their genomes in clusters of genes that make up what is referred to as the magnetosome gene island in some species. In addition, magnetosomes contain a unique set of proteins, not present in other cellular fractions, which control the biomineralization process. Through the development of genetic systems, proteomic and genomic work, and the use of molecular and biochemical tools, the functions of a number of magnetosome membrane proteins have been demonstrated and the molecular

  17. Connected gene neighborhoods in prokaryotic genomes

    PubMed Central

    Rogozin, Igor B.; Makarova, Kira S.; Murvai, Janos; Czabarka, Eva; Wolf, Yuri I.; Tatusov, Roman L.; Szekely, Laszlo A.; Koonin, Eugene V.

    2002-01-01

    A computational method was developed for delineating connected gene neighborhoods in bacterial and archaeal genomes. These gene neighborhoods are not typically present, in their entirety, in any single genome, but are held together by overlapping, partially conserved gene arrays. The procedure was applied to comparing the orders of orthologous genes, which were extracted from the database of Clusters of Orthologous Groups of proteins (COGs), in 31 prokaryotic genomes and resulted in the identification of 188 clusters of gene arrays, which included 1001 of 2890 COGs. These clusters were projected onto actual genomes to produce extended neighborhoods including additional genes, which are adjacent to the genes from the clusters and are transcribed in the same direction, which resulted in a total of 2387 COGs being included in the neighborhoods. Most of the neighborhoods consist predominantly of genes united by a coherent functional theme, but also include a minority of genes without an obvious functional connection to the main theme. We hypothesize that although some of the latter genes might have unsuspected roles, others are maintained within gene arrays because of the advantage of expression at a level that is typical of the given neighborhood. We designate this phenomenon ‘genomic hitchhiking’. The largest neighborhood includes 79 genes (COGs) and consists of overlapping, rearranged ribosomal protein superoperons; apparent genome hitchhiking is particularly typical of this neighborhood and other neighborhoods that consist of genes coding for translation machinery components. Several neighborhoods involve previously undetected connections between genes, allowing new functional predictions. Gene neighborhoods appear to evolve via complex rearrangement, with different combinations of genes from a neighborhood fixed in different lineages. PMID:12000841

  18. Enzymatic Characterization of a Prokaryotic Urea Carboxylase

    PubMed Central

    Kanamori, Takeshi; Kanou, Norihisa; Atomi, Haruyuki; Imanaka, Tadayuki

    2004-01-01

    We identified the first prokaryotic urea carboxylase (UCA) from a member of the alpha subclass of the class Proteobacteria, Oleomonas sagaranensis. This enzyme (O. sagaranensis Uca) was composed of 1,171 amino acids, and its N-terminal region resembled the biotin carboxylase domains of various biotin-dependent carboxylases. The C-terminal region of the enzyme harbored the Met-Lys-Met motif found in biotin carboxyl carrier proteins. The primary structure of the enzyme was 45% identical to that of the urea carboxylase domain of urea amidolyase from Saccharomyces cerevisiae. O. sagaranensis Uca did not harbor the allophanate hydrolase domain found in the yeast enzyme, but a separate gene with structural similarity was found to be adjacent to the uca gene. Purified recombinant O. sagaranensis Uca displayed ATP-dependent carboxylase activity towards urea (Vmax = 21.2 μmol mg−1 min−1) but not towards acetyl coenzyme A (acetyl-CoA) and propionyl-CoA, indicating that the gene encoded a bona fide UCA and not an acetyl-CoA or propionyl-CoA carboxylase. The enzyme also exhibited high levels of activity towards acetamide and formamide. Kinetic parameters of the enzyme reaction were determined with ATP, urea, acetamide, and formamide. O. sagaranensis could grow on urea, acetamide, and formamide as sole nitrogen sources; moreover, ATP-dependent urea-degrading activity was found in cells grown with urea but not in cells grown with ammonia. The results suggest that the UCA of this organism may be involved in the assimilation of these compounds as nitrogen sources. Furthermore, orthologues of the O. sagaranensis uca gene were found to be widely distributed among Bacteria. This implies that there are two systems of urea degradation in Bacteria, a pathway catalyzed by the previously described ureases and the UCA-allophanate hydrolase pathway identified in this study. PMID:15090492

  19. Evolutionary constraints of phosphorylation in eukaryotes, prokaryotes, and mitochondria.

    PubMed

    Gnad, Florian; Forner, Francesca; Zielinska, Dorota F; Birney, Ewan; Gunawardena, Jeremy; Mann, Matthias

    2010-12-01

    High accuracy mass spectrometry has proven to be a powerful technology for the large scale identification of serine/threonine/tyrosine phosphorylation in the living cell. However, despite many described phosphoproteomes, there has been no comparative study of the extent of phosphorylation and its evolutionary conservation in all domains of life. Here we analyze the results of phosphoproteomics studies performed with the same technology in a diverse set of organisms. For the most ancient organisms, the prokaryotes, only a few hundred proteins have been found to be phosphorylated. Applying the same technology to eukaryotic species resulted in the detection of thousands of phosphorylation events. Evolutionary analysis shows that prokaryotic phosphoproteins are preferentially conserved in all living organisms, whereas-site specific phosphorylation is not. Eukaryotic phosphosites are generally more conserved than their non-phosphorylated counterparts (with similar structural constraints) throughout the eukaryotic domain. Yeast and Caenorhabditis elegans are two exceptions, indicating that the majority of phosphorylation events evolved after the divergence of higher eukaryotes from yeast and reflecting the unusually large number of nematode-specific kinases. Mitochondria present an interesting intermediate link between the prokaryotic and eukaryotic domains. Applying the same technology to this organelle yielded 174 phosphorylation sites mapped to 74 proteins. Thus, the mitochondrial phosphoproteome is similarly sparse as the prokaryotic phosphoproteomes. As expected from the endosymbiotic theory, phosphorylated as well as non-phosphorylated mitochondrial proteins are significantly conserved in prokaryotes. However, mitochondrial phosphorylation sites are not conserved throughout prokaryotes, consistent with the notion that serine/threonine phosphorylation in prokaryotes occurred relatively recently in evolution. Thus, the phosphoproteome reflects major events in the

  20. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  1. A Rapid Technique for the Estimation of Polynucleotide Adenylyltransferase and Ribonucleic Acid Polymerase in Plant Tissues 1

    PubMed Central

    Walter, Trevor J.; Mans, Rusty J.

    1975-01-01

    Nucleic acid-dependent polynucleotide adenylytransferase (EC 2.7.7.19) and ribonucleic acid polymerase (EC 2.7.7.6) have been partially purified from maize tissues (Zea mays L.) utilizing ammonium sulfate precipitation and batch diethylaminoethylcellulose chromatography. The technique is applicable to the simultaneous processing of up to eight samples of plant tissue and affords a rapid and reproducible means of assaying these two enzymes from small quantities of kernels or seedlings. The kinetic characteristics of the partially purified enzymes resemble those from more extensively purified preparations. PMID:16659402

  2. Why keep the pressure to estimate prokaryotic activities? (Invited)

    NASA Astrophysics Data System (ADS)

    Tamburini, C.

    2013-12-01

    Recent discoveries challenge the paradigm that cycling of organic matter is slow in the deep sea and mediated by microbial food webs of static structure and function. Data showing spatial variation in prokaryotic abundance and activity support the hypothesis that deep-sea microorganisms respond dynamically to variations in organic matter input to the bathypelagic realm. Moreover, almost half of the total water column heterotrophic prokaryotic production takes place below the epipelagic layer. Compiled global budgets suggest that the estimate of metabolic activity in the dark pelagic ocean exceeds the input of organic carbon. However, these conclusions are based mainly on measurements done at atmospheric pressure without taking into account pressure effects on natural prokaryotic assemblages. In this presentation, I will clarify the effect of hydrostatic pressure on prokaryotes living in the dark ocean and inform experimental design and the achievement of more accurate estimates of microbial activity in the deep ocean. Finally, their potential capabilities to degrade complex compounds as well as the chemolithoautrophy in the deep ocean represent examples of ways to explore deeper the role of deep-sea prokaryotes in the global cycles.

  3. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  4. Inhibition of Peptidoglycan, Ribonucleic Acid, and Protein Synthesis in Tolerant Strains of Streptococcus mutans

    PubMed Central

    Mychajlonka, Myron; McDowell, Thomas D.; Shockman, Gerald D.

    1980-01-01

    Exposure of exponentially growing cultures of Streptococcus mutans strains FA-1 and GS-5 to various concentrations of benzylpenicillin (Pen G) resulted in inhibition of turbidity increases at low concentrations (0.02 to 0.04 μg/ml). However, in contrast to some other streptococcal species, growth inhibition was not accompanied by cellular lysis or by a rapid loss of viability. In both strains, synthesis of insoluble cell wall peptidoglycan was very sensitive to Pen G inhibition and responded in a dose-dependent manner to concentrations of about 0.2 and 0.5 μg/ml for strains GS-5 and FA-1, respectively. Higher Pen G concentrations failed to inhibit further either growth or insoluble peptidoglycan assembly. Somewhat surprisingly, Pen G also inhibited both ribonucleic acid (RNA) and protein syntheses, each in a dose-dependent manner. Compared with inhibition of peptidoglycan synthesis, inhibition of RNA and protein syntheses by Pen G was less rapid and less extensive. Maximum amounts of radiolabeled Pen G were specifically bound to intact cells upon exposure to about 0.2 and 0.5 μg/ml of Pen G for strains GS-5 and FA-1, respectively, concentrations consistent with those that resulted in maximum or near-maximum inhibitions of the synthesis of cellular peptidoglycan, RNA, and protein. Five polypeptide bands that had a very high affinity for [14C]Pen G were detected in a crude cell envelope preparation of strain FA-1. After exposure of cultures of strain FA-1 to the effects of saturating concentrations of the drug for up to 3 h, addition of penicillinase was followed by recovery of growth after a lag. The length of the lag before regrowth depended on both Pen G concentration and time of exposure. On the basis of these and other observations, it is proposed that the secondary inhibitions of cellular RNA or protein synthesis, or both, are involved in the tolerance of these organisms to lysis and killing by Pen G and other inhibitors of insoluble peptidoglycan assembly

  5. Boletus edulis ribonucleic acid - a potent apoptosis inducer in human colon adenocarcinoma cells.

    PubMed

    Lemieszek, Marta Kinga; Ribeiro, Miguel; Guichard Alves, Helena; Marques, Guilhermina; Nunes, Fernando Milheiro; Rzeski, Wojciech

    2016-07-13

    Despite the large popularity of the Boletus edulis mushroom, little is known about its influence on human health and the possibilities of its therapeutic use. Nevertheless, several reports revealed the usefulness of biopolymers isolated from it in cancer treatment. Our previous studies have shown that B. edulis water soluble biopolymers are not toxic against normal colon epithelial cells (CCD841 CoTr) and at the same concentration range elicited a very prominent antiproliferative effect in colon cancer cells (LS180) which was accompanied with cell cycle arrest in the G0/G1 phase. The purpose of the present study was to verify the proapoptotic properties of a selected fraction from B. edulis - BE3, as well as determine its chemical nature. The BE3 fraction was extracted with hot water and purified by anion-exchange chromatography. Further chemical examinations revealed that BE3 consists mainly of ribonucleic acid (59.1%). The ability of BE3 to induce programmed cell death was examined in human colon cancer cell lines LS180 and HT-29 by measuring caspase activation, DNA fragmentation and expression of BAX, BCL2, TP53 and CDKN1A genes. The sensitivity of colon cancer cells with silenced BAX, TP53 and CDKN1A expression to BE3 treatment was also evaluated. We have demonstrated for the first time that the BE3 fraction is a potent apoptosis inducer in human colon cancer cells. The revealed mechanism of apoptosis triggering was dependent on the presence of functional p53 and consequently was a little different in investigated cell lines. Our results indicated that BE3 stimulated proapoptotic genes BAX (LS180, HT-29), TP53 (LS180) and CDKN1A (HT-29) while at the same time silenced the expression of the key prosurvival gene BCL2 (LS180, HT-29). The obtained results indicate the high therapeutic potential of the BE3 fraction against colon cancer, yet it is necessary to further confirm fraction efficacy and safety in animal and clinical studies. PMID:27302173

  6. Roary: rapid large-scale prokaryote pan genome analysis

    PubMed Central

    Page, Andrew J.; Cummins, Carla A.; Hunt, Martin; Wong, Vanessa K.; Reuter, Sandra; Holden, Matthew T.G.; Fookes, Maria; Falush, Daniel; Keane, Jacqueline A.; Parkhill, Julian

    2015-01-01

    Summary: A typical prokaryote population sequencing study can now consist of hundreds or thousands of isolates. Interrogating these datasets can provide detailed insights into the genetic structure of prokaryotic genomes. We introduce Roary, a tool that rapidly builds large-scale pan genomes, identifying the core and accessory genes. Roary makes construction of the pan genome of thousands of prokaryote samples possible on a standard desktop without compromising on the accuracy of results. Using a single CPU Roary can produce a pan genome consisting of 1000 isolates in 4.5 hours using 13 GB of RAM, with further speedups possible using multiple processors. Availability and implementation: Roary is implemented in Perl and is freely available under an open source GPLv3 license from http://sanger-pathogens.github.io/Roary Contact: roary@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26198102

  7. Coevolution of the Organization and Structure of Prokaryotic Genomes.

    PubMed

    Touchon, Marie; Rocha, Eduardo P C

    2016-01-01

    The cytoplasm of prokaryotes contains many molecular machines interacting directly with the chromosome. These vital interactions depend on the chromosome structure, as a molecule, and on the genome organization, as a unit of genetic information. Strong selection for the organization of the genetic elements implicated in these interactions drives replicon ploidy, gene distribution, operon conservation, and the formation of replication-associated traits. The genomes of prokaryotes are also very plastic with high rates of horizontal gene transfer and gene loss. The evolutionary conflicts between plasticity and organization lead to the formation of regions with high genetic diversity whose impact on chromosome structure is poorly understood. Prokaryotic genomes are remarkable documents of natural history because they carry the imprint of all of these selective and mutational forces. Their study allows a better understanding of molecular mechanisms, their impact on microbial evolution, and how they can be tinkered in synthetic biology. PMID:26729648

  8. Hydroxyquinolines inhibit ribonucleic acid-dependent deoxyribonucleic acid polymerase and inactivate Rous sarcoma virus and herpes simplex virus.

    PubMed

    Rohde, W; Mikelens, P; Jackson, J; Blackman, J; Whitcher, J; Levinson, W

    1976-08-01

    8-Hydroxyquinoline and several of its derivatives inactivate the transforming ability of Rous sarcoma virus and inhibit its ribonucleic acid-dependent deoxyribonucleic acid polymerase activity. The copper complex of these metal-binding ligands is as active as the free ligand. The activity of the 8-hydroxyquinolines is approximately 50-fold more effective than another group of metal-binding compounds that we have tested, the thiosemicarbazones. In contrast to the potency of the 8-hydroxyquinolines to inactivate Rous sarcoma virus, no intracellular inhibition of transformation could be demonstrated at a concentration that did not affect the growth and appearance of the cells. Cellular deoxyribonucleic acid synthesis was inhibited to a greater extent than was ribonucleic acid or protein synthesis. The phenomenon of "concentration quenching" was observed with high concentrations of drug, causing less inhibition of deoxyribonucleic acid synthesis than was observed with lower concentrations. Herpes simplex virus type 1 was inactivated also by the 8-hydroxyquinolines and their copper complexes. No intracellular inhibition of plaque formation was observed. Treatment with 8-hydroxyquinoline sulfate had no effect on the resolution of herpetic keratitis in rabbits. Some 8-hydroxyquinolines bind to deoxyribonucleic acid in the presence of copper, a phenomenon that may be important in their antiviral activity. PMID:185949

  9. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A

    1981-01-01

    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  10. Advanced nuclear magnetic resonance lanthanide probe analyses of short-range conformational interrelations controlling ribonucleic acid structures.

    PubMed

    Yokoyama, S; Inagaki, F; Miyazawa, T

    1981-05-12

    An advanced method was developed for lanthanide-probe analyses of the conformations of flexible biomolecules such as nucleotides. The new method is to determine structure parameters (such as internal-rotation angles) and population parameters for local conformational equilibria of flexible sites, together with standard deviations of these parameters. As the prominent advantage of this method, the interrelations among local conformations of flexible sites may be quantitatively elucidated from the experimental data of lanthanide-induced shifts and relaxations and vicinal coupling constants. As a structural unit of ribonucleic acids, the molecular conformations and conformational equilibria of uridine 3'-monophosphate in aqueous solution were analyzed. The stable local conformers about the C3'-O3' bond are the G+ (phi' = 281 +/- 11 degrees) and G- (phi' = 211 +/- 8 degrees) forms. The internal rotation about the C3'-O3' bond and the ribose-ring puckering are interrelated; 97 +/- 5% of the C3'-endo ribose ring is associated with the G- form while 70 +/- 22% o the C2'-endo ribose ring is associated with the G+ form. An interdependency also exists between the internal rotation about the C4'-C5' bond and the ribose-ring puckering. These short-range conformational interrelations are probably important in controlling the dynamic aspects of ribonucleic acid structures. PMID:6166319

  11. Energetics and genetics across the prokaryote-eukaryote divide

    PubMed Central

    2011-01-01

    Background All complex life on Earth is eukaryotic. All eukaryotic cells share a common ancestor that arose just once in four billion years of evolution. Prokaryotes show no tendency to evolve greater morphological complexity, despite their metabolic virtuosity. Here I argue that the eukaryotic cell originated in a unique prokaryotic endosymbiosis, a singular event that transformed the selection pressures acting on both host and endosymbiont. Results The reductive evolution and specialisation of endosymbionts to mitochondria resulted in an extreme genomic asymmetry, in which the residual mitochondrial genomes enabled the expansion of bioenergetic membranes over several orders of magnitude, overcoming the energetic constraints on prokaryotic genome size, and permitting the host cell genome to expand (in principle) over 200,000-fold. This energetic transformation was permissive, not prescriptive; I suggest that the actual increase in early eukaryotic genome size was driven by a heavy early bombardment of genes and introns from the endosymbiont to the host cell, producing a high mutation rate. Unlike prokaryotes, with lower mutation rates and heavy selection pressure to lose genes, early eukaryotes without genome-size limitations could mask mutations by cell fusion and genome duplication, as in allopolyploidy, giving rise to a proto-sexual cell cycle. The side effect was that a large number of shared eukaryotic basal traits accumulated in the same population, a sexual eukaryotic common ancestor, radically different to any known prokaryote. Conclusions The combination of massive bioenergetic expansion, release from genome-size constraints, and high mutation rate favoured a protosexual cell cycle and the accumulation of eukaryotic traits. These factors explain the unique origin of eukaryotes, the absence of true evolutionary intermediates, and the evolution of sex in eukaryotes but not prokaryotes. Reviewers This article was reviewed by: Eugene Koonin, William Martin

  12. Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts

    NASA Technical Reports Server (NTRS)

    Schwartz, R. M.; Dayhoff, M. O.

    1978-01-01

    A computer branching model is used to analyze cellular evolution. Attention is given to certain key amino acids and nucleotide residues (ferredoxin, 5s ribosomal RNA, and c-type cytochromes) because of their commonality over a wide variety of cell types. Each amino acid or nucleotide residue is a sequence in an inherited biological trait; and the branching method is employed to align sequences so that changes reflect substitution of one residue for another. Based on the computer analysis, the symbiotic theory of cellular evolution is considered the most probable. This theory holds that organelles, e.g., mitochondria and chloroplasts invaded larger bodies, e.g., bacteria, and combined functions to form eucaryotic cells.

  13. Genome Networks Root the Tree of Life between Prokaryotic Domains

    PubMed Central

    Dagan, Tal; Roettger, Mayo; Bryant, David; Martin, William

    2010-01-01

    Eukaryotes arose from prokaryotes, hence the root in the tree of life resides among the prokaryotic domains. The position of the root is still debated, although pinpointing it would aid our understanding of the early evolution of life. Because prokaryote evolution was long viewed as a tree-like process of lineage bifurcations, efforts to identify the most ancient microbial lineage split have traditionally focused on positioning a root on a phylogenetic tree constructed from one or several genes. Such studies have delivered widely conflicting results on the position of the root, this being mainly due to methodological problems inherent to deep gene phylogeny and the workings of lateral gene transfer among prokaryotes over evolutionary time. Here, we report the position of the root determined with whole genome data using network-based procedures that take into account both gene presence or absence and the level of sequence similarity among all individual gene families that are shared across genomes. On the basis of 562,321 protein-coding gene families distributed across 191 genomes, we find that the deepest divide in the prokaryotic world is interdomain, that is, separating the archaebacteria from the eubacteria. This result resonates with some older views but conflicts with the results of most studies over the last decade that have addressed the issue. In particular, several studies have suggested that the molecular distinctness of archaebacteria is not evidence for their antiquity relative to eubacteria but instead stems from some kind of inherently elevated rate of archaebacterial sequence change. Here, we specifically test for such a rate elevation across all prokaryotic lineages through the analysis of all possible quartets among eight genes duplicated in all prokaryotes, hence the last common ancestor thereof. The results show that neither the archaebacteria as a group nor the eubacteria as a group harbor evidence for elevated evolutionary rates in the sampled

  14. Terminal sequence studies of high-molecular-weight ribonucleic acid. The 3′-termini of rabbit globin messenger ribonucleic acid

    PubMed Central

    Hunt, John A.

    1973-01-01

    Haemoglobin mRNA isolated from EDTA-treated polyribosomes has an apparent molecular weight of 120000–180000 estimated by condensation with 3H-labelled isoniazid after periodate oxidation. Analysis of the ribonuclease digests of isoniazid-labelled RNA by paper electrophoresis and column chromatography enables the amount of contaminating 18S, 7S, 5S and 4S RNA to be estimated, and a corrected molecular weight of globin mRNA as the acid is 161000 or 500 nucleotides in length. This molecule contains two groups of 3′-terminal sequences in equal yield; G-Y-A6 and G-Y-A7 in the ratio 3:2, and G-N9–16-Y-A2 and G-N9–16-Y-N3 in the ratio 3:2. The significance of these sequences is discussed in relation to the poly(A) content of globin mRNA, the specificity of the sequences, and possible function in processing and biosynthesis of mRNA. PMID:4737318

  15. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  16. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  17. Cytokinesis in Prokaryotes and Eukaryotes: Common Principles and Different Solutions

    PubMed Central

    Nanninga, Nanne

    2001-01-01

    Cytokinesis requires duplication of cellular structures followed by bipolarization of the predivisional cell. As a common principle, this applies to prokaryotes as well as eukaryotes. With respect to eukaryotes, the discussion has focused mainly on Saccharomyces cerevisiae and on Schizosaccharomyces pombe. Escherichia coli and to a lesser extent Bacillus subtilis have been used as prokaryotic examples. To establish a bipolar cell, duplication of a eukaryotic origin of DNA replication as well as its genome is not sufficient. Duplication of the microtubule-organizing center is required as a prelude to mitosis, and it is here that the dynamic cytoskeleton with all its associated proteins comes to the fore. In prokaryotes, a cytoskeleton that pervades the cytoplasm appears to be absent. DNA replication and the concomitant DNA segregation seem to occur without help from extensive cytosolic supramacromolecular assemblies but with help from the elongating cellular envelope. Prokaryotic cytokinesis proceeds through a contracting ring, which has a roughly 100-fold-smaller circumference than its eukaryotic counterpart. Although the ring contains proteins that can be considered as predecessors of actin, tubulin, and microtubule-associated proteins, its macromolecular composition is essentially different. PMID:11381104

  18. Gene duplications in prokaryotes can be associated with environmental adaptation

    PubMed Central

    2010-01-01

    Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism

  19. Top-Down Control of Diesel-Degrading Prokaryotic Communities.

    PubMed

    Sauret, Caroline; Böttjer, Daniela; Talarmin, Agathe; Guigue, Catherine; Conan, Pascal; Pujo-Pay, Mireille; Ghiglione, Jean-François

    2015-08-01

    Biostimulation through the addition of inorganic nutrients has been the most widely practiced bioremediation strategy in oil-polluted marine waters. However, little attention has so far been paid to the microbial food web and the impact of top-down control that directly or indirectly influences the success of the bioremediation. We designed a mesocosm experiment using pre-filtered (<50 μm) surface seawater from the Bay of Banyuls-sur-Mer (North-Western Mediterranean Sea) and examined the top-down effect exerted by heterotrophic nanoflagellates (HNF) and virus-like particles (VLP) on prokaryotic abundance, activity and diversity in the presence or absence of diesel fuel. Prokaryotes, HNF and VLP abundances showed a predator-prey succession, with a co-development of HNF and VLP. In the polluted system, we observed a stronger impact of viral lysis on prokaryotic abundances than in the control. Analysis of the diversity revealed that a bloom of Vibrio sp. occurred in the polluted mesocosm. That bloom was rapidly followed by a less abundant and more even community of predation-resistant bacteria, including known hydrocarbon degraders such as Oleispira spp. and Methylophaga spp. and opportunistic bacteria such as Percisivirga spp., Roseobacter spp. and Phaeobacter spp. The shift in prokaryotic dominance in response to viral lysis provided clear evidence of the 'killing the winner' model. Nevertheless, despite clear effects on prokaryotic abundance, activity and diversity, the diesel degradation was not impacted by top-down control. The present study investigates for the first time the functioning of a complex microbial network (including VLP) using a nutrient-based biostimulation strategy and highlights some key processes useful for tailoring bioremediation. PMID:25805213

  20. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes

    PubMed Central

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F.

    2015-01-01

    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners—the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)—and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic—and plant and algal—lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller’s ratchet—the origin of eukaryotic recombination, or sex—might have required surprisingly little evolutionary innovation. PMID:25733873

  1. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F

    2015-08-18

    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation. PMID:25733873

  2. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  3. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  4. Ribonuclease "XlaI," an activity from Xenopus laevis oocytes that excises intervening sequences from yeast transfer ribonucleic acid precursors.

    PubMed Central

    Otsuka, A; de Paolis, A; Tocchini-Valentini, G P

    1981-01-01

    A ribonuclease (RNase) activity, RNase "XlaI," responsible for the excision of intervening sequences from two yeast transfer ribonucleic acid (tRNA) precursors, pre-tRNA(Tyr) and pre-tRNA(3Leu), has been purified 54-fold from nuclear extracts of Xenopus laevis oocytes. The RNase preparation is essentially free of contaminating RNase. A quantitative assay for RNase XlaI was developed, and the reaction products were characterized. RNase XlaI cleavage sites in the yeast tRNA precursors were identical to those made by yeast extracts (including 3'-phosphate and 5'-hydroxyl termini). Cleavage of pre-tRNA(3Leu) by RNase XlaI and subsequent ligation of the half-tRNA molecules do not require removal of the 5' leader or 3' trailer sequences. Images PMID:6765601

  5. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France)

    PubMed Central

    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore

    2016-01-01

    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1–63.5 × 107 ml-1) and viral infection rates of prokaryotes (range = 5.3–32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  6. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France).

    PubMed

    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore

    2016-01-01

    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1-63.5 × 10(7) ml(-1)) and viral infection rates of prokaryotes (range = 5.3-32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  7. Geochemical Interactions and Viral-Prokaryote Relationships in Freshwater Environments

    NASA Astrophysics Data System (ADS)

    Kyle, J. E.; Ferris, G.

    2009-05-01

    Viral and prokaryotic abundances were surveyed throughout southern Ontario aquatic habitats to determine relationships with geochemical parameters in the natural environment. Surface water samples were collected from acid mine drainage in summer of 2007 and 2008 and from circum-neutral pH environments in October to November 2008. Site determination was based on collecting samples from various aquatic habitats (acid mine drainage, lakes, rivers, tributaries, wetlands) with differing bedrock geology (limestone and shale dominated vs granitic Canadian Shield) to obtain a range of geochemical conditions. At each site, measurements of temperature, pH, and Eh were conducted. Samples collected for microbial counts and electron imaging were preserved to a final concentration of 2.5 % (v/v) glutaraldehyde. Additional sample were filtered into 60 mL nalgene bottles and amber EPA certified 40 mL glass vials to determine chemical constituents and dissolved organic carbon (DOC), respectively. Water was also collected to determine additional physiochemical parameters (dissolved total iron, ferric iron, nitrate, sulfate, phosphate, alkalinity, and turbidity). All samples were stored at 4 °C until analysis. Viral and prokaryotic abundance was determined by staining samples with SYBR Green I and examining with a epifluorescence microscope under blue excitation. Multiple regression analysis using stepwise backwards regression and general linear models revealed that viral abundance was the most influential predictor of prokaryotic abundance. Additional predictors include pH, sulfate, phosphate, and magnesium. The strength of the model was very strong with 90 % of the variability explained (R2 = 0.90, p < 0.007). This is the first report, to our knowledge, of viruses exhibiting such strong controls over prokaryotic abundance in the natural environment. All relationships are positively correlated with the exception of Mg, which is negatively correlated. Iron was also noted as a

  8. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  9. Functional Advantages Conferred by Extracellular Prokaryotic Membrane Vesicles

    PubMed Central

    Manning, Andrew J.; Kuehn, Meta J.

    2015-01-01

    The absence of subcellular organelles is a characteristic typically used to distinguish prokaryotic from eukaryotic cells. But recent discoveries do not support this dogma. Over the past 50 years, researchers have begun to appreciate and characterize Gram-negative bacterial outer membrane derived vesicles and Gram-positive and archaeal membrane vesicles. These extracellular, membrane-bound organelles can perform a variety of functions, including binding and delivery of DNA, transport of virulence factors, protection of the cell from outer membrane targeting antimicrobials, and ridding the cell of toxic envelope proteins. Here we review the contributions of these extracellular organelles to prokaryotic physiology and compare these with the contributions of the bacterial interior membrane bound organelles responsible for harvesting light energy and for generating magnetic crystals of heavy metals. Understanding the roles of these multifunctional extracellular vesicle organelles as microbial tools will help us to better realize the diverse interactions that occur in our polymicrobial world. PMID:23615201

  10. Proteogenomic analysis and global discovery of posttranslational modifications in prokaryotes

    PubMed Central

    Yang, Ming-kun; Yang, Yao-hua; Chen, Zhuo; Zhang, Jia; Lin, Yan; Wang, Yan; Xiong, Qian; Li, Tao; Ge, Feng; Bryant, Donald A.; Zhao, Jin-dong

    2014-01-01

    We describe an integrated workflow for proteogenomic analysis and global profiling of posttranslational modifications (PTMs) in prokaryotes and use the model cyanobacterium Synechococcus sp. PCC 7002 (hereafter Synechococcus 7002) as a test case. We found more than 20 different kinds of PTMs, and a holistic view of PTM events in this organism grown under different conditions was obtained without specific enrichment strategies. Among 3,186 predicted protein-coding genes, 2,938 gene products (>92%) were identified. We also identified 118 previously unidentified proteins and corrected 38 predicted gene-coding regions in the Synechococcus 7002 genome. This systematic analysis not only provides comprehensive information on protein profiles and the diversity of PTMs in Synechococcus 7002 but also provides some insights into photosynthetic pathways in cyanobacteria. The entire proteogenomics pipeline is applicable to any sequenced prokaryotic organism, and we suggest that it should become a standard part of genome annotation projects. PMID:25512518

  11. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome

    PubMed Central

    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S.

    2016-01-01

    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  12. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome.

    PubMed

    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S

    2016-01-01

    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  13. Gene and cell survival: lessons from prokaryotic plasmid R1.

    PubMed

    de la Cueva-Méndez, Guillermo; Pimentel, Belén

    2007-05-01

    Plasmids are units of extrachromosomal genetic inheritance found in all kingdoms of life. They replicate autonomously and undergo stable propagation in their hosts. Despite their small size, plasmid replication and gene expression constitute a metabolic burden that compromises their stable maintenance in host cells. This pressure has driven the evolution of strategies to increase plasmid stability--a process accelerated by the ability of plasmids to transfer horizontally between cells and to exchange genetic material with their host and other resident episomal DNAs. These abilities drive the adaptability and diversity of plasmids and their host cells. Indeed, survival functions found in plasmids have chromosomal homologues that have an essential role in cellular responses to stress. An analysis of these functions in the prokaryotic plasmid R1, and of their intricate interrelationships, reveals remarkable overall similarities with other gene- and cell-survival strategies found within and beyond the prokaryotic world. PMID:17471262

  14. Classification of prokaryotic genetic replicators: between selfishness and altruism

    PubMed Central

    Jalasvuori, Matti; Koonin, Eugene V.

    2015-01-01

    Prokaryotes harbor a variety of genetic replicators, including plasmids, viruses, and chromosomes, each having differing effects on the phenotype of the hosting cell. Here, we propose a classification for replicators of bacteria and archaea on the basis of their horizontal-transfer potential and the type of relationships (mutualistic, symbiotic, commensal, or parasitic) that they have with the host cell vehicle. Horizontal movement of replicators can be either active or passive, reflecting whether or not the replicator encodes the means to mediate its own transfer from one cell to another. Some replicators also have an infectious extracellular state, thus separating viruses from other mobile elements. From the perspective of the cell vehicle, the different types of replicators form a continuum from genuinely mutualistic to completely parasitic replicators. This classification provides a general framework for dissecting prokaryotic systems into evolutionarily meaningful components. PMID:25703428

  15. Next Generation Prokaryotic Engineering: The CRISPR-Cas Toolkit.

    PubMed

    Mougiakos, Ioannis; Bosma, Elleke F; de Vos, Willem M; van Kranenburg, Richard; van der Oost, John

    2016-07-01

    The increasing demand for environmentally friendly production processes of green chemicals and fuels has stimulated research in microbial metabolic engineering. CRISPR-Cas-based tools for genome editing and expression control have enabled fast, easy, and accurate strain development for established production platform organisms, such as Escherichia coli and Saccharomyces cerevisiae. However, the growing interest in alternative production hosts, for which genome editing options are generally limited, requires further developing such engineering tools. In this review, we discuss established and emerging CRISPR-Cas-based tools for genome editing and transcription control of model and non-model prokaryotes, and we analyse the possibilities for further improvement and expansion of these tools for next generation prokaryotic engineering. PMID:26944793

  16. Pyrophosphate-Fueled Na+ and H+ Transport in Prokaryotes

    PubMed Central

    Malinen, Anssi M.; Luoto, Heidi H.

    2013-01-01

    SUMMARY In its early history, life appeared to depend on pyrophosphate rather than ATP as the source of energy. Ancient membrane pyrophosphatases that couple pyrophosphate hydrolysis to active H+ transport across biological membranes (H+-pyrophosphatases) have long been known in prokaryotes, plants, and protists. Recent studies have identified two evolutionarily related and widespread prokaryotic relics that can pump Na+ (Na+-pyrophosphatase) or both Na+ and H+ (Na+,H+-pyrophosphatase). Both these transporters require Na+ for pyrophosphate hydrolysis and are further activated by K+. The determination of the three-dimensional structures of H+- and Na+-pyrophosphatases has been another recent breakthrough in the studies of these cation pumps. Structural and functional studies have highlighted the major determinants of the cation specificities of membrane pyrophosphatases and their potential use in constructing transgenic stress-resistant organisms. PMID:23699258

  17. Prokaryotic Phylogeny Based on Complete Genomes Without Sequence Alignment

    NASA Astrophysics Data System (ADS)

    Hao, Bailin; Qi, Ji; Wang, Bin

    We present a brief review of a series of on-going work on bacterial phylogeny. We propose a new method to infer relatedness of prokaryotes from their complete genome data without using sequence alignment, leading to results comparable with the bacteriologist's systematics as reflected in the latest 2001 edition of Bergey's Manual of Systematic Bacteriology.1 We only touch on the mathematical aspects of the method. The biological implications of our results will be published elsewhere.

  18. Distributions of Virus-Like Particles and Prokaryotes within Microenvironments

    PubMed Central

    Dann, Lisa M.; Paterson, James S.; Newton, Kelly; Oliver, Rod; Mitchell, James G.

    2016-01-01

    Microbial interactions are important for ecosystem function, but occur at the microscale and so are difficult to observe. Previous studies in marine systems have shown significant shifts in microbial community abundance and composition over scales of micrometres to centimetres. This study investigates the microscale abundance distributions of virus-like particles (VLPs) and prokaryotes in the lower reaches of a river to determine the extent to which microscale microbial patchiness exists in freshwater systems. Here we report local hotspots surrounded by gradients that reach a maximum 80 and 107 fold change in abundance over 0.9 cm for prokaryotic and VLP subpopulations. Changes in prokaryotic and VLP hotspots were tightly coupled. There were no gradients at tens of centimetres across the boundary layers, which is consistent with strong mixing and turbulence-driven aggregation found in river systems. Quantification of the patchiness shows a marked asymmetry with patches 10 times greater than background common, but depletions being rare or absent in most samples. This consistent asymmetry suggests that coldspots depleted by grazing and lysis are rapidly mixed to background concentrations, while the prevalence of hotspots indicates persistence against disruption. The hotspot to coldspot relative abundance may be useful for understanding microbial river dynamics. The patchiness indicates that the mean- field approach of bulk phase sampling misses the microbially relevant community variation and may underestimate the concentrations of these important microbial groups. PMID:26785114

  19. Function and structure of a prokaryotic formylglycine-generating enzyme.

    PubMed

    Carlson, Brian L; Ballister, Edward R; Skordalakes, Emmanuel; King, David S; Breidenbach, Mark A; Gilmore, Sarah A; Berger, James M; Bertozzi, Carolyn R

    2008-07-18

    Type I sulfatases require an unusual co- or post-translational modification for their activity in hydrolyzing sulfate esters. In eukaryotic sulfatases, an active site cysteine residue is oxidized to the aldehyde-containing C(alpha)-formylglycine residue by the formylglycine-generating enzyme (FGE). The machinery responsible for sulfatase activation is poorly understood in prokaryotes. Here we describe the identification of a prokaryotic FGE from Mycobacterium tuberculosis. In addition, we solved the crystal structure of the Streptomyces coelicolor FGE homolog to 2.1 A resolution. The prokaryotic homolog exhibits remarkable structural similarity to human FGE, including the position of catalytic cysteine residues. Both biochemical and structural data indicate the presence of an oxidized cysteine modification in the active site that may be relevant to catalysis. In addition, we generated a mutant M. tuberculosis strain lacking FGE. Although global sulfatase activity was reduced in the mutant, a significant amount of residual sulfatase activity suggests the presence of FGE-independent sulfatases in this organism. PMID:18390551

  20. Birth, Death, and Diversification of Mobile Promoters in Prokaryotes

    PubMed Central

    van Passel, Mark W.J.; Nijveen, Harm; Wahl, Lindi M.

    2014-01-01

    A previous study of prokaryotic genomes identified large reservoirs of putative mobile promoters (PMPs), that is, homologous promoter sequences associated with nonhomologous coding sequences. Here we extend this data set to identify the full complement of mobile promoters in sequenced prokaryotic genomes. The expanded search identifies nearly 40,000 PMP sequences, 90% of which occur in noncoding regions of the genome. To gain further insight from this data set, we develop a birth–death–diversification model for mobile genetic elements subject to sequence diversification; applying the model to PMPs we are able to quantify the relative importance of duplication, loss, horizontal gene transfer (HGT), and diversification to the maintenance of the PMP reservoir. The model predicts low rates of HGT relative to the duplication and loss of PMP copies, rapid dynamics of PMP families, and a pool of PMPs that exist as a single copy in a genome at any given time, despite their mobility. We report evidence of these “singletons” at high frequencies in prokaryotic genomes. We also demonstrate that including selection, either for or against PMPs, was not necessary to describe the observed data. PMID:24578351

  1. Predatory prokaryotes: predation and primary consumption evolved in bacteria

    NASA Technical Reports Server (NTRS)

    Guerrero, R.; Pedros-Alio, C.; Esteve, I.; Mas, J.; Chase, D.; Margulis, L.

    1986-01-01

    Two kinds of predatory bacteria have been observed and characterized by light and electron microscopy in samples from freshwater sulfurous lakes in northeastern Spain. The first bacterium, named Vampirococcus, is Gram-negative and ovoidal (0.6 micrometer wide). An anaerobic epibiont, it adheres to the surface of phototrophic bacteria (Chromatium spp.) by specific attachment structures and, as it grows and divides by fission, destroys its prey. An important in situ predatory role can be inferred for Vampirococcus from direct counts in natural samples. The second bacterium, named Daptobacter, is a Gram-negative, facultatively anaerobic straight rod (0.5 x 1.5 micrometers) with a single polar flagellum, which collides, penetrates, and grows inside the cytoplasm of its prey (several genera of Chromatiaceae). Considering also the well-known case of Bdellovibrio, a Gram-negative, aerobic curved rod that penetrates and divides in the periplasmic space of many chemotrophic Gram-negative bacteria, there are three types of predatory prokaryotes presently known (epibiotic, cytoplasmic, and periplasmic). Thus, we conclude that antagonistic relationships such as primary consumption, predation, and scavenging had already evolved in microbial ecosystems prior to the appearance of eukaryotes. Furthermore, because they represent methods by which prokaryotes can penetrate other prokaryotes in the absence of phagocytosis, these associations can be considered preadaptation for the origin of intracellular organelles.

  2. Prokaryotic community structure and respiration during long-term incubations

    PubMed Central

    Baltar, Federico; Lindh, Markus V; Parparov, Arkadi; Berman, Tom; Pinhassi, Jarone

    2012-01-01

    Despite the importance of incubation assays for studies in microbial ecology that frequently require long confinement times, few reports are available in which changes in the assemblage structure of aquatic prokaryotes were monitored during long-term incubations. We measured rates of dissolved organic carbon degradation and microbial respiration by consumption of dissolved oxygen (DO) in four experiments with Lake Kinneret near-surface water and, concomitantly, we analyzed the variability in prokaryotic community structure during long-term dark bottle incubations. During the first 24 h, there were only minor changes in bacterial community composition. Thereafter there were marked changes in the prokaryotic community structure during the incubations. In contrast, oxygen consumption rates (a proxy for both respiration and dissolved organic carbon degradation rates) remained stable for up to 10–23 days. This study is one of the first to examine closely the phylo-genetic changes that occur in the microbial community of untreated freshwater during long-term (days) incubations in dark, sealed containers. Novel information on the diversity of the main bacterial phylotypes that may be involved in dissolved organic matter degradation in lake Kinneret is also provided. Our results suggest that, under certain ecological settings, constant community metabolic rates can be maintained as a result of shifts in community composition. PMID:22950026

  3. Distribution of glucan-branching enzymes among prokaryotes.

    PubMed

    Suzuki, Eiji; Suzuki, Ryuichiro

    2016-07-01

    Glucan-branching enzyme plays an essential role in the formation of branched polysaccharides, glycogen, and amylopectin. Only one type of branching enzyme, belonging to glycoside hydrolase family 13 (GH13), is found in eukaryotes, while two types of branching enzymes (GH13 and GH57) occur in prokaryotes (Bacteria and Archaea). Both of these types are the members of protein families containing the diverse specificities of amylolytic glycoside hydrolases. Although similarities are found in the catalytic mechanism between the two types of branching enzyme, they are highly distinct from each other in terms of amino acid sequence and tertiary structure. Branching enzymes are found in 29 out of 30 bacterial phyla and 1 out of 5 archaeal phyla, often along with glycogen synthase, suggesting the existence of α-glucan production and storage in a wide range of prokaryotes. Enormous variability is observed as to which type and how many copies of branching enzyme are present depending on the phylum and, in some cases, even among species of the same genus. Such a variation may have occurred through lateral transfer, duplication, and/or differential loss of genes coding for branching enzyme during the evolution of prokaryotes. PMID:27141939

  4. A comprehensive repertoire of prokaryotic species identified in human beings.

    PubMed

    Hugon, Perrine; Dufour, Jean-Charles; Colson, Philippe; Fournier, Pierre-Edouard; Sallah, Kankoe; Raoult, Didier

    2015-10-01

    The compilation of the complete prokaryotic repertoire associated with human beings as commensals or pathogens is a major goal for the scientific and medical community. The use of bacterial culture techniques remains a crucial step to describe new prokaryotic species. The large number of officially acknowledged bacterial species described since 1980 and the recent increase in the number of recognised pathogenic species have highlighted the absence of an exhaustive compilation of species isolated in human beings. By means of a thorough investigation of several large culture databases and a search of the scientific literature, we built an online database containing all human-associated prokaryotic species described, whether or not they had been validated and have standing in nomenclature. We list 2172 species that have been isolated in human beings. They were classified in 12 different phyla, mostly in the Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes phyla. Our online database is useful for both clinicians and microbiologists and forms part of the Human Microbiome Project, which aims to characterise the whole human microbiota and help improve our understanding of the human predisposition and susceptibility to infectious agents. PMID:26311042

  5. The Prokaryote-Eukaryote Dichotomy: Meanings and Mythology

    PubMed Central

    Sapp, Jan

    2005-01-01

    Drawing on documents both published and archival, this paper explains how the prokaryote-eukaryote dichotomy of the 1960s was constructed, the purposes it served, and what it implied in terms of classification and phylogeny. In doing so, I first show how the concept was attributed to Edouard Chatton and the context in which he introduced the terms. Following, I examine the context in which the terms were reintroduced into biology in 1962 by Roger Stanier and C. B. van Niel. I study the discourse over the subsequent decade to understand how the organizational dichotomy took on the form of a natural classification as the kingdom Monera or superkingdom Procaryotae. Stanier and van Niel admitted that, in regard to constructing a natural classification of bacteria, structural characteristics were no more useful than physiological properties. They repeatedly denied that bacterial phylogenetics was possible. I thus examine the great historical irony that the “prokaryote,” in both its organizational and phylogenetic senses, was defined (negatively) on the basis of structure. Finally, we see how phylogenetic research based on 16S rRNA led by Carl Woese and his collaborators confronted the prokaryote concept while moving microbiology to the center of evolutionary biology. PMID:15944457

  6. Evolution of early life inferred from protein and ribonucleic acid sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  7. Linking host prokaryotic physiology to viral lifestyle dynamics in a temperate freshwater lake (Lake Pavin, France).

    PubMed

    Palesse, S; Colombet, J; Pradeep Ram, A S; Sime-Ngando, T

    2014-11-01

    In aquatic ecosystems, fluctuations in environmental conditions and prokaryotic host physiological states can strongly affect the dynamics of viral life strategies. The influence of prokaryote physiology and environmental factors on viral replication cycles (lytic and lysogeny) was investigated from April to September 2011 at three different strata (epi, meta, and hypolimnion) in the mixolimnion of deep volcanic temperate freshwater Lake Pavin (France). Overall, the euphotic region (epi and metalimnion) was more dynamic and showed significant variation in microbial standing stocks, prokaryotic physiological state, and viral life strategies compared to the aphotic hypolimnion which was stable within sampled months. The prokaryotic host physiology as inferred from the nucleic acid content of prokaryotic cells (high or low nucleic acid) was strongly regulated by the chlorophyll concentration. The predominance of the high nucleic acid (HNA) prokaryotes (cells) over low nucleic acid (LNA) prokaryotes (cells) in the spring (HNA/LNA = 1.2) and vice versa in the summer period (HNA/LNA = 0.4) suggest that the natural prokaryotic communities underwent major shifts in their physiological states during investigated time period. The increase in the percentage of inducible lysogenic prokaryotes in the summer period was associated with the switch in the dominance of LNA over HNA cells, which coincided with the periods of strong resource (nutrient) limitation. This supports the idea that lysogeny represents a maintenance strategy for viruses in unproductive or harsh nutrient/host conditions. A negative correlation of percentage of lysogenic prokaryotes with HNA cell abundance and chlorophyll suggest that lysogenic cycle is closely related to prokaryotic cells which are stressed or starved due to unavailability of resources for its growth and activity. Our results provide support to previous findings that changes in prokaryote physiology are critical for the promotion and

  8. The Occurrence and Distribution of Poly(A) Ribonucleic Acid in Soybean

    PubMed Central

    Key, Joe L.; Silflow, Carolyn

    1975-01-01

    The occurrence and distribution of poly(A) sequences in the RNA of soybean (Glycine max var. Wayne) have been studied. Only one of the two species of AMP-rich RNA contains poly(A). D-RNA does not contain detectable poly(A) sequences. The TB-RNA is the poly(A) RNA in this system. At least a part (up to 50% or more) of the mRNA in polyribosomes contains a poly(A) sequence. The poly(A) RNA is heterodisperse in size but has a mean size of approximately 18S (2,000 nucleotides) in urea and formamide gels. The poly(A) fragment resulting from ribonuclease A and T1 digestion migrates as a broad band overlapping the 4 to 5.8S regions of the gels with a mean size of somewhat greater than 5S. No evidence was found for the occurrence of a discrete oligo(A) fragment in the poly(A) RNA; however, oligonucleotides which migrate faster than the poly(A) fraction were observed in preparations which were not bound to oligo(dT) cellulose prior to electrophoresis. This oligonucleotide region was enriched in AMP (up to about 65%) as would be expected after ribonuclease A and T1 digestion. PMID:16659304

  9. Gradient enhanced-fluidity liquid hydrophilic interaction chromatography of ribonucleic acid nucleosides and nucleotides: A "green" technique.

    PubMed

    Beilke, Michael C; Beres, Martin J; Olesik, Susan V

    2016-03-01

    A "green" hydrophilic interaction liquid chromatography (HILIC) technique for separating the components of mixtures with a broad range of polarities is illustrated using enhanced-fluidity liquid mobile phases. Enhanced-fluidity liquid chromatography (EFLC) involves the addition of liquid CO2 to conventional liquid mobile phases. Decreased mobile phase viscosity and increased analyte diffusivity results when a liquefied gas is dissolved in common liquid mobile phases. The impact of CO2 addition to a methanol:water (MeOH:H2O) mobile phase was studied to optimize HILIC gradient conditions. For the first time a fast separation of 16 ribonucleic acid (RNA) nucleosides/nucleotides was achieved (16min) with greater than 1.3 resolution for all analyte pairs. By using a gradient, the analysis time was reduced by over 100% compared to similar separations conducted under isocratic conditions. The optimal separation using MeOH:H2O:CO2 mobile phases was compared to MeOH:H2O and acetonitrile:water (ACN:H2O) mobile phases. Based on chromatographic performance parameters (efficiency, resolution and speed of analysis) and an assessment of the environmental impact of the mobile phase mixtures, MeOH:H2O:CO2 mixtures are preferred over ACN:H2O or MeOH:H2O mobile phases for the separation of mixtures of RNA nucleosides and nucleotides. PMID:26860052

  10. Synthesis of Capsid and Noncapsid Viral Proteins in Response to Encephalomyocarditis Virus Ribonucleic Acid in Animal Cell-Free Systems

    PubMed Central

    Dobos, P.; Kerr, Ian M.; Martin, E. M.

    1971-01-01

    The polypeptide products formed in two cell-free protein-synthetic systems programmed with encephalomyocarditis (EMC) virus ribonucleic acid (RNA) have been compared with the virus-specific proteins found in EMC-infected cells and with the capsid proteins of the purified virion. Tryptic peptides of 35S-methioninelabeled proteins from these three sources were compared by co-chromatography and electrophoresis and by isoelectric focussing. Fifty-two methionine-containing peptides were resolved in digests of material from infected cells, of which about one-third were also clearly present in digests of the virion capsid proteins. The product formed in response to EMC RNA in cell-free systems from Krebs mouse ascites tumor cells yielded 26 to 29 such peptides. Most of these peptides were shown to behave identically with virus-specific peptides from infected cells, whereas just under half of them appeared to be identical with peptides from the virion capsid proteins. The product formed in response to EMC RNA in the L-cell cell-free system was similar, whereas six additional EMC-specific peptides were detected in mixed Krebs L-cell systems. The results indicate that the EMC RNA genome is partially translated in the mouse cell-free systems used to yield products containing both virion capsid and virus-specific noncapsid polypeptides. Images PMID:4331652

  11. Impact of size, secondary structure, and counterions on the binding of small ribonucleic acids to layered double hydroxide nanoparticles.

    PubMed

    Rodriguez, Blanca V; Pescador, Jorge; Pollok, Nicole; Beall, Gary W; Maeder, Corina; Lewis, L Kevin

    2015-01-01

    Use of ribonucleic acid (RNA) interference to regulate protein expression has become an important research topic and gene therapy tool, and therefore, finding suitable vehicles for delivery of small RNAs into cells is of crucial importance. Layered double metal hydroxides such as hydrotalcite (HT) have shown great promise as nonviral vectors for transport of deoxyribose nucleic acid (DNA), proteins, and drugs into cells, but the adsorption of RNAs to these materials has been little explored. In this study, the binding of small RNAs with different lengths and levels of secondary structure to HT nanoparticles has been analyzed and compared to results obtained with small DNAs in concurrent experiments. Initial experiments established the spectrophotometric properties of HT in aqueous solutions and determined that HT particles could be readily sedimented with near 100% efficiencies. Use of RNA+HT cosedimentation experiments as well as electrophoretic mobility shift assays demonstrated strong adsorption of RNA 25mers to HT, with twofold greater binding of single-stranded RNAs relative to double-stranded molecules. Strong affinities were also observed with ssRNA and dsRNA 54mers and with more complex transfer RNA molecules. Competition binding and RNA displacement experiments indicated that RNA-HT associations were strong and were only modestly affected by the presence of high concentrations of inorganic anions. PMID:26620852

  12. Multivariate entropy distance method for prokaryotic gene identification.

    PubMed

    Ouyang, Zhengqing; Zhu, Huaiqiu; Wang, Jin; She, Zhen-Su

    2004-06-01

    A new simple method is found for efficient and accurate identification of coding sequences in prokaryotic genome. The method employs a Shannon description of artificial language for DNA sequences. It consists in translating a DNA sequence into a pseudo-amino acid sequence with 20 fundamental words according to the universal genetic code. With an entropy-density profile (EDP), the method maps a sequence of finite length to a vector and then analyzes its position in the 20-dimensional phase space depending on its nature. It is found that the ratio of the relative distance to an averaged coding and non-coding EDP over a small number (up to one) of open reading frames (ORFs) can serve as a good coding potential. An iterative algorithm is designed for finding a set of "root" sequences using this coding potential. A multivariate entropy distance (MED) algorithm is then proposed for the identification of prokaryotic genes; it has a feature to combine the use of a coding potential and an EDP-based sequence similarity analysis. The current version of MED is unsupervised, parameter-free and simple to implement. It is demonstrated to be able to detect 95-99% genes with 10-30% of additional genes when tested against the RefSeq database of NCBI and to detect 97.5-99.8% of confirmed genes with known functions. It is also shown to be able to find a set of (functionally known) genes that are missed by other well-known gene finding algorithms. All measurements show that the MED algorithm reaches a similar performance level as the algorithms like GeneMark and Glimmer for prokaryotic gene prediction. PMID:15297987

  13. Dynamic evolution of translation initiation mechanisms in prokaryotes

    PubMed Central

    Nakagawa, So; Niimura, Yoshihito; Miura, Kin-ichiro; Gojobori, Takashi

    2010-01-01

    It is generally believed that prokaryotic translation is initiated by the interaction between the Shine-Dalgarno (SD) sequence in the 5′ UTR of an mRNA and the anti-SD sequence in the 3′ end of a 16S ribosomal RNA. However, there are two exceptional mechanisms, which do not require the SD sequence for translation initiation: one is mediated by a ribosomal protein S1 (RPS1) and the other used leaderless mRNA that lacks its 5′ UTR. To understand the evolutionary changes of the mechanisms of translation initiation, we examined how universal the SD sequence is as an effective initiator for translation among prokaryotes. We identified the SD sequence from 277 species (249 eubacteria and 28 archaebacteria). We also devised an SD index that is a proportion of SD-containing genes in which the differences of GC contents are taken into account. We found that the SD indices varied among prokaryotic species, but were similar within each phylum. Although the anti-SD sequence is conserved among species, loss of the SD sequence seems to have occurred multiple times, independently, in different phyla. For those phyla, RPS1-mediated or leaderless mRNA-used mechanisms of translation initiation are considered to be working to a greater extent. Moreover, we also found that some species, such as Cyanobacteria, may acquire new mechanisms of translation initiation. Our findings indicate that, although translation initiation is indispensable for all protein-coding genes in the genome of every species, its mechanisms have dynamically changed during evolution. PMID:20308567

  14. A computational genomics pipeline for prokaryotic sequencing projects

    PubMed Central

    Kislyuk, Andrey O.; Katz, Lee S.; Agrawal, Sonia; Hagen, Matthew S.; Conley, Andrew B.; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C.; Sammons, Scott A.; Govil, Dhwani; Mair, Raydel D.; Tatti, Kathleen M.; Tondella, Maria L.; Harcourt, Brian H.; Mayer, Leonard W.; Jordan, I. King

    2010-01-01

    Motivation: New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. Results: We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. Availability and implementation: The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base (http://nbase.biology.gatech.edu/). The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems. Contact: king.jordan@biology.gatech.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20519285

  15. Microdiversity of extracellular enzyme genes among sequenced prokaryotic genomes

    PubMed Central

    Zimmerman, Amy E; Martiny, Adam C; Allison, Steven D

    2013-01-01

    Understanding the relationship between prokaryotic traits and phylogeny is important for predicting and modeling ecological processes. Microbial extracellular enzymes have a pivotal role in nutrient cycling and the decomposition of organic matter, yet little is known about the phylogenetic distribution of genes encoding these enzymes. In this study, we analyzed 3058 annotated prokaryotic genomes to determine which taxa have the genetic potential to produce alkaline phosphatase, chitinase and β-N-acetyl-glucosaminidase enzymes. We then evaluated the relationship between the genetic potential for enzyme production and 16S rRNA phylogeny using the consenTRAIT algorithm, which calculated the phylogenetic depth and corresponding 16S rRNA sequence identity of clades of potential enzyme producers. Nearly half (49.2%) of the genomes analyzed were found to be capable of extracellular enzyme production, and these were non-randomly distributed across most prokaryotic phyla. On average, clades of potential enzyme-producing organisms had a maximum phylogenetic depth of 0.008004–0.009780, though individual clades varied broadly in both size and depth. These values correspond to a minimum 16S rRNA sequence identity of 98.04–98.40%. The distribution pattern we found is an indication of microdiversity, the occurrence of ecologically or physiologically distinct populations within phylogenetically related groups. Additionally, we found positive correlations among the genes encoding different extracellular enzymes. Our results suggest that the capacity to produce extracellular enzymes varies at relatively fine-scale phylogenetic resolution. This variation is consistent with other traits that require a small number of genes and provides insight into the relationship between taxonomy and traits that may be useful for predicting ecological function. PMID:23303371

  16. Prokaryotic Phylogeny Based on Complete Genomes Without Sequence Alignment

    NASA Astrophysics Data System (ADS)

    Hao, Bailin; Qi, Ji; Wang, Bin

    2003-04-01

    This is a brief review of a series of on-going work on bacterial phylogeny. We have proposed a new method to infer relatedness of prokaryotes from their complete genome data without using sequence alignment. It has led to results comparable with the bacteriologists' systematics as reflected in the latest 2001 edition of the Bergey's Manual of Systematic Bacteriology1. In what follows we only touch on the mathematical aspects of the method. The biological implications of our results will be published elsewhere.

  17. A new view into prokaryotic cell biology from electron cryotomography.

    PubMed

    Oikonomou, Catherine M; Jensen, Grant J

    2016-04-01

    Electron cryotomography (ECT) enables intact cells to be visualized in 3D in an essentially native state to 'macromolecular' (∼4 nm) resolution, revealing the basic architectures of complete nanomachines and their arrangements in situ. Since its inception, ECT has advanced our understanding of many aspects of prokaryotic cell biology, from morphogenesis to subcellular compartmentalization and from metabolism to complex interspecies interactions. In this Review, we highlight how ECT has provided structural and mechanistic insights into the physiology of bacteria and archaea and discuss prospects for the future. PMID:26923112

  18. The Gas Vacuole - an Early Organelle of Prokaryote Motility

    NASA Astrophysics Data System (ADS)

    Staley, James T.

    1980-06-01

    Several lines of evidence suggest that the gas vesicle may have been an early organelle of prokaryote motility. First, it is found in bacteria that are thought to be representatives of primitive groups. Second, it is a simple structure, and the structure alone imparts the function of motility. Thirdly, it is widely distributed amongst prokaryotes, having been found in the purple and green sulfur photosynthetic bacteria, cyanobacteria, methanogenic bacteria, obligate and facultative anaerobic heterotrophic bacteria, as well as aerobic heterotrophic bacteria that divide by budding and binary transverse fission. Recent evidence suggests that in some bacteria the genes for gas vesicle synthesis occur on plasmids. Thus, the wide distribution of this characteristic could be due to recent evolution and rapid dispersal, though early evolution is not precluded. Though the gas vesicle structure itself appears to be highly conserved among the various groups of bacteria, it seems doubtful that the regulatory mechanism to control its synthesis could be the same for the diverse gas vacuolate bacterial groups.

  19. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes

    PubMed Central

    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard

    2015-01-01

    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  20. Transcriptome dynamics-based operon prediction in prokaryotes

    PubMed Central

    2014-01-01

    Background Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. Results In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. Conclusion We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available. PMID:24884724

  1. Deciphering unusual uncultured magnetotactic multicellular prokaryotes through genomics

    PubMed Central

    Abreu, Fernanda; Morillo, Viviana; Nascimento, Fabrícia F; Werneck, Clarissa; Cantão, Mauricio Egidio; Ciapina, Luciane Prioli; de Almeida, Luiz Gonzaga Paula; Lefèvre, Christopher T; Bazylinski, Dennis A; de Vasconcelos, Ana Tereza Ribeiro; Lins, Ulysses

    2014-01-01

    Candidatus Magnetoglobus multicellularis (Ca. M. multicellularis) is a member of a group of uncultured magnetotactic prokaryotes that possesses a unique multicellular morphology. To better understand this organism's physiology, we used a genomic approach through pyrosequencing. Genomic data analysis corroborates previous structural studies and reveals the proteins that are likely involved in multicellular morphogenesis of this microorganism. Interestingly, some detected protein sequences that might be involved in cell adhesion are homologues to phylogenetically unrelated filamentous multicellular bacteria proteins, suggesting their contribution in the early development of multicellular organization in Bacteria. Genes related to the behavior of Ca. M. multicellularis (chemo-, photo- and magnetotaxis) and its metabolic capabilities were analyzed. On the basis of the genomic–physiologic information, enrichment media were tested. One medium supported chemoorganoheterotrophic growth of Ca. M. multicellularis and allowed the microorganisms to maintain their multicellular morphology and cell cycle, confirming for the first time that the entire life cycle of the MMP occurs in a multicellular form. Because Ca. M. multicellularis has a unique multicellular life style, its cultivation is an important achievement for further studies regarding the multicellular evolution in prokaryotes. PMID:24196322

  2. Co-polymer tracts in eukaryotic, prokaryotic, and organellar DNA.

    PubMed

    Behe, M J; Beasty, A M

    1991-01-01

    Large variations in DNA base composition and noticeable strand asymmetries are known to occur between different organisms and within different regions of the genomes of single organisms. Apparently such composition and sequence biases occur to fulfill structural rather than informational requirements. Here we report the wide occurrence of a more subtle biasing of DNA sequence that can have structural consequences: an increase or a suppression of the number of long tracts of two-base co-polymers. Strong biases were observed when the DNA sequences of the longest eukaryotic, prokaryotic, and organellar entries in the GenBank data base (totaling 773 kilobases) were analyzed for the number of occurrences of tracts of the two-base co-polymers (A,T)n, (G,C)n, and (A,C)n as a function of tract length. (The expression (A,T)n is used here to denote an uninterrupted tract, n nucleotides in length, of A and T bases in any proportion or order, terminated at each end by a G or C residue.) Characteristic differences are also observed in tract biases of eukaryotic vs. prokaryotic organisms. PMID:1799681

  3. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes.

    PubMed

    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard

    2015-01-01

    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  4. Lengths of Orthologous Prokaryotic Proteins Are Affected by Evolutionary Factors

    PubMed Central

    Tatarinova, Tatiana; Dien Bard, Jennifer; Cohen, Irit

    2015-01-01

    Proteins of the same functional family (for example, kinases) may have significantly different lengths. It is an open question whether such variation in length is random or it appears as a response to some unknown evolutionary driving factors. The main purpose of this paper is to demonstrate existence of factors affecting prokaryotic gene lengths. We believe that the ranking of genomes according to lengths of their genes, followed by the calculation of coefficients of association between genome rank and genome property, is a reasonable approach in revealing such evolutionary driving factors. As we demonstrated earlier, our chosen approach, Bubble-sort, combines stability, accuracy, and computational efficiency as compared to other ranking methods. Application of Bubble Sort to the set of 1390 prokaryotic genomes confirmed that genes of Archaeal species are generally shorter than Bacterial ones. We observed that gene lengths are affected by various factors: within each domain, different phyla have preferences for short or long genes; thermophiles tend to have shorter genes than the soil-dwellers; halophiles tend to have longer genes. We also found that species with overrepresentation of cytosines and guanines in the third position of the codon (GC3 content) tend to have longer genes than species with low GC3 content. PMID:26114113

  5. Prokaryotic diversity of arctic ice shelf microbial mats.

    PubMed

    Bottos, Eric M; Vincent, Warwick F; Greer, Charles W; Whyte, Lyle G

    2008-04-01

    The prokaryotic diversity and respiratory activity of microbial mat communities on the Markham Ice Shelf and Ward Hunt Ice Shelf in the Canadian high Arctic were analysed. All heterotrophic isolates and > 95% of bacterial 16S rRNA gene clone library sequences from both ice shelves grouped within the phyla Bacteroidetes, Proteobacteria and Actinobacteria. Clone library analyses showed that the bacterial communities were diverse and varied significantly between the two ice shelves, with the Markham library having a higher estimated diversity (Chao1 = 243; 105 operational taxonomic units observed in 189 clones) than the Ward Hunt library (Chao1 = 106; 52 operational taxonomic units observed in 128 clones). Archaeal 16S rRNA gene clone libraries from both ice shelves were dominated by a single Euryarchaeota sequence, which appears to represent a novel phylotype. Analyses of community activity by radiorespiration assays detected metabolism in mat samples from both ice shelves at temperatures as low as -10 degrees C. These findings provide the first insight into the prokaryotic biodiversity of Arctic ice shelf communities and underscore the importance of these cryo-ecosystems as a rich source of microbiota that are adapted to extreme cold. PMID:18215157

  6. A Proposed Genus Boundary for the Prokaryotes Based on Genomic Insights

    PubMed Central

    Qin, Qi-Long; Xie, Bin-Bin; Zhang, Xi-Ying; Chen, Xiu-Lan; Zhou, Bai-Cheng; Zhou, Jizhong; Oren, Aharon

    2014-01-01

    Genomic information has already been applied to prokaryotic species definition and classification. However, the contribution of the genome sequence to prokaryotic genus delimitation has been less studied. To gain insights into genus definition for the prokaryotes, we attempted to reveal the genus-level genomic differences in the current prokaryotic classification system and to delineate the boundary of a genus on the basis of genomic information. The average nucleotide sequence identity between two genomes can be used for prokaryotic species delineation, but it is not suitable for genus demarcation. We used the percentage of conserved proteins (POCP) between two strains to estimate their evolutionary and phenotypic distance. A comprehensive genomic survey indicated that the POCP can serve as a robust genomic index for establishing the genus boundary for prokaryotic groups. Basically, two species belonging to the same genus would share at least half of their proteins. In a specific lineage, the genus and family/order ranks showed slight or no overlap in terms of POCP values. A prokaryotic genus can be defined as a group of species with all pairwise POCP values higher than 50%. Integration of whole-genome data into the current taxonomy system can provide comprehensive information for prokaryotic genus definition and delimitation. PMID:24706738

  7. Links between viruses and prokaryotes throughout the water column along a North Atlantic latitudinal transect.

    PubMed

    De Corte, Daniele; Sintes, Eva; Yokokawa, Taichi; Reinthaler, Thomas; Herndl, Gerhard J

    2012-08-01

    Viruses are an abundant, diverse and dynamic component of marine ecosystems and have a key role in the biogeochemical processes of the ocean by controlling prokaryotic and phytoplankton abundance and diversity. However, most of the studies on virus-prokaryote interactions in marine environments have been performed in nearshore waters. To assess potential variations in the relation between viruses and prokaryotes in different oceanographic provinces, we determined viral and prokaryotic abundance and production throughout the water column along a latitudinal transect in the North Atlantic. Depth-related trends in prokaryotic and viral abundance (both decreasing by one order of magnitude from epi- to abyssopelagic waters), and prokaryotic production (decreasing by three orders of magnitude) were observed along the latitudinal transect. The virus-to-prokaryote ratio (VPR) increased from ~19 in epipelagic to ~53 in the bathy- and abyssopelagic waters. Although the lytic viral production decreased significantly with depth, the lysogenic viral production did not vary with depth. In bathypelagic waters, pronounced differences in prokaryotic and viral abundance were found among different oceanic provinces with lower leucine incorporation rates and higher VPRs in the North Atlantic Gyre province than in the provinces further north and south. The percentage of lysogeny increased from subpolar regions toward the more oligotrophic lower latitudes. Based on the observed trends over this latitudinal transect, we conclude that the viral-host interactions significantly change among different oceanic provinces in response to changes in the biotic and abiotic variables. PMID:22258100

  8. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    NASA Astrophysics Data System (ADS)

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems.

  9. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    PubMed Central

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems. PMID:26781165

  10. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems.

    PubMed

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m(2) quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems. PMID:26781165

  11. Prolactin messenger ribonucleic acid levels, prolactin synthesis, and radioimmunoassayable prolactin during the estrous cycle in the Golden Syrian hamster

    SciTech Connect

    Massa, J.S. ); Blask, D.E. )

    1990-01-01

    The purpose of this study was to observe the molecular dynamics of pituitary prolactin (PRL) gene expression during the estrous cycle of the Golden Syrian hamster. PRL messenger ribonucleic acid (mRNA) levels, PRL synthesis were measured in the morning on each day of the cycle. We observed that all of these PRL indices declined or did not change from Day 2 to Day 3 of the cycle. From Day 3 to Day 4 however, PRL mRNA levels increased 33-38% and media {sup 3}H-PRL increased 32-42%, while there were no significant changes in pituitary {sup 3}H-PRL, or RIA-PRL in the media or pituitary. From Day 4 to Day 1 (estrus) there was reciprocal change in the levels of {sup 3}H-PRL in the pituitary vs. the media, with the former increasing 37-50% and the latter decreasing 25-32%. Pituitary RIA-PRL did also increased 45-64% from Day 4 to Day 1 while media RIA-PRL did not change. These data are consistent with the following hypothesis: On the morning of proestrus(Day 4) in the hamster, PRL mRNA levels are elevated compared to those on Day 3, signaling an increase in PRL synthesis. This newly synthesized PRL is shunted into a readily releasable pool on the morning of Day 4 (contributing to the afternoon surge of serum PRL), and into a preferentially stored pool by the morning of Day 1.

  12. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  13. Age-related differences in messenger ribonucleic acid expression of key proteins involved in adipose cell differentiation and metabolism.

    PubMed

    Imbeault, P; Vidal, H; Tremblay, A; Vega, N; Nadeau, A; Després, J P; Mauriège, P

    2001-02-01

    This study was performed to compare the expression of key proteins [lipoprotein lipase (LPL), hormone-sensitive lipase (HSL), complement 3 (C3), and peroxisome proliferator-stimulated receptor-gamma (PPAR gamma)] involved in sc abdominal adipose tissue (AT) metabolism of young (n = 13) vs. middle-aged (n = 16) men. The sc abdominal AT-LPL activity as well as fat cell lipolysis were also measured in both groups of men. Young and middle-aged men displayed similar body weight and sc abdominal fat accumulation, measured by computed tomography. However, middle-aged men were characterized by a higher percent body fat (28 +/- 5% vs. 22 +/- 7%; P < 0.05) than young subjects. No difference between groups was observed in sc abdominal adipose tissue LPL activity. On the other hand, maximal lipolytic responses of sc abdominal adipocytes to isoproterenol (beta-adrenergic agonist) or to postadrenoceptor agents such as dibutyryl cAMP, forskolin, and theophylline were lower in middle-aged than in young men (P < 0.05). AT-LPL messenger ribonucleic acid (mRNA) levels were similar regardless of the subject's age. However, HSL, C3, and PPAR gamma mRNA levels were higher in middle-aged than in young individuals (P < 0.01-0.05). After correction for percent body fat, only HSL and C3 mRNA levels remained significantly different between groups (P < 0.05). Taken together, these results suggest that aging has an effect on the up-regulation of HSL and C3 mRNA levels, whereas PPAR gamma expression seems to be related mainly to increased adiposity. PMID:11158053

  14. Fossils of Prokaryotic Microorganisms in the Orgueil Meteorite

    NASA Technical Reports Server (NTRS)

    Hoover, Richard B.

    2006-01-01

    The Orgueil CII meteorite, which fell in southern France on the evening of May 14, 1864, has been one of the most extensively studied of all known carbonaceous meteorites. Field Emission Scanning Electron Microscopy (FESEM) studies of freshly fractured interior surfaces of the Orgueil meteorite have resulted in the detection of the fossilized remains of a large and diverse population of filamentous prokaryotic microorganisms. The taphonomy and the diverse modes of the preservation of these remains ,are diverse. Some of the remains exhibit carbonization of a hollow sheath and in other cases the remains are permineralized with water-soluble evaporite minerals, such as magnesium sulfate or ammonium salts. After the sample is fractured and the interior surfaces are exposed to the atmospheric moisture, some of these friable remains have been observed to exhibit significant alterations in appearance with time. Images are presented to document the changes that have been observed in some forms within the past two years. Images and EDS spectral data will also be presented to document the studies carried out on abiotic forms to search for possible nonbiological interpretations of the indigenous filamentous microstructures that have been found in the Orgueil meteorite. Images and EDS data will be presented showing the size, size range, morphology and chemical compositions of abiotic microstructures found in native crystalline and fibrous Epsomites from Poison Lake, Washington, USA and Catalayud, Zaragoza, Aragon, Spain. Many of these embedded forms are consistent in size and microstructure with cyanobacteria morphotypes. Some of the forms are exhibit known characteristics differentiation of cells, and reproductive structures of filamentous trichomic prokaryotes (bacteria and cyanobacteria) and the degraded remains of microfibrils associated with sheaths of cyanobacteria. In this paper, recently obtained comparative images and EDS data will be presented for the mineralized

  15. Prokaryotic Production of Virus-Like Particle Vaccine of Betanodavirus.

    PubMed

    Xie, Junfeng; Huang, Runqing; Lai, Yuxiong

    2016-01-01

    Betanodaviruses are the causative agents of viral nervous necrosis (VNN), a serious disease of cultured marine fish worldwide. To control this disease, vaccines of subunit capsid proteins (recombinant proteins or peptides), inactivated viruses, and virus-like particles (VLPs) were developed. VLP, which is highly similar to the wild-type virus in virion structure and contains no viral genome, was proved as one of the good and safe vaccines that can activate humoral immune response in the long term and induce cellular and innate immunities in the early stage post-immunization. The VLP vaccines can be expressed in vitro either by Baculovirus-based or yeast-based eukaryotic system or by bacterial expression system. In this chapter, the prokaryotic expression and the subsequent purification of VLP of betanodavirus orange-spotted grouper nervous necrosis virus (OGNNV) are presented. PMID:27076301

  16. Single-Molecule Observation of Prokaryotic DNA Replication

    PubMed Central

    Tanner, Nathan A.; van Oijen, Antoine M.

    2010-01-01

    Recent advances in optical imaging and molecular manipulation techniques have made it possible to observe the activity of individual enzymes and study the dynamic properties of processes that are challenging to elucidate using ensemble-averaging techniques. The use of single-molecule approaches has proven to be particularly successful in the study of the dynamic interactions between the components at the replication fork. In this section, we describe the methods necessary for in vitro single-molecule studies of prokaryotic replication systems. Through these experiments, accurate information can be obtained on the rates and processivities of DNA unwinding and polymerization. The ability to monitor in real time the progress of a single replication fork allows for the detection of short-lived, intermediate states that would be difficult to visualize in bulk-phase assays. PMID:19563119

  17. A chimeric prokaryotic ancestry of mitochondria and primitive eukaryotes.

    PubMed

    Karlin, S; Brocchieri, L; Mrázek, J; Campbell, A M; Spormann, A M

    1999-08-01

    We provide data and analysis to support the hypothesis that the ancestor of animal mitochondria (Mt) and many primitive amitochondrial (a-Mt) eukaryotes was a fusion microbe composed of a Clostridium-like eubacterium and a Sulfolobus-like archaebacterium. The analysis is based on several observations: (i) The genome signatures (dinucleotide relative abundance values) of Clostridium and Sulfolobus are compatible (sufficiently similar) and each has significantly more similarity in genome signatures with animal Mt sequences than do all other available prokaryotes. That stable fusions may require compatibility in genome signatures is suggested by the compatibility of plasmids and hosts. (ii) The expanded energy metabolism of the fusion organism was strongly selective for cementing such a fusion. (iii) The molecular apparatus of endospore formation in Clostridium serves as raw material for the development of the nucleus and cytoplasm of the eukaryotic cell. PMID:10430918

  18. Metabolic Compensation and Circadian Resilience in Prokaryotic Cyanobacteria

    PubMed Central

    Johnson, Carl Hirschie; Egli, Martin

    2014-01-01

    For a biological oscillator to function as a circadian pacemaker that confers a fitness advantage, its timing functions must be stable in response to environmental and metabolic fluctuations. One such stability enhancer, temperature compensation, has long been a defining characteristic of these timekeepers. However, an accurate biological timekeeper must also resist changes in metabolism, and this review suggests that temperature compensation is actually a subset of a larger phenomenon, namely metabolic compensation, which maintains the frequency of circadian oscillators in response to a host of factors that impinge on metabolism and would otherwise destabilize these clocks. The circadian system of prokaryotic cyanobacteria is an illustrative model because it is composed of transcriptional and nontranscriptional oscillators that are coupled to promote resilience. Moreover, the cyanobacterial circadian program regulates gene activity and metabolic pathways, and it can be manipulated to improve the expression of bioproducts that have practical value. PMID:24905782

  19. Pi sensing and signalling: from prokaryotic to eukaryotic cells.

    PubMed

    Qi, Wanjun; Baldwin, Stephen A; Muench, Stephen P; Baker, Alison

    2016-06-15

    Phosphorus is one of the most important macronutrients and is indispensable for all organisms as a critical structural component as well as participating in intracellular signalling and energy metabolism. Sensing and signalling of phosphate (Pi) has been extensively studied and is well understood in single-cellular organisms like bacteria (Escherichia coli) and Saccharomyces cerevisiae In comparison, the mechanism of Pi regulation in plants is less well understood despite recent advances in this area. In most soils the available Pi limits crop yield, therefore a clearer understanding of the molecular basis underlying Pi sensing and signalling is of great importance for the development of plants with improved Pi use efficiency. This mini-review compares some of the main Pi regulation pathways in prokaryotic and eukaryotic cells and identifies similarities and differences among different organisms, as well as providing some insight into future research. PMID:27284040

  20. Arabidopsis thaliana SEPALLATA3 protein prokaryotic expression and purification.

    PubMed

    He, Q; Fu, A Y; Zhang, G C; Li, T J; Zhang, J H

    2015-01-01

    SEPALLATA3 (SEP3) can be attributed to E class gene of the ABCE model of floral organ development. In order to reveal how SEP3 proteins form polymers, and the relationship between the polymers and their biological functions, the experiments of Arabidopsis thaliana AtSEP3 protein soluble expression in vitro were performed to construct a vector of prokaryotic expression, and investigate induced expression of recombinant proteins in Escherichia coli cells. The protein soluble expression was analyzed through the aspects of different protein domains, induction time, induction temperature, etc. Different structural domains and expression conditions were screened, and 0.1% IPTG inducing at 22 oC for 15 h was estimated as an optimal expression strategy. The nickel chelating resin was used to purify the protein in size exclusion chromatography (SEC) and the results indicated that AtSEP3 protein was present in the form of tetramer. PMID:26025404

  1. There must be a prokaryote somewhere: microbiology's search for itself

    NASA Technical Reports Server (NTRS)

    Woese, C. R.

    1994-01-01

    While early microbiologists showed considerable interest in the problem of the natural (evolutionary) relationships among prokaryotes, by the middle of this century that problem had largely been discarded as being unsolvable. In other words, the science of microbiology developed without an evolutionary framework, the lack of which kept it a weak discipline, defined largely by external forces. Modern technology has allowed microbiology finally to develop the needed evolutionary framework, and with this comes a sense of coherence, a sense of identity. Not only is this development radically changing microbiology itself, but also it will change microbiology's relationship to the other biological disciplines. Microbiology of the future will become the primary biological science, the base upon which our future understanding of the living world rests, and the font from which new understanding of it flows.

  2. Disulfide Bond Formation in Prokaryotes: History, Diversity and Design

    PubMed Central

    Hatahet, Feras; Boyd, Dana; Beckwith, Jon

    2014-01-01

    The formation of structural disulfide bonds is essential for the function and stability of a great number of proteins, particularly those that are secreted. There exists a variety of dedicated cellular catalysts and pathways from Archaea to humans that ensure the formation of native disulfide bonds. In this review we describe the initial discoveries of these pathways and report progress in recent years in our understanding of the diversity of these pathways in prokaryotes, including those newly discovered in some Archaea. We will also discuss the various successful efforts to achieve laboratory-based evolution and design of synthetic disulfide bond formation machineries in the bacterium E. coli. These latter studies have also led to new more general insights into the redox environment of the cytoplasm and bacterial cell envelope. PMID:24576574

  3. Isolation and Partial Characterization of Temperature-Sensitive Escherichia coli Mutants with Altered Leucyl- and Seryl-Transfer Ribonucleic Acid Synthetases

    PubMed Central

    Low, B.; Gates, F.; Goldstein, T.; Söll, D.

    1971-01-01

    Two temperature-sensitive mutants of Escherichia coli have been found in which the conditional growth is a result of a thermosensitive leucyl-transfer ribonucleic acid (tRNA) synthetase and seryl-tRNA synthetase, respectively. The corresponding genetic loci, leuS and serS, cotransduce with lip and serC, respectively. As a result of the mutationally altered leucyl-tRNA synthetase, some leucine-, valine-, and isoleucine-forming enzymes were derepressed. Thus, leucyl-tRNA synthetase is involved in the repression of the enzymes needed for the synthesis of branched-chain amino acids. PMID:4942762

  4. Function of prokaryotic and eukaryotic ABC proteins in lipid transport.

    PubMed

    Pohl, Antje; Devaux, Philippe F; Herrmann, Andreas

    2005-03-21

    ATP binding cassette (ABC) proteins of both eukaryotic and prokaryotic origins are implicated in the transport of lipids. In humans, members of the ABC protein families A, B, C, D and G are mutated in a number of lipid transport and metabolism disorders, such as Tangier disease, Stargardt syndrome, progressive familial intrahepatic cholestasis, pseudoxanthoma elasticum, adrenoleukodystrophy or sitosterolemia. Studies employing transfection, overexpression, reconstitution, deletion and inhibition indicate the transbilayer transport of endogenous lipids and their analogs by some of these proteins, modulating lipid transbilayer asymmetry. Other proteins appear to be involved in the exposure of specific lipids on the exoplasmic leaflet, allowing their uptake by acceptors and further transport to specific sites. Additionally, lipid transport by ABC proteins is currently being studied in non-human eukaryotes, e.g. in sea urchin, trypanosomatides, arabidopsis and yeast, as well as in prokaryotes such as Escherichia coli and Lactococcus lactis. Here, we review current information about the (putative) role of both pro- and eukaryotic ABC proteins in the various phenomena associated with lipid transport. Besides providing a better understanding of phenomena like lipid metabolism, circulation, multidrug resistance, hormonal processes, fertilization, vision and signalling, studies on pro- and eukaryotic ABC proteins might eventually enable us to put a name on some of the proteins mediating transbilayer lipid transport in various membranes of cells and organelles. It must be emphasized, however, that there are still many uncertainties concerning the functions and mechanisms of ABC proteins interacting with lipids. In particular, further purification and reconstitution experiments with an unambiguous role of ATP hydrolysis are needed to demonstrate a clear involvement of ABC proteins in lipid transbilayer asymmetry. PMID:15749056

  5. Viral and grazer regulation of prokaryotic growth efficiency in temperate freshwater pelagic environments.

    PubMed

    Pradeep Ram, A S; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Telesphore

    2015-02-01

    In aquatic systems, limited data exists on the impact of mortality forces such as viral lysis and flagellate grazing when seeking to explain factors regulating prokaryotic metabolism. We explored the relative influence of top-down factors (viral lysis and heterotrophic nanoflagellate grazing) on prokaryotic mortality and their subsequent impact on their community metabolism in the euphotic zone of 21 temperate freshwater lakes located in the French Massif Central. Prokaryotic growth efficiency (PGE, index of prokaryotic community metabolism) determined from prokaryotic production and respiration measurements varied from 5 to 74% across the lakes. Viral and potential grazer-induced mortality of prokaryotes had contrasting impact on PGE. Potential flagellate grazing was found to enhance PGE whereas viral lysis had antagonistic impacts on PGE. The average PGE value in the grazing and viral lysis dominated lake water samples was 35.4% (±15.2%) and 17.2% (±8.1%), respectively. Selective viral lysis or flagellate grazing on prokaryotes together with the nature of contrasted substrates released through mortality processes can perhaps explain for the observed variation and differences in PGE among the studied lakes. The influences of such specific top-down processes on PGE can have strong implications on the carbon and nutrient fluxes in freshwater pelagic environments. PMID:25764557

  6. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  7. Effects of starvation for potassium and other inorganic ions on protein degradation and ribonucleic acid synthesis in Escherichia coli.

    PubMed

    St John, A C; Goldberg, A L

    1980-09-01

    Starvation of Escherichia coli for potassium, phosphate, or magnesium ions leads to a reversible increase in the rate of protein degradation and an inhibition of ribonucleic acid (RNA) synthesis. In cells deprived of potassium, the breakdown of the more stable cell proteins increased two- to threefold, whereas the hydrolysis of short-lived proteins, both normal ones and analog-containing polypeptides, did not change. The mechanisms initiating the enhancement of proteolysis during starvation for these ions were examined. Upon starvation for amino acids or amino acyl-transfer RNA (tRNA), protein breakdown increases in relA+ (but not relA) cells as a result of the rapid synthesis of guanosine-5'-diphosphate-3'-diphosphate (ppGpp). However, a lack of amino acyl-tRNA does not appear to be responsible for the increased protein breakdown in cells starved for inorganic ions, since protein breakdown increased in the absence of these ions in both relA+ and relA cultures, and since a large excess of amino acids did not affect this response. In bacteria in which energy production is restricted, ppGpp levels also rise, and protein breakdown increases. The ion-deprived cultures did show a 40 to 75% reduction in adenosine-5'-triphosphate levels,l similar to that seen upon glucose starvation. However, this decrease in ATP content does not appear to cause the increase in protein breakdown or lead to an accumulation of ppGpp. No consistent change in intracellular ppGpp levels was found in relA+ or relA cells starved for these ions. In addition, in relX mutants, removal of these ions led to accelerated protein degradation even though relX cells are unable to increase ppGpp levels or proteolysis when deprived of a carbon source. In the potassium-, phosphate-, and magnesium-deprived cultures, the addition of choramphenicol or tetracycline caused a reduction in protein breakdown toward basal levels. Such findings, however, do not indicate that protein synthesis is essential for the

  8. Prophage Finder: a prophage loci prediction tool for prokaryotic genome sequences.

    PubMed

    Bose, M; Barber, Robert D

    2006-01-01

    Prophage loci often remain under-annotated or even unrecognized in prokaryotic genome sequencing projects. A PHP application, Prophage Finder, has been developed and implemented to predict prophage loci, based upon clusters of phage-related gene products encoded within DNA sequences. This application provides results detailing several facets of these clusters to facilitate rapid prediction and analysis of prophage sequences. Prophage Finder was tested using previously annotated prokaryotic genomic sequences with manually curated prophage loci as benchmarks. Additional analyses from Prophage Finder searches of several draft prokaryotic genome sequences are available through the Web site (http://bioinformatics.uwp.edu/~phage/DOEResults.php) to illustrate the potential of this application. PMID:16922685

  9. Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans

    PubMed Central

    Chowdhury, Rasheduzzaman; Krojer, Tobias; Ho, Chia-hua; Ng, Stanley S.; Clifton, Ian J.; Ge, Wei; Kershaw, Nadia J.; Fox, Gavin C.; Muniz, Joao R. C.; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S.; Kavanagh, Kathryn L.; von Delft, Frank; Oppermann, Udo; McDonough, Michael A.; Doherty, Aiden J.; Schofield, Christopher J.

    2014-01-01

    2-Oxoglutarate (2OG)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of N-methylated chromatin components1,2, hydroxylation of transcription factors3, and of splicing factor proteins4. Recently, 2OG-oxygenases that catalyze hydroxylation of tRNA5-7 and ribosomal proteins8, have been shown to play roles in translation relating to cellular growth, TH17-cell differentiation and translational accuracy9-12. The finding that the ribosomal oxygenases (ROX) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships. In Escherichia coli, ycfD catalyzes arginine-hydroxylation in the ribosomal protein L16; in humans, Mina53 (MYC-induced nuclear antigen) and NO66 (Nucleolar protein 66) catalyze histidine-hydroxylation in ribosomal proteins rpL27a and rpL8, respectively. The functional assignments of the ROX open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in residue- and protein-selectivities of prokaryotic and eukaryotic ROX, crystal structures of ycfD and ycfDRM from E. coli and Rhodothermus marinus with those of human Mina53 and NO66 (hROX) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-oxygenases. ROX structures in complex with/without their substrates, support their functional assignments as hydroxylases, but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-hydroxylases including the hypoxia-inducible factor asparaginyl-hydroxylase (FIH) and histone Nε-methyl lysine demethylases (KDMs) identifies branchpoints in 2OG-oxygenase evolution and distinguishes between JmjC-hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery. The

  10. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  11. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water.

    PubMed

    Frank, Alexander H; Garcia, Juan A L; Herndl, Gerhard J; Reinthaler, Thomas

    2016-06-01

    To decipher the influence of depth stratification and surface provincialism on the dark ocean prokaryotic community composition, we sampled the major deep-water masses in the eastern North Atlantic covering three biogeographic provinces. Their diversity was evaluated using ordination and canonical analysis of 454 pyrotag sequences. Variance partitioning suggested that 16% of the variation in the bacterial community composition was based on depth stratification while 9% of the variation was due to geographic location. General linear mixed effect models showed that the community of the subsurface waters was connected to the dark ocean prokaryotic communities in different biogeographic provinces. Cluster analysis indicated that some prokaryotic taxa are specific to distinct regions in bathypelagic water masses. Taken together, our data suggest that the dark ocean prokaryotic community composition of the eastern North Atlantic is primed by the formation and the horizontal transport of water masses. PMID:26914787

  12. ASSOCIATION OF PROKARYOTES WITH SYMPTOMATIC APPEARANCE OF WITHERING SYNDROME IN BLACK ABALONE HALIOTIS CRACHERODII

    EPA Science Inventory

    Withering syndrome (WS) is an epizootic fatal wasting disease that is devastating California Channel Island populations of black abalone Haliotis cracherodii. ur studies suggest a strong pathogen-disease association. he pathogen is an intracellular prokaryote that infects epithel...

  13. PHYLOGENETIC ANALYSIS OF PROKARYOTIC AND EUKAROYOTIC MICROOORGANISMS IN A DRINKING WATER PIPE LOOP SYSTEM

    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  14. PHYLOGENETIC ANALYSIS OF PROKARYOTIC AND EUKARYOTIC MICROORGANISMS IN A DRINKING WATER PIPE LOOP SYSTEM

    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  15. Identification and Detection of Prokaryotic Symbionts in the Ciliate Metopus from Anaerobic Granular Sludge

    PubMed Central

    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo

    2015-01-01

    The aim of the present study was to investigate the prokaryotic community structure of the anaerobic ciliate, Metopus sp. using rRNA sequencing, fluorescence in situ hybridization (FISH), and transmission electron microscopy (TEM). Metopus sp. was physically separated from anaerobic granular sludge in a domestic wastewater treatment plant and anoxically cultivated for 7 d. 16S rRNA gene sequences from the prokaryotes Methanoregula boonei and Clostridium aminobutyricum were abundantly detected in Metopus ciliates. The FISH analysis using the oligonucleotide probes Mg1200b and Cla568 demonstrated that these prokaryotes were localized within Metopus cells. These results identify M. boonei- and C. aminobutyricum-like prokaryotes as novel endosymbionts of Metopus ciliates. PMID:26639580

  16. From photon to signal in phytochromes: similarities and differences between prokaryotic and plant phytochromes.

    PubMed

    Nagano, Soshichiro

    2016-03-01

    Phytochromes represent a diverse family of red/far-red-light absorbing chromoproteins which are widespread across plants, cyanobacteria, non-photosynthetic bacteria, and more. Phytochromes play key roles in regulating physiological activities in response to light, a critical element in the acclimatization to the environment. The discovery of prokaryotic phytochromes facilitated structural studies which deepened our understanding on the general mechanisms of phytochrome action. An extrapolation of this information to plant phytochromes is justified for universally conserved functional aspects, but it is also true that there are many aspects which are unique to plant phytochromes. Here I summarize some structural studies carried out to date on both prokaryotic and plant phytochromes. I also attempt to identify aspects which are common or unique to plant and prokaryotic phytochromes. Phytochrome themselves, as well as the downstream signaling pathway in plants are more complex than in their prokaryotic counterparts. Thus many structural and functional aspects of plant phytochrome remain unresolved. PMID:26818948

  17. Modest proposals to expand the type material for naming of prokaryotes.

    PubMed

    Whitman, William B

    2016-05-01

    Gene sequences are herein proposed to be suitable type material for the description of prokaryotic species. This proposal follows from the principles described in the International Code of Nomenclature of Prokaryotes. This simple change in the Code will allow for the stability of naming of Candidatus taxa, endosymbionts and uncultivated prokaryotes and will meet an important need within microbiology. In addition, modern molecular techniques allow the identification of genera even when the species remain obscure. The Code should be modified to allow gene sequences to serve as the type material for genera in the absence of described species. This simple change will unite the nomenclature of the cultured and uncultured prokaryotes into a single, robust system. PMID:26902077

  18. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water

    PubMed Central

    Frank, Alexander H.; Garcia, Juan A. L.; Herndl, Gerhard J.

    2016-01-01

    Summary To decipher the influence of depth stratification and surface provincialism on the dark ocean prokaryotic community composition, we sampled the major deep‐water masses in the eastern North Atlantic covering three biogeographic provinces. Their diversity was evaluated using ordination and canonical analysis of 454 pyrotag sequences. Variance partitioning suggested that 16% of the variation in the bacterial community composition was based on depth stratification while 9% of the variation was due to geographic location. General linear mixed effect models showed that the community of the subsurface waters was connected to the dark ocean prokaryotic communities in different biogeographic provinces. Cluster analysis indicated that some prokaryotic taxa are specific to distinct regions in bathypelagic water masses. Taken together, our data suggest that the dark ocean prokaryotic community composition of the eastern North Atlantic is primed by the formation and the horizontal transport of water masses. PMID:26914787

  19. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  20. Can ends justify the means? Digging deep for human fusion genes of prokaryotic origin.

    PubMed

    Yiting, Yu; Chaturvedi, Iti; Meow, Liew Kim; Kangueane, Pandjassarame; Sakharkar, Meena Kishore

    2004-09-01

    Gene fusion has been described as an important evolutionary phenomenon. This report focuses on identifying, analyzing, and tabulating human fusion proteins of prokaryotic origin. These fusion proteins are found to mimic operons, simulate protein-protein interfaces in prokaryotes, exhibiting multiple functions and alternative splicing in humans. The accredited biological functions for each of these proteins is made available as a database at http://sege.ntu.edu.sg/wester/fusion/ PMID:15353329

  1. Microscopic Identification of Prokaryotes in Modern and Ancient Halite, Saline Valley and Death Valley, California

    NASA Astrophysics Data System (ADS)

    Schubert, Brian A.; Lowenstein, Tim K.; Timofeeff, Michael N.

    2009-06-01

    Primary fluid inclusions in halite crystallized in Saline Valley, California, in 1980, 2004-2005, and 2007, contain rod- and coccoid-shaped microparticles the same size and morphology as archaea and bacteria living in modern brines. Primary fluid inclusions from a well-dated (0-100,000 years), 90 m long salt core from Badwater Basin, Death Valley, California, also contain microparticles, here interpreted as halophilic and halotolerant prokaryotes. Prokaryotes are distinguished from crystals on the basis of morphology, optical properties (birefringence), and uniformity of size. Electron micrographs of microparticles from filtered modern brine (Saline Valley), dissolved modern halite crystals (Saline Valley), and dissolved ancient halite crystals (Death Valley) support in situ microscopic observations that prokaryotes are present in fluid inclusions in ancient halite. In the Death Valley salt core, prokaryotes in fluid inclusions occur almost exclusively in halite precipitated in perennial saline lakes 10,000 to 35,000 years ago. This suggests that trapping and preservation of prokaryotes in fluid inclusions is influenced by the surface environment in which the halite originally precipitated. In all cases, prokaryotes in fluid inclusions in halite from the Death Valley salt core are miniaturized (<1 μm diameter cocci, <2.5 μm long, very rare rod shapes), which supports interpretations that the prokaryotes are indigenous to the halite and starvation survival may be the normal response of some prokaryotes to entrapment in fluid inclusions for millennia. These results reinforce the view that fluid inclusions in halite and possibly other evaporites are important repositories of microbial life and should be carefully examined in the search for ancient microorganisms on Earth, Mars, and elsewhere in the Solar System.

  2. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    PubMed

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes. PMID:25261947

  3. The prokaryotic pathway of lipid synthesis in oat leaf plastids

    SciTech Connect

    Gillanders, B.; Mackender, R. )

    1990-05-01

    Evidence for the operation of the prokaryotic pathway of acyl lipid synthesis is an 18:3 plant was sought by incubating plastids from 6 sequential segments from oat seedling leaves as described previously except that {sup 14}C-G3P was used. Proplastids were the most biosynthetically active plastids (x2-3) and DAG and PA were the most heavily labelled acyl lipids (>75% of label). Analysis of MGDG and DGDG molecular species (MS) following pre-incubation with {sup 14}C-G3P (40 mins) and subsequently with UDP{sup 3}H-gal (30 mins), showed that only MS 16:0/18:0 and MS 16:0/18:1 were significantly labelled with {sup 14}C whereas all 5 MS were labelled with {sup 3}H-gal. However most of the {sup 3}H label was in the same MS as the {sup 14}C except when 18:2/18:2 DAG or PC was added with the {sup 3}H-gal, in which case considerably additional {sup 3}H-gal (up to 100%) appeared in the 18:2/18:2 MS of both these lipids.

  4. ICDS database: interrupted CoDing sequences in prokaryotic genomes.

    PubMed

    Perrodou, Emmanuel; Deshayes, Caroline; Muller, Jean; Schaeffer, Christine; Van Dorsselaer, Alain; Ripp, Raymond; Poch, Olivier; Reyrat, Jean-Marc; Lecompte, Odile

    2006-01-01

    Unrecognized frameshifts, in-frame stop codons and sequencing errors lead to Interrupted CoDing Sequence (ICDS) that can seriously affect all subsequent steps of functional characterization, from in silico analysis to high-throughput proteomic projects. Here, we describe the Interrupted CoDing Sequence database containing ICDS detected by a similarity-based approach in 80 complete prokaryotic genomes. ICDS can be retrieved by species browsing or similarity searches via a web interface (http://www-bio3d-igbmc.u-strasbg.fr/ICDS/). The definition of each interrupted gene is provided as well as the ICDS genomic localization with the surrounding sequence. Furthermore, to facilitate the experimental characterization of ICDS, we propose optimized primers for re-sequencing purposes. The database will be regularly updated with additional data from ongoing sequenced genomes. Our strategy has been validated by three independent tests: (i) ICDS prediction on a benchmark of artificially created frameshifts, (ii) comparison of predicted ICDS and results obtained from the comparison of the two genomic sequences of Bacillus licheniformis strain ATCC 14580 and (iii) re-sequencing of 25 predicted ICDS of the recently sequenced genome of Mycobacterium smegmatis. This allows us to estimate the specificity and sensitivity (95 and 82%, respectively) of our program and the efficiency of primer determination. PMID:16381882

  5. Metabolic Design and Control for Production in Prokaryotes

    SciTech Connect

    Chhabra, Swapnil R.; Keasling, J.D.

    2010-11-10

    Prokaryotic life on earth is manifested by its diversity and omnipresence. These microbes serve as natural sources of a large variety of compounds with the potential to serve the ever growing, medicinal, chemical and transportation needs of the human population. However, commercially viable production of these compounds can be realized only through significant improvement of the native production capacity of natural isolates. The most favorable way to achieve this goal is through the genetic manipulation of metabolic pathways that direct the production of these molecules. While random mutagenesis and screening have dominated the industrial production of such compounds in the past our increased understanding of microbial physiology over the last five decades has shifted this trend towards rational approaches for metabolic design. Major drivers of this trend include recombinant DNA technology, high throughput characterization of macromolecular cellular components, quantitative modeling for metabolic engine ring, targeted combinatorial engineering and synthetic biology. In this chapter we track the evolution of microbial engineering technologies from the black box era of random mutagenesis to the science and engineering-driven era of metabolic design.

  6. Single-molecule observation of prokaryotic DNA replication.

    PubMed

    Geertsema, Hylkje J; Duderstadt, Karl E; van Oijen, Antoine M

    2015-01-01

    Replication of DNA requires the coordinated activity of a number of proteins within a multiprotein complex, the replisome. Recent advances in single-molecule techniques have enabled the observation of dynamic behavior of individual replisome components and of the replisome as a whole, aspects that previously often have been obscured by ensemble averaging in more classical solution-phase biochemical experiments. To improve robustness and reproducibility of single-molecule assays of replication and allow objective analysis and comparison of results obtained from such assays, common practices should be established. Here, we describe the technical details of two assays to study replisome activity. In one, the kinetics of replication are observed as length changes in DNA molecules mechanically stretched by a laminar flow applied to attached beads. In the other, fluorescence imaging is used to determine both the kinetics and stoichiometry of individual replisome components. These in vitro single-molecule methods allow for elucidation of the dynamic behavior of individual replication proteins of prokaryotic replication systems. PMID:25916715

  7. Diversity of aquatic prokaryotic communities in the Cuatro Cienegas basin.

    PubMed

    Escalante, Ana E; Eguiarte, Luis E; Espinosa-Asuar, Laura; Forney, Larry J; Noguez, Ana M; Souza Saldivar, Valeria

    2008-07-01

    The Cuatro Cienegas basin (Coahuila, México) is a composite of different water systems in the middle of the desert with unusually high levels of endemism and diversity in different taxa. Although the diversity of macrobiota has been well described, little is known about the diversity and distribution of microorganisms in the oligotrophic ponds. Here we describe the extent and distribution of diversity found in aquatic prokaryotic communities by analysis of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes and phylogenetic analysis of cloned genes. Twelve locations within the basin were sampled. Among all the samples, we found a total of 117 operational taxonomic units (OTUs) using T-RFLPs, which ranged in any single sample from four to 49. OTU richness and Shannon diversity indices for different sites varied, but none were particularly high. 16S rRNA gene sequence data showed 68 different phylotypes among 198 clones. The most abundant phylotypes were Gamma- and Betaproteobacteria, and extreme halophiles. The differences among sites were significant; 45 TRFs were found only once, and 37% of the total diversity was represented by differences between sites, suggesting high beta-diversity. Further studies are needed to test whether this is a direct consequence of environmental heterogeneity in the basin. PMID:18479448

  8. Comparative analysis of essential genes in prokaryotic genomic islands

    PubMed Central

    Zhang, Xi; Peng, Chong; Zhang, Ge; Gao, Feng

    2015-01-01

    Essential genes are thought to encode proteins that carry out the basic functions to sustain a cellular life, and genomic islands (GIs) usually contain clusters of horizontally transferred genes. It has been assumed that essential genes are not likely to be located in GIs, but systematical analysis of essential genes in GIs has not been explored before. Here, we have analyzed the essential genes in 28 prokaryotes by statistical method and reached a conclusion that essential genes in GIs are significantly fewer than those outside GIs. The function of 362 essential genes found in GIs has been explored further by BLAST against the Virulence Factor Database (VFDB) and the phage/prophage sequence database of PHAge Search Tool (PHAST). Consequently, 64 and 60 eligible essential genes are found to share the sequence similarity with the virulence factors and phage/prophages-related genes, respectively. Meanwhile, we find several toxin-related proteins and repressors encoded by these essential genes in GIs. The comparative analysis of essential genes in genomic islands will not only shed new light on the development of the prediction algorithm of essential genes, but also give a clue to detect the functionality of essential genes in genomic islands. PMID:26223387

  9. Integrating prokaryotes and eukaryotes: DNA transposases in light of structure.

    PubMed

    Hickman, Alison Burgess; Chandler, Michael; Dyda, Fred

    2010-02-01

    DNA rearrangements are important in genome function and evolution. Genetic material can be rearranged inadvertently during processes such as DNA repair, or can be moved in a controlled manner by enzymes specifically dedicated to the task. DNA transposases comprise one class of such enzymes. These move DNA segments known as transposons to new locations, without the need for sequence homology between transposon and target site. Several biochemically distinct pathways have evolved for DNA transposition, and genetic and biochemical studies have provided valuable insights into many of these. However, structural information on transposases - particularly with DNA substrates - has proven elusive in most cases. On the other hand, large-scale genome sequencing projects have led to an explosion in the number of annotated prokaryotic and eukaryotic mobile elements. Here, we briefly review biochemical and mechanistic aspects of DNA transposition, and propose that integrating sequence information with structural information using bioinformatics tools such as secondary structure prediction and protein threading can lead not only to an additional level of understanding but possibly also to testable hypotheses regarding transposition mechanisms. Detailed understanding of transposition pathways is a prerequisite for the long-term goal of exploiting DNA transposons as genetic tools and as a basis for genetic medical applications. PMID:20067338

  10. Evolution of animal Piwi-interacting RNAs and prokaryotic CRISPRs.

    PubMed

    Kumar, M Senthil; Chen, Kevin C

    2012-07-01

    Piwi-interacting RNAs (piRNAs) and CRISPR RNAs (crRNAs) are two recently discovered classes of small noncoding RNA that are found in animals and prokaryotes, respectively. Both of these novel RNA species function as components of adaptive immune systems that protect their hosts from foreign nucleic acids-piRNAs repress transposable elements in animal germlines, whereas crRNAs protect their bacterial hosts from phage and plasmids. The piRNA and CRISPR systems are nonhomologous but rather have independently evolved into logically similar defense mechanisms based on the specificity of targeting via nucleic acid base complementarity. Here we review what is known about the piRNA and CRISPR systems with a focus on comparing their evolutionary properties. In particular, we highlight the importance of several factors on the pattern of piRNA and CRISPR evolution, including the population genetic environment, the role of alternate defense systems and the mechanisms of acquisition of new piRNAs and CRISPRs. PMID:22539610

  11. Tracing the path of a prokaryotic paracrine signal.

    PubMed

    Mullineaux, Conrad W; Nürnberg, Dennis J

    2014-12-01

    Filamentous heterocyst-forming cyanobacteria are a beautiful example of prokaryotic multicellularity. The filaments can achieve simultaneous nitrogen fixation and oxygenic photosynthesis by cooperation between two cell types: the photosynthetic vegetative cells and the nitrogen-fixing heterocysts. The multicellular features exhibited by the system include differentiation of different cell types, metabolic interdependence and even pattern formation, as the spacing of heterocysts along the filament is non-random. Recent years have seen exciting progress both in understanding the control of heterocyst differentiation, and also in understanding the function of 'septal junctions': an array of pore-like structures at the cell junctions that allow intercellular communication by facilitating the diffusion of small molecules from cell to cell. A new report by Rivers et al. (2014) makes the connection between pattern formation and intercellular communication by showing that a mutation that partially disables the septal junctions leads to a decrease in the range of a signal dependent on the HetN protein that is one of the factors controlling heterocyst spacing. This suggests that the signal travels from cell to cell by diffusion through the septal junctions, opening the door to quantitative understanding of the mechanism that controls heterocyst spacing in filamentous cyanobacteria. PMID:25362990

  12. Prokaryotic diversity in a Tunisian hypersaline lake, Chott El Jerid.

    PubMed

    Abdallah, Manel Ben; Karray, Fatma; Mhiri, Najla; Mei, Nan; Quéméneur, Marianne; Cayol, Jean-Luc; Erauso, Gaël; Tholozan, Jean-Luc; Alazard, Didier; Sayadi, Sami

    2016-03-01

    Prokaryotic diversity was investigated in a Tunisian salt lake, Chott El Jerid, by quantitative real-time PCR, denaturing gradient gel electrophoresis (DGGE) fingerprinting methods targeting the 16S rRNA gene and culture-dependent methods. Two different samples S1-10 and S2-10 were taken from under the salt crust of Chott El Jerid in the dry season. DGGE analysis revealed that bacterial sequences were related to Firmicutes, Proteobacteria, unclassified bacteria, and Deinococcus-Thermus phyla. Anaerobic fermentative and sulfate-reducing bacteria were also detected in this ecosystem. Within the domain archaea, all sequences were affiliated to Euryarchaeota phylum. Quantitative real-time PCR showed that 16S rRNA gene copy numbers of bacteria was 5 × 10(6) DNA copies g(-1) whereas archaea varied between 5 × 10(5) and 10(6) DNA copies g(-1) in these samples. Eight anaerobic halophilic fermentative bacterial strains were isolated and affiliated with the species Halanaerobium alcaliphilum, Halanaerobium saccharolyticum, and Sporohalobacter salinus. These data showed an abundant and diverse microbial community detected in the hypersaline thalassohaline environment of Chott El Jerid. PMID:26724953

  13. Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates

    PubMed Central

    Stanton, Brynne C.; Nielsen, Alec A.K.; Tamsir, Alvin; Clancy, Kevin; Peterson, Todd; Voigt, Christopher A.

    2014-01-01

    Genetic circuits perform computational operations based on interactions between freely diffusing molecules within a cell. When transcription factors are combined to build a circuit, unintended interactions can disrupt its function. Here, we apply “part mining” to build a library of 73 TetR-family repressors gleaned from prokaryotic genomes. The operators of a subset were determined using an in vitro method and this information was used to build synthetic promoters. The promoters and repressors were screened for cross-reactions. Of these, 16 were identified that both strongly repress their cognate promoter (5- to 207-fold) and do not interact with other promoters. Each repressor:promoter pair was converted to a NOT gate and characterized. Used as a set of 16 NOR gates, there are >1054 circuits that could be built by changing the pattern of input and output promoters. This represents a large set of compatible gates that can be used to construct user-defined circuits. PMID:24316737

  14. Engineering input/output nodes in prokaryotic regulatory circuits.

    PubMed

    de Las Heras, Aitor; Carreño, Carlos A; Martínez-García, Esteban; de Lorenzo, Víctor

    2010-09-01

    A large number of prokaryotic regulatory elements have been interfaced artificially with biological circuits that execute specific expression programs. Engineering such circuits involves the association of input/output components that perform discrete signal-transfer steps in an autonomous fashion while connected to the rest of the network with a defined topology. Each of these nodes includes a signal-recognition component for the detection of the relevant physicochemical or biological stimulus, a molecular device able to translate the signal-sensing event into a defined output and a genetic module capable of understanding such an output as an input for the next component of the circuit. The final outcome of the process can be recorded by means of a reporter product. This review addresses three such aspects of forward engineering of signal-responding genetic parts. We first recap natural and non-natural regulatory assets for designing gene expression in response to predetermined signals - chemical or otherwise. These include transcriptional regulators developed by in vitro evolution (or designed from scratch), and synthetic riboswitches derived from in vitro selection of aptamers. Then we examine recent progress on reporter genes, whose expression allows the quantification and parametrization of signal-responding circuits in their entirety. Finally, we critically examine recent work on other reporters that confer bacteria with gross organoleptic properties (e.g. distinct odour) and the interfacing of signal-sensing devices with determinants of community behaviour. PMID:20618867

  15. Current Developments in Prokaryotic Single Cell Whole Genome Amplification

    SciTech Connect

    Goudeau, Danielle; Nath, Nandita; Ciobanu, Doina; Cheng, Jan-Fang; Malmstrom, Rex

    2014-03-14

    Our approach to prokaryotic single-cell Whole Genome Amplification at the JGI continues to evolve. To increase both the quality and number of single-cell genomes produced, we explore all aspects of the process from cell sorting to sequencing. For example, we now utilize specialized reagents, acoustic liquid handling, and reduced reaction volumes eliminate non-target DNA contamination in WGA reactions. More specifically, we use a cleaner commercial WGA kit from Qiagen that employs a UV decontamination procedure initially developed at the JGI, and we use the Labcyte Echo for tip-less liquid transfer to set up 2uL reactions. Acoustic liquid handling also dramatically reduces reagent costs. In addition, we are exploring new cell lysis methods including treatment with Proteinase K, lysozyme, and other detergents, in order to complement standard alkaline lysis and allow for more efficient disruption of a wider range of cells. Incomplete lysis represents a major hurdle for WGA on some environmental samples, especially rhizosphere, peatland, and other soils. Finding effective lysis strategies that are also compatible with WGA is challenging, and we are currently assessing the impact of various strategies on genome recovery.

  16. Novel species and expanded distribution of ellipsoidal multicellular magnetotactic prokaryotes.

    PubMed

    Chen, Yi-ran; Zhang, Wen-yan; Zhou, Ke; Pan, Hong-miao; Du, Hai-jian; Xu, Cong; Xu, Jian-hong; Pradel, Nathalie; Santini, Claire-Lise; Li, Jin-hua; Huang, Hui; Pan, Yong-xin; Xiao, Tian; Wu, Long-fei

    2016-04-01

    Multicellular magnetotactic prokaryotes (MMPs) are a peculiar group of magnetotactic bacteria, each comprising approximately 10-100 cells of the same phylotype. Two morphotypes of MMP have been identified, including several species of globally distributed spherical mulberry-like MMPs (s-MMPs), and two species of ellipsoidal pineapple-like MMPs (e-MMPs) from China (Qingdao and Rongcheng cities). We recently collected e-MMPs from Mediterranean Sea sediments (Six-Fours-les-Plages) and Drummond Island, in the South China Sea. Phylogenetic analysis revealed that the MMPs from Six-Fours-les-Plages and the previously reported e-MMP Candidatus Magnetananas rongchenensis have 98.5% sequence identity and are the same species, while the MMPs from Drummond Island appear to be a novel species, having > 7.1% sequence divergence from the most closely related e-MMP, Candidatus Magnetananas tsingtaoensis. Identification of the novel species expands the distribution of e-MMPs to Tropical Zone. Comparison of nine physical and chemical parameters revealed that sand grain size and the content of inorganic nitrogen (nitrate, ammonium and nitrite) in the sediments from Rongcheng City and Six-Fours-les-Plages were similar, and lower than found for sediments from the other two sampling sites. The results of the study reveal broad diversity and wide distribution of e-MMPs. PMID:26711721

  17. Shifting the genomic gold standard for the prokaryotic species definition

    PubMed Central

    Richter, Michael; Rosselló-Móra, Ramon

    2009-01-01

    DNA-DNA hybridization (DDH) has been used for nearly 50 years as the gold standard for prokaryotic species circumscriptions at the genomic level. It has been the only taxonomic method that offered a numerical and relatively stable species boundary, and its use has had a paramount influence on how the current classification has been constructed. However, now, in the era of genomics, DDH appears to be an outdated method for classification that needs to be substituted. The average nucleotide identity (ANI) between two genomes seems the most promising method since it mirrors DDH closely. Here we examine the work package JSpecies as a user-friendly, biologist-oriented interface to calculate ANI and the correlation of the tetranucleotide signatures between pairwise genomic comparisons. The results agreed with the use of ANI to substitute DDH, with a narrowed boundary that could be set at ≈95–96%. In addition, the JSpecies package implemented the tetranucleotide signature correlation index, an alignment-free parameter that generally correlates with ANI and that can be of help in deciding when a given pair of organisms should be classified in the same species. Moreover, for taxonomic purposes, the analyses can be produced by simply randomly sequencing at least 20% of the genome of the query strains rather than obtaining their full sequence. PMID:19855009

  18. Prokaryotic and eukaryotic RNA polymerases have homologous core subunits.

    PubMed Central

    Sweetser, D; Nonet, M; Young, R A

    1987-01-01

    Eukaryotic RNA polymerases are complex aggregates whose component subunits are functionally ill-defined. The gene that encodes the 140,000-dalton subunit of Saccharomyces cerevisiae RNA polymerase II was isolated and studied in detail to obtain clues to the protein's function. This gene, RPB2, exists in a single copy in the haploid genome. Disruption of the gene is lethal to the yeast cell. RPB2 encodes a protein of 138,750 daltons, which contains sequences implicated in binding purine nucleotides and zinc ions and exhibits striking sequence homology with the beta subunit of Escherichia coli RNA polymerase. These observations suggest that the yeast and the E. coli subunit have similar roles in RNA synthesis, as the beta subunit contains binding sites for nucleotide substrates and a portion of the catalytic site for RNA synthesis. The subunit homologies reported here, and those observed previously with the largest RNA polymerase subunit, indicate that components of the prokaryotic RNA polymerase "core" enzyme have counterparts in eukaryotic RNA polymerases. PMID:3547406

  19. Linking environmental prokaryotic viruses and their host through CRISPRs.

    PubMed

    Sanguino, Laura; Franqueville, Laure; Vogel, Timothy M; Larose, Catherine

    2015-05-01

    The ecological pressure that viruses place on microbial communities is not only based on predation, but also on gene transfer. In order to determine the potential impact of viruses and transduction, we need a better understanding of the dynamics of interactions between viruses and their hosts in the environment. Data on environmental viruses are scarce, and methods for tracking their interactions with prokaryotes are needed. Clustered regularly interspaced short palindromic repeats (CRISPRs), which contain viral sequences in bacterial genomes, might help document the history of virus-host interactions in the environment. In this study, a bioinformatics network linking viruses and their hosts using CRISPR sequences obtained from metagenomic data was developed and applied to metagenomes from Arctic glacial ice and soil. The application of our network approach showed that putative interactions were more commonly detected in the ice samples than the soil which would be consistent with the ice viral-bacterial interactions being more dynamic than those in soil. Further analysis of the viral sequences in the CRISPRs indicated that Ralstonia phages might be agents of transduction in the Arctic glacial ice. PMID:25908869

  20. A cost-effective and universal strategy for complete prokaryotic genomic sequencing proposed by computer simulation

    PubMed Central

    2012-01-01

    Background Pyrosequencing techniques allow scientists to perform prokaryotic genome sequencing to achieve the draft genomic sequences within a few days. However, the assemblies with shotgun sequencing are usually composed of hundreds of contigs. A further multiplex PCR procedure is needed to fill all the gaps and link contigs into complete chromosomal sequence, which is the basis for prokaryotic comparative genomic studies. In this article, we study various pyrosequencing strategies by simulated assembling from 100 prokaryotic genomes. Findings Simulation study shows that a single end 454 Jr. run combined with a paired end 454 Jr. run (8 kb library) can produce: 1) ~90% of 100 assemblies with < 10 scaffolds and ~95% of 100 assemblies with < 150 contigs; 2) average contig N50 size is over 331 kb; 3) average single base accuracy is > 99.99%; 4) average false gene duplication rate is < 0.7%; 5) average false gene loss rate is < 0.4%. Conclusions A single end 454 Jr. run combined with a paired end 454 Jr. run (8 kb library) is a cost-effective way for prokaryotic whole genome sequencing. This strategy provides solution to produce high quality draft assemblies for most of prokaryotic organisms within days. Due to the small number of assembled scaffolds, the following multiplex PCR procedure (for gap filling) would be easy. As a result, large scale prokaryotic whole genome sequencing projects may be finished within weeks. PMID:22289569

  1. Prokaryotic Community Diversity Along an Increasing Salt Gradient in a Soda Ash Concentration Pond.

    PubMed

    Simachew, Addis; Lanzén, Anders; Gessesse, Amare; Øvreås, Lise

    2016-02-01

    The effect of salinity on prokaryotic community diversity in Abijata-Shalla Soda Ash Concentration Pond system was investigated by using high-throughput 16S rRNA gene 454 pyrosequencing. Surface water and brine samples from five sites spanning a salinity range of 3.4 % (Lake Abijata) to 32 % (SP230F, crystallizer pond) were analyzed. Overall, 33 prokaryotic phyla were detected, and the dominant prokaryotic phyla accounted for more than 95 % of the reads consisting of Planctomycetes, Bacteroidetes, candidate division TM7, Deinococcus-Thermus, Firmicutes, Actinobacteria, Proteobacteria, and Euryarchaeota. Diversity indices indicated that operational taxonomic unit (OTU) richness decreases drastically with increasing salinity in the pond system. A total of 471 OTUs were found at 3.4 % salinity whereas 49 OTUs were detected in pond SP211 (25 % salinity), and only 19 OTUs in the crystallization pond at 32 % salinity (SP230F). Along the salinity gradient, archaeal community gradually replaced bacterial community. Thus, archaeal community accounted for 0.4 % in Lake Abijata while 99.0 % in pond SP230F. This study demonstrates that salinity appears to be the key environmental parameter in structuring the prokaryotic communities of haloalkaline environments. Further, it confirmed that the prokaryotic diversity in Lake Abijata is high and it harbors taxa with low or no phylogenetic similarities to existing prokaryotic taxa and thus represents novel microorganisms. PMID:26408190

  2. Vertical distribution of the prokaryotic cell size in the Mediterranean Sea

    NASA Astrophysics Data System (ADS)

    La Ferla, R.; Maimone, G.; Azzaro, M.; Conversano, F.; Brunet, C.; Cabral, A. S.; Paranhos, R.

    2012-12-01

    Distributions of prokaryotic cell size and morphology were studied in different areas of the Mediterranean Sea by using image analysis on samples collected from surface down to bathypelagic layers (max depth 4,900 m) in the Southern Tyrrhenian, Southern Adriatic and Eastern Mediterranean Seas. Distribution of cell size of prokaryotes in marine ecosystem is very often not considered, which makes our study first in the context of prokaryotic ecology. In the deep Mediterranean layers, an usually-not-considered form of carbon sequestration through prokaryotic cells has been highlighted, which is consistent with an increase in cell size with the depth of the water column. A wide range in prokaryotic cell volumes was observed (between 0.045 and 0.566 μm3). Increase in cell size with depth was opposed to cell abundance distribution. Our results from microscopic observations were confirmed by the increasing HNA/LNA ratio (HNA, cells with high nucleic acid content; LNA, cells with low nucleic acid content) along the water column. Implications of our results on the increasing cell size with depth are in the fact that the quantitative estimation of prokaryotic biomass changes along the water column and the amount of carbon sequestered in the deep biota is enhanced.

  3. Prokaryote diversity and viral production in deep-sea sediments and seamounts

    NASA Astrophysics Data System (ADS)

    Danovaro, Roberto; Corinaldesi, Cinzia; Luna, Gian Marco; Magagnini, Mirko; Manini, Elena; Pusceddu, Antonio

    2009-05-01

    Despite the fact that marine prokaryotes and viruses have been increasingly investigated over the last decade, knowledge on prokaryote diversity and viral production in bathyal sediments is limited. We investigated microbial variables in the deep-sea sediments around two seamounts at 3000-m depth in the Tyrrhenian Sea and sediments located at the same depth, but not affected by the presence of the seamounts. We hypothesized that seamounts altered significantly prokaryotes-viruses interactions in surrounding deep-sea sediments. Sediments surrounding seamounts were characterised by prokaryotic abundances significantly higher than those observed in non-seamount sediments. Benthic viral production was about double in sediments close to seamounts than in non-seamount sediments, where virus turnover was up to 3 times lower. Total Bacteria, as assessed by CARD-FISH, dominated prokaryotic community structure, whereas Archaea accounted on average for approximately 10%. The fraction of Crenarchaeota was always higher than Euryarchaeota. Bacterial diversity, estimated using ARISA, was high, with up to 127 different microbial operational taxonomic units (OTUs) in a single sample. Archaeal richness (determined using T-RFLP of the 16S rRNA gene) ranged from 12 to 20 OTUs, while Archaeal evenness was comprised between 0.529±0.018 and 0.623±0.08. Results represent a pointer for future investigations dealing with the interactions between viruses and prokaryotes in deep-sea sediments.

  4. Chloramphenicol-induced changes in the synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r.

    PubMed

    Shen, V; Bremer, H

    1977-06-01

    The synthesis of ribosomal ribonucleic acid (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA) was measured in Escherichia coli B/r after the addition of 100 mug of chloramphenicol (CAM) per ml to cultures growing either in one of three minimal media (succinate, glycerol, or glucose) or in one of the same three media supplemented with 20 amino acids. (i) During CAM treatment, rRNA and tRNA were synthesized in the same relative proportions (85:15) as during exponential growth. The faster accumulation of tRNA relative to rRNA in CAM was due to a decreased stability of rRNA that is synthesized in the presence of or immediately before the addition of CAM. (ii) CAM stimulated the synthesis of rRNA and tRNA two- to eightfold. The results fell into two groups; one group was from studies done in minimal media and the other was from amino acid-supplemented media. In each group the stimulation decreased with increasing growth rate of the culture during exponential growth before the addition of CAM; however, the stimulation in minimal media was lower than that in amino acid-supplemented media. (iii) CAM caused an increase in the proportion of rRNA and tRNA synthesis and a corresponding decrease in the proportion of mRNA synthesis. In minimal media, the residual proportion of mRNA synthesis after CAM treatment was 10 to 15% of total RNA synthesis; in amino acid-supplemented media this proportion was 0 to 10%. In either case, the residual proportion of mRNA synthesis was independent of the proportions observed during exponential growth in these media. (iv) The absolute rate of mRNA synthesis decreased severalfold with the addition of CAM; i.e., the rate of synthesis of rRNA and tRNA was increased at the expense of mRNA synthesis. (v) During exponential growth, the fraction of the instantaneous rate of total RNA synthesis that corresponds to mRNA is a function of both the growth rate and the presence or absence of amino acids in the growth medium: in the absence of amino acids

  5. ATGC: a database of orthologous genes from closely related prokaryotic genomes and a research platform for microevolution of prokaryotes

    SciTech Connect

    Novichkov, Pavel S.; Ratnere, Igor; Wolf, Yuri I.; Koonin, Eugene V.; Dubchak, Inna

    2009-07-23

    The database of Alignable Tight Genomic Clusters (ATGCs) consists of closely related genomes of archaea and bacteria, and is a resource for research into prokaryotic microevolution. Construction of a data set with appropriate characteristics is a major hurdle for this type of studies. With the current rate of genome sequencing, it is difficult to follow the progress of the field and to determine which of the available genome sets meet the requirements of a given research project, in particular, with respect to the minimum and maximum levels of similarity between the included genomes. Additionally, extraction of specific content, such as genomic alignments or families of orthologs, from a selected set of genomes is a complicated and time-consuming process. The database addresses these problems by providing an intuitive and efficient web interface to browse precomputed ATGCs, select appropriate ones and access ATGC-derived data such as multiple alignments of orthologous proteins, matrices of pairwise intergenomic distances based on genome-wide analysis of synonymous and nonsynonymous substitution rates and others. The ATGC database will be regularly updated following new releases of the NCBI RefSeq. The database is hosted by the Genomics Division at Lawrence Berkeley National laboratory and is publicly available at http://atgc.lbl.gov.

  6. Phylogenomic analysis of the cystatin superfamily in eukaryotes and prokaryotes

    PubMed Central

    2009-01-01

    Background The cystatin superfamily comprises cysteine protease inhibitors that play key regulatory roles in protein degradation processes. Although they have been the subject of many studies, little is known about their genesis, evolution and functional diversification. Our aim has been to obtain a comprehensive insight into their origin, distribution, diversity, evolution and classification in Eukaryota, Bacteria and Archaea. Results We have identified in silico the full complement of the cystatin superfamily in more than 2100 prokaryotic and eukaryotic genomes. The analysis of numerous eukaryotic genomes has provided strong evidence for the emergence of this superfamily in the ancestor of eukaryotes. The progenitor of this superfamily was most probably intracellular and lacked a signal peptide and disulfide bridges, much like the extant Giardia cystatin. A primordial gene duplication produced two ancestral eukaryotic lineages, cystatins and stefins. While stefins remain encoded by a single or a small number of genes throughout the eukaryotes, the cystatins have undergone a more complex and dynamic evolution through numerous gene and domain duplications. In the cystatin superfamily we discovered twenty vertebrate-specific and three angiosperm-specific orthologous families, indicating that functional diversification has occurred only in multicellular eukaryotes. In vertebrate orthologous families, the prevailing trends were loss of the ancestral inhibitory activity and acquisition of novel functions in innate immunity. Bacterial cystatins and stefins may be emergency inhibitors that enable survival of bacteria in the host, defending them from the host's proteolytic activity. Conclusion This study challenges the current view on the classification, origin and evolution of the cystatin superfamily and provides valuable insights into their functional diversification. The findings of this comprehensive study provide guides for future structural and evolutionary studies

  7. Toward a standard in structural genome annotation for prokaryotes

    SciTech Connect

    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia

    2015-07-25

    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found that the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.

  8. Toward a standard in structural genome annotation for prokaryotes

    DOE PAGESBeta

    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia

    2015-07-25

    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found thatmore » the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.« less

  9. Systematic Transfer of Prokaryotic Sensors and Circuits to Mammalian Cells

    PubMed Central

    2015-01-01

    Prokaryotic regulatory proteins respond to diverse signals and represent a rich resource for building synthetic sensors and circuits. The TetR family contains >105 members that use a simple mechanism to respond to stimuli and bind distinct DNA operators. We present a platform that enables the transfer of these regulators to mammalian cells, which is demonstrated using human embryonic kidney (HEK293) and Chinese hamster ovary (CHO) cells. The repressors are modified to include nuclear localization signals (NLS) and responsive promoters are built by incorporating multiple operators. Activators are also constructed by modifying the protein to include a VP16 domain. Together, this approach yields 15 new regulators that demonstrate 19- to 551-fold induction and retain both the low levels of crosstalk in DNA binding specificity observed between the parent regulators in Escherichia coli, as well as their dynamic range of activity. By taking advantage of the DAPG small molecule sensing mediated by the PhlF repressor, we introduce a new inducible system with 50-fold induction and a threshold of 0.9 μM DAPG, which is comparable to the classic Dox-induced TetR system. A set of NOT gates is constructed from the new repressors and their response function quantified. Finally, the Dox- and DAPG- inducible systems and two new activators are used to build a synthetic enhancer (fuzzy AND gate), requiring the coordination of 5 transcription factors organized into two layers. This work introduces a generic approach for the development of mammalian genetic sensors and circuits to populate a toolbox that can be applied to diverse applications from biomanufacturing to living therapeutics. PMID:25360681

  10. Interaction of Low Temperature Plasmas with Prokaryotic and Eukaryotic Cells

    NASA Astrophysics Data System (ADS)

    Laroussi, Mounir

    2008-10-01

    Due to promising possibilities for their use in medical applications such as wound healing, surface modification of biocompatible materials, and the sterilization of reusable heat-sensitive medical instruments, low temperature plasmas and plasma jets are making big strides as a technology that can potentially be used in medicine^1-2. At this stage of research, fundamental questions about the effects of plasma on prokaryotic and eukaryotic cells are still not completely answered. An in-depth understanding of the pathway whereby cold plasma interact with biological cells is necessary before real applications can emerge. In this paper, first an overview of non-equilibrium plasma sources (both low and high pressures) will be presented. Secondly, the effects of plasma on bacterial cells will be discussed. Here, the roles of the various plasma agents in the inactivation process will be outlined. In particular, the effects of UV and that of various reactive species (O3, O, OH) are highlighted. Thirdly, preliminary findings on the effects of plasma on few types of eukaryotic cells will be presented. How plasma affects eukaryotic cells, such as mammalian cells, is very important in applications where the viability/preservation of the cells could be an issue (such as in wound treatment). Another interesting aspect is the triggering of apoptosis (programmed cell death). Some investigators have claimed that plasma is able to induce apoptosis in some types of cancer cells. If successfully replicated, this can open up a novel method of cancer treatment. In this talk however, I will briefly focus more on the wound healing potential of cold plasmas. ^1E. A. Blakely, K. A. Bjornstad, J. E. Galvin, O. R. Monteiro, and I. G. Brown, ``Selective Neuron Growth on Ion Implanted and Plasma Deposited Surfaces'', In Proc. IEEE Int. Conf. Plasma Sci., (2002), p. 253. ^2M. Laroussi, ``Non-thermal Decontamination of Biological Media by Atmospheric Pressure Plasmas: Review, Analysis, and

  11. Eukaryotic and prokaryotic contributions to colonic hydrogen sulfide synthesis.

    PubMed

    Flannigan, Kyle L; McCoy, Kathy D; Wallace, John L

    2011-07-01

    Hydrogen sulfide (H(2)S) is an important modulator of many aspects of digestive function, both in health and disease. Colonic tissue H(2)S synthesis increases markedly during injury and inflammation and appears to contribute to resolution. Some of the bacteria residing in the colon can also produce H(2)S. The extent to which bacterial H(2)S synthesis contributes to what is measured as colonic H(2)S synthesis is not clear. Using conventional and germ-free mice, we have delineated the eukaryotic vs. prokaryotic contributions to colonic H(2)S synthesis, both in healthy and colitic mice. Colonic tissue H(2)S production is entirely dependent on the presence of the cofactor pyridoxal 5'-phosphate (vitamin B(6)), while bacterial H(2)S synthesis appears to occur independent of this cofactor. As expected, approximately one-half of the H(2)S produced by feces is derived from eukaryotic cells. While colonic H(2)S synthesis is markedly increased when the tissue is inflamed, and, in proportion to the extent of inflammation, fecal H(2)S synthesis does not change and tissue granulocytes do not appear to be the source of the elevated H(2)S production. Rats fed a B vitamin-deficient diet for 6 wk exhibited significantly diminished colonic H(2)S synthesis, but fecal H(2)S synthesis was not different from that of rats on the control diet. Our results demonstrate that H(2)S production by colonic bacteria does not contribute significantly to what is measured as colonic tissue H(2)S production, using the acetate trapping assay system employed in this study. PMID:21474649

  12. Prochlorococcus, a Marine Photosynthetic Prokaryote of Global Significance

    PubMed Central

    Partensky, F.; Hess, W. R.; Vaulot, D.

    1999-01-01

    The minute photosynthetic prokaryote Prochlorococcus, which was discovered about 10 years ago, has proven exceptional from several standpoints. Its tiny size (0.5 to 0.7 μm in diameter) makes it the smallest known photosynthetic organism. Its ubiquity within the 40°S to 40°N latitudinal band of oceans and its occurrence at high density from the surface down to depths of 200 m make it presumably the most abundant photosynthetic organism on Earth. Prochlorococcus typically divides once a day in the subsurface layer of oligotrophic areas, where it dominates the photosynthetic biomass. It also possesses a remarkable pigment complement which includes divinyl derivatives of chlorophyll a (Chl a) and Chl b, the so-called Chl a2 and Chl b2, and, in some strains, small amounts of a new type of phycoerythrin. Phylogenetically, Prochlorococcus has also proven fascinating. Recent studies suggest that it evolved from an ancestral cyanobacterium by reducing its cell and genome sizes and by recruiting a protein originally synthesized under conditions of iron depletion to build a reduced antenna system as a replacement for large phycobilisomes. Environmental constraints clearly played a predominant role in Prochlorococcus evolution. Its tiny size is an advantage for its adaptation to nutrient-deprived environments. Furthermore, genetically distinct ecotypes, with different antenna systems and ecophysiological characteristics, are present at depth and in surface waters. This vertical species variation has allowed Prochlorococcus to adapt to the natural light gradient occurring in the upper layer of oceans. The present review critically assesses the basic knowledge acquired about Prochlorococcus both in the ocean and in the laboratory. PMID:10066832

  13. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  14. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  15. Metabolic profiles of prokaryotic and eukaryotic communities in deep-sea sponge Lamellomorpha sp. indicated by metagenomics

    NASA Astrophysics Data System (ADS)

    Li, Zhi-Yong; Wang, Yue-Zhu; He, Li-Ming; Zheng, Hua-Jun

    2014-01-01

    The whole metabolism of a sponge holobiont and the respective contributions of prokaryotic and eukaryotic symbionts and their associations with the sponge host remain largely unclear. Meanwhile, compared with shallow water sponges, deep-sea sponges are rarely understood. Here we report the metagenomic exploration of deep-sea sponge Lamellomorpha sp. at the whole community level. Metagenomic data showed phylogenetically diverse prokaryotes and eukaryotes in Lamellomorpha sp.. MEGAN and gene enrichment analyses indicated different metabolic potentials of prokaryotic symbionts from eukaryotic symbionts, especially in nitrogen and carbon metabolisms, and their molecular interactions with the sponge host. These results supported the hypothesis that prokaryotic and eukaryotic symbionts have different ecological roles and relationships with sponge host. Moreover, vigorous denitrification, and CO2 fixation by chemoautotrophic prokaryotes were suggested for this deep-sea sponge. The study provided novel insights into the respective potentials of prokaryotic and eukaryotic symbionts and their associations with deep-sea sponge Lamellomorpha sp..

  16. [Analysis of Prokaryotic Community Structure in River Waters of the Ningbo Sanjiang Mouth].

    PubMed

    Hu, An-yi; Li, Jiang-wei; Yang, Xiao-yong; Wang, Hong-jie; Yu, Chang-ping

    2015-07-01

    The prokaryotic community structure in river waters of the Ningbo Sanjiang Mouth was analyzed for the first time using 16S rRNA gene based-Illumina Miseq high-throughput sequencing. A total of 215 504 high-quality sequences were obtained, and the results of alpha-diversity analysis revealed that Yongjiang River Watershed (YRW) harbored high diversity and richness of prokaryotic communities. Taxonomic assignment analysis indicated that β-Proteobacterium, Actinobacteria and Bacteroidetes dominated in the river water of YRW, and accounted for 78. 88% of the total prokaryotic communities. Hydrological condition may play an important role in influencing the composition and structure of YRW prokaryotic community. In addition, several kinds of sewer- and fecal-pollution indicator bacterial groups were observed in this area with the highest abundance of pollution indicator bacteria occurring in the water sample of Yuyao River, implying that the Yuyao River might have a high potential risk of sewer- and fecal-pollution. Moreover, a total of 76 species and 18 subspecies of potential pathogenic bacteria, which accounted for 2. 19% and 0. 40% of total sequences respectively, were identified using BLASTN analysis with a local pathogenic bacteria database. Overall, this study provided an important basic data for shedding light on the structure and ecological function of YRW prokaryotic community. PMID:26489316

  17. Effects of Predation by Protists on Prokaryotic Community Function, Structure, and Diversity in Anaerobic Granular Sludge

    PubMed Central

    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo

    2016-01-01

    Predation by protists is top-down pressure that regulates prokaryotic abundance, community function, structure, and diversity in natural and artificial ecosystems. Although the effects of predation by protists have been studied in aerobic ecosystems, they are poorly understood in anoxic environments. We herein studied the influence of predation by Metopus and Caenomorpha ciliates—ciliates frequently found in anoxic ecosystems—on prokaryotic community function, structure, and diversity. Metopus and Caenomorpha ciliates were cocultivated with prokaryotic assemblages (i.e., anaerobic granular sludge) in an up-flow anaerobic sludge blanket (UASB) reactor for 171 d. Predation by these ciliates increased the methanogenic activities of granular sludge, which constituted 155% of those found in a UASB reactor without the ciliates (i.e., control reactor). Sequencing of 16S rRNA gene amplicons using Illumina MiSeq revealed that the prokaryotic community in the UASB reactor with the ciliates was more diverse than that in the control reactor; 2,885–3,190 and 2,387–2,426 operational taxonomic units (>97% sequence similarities), respectively. The effects of predation by protists in anaerobic engineered systems have mostly been overlooked, and our results show that the influence of predation by protists needs to be examined and considered in the future for a better understanding of prokaryotic community structure and function. PMID:27431197

  18. Examination of Prokaryotic Multipartite Genome Evolution through Experimental Genome Reduction

    PubMed Central

    diCenzo, George C.; MacLean, Allyson M.; Milunovic, Branislava; Golding, G. Brian; Finan, Turlough M.

    2014-01-01

    Many bacteria carry two or more chromosome-like replicons. This occurs in pathogens such as Vibrio cholerea and Brucella abortis as well as in many N2-fixing plant symbionts including all isolates of the alfalfa root-nodule bacteria Sinorhizobium meliloti. Understanding the evolution and role of this multipartite genome organization will provide significant insight into these important organisms; yet this knowledge remains incomplete, in part, because technical challenges of large-scale genome manipulations have limited experimental analyses. The distinct evolutionary histories and characteristics of the three replicons that constitute the S. meliloti genome (the chromosome (3.65 Mb), pSymA megaplasmid (1.35 Mb), and pSymB chromid (1.68 Mb)) makes this a good model to examine this topic. We transferred essential genes from pSymB into the chromosome, and constructed strains that lack pSymB as well as both pSymA and pSymB. This is the largest reduction (45.4%, 3.04 megabases, 2866 genes) of a prokaryotic genome to date and the first removal of an essential chromid. Strikingly, strains lacking pSymA and pSymB (ΔpSymAB) lost the ability to utilize 55 of 74 carbon sources and various sources of nitrogen, phosphorous and sulfur, yet the ΔpSymAB strain grew well in minimal salts media and in sterile soil. This suggests that the core chromosome is sufficient for growth in a bulk soil environment and that the pSymA and pSymB replicons carry genes with more specialized functions such as growth in the rhizosphere and interaction with the plant. These experimental data support a generalized evolutionary model, in which non-chromosomal replicons primarily carry genes with more specialized functions. These large secondary replicons increase the organism's niche range, which offsets their metabolic burden on the cell (e.g. pSymA). Subsequent co-evolution with the chromosome then leads to the formation of a chromid through the acquisition of functions core to all niches (e.g. p

  19. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  20. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  1. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  2. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  3. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  4. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  5. Faster growth of the major prokaryotic versus eukaryotic CO2 fixers in the oligotrophic ocean

    PubMed Central

    Zubkov, Mikhail V.

    2014-01-01

    Because maintenance of non-scalable cellular components—membranes and chromosomes—requires an increasing fraction of energy as cell size decreases, miniaturization comes at a considerable energetic cost for a phytoplanktonic cell. Consequently, if eukaryotes can use their superior energetic resources to acquire nutrients with more or even similar efficiency compared with prokaryotes, larger unicellular eukaryotes should be able to achieve higher growth rates than smaller cyanobacteria. Here, to test this hypothesis, we directly compare the intrinsic growth rates of phototrophic prokaryotes and eukaryotes from the equatorial to temperate South Atlantic using an original flow cytometric 14CO2-tracer approach. At the ocean basin scale, cyanobacteria double their biomass twice as frequently as the picoeukaryotes indicating that the prokaryotes are faster growing CO2 fixers, better adapted to phototrophic living in the oligotrophic open ocean—the most extensive biome on Earth. PMID:24777140

  6. The Evolution of Epigenetics: From Prokaryotes to Humans and Its Biological Consequences.

    PubMed

    Willbanks, Amber; Leary, Meghan; Greenshields, Molly; Tyminski, Camila; Heerboth, Sarah; Lapinska, Karolina; Haskins, Kathryn; Sarkar, Sibaji

    2016-01-01

    The evolution process includes genetic alterations that started with prokaryotes and now continues in humans. A distinct difference between prokaryotic chromosomes and eukaryotic chromosomes involves histones. As evolution progressed, genetic alterations accumulated and a mechanism for gene selection developed. It was as if nature was experimenting to optimally utilize the gene pool without changing individual gene sequences. This mechanism is called epigenetics, as it is above the genome. Curiously, the mechanism of epigenetic regulation in prokaryotes is strikingly different from that in eukaryotes, mainly higher eukaryotes, like mammals. In fact, epigenetics plays a significant role in the conserved process of embryogenesis and human development. Malfunction of epigenetic regulation results in many types of undesirable effects, including cardiovascular disease, metabolic disorders, autoimmune diseases, and cancer. This review provides a comparative analysis and new insights into these aspects. PMID:27512339

  7. Assessment of diversity indices for the characterization of the soil prokaryotic community by metagenomic analysis

    NASA Astrophysics Data System (ADS)

    Chernov, T. I.; Tkhakakhova, A. K.; Kutovaya, O. V.

    2015-04-01

    The diversity indices used in ecology for assessing the metagenomes of soil prokaryotic communities at different phylogenetic levels were compared. The following indices were considered: the number of detected taxa and the Shannon, Menhinick, Margalef, Simpson, Chao1, and ACE indices. The diversity analysis of the prokaryotic communities in the upper horizons of a typical chernozem (Haplic Chernozem (Pachic)), a dark chestnut soil (Haplic Kastanozem (Chromic)), and an extremely arid desert soil (Endosalic Calcisol (Yermic)) was based on the analysis of 16S rRNA genes. The Menhinick, Margalef, Chao1, and ACE indices gave similar results for the classification of the communities according to their diversity levels; the Simpson index gave good results only for the high-level taxa (phyla); the best results were obtained with the Shannon index. In general, all the indices used showed a decrease in the diversity of the soil prokaryotes in the following sequence: chernozem > dark chestnut soil > extremely arid desert soil.

  8. Lanosterol biosynthesis in the prokaryote Methylococcus capsulatus: insight into the evolution of sterol biosynthesis.

    PubMed

    Lamb, David C; Jackson, Colin J; Warrilow, Andrew G S; Manning, Nigel J; Kelly, Diane E; Kelly, Steven L

    2007-08-01

    A putative operon containing homologues of essential eukaryotic sterol biosynthetic enzymes, squalene monooxygenase and oxidosqualene cyclase, has been identified in the genome of the prokaryote Methylococcus capsulatus. Expression of the squalene monooxygenase yielded a protein associated with the membrane fraction, while expression of oxidosqualene cyclase yielded a soluble protein, contrasting with the eukaryotic enzyme forms. Activity studies with purified squalene monooxygenase revealed a catalytic activity in epoxidation of 0.35 nmol oxidosqualene produced/min/nmol squalene monooxygenase, while oxidosqualene cyclase catalytic activity revealed cyclization of oxidosqualene to lanosterol with 0.6 nmol lanosterol produced/min/nmol oxidosqualene cyclase and no other products observed. The presence of prokaryotic sterol biosynthesis is still regarded as rare, and these are the first representatives of such prokaryotic enzymes to be studied, providing new insight into the evolution of sterol biosynthesis in general. PMID:17567593

  9. The Evolution of Epigenetics: From Prokaryotes to Humans and Its Biological Consequences

    PubMed Central

    Willbanks, Amber; Leary, Meghan; Greenshields, Molly; Tyminski, Camila; Heerboth, Sarah; Lapinska, Karolina; Haskins, Kathryn; Sarkar, Sibaji

    2016-01-01

    The evolution process includes genetic alterations that started with prokaryotes and now continues in humans. A distinct difference between prokaryotic chromosomes and eukaryotic chromosomes involves histones. As evolution progressed, genetic alterations accumulated and a mechanism for gene selection developed. It was as if nature was experimenting to optimally utilize the gene pool without changing individual gene sequences. This mechanism is called epigenetics, as it is above the genome. Curiously, the mechanism of epigenetic regulation in prokaryotes is strikingly different from that in eukaryotes, mainly higher eukaryotes, like mammals. In fact, epigenetics plays a significant role in the conserved process of embryogenesis and human development. Malfunction of epigenetic regulation results in many types of undesirable effects, including cardiovascular disease, metabolic disorders, autoimmune diseases, and cancer. This review provides a comparative analysis and new insights into these aspects. PMID:27512339

  10. Genomics of Bacterial and Archaeal Viruses: Dynamics within the Prokaryotic Virosphere

    PubMed Central

    Krupovic, Mart; Prangishvili, David; Hendrix, Roger W.; Bamford, Dennis H.

    2011-01-01

    Summary: Prokaryotes, bacteria and archaea, are the most abundant cellular organisms among those sharing the planet Earth with human beings (among others). However, numerous ecological studies have revealed that it is actually prokaryotic viruses that predominate on our planet and outnumber their hosts by at least an order of magnitude. An understanding of how this viral domain is organized and what are the mechanisms governing its evolution is therefore of great interest and importance. The vast majority of characterized prokaryotic viruses belong to the order Caudovirales, double-stranded DNA (dsDNA) bacteriophages with tails. Consequently, these viruses have been studied (and reviewed) extensively from both genomic and functional perspectives. However, albeit numerous, tailed phages represent only a minor fraction of the prokaryotic virus diversity. Therefore, the knowledge which has been generated for this viral system does not offer a comprehensive view of the prokaryotic virosphere. In this review, we discuss all families of bacterial and archaeal viruses that contain more than one characterized member and for which evolutionary conclusions can be attempted by use of comparative genomic analysis. We focus on the molecular mechanisms of their genome evolution as well as on the relationships between different viral groups and plasmids. It becomes clear that evolutionary mechanisms shaping the genomes of prokaryotic viruses vary between different families and depend on the type of the nucleic acid, characteristics of the virion structure, as well as the mode of the life cycle. We also point out that horizontal gene transfer is not equally prevalent in different virus families and is not uniformly unrestricted for diverse viral functions. PMID:22126996

  11. Prokaryotic Caspase Homologs: Phylogenetic Patterns and Functional Characteristics Reveal Considerable Diversity

    PubMed Central

    Asplund-Samuelsson, Johannes; Bergman, Birgitta; Larsson, John

    2012-01-01

    Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18%) were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota). Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes. PMID:23185476

  12. The Repertoire of ICE in Prokaryotes Underscores the Unity, Diversity, and Ubiquity of Conjugation

    PubMed Central

    Guglielmini, Julien; Quintais, Leonor; Garcillán-Barcia, Maria Pilar; de la Cruz, Fernando; Rocha, Eduardo P. C.

    2011-01-01

    Horizontal gene transfer shapes the genomes of prokaryotes by allowing rapid acquisition of novel adaptive functions. Conjugation allows the broadest range and the highest gene transfer input per transfer event. While conjugative plasmids have been studied for decades, the number and diversity of integrative conjugative elements (ICE) in prokaryotes remained unknown. We defined a large set of protein profiles of the conjugation machinery to scan over 1,000 genomes of prokaryotes. We found 682 putative conjugative systems among all major phylogenetic clades and showed that ICEs are the most abundant conjugative elements in prokaryotes. Nearly half of the genomes contain a type IV secretion system (T4SS), with larger genomes encoding more conjugative systems. Surprisingly, almost half of the chromosomal T4SS lack co-localized relaxases and, consequently, might be devoted to protein transport instead of conjugation. This class of elements is preponderant among small genomes, is less commonly associated with integrases, and is rarer in plasmids. ICEs and conjugative plasmids in proteobacteria have different preferences for each type of T4SS, but all types exist in both chromosomes and plasmids. Mobilizable elements outnumber self-conjugative elements in both ICEs and plasmids, which suggests an extensive use of T4SS in trans. Our evolutionary analysis indicates that switch of plasmids to and from ICEs were frequent and that extant elements began to differentiate only relatively recently. According to the present results, ICEs are the most abundant conjugative elements in practically all prokaryotic clades and might be far more frequently domesticated into non-conjugative protein transport systems than previously thought. While conjugative plasmids and ICEs have different means of genomic stabilization, their mechanisms of mobility by conjugation show strikingly conserved patterns, arguing for a unitary view of conjugation in shaping the genomes of prokaryotes by

  13. Prokaryotic evolution and the tree of life are two different things

    PubMed Central

    Bapteste, Eric; O'Malley, Maureen A; Beiko, Robert G; Ereshefsky, Marc; Gogarten, J Peter; Franklin-Hall, Laura; Lapointe, François-Joseph; Dupré, John; Dagan, Tal; Boucher, Yan; Martin, William

    2009-01-01

    Background The concept of a tree of life is prevalent in the evolutionary literature. It stems from attempting to obtain a grand unified natural system that reflects a recurrent process of species and lineage splittings for all forms of life. Traditionally, the discipline of systematics operates in a similar hierarchy of bifurcating (sometimes multifurcating) categories. The assumption of a universal tree of life hinges upon the process of evolution being tree-like throughout all forms of life and all of biological time. In multicellular eukaryotes, the molecular mechanisms and species-level population genetics of variation do indeed mainly cause a tree-like structure over time. In prokaryotes, they do not. Prokaryotic evolution and the tree of life are two different things, and we need to treat them as such, rather than extrapolating from macroscopic life to prokaryotes. In the following we will consider this circumstance from philosophical, scientific, and epistemological perspectives, surmising that phylogeny opted for a single model as a holdover from the Modern Synthesis of evolution. Results It was far easier to envision and defend the concept of a universal tree of life before we had data from genomes. But the belief that prokaryotes are related by such a tree has now become stronger than the data to support it. The monistic concept of a single universal tree of life appears, in the face of genome data, increasingly obsolete. This traditional model to describe evolution is no longer the most scientifically productive position to hold, because of the plurality of evolutionary patterns and mechanisms involved. Forcing a single bifurcating scheme onto prokaryotic evolution disregards the non-tree-like nature of natural variation among prokaryotes and accounts for only a minority of observations from genomes. Conclusion Prokaryotic evolution and the tree of life are two different things. Hence we will briefly set out alternative models to the tree of life to

  14. An unusual symbiont from the gut of surgeonfishes may be the largest known prokaryote.

    PubMed Central

    Clements, K D; Bullivant, S

    1991-01-01

    Symbionts first reported from the gut of a Red Sea surgeonfish, Acanthurus nigrofuscus (family Acanthuridae), were subsequently described as Epulopiscium fishelsoni. The taxonomic position of this very large (up to 576 microns in length) microorganism has previously been designated in the literature as either uncertain or eukaryotic. We suggest that similar symbionts from Great Barrier Reef surgeonfish may be prokaryotes, which together with E. fishelsoni from the Red Sea may represent the largest known forms of this cell type. Features identifying the symbionts as prokaryotes include the presence of bacterial-type flagella and a bacterial nucleoid and the absence of a nucleus or any other membrane-bound organelle. Images PMID:1885516

  15. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  16. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  17. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  18. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  19. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  20. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  1. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  2. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  3. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  4. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  5. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  6. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  7. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  8. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  9. Metagenome sequencing of the prokaryotic microbiota of the hypersaline and meromictic soap lake, washington.

    PubMed

    Hawley, Erik R; Hess, Matthias

    2014-01-01

    Soap Lake is a small saline lake in central eastern Washington that is sharply stratified into two layers. In addition to being highly alkaline (~pH 10), Soap Lake also contains high concentrations of sulfide. Here, we report the community profile of the prokaryotic microbiota associated with Soap Lake surface water. PMID:24459273

  10. Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world

    PubMed Central

    Koonin, Eugene V.; Wolf, Yuri I.

    2008-01-01

    The first bacterial genome was sequenced in 1995, and the first archaeal genome in 1996. Soon after these breakthroughs, an exponential rate of genome sequencing was established, with a doubling time of approximately 20 months for bacteria and approximately 34 months for archaea. Comparative analysis of the hundreds of sequenced bacterial and dozens of archaeal genomes leads to several generalizations on the principles of genome organization and evolution. A crucial finding that enables functional characterization of the sequenced genomes and evolutionary reconstruction is that the majority of archaeal and bacterial genes have conserved orthologs in other, often, distant organisms. However, comparative genomics also shows that horizontal gene transfer (HGT) is a dominant force of prokaryotic evolution, along with the loss of genetic material resulting in genome contraction. A crucial component of the prokaryotic world is the mobilome, the enormous collection of viruses, plasmids and other selfish elements, which are in constant exchange with more stable chromosomes and serve as HGT vehicles. Thus, the prokaryotic genome space is a tightly connected, although compartmentalized, network, a novel notion that undermines the ‘Tree of Life’ model of evolution and requires a new conceptual framework and tools for the study of prokaryotic evolution. PMID:18948295

  11. Dynamics of natural prokaryotes, viruses, and heterotrophic nanoflagellates in alpine karstic groundwater.

    PubMed

    Wilhartitz, Inés C; Kirschner, Alexander K T; Brussaard, Corina P D; Fischer, Ulrike R; Wieltschnig, Claudia; Stadler, Hermann; Farnleitner, Andreas H

    2013-08-01

    Seasonal dynamics of naturally occurring prokaryotes, viruses, and heterotrophic nanoflagellates in two hydro-geologically contrasting alpine karst springs were monitored over three annual cycles. To our knowledge, this study is the first to shed light on the occurrence and possible interrelationships between these three groups in karstic groundwater. Hydrological and microbiological standard indicators were recovered simultaneously in order to estimate surface influence, especially during rainfall events. Data revealed a strong dependence of the microbial communities on the prevailing hydrological situation. Prokaryotic numbers averaged 5.1 × 10(7) and 1.3 × 10(7) cells L(-1) , and heterotrophic nanoflagellate abundance averaged 1.1 × 10(4) and 3 × 10(3) cells L(-1) in the limestone spring type (LKAS2) and the dolomitic spring type (DKAS1), respectively. Viral abundance in LKAS2 and DKAS1 averaged 9.4 × 10(8) and 1.1 × 10(8) viruses L(-1) . Unlike in DKAS1, the dynamic spring type LKAS2 revealed a clear difference between base flow and high discharge conditions. The virus-to-prokaryotes ratio was generally lower by a factor of 2-3, at higher average water residence times. Furthermore, the high prokaryotes-to-heterotrophic nanoflagellate ratios, namely about 4700 and 5400 for LKAS2 and DKAS1, respectively, pointed toward an uncoupling of these two groups in the planktonic fraction of alpine karstic aquifers. PMID:23828838

  12. Genomics of bacteria and archaea: the emerging dynamic view of the prokaryotic world.

    PubMed

    Koonin, Eugene V; Wolf, Yuri I

    2008-12-01

    The first bacterial genome was sequenced in 1995, and the first archaeal genome in 1996. Soon after these breakthroughs, an exponential rate of genome sequencing was established, with a doubling time of approximately 20 months for bacteria and approximately 34 months for archaea. Comparative analysis of the hundreds of sequenced bacterial and dozens of archaeal genomes leads to several generalizations on the principles of genome organization and evolution. A crucial finding that enables functional characterization of the sequenced genomes and evolutionary reconstruction is that the majority of archaeal and bacterial genes have conserved orthologs in other, often, distant organisms. However, comparative genomics also shows that horizontal gene transfer (HGT) is a dominant force of prokaryotic evolution, along with the loss of genetic material resulting in genome contraction. A crucial component of the prokaryotic world is the mobilome, the enormous collection of viruses, plasmids and other selfish elements, which are in constant exchange with more stable chromosomes and serve as HGT vehicles. Thus, the prokaryotic genome space is a tightly connected, although compartmentalized, network, a novel notion that undermines the 'Tree of Life' model of evolution and requires a new conceptual framework and tools for the study of prokaryotic evolution. PMID:18948295

  13. P2CS: a two-component system resource for prokaryotic signal transduction research

    PubMed Central

    Barakat, Mohamed; Ortet, Philippe; Jourlin-Castelli, Cécile; Ansaldi, Mireille; Méjean, Vincent; Whitworth, David E

    2009-01-01

    Background With the escalation of high throughput prokaryotic genome sequencing, there is an ever-increasing need for databases that characterise, catalogue and present data relating to particular gene sets and genomes/metagenomes. Two-component system (TCS) signal transduction pathways are the dominant mechanisms by which micro-organisms sense and respond to external as well as internal environmental changes. These systems respond to a wide range of stimuli by triggering diverse physiological adjustments, including alterations in gene expression, enzymatic reactions, or protein-protein interactions. Description We present P2CS (Prokaryotic 2-Component Systems), an integrated and comprehensive database of TCS signal transduction proteins, which contains a compilation of the TCS genes within 755 completely sequenced prokaryotic genomes and 39 metagenomes. P2CS provides detailed annotation of each TCS gene including family classification, sequence features, functional domains, as well as genomic context visualization. To bypass the generic problem of gene underestimation during genome annotation, we also constituted and searched an ORFeome, which improves the recovery of TCS proteins compared to searches on the equivalent proteomes. Conclusion P2CS has been developed for computational analysis of the modular TCSs of prokaryotic genomes and metagenomes. It provides a complete overview of information on TCSs, including predicted candidate proteins and probable proteins, which need further curation/validation. The database can be browsed and queried with a user-friendly web interface at . PMID:19604365

  14. The (un)coupling between viruses and prokaryotes in the Gulf of Trieste

    NASA Astrophysics Data System (ADS)

    Karuza, Ana; Umani, Serena Fonda; Del Negro, Paola

    2012-12-01

    Viruses and prokaryotes represent the smallest and the most abundant biological entities in marine environments. The interest for viruses and their interactions with marine organisms is continuously rising but the studies are generally limited to short-time investigations. This study conducted in the Gulf of Trieste on monthly resolution investigates for the very first time relationships between viruses and prokaryotes (both heterotrophs-HP and autotrophs-AP) over ten years (2000-2010). From our results emerged that no clear relationship between the abundances of viruses and prokaryotes is observed unless for rather restricted time intervals. Some of the sporadic peaks of viral abundances can be attributable to infections occurred during the autumn phytoplankton blooms, thus probably contributing to the end of the bloom. We infer that the general uncoupling between viruses and prokaryotes in the Gulf of Trieste is due to the variety of factors that regulate viral infection, proliferation and persistence such as the diversity of viral life cycles that are determined by environmental factors, the abundance and the physiological status of their hosts.

  15. OperomeDB: A Database of Condition-Specific Transcription Units in Prokaryotic Genomes

    PubMed Central

    Chetal, Kashish; Janga, Sarath Chandra

    2015-01-01

    Background. In prokaryotic organisms, a substantial fraction of adjacent genes are organized into operons—codirectionally organized genes in prokaryotic genomes with the presence of a common promoter and terminator. Although several available operon databases provide information with varying levels of reliability, very few resources provide experimentally supported results. Therefore, we believe that the biological community could benefit from having a new operon prediction database with operons predicted using next-generation RNA-seq datasets. Description. We present operomeDB, a database which provides an ensemble of all the predicted operons for bacterial genomes using available RNA-sequencing datasets across a wide range of experimental conditions. Although several studies have recently confirmed that prokaryotic operon structure is dynamic with significant alterations across environmental and experimental conditions, there are no comprehensive databases for studying such variations across prokaryotic transcriptomes. Currently our database contains nine bacterial organisms and 168 transcriptomes for which we predicted operons. User interface is simple and easy to use, in terms of visualization, downloading, and querying of data. In addition, because of its ability to load custom datasets, users can also compare their datasets with publicly available transcriptomic data of an organism. Conclusion. OperomeDB as a database should not only aid experimental groups working on transcriptome analysis of specific organisms but also enable studies related to computational and comparative operomics. PMID:26543854

  16. Seasonal composition and activity of sulfate-reducing prokaryotic communities in seagrass bed sediments

    EPA Science Inventory

    Sulfate-reducing prokaryotes (SRP) play a key role in the carbon and nutrient cycles of coastal marine, vegetated ecosystems, but the interactions of SRP communities with aquatic plants remain little studied. The abundance, activity, and community composition of SRP was studied i...

  17. The Evolution and Functional Role of Flavin-based Prokaryotic Photoreceptors.

    PubMed

    Losi, Aba; Mandalari, Carmen; Gärtner, Wolfgang

    2015-01-01

    Flavin-based photoreceptor proteins of the LOV (light, oxygen and voltage) superfamily are ubiquitous and appear to be essential blue-light sensing systems not only in plants, algae and fungi, but also in prokaryotes, where they are represented in more than 10% of known species. Despite their broad occurrence, only in few cases LOV proteins have been correlated with important phenomena such as bacterial infectivity, selective growth patterns or/and stress responses; nevertheless these few known roles are helping us understand the multiple ways by which prokaryotes can exploit these soluble blue-light photoreceptors. Given the large number of sequences now deposited in databases, it becomes meaningful to define a signature for bona fide LOV domains, a procedure that facilitates identification of proteins with new properties and phylogenetic analysis. The latter clearly evidences that a class of LOV proteins from alpha-proteobacteria is the closest prokaryotic relative of eukaryotic LOV domains, whereas cyanobacterial sequences cluster with the archaeal and the other bacterial LOV domains. Distance trees built for LOV domains suggest complex evolutionary patterns, possibly involving multiple horizontal gene transfer events. Based on available data, the in vivo relevance and evolution of prokaryotic LOV is discussed. PMID:26138219

  18. Impact of Lowland Rainforest Transformation on Diversity and Composition of Soil Prokaryotic Communities in Sumatra (Indonesia)

    PubMed Central

    Schneider, Dominik; Engelhaupt, Martin; Allen, Kara; Kurniawan, Syahrul; Krashevska, Valentyna; Heinemann, Melanie; Nacke, Heiko; Wijayanti, Marini; Meryandini, Anja; Corre, Marife D.; Scheu, Stefan; Daniel, Rolf

    2015-01-01

    Prokaryotes are the most abundant and diverse group of microorganisms in soil and mediate virtually all biogeochemical cycles in terrestrial ecosystems. Thereby, they influence aboveground plant productivity and diversity. In this study, the impact of rainforest transformation to intensively managed cash crop systems on soil prokaryotic communities was investigated. The studied managed land use systems comprised rubber agroforests (jungle rubber), rubber plantations and oil palm plantations within two Indonesian landscapes Bukit Duabelas and Harapan. Soil prokaryotic community composition and diversity were assessed by pyrotag sequencing of bacterial and archaeal 16S rRNA genes. The curated dataset contained 16,413 bacterial and 1679 archaeal operational taxonomic units at species level (97% genetic identity). Analysis revealed changes in indigenous taxon-specific patterns of soil prokaryotic communities accompanying lowland rainforest transformation to jungle rubber, and intensively managed rubber and oil palm plantations. Distinct clustering of the rainforest soil communities indicated that these are different from the communities in the studied managed land use systems. The predominant bacterial taxa in all investigated soils were Acidobacteria, Actinobacteria, Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Overall, the bacterial community shifted from proteobacterial groups in rainforest soils to Acidobacteria in managed soils. The archaeal soil communities were mainly represented by Thaumarchaeota and Euryarchaeota. Members of the Terrestrial Group and South African Gold Mine Group 1 (Thaumarchaeota) dominated in the rainforest and members of Thermoplasmata in the managed land use systems. The alpha and beta diversity of the soil prokaryotic communities was higher in managed land use systems than in rainforest. In the case of bacteria, this was related to soil characteristics such as pH value, exchangeable Ca and Fe content, C to N ratio

  19. Probabilistic methods of identifying genes in prokaryotic genomes: connections to the HMM theory.

    PubMed

    Azad, Rajeev K; Borodovsky, Mark

    2004-06-01

    In this paper, we review developments in probabilistic methods of gene recognition in prokaryotic genomes with the emphasis on connections to the general theory of hidden Markov models (HMM). We show that the Bayesian method implemented in GeneMark, a frequently used gene-finding tool, can be augmented and reintroduced as a rigorous forward-backward (FB) algorithm for local posterior decoding described in the HMM theory. Another earlier developed method, prokaryotic GeneMark.hmm, uses a modification of the Viterbi algorithm for HMM with duration to identify the most likely global path through hidden functional states given the DNA sequence. GeneMark and GeneMark.hmm programs are worth using in concert for analysing prokaryotic DNA sequences that arguably do not follow any exact mathematical model. The new extension of GeneMark using the FB algorithm was implemented in the software program GeneMark.fba. Given the DNA sequence, this program determines an a posteriori probability for each nucleotide to belong to coding or non-coding region. Also, for any open reading frame (ORF), it assigns a score defined as a probabilistic measure of all paths through hidden states that traverse the ORF as a coding region. The prediction accuracy of GeneMark.fba determined in our tests was compared favourably to the accuracy of the initial (standard) GeneMark program. Comparison to the prokaryotic GeneMark.hmm has also demonstrated a certain, yet species-specific, degree of improvement in raw gene detection, ie detection of correct reading frame (and stop codon). The accuracy of exact gene prediction, which is concerned about precise prediction of gene start (which in a prokaryotic genome unambiguously defines the reading frame and stop codon, thus, the whole protein product), still remains more accurate in GeneMarkS, which uses more elaborate HMM to specifically address this task. PMID:15260893

  20. Dynamics of natural prokaryotes, viruses, and heterotrophic nanoflagellates in alpine karstic groundwater

    PubMed Central

    Wilhartitz, Inés C; Kirschner, Alexander K T; Brussaard, Corina P D; Fischer, Ulrike R; Wieltschnig, Claudia; Stadler, Hermann; Farnleitner, Andreas H

    2013-01-01

    Abstract Seasonal dynamics of naturally occurring prokaryotes, viruses, and heterotrophic nanoflagellates in two hydro-geologically contrasting alpine karst springs were monitored over three annual cycles. To our knowledge, this study is the first to shed light on the occurrence and possible interrelationships between these three groups in karstic groundwater. Hydrological and microbiological standard indicators were recovered simultaneously in order to estimate surface influence, especially during rainfall events. Data revealed a strong dependence of the microbial communities on the prevailing hydrological situation. Prokaryotic numbers averaged 5.1 × 107 and 1.3 × 107 cells L−1, and heterotrophic nanoflagellate abundance averaged 1.1 × 104 and 3 × 103 cells L−1 in the limestone spring type (LKAS2) and the dolomitic spring type (DKAS1), respectively. Viral abundance in LKAS2 and DKAS1 averaged 9.4 × 108 and 1.1 × 108 viruses L−1. Unlike in DKAS1, the dynamic spring type LKAS2 revealed a clear difference between base flow and high discharge conditions. The virus-to-prokaryotes ratio was generally lower by a factor of 2–3, at higher average water residence times. Furthermore, the high prokaryotes-to-heterotrophic nanoflagellate ratios, namely about 4700 and 5400 for LKAS2 and DKAS1, respectively, pointed toward an uncoupling of these two groups in the planktonic fraction of alpine karstic aquifers. Seasonal dynamics of naturally occurring prokaryotes, viruses and heterotrophic nanoflagellates in two hydro-geologically contrasting alpine karst springs were monitored over three annual cycles. Data revealed a strong dependence of the microbial communities on the prevailing hydrological situation. PMID:23828838

  1. Small activating ribonucleic acid reverses tyrosine kinase inhibitor resistance in epidermal growth factor receptor‐mutant lung cancer by increasing the expression of phosphatase and tensin homolog

    PubMed Central

    Li, Meng; Peng, Zhongmin; Ren, Wangang

    2016-01-01

    Background Epidermal growth factor receptor‐tyrosine kinase inhibitors (TKI‐EGFRs) present a new prospect for the treatment of lung cancer. However, in clinical application, the majority of patients become TKI resistant within a year. More and more studies have shown that a loss of phosphatase and tensin homolog (PTEN) expression is associated with TKI resistance. An alternative method of upregulating PTEN expression may reverse TKI resistance. Methods We designed five candidate small activating ribonucleic acids (saRNAs) to target PTEN, and transfected them into H‐157 cells to screen out functional saRNA. We used reverse transcriptase‐polymerase chain reaction and Western blot to evaluate the effect of saRNA to PTEN expression. We then analyzed the growth and apoptosis of cells transfected with saRNA under the treatment of TKI to investigate whether saRNAs can reverse TKI resistance by upregulating PTEN expression. Results The functional saRNA we designed could upregulate PTEN expression. The H‐157 cells transfected with saRNA grew slower in the presence of TKI drugs than the cells that were not transfected with saRNA. The apoptosis rate was also obviously higher. Conclusions Our study proves that loss of PTEN expression is an important mechanism of TKI resistance. It is possible to control TKI resistance by upregulating PTEN expression using RNA activation technology. PMID:27385992

  2. Derepression of Synthesis of the Aminoacyl-Transfer Ribonucleic Acid Synthetases for the Branched-Chain Amino Acids of Escherichia coli

    PubMed Central

    McGinnis, Etheleen; Williams, Ann C.; Williams, L. S.

    1974-01-01

    The kinetics of derepression of valyl-, isoleucyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined during valine-, isoleucine-, and leucine-limited growth. When valine was limiting growth, valyl-tRNA synthetase formation was maximally derepressed within 5 min, whereas the rates of synthesis of isoleucyl-, and leucyl-tRNA synthetases were unchanged. Isoleucine-restricted growth caused a maximal derepression of isoleucyl-tRNA synthetase formation in 5 min and derepression of valyl-tRNA synthetase formation in 15 min with no effect on leucyl-tRNA synthetase formation. When leucine was limiting growth, leucyl-tRNA synthetase formation was immediately derepressed, whereas valyl- and isoleucyl-tRNA synthetase formation was unaffected by manipulation of the leucine supply to the cells. These results support our previous findings that valyl-tRNA synthetase formation is subject to multivalent repression control by both isoleucine and valine. In contrast, repression control of iso-leucyl- and leucyl-tRNA synthetase formation is specifically mediated by the supply of the cognate amino acid. PMID:4604302

  3. RoboOligo: software for mass spectrometry data to support manual and de novo sequencing of post-transcriptionally modified ribonucleic acids

    PubMed Central

    Sample, Paul J.; Gaston, Kirk W.; Alfonzo, Juan D.; Limbach, Patrick A.

    2015-01-01

    Ribosomal ribonucleic acid (RNA), transfer RNA and other biological or synthetic RNA polymers can contain nucleotides that have been modified by the addition of chemical groups. Traditional Sanger sequencing methods cannot establish the chemical nature and sequence of these modified-nucleotide containing oligomers. Mass spectrometry (MS) has become the conventional approach for determining the nucleotide composition, modification status and sequence of modified RNAs. Modified RNAs are analyzed by MS using collision-induced dissociation tandem mass spectrometry (CID MS/MS), which produces a complex dataset of oligomeric fragments that must be interpreted to identify and place modified nucleosides within the RNA sequence. Here we report the development of RoboOligo, an interactive software program for the robust analysis of data generated by CID MS/MS of RNA oligomers. There are three main functions of RoboOligo: (i) automated de novo sequencing via the local search paradigm. (ii) Manual sequencing with real-time spectrum labeling and cumulative intensity scoring. (iii) A hybrid approach, coined ‘variable sequencing’, which combines the user intuition of manual sequencing with the high-throughput sampling of automated de novo sequencing. PMID:25820423

  4. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  5. Polyriboadenylate Sequences at the 3′-Termini of Ribonucleic Acid Obtained from Mammalian Leukemia and Sarcoma Viruses

    PubMed Central

    Phillips, Leo A.; Park, James J.; Hollis, Vincent W.

    1974-01-01

    The location of poly(A) sequences in the RNA of mammalian RNA-tumor viruses was determined by enzymatic analyses. The 56-64S viral genomic RNAs, the 20-40S viral subunit RNAs, and the 4-5S poly(A) sequences excised from these viral RNAs were subjected to either hydrolysis with a 3′-OH specific exoribonuclease from Ehrlich ascites tumor cells or phosphorolysis from the 3′-termini with polynucleotide phosphorylase from Micrococcus luteus. Purified adenosine-labeled poly(A) fragments, excised from genomic viral RNAs by RNase A and T1 digestion, were hydrolyzed with the 3′-OH specific exoribonuclease for various periods of time. Poly(U) filter binding studies of the residual poly(A) indicated that 97% of the poly(A) fragments were hydrolyzed. Adenosine-labeled genomic and subunit viral RNAs and excised poly(A) fragments were phosphorolyzed from their 3′-termini for various periods of time with polynucleotide phosphorylase. The degree of phosphorolysis was monitored by poly(U) filter binding studies, and CCl3COOH insolubility and solubility determinations. There was an initial preferential rate of phosphorolysis of the poly(A) sequences of genomic and subunit viral RNAs as compared to the total adenosine-labeled viral RNAs. The data from these two different enzymatic mechanisms of action indicated conclusively that the poly(A) sequences were located at the 3′-termini of genomic and subunit viral RNAs. PMID:4373712

  6. Viral Impact on Prokaryotic and Microalgal Activities in the Microphytobenthic Biofilm of an Intertidal Mudflat (French Atlantic Coast)

    PubMed Central

    Montanié, Hélène; De Crignis, Margot G.; Lavaud, Johann

    2015-01-01

    This is the first report on viriobenthos activity within the microbial biofilm located at the top-surface of the intertidal mudflat during emersion in Marennes-Oléron Bay (France). By combining in situ and ex situ approaches, the viral production (VP) was linked to the dynamics of prokaryotes and microphytobenthos (MPB). VP averaged 2–4 × 108 viruses ml−1 h−1. VP correlated positively with the Virus to Prokaryote Ratio, and both were correlated negatively with the water content. The virus-induced mortality of prokaryotes was lower in winter than in summer (6.8 vs. 39.7% of the production) and the C-shunting may supply 2–12% of their Carbon Demand, respectively. VP accounted for 79% of loss in Prokaryotes but the response was delayed compared to the increase in VP suggesting a simultaneous release of viruses of MPB origin. This hypothesis is supported by capsid-sizing of virions by transmission electronic microscopy and bioassays. Harvesting and ex situ maintenance of top-surface sediments was carried out to monitor the dynamics of viruses, prokaryotes and MPB after inoculation with benthic or planktonic viruses. Benthic viruses modified the prokaryotic and MPB dynamics and decreased the photosynthesis efficiency in contrast to planktonic viruses that impacted MPB but not the prokaryotes. PMID:26617575

  7. Viral Impact on Prokaryotic and Microalgal Activities in the Microphytobenthic Biofilm of an Intertidal Mudflat (French Atlantic Coast).

    PubMed

    Montanié, Hélène; De Crignis, Margot G; Lavaud, Johann

    2015-01-01

    This is the first report on viriobenthos activity within the microbial biofilm located at the top-surface of the intertidal mudflat during emersion in Marennes-Oléron Bay (France). By combining in situ and ex situ approaches, the viral production (VP) was linked to the dynamics of prokaryotes and microphytobenthos (MPB). VP averaged 2-4 × 10(8) viruses ml(-1) h(-1). VP correlated positively with the Virus to Prokaryote Ratio, and both were correlated negatively with the water content. The virus-induced mortality of prokaryotes was lower in winter than in summer (6.8 vs. 39.7% of the production) and the C-shunting may supply 2-12% of their Carbon Demand, respectively. VP accounted for 79% of loss in Prokaryotes but the response was delayed compared to the increase in VP suggesting a simultaneous release of viruses of MPB origin. This hypothesis is supported by capsid-sizing of virions by transmission electronic microscopy and bioassays. Harvesting and ex situ maintenance of top-surface sediments was carried out to monitor the dynamics of viruses, prokaryotes and MPB after inoculation with benthic or planktonic viruses. Benthic viruses modified the prokaryotic and MPB dynamics and decreased the photosynthesis efficiency in contrast to planktonic viruses that impacted MPB but not the prokaryotes. PMID:26617575

  8. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  9. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  10. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  11. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  12. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  13. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  14. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  15. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  16. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  17. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  18. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  19. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  20. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  1. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  2. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  3. Protist Community Grazing on Prokaryotic Prey in Deep Ocean Water Masses.

    PubMed

    Rocke, Emma; Pachiadaki, Maria G; Cobban, Alec; Kujawinski, Elizabeth B; Edgcomb, Virginia P

    2015-01-01

    Oceanic protist grazing at mesopelagic and bathypelagic depths, and their subsequent effects on trophic links between eukaryotes and prokaryotes, are not well constrained. Recent studies show evidence of higher than expected grazing activity by protists down to mesopelagic depths. This study provides the first exploration of protist grazing in the bathypelagic North Atlantic Deep Water (NADW). Grazing was measured throughout the water column at three stations in the South Atlantic using fluorescently-labeled prey analogues. Grazing in the deep Antarctic Intermediate water (AAIW) and NADW at all three stations removed 3.79% ± 1.72% to 31.14% ± 8.24% of the standing prokaryote stock. These results imply that protist grazing may be a significant source of labile organic carbon at certain meso- and bathypelagic depths. PMID:25894547

  4. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.

    PubMed

    Borodovsky, Mark; Lomsadze, Alex

    2014-01-01

    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy, and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:24510847

  5. Gene identification in prokaryotic genomes, phages, metagenomes, and EST sequences with GeneMarkS suite.

    PubMed

    Borodovsky, Mark; Lomsadze, Alex

    2011-09-01

    This unit describes how to use several gene-finding programs from the GeneMark line developed for finding protein-coding ORFs in genomic DNA of prokaryotic species, in genomic DNA of eukaryotic species with intronless genes, in genomes of viruses and phages, and in prokaryotic metagenomic sequences, as well as in EST sequences with spliced-out introns. These bioinformatics tools were demonstrated to have state-of-the-art accuracy and have been frequently used for gene annotation in novel nucleotide sequences. An additional advantage of these sequence-analysis tools is that the problem of algorithm parameterization is solved automatically, with parameters estimated by iterative self-training (unsupervised training). PMID:21901741

  6. [Diversity and viability of prokaryotes in primitive soils of the larsemann oasis (East Antarctica)].

    PubMed

    Kudinova, A G; Lysak, L V; Lapygina, E V; Soina, V S; Mergelov, N S

    2015-01-01

    The diversity and viability of prokaryotic communities in the primitive organomineral soils of East Antarctica have been studied; it has been shown that the total number of bacteria is smaller than and the viability of bacteria is similar to that in soils of the temperate zone. The prokaryotic communities are characterized by the occurrence of a major part of cells in filterable forms, which is higher than the analogous parameter for the temperate soils. The method of fluorescence in situ hybridization (FISH) revealed that the distribution of the main taxons is similar to that in the temperate soils: the portion of the domain Archaea is smaller than that of the domain Bacteria; the total content of Gram-negative bacteria (the phyla Proteobacteria, Acidobacteria, and Planctomycetes) is higher than that of Gram-positive bacteria (Actinobacteria). Within the phylum Proteobacteria, a significant variation of three proteobacterial classes has been noted along the profiles of the soils studied. PMID:26021154

  7. "Depupylation" of Prokaryotic Ubiquitin-like Protein from Mycobacterial Proteasome Substrates

    SciTech Connect

    Burns, K.E.; Li, H.; Cerda-Maira, F. A.; Wang, T.; Bishai, W. R.; Darwin, K. H.

    2010-09-10

    Ubiquitin (Ub) provides the recognition and specificity required to deliver proteins to the eukaryotic proteasome for destruction. Prokaryotic ubiquitin-like protein (Pup) is functionally analogous to Ub in Mycobacterium tuberculosis (Mtb), as it dooms proteins to the Mtb proteasome. Studies suggest that Pup and Ub do not share similar mechanisms of activation and conjugation to target proteins. Dop (deamidase of Pup; Mtb Rv2112c/MT2172) deamidates the C-terminal glutamine of Pup to glutamate, preparing it for ligation to target proteins by proteasome accessory factor A (PafA). While studies have shed light on the conjugation of Pup to proteins, it was not known if Pup could be removed from substrates in a manner analogous to the deconjugation of Ub from eukaryotic proteins. Here, we show that Mycobacteria have a depupylase activity provided by Dop. The discovery of a depupylase strengthens the parallels between the Pup- and Ub-tagging systems of prokaryotes and eukaryotes, respectively.

  8. The prokaryotic zinc-finger: structure, function and comparison with the eukaryotic counterpart.

    PubMed

    Malgieri, Gaetano; Palmieri, Maddalena; Russo, Luigi; Fattorusso, Roberto; Pedone, Paolo V; Isernia, Carla

    2015-12-01

    Classical zinc finger (ZF) domains were thought to be confined to the eukaryotic kingdom until the transcriptional regulator Ros protein was identified in Agrobacterium tumefaciens. The Ros Cys2 His2 ZF binds DNA in a peculiar mode and folds in a domain significantly larger than its eukaryotic counterpart consisting of 58 amino acids (the 9-66 region) arranged in a βββαα topology, and stabilized by a conserved, extensive, 15-residue hydrophobic core. The prokaryotic ZF domain, then, shows some intriguing new features that make it interestingly different from its eukaryotic counterpart. This review will focus on the prokaryotic ZFs, summarizing and discussing differences and analogies with the eukaryotic domains and providing important insights into their structure/function relationships. PMID:26365095

  9. Exceptionally widespread nanomachines composed of type IV pilins: the prokaryotic Swiss Army knives

    PubMed Central

    Berry, Jamie-Lee; Pelicic, Vladimir

    2014-01-01

    Prokaryotes have engineered sophisticated surface nanomachines that have allowed them to colonize Earth and thrive even in extreme environments. Filamentous machineries composed of type IV pilins, which are associated with an amazing array of properties ranging from motility to electric conductance, are arguably the most widespread since distinctive proteins dedicated to their biogenesis are found in most known species of prokaryotes. Several decades of investigations, starting with type IV pili and then a variety of related systems both in bacteria and archaea, have outlined common molecular and structural bases for these nanomachines. Using type IV pili as a paradigm, we will highlight in this review common aspects and key biological differences of this group of filamentous structures. PMID:25793962

  10. ODoSE: a webserver for genome-wide calculation of adaptive divergence in prokaryotes.

    PubMed

    Vos, Michiel; te Beek, Tim A H; van Driel, Marc A; Huynen, Martijn A; Eyre-Walker, Adam; van Passel, Mark W J

    2013-01-01

    Quantifying patterns of adaptive divergence between taxa is a major goal in the comparative and evolutionary study of prokaryote genomes. When applied appropriately, the McDonald-Kreitman (MK) test is a powerful test of selection based on the relative frequency of non-synonymous and synonymous substitutions between species compared to non-synonymous and synonymous polymorphisms within species. The webserver ODoSE (Ortholog Direction of Selection Engine) allows the calculation of a novel extension of the MK test, the Direction of Selection (DoS) statistic, as well as the calculation of a weighted-average Neutrality Index (NI) statistic for the entire core genome, allowing for systematic analysis of the evolutionary forces shaping core genome divergence in prokaryotes. ODoSE is hosted in a Galaxy environment, which makes it easy to use and amenable to customization and is freely available at www.odose.nl. PMID:23671597

  11. Survival of Prokaryotic- and Eukaryotic Symbiotic Rock Inhabiting Organisms in Short- and Long-Term Space Missions

    NASA Astrophysics Data System (ADS)

    de La Torre, R.; Horneck, G.; Rabbow, E.; Rettberg, P.; Sancho, L. G.; Sanchez Iñigo, F. J.; Onofri, S.; Frias, M.; Mateo-Marti, E.; de Vera, J. P.; Cockell, C.; Olsson, K.; Demets, R.

    2010-04-01

    Three experiments allowed for the first time the demonstration and intercomparision of the high survival capacity of eukaryotic and prokaryotic symbiotic organisms in space: on a short mission (LICHENS and LITHOPANSPERMIA) and on a long mission (LIFE, EXPOSE-E).

  12. Simultaneous prediction of transcription factor binding sites in a group of prokaryotic genomes

    PubMed Central

    2010-01-01

    Background Our current understanding of transcription factor binding sites (TFBSs) in sequenced prokaryotic genomes is very limited due to the lack of an accurate and efficient computational method for the prediction of TFBSs at a genome scale. In an attempt to change this situation, we have recently developed a comparative genomics based algorithm called GLECLUBS for de novo genome-wide prediction of TFBSs in a target genome. Although GLECLUBS has achieved rather high prediction accuracy of TFBSs in a target genome, it is still not efficient enough to be applied to all the sequenced prokaryotic genomes. Results Here, we designed a new algorithm based on GLECLUBS called extended GLECLUBS (eGLECLUBS) for simultaneous prediction of TFBSs in a group of related prokaryotic genomes. When tested on a group of γ-proteobacterial genomes including E. coli K12, a group of firmicutes genomes including B. subtilis and a group of cyanobacterial genomes using the same parameter settings, eGLECLUBS predicts more than 82% of known TFBSs in extracted inter-operonic sequences in both E. coli K12 and B. subtilis. Because each genome in a group is equally treated, it is highly likely that similar prediction accuracy has been achieved for each genome in the group. Conclusions We have developed a new algorithm for genome-wide de novo prediction of TFBSs in a group of related prokaryotic genomes. The algorithm has achieved the same level of accuracy and robustness as its predecessor GLECLUBS, but can work on dozens of genomes at the same time. PMID:20653963

  13. Protein structure, electron transfer and evolution of prokaryotic photosynthetic reaction centers

    NASA Technical Reports Server (NTRS)

    Blankenship, R. E.

    1994-01-01

    Photosynthetic reaction centers from a variety of organisms have been isolated and characterized. The groups of prokaryotic photosynthetic organisms include the purple bacteria, the filamentous green bacteria, the green sulfur bacteria and the heliobacteria as anoxygenic representatives as well as the cyanobacteria and prochlorophytes as oxygenic representatives. This review focuses on structural and functional comparisons of the various groups of photosynthetic reaction centers and considers possible evolutionary scenarios to explain the diversity of existing photosynthetic organisms.

  14. Prokaryotic taxonomy in the sequencing era--the polyphasic approach revisited.

    PubMed

    Kämpfer, Peter; Glaeser, Stefanie P

    2012-02-01

    The ultimate goal of taxonomy is to establish a system that mirrors the 'order in nature'. In prokaryote microbiology, almost all taxonomic concepts try to mirror the whole evolutionary order back to the origin of life with the cell as basic unit. The introduction of the 16S rRNA gene as molecular marker allowed for the first time the creation of a hierarchical taxonomic system based on one practical molecular marker. With the development of new and rapid sequencing technologies a wealth of new data can and will be used for critical evaluation of the taxonomic system. Comprehensive analyses of other molecular markers as well as total or partial genome comparisons confirmed the 16S rRNA based hierarchical system as 'backbone of prokaryote taxonomy' at least at the genus level and above. A tendency is visible to classify novel taxa more and more based on the genotype, i.e. comparative analyses of 16S rRNA and/or other gene sequence data (in multilocus sequence analysis, MLSA) at the genus and the species level, sometimes contrary to the indications of other (often phenotypic) data. The understanding of all the information behind these data is lagging far behind their accumulation. Genes and genomes do not function on its own and can only display their potential within the cell as the basic unit of evolution (and hence taxonomy). It is the phenotype and the natural selection that 'drive' evolution in a given environment. In this context, the 'polyphasic taxonomic approach' should be revisited again, taking into account the novel insights into genomes and other 'omic' sciences in a more strict and detailed context with the phenotype. This approach allows a more holistic view and provides a sound basis for describing the diversity of prokaryotes and has the potential to become the foundation of a more stable, in-depth taxonomy of the prokaryotes. PMID:22040009

  15. GenePRIMP: A GENE PRediction IMprovement Pipeline for Prokaryotic genomes

    SciTech Connect

    Pati, Amrita; Ivanova, Natalia N.; Mikhailova, Natalia; Ovchinnikova, Galina; Hooper, Sean D.; Lykidis, Athanasios; Kyrpides, Nikos C.

    2010-04-01

    We present 'gene prediction improvement pipeline' (GenePRIMP; http://geneprimp.jgi-psf.org/), a computational process that performs evidence-based evaluation of gene models in prokaryotic genomes and reports anomalies including inconsistent start sites, missed genes and split genes. We found that manual curation of gene models using the anomaly reports generated by GenePRIMP improved their quality, and demonstrate the applicability of GenePRIMP in improving finishing quality and comparing different genome-sequencing and annotation technologies.

  16. Biodiversity of Prokaryotic Communities Associated with the Ectoderm of Ectopleura crocea (Cnidaria, Hydrozoa)

    PubMed Central

    Di Camillo, Cristina Gioia; Luna, Gian Marco; Bo, Marzia; Giordano, Giuseppe; Corinaldesi, Cinzia; Bavestrello, Giorgio

    2012-01-01

    The surface of many marine organisms is colonized by complex communities of microbes, yet our understanding of the diversity and role of host-associated microbes is still limited. We investigated the association between Ectopleura crocea (a colonial hydroid distributed worldwide in temperate waters) and prokaryotic assemblages colonizing the hydranth surface. We used, for the first time on a marine hydroid, a combination of electron and epifluorescence microscopy and 16S rDNA tag pyrosequencing to investigate the associated prokaryotic diversity. Dense assemblages of prokaryotes were associated with the hydrant surface. Two microbial morphotypes were observed: one horseshoe-shaped and one fusiform, worm-like. These prokaryotes were observed on the hydrozoan epidermis, but not in the portions covered by the perisarcal exoskeleton, and their abundance was higher in March while decreased in late spring. Molecular analyses showed that assemblages were dominated by Bacteria rather than Archaea. Bacterial assemblages were highly diversified, with up to 113 genera and 570 Operational Taxonomic Units (OTUs), many of which were rare and contributed to <0.4%. The two most abundant OTUs, likely corresponding to the two morphotypes present on the epidermis, were distantly related to Comamonadaceae (genus Delftia) and to Flavobacteriaceae (genus Polaribacter). Epibiontic bacteria were found on E. crocea from different geographic areas but not in other hydroid species in the same areas, suggesting that the host-microbe association is species-specific. This is the first detailed report of bacteria living on the hydrozoan epidermis, and indeed the first study reporting bacteria associated with the epithelium of E. crocea. Our results provide a starting point for future studies aiming at clarifying the role of this peculiar hydrozoan-bacterial association. PMID:22768172

  17. Benthic prokaryotic community dynamics along the Ardencaple Canyon, Western Greenland Sea

    NASA Astrophysics Data System (ADS)

    Quéric, Nadia-Valérie; Soltwedel, Thomas

    2012-07-01

    The Ardencaple Canyon, emanating from the Eastern Greenland continental rise over a distance of about 200 km towards the Greenland Basin, was investigated to determine the effect of enhanced down-slope transport mechanisms on deep-sea benthic prokaryotic communities. The concentration of viable bacterial cells (Live/Dead®BacLight) and prokaryotic incorporation rates (3H-thymidine, 14C-leucine) increased with increasing distance from the continental shelf. Multidimensional scaling (MDS) results from terminal restriction fragment length polymorphism (T-RFLP) analysis indicated a spatial coherence between the benthic bacterial community structure, prokaryotic incorporation rates, water content, protein concentration and the total organic matter in the sediments. The community complexity in sediments at 4-5 cm depth was lower in the central parts of the channel compared with the northern and the southern levees, while richness in surface sediments of all stations was similar. Lacking any clear indications for a recent mass sediment transport or funneled shelf drainage flows, high similarities between bacterial assemblages in sediments along the canyon course may thus be governed by a combination of an ice-edge induced particle flux, episodic down-slope and canyon-guided transport mechanisms.

  18. Diversity of prokaryotic community at a shallow marine hydrothermal site elucidated by Illumina sequencing technology.

    PubMed

    Lentini, Valeria; Gugliandolo, Concetta; Bunk, Boyke; Overmann, Jörg; Maugeri, Teresa L

    2014-10-01

    To investigate the prokaryotic community structure and composition in an active hydrothermal site, named Black Point, off Panarea Island (Eolian Islands, Italy), we examined sediment and fluid samples, differing in temperature, by a massive parallel sequencing (Illumina) technique targeting the V3 region of the 16S rRNA gene. The used technique enabled us to detect a greater prokaryotic diversity than that until now observed and to reveal also microorganisms occurring at very low abundance (≤0.01 %). Most of sequences were assigned to Bacteria while Archaea were a minor component of the microbial community in both low- and high-temperature samples. Proteobacteria (mainly consisting of Alpha-, Gamma-, and Epsilonproteobacteria) dominated among all samples followed by Actinobacteria and Bacteroidetes. Analyzed DNA obtained from samples taken at different temperatures indicated the presence of members of different dominant genera. The main differences were observed between sediment samples where Rhodovulum and Thiohalospira prevailed at high temperature, while Thalassomonas and Sulfurimonas at low temperature. Chlorobium, Acinetobacter, Sulfurimonas, and Brevundimonas were abundant in both low- and high-temperature fluid samples. Euryarchaeota dominated the archaeal community in all samples. Classes of Euryarchaeota embracing hyperthermophilic members (Thermococci and Thermoplasmata) and of Crenarchaeota (Thermoprotei) were more abundant in high-temperature samples. A great number of sequences referred to Bacteria and Archaea still remained unaffiliated, indicating that Black Point site represents a rich source of so-far uncharted prokaryotic diversity. PMID:24849732

  19. GeneMark: web software for gene finding in prokaryotes, eukaryotes and viruses.

    PubMed

    Besemer, John; Borodovsky, Mark

    2005-07-01

    The task of gene identification frequently confronting researchers working with both novel and well studied genomes can be conveniently and reliably solved with the help of the GeneMark web software (http://opal.biology.gatech.edu/GeneMark/). The website provides interfaces to the GeneMark family of programs designed and tuned for gene prediction in prokaryotic, eukaryotic and viral genomic sequences. Currently, the server allows the analysis of nearly 200 prokaryotic and >10 eukaryotic genomes using species-specific versions of the software and pre-computed gene models. In addition, genes in prokaryotic sequences from novel genomes can be identified using models derived on the spot upon sequence submission, either by a relatively simple heuristic approach or by the full-fledged self-training program GeneMarkS. A database of reannotations of >1000 viral genomes by the GeneMarkS program is also available from the web site. The GeneMark website is frequently updated to provide the latest versions of the software and gene models. PMID:15980510

  20. Toolbox model of evolution of prokaryotic metabolic networks and their regulation.

    PubMed

    Maslov, Sergei; Krishna, Sandeep; Pang, Tin Yau; Sneppen, Kim

    2009-06-16

    It has been reported that the number of transcription factors encoded in prokaryotic genomes scales approximately quadratically with their total number of genes. We propose a conceptual explanation of this finding and illustrate it using a simple model in which metabolic and regulatory networks of prokaryotes are shaped by horizontal gene transfer of coregulated metabolic pathways. Adapting to a new environmental condition monitored by a new transcription factor (e.g., learning to use another nutrient) involves both acquiring new enzymes and reusing some of the enzymes already encoded in the genome. As the repertoire of enzymes of an organism (its toolbox) grows larger, it can reuse its enzyme tools more often and thus needs to get fewer new ones to master each new task. From this observation, it logically follows that the number of functional tasks and their regulators increases faster than linearly with the total number of genes encoding enzymes. Genomes can also shrink, e.g., because of a loss of a nutrient from the environment, followed by deletion of its regulator and all enzymes that become redundant. We propose several simple models of network evolution elaborating on this toolbox argument and reproducing the empirically observed quadratic scaling. The distribution of lengths of pathway branches in our model agrees with that of the real-life metabolic network of Escherichia coli. Thus, our model provides a qualitative explanation for broad distributions of regulon sizes in prokaryotes. PMID:19482938

  1. Diversity and Distribution of Prokaryotes within a Shallow-Water Pockmark Field.

    PubMed

    Giovannelli, Donato; d'Errico, Giuseppe; Fiorentino, Federica; Fattorini, Daniele; Regoli, Francesco; Angeletti, Lorenzo; Bakran-Petricioli, Tatjana; Vetriani, Costantino; Yücel, Mustafa; Taviani, Marco; Manini, Elena

    2016-01-01

    Pockmarks are crater-like depression on the seafloor associated with hydrocarbon ascent through muddy sediments in continental shelves around the world. In this study, we examine the diversity and distribution of benthic microbial communities at shallow-water pockmarks adjacent to the Middle Adriatic Ridge. We integrate microbial diversity data with characterization of local hydrocarbons concentrations and sediment geochemistry. Our results suggest these pockmarks are enriched in sedimentary hydrocarbons, and host a microbial community dominated by Bacteria, even in deeper sediment layers. Pockmark sediments showed higher prokaryotic abundance and biomass than surrounding sediments, potentially due to the increased availability of organic matter and higher concentrations of hydrocarbons linked to pockmark activity. Prokaryotic diversity analyses showed that the microbial communities of these shallow-water pockmarks are unique, and comprised phylotypes associated with the cycling of sulfur and nitrate compounds, as well as numerous know hydrocarbon degraders. Altogether, this study suggests that shallow-water pockmark habitats enhance the diversity of the benthic prokaryotic biosphere by providing specialized environmental niches. PMID:27379070

  2. Prokaryotic community composition revealed by denaturing gradient gel electrophoresis in the East Sea

    NASA Astrophysics Data System (ADS)

    Jang, Gwang Il; Choi, Dong Han

    2015-12-01

    To understand the temporal and spatial variation of the prokaryotic community in the East Sea, their composition was determined by polymerase chain reaction (PCR)-denaturing gradient gel electrophoresis (DGGE)-sequencing techniques. The investigations were conducted twice annually in 2007 and 2009 in coastal and offshore stations. Prokaryotic abundance (PA), leucine incorporation rate, and other environmental parameters were also measured. By using the DGGE approach, we obtained 283 bacterial sequences and 160 archaeal sequences. The most frequently detected bacterial phylotypes during the investigations belonged to Alphaproteobacteria, Gammaproteobacteria, and Bacteroidetes. However, their relative compositions differed in time and space. Although Alphaproteobacteria and Bacteroidetes were the dominant groups in the surface water in May 2007 and in May and October 2007, Gammaproteobacteria was dominant in mesopelagic samples. However, Gammaproteobacteria was overwhelmingly dominant in most samples in August 2009. Although Deltaproteobacteria was rarely found as a dominant bacterial group, it occupied the highest fraction in a mesopelagic sample in October 2007. Epsilonproteobacteria also showed a similar trend, although its maximal dominance was found in a mesopelagic sample in August 2009. The archaeal community was dominated overwhelmingly by members of the Euryarchaeota in most of the investigations. However, Nitrosopumilales was dominant in aphotic samples in August 2009. Further, their spatiotemporal composition at the family level changed more dynamically in the East Sea. These temporal and spatial distributions of the prokaryotic community were influenced mainly by seawater temperature and depth in the East Sea.

  3. Diversity and Distribution of Prokaryotes within a Shallow-Water Pockmark Field

    PubMed Central

    Giovannelli, Donato; d'Errico, Giuseppe; Fiorentino, Federica; Fattorini, Daniele; Regoli, Francesco; Angeletti, Lorenzo; Bakran-Petricioli, Tatjana; Vetriani, Costantino; Yücel, Mustafa; Taviani, Marco; Manini, Elena

    2016-01-01

    Pockmarks are crater-like depression on the seafloor associated with hydrocarbon ascent through muddy sediments in continental shelves around the world. In this study, we examine the diversity and distribution of benthic microbial communities at shallow-water pockmarks adjacent to the Middle Adriatic Ridge. We integrate microbial diversity data with characterization of local hydrocarbons concentrations and sediment geochemistry. Our results suggest these pockmarks are enriched in sedimentary hydrocarbons, and host a microbial community dominated by Bacteria, even in deeper sediment layers. Pockmark sediments showed higher prokaryotic abundance and biomass than surrounding sediments, potentially due to the increased availability of organic matter and higher concentrations of hydrocarbons linked to pockmark activity. Prokaryotic diversity analyses showed that the microbial communities of these shallow-water pockmarks are unique, and comprised phylotypes associated with the cycling of sulfur and nitrate compounds, as well as numerous know hydrocarbon degraders. Altogether, this study suggests that shallow-water pockmark habitats enhance the diversity of the benthic prokaryotic biosphere by providing specialized environmental niches. PMID:27379070

  4. P2CS: updates of the prokaryotic two-component systems database

    PubMed Central

    Ortet, Philippe; Whitworth, David E.; Santaella, Catherine; Achouak, Wafa; Barakat, Mohamed

    2015-01-01

    The P2CS database (http://www.p2cs.org/) is a comprehensive resource for the analysis of Prokaryotic Two-Component Systems (TCSs). TCSs are comprised of a receptor histidine kinase (HK) and a partner response regulator (RR) and control important prokaryotic behaviors. The latest incarnation of P2CS includes 164 651 TCS proteins, from 2758 sequenced prokaryotic genomes. Several important new features have been added to P2CS since it was last described. Users can search P2CS via BLAST, adding hits to their cart, and homologous proteins can be aligned using MUSCLE and viewed using Jalview within P2CS. P2CS also provides phylogenetic trees based on the conserved signaling domains of the RRs and HKs from entire genomes. HK and RR trees are annotated with gene organization and domain architecture, providing insights into the evolutionary origin of the contemporary gene set. The majority of TCSs are encoded by adjacent HK and RR genes, however, ‘orphan’ unpaired TCS genes are also abundant and identifying their partner proteins is challenging. P2CS now provides paired HK and RR trees with proteins from the same genetic locus indicated. This allows the appraisal of evolutionary relationships across entire TCSs and in some cases the identification of candidate partners for orphan TCS proteins. PMID:25324303

  5. A Novel Method for Accurate Operon Predictions in All SequencedProkaryotes

    SciTech Connect

    Price, Morgan N.; Huang, Katherine H.; Alm, Eric J.; Arkin, Adam P.

    2004-12-01

    We combine comparative genomic measures and the distance separating adjacent genes to predict operons in 124 completely sequenced prokaryotic genomes. Our method automatically tailors itself to each genome using sequence information alone, and thus can be applied to any prokaryote. For Escherichia coli K12 and Bacillus subtilis, our method is 85 and 83% accurate, respectively, which is similar to the accuracy of methods that use the same features but are trained on experimentally characterized transcripts. In Halobacterium NRC-1 and in Helicobacterpylori, our method correctly infers that genes in operons are separated by shorter distances than they are in E.coli, and its predictions using distance alone are more accurate than distance-only predictions trained on a database of E.coli transcripts. We use microarray data from sixphylogenetically diverse prokaryotes to show that combining intergenic distance with comparative genomic measures further improves accuracy and that our method is broadly effective. Finally, we survey operon structure across 124 genomes, and find several surprises: H.pylori has many operons, contrary to previous reports; Bacillus anthracis has an unusual number of pseudogenes within conserved operons; and Synechocystis PCC6803 has many operons even though it has unusually wide spacings between conserved adjacent genes.

  6. Cellular Viscosity in Prokaryotes and Thermal Stability of Low Molecular Weight Biomolecules.

    PubMed

    Cuecas, Alba; Cruces, Jorge; Galisteo-López, Juan F; Peng, Xiaojun; Gonzalez, Juan M

    2016-08-23

    Some low molecular weight biomolecules, i.e., NAD(P)H, are unstable at high temperatures. The use of these biomolecules by thermophilic microorganisms has been scarcely analyzed. Herein, NADH stability has been studied at different temperatures and viscosities. NADH decay increased at increasing temperatures. At increasing viscosities, NADH decay rates decreased. Thus, maintaining relatively high cellular viscosity in cells could result in increased stability of low molecular weight biomolecules (i.e., NADH) at high temperatures, unlike what was previously deduced from studies in diluted water solutions. Cellular viscosity was determined using a fluorescent molecular rotor in various prokaryotes covering the range from 10 to 100°C. Some mesophiles showed the capability of changing cellular viscosity depending on growth temperature. Thermophiles and extreme thermophiles presented a relatively high cellular viscosity, suggesting this strategy as a reasonable mechanism to thrive under these high temperatures. Results substantiate the capability of thermophiles and extreme thermophiles (growth range 50-80°C) to stabilize and use generally considered unstable, universal low molecular weight biomolecules. In addition, this study represents a first report, to our knowledge, on cellular viscosity measurements in prokaryotes and it shows the dependency of prokaryotic cellular viscosity on species and growth temperature. PMID:27558730

  7. A computational analysis of antisense off-targets in prokaryotic organisms.

    PubMed

    Worley-Morse, Thomas O; Gunsch, Claudia K

    2015-02-01

    The adoption of antisense gene silencing as a novel disinfectant for prokaryotic organisms is hindered by poor silencing efficiencies. Few studies have considered the effects of off-targets on silencing efficiencies, especially in prokaryotic organisms. In this computational study, a novel algorithm was developed that determined and sorted the number of off-targets as a function of alignment length in Escherichia coli K-12 MG1655 and Mycobacterium tuberculosis H37Rv. The mean number of off-targets per a single location was calculated to be 14.1 ± 13.3 and 36.1 ± 58.5 for the genomes of E. coli K-12 MG1655 and M. tuberculosis H37Rv, respectively. Furthermore, when the entire transcriptome was analyzed, it was found that there was no general gene location that could be targeted to minimize or maximize the number of off-targets. In an effort to determine the effects of off-targets on silencing efficiencies, previously published studies were used. Analyses with acpP, ino1, and marORAB revealed a statistically significant relationship between the number of short alignment length off-targets hybrids and the efficacy of the antisense gene silencing, suggesting that the minimization of off-targets may be beneficial for antisense gene silencing in prokaryotic organisms. PMID:25486012

  8. YcgC represents a new protein deacetylase family in prokaryotes

    PubMed Central

    Tu, Shun; Guo, Shu-Juan; Chen, Chien-Sheng; Liu, Cheng-Xi; Jiang, He-Wei; Ge, Feng; Deng, Jiao-Yu; Zhou, Yi-Ming; Czajkowsky, Daniel M; Li, Yang; Qi, Bang-Ruo; Ahn, Young-Hoon; Cole, Philip A; Zhu, Heng; Tao, Sheng-Ce

    2015-01-01

    Reversible lysine acetylation is one of the most important protein posttranslational modifications that plays essential roles in both prokaryotes and eukaryotes. However, only a few lysine deacetylases (KDACs) have been identified in prokaryotes, perhaps in part due to their limited sequence homology. Herein, we developed a ‘clip-chip’ strategy to enable unbiased, activity-based discovery of novel KDACs in the Escherichia coli proteome. In-depth biochemical characterization confirmed that YcgC is a serine hydrolase involving Ser200 as the catalytic nucleophile for lysine deacetylation and does not use NAD+ or Zn2+ like other established KDACs. Further, in vivo characterization demonstrated that YcgC regulates transcription by catalyzing deacetylation of Lys52 and Lys62 of a transcriptional repressor RutR. Importantly, YcgC targets a distinct set of substrates from the only known E. coli KDAC CobB. Analysis of YcgC’s bacterial homologs confirmed that they also exhibit KDAC activity. YcgC thus represents a novel family of prokaryotic KDACs. DOI: http://dx.doi.org/10.7554/eLife.05322.001 PMID:26716769

  9. Iridescence of a Marine Bacterium and Classification of Prokaryotic Structural Colors

    PubMed Central

    Vukusic, Peter; Luke, Stephen

    2012-01-01

    Iridescence is a property of structural color that is occasionally encountered in higher eukaryotes but that has been poorly documented in the prokaryotic kingdom. In the present work, we describe a marine bacterium, identified as Cellulophaga lytica, isolated from the surface of an anemone, that exhibits bright green iridescent colonies under direct epi-illumination. This phenomenon has not previously been investigated in detail. In this study, color changes of C. lytica colonies were observed at various angles of direct illumination or observation. Its iridescent green appearance was dominant on various growth media. Red and violet colors were also discerned on colony edges. Remarkable C. lytica bacterial iridescence was revealed and characterized using high-resolution optical spectrometry. In addition to this, by culturing other bacterial strains to which various forms of faintly iridescent traits have previously been attributed, we identify four principal appearance characteristics of structural color in prokaryotes. A new general classification of bacterial iridescence is therefore proposed in this study. Furthermore, a specific separate class is described for iridescent C. lytica strains because they exhibit what is so far a unique intense glitter-like iridescence in reflection. C. lytica is the first prokaryote discovered to produce the same sort of intense iridescence under direct illumination as that associated with higher eukaryotes, like some insects and birds. Due to the nature of bacterial biology, cultivation, and ubiquity, this discovery may be of significant interest for both ecological and nanoscience endeavors. PMID:22267664

  10. Intra-plastid protein trafficking; how plant cells adapted prokaryotic mechanisms to the eukaryotic condition

    PubMed Central

    Celedon, Jose M.; Cline, Kenneth

    2012-01-01

    Protein trafficking and localization in plastids involves a complex interplay between ancient (prokaryotic) and novel (eukaryotic) translocases and targeting machineries. During evolution, ancient systems acquired new functions and novel translocation machineries were developed to facilitate the correct localization of nuclear encoded proteins targeted to the chloroplast. Because of its post-translational nature, targeting and integration of membrane proteins posed the biggest challenge to the organelle to avoid aggregation in the aqueous compartments. Soluble proteins faced a different kind of problem since some had to be transported across three membranes to reach their destination. Early studies suggested that chloroplasts addressed these issues by adapting ancient-prokaryotic machineries and integrating them with novel-eukaryotic systems, a process called ‘conservative sorting’. In the last decade, detailed biochemical, genetic, and structural studies have unraveled the mechanisms of protein targeting and localization in chloroplasts, suggesting a highly integrated scheme where ancient and novel systems collaborate at different stages of the process. In this review we focus on the differences and similarities between chloroplast ancestral translocases and their prokaryotic relatives to highlight known modifications that adapted them to the eukaryotic situation. PMID:22750312

  11. Ecological traits of planktonic viruses and prokaryotes along a full-salinity gradient.

    PubMed

    Bettarel, Yvan; Bouvier, Thierry; Bouvier, Corinne; Carré, Claire; Desnues, Anne; Domaizon, Isabelle; Jacquet, Stéphan; Robin, Agnès; Sime-Ngando, Télesphore

    2011-05-01

    Virus-prokaryote interactions were investigated in four natural sites in Senegal (West Africa) covering a salinity gradient ranging from brackish (10‰) to near salt saturation (360‰). Both the viral and the prokaryote communities exhibited remarkable differences in their physiological, ecological and morphological traits along the gradient. Above 240‰ salinity, viral and prokaryotic abundance increased considerably with the emergence of (1) highly active square haloarchaea and of (2) viral particles with pleiomorphic morphologies (predominantly spindle, spherical and linear shaped). Viral life strategies also showed some salinity-driven dependence, switching from a prevalence of lytic to lysogenic modes of infection at the highest salinities. Interestingly, the fraction of lysogenized cells was positively correlated with the proportion of square cells. Overall, the extraordinary abundance of viruses in hypersaline systems (up to 6.8 × 10(8) virus-like particles per milliliter) appears to be partly explained by their high stability and specific ability to persist and proliferate in these apparently restrictive habitats. PMID:21255052

  12. De Novo Identification of Regulatory Regions in Intergenic Spaces of Prokaryotic Genomes

    SciTech Connect

    Chain, P; Garcia, E; Mcloughlin, K; Ovcharenko, I

    2007-02-20

    This project was begun to implement, test, and experimentally validate the results of a novel algorithm for genome-wide identification of candidate transcription-factor binding sites in prokaryotes. Most techniques used to identify regulatory regions rely on conservation between different genomes or have a predetermined sequence motif(s) to perform a genome-wide search. Therefore, such techniques cannot be used with new genome sequences, where information regarding such motifs has not yet been discovered. This project aimed to apply a de novo search algorithm to identify candidate binding-site motifs in intergenic regions of prokaryotic organisms, initially testing the available genomes of the Yersinia genus. We retrofitted existing nucleotide pattern-matching algorithms, analyzed the candidate sites identified by these algorithms as well as their target genes to screen for meaningful patterns. Using properly annotated prokaryotic genomes, this project aimed to develop a set of procedures to identify candidate intergenic sites important for gene regulation. We planned to demonstrate this in Yersinia pestis, a model biodefense, Category A Select Agent pathogen, and then follow up with experimental evidence that these regions are indeed involved in regulation. The ability to quickly characterize transcription-factor binding sites will help lead to a better understanding of how known virulence pathways are modulated in biodefense-related organisms, and will help our understanding and exploration of regulons--gene regulatory networks--and novel pathways for metabolic processes in environmental microbes.

  13. Molecular fossils of prokaryotes in ancient authigenic minerals: archives of microbial activity in reefs and mounds?

    NASA Astrophysics Data System (ADS)

    Heindel, Katrin; Birgel, Daniel; Richoz, Sylvain; Westphal, Hildegard; Peckmann, Jörn

    2016-04-01

    Molecular fossils (lipid biomarkers) are commonly used as proxies in organic-rich sediments of various sources, including eukaryotes and prokaryotes. Usually, molecular fossils of organisms transferred from the water column to the sediment are studied to monitor environmental changes (e.g., temperature, pH). Apart from these 'allochthonous' molecular fossils, prokaryotes are active in sediments and mats on the seafloor and leave behind 'autochthonous' molecular fossils in situ. In contrast to many phototrophic organisms, most benthic sedimentary prokaryotes are obtaining their energy from oxidation or reduction of organic or inorganic substrates. A peculiarity of some of the sediment-thriving prokaryotes is their ability to trigger in situ mineral precipitation, often but not only due to metabolic activity, resulting in authigenic rocks (microbialites). During that process, prokaryotes are rapidly entombed in the mineral matrix, where the molecular fossils are protected from early (bio)degradation. In contrast to other organic compounds (DNA, proteins etc.), molecular fossils can be preserved over very long time periods (millions of years). Thus, molecular fossils in authigenic mineral phases are perfectly suitable to trace microbial activity back in time. Among the best examples of molecular fossils, which are preserved in authigenic rocks are various microbialites, forming e.g. in phototrophic microbial mats and at cold seeps. Microbialite formation is reported throughout earth history. We here will focus on reefal microbialites form the Early Triassic and the Holocene. After the End-Permian mass extinction, microbialites covered wide areas on the ocean margins. In microbialites from the Griesbachian in Iran and Turkey (both Neotethys), molecular fossils of cyanobacteria, archaea, anoxygenic phototrophs, and sulphate-reducing bacteria indicate the presence of layered microbial mats on the seafloor, in which carbonate precipitation was induced. In association with

  14. Prokaryotic Community Structure Driven by Salinity and Ionic Concentrations in Plateau Lakes of the Tibetan Plateau

    PubMed Central

    Zhong, Zhi-Ping; Liu, Ying; Miao, Li-Li; Wang, Fang; Chu, Li-Min; Wang, Jia-Li

    2016-01-01

    The prokaryotic community composition and diversity and the distribution patterns at various taxonomic levels across gradients of salinity and physiochemical properties in the surface waters of seven plateau lakes in the Qaidam Basin, Tibetan Plateau, were evaluated using Illumina MiSeq sequencing. These lakes included Lakes Keluke (salinity, <1 g/liter), Qing (salinity, 5.5 to 6.6 g/liter), Tuosu (salinity, 24 to 35 g/liter), Dasugan (salinity, 30 to 33 g/liter), Gahai (salinity, 92 to 96 g/liter), Xiaochaidan (salinity, 94 to 99 g/liter), and Gasikule (salinity, 317 to 344 g/liter). The communities were dominated by Bacteria in lakes with salinities of <100 g/liter and by Archaea in Lake Gasikule. The clades At12OctB3 and Salinibacter, previously reported only in hypersaline environments, were found in a hyposaline lake (salinity, 5.5 to 6.6 g/liter) at an abundance of ∼1.0%, indicating their ecological plasticity. Salinity and the concentrations of the chemical ions whose concentrations covary with salinity (Mg2+, K+, Cl−, Na+, SO42−, and Ca2+) were found to be the primary environmental factors that directly or indirectly determined the composition and diversity at the level of individual clades as well as entire prokaryotic communities. The distribution patterns of two phyla, five classes, five orders, five families, and three genera were well predicted by salinity. The variation of the prokaryotic community structure also significantly correlated with the dissolved oxygen concentration, pH, the total nitrogen concentration, and the PO43− concentration. Such correlations varied depending on the taxonomic level, demonstrating the importance of comprehensive correlation analyses at various taxonomic levels in evaluating the effects of environmental variable factors on prokaryotic community structures. Our findings clarify the distribution patterns of the prokaryotic community composition in plateau lakes at the levels of individual clades as well as whole

  15. Prokaryotic Community Structure Driven by Salinity and Ionic Concentrations in Plateau Lakes of the Tibetan Plateau.

    PubMed

    Zhong, Zhi-Ping; Liu, Ying; Miao, Li-Li; Wang, Fang; Chu, Li-Min; Wang, Jia-Li; Liu, Zhi-Pei

    2016-03-01

    The prokaryotic community composition and diversity and the distribution patterns at various taxonomic levels across gradients of salinity and physiochemical properties in the surface waters of seven plateau lakes in the Qaidam Basin, Tibetan Plateau, were evaluated using Illumina MiSeq sequencing. These lakes included Lakes Keluke (salinity, <1 g/liter), Qing (salinity, 5.5 to 6.6 g/liter), Tuosu (salinity, 24 to 35 g/liter), Dasugan (salinity, 30 to 33 g/liter), Gahai (salinity, 92 to 96 g/liter), Xiaochaidan (salinity, 94 to 99 g/liter), and Gasikule (salinity, 317 to 344 g/liter). The communities were dominated by Bacteria in lakes with salinities of <100 g/liter and by Archaea in Lake Gasikule. The clades At12OctB3 and Salinibacter, previously reported only in hypersaline environments, were found in a hyposaline lake (salinity, 5.5 to 6.6 g/liter) at an abundance of ∼1.0%, indicating their ecological plasticity. Salinity and the concentrations of the chemical ions whose concentrations covary with salinity (Mg(2+), K(+), Cl(-), Na(+), SO4 (2-), and Ca(2+)) were found to be the primary environmental factors that directly or indirectly determined the composition and diversity at the level of individual clades as well as entire prokaryotic communities. The distribution patterns of two phyla, five classes, five orders, five families, and three genera were well predicted by salinity. The variation of the prokaryotic community structure also significantly correlated with the dissolved oxygen concentration, pH, the total nitrogen concentration, and the PO4 (3-) concentration. Such correlations varied depending on the taxonomic level, demonstrating the importance of comprehensive correlation analyses at various taxonomic levels in evaluating the effects of environmental variable factors on prokaryotic community structures. Our findings clarify the distribution patterns of the prokaryotic community composition in plateau lakes at the levels of individual clades as

  16. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  17. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  18. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  19. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  20. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  1. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  2. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  3. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  4. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  5. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  6. On the origins of cells: a hypothesis for the evolutionary transitions from abiotic geochemistry to chemoautotrophic prokaryotes, and from prokaryotes to nucleated cells.

    PubMed Central

    Martin, William; Russell, Michael J

    2003-01-01

    All life is organized as cells. Physical compartmentation from the environment and self-organization of self-contained redox reactions are the most conserved attributes of living things, hence inorganic matter with such attributes would be life's most likely forebear. We propose that life evolved in structured iron monosulphide precipitates in a seepage site hydrothermal mound at a redox, pH and temperature gradient between sulphide-rich hydrothermal fluid and iron(II)-containing waters of the Hadean ocean floor. The naturally arising, three-dimensional compartmentation observed within fossilized seepage-site metal sulphide precipitates indicates that these inorganic compartments were the precursors of cell walls and membranes found in free-living prokaryotes. The known capability of FeS and NiS to catalyse the synthesis of the acetyl-methylsulphide from carbon monoxide and methylsulphide, constituents of hydrothermal fluid, indicates that pre-biotic syntheses occurred at the inner surfaces of these metal-sulphide-walled compartments, which furthermore restrained reacted products from diffusion into the ocean, providing sufficient concentrations of reactants to forge the transition from geochemistry to biochemistry. The chemistry of what is known as the RNA-world could have taken place within these naturally forming, catalyticwalled compartments to give rise to replicating systems. Sufficient concentrations of precursors to support replication would have been synthesized in situ geochemically and biogeochemically, with FeS (and NiS) centres playing the central catalytic role. The universal ancestor we infer was not a free-living cell, but rather was confined to the naturally chemiosmotic, FeS compartments within which the synthesis of its constituents occurred. The first free-living cells are suggested to have been eubacterial and archaebacterial chemoautotrophs that emerged more than 3.8 Gyr ago from their inorganic confines. We propose that the emergence of these

  7. On the origins of cells: a hypothesis for the evolutionary transitions from abiotic geochemistry to chemoautotrophic prokaryotes, and from prokaryotes to nucleated cells.

    PubMed

    Martin, William; Russell, Michael J

    2003-01-29

    All life is organized as cells. Physical compartmentation from the environment and self-organization of self-contained redox reactions are the most conserved attributes of living things, hence inorganic matter with such attributes would be life's most likely forebear. We propose that life evolved in structured iron monosulphide precipitates in a seepage site hydrothermal mound at a redox, pH and temperature gradient between sulphide-rich hydrothermal fluid and iron(II)-containing waters of the Hadean ocean floor. The naturally arising, three-dimensional compartmentation observed within fossilized seepage-site metal sulphide precipitates indicates that these inorganic compartments were the precursors of cell walls and membranes found in free-living prokaryotes. The known capability of FeS and NiS to catalyse the synthesis of the acetyl-methylsulphide from carbon monoxide and methylsulphide, constituents of hydrothermal fluid, indicates that pre-biotic syntheses occurred at the inner surfaces of these metal-sulphide-walled compartments, which furthermore restrained reacted products from diffusion into the ocean, providing sufficient concentrations of reactants to forge the transition from geochemistry to biochemistry. The chemistry of what is known as the RNA-world could have taken place within these naturally forming, catalyticwalled compartments to give rise to replicating systems. Sufficient concentrations of precursors to support replication would have been synthesized in situ geochemically and biogeochemically, with FeS (and NiS) centres playing the central catalytic role. The universal ancestor we infer was not a free-living cell, but rather was confined to the naturally chemiosmotic, FeS compartments within which the synthesis of its constituents occurred. The first free-living cells are suggested to have been eubacterial and archaebacterial chemoautotrophs that emerged more than 3.8 Gyr ago from their inorganic confines. We propose that the emergence of these

  8. Microbial biomass and viral infections of heterotrophic prokaryotes in the sub-surface layer of the central Arctic Ocean

    NASA Astrophysics Data System (ADS)

    Steward, Grieg F.; Fandino, Laura B.; Hollibaugh, James T.; Whitledge, Terry E.; Azam, Farooq

    2007-10-01

    Seawater samples were collected for microbial analyses between 55 and 235 m depth across the Arctic Ocean during the SCICEX 97 expedition (03 September-02 October 1997) using a nuclear submarine as a research platform. Abundances of prokaryotes (range 0.043-0.47×10 9 dm -3) and viruses (range 0.68-11×10 9 dm -3) were correlated ( r=0.66, n=150) with an average virus:prokaryote ratio of 26 (range 5-70). Biomass of prokaryotes integrated from 55 to 235 m ranged from 0.27 to 0.85 g C m -2 exceeding that of phytoplankton (0.005-0.2 g C m -2) or viruses (0.02-0.05 g C m -2) over the same depth range by an order of magnitude on average. Using transmission electron microscopy (TEM), we estimated that 0.5% of the prokaryote community on average (range 0-1.4%) was visibly infected with viruses, which suggests that very little of prokaryotic secondary production was lost due to viral lysis. Intracellular viruses ranged from 5 to >200/cell, with an average apparent burst size of 45±38 (mean±s.d.; n=45). TEM also revealed the presence of putative metal-precipitating bacteria in 8 of 13 samples, which averaged 0.3% of the total prokaryote community (range 0-1%). If these prokaryotes are accessible to protistan grazers, the Fe and Mn associated with their capsules might be an important source of trace metals to the planktonic food web. After combining our abundance and mortality data with data from the literature, we conclude that the biomass of prokaryoplankton exceeds that of phytoplankton when averaged over the upper 250 m of the central Arctic Ocean and that the fate of this biomass is poorly understood.

  9. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  10. Fracture zones in the Mid Atlantic Ridge lead to alterations in prokaryotic and viral parameters in deep-water masses.

    PubMed

    Muck, Simone; Griessler, Thomas; Köstner, Nicole; Klimiuk, Adam; Winter, Christian; Herndl, Gerhard J

    2014-01-01

    We hypothesized that mixing zones of deep-water masses act as ecotones leading to alterations in microbial diversity and activity due to changes in the biogeochemical characteristics of these boundary systems. We determined the changes in prokaryotic and viral abundance and production in the Vema Fracture Zone (VFZ) of the subtropical North Atlantic Ocean, where North Atlantic Deep Water (NADW) and Antarctic Bottom Water (AABW) are funneled through this narrow canyon and therefore, are subjected to intense vertical mixing. Consequently, salinity, potential temperature, oxygen, PO4, SiO4, NO3 were altered in the NADW inside the VFZ as compared to the NADW outside of the VFZ. Also, viral abundance, lytic viral production (VP) and the virus-to-prokaryote ratio (VPR) were elevated in the NADW in the VFZ as compared to the NADW outside the VFZ. In contrast to lytic VP, lysogenic VP and both the frequency of lytically (FIC) and lysogenically infected cells (FLC) did not significantly differ between in- and outside the VFZ. Generally, FIC was higher than FLC throughout the water column. Prokaryotic (determined by T-RFLP) and viral (determined by RAPD-PCR) community composition was depth-stratified inside and outside the VFZ. The viral community was more modified both with depth and over distance inside the VFZ as compared to the northern section and to the prokaryotic communities. However, no clusters of prokaryotic and viral communities characteristic for the VFZ were identified. Based on our observations, we conclude that turbulent mixing of the deep water masses impacts not only the physico-chemical parameters of the mixing zone but also the interaction between viruses and prokaryotes due to a stimulation of the overall activity. However, only minor effects of deep water mixing were observed on the community composition of the dominant prokaryotes and viruses. PMID:24917857

  11. Two novel PRPF31 premessenger ribonucleic acid processing factor 31 homolog mutations including a complex insertion-deletion identified in Chinese families with retinitis pigmentosa

    PubMed Central

    Dong, Bing; Chen, Jieqiong; Zhang, Xiaohui; Pan, Zhe; Bai, Fengge

    2013-01-01

    Objective To identify the causative mutations in two Chinese families with retinitis pigmentosa (RP), and to describe the associated phenotype. Methods Individuals from two unrelated families underwent full ophthalmic examinations. After informed consent was obtained, genomic DNA was extracted from the venous blood of all participants. Linkage analysis was performed on the known genetic loci for autosomal dominant retinitis pigmentosa with a panel of polymorphic markers in the two families, and then all coding exons of the PRP31 premessenger ribonucleic acid processing factor 31 homolog (PRPF31) gene were screened for mutations with direct sequencing of PCR-amplified DNA fragments. Allele-specific PCR was used to validate a substitution in all available family members and 100 normal controls. A large deletion was detected with real-time quantitative PCR (RQ-PCR) using a panel of primers from regions around the PRPF31 gene. Long-range PCR, followed by DNA sequencing, was used to define the breakpoints. Results Clinical examination and pedigree analysis revealed two four-generation families (RP24 and RP106) with autosomal dominant retinitis pigmentosa. A significant two-point linkage odd disequilibrium score was generated at marker D19S926 (Zmax=3.55, θ=0) for family RP24 and D19S571 (Zmax=3.21, θ=0) for family RP106, and further linkage and haplotype studies confined the disease locus to chromosome 19q13.42 where the PRPF31 gene is located. Mutation screening of the PRPF31 gene revealed a novel deletion c.1215delG (p.G405fs+7X) in family RP106. The deletion cosegregated with the family’s disease phenotype, but was not found in 100 normal controls. No disease-causing mutation was detected in family RP24 with PCR-based sequencing analysis. RQ-PCR and long-range PCR analysis revealed a complex insertion-deletion (indel) in the patients of family RP24. The deletion is more than 19 kb and encompasses part of the PRPF31 gene (exons 1–3), together with three adjacent

  12. A comparison of cell-free placental messenger ribonucleic acid and color Doppler ultrasound for the prediction of placental invasion in patients with placenta accreta

    PubMed Central

    Naghshineh, Elham; Khorvash, Elahe; Kamali, Sara

    2015-01-01

    Background: The aim of the present study was to comparison between cell-free placental messenger ribonucleic acid (mRNA) and Doppler ultrasound for the prediction of placental invasion in women with placenta accreta. Materials and Methods: In this cross-sectional study, 50 pregnant women at risk for placenta accreta underwent color Doppler and assessment of cell-free placental mRNA. Real-time reverse-transcription polymerase chain reaction was used for measurement of cell-free placental mRNA in maternal plasma. Based on the findings at cesarean delivery and histological examination, patients were divided into two groups of women with and without placenta accrete. To compare of the mean of mRNA levels between the two groups we used independent t-test and to compare of the mean of age and gestational age at sonography we used Mann-Whitney test. For determination of sensitivity and specificity and the cut-off point of mRNA levels we used the receiver operating characteristic curve. Results: A total of 50 women with a mean age of 30.24 ± 4.905 years entered the study and 12 (24%) patients were diagnosed with placenta accreta. The sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of Doppler ultrasound were 83.3%, 78.9%, 56% and 94%, respectively. Results of our study showed if we consider a cut-off point equal to 3.325, with sensitivity and specificity of 0.917 and 0.789, respectively and the sensitivity, specificity, PPV and NPV of mRNA with were cut-off point of 3.325 were 91.7%, 78.9%, 57.9% and 96.8%, respectively. Conclusions: Cell-free mRNA is an acceptable, easy made, functional test with sensitivity, specificity, PPV and NPV more than Doppler ultrasound for diagnosis and prediction of incidence of placenta accrete and we recommend the use of cell-free mRNA test for diagnosis of placenta accreta. PMID:25709996

  13. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  14. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  15. Release and consumption of D-amino acids during growth of marine prokaryotes.

    PubMed

    Azúa, Iñigo; Goiriena, Itziar; Baña, Zuriñe; Iriberri, Juan; Unanue, Marian

    2014-01-01

    Analysis of the composition of the marine-dissolved organic matter has highlighted the importance of D-amino acids, whose origin is attributed mainly to the remains of bacterial peptidoglycan released as a result of grazing or viral lysis. However, very few studies have focused on the active release of D-amino acids by bacteria. With this purpose, we measured the concentration of dissolved amino acids in both enantiomeric forms with two levels of complexity: axenic cultures of Vibrio furnissii and Vibrio alginolyticus and microcosms created from marine microbial assemblages (Biscay Bay, Cantabrian Sea) with and without heterotrophic nanoflagellates (HNFs). Axenic cultures showed that only D-Ala was significantly released and accumulated in the medium up to a concentration of 120 nM, probably as a consequence of the rearrangement of peptidoglycan. The marine microbial assemblages showed that only two D-amino acids significantly accumulated in the environment, D-Ala and D-aspartic acid (Asp), in both the absence and presence of HNFs. The D/L ratio increased during the incubation and reached maximum values of 3.0 to 4.3 for Ala and 0.4 to 10.6 for Asp and correlated with prokaryotic and HNF abundance as well as the rate of prokaryotic thymidine and leucine incorporation. Prokaryotes preferentially consumed L-amino acids, but the relative uptake rates of D-Ala significantly increased in the growth phase. These results demonstrate that bacteria can release and consume D-amino acids at high rates during growth, even in the absence of viruses and grazers, highlighting the importance of bacteria as producers of dissolved organic matter (DOM) in the sea. PMID:24057323

  16. Analyzing the Differences and Preferences of Pathogenic and Nonpathogenic Prokaryote Species

    NASA Astrophysics Data System (ADS)

    Nolen, L.; Duong, K.; Heim, N. A.; Payne, J.

    2015-12-01

    A limited amount of knowledge exists on the large-scale characteristics and differences of pathogenic species in comparison to all prokaryotes. Pathogenic species, like other prokaryotes, have attributes specific to their environment and lifestyles. However, because they have evolved to coexist inside their hosts, the conditions they occupy may be more limited than those of non-pathogenic species. In this study we investigate the possibility of divergent evolution between pathogenic and non-pathogenic species by examining differences that may have evolved as a result of the need to adapt to their host. For this research we analyzed data collected from over 1900 prokaryotic species and performed t-tests using R to quantify potential differences in preferences. To examine the possible divergences from nonpathogenic bacteria, we focused on three variables: cell biovolume, preferred environmental pH, and preferred environmental temperature. We also looked at differences between pathogenic and nonpathogenic species belonging to the same phylum. Our results suggest a strong divergence in abiotic preferences between the two groups, with pathogens occupying a much smaller range of temperatures and pHs than their non-pathogenic counterparts. However, while the median biovolume is different when comparing pathogens and nonpathogens, we cannot conclude that the mean values are significantly different from each other. In addition, we found evidence of convergent evolution, as the temperature and pH preferences of pathogenic bacteria species from different phlya all approach the same values. Pathogenic species do not, however, all approach the same biovolume values, suggesting that specific pH and temperature preferences are more characteristic of pathogens than certain biovolumes.

  17. A Fungal-Prokaryotic Consortium at the Basalt-Zeolite Interface in Subseafloor Igneous Crust

    PubMed Central

    Ivarsson, Magnus; Bengtson, Stefan; Skogby, Henrik; Lazor, Peter; Broman, Curt; Belivanova, Veneta; Marone, Federica

    2015-01-01

    We have after half a century of coordinated scientific drilling gained insight into Earth´s largest microbial habitat, the subseafloor igneous crust, but still lack substantial understanding regarding its abundance, diversity and ecology. Here we describe a fossilized microbial consortium of prokaryotes and fungi at the basalt-zeolite interface of fractured subseafloor basalts from a depth of 240 m below seafloor (mbsf). The microbial consortium and its relationship with the surrounding physical environment are revealed by synchrotron-based X-ray tomographic microscopy (SRXTM), environmental scanning electron microscopy (ESEM), and Raman spectroscopy. The base of the consortium is represented by microstromatolites—remains of bacterial communities that oxidized reduced iron directly from the basalt. The microstromatolites and the surrounding basalt were overlaid by fungal cells and hyphae. The consortium was overgrown by hydrothermally formed zeolites but remained alive and active during this event. After its formation, fungal hyphae bored in the zeolite, producing millimetre-long tunnels through the mineral substrate. The dissolution could either serve to extract metals like Ca, Na and K essential for fungal growth and metabolism, or be a response to environmental stress owing to the mineral overgrowth. Our results show how microbial life may be maintained in a nutrient-poor and extreme environment by close ecological interplay and reveal an effective strategy for nutrient extraction from minerals. The prokaryotic portion of the consortium served as a carbon source for the eukaryotic portion. Such an approach may be a prerequisite for prokaryotic-eukaryotic colonisation of, and persistence in, subseafloor igneous crust. PMID:26488482

  18. Prokaryotic Diversity in the Rhizosphere of Organic, Intensive, and Transitional Coffee Farms in Brazil.

    PubMed

    Caldwell, Adam Collins; Silva, Lívia Carneiro Fidéles; da Silva, Cynthia Canêdo; Ouverney, Cleber Costa

    2015-01-01

    Despite a continuous rise in consumption of coffee over the past 60 years and recent studies showing positive benefits linked to human health, intensive coffee farming practices have been associated with environmental damage, risks to human health, and reductions in biodiversity. In contrast, organic farming has become an increasingly popular alternative, with both environmental and health benefits. This study aimed to characterize and determine the differences in the prokaryotic soil microbiology of three Brazilian coffee farms: one practicing intensive farming, one practicing organic farming, and one undergoing a transition from intensive to organic practices. Soil samples were collected from 20 coffee plant rhizospheres (soil directly influenced by the plant root exudates) and 10 control sites (soil 5 m away from the coffee plantation) at each of the three farms for a total of 90 samples. Profiling of 16S rRNA gene V4 regions revealed high levels of prokaryotic diversity in all three farms, with thousands of species level operational taxonomic units identified in each farm. Additionally, a statistically significant difference was found between each farm's coffee rhizosphere microbiome, as well as between coffee rhizosphere soils and control soils. Two groups of prokaryotes associated with the nitrogen cycle, the archaeal genus Candidatus Nitrososphaera and the bacterial order Rhizobiales were found to be abundant and statistically different in composition between the three farms and in inverse relationship to each other. Many of the nitrogen-fixing genera known to enhance plant growth were found in low numbers (e.g. Rhizobium, Agrobacter, Acetobacter, Rhodospirillum, Azospirillum), but the families in which they belong had some of the highest relative abundance in the dataset, suggesting many new groups may exist in these samples that can be further studied as potential plant growth-promoting bacteria to improve coffee production while diminishing negative

  19. Prokaryotic Super Program Advisory Committee DOE Joint Genome Institute, Walnut Creek, CA, March 27, 2013

    PubMed Central

    Garrity, George M.; Banfield, Jill; Eisen, Jonathan; van der Lelie, Niels; McMahon, Trina; Rusch, Doug; DeLong, Edward; Moran, Mary Ann; Currie, Cameron; Furhman, Jed; Hallam, Steve; Hugenholtz, Phil; Moran, Nancy; Nelson, Karen; Roberts, Richard; Stepanauskas, Ramunas

    2013-01-01

    The Prokaryotic Super Program Advisory Committee met on March 27, 2013 for their annual review the Prokaryotic Super Program at the DOE Joint Genome Institute. As is the case with any site visit or program review, the objective is to evaluate progress in meeting organizational objectives, provide feedback to from the user-community and to assist the JGI in formulating plans for the coming year. The advisors want to commend the JGI for its central role in developing new technologies and capabilities, and for catalyzing the formation of new collaborative user communities. Highlights of the post-meeting exchanges among the advisors focused on the importance of programmatic initiatives including: • GEBA, which serves as a phylogenetic “base-map” on which our knowledge of functional diversity can be layered. • FEBA, which promises to provide new insights into the physiological capabilities of prokaryotes under highly standardized conditions. • Single-cell genomics technology, which is seen to significantly enhance our ability to interpret genomic and metagenomic data and broaden the scope of the GEBA program to encompass at least a part of the microbial “dark-matter”. • IMG, which is seen to play a central role in JGI programs and is viewed as a strategically important asset in the JGI portfolio. On this latter point, the committee encourages the formation of a strategic relationship between IMG and the Kbase to ensure that the intelligence, deep knowledge and experience captured in the former is not lost. The committee strongly urges the DOE to continue its support for maintaining this critical resource. PMID:24501639

  20. Late acquisition of mitochondria by a host with chimaeric prokaryotic ancestry.

    PubMed

    Pittis, Alexandros A; Gabaldón, Toni

    2016-03-01

    The origin of eukaryotes stands as a major conundrum in biology. Current evidence indicates that the last eukaryotic common ancestor already possessed many eukaryotic hallmarks, including a complex subcellular organization. In addition, the lack of evolutionary intermediates challenges the elucidation of the relative order of emergence of eukaryotic traits. Mitochondria are ubiquitous organelles derived from an alphaproteobacterial endosymbiont. Different hypotheses disagree on whether mitochondria were acquired early or late during eukaryogenesis. Similarly, the nature and complexity of the receiving host are debated, with models ranging from a simple prokaryotic host to an already complex proto-eukaryote. Most competing scenarios can be roughly grouped into either mito-early, which consider the driving force of eukaryogenesis to be mitochondrial endosymbiosis into a simple host, or mito-late, which postulate that a significant complexity predated mitochondrial endosymbiosis. Here we provide evidence for late mitochondrial endosymbiosis. We use phylogenomics to directly test whether proto-mitochondrial proteins were acquired earlier or later than other proteins of the last eukaryotic common ancestor. We find that last eukaryotic common ancestor protein families of alphaproteobacterial ancestry and of mitochondrial localization show the shortest phylogenetic distances to their closest prokaryotic relatives, compared with proteins of different prokaryotic origin or cellular localization. Altogether, our results shed new light on a long-standing question and provide compelling support for the late acquisition of mitochondria into a host that already had a proteome of chimaeric phylogenetic origin. We argue that mitochondrial endosymbiosis was one of the ultimate steps in eukaryogenesis and that it provided the definitive selective advantage to mitochondria-bearing eukaryotes over less complex forms. PMID:26840490

  1. Prokaryotic Diversity in the Rhizosphere of Organic, Intensive, and Transitional Coffee Farms in Brazil

    PubMed Central

    Caldwell, Adam Collins; Silva, Lívia Carneiro Fidéles; da Silva, Cynthia Canêdo; Ouverney, Cleber Costa

    2015-01-01

    Despite a continuous rise in consumption of coffee over the past 60 years and recent studies showing positive benefits linked to human health, intensive coffee farming practices have been associated with environmental damage, risks to human health, and reductions in biodiversity. In contrast, organic farming has become an increasingly popular alternative, with both environmental and health benefits. This study aimed to characterize and determine the differences in the prokaryotic soil microbiology of three Brazilian coffee farms: one practicing intensive farming, one practicing organic farming, and one undergoing a transition from intensive to organic practices. Soil samples were collected from 20 coffee plant rhizospheres (soil directly influenced by the plant root exudates) and 10 control sites (soil 5 m away from the coffee plantation) at each of the three farms for a total of 90 samples. Profiling of 16S rRNA gene V4 regions revealed high levels of prokaryotic diversity in all three farms, with thousands of species level operational taxonomic units identified in each farm. Additionally, a statistically significant difference was found between each farm’s coffee rhizosphere microbiome, as well as between coffee rhizosphere soils and control soils. Two groups of prokaryotes associated with the nitrogen cycle, the archaeal genus Candidatus Nitrososphaera and the bacterial order Rhizobiales were found to be abundant and statistically different in composition between the three farms and in inverse relationship to each other. Many of the nitrogen-fixing genera known to enhance plant growth were found in low numbers (e.g. Rhizobium, Agrobacter, Acetobacter, Rhodospirillum, Azospirillum), but the families in which they belong had some of the highest relative abundance in the dataset, suggesting many new groups may exist in these samples that can be further studied as potential plant growth-promoting bacteria to improve coffee production while diminishing negative

  2. Characterization of a prokaryotic haemerythrin from the methanotrophic bacterium Methylococcus capsulatus (Bath).

    PubMed

    Karlsen, Odd A; Ramsevik, Linda; Bruseth, Live J; Larsen, Øivind; Brenner, Annette; Berven, Frode S; Jensen, Harald B; Lillehaug, Johan R

    2005-05-01

    For a long time, the haemerythrin family of proteins was considered to be restricted to only a few phyla of marine invertebrates. When analysing differential protein expression in the methane-oxidizing bacterium, Methylococcus capsulatus (Bath), grown at a high and low copper-to-biomass ratio, respectively, we identified a putative prokaryotic haemerythrin expressed in high-copper cultures. Haemerythrins are recognized by a conserved sequence motif that provides five histidines and two carboxylate ligands which coordinate two iron atoms. The diiron site is located in a hydrophobic pocket and is capable of binding O(2). We cloned the M. capsulatus haemerythrin gene and expressed it in Escherichia coli as a fusion protein with NusA. The haemerythrin protein was purified to homogeneity cleaved from its fusion partner. Recombinant M. capsulatus haemerythrin (McHr) was found to fold into a stable protein. Sequence similarity analysis identified all the candidate residues involved in the binding of diiron (His22, His58, Glu62, His77, His81, His117, Asp122) and the amino acids forming the hydrophobic pocket in which O(2) may bind (Ile25, Phe59, Trp113, Leu114, Ile118). We were also able to model a three-dimensional structure of McHr maintaining the correct positioning of these residues. Furthermore, UV/vis spectrophotometric analysis demonstrated the presence of conjugated diiron atoms in McHr. A comprehensive genomic database search revealed 21 different prokaryotes containing the haemerythrin signature (PROSITE 00550), indicating that these putative haemerythrins may be a conserved prokaryotic subfamily. PMID:15885093

  3. Prokaryotic Super Program Advisory Committee DOE Joint Genome Institute, Walnut Creek, CA, March 27, 2013.

    PubMed

    Garrity, George M; Banfield, Jill; Eisen, Jonathan; van der Lelie, Niels; McMahon, Trina; Rusch, Doug; Delong, Edward; Moran, Mary Ann; Currie, Cameron; Furhman, Jed; Hallam, Steve; Hugenholtz, Phil; Moran, Nancy; Nelson, Karen; Roberts, Richard; Stepanauskas, Ramunas

    2013-07-30

    The Prokaryotic Super Program Advisory Committee met on March 27, 2013 for their annual review the Prokaryotic Super Program at the DOE Joint Genome Institute. As is the case with any site visit or program review, the objective is to evaluate progress in meeting organizational objectives, provide feedback to from the user-community and to assist the JGI in formulating plans for the coming year. The advisors want to commend the JGI for its central role in developing new technologies and capabilities, and for catalyzing the formation of new collaborative user communities. Highlights of the post-meeting exchanges among the advisors focused on the importance of programmatic initiatives including: • GEBA, which serves as a phylogenetic "base-map" on which our knowledge of functional diversity can be layered. • FEBA, which promises to provide new insights into the physiological capabilities of prokaryotes under highly standardized conditions. • Single-cell genomics technology, which is seen to significantly enhance our ability to interpret genomic and metagenomic data and broaden the scope of the GEBA program to encompass at least a part of the microbial "dark-matter". • IMG, which is seen to play a central role in JGI programs and is viewed as a strategically important asset in the JGI portfolio. On this latter point, the committee encourages the formation of a strategic relationship between IMG and the Kbase to ensure that the intelligence, deep knowledge and experience captured in the former is not lost. The committee strongly urges the DOE to continue its support for maintaining this critical resource. PMID:24501639

  4. Relationships between Meiofaunal Biodiversity and Prokaryotic Heterotrophic Production in Different Tropical Habitats and Oceanic Regions

    PubMed Central

    Pusceddu, Antonio; Gambi, Cristina; Corinaldesi, Cinzia; Scopa, Mariaspina; Danovaro, Roberto

    2014-01-01

    Tropical marine ecosystems are among the most diverse of the world oceans, so that assessing the linkages between biodiversity and ecosystem functions (BEF) is a crucial step to predict consequences of biodiversity loss. Most BEF studies in marine ecosystems have been carried out on macrobenthic diversity, whereas the influence of the meiofauna on ecosystem functioning has received much less attention. We compared meiofaunal and nematode biodiversity and prokaryotic heterotrophic production across seagrass, mangrove and reef sediments in the Caribbean, Celebes and Red Seas. For all variables we report the presence of differences among habitats within the same region, and among regions within the same habitat. In all regions, the richness of meiofaunal taxa in reef and seagrass sediments is higher than in mangrove sediments. The sediments of the Celebes Sea show the highest meiofaunal biodiversity. The composition of meiofaunal assemblages varies significantly among habitats in the same region. The nematode beta diversity among habitats within the same region is higher than the beta diversity among regions. Although one site per habitat was considered in each region, these results suggest that the composition of meiofaunal assemblages varies primarily among biogeographic regions, whereas the composition of nematode assemblages varies more considerably among habitats. Meiofauna and nematode biodiversity and prokaryotic heterotrophic production, even after the removal of covariate effects linked with longitude and the quantity and nutritional quality of organic matter, are positively and linearly linked both across regions and within each habitat type. Our results confirm that meiofauna and nematode biodiversity may influence benthic prokaryotic activity, which, in turn, implies that diversity loss could have negative impacts on ecosystem functioning in these systems. PMID:24603709

  5. Prokaryote-derived protein inhibitors of peptidases: a sketchy occurrence and mostly unknown function

    PubMed Central

    Kantyka, Tomasz; Rawlings, Neil D.; Potempa, Jan

    2010-01-01

    In metazoan organisms protein inhibitors of peptidases are important factors essential for regulation of proteolytic activity. In vertebrates genes encoding peptidase inhibitors constitute up to 1% of genes reflecting a need for tight and specific control of proteolysis especially in extracellular body fluids. In stark contrast unicellular organisms, both prokaryotic and eukaryotic consistently contain only few, if any, genes coding for putative peptidase inhibitors. This may seem perplexing in the light of the fact that these organisms produce large numbers of proteases of different catalytic classes with the genes constituting up to 6% of the total gene count with the average being about 3%. Apparently, however, a unicellular life-style is fully compatible with other mechanisms of regulation of proteolysis and does not require protein inhibitors to control their intracellular and extracellular proteolytic activity. So in prokaryotes occurrence of genes encoding different types of peptidase inhibitors is infrequent and often scattered among phylogenetically distinct orders or even phyla of microbiota. Genes encoding proteins homologous to alpha-2-macroglobulin (family I39), serine carboxypeptidase Y inhibitor (family I51), alpha-1-peptidase inhibitor (family I4) and ecotin (family I11) are the most frequently represented in Bacteria. Although several of these gene products were shown to possess inhibitory activity, with an exception of ecotin and staphostatins, the biological function of microbial inhibitors is unclear. In this review we present distribution of protein inhibitors from different families among prokaryotes, describe their mode of action and hypothesize on their role in microbial physiology and interactions with hosts and environment. PMID:20558234

  6. A Fungal-Prokaryotic Consortium at the Basalt-Zeolite Interface in Subseafloor Igneous Crust.

    PubMed

    Ivarsson, Magnus; Bengtson, Stefan; Skogby, Henrik; Lazor, Peter; Broman, Curt; Belivanova, Veneta; Marone, Federica

    2015-01-01

    We have after half a century of coordinated scientific drilling gained insight into Earth´s largest microbial habitat, the subseafloor igneous crust, but still lack substantial understanding regarding its abundance, diversity and ecology. Here we describe a fossilized microbial consortium of prokaryotes and fungi at the basalt-zeolite interface of fractured subseafloor basalts from a depth of 240 m below seafloor (mbsf). The microbial consortium and its relationship with the surrounding physical environment are revealed by synchrotron-based X-ray tomographic microscopy (SRXTM), environmental scanning electron microscopy (ESEM), and Raman spectroscopy. The base of the consortium is represented by microstromatolites-remains of bacterial communities that oxidized reduced iron directly from the basalt. The microstromatolites and the surrounding basalt were overlaid by fungal cells and hyphae. The consortium was overgrown by hydrothermally formed zeolites but remained alive and active during this event. After its formation, fungal hyphae bored in the zeolite, producing millimetre-long tunnels through the mineral substrate. The dissolution could either serve to extract metals like Ca, Na and K essential for fungal growth and metabolism, or be a response to environmental stress owing to the mineral overgrowth. Our results show how microbial life may be maintained in a nutrient-poor and extreme environment by close ecological interplay and reveal an effective strategy for nutrient extraction from minerals. The prokaryotic portion of the consortium served as a carbon source for the eukaryotic portion. Such an approach may be a prerequisite for prokaryotic-eukaryotic colonisation of, and persistence in, subseafloor igneous crust. PMID:26488482

  7. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  8. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  9. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  10. Temporal and depth-related differences in prokaryotic communities in abyssal sediments associated with particulate organic carbon flux

    NASA Astrophysics Data System (ADS)

    Moeseneder, M. M.; Smith, K. L.; Ruhl, H. A.; Jones, D. O. B.; Witte, U.; Prosser, J. I.

    2012-12-01

    Particulate organic carbon (POC) flux is hypothesized to be the most important parameter influencing activity and biomass of prokaryotic and faunal communities in the abyssal seafloor, but there is little evidence of POC-related changes in community composition of prokaryotes. This hypothesis was tested by 16S rRNA-gene-based analysis of prokaryotic DNA and RNA extracted from abyssal seafloor sediments during periods of low and high POC flux. Fingerprint analysis of prokaryotic communities indicated that approximately 50% of the phylotypes were identical at each sediment horizon, regardless of the temporal variations in POC flux. However, phylotypes were also detected that represented a relatively dynamic component of these communities and were probably strongly influenced by the prevalent POC flux regime. These patterns were also detected in deeper sediment horizons. DNA- and RNA-based community profiles differed, although both approaches had similar community dynamics. Crenarchaeota showed the strongest shift in community composition in response to availability of labile POC, indicating that POC flux may have a more pronounced impact on crenarchaeal communities than on bacterial communities. The high number of phylotypes common to each sample time suggests that both standing stock and active prokaryotic communities are stable.

  11. Short-term under-ice variability of prokaryotic plankton communities in coastal Antarctic waters (Cape Hallett, Ross Sea)

    NASA Astrophysics Data System (ADS)

    Celussi, Mauro; Paoli, Alessandro; Crevatin, Erica; Bergamasco, Andrea; Margiotta, Francesca; Saggiomo, Vincenzo; Umani, Serena Fonda; Del Negro, Paola

    2009-03-01

    During the 2006 Italian Antarctic expedition a diel sampling was performed close to Cape Hallett (Ross Sea) during the Austral summer. Under-ice seawater samples (˜4 m) were collected every 2 h for 28 h in order to estimate prokaryotic processes' variability and community structure dynamics. Prokaryotic and viral abundances, exoenzymatic activities (β-glucosidase, chitinase, lipase, alkaline phosphatase and leucine aminopeptidase), prokaryotic carbon production ( 3H-leucine incorporation) and community structure (Denaturing Gradient Gel Electrophoresis - DGGE fingerprints) were analysed. Results showed that the diel variability of the prokaryotic activity followed a variation in salinity, probably as a consequence of the periodical thawing of sea ice (driven by solar radiation and air temperature cycles), while negligible variation in viral and prokaryotic abundances occurred. The Bacterial and Archaeal community structures underwent an Operational Taxonomic Units (OTUs) temporal shift from the beginning to the end of the sampling, while Flavobacteria-specific primers highlighted high variations in this group possibly related to sea ice melting and substrate release.

  12. Keeping the Wolves at Bay: Antitoxins of Prokaryotic Type II Toxin-Antitoxin Systems

    PubMed Central

    Chan, Wai Ting; Espinosa, Manuel; Yeo, Chew Chieng

    2016-01-01

    In their initial stages of discovery, prokaryotic toxin-antitoxin (TA) systems were confined to bacterial plasmids where they function to mediate the maintenance and stability of usually low- to medium-copy number plasmids through the post-segregational killing of any plasmid-free daughter cells that developed. Their eventual discovery as nearly ubiquitous and repetitive elements in bacterial chromosomes led to a wealth of knowledge and scientific debate as to their diversity and functionality in the prokaryotic lifestyle. Currently categorized into six different types designated types I–VI, type II TA systems are the best characterized. These generally comprised of two genes encoding a proteic toxin and its corresponding proteic antitoxin, respectively. Under normal growth conditions, the stable toxin is prevented from exerting its lethal effect through tight binding with the less stable antitoxin partner, forming a non-lethal TA protein complex. Besides binding with its cognate toxin, the antitoxin also plays a role in regulating the expression of the type II TA operon by binding to the operator site, thereby repressing transcription from the TA promoter. In most cases, full repression is observed in the presence of the TA complex as binding of the toxin enhances the DNA binding capability of the antitoxin. TA systems have been implicated in a gamut of prokaryotic cellular functions such as being mediators of programmed cell death as well as persistence or dormancy, biofilm formation, as defensive weapons against bacteriophage infections and as virulence factors in pathogenic bacteria. It is thus apparent that these antitoxins, as DNA-binding proteins, play an essential role in modulating the prokaryotic lifestyle whilst at the same time preventing the lethal action of the toxins under normal growth conditions, i.e., keeping the proverbial wolves at bay. In this review, we will cover the diversity and characteristics of various type II TA antitoxins. We shall

  13. Antimicrobial Activity of Pantothenol against Staphylococci Possessing a Prokaryotic Type II Pantothenate Kinase

    PubMed Central

    Chohnan, Shigeru; Murase, Misa; Kurikawa, Kota; Higashi, Kodai; Ogata, Yuta

    2014-01-01

    Pantothenol is a provitamin of pantothenic acid (vitamin B5) that is widely used in healthcare and cosmetic products. This analog of pantothenate has been shown to markedly inhibit the phosphorylation activity of the prokaryotic type II pantothenate kinase of Staphylococcus aureus, which catalyzes the first step of the coenzyme A biosynthetic pathway. Since type II enzymes are found exclusively in staphylococci, pantothenol suppresses the growth of S. aureus, S. epidermidis, and S. saprophyticus, which inhabit the skin of humans. Therefore, the addition of this provitamin to ointment and skincare products may be highly effective in preventing infections by opportunistic pathogens. PMID:24759689

  14. Harnessing the Prokaryotic Adaptive Immune System as a Eukaryotic Antiviral Defense.

    PubMed

    Price, Aryn A; Grakoui, Arash; Weiss, David S

    2016-04-01

    Clustered, regularly interspaced, short palindromic repeats - CRISPR-associated (CRISPR-Cas) systems - are sequence-specific RNA-directed endonuclease complexes that bind and cleave nucleic acids. These systems evolved within prokaryotes as adaptive immune defenses to target and degrade nucleic acids derived from bacteriophages and other foreign genetic elements. The antiviral function of these systems has now been exploited to combat eukaryotic viruses throughout the viral life cycle. Here we discuss current advances in CRISPR-Cas9 technology as a eukaryotic antiviral defense. PMID:26852268

  15. Keeping the Wolves at Bay: Antitoxins of Prokaryotic Type II Toxin-Antitoxin Systems.

    PubMed

    Chan, Wai Ting; Espinosa, Manuel; Yeo, Chew Chieng

    2016-01-01

    In their initial stages of discovery, prokaryotic toxin-antitoxin (TA) systems were confined to bacterial plasmids where they function to mediate the maintenance and stability of usually low- to medium-copy number plasmids through the post-segregational killing of any plasmid-free daughter cells that developed. Their eventual discovery as nearly ubiquitous and repetitive elements in bacterial chromosomes led to a wealth of knowledge and scientific debate as to their diversity and functionality in the prokaryotic lifestyle. Currently categorized into six different types designated types I-VI, type II TA systems are the best characterized. These generally comprised of two genes encoding a proteic toxin and its corresponding proteic antitoxin, respectively. Under normal growth conditions, the stable toxin is prevented from exerting its lethal effect through tight binding with the less stable antitoxin partner, forming a non-lethal TA protein complex. Besides binding with its cognate toxin, the antitoxin also plays a role in regulating the expression of the type II TA operon by binding to the operator site, thereby repressing transcription from the TA promoter. In most cases, full repression is observed in the presence of the TA complex as binding of the toxin enhances the DNA binding capability of the antitoxin. TA systems have been implicated in a gamut of prokaryotic cellular functions such as being mediators of programmed cell death as well as persistence or dormancy, biofilm formation, as defensive weapons against bacteriophage infections and as virulence factors in pathogenic bacteria. It is thus apparent that these antitoxins, as DNA-binding proteins, play an essential role in modulating the prokaryotic lifestyle whilst at the same time preventing the lethal action of the toxins under normal growth conditions, i.e., keeping the proverbial wolves at bay. In this review, we will cover the diversity and characteristics of various type II TA antitoxins. We shall

  16. Prokaryotic gene prediction using GeneMark and GeneMark.hmm.

    PubMed

    Borodovsky, Mark; Mills, Ryan; Besemer, John; Lomsadze, Alex

    2003-05-01

    In this unit, the GeneMark and GeneMark.hmm programs are presented as two different methods for the in silico prediction of genes in prokaryotes. GeneMark can be used for whole genome analysis as well as for the local analysis of a particular gene and its surrounding regions. GeneMark.hmm makes use of Hidden Markov models to find the transition points (boundaries) between protein coding states and noncoding states and can be efficiently used for larger genome sequences. These methods can be used in conjunction with each other for a higher sensitivity of gene detection. PMID:18428700

  17. The Influence of pH on Prokaryotic Cell Size and Temperature

    NASA Astrophysics Data System (ADS)

    Sundararajan, D.; Gutierrez, F.; Heim, N. A.; Payne, J.

    2015-12-01

    The pH of a habitat is essential to an organism's growth and success in its environment. Although most organisms maintain a neutral internal pH, their environmental pH can vary greatly. However, little research has been done concerning an organism's environmental pH across a wide range of taxa. We studied pH tolerance in prokaryotes and its relationship with biovolume, taxonomic classification, and ideal temperature. We had three hypotheses: pH and temperature are not correlated; pH tolerance is similar within taxonomic groups; and extremophiles have small cell sizes. To test these hypotheses, we used pH, size, and taxonomic data from The Prokaryotes. We found that the mean optimum external pH was neutral for prokaryotes as a whole and when divided by domain, phylum, and class. Using ANOVA to test for pH within and among group variances, we found that variation of pH in domains, phyla, classes, and families was greater than between them. pH and size did not show much of a correlation, except that the largest and smallest sized prokaryotes had nearly neutral pH. This seems significant because extremophiles need to divert more of their energy from growth to maintain a neutral internal pH. Acidophiles showed a larger range of optimum pH values than alkaliphiles. A similar result was seen with the minimum and maximum pH values of acidophiles and alkaliphiles. While acidophiles were spread out and had some alkaline maximum values, alkaliphiles had smaller ranges, and unlike some acidophiles that had pH minimums close to zero, alkaliphile pH maximums did not go beyond a pH of 12. No statistically significant differences were found between sizes of acidophiles and alkaliphiles. However, optimum temperatures of acidophiles and alkaliphiles did have a statistically significant difference. pH and temperature had a negative correlation. Therefore, pH seems to have a correlation with cell size, temperature, and taxonomy to some extent.

  18. Metabolic engineering with systems biology tools to optimize production of prokaryotic secondary metabolites.

    PubMed

    Kim, Hyun Uk; Charusanti, Pep; Lee, Sang Yup; Weber, Tilmann

    2016-08-27

    Covering: 2012 to 2016Metabolic engineering using systems biology tools is increasingly applied to overproduce secondary metabolites for their potential industrial production. In this Highlight, recent relevant metabolic engineering studies are analyzed with emphasis on host selection and engineering approaches for the optimal production of various prokaryotic secondary metabolites: native versus heterologous hosts (e.g., Escherichia coli) and rational versus random approaches. This comparative analysis is followed by discussions on systems biology tools deployed in optimizing the production of secondary metabolites. The potential contributions of additional systems biology tools are also discussed in the context of current challenges encountered during optimization of secondary metabolite production. PMID:27072921

  19. VESPA: Software to Facilitate Genomic Annotation of Prokaryotic Organisms Through Integration of Proteomic and Transcriptomic Data

    SciTech Connect

    Peterson, Elena S.; McCue, Lee Ann; Rutledge, Alexandra C.; Jensen, Jeffrey L.; Walker, Julia; Kobold, Mark A.; Webb, Samantha R.; Payne, Samuel H.; Ansong, Charles; Adkins, Joshua N.; Cannon, William R.; Webb-Robertson, Bobbie-Jo M.

    2012-04-25

    Visual Exploration and Statistics to Promote Annotation (VESPA) is an interactive visual analysis software tool that facilitates the discovery of structural mis-annotations in prokaryotic genomes. VESPA integrates high-throughput peptide-centric proteomics data and oligo-centric or RNA-Seq transcriptomics data into a genomic context. The data may be interrogated via visual analysis across multiple levels of genomic resolution, linked searches, exports and interaction with BLAST to rapidly identify location of interest within the genome and evaluate potential mis-annotations.

  20. Synechocystis Strain PCC 6803 cya2, a Prokaryotic Gene That Encodes a Guanylyl Cyclase

    PubMed Central

    Ochoa de Alda, Jesús A. G.; Ajlani, Ghada; Houmard, Jean

    2000-01-01

    Synechocystis strain PCC 6803 exhibits similar levels of cyclic AMP (cAMP) and cyclic GMP (cGMP). A thorough analysis of its genome showed that Cya2 (Sll0646) has all the sequence determinants required in terms of activity and purine specificity for being a guanylyl cyclase. Insertional mutagenesis of cya2 caused a marked reduction in cGMP content without altering the cAMP content. Thus, Cya2 represents the first example of a prokaryotic guanylyl cyclase. PMID:10851002

  1. Characterization of a prokaryotic topoisomerase I activity in chloroplast extracts from spinach.

    PubMed

    Siedlecki, J; Zimmermann, W; Weissbach, A

    1983-03-11

    A topoisomerase I activity has been partially purified from crude extracts of spinach chloroplasts. This activity relaxes the supercoiled covalently closed circular DNA of pBR322. The enzyme requires Mg++, but not ATP, and has an apparent molecular weight of about 115,000. It catalyzes a unit change in the linkage number of supercoiled DNA but cannot relax positive supercoiled DNA. These characteristics of the topoisomerase suggest it is of the prokaryotic type and would tend to support the endosymbiotic theory of plastid origin and evolution. PMID:6298746

  2. Antimicrobial activity of pantothenol against staphylococci possessing a prokaryotic type II pantothenate kinase.

    PubMed

    Chohnan, Shigeru; Murase, Misa; Kurikawa, Kota; Higashi, Kodai; Ogata, Yuta

    2014-01-01

    Pantothenol is a provitamin of pantothenic acid (vitamin B5) that is widely used in healthcare and cosmetic products. This analog of pantothenate has been shown to markedly inhibit the phosphorylation activity of the prokaryotic type II pantothenate kinase of Staphylococcus aureus, which catalyzes the first step of the coenzyme A biosynthetic pathway. Since type II enzymes are found exclusively in staphylococci, pantothenol suppresses the growth of S. aureus, S. epidermidis, and S. saprophyticus, which inhabit the skin of humans. Therefore, the addition of this provitamin to ointment and skincare products may be highly effective in preventing infections by opportunistic pathogens. PMID:24759689

  3. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  4. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  5. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  6. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  7. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  8. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  9. Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

    PubMed Central

    Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

    2015-01-01

    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. PMID:25861819

  10. Diversity of acidophilic prokaryotes at two acid mine drainage sites in Turkey.

    PubMed

    Aytar, Pınar; Kay, Catherine Melanie; Mutlu, Mehmet Burçin; Çabuk, Ahmet; Johnson, David Barrie

    2015-04-01

    The biodiversity of acidophilic prokaryotes in two acidic (pH 2.8-3.05) mine drainage (AMD) sites (Balya and Çan) in Turkey was examined using a combined cultivation-based and cultivation-independent approach. The latter included analyzing microbial diversity using fluorescent in situ hybridization (FISH), terminal restriction enzyme fragment length polymorphism (`T-RFLP), and quantitative PCR (qPCR). Numbers of cultivatable heterotrophic acidophilic bacteria were over an order of magnitude greater than those of chemolithotrophic acidophiles in both AMD ponds examined. Isolates identified as strains of Acidithiobacillus ferrivorans, Acidiphilium organovorum, and Ferrimicrobium acidiphilum were isolated from the Balya AMD pond, and others identified as strains of Leptospirillum ferriphilum, Acidicapsa ligni, and Acidiphilium rubrum from Çan AMD. Other isolates were too distantly related (from analysis of their 16S rRNA genes) to be identified at the species level. Archaeal diversity in the two ponds appeared to be far more limited. T-RFLP and qPCR confirmed the presence of Ferroplasma-like prokaryotes, but no archaea were isolated from the two sites. qPCR generated semiquantitative data for genera of some of the iron-oxidizing acidophiles isolated and/or detected, suggesting the order of abundance was Leptospirillum > Ferroplasma > Acidithiobacillus (Balya AMD) and Ferroplasma > Leptospirillum > Acidithiobacillus (Çan AMD). PMID:25380633

  11. Translational arrest by a prokaryotic signal recognition particle is mediated by RNA interactions.

    PubMed

    Beckert, Bertrand; Kedrov, Alexej; Sohmen, Daniel; Kempf, Georg; Wild, Klemens; Sinning, Irmgard; Stahlberg, Henning; Wilson, Daniel N; Beckmann, Roland

    2015-10-01

    The signal recognition particle (SRP) recognizes signal sequences of nascent polypeptides and targets ribosome-nascent chain complexes to membrane translocation sites. In eukaryotes, translating ribosomes are slowed down by the Alu domain of SRP to allow efficient targeting. In prokaryotes, however, little is known about the structure and function of Alu domain-containing SRPs. Here, we report a complete molecular model of SRP from the Gram-positive bacterium Bacillus subtilis, based on cryo-EM. The SRP comprises two subunits, 6S RNA and SRP54 or Ffh, and it facilitates elongation slowdown similarly to its eukaryotic counterpart. However, protein contacts with the small ribosomal subunit observed for the mammalian Alu domain are substituted in bacteria by RNA-RNA interactions of 6S RNA with the α-sarcin-ricin loop and helices H43 and H44 of 23S rRNA. Our findings provide a structural basis for cotranslational targeting and RNA-driven elongation arrest in prokaryotes. PMID:26344568

  12. Prediction of Metabolic Pathway Involvement in Prokaryotic UniProtKB Data by Association Rule Mining

    PubMed Central

    Hoehndorf, Robert; Martin, Maria J.; Solovyev, Victor

    2016-01-01

    The widening gap between known proteins and their functions has encouraged the development of methods to automatically infer annotations. Automatic functional annotation of proteins is expected to meet the conflicting requirements of maximizing annotation coverage, while minimizing erroneous functional assignments. This trade-off imposes a great challenge in designing intelligent systems to tackle the problem of automatic protein annotation. In this work, we present a system that utilizes rule mining techniques to predict metabolic pathways in prokaryotes. The resulting knowledge represents predictive models that assign pathway involvement to UniProtKB entries. We carried out an evaluation study of our system performance using cross-validation technique. We found that it achieved very promising results in pathway identification with an F1-measure of 0.982 and an AUC of 0.987. Our prediction models were then successfully applied to 6.2 million UniProtKB/TrEMBL reference proteome entries of prokaryotes. As a result, 663,724 entries were covered, where 436,510 of them lacked any previous pathway annotations. PMID:27390860

  13. Variability of Prokaryotic Community Structure in a Drinking Water Reservoir (Marathonas, Greece)

    PubMed Central

    Lymperopoulou, Despoina S.; Kormas, Konstantinos Ar.; Karagouni, Amalia D.

    2012-01-01

    The structure of the Bacteria and Archaea community in a large drinking water reservoir (Marathonas, Greece; MR) was investigated in October 2007 and September 2008, using 16S rRNA gene clone libraries. The bacterial communities were more diverse than archaeal communities (Shannon diversity index H′ 0.81–3.28 and 1.36–1.77, respectively). The overall bacterial community composition was comparable to bacterioplankton community described in other freshwater habitats. Within the Bacteria, Betaproteobacteria dominated, while representatives of Alpha-, Gamma- and Deltaproteobacteria also occurred. Other important phyla were Actinobacteria and Bacteroidetes, while representatives of Acidobacteria, Cyanobacteria, Chloroflexi, Planctomycetes and Verrucomicrobia were also retrieved. Several phylotypes in Alpha- and Betaproteobacteria and Bacteroidetes were related to bacteria capable of cyanotoxin degradation and with aromatic compounds/iron oxidizers or polymer degraders. Euryarchaeota dominated (60.5%) the Archaea community mostly with phylotypes related to Methanobacteriales and Methanosarcinales. Among the Thaumarchaeota, the two most abundant phylotypes were affiliated (97% similarity) with the only cultivated mesophilic thaumarchaeote of marine origin, Nitrosopumilus maritimus. Temporal and spatial comparison of the prokaryotic community structure revealed that three of the most abundant prokaryotic phylotypes, belonging to Actinobacteria, were recovered from all sites both years, suggesting that these Actinobacteria could be important key players in MR ecosystem functioning. PMID:21971081

  14. ProGlycProt: a repository of experimentally characterized prokaryotic glycoproteins

    PubMed Central

    Bhat, Aadil H.; Mondal, Homchoru; Chauhan, Jagat S.; Raghava, Gajendra P. S.; Methi, Amrish; Rao, Alka

    2012-01-01

    ProGlycProt (http://www.proglycprot.org/) is an open access, manually curated, comprehensive repository of bacterial and archaeal glycoproteins with at least one experimentally validated glycosite (glycosylated residue). To facilitate maximum information at one point, the database is arranged under two sections: (i) ProCGP—the main data section consisting of 95 entries with experimentally characterized glycosites and (ii) ProUGP—a supplementary data section containing 245 entries with experimentally identified glycosylation but uncharacterized glycosites. Every entry in the database is fully cross-referenced and enriched with available published information about source organism, coding gene, protein, glycosites, glycosylation type, attached glycan, associated oligosaccharyl/glycosyl transferases (OSTs/GTs), supporting references, and applicable additional information. Interestingly, ProGlycProt contains as many as 174 entries for which information is unavailable or the characterized glycosites are unannotated in Swiss-Prot release 2011_07. The website supports a dedicated structure gallery of homology models and crystal structures of characterized glycoproteins in addition to two new tools developed in view of emerging information about prokaryotic sequons (conserved sequences of amino acids around glycosites) that are never or rarely seen in eukaryotic glycoproteins. ProGlycProt provides an extensive compilation of experimentally identified glycosites (334) and glycoproteins (340) of prokaryotes that could serve as an information resource for research and technology applications in glycobiology. PMID:22039152

  15. A novel species of ellipsoidal multicellular magnetotactic prokaryotes from Lake Yuehu in China.

    PubMed

    Chen, Yi-Ran; Zhang, Rui; Du, Hai-Jian; Pan, Hong-Miao; Zhang, Wen-Yan; Zhou, Ke; Li, Jin-Hua; Xiao, Tian; Wu, Long-Fei

    2015-03-01

    Two morphotypes of multicellular magnetotactic prokaryotes (MMPs) have been identified: spherical (several species) and ellipsoidal (previously one species). Here, we report novel ellipsoidal MMPs that are ∼ 10 × 8 μm in size, and composed of about 86 cells arranged in six to eight interlaced circles. Each MMP was composed of cells that synthesized either bullet-shaped magnetite magnetosomes alone, or both bullet-shaped magnetite and rectangular greigite magnetosomes. They showed north-seeking magnetotaxis, ping-pong motility and negative phototaxis at a velocity up to 300 μm s(-1) . During reproduction, they divided along either their long- or short-body axes. For genetic analysis, we sorted the ellipsoidal MMPs with micromanipulation and amplified their genomes using multiple displacement amplification. We sequenced the 16S rRNA gene and found 6.9% sequence divergence from that of ellipsoidal MMPs, Candidatus Magnetananas tsingtaoensis and > 8.3% divergence from those of spherical MMPs. Therefore, the novel MMPs belong to different species and genus compared with the currently known ellipsoidal and spherical MMPs respectively. The novel MMPs display a morphological cell differentiation, implying a potential division of labour. These findings provide new insights into the diversity of MMPs in general, and contribute to our understanding of the evolution of multicellularity among prokaryotes. PMID:24725306

  16. Cell adhesion, multicellular morphology, and magnetosome distribution in the multicellular magnetotactic prokaryote Candidatus Magnetoglobus multicellularis.

    PubMed

    Abreu, Fernanda; Silva, Karen Tavares; Leão, Pedro; Guedes, Iame Alves; Keim, Carolina Neumann; Farina, Marcos; Lins, Ulysses

    2013-06-01

    Candidatus Magnetoglobus multicellularis is an uncultured magnetotactic multicellular prokaryote composed of 17-40 Gram-negative cells that are capable of synthesizing organelles known as magnetosomes. The magnetosomes of Ca. M. multicellularis are composed of greigite and are organized in chains that are responsible for the microorganism's orientation along magnetic field lines. The characteristics of the microorganism, including its multicellular life cycle, magnetic field orientation, and swimming behavior, and the lack of viability of individual cells detached from the whole assembly, are considered strong evidence for the existence of a unique multicellular life cycle among prokaryotes. It has been proposed that the position of each cell within the aggregate is fundamental for the maintenance of its distinctive morphology and magnetic field orientation. However, the cellular organization of the whole organism has never been studied in detail. Here, we investigated the magnetosome organization within a cell, its distribution within the microorganism, and the intercellular relationships that might be responsible for maintaining the cells in the proper position within the microorganism, which is essential for determining the magnetic properties of Ca. M. multicellularis during its life cycle. The results indicate that cellular interactions are essential for the determination of individual cell shape and the magnetic properties of the organism and are likely directly associated with the morphological changes that occur during the multicellular life cycle of this species. PMID:23551897

  17. MapRepeat: an approach for effective assembly of repetitive regions in prokaryotic genomes

    PubMed Central

    Mariano, Diego CB; Pereira, Felipe L; Ghosh, Preetam; Barh, Debmalya; Figueiredo, Henrique CP; Silva, Artur; Ramos, Rommel TJ; Azevedo, Vasco AC

    2015-01-01

    The newest technologies for DNA sequencing have led to the determination of the primary structure of the genomes of organisms, mainly prokaryotes, with high efficiency and at lower costs. However, the presence of regions with repetitive sequences, in addition to the short reads produced by the Next-Generation Sequencing (NGS) platforms, created a lot of difficulty in reconstructing the original genome in silico. Thus, even today, genome assembly continues to be one of the major challenges in bioinformatics specifically when repetitive sequences are considered. In this paper, we present an approach to assemble repetitive regions in prokaryotic genomes. Our methodology enables (i) the identification of these regions through visual tools, (ii) the characterization of sequences on the extremities of gaps and (iii) the extraction of consensus sequences based on mapping of raw data to a reference genome. We also present a case study on the assembly of regions that encode ribosomal RNAs (rRNA) in the genome of Corynebacterium ulcerans FRC11, in order to show the efficiency of the strategies presented here. The proposed methods and tools will help in finishing genome assemblies, besides reducing the running time and associated costs. Availability All scripts are available at http://github.com/dcbmariano/maprepeat PMID:26229287

  18. Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river

    PubMed Central

    Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

    2013-01-01

    Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47–48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

  19. Pyrosequencing assessment of prokaryotic and eukaryotic diversity in biofilm communities from a French river.

    PubMed

    Bricheux, Geneviève; Morin, Loïc; Le Moal, Gwenaël; Coffe, Gérard; Balestrino, Damien; Charbonnel, Nicolas; Bohatier, Jacques; Forestier, Christiane

    2013-06-01

    Despite the recent and significant increase in the study of aquatic microbial communities, little is known about the microbial diversity of complex ecosystems such as running waters. This study investigated the biodiversity of biofilm communities formed in a river with 454 Sequencing™. This river has the particularity of integrating both organic and microbiological pollution, as receiver of agricultural pollution in its upstream catchment area and urban pollution through discharges of the wastewater treatment plant of the town of Billom. Different regions of the small subunit (SSU) ribosomal RNA gene were targeted using nine pairs of primers, either universal or specific for bacteria, eukarya, or archaea. Our aim was to characterize the widest range of rDNA sequences using different sets of polymerase chain reaction (PCR) primers. A first look at reads abundance revealed that a large majority (47-48%) were rare sequences (<5 copies). Prokaryotic phyla represented the species richness, and eukaryotic phyla accounted for a small part. Among the prokaryotic phyla, Proteobacteria (beta and alpha) predominated, followed by Bacteroidetes together with a large number of nonaffiliated bacterial sequences. Bacillariophyta plastids were abundant. The remaining bacterial phyla, Verrucomicrobia and Cyanobacteria, made up the rest of the bulk biodiversity. The most abundant eukaryotic phyla were annelid worms, followed by Diatoms, and Chlorophytes. These latter phyla attest to the abundance of plastids and the importance of photosynthetic activity for the biofilm. These findings highlight the existence and plasticity of multiple trophic levels within these complex biological systems. PMID:23520129

  20. GeneTack database: genes with frameshifts in prokaryotic genomes and eukaryotic mRNA sequences.

    PubMed

    Antonov, Ivan; Baranov, Pavel; Borodovsky, Mark

    2013-01-01

    Database annotations of prokaryotic genomes and eukaryotic mRNA sequences pay relatively low attention to frame transitions that disrupt protein-coding genes. Frame transitions (frameshifts) could be caused by sequencing errors or indel mutations inside protein-coding regions. Other observed frameshifts are related to recoding events (that evolved to control expression of some genes). Earlier, we have developed an algorithm and software program GeneTack for ab initio frameshift finding in intronless genes. Here, we describe a database (freely available at http://topaz.gatech.edu/GeneTack/db.html) containing genes with frameshifts (fs-genes) predicted by GeneTack. The database includes 206 991 fs-genes from 1106 complete prokaryotic genomes and 45 295 frameshifts predicted in mRNA sequences from 100 eukaryotic genomes. The whole set of fs-genes was grouped into clusters based on sequence similarity between fs-proteins (conceptually translated fs-genes), conservation of the frameshift position and frameshift direction (-1, +1). The fs-genes can be retrieved by similarity search to a given query sequence via a web interface, by fs-gene cluster browsing, etc. Clusters of fs-genes are characterized with respect to their likely origin, such as pseudogenization, phase variation, etc. The largest clusters contain fs-genes with programed frameshifts (related to recoding events). PMID:23161689

  1. Tellurium as a valuable tool for studying the prokaryotic origins of mitochondria.

    PubMed

    Pontieri, Paola; De Stefano, Mario; Massardo, Domenica Rita; Gunge, Norio; Miyakawa, Isamu; Sando, Nobundo; Pignone, Domenico; Pizzolante, Graziano; Romano, Roberta; Alifano, Pietro; Del Giudice, Luigi

    2015-04-01

    Mitochondria are eukaryotic organelles which contain the own genetic material and evolved from free-living Eubacteria, namely hydrogen-producing Alphaproteobacteria. Since 1965, biologists provided, by research at molecular level, evidence for the prokaryotic origins of mitochondria. However, determining the precise origins of mitochondria is challenging due to inherent difficulties in phylogenetically reconstructing ancient evolutionary events. The use of new tools to evidence the prokaryotic origin of mitochondria could be useful to gain an insight into the bacterial endosymbiotic event that resulted in the permanent acquisition of bacteria, from the ancestral cell, that through time were transformed into mitochondria. Electron microscopy has shown that both proteobacterial and yeast cells during their growth in the presence of increasing amount of tellurite resulted in dose-dependent blackening of the culture due to elemental tellurium (Te(0)) that formed large deposits either along the proteobacterial membrane or along the yeast cell wall and mitochondria. Since the mitochondrial inner membrane composition is similar to that of proteobacterial membrane, in the present work we evidenced the black tellurium deposits on both, cell wall and mitochondria of ρ(+) and respiratory deficient ρ(-) mutants of yeast. A possible role of tellurite in studying the evolutionary origins of mitochondria will be discussed. PMID:25644076

  2. Comprehensive Analysis of Prokaryotes in Environmental Water Using DNA Microarray Analysis and Whole Genome Amplification

    PubMed Central

    Akama, Takeshi; Kawashima, Akira; Tanigawa, Kazunari; Hayashi, Moyuru; Ishido, Yuko; Luo, Yuqian; Hata, Akihisa; Fujitani, Noboru; Ishii, Norihisa; Suzuki, Koichi

    2013-01-01

    The microflora in environmental water consists of a high density and diversity of bacterial species that form the foundation of the water ecosystem. Because the majority of these species cannot be cultured in vitro, a different approach is needed to identify prokaryotes in environmental water. A novel DNA microarray was developed as a simplified detection protocol. Multiple DNA probes were designed against each of the 97,927 sequences in the DNA Data Bank of Japan and mounted on a glass chip in duplicate. Evaluation of the microarray was performed using the DNA extracted from one liter of environmental water samples collected from seven sites in Japan. The extracted DNA was uniformly amplified using whole genome amplification (WGA), labeled with Cy3-conjugated 16S rRNA specific primers and hybridized to the microarray. The microarray successfully identified soil bacteria and environment-specific bacteria clusters. The DNA microarray described herein can be a useful tool in evaluating the diversity of prokaryotes and assessing environmental changes such as global warming. PMID:25437334

  3. A universal strategy for regulating mRNA translation in prokaryotic and eukaryotic cells

    PubMed Central

    Cao, Jicong; Arha, Manish; Sudrik, Chaitanya; Mukherjee, Abhirup; Wu, Xia; Kane, Ravi S.

    2015-01-01

    We describe a simple strategy to control mRNA translation in both prokaryotic and eukaryotic cells which relies on a unique protein–RNA interaction. Specifically, we used the Pumilio/FBF (PUF) protein to repress translation by binding in between the ribosome binding site (RBS) and the start codon (in Escherichia coli), or by binding to the 5′ untranslated region of target mRNAs (in mammalian cells). The design principle is straightforward, the extent of translational repression can be tuned and the regulator is genetically encoded, enabling the construction of artificial signal cascades. We demonstrate that this approach can also be used to regulate polycistronic mRNAs; such regulation has rarely been achieved in previous reports. Since the regulator used in this study is a modular RNA-binding protein, which can be engineered to target different 8-nucleotide RNA sequences, our strategy could be used in the future to target endogenous mRNAs for regulating metabolic flows and signaling pathways in both prokaryotic and eukaryotic cells. PMID:25845589

  4. Potential of Cathodoluminescence Microscopy and Spectroscopy for the Detection of Prokaryotic Cells on Minerals

    NASA Astrophysics Data System (ADS)

    Rommevaux-Jestin, Céline; Ménez, Bénédicte

    2010-11-01

    Detecting mineral-hosted ecosystems to assess the extent and functioning of the biosphere from the surface to deep Earth requires appropriate techniques that provide, beyond the morphological criteria, indubitable clues of the presence of prokaryotic cells. Here, we evaluate the capability of cathodoluminescence microscopy and spectroscopy, implemented on a scanning electron microscope, to identify prokaryotes on mineral surfaces. For this purpose, we used, as a first step, a simple model of either unstained or stained cultivable cells (Escherichia coli, Deinococcus radiodurans) deposited on minerals that are common in the oceanic crust (basaltic glass, amphibole, pyroxene, and magnetite). Our results demonstrate that the detection of cells is possible at the micrometric level on the investigated minerals through the intrinsic fluorescence of their constituting macromolecules (aromatic amino and nucleic acids, coenzymes). This allows us to distinguish biomorph inorganic phases from cells. This easily implemented technique permits an exploration of colonized rock samples. In addition, the range of spectrometric techniques available on a scanning electron microscope can provide additional information on the nature and chemistry of the associated mineral phases, which would lead to a simultaneous characterization of cells, their microhabitats, and a better understanding of their potential relationships.

  5. SigMol: repertoire of quorum sensing signaling molecules in prokaryotes

    PubMed Central

    Rajput, Akanksha; Kaur, Karambir; Kumar, Manoj

    2016-01-01

    Quorum sensing is a widespread phenomenon in prokaryotes that helps them to communicate among themselves and with eukaryotes. It is driven through quorum sensing signaling molecules (QSSMs) in a density dependent manner that assists in numerous biological functions like biofilm formation, virulence factors secretion, swarming motility, bioluminescence, etc. Despite immense implications, dedicated resources of QSSMs are lacking. Therefore, we have developed SigMol (http://bioinfo.imtech.res.in/manojk/sigmol), a specialized repository of these molecules in prokaryotes. SigMol harbors information on QSSMs pertaining to different quorum sensing signaling systems namely acylated homoserine lactones (AHLs), diketopiperazines (DKPs), 4-hydroxy-2-alkylquinolines (HAQs), diffusible signal factors (DSFs), autoinducer-2 (AI-2) and others. Database contains 1382 entries of 182 unique signaling molecules from 215 organisms. It encompasses biological as well as chemical aspects of signaling molecules. Biological information includes genes, preliminary bioassays, identification assays and applications, while chemical detail comprises of IUPAC name, SMILES and structure. We have provided user-friendly browsing and searching facilities for easy data retrieval and comparison. We have gleaned information of diverse QSSMs reported in literature at a single platform ‘SigMol’. This comprehensive resource will assist the scientific community in understanding intraspecies, interspecies or interkingdom networking and further help to unfold different facets of quorum sensing and related therapeutics. PMID:26490957

  6. Microbial diversity and adaptation to high hydrostatic pressure in deep-sea hydrothermal vents prokaryotes.

    PubMed

    Jebbar, Mohamed; Franzetti, Bruno; Girard, Eric; Oger, Philippe

    2015-07-01

    Prokaryotes inhabiting in the deep sea vent ecosystem will thus experience harsh conditions of temperature, pH, salinity or high hydrostatic pressure (HHP) stress. Among the fifty-two piezophilic and piezotolerant prokaryotes isolated so far from different deep-sea environments, only fifteen (four Bacteria and eleven Archaea) that are true hyper/thermophiles and piezophiles have been isolated from deep-sea hydrothermal vents; these belong mainly to the Thermococcales order. Different strategies are used by microorganisms to thrive in deep-sea hydrothermal vents in which "extreme" physico-chemical conditions prevail and where non-adapted organisms cannot live, or even survive. HHP is known to impact the structure of several cellular components and functions, such as membrane fluidity, protein activity and structure. Physically the impact of pressure resembles a lowering of temperature, since it reinforces the structure of certain molecules, such as membrane lipids, and an increase in temperature, since it will also destabilize other structures, such as proteins. However, universal molecular signatures of HHP adaptation are not yet known and are still to be deciphered. PMID:26101015

  7. [Characterization of the Structure of the Prokaryotic Complex of Antarctic Permafrost by Molecular Genetic Techniques].

    PubMed

    Manucharova, N A; Trosheva, E V; Kol'tsova, E M; Demkina, E V; Karaevskaya, E V; Rivkina, E M; Mardanov, A V; El'-Registan, G I

    2016-01-01

    A prokaryotic mesophilic organotrophic community responsible for 10% of the total microbial number determined by epifluorescence microscopy was reactivated in the samples ofAntarctic permafrost retrieved from the environment favoring long-term preservation of microbial communities (7500 years). No culturable forms were obtained without resuscitation procedures (CFU = 0). Proteobacteria, Actinobacteria, and Firmicutes were the dominant microbial groups in the complex. Initiation of the reactivated microbial complex by addition of chitin (0.1% wt/vol) resulted in an increased share of metabolically active biomass (up to 50%) due to the functional domination of chitinolytics caused by the target resource. Thus, sequential application of resuscitation procedures and initiation of a specific physiological group (in this case, chitinolytics) to a permafrost-preserved microbial community made it possible to reveal a prokaryotic complex capable of reversion of metabolic activity (FISH data), to determine its phylogenetic structure by metagenomic anal-ysis, and to isolate a pure culture of the dominant microorganism with high chitinolytic activity. PMID:27301132

  8. OxyGene: an innovative platform for investigating oxidative-response genes in whole prokaryotic genomes

    PubMed Central

    Thybert, David; Avner, Stéphane; Lucchetti-Miganeh, Céline; Chéron, Angélique; Barloy-Hubler, Frédérique

    2008-01-01

    Background Oxidative stress is a common stress encountered by living organisms and is due to an imbalance between intracellular reactive oxygen and nitrogen species (ROS, RNS) and cellular antioxidant defence. To defend themselves against ROS/RNS, bacteria possess a subsystem of detoxification enzymes, which are classified with regard to their substrates. To identify such enzymes in prokaryotic genomes, different approaches based on similarity, enzyme profiles or patterns exist. Unfortunately, several problems persist in the annotation, classification and naming of these enzymes due mainly to some erroneous entries in databases, mistake propagation, absence of updating and disparity in function description. Description In order to improve the current annotation of oxidative stress subsystems, an innovative platform named OxyGene has been developed. It integrates an original database called OxyDB, holding thoroughly tested anchor-based signatures associated to subfamilies of oxidative stress enzymes, and a new anchor-driven annotator, for ab initio detection of ROS/RNS response genes. All complete Bacterial and Archaeal genomes have been re-annotated, and the results stored in the OxyGene repository can be interrogated via a Graphical User Interface. Conclusion OxyGene enables the exploration and comparative analysis of enzymes belonging to 37 detoxification subclasses in 664 microbial genomes. It proposes a new classification that improves both the ontology and the annotation of the detoxification subsystems in prokaryotic whole genomes, while discovering new ORFs and attributing precise function to hypothetical annotated proteins. OxyGene is freely available at: PMID:19117520

  9. Deep-biosphere consortium of fungi and prokaryotes in Eocene subseafloor basalts.

    PubMed

    Bengtson, S; Ivarsson, M; Astolfo, A; Belivanova, V; Broman, C; Marone, F; Stampanoni, M

    2014-11-01

    The deep biosphere of the subseafloor crust is believed to contain a significant part of Earth's biomass, but because of the difficulties of directly observing the living organisms, its composition and ecology are poorly known. We report here a consortium of fossilized prokaryotic and eukaryotic micro-organisms, occupying cavities in deep-drilled vesicular basalt from the Emperor Seamounts, Pacific Ocean, 67.5 m below seafloor (mbsf). Fungal hyphae provide the framework on which prokaryote-like organisms are suspended like cobwebs and iron-oxidizing bacteria form microstromatolites (Frutexites). The spatial inter-relationships show that the organisms were living at the same time in an integrated fashion, suggesting symbiotic interdependence. The community is contemporaneous with secondary mineralizations of calcite partly filling the cavities. The fungal hyphae frequently extend into the calcite, indicating that they were able to bore into the substrate through mineral dissolution. A symbiotic relationship with chemoautotrophs, as inferred for the observed consortium, may be a pre-requisite for the eukaryotic colonization of crustal rocks. Fossils thus open a window to the extant as well as the ancient deep biosphere. PMID:25214186

  10. Non-Gaussian statistics of anomalous diffusion: The DNA sequences of prokaryotes

    NASA Astrophysics Data System (ADS)

    Allegrini, Paolo; Buiatti, Marco; Grigolini, Paolo; West, Bruce J.

    1998-09-01

    We adopt a non-Gaussian indicator to measure the deviation from Gaussian statistics of a diffusion process generated by dichotomous fluctuations with infinite memory. We also make analytical predictions on the transient behavior of the non-Gaussian indicator as well as on its stationary value. We then apply this non-Gaussian analysis to the DNA sequences of prokaryotes adopting a theoretical model where the ``DNA dynamics'' are assumed to be determined by the statistical superposition of two independent generators of fluctuations: a generator of fluctuations with no correlation and a generator of fluctuations with infinite correlation ``time.'' We study also the influence that the finite length of the observed sequences has on the non-Gaussian statistics of diffusion. We find that these non-Gaussian effects are blurred by the joint action of short-range fluctuation and sequence truncation. Nevertheless, under proper conditions, fulfilled by all the DNA sequences of prokaryotes that have been examined, a non-Gaussian signature remains to signal the correlated nature of the driving process.

  11. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions.

    PubMed

    Koonin, Eugene V

    2016-01-01

    The wide spread of gene exchange and loss in the prokaryotic world has prompted the concept of 'lateral genomics' to the point of an outright denial of the relevance of phylogenetic trees for evolution. However, the pronounced coherence congruence of the topologies of numerous gene trees, particularly those for (nearly) universal genes, translates into the notion of a statistical tree of life (STOL), which reflects a central trend of vertical evolution. The STOL can be employed as a framework for reconstruction of the evolutionary processes in the prokaryotic world. Quantitatively, however, horizontal gene transfer (HGT) dominates microbial evolution, with the rate of gene gain and loss being comparable to the rate of point mutations and much greater than the duplication rate. Theoretical models of evolution suggest that HGT is essential for the survival of microbial populations that otherwise deteriorate due to the Muller's ratchet effect. Apparently, at least some bacteria and archaea evolved dedicated vehicles for gene transfer that evolved from selfish elements such as plasmids and viruses. Recent phylogenomic analyses suggest that episodes of massive HGT were pivotal for the emergence of major groups of organisms such as multiple archaeal phyla as well as eukaryotes. Similar analyses appear to indicate that, in addition to donating hundreds of genes to the emerging eukaryotic lineage, mitochondrial endosymbiosis severely curtailed HGT. These results shed new light on the routes of evolutionary transitions, but caution is due given the inherent uncertainty of deep phylogenies. PMID:27508073

  12. Sequence analysis and prokaryotic expression of Giardia lamblia α-18 giardin gene.

    PubMed

    Wu, Sheng; Yu, Xingang; Abdullahi, Auwalu Yusuf; Hu, Wei; Pan, Weida; Shi, Xianli; Tan, Liping; Song, Meiran; Li, Guoqing

    2016-03-01

    To study the genetic variation and prokaryotic expression of α18 giardin gene of Giardia lamblia zoonotic assemblage A and host-specific assemblage F, the α18 genes were amplified from G. lamblia assemblages A and F by PCR and sequenced. The PCR product was cloned into the prokaryotic expression vector pET-28a(+) and the positive recombinant plasmid was transformed into Escherichia coli Rosetta (DE3) strain for the expression. The expressed α18 giardin fusion protein was validated by SDS-PAGE and Western blot analysis, and purified by Ni-Agarose resin. The putative sequence of α18 giardin amino acid was analyzed by bioinformatics software. Results showed that the α18 giardin gene was 861 bp in length, encoding 286 amino acids; it was 100% homologous between human-derived and dog-derived G. lamblia assemblage A, but it was 86.8% homologous with G. lamblia assemblage F (cat-derived). Giardin α18 was about 36 kDa in molecular weight, with good reactivity. Prediction based on in silico analyses: it had hydrophobicity, without signal peptide and transmembrane domain, and contained 11 alpha regions, 13 beta sheets, 1 beta turn and 7 random coils in secondary structure. The above information would lay the foundation for research about the subcellular localization and biological function of α18 giardin in G. lamblia. PMID:26656833

  13. Transplantation of prokaryotic two-component signaling pathways into mammalian cells

    PubMed Central

    Hansen, Jonathan; Mailand, Erik; Swaminathan, Krishna Kumar; Schreiber, Joerg; Angelici, Bartolomeo; Benenson, Yaakov

    2014-01-01

    Signaling pathway engineering is a promising route toward synthetic biological circuits. Histidine–aspartate phosphorelays are thought to have evolved in prokaryotes where they form the basis for two-component signaling. Tyrosine-serine–threonine phosphorelays, exemplified by MAP kinase cascades, are predominant in eukaryotes. Recently, a prokaryotic two-component pathway was implemented in a plant species to sense environmental trinitrotoluene. We reasoned that “transplantation” of two-component pathways into mammalian host could provide an orthogonal and diverse toolkit for a variety of signal processing tasks. Here we report that two-component pathways could be partially reconstituted in mammalian cell culture and used for programmable control of gene expression. To enable this reconstitution, coding sequences of histidine kinase (HK) and response regulator (RR) components were codon-optimized for human cells, whereas the RRs were fused with a transactivation domain. Responsive promoters were furnished by fusing DNA binding sites in front of a minimal promoter. We found that coexpression of HKs and their cognate RRs in cultured mammalian cells is necessary and sufficient to strongly induce gene expression even in the absence of pathways’ chemical triggers in the medium. Both loss-of-function and constitutive mutants behaved as expected. We further used the two-component signaling pathways to implement two-input logical AND, NOR, and OR gene regulation. Thus, two-component systems can be applied in different capacities in mammalian cells and their components can be used for large-scale synthetic gene circuits. PMID:25331891

  14. SUMO fusion technology for enhanced protein production in prokaryotic and eukaryotic expression systems.

    PubMed

    Panavas, Tadas; Sanders, Carsten; Butt, Tauseef R

    2009-01-01

    In eukaryotic cells, the reversible attachment of small ubiquitin-like modifier (SUMO) protein is a post-translational modification that has been demonstrated to play an important role in various cellular processes. Moreover, it has been found that SUMO as an N-terminal fusion partner enhances functional protein production in prokaryotic and eukaryotic expression systems, based upon significantly improved protein stability and solubility. Following the expression and purification of the fusion protein, the SUMO-tag can be cleaved by specific (SUMO) proteases via their endopeptidase activity in vitro to generate the desired N-terminus of the released protein partner. In addition to its physiological relevance in eukaryotes, SUMO can, thus, be used as a powerful biotechnological tool for protein expression in prokaryotic and eukaryotic cell systems.In this chapter, we will describe the construction of a fusion protein with the SUMO-tag, its expression in Escherichia coli, and its purification followed by the removal of the SUMO-tag by a SUMO-specific protease in vitro. PMID:19107426

  15. The (unusual) aspartic acid in the metal coordination sphere of the prokaryotic zinc finger domain.

    PubMed

    D'Abrosca, Gianluca; Russo, Luigi; Palmieri, Maddalena; Baglivo, Ilaria; Netti, Fortuna; de Paola, Ivan; Zaccaro, Laura; Farina, Biancamaria; Iacovino, Rosa; Pedone, Paolo Vincenzo; Isernia, Carla; Fattorusso, Roberto; Malgieri, Gaetano

    2016-08-01

    The possibility of choices of protein ligands and coordination geometries leads to diverse Zn(II) binding sites in zinc-proteins, allowing a range of important biological roles. The prokaryotic Cys2His2 zinc finger domain (originally found in the Ros protein from Agrobacterium tumefaciens) tetrahedrally coordinates zinc through two cysteine and two histidine residues and it does not adopt a correct fold in the absence of the metal ion. Ros is the first structurally characterized member of a family of bacterial proteins that presents several amino acid changes in the positions occupied in Ros by the zinc coordinating residues. In particular, the second position is very often occupied by an aspartic acid although the coordination of structural zinc by an aspartate in eukaryotic zinc fingers is very unusual. Here, by appropriately mutating the protein Ros, we characterize the aspartate role within the coordination sphere of this family of proteins demonstrating how the presence of this residue only slightly perturbs the functional structure of the prokaryotic zinc finger domain while it greatly influences its thermodynamic properties. PMID:27238756

  16. Fancy meeting you here! A fresh look at "prokaryotic" protein phosphorylation.

    PubMed Central

    Kennelly, P J; Potts, M

    1996-01-01

    Bacteria play host to a wide range of protein phosphorylation-dephosphorylation systems (Fig. 1). As little as five years ago the known systems were thought to be late-emerging and absolutely prokaryote specific. Today we know that most protein kinases and protein phosphatases are descended from a set of common, and possibly quite ancient, prototypes. Prokaryote- and eukaryote-specific protein kinases and protein phosphatases are rare and represent exceptions, not the rule as previously thought. Commonality suggests that a dynamic and versatile regulatory mechanism was first adapted to the modulation of protein function as early if not earlier than more "basic" mechanisms such as allosterism, etc. The existence of common molecular themes confirms that the microbial world offers a unique, largely untapped library and a powerful set of tools for the understanding of a regulatory mechanism which is crucial to all organisms, tools whose diversity and experimental malleability will provide new avenues for exploring and understanding key modes of cellular regulation. PMID:8759835

  17. A Comprehensive Curation Shows the Dynamic Evolutionary Patterns of Prokaryotic CRISPRs.

    PubMed

    Mai, Guoqin; Ge, Ruiquan; Sun, Guoquan; Meng, Qinghan; Zhou, Fengfeng

    2016-01-01

    Motivation. Clustered regularly interspaced short palindromic repeat (CRISPR) is a genetic element with active regulation roles for foreign invasive genes in the prokaryotic genomes and has been engineered to work with the CRISPR-associated sequence (Cas) gene Cas9 as one of the modern genome editing technologies. Due to inconsistent definitions, the existing CRISPR detection programs seem to have missed some weak CRISPR signals. Results. This study manually curates all the currently annotated CRISPR elements in the prokaryotic genomes and proposes 95 updates to the annotations. A new definition is proposed to cover all the CRISPRs. The comprehensive comparison of CRISPR numbers on the taxonomic levels of both domains and genus shows high variations for closely related species even in the same genus. The detailed investigation of how CRISPRs are evolutionarily manipulated in the 8 completely sequenced species in the genus Thermoanaerobacter demonstrates that transposons act as a frequent tool for splitting long CRISPRs into shorter ones along a long evolutionary history. PMID:27195295

  18. SigMol: repertoire of quorum sensing signaling molecules in prokaryotes.

    PubMed

    Rajput, Akanksha; Kaur, Karambir; Kumar, Manoj

    2016-01-01

    Quorum sensing is a widespread phenomenon in prokaryotes that helps them to communicate among themselves and with eukaryotes. It is driven through quorum sensing signaling molecules (QSSMs) in a density dependent manner that assists in numerous biological functions like biofilm formation, virulence factors secretion, swarming motility, bioluminescence, etc. Despite immense implications, dedicated resources of QSSMs are lacking. Therefore, we have developed SigMol (http://bioinfo.imtech.res.in/manojk/sigmol), a specialized repository of these molecules in prokaryotes. SigMol harbors information on QSSMs pertaining to different quorum sensing signaling systems namely acylated homoserine lactones (AHLs), diketopiperazines (DKPs), 4-hydroxy-2-alkylquinolines (HAQs), diffusible signal factors (DSFs), autoinducer-2 (AI-2) and others. Database contains 1382: entries of 182: unique signaling molecules from 215: organisms. It encompasses biological as well as chemical aspects of signaling molecules. Biological information includes genes, preliminary bioassays, identification assays and applications, while chemical detail comprises of IUPAC name, SMILES and structure. We have provided user-friendly browsing and searching facilities for easy data retrieval and comparison. We have gleaned information of diverse QSSMs reported in literature at a single platform 'SigMol'. This comprehensive resource will assist the scientific community in understanding intraspecies, interspecies or interkingdom networking and further help to unfold different facets of quorum sensing and related therapeutics. PMID:26490957

  19. Potential of cathodoluminescence microscopy and spectroscopy for the detection of prokaryotic cells on minerals.

    PubMed

    Rommevaux-Jestin, Céline; Ménez, Bénédicte

    2010-11-01

    Detecting mineral-hosted ecosystems to assess the extent and functioning of the biosphere from the surface to deep Earth requires appropriate techniques that provide, beyond the morphological criteria, indubitable clues of the presence of prokaryotic cells. Here, we evaluate the capability of cathodoluminescence microscopy and spectroscopy, implemented on a scanning electron microscope, to identify prokaryotes on mineral surfaces. For this purpose, we used, as a first step, a simple model of either unstained or stained cultivable cells (Escherichia coli, Deinococcus radiodurans) deposited on minerals that are common in the oceanic crust (basaltic glass, amphibole, pyroxene, and magnetite). Our results demonstrate that the detection of cells is possible at the micrometric level on the investigated minerals through the intrinsic fluorescence of their constituting macromolecules (aromatic amino and nucleic acids, coenzymes). This allows us to distinguish biomorph inorganic phases from cells. This easily implemented technique permits an exploration of colonized rock samples. In addition, the range of spectrometric techniques available on a scanning electron microscope can provide additional information on the nature and chemistry of the associated mineral phases, which would lead to a simultaneous characterization of cells, their microhabitats, and a better understanding of their potential relationships. PMID:21118024

  20. Prokaryotic complex of newly formed soils on nepheline-containing industrial waste

    NASA Astrophysics Data System (ADS)

    Evdokimova, G. A.; Kalmykova, V. V.

    2010-06-01

    The characteristics are given of the prokaryotic complex participating in the processes of the primary soil formation on nepheline-containing waste and depending on the time of the waste disposal and degree of reclamation. The total population density of the bacteria determined with the method of fluorescent microscopy in “pure” sand ranged within 0.34—0.60 billion CFU/g soil; in the reclaimed sand under different vegatation communities, from 2.6 to 7.2 billion CFU/g soil. Gram-positive bacteria dominate in the prokaryotic complex of the nepheline sands, whereas the Grarrmegative ones dominate in the zonal soils. The bacteria predominating in the nepheline sands were classified on the basis of the comparative analysis of the nucleotide sequences in the 16S rRNA genes within the Actinobacteria class (Arthrobacter boritolerans, A. ramosus, Rhodococcusfascians, Micrococcus luteus, and Streptomyces spp.). The evolution of the microbial community in the nepheline sands in the course of their reclamation and in the course of their overgrowing by plants proceeds in way toward the microbial communities of the zonal soils on moraine deposits.

  1. Assessing Diversity of DNA Structure-Related Sequence Features in Prokaryotic Genomes

    PubMed Central

    Huang, Yongjie; Mrázek, Jan

    2014-01-01

    Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

  2. Diversity, evolution, and therapeutic applications of small RNAs in prokaryotic and eukaryotic immune systems

    NASA Astrophysics Data System (ADS)

    Cooper, Edwin L.; Overstreet, Nicola

    2014-03-01

    Recent evidence supports that prokaryotes exhibit adaptive immunity in the form of CRISPR (Clustered Regularly Interspersed Short Palindromic Repeats) and Cas (CRISPR associated proteins). The CRISPR-Cas system confers resistance to exogenous genetic elements such as phages and plasmids by allowing for the recognition and silencing of these genetic elements. Moreover, CRISPR-Cas serves as a memory of past exposures. This suggests that the evolution of the immune system has counterparts among the prokaryotes, not exclusively among eukaryotes. Mathematical models have been proposed which simulate the evolutionary patterns of CRISPR, however large gaps in our understanding of CRISPR-Cas function and evolution still exist. The CRISPR-Cas system is analogous to small RNAs involved in resistance mechanisms throughout the tree of life, and a deeper understanding of the evolution of small RNA pathways is necessary before the relationship between these convergent systems is to be determined. Presented in this review are novel RNAi therapies based on CRISPR-Cas analogs and the potential for future therapies based on CRISPR-Cas system components.

  3. Selective pressure against horizontally acquired prokaryotic genes as a driving force of plastid evolution.

    PubMed

    Llorente, Briardo; de Souza, Flavio S J; Soto, Gabriela; Meyer, Cristian; Alonso, Guillermo D; Flawiá, Mirtha M; Bravo-Almonacid, Fernando; Ayub, Nicolás D; Rodríguez-Concepción, Manuel

    2016-01-01

    The plastid organelle comprises a high proportion of nucleus-encoded proteins that were acquired from different prokaryotic donors via independent horizontal gene transfers following its primary endosymbiotic origin. What forces drove the targeting of these alien proteins to the plastid remains an unresolved evolutionary question. To better understand this process we screened for suitable candidate proteins to recapitulate their prokaryote-to-eukaryote transition. Here we identify the ancient horizontal transfer of a bacterial polyphenol oxidase (PPO) gene to the nuclear genome of an early land plant ancestor and infer the possible mechanism behind the plastidial localization of the encoded enzyme. Arabidopsis plants expressing PPO versions either lacking or harbouring a plastid-targeting signal allowed examining fitness consequences associated with its subcellular localization. Markedly, a deleterious effect on plant growth was highly correlated with PPO activity only when producing the non-targeted enzyme, suggesting that selection favoured the fixation of plastid-targeted protein versions. Our results reveal a possible evolutionary mechanism of how selection against heterologous genes encoding cytosolic proteins contributed in incrementing plastid proteome complexity from non-endosymbiotic gene sources, a process that may also impact mitochondrial evolution. PMID:26750147

  4. Assessing diversity of DNA structure-related sequence features in prokaryotic genomes.

    PubMed

    Huang, Yongjie; Mrázek, Jan

    2014-06-01

    Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

  5. Restriction-Modification systems interplay causes avoidance of GATC site in prokaryotic genomes.

    PubMed

    Ershova, Anna; Rusinov, Ivan; Vasiliev, Mikhail; Spirin, Sergey; Karyagina, Anna

    2016-04-01

    Palindromes are frequently underrepresented in prokaryotic genomes. Palindromic 5[Formula: see text]-GATC-3[Formula: see text] site is a recognition site of different Restriction-Modification (R-M) systems, as well as solitary methyltransferase Dam. Classical GATC-specific R-M systems methylate GATC and cleave unmethylated GATC. On the contrary, methyl-directed Type II restriction endonucleases cleave methylated GATC. Methylation of GATC by Dam methyltransferase is involved in the regulation of different cellular processes. The diversity of functions of GATC-recognizing proteins makes GATC sequence a good model for studying the reasons of palindrome avoidance in prokaryotic genomes. In this work, the influence of R-M systems and solitary proteins on the GATC site avoidance is described by a mathematical model. GATC avoidance is strongly associated with the presence of alternate (methyl-directed or classical Type II R-M system) genes in different strains of the same species, as we have shown for Streptococcus pneumoniae, Neisseria meningitidis, Eubacterium rectale, and Moraxella catarrhalis. We hypothesize that GATC avoidance can result from a DNA exchange between strains with different methylation status of GATC site within the process of natural transformation. If this hypothesis is correct, the GATC avoidance is a sign of a DNA exchange between bacteria with different methylation status in a mixed population. PMID:26972562

  6. Selective pressure against horizontally acquired prokaryotic genes as a driving force of plastid evolution

    PubMed Central

    Llorente, Briardo; de Souza, Flavio S. J.; Soto, Gabriela; Meyer, Cristian; Alonso, Guillermo D.; Flawiá, Mirtha M.; Bravo-Almonacid, Fernando; Ayub, Nicolás D.; Rodríguez-Concepción, Manuel

    2016-01-01

    The plastid organelle comprises a high proportion of nucleus-encoded proteins that were acquired from different prokaryotic donors via independent horizontal gene transfers following its primary endosymbiotic origin. What forces drove the targeting of these alien proteins to the plastid remains an unresolved evolutionary question. To better understand this process we screened for suitable candidate proteins to recapitulate their prokaryote-to-eukaryote transition. Here we identify the ancient horizontal transfer of a bacterial polyphenol oxidase (PPO) gene to the nuclear genome of an early land plant ancestor and infer the possible mechanism behind the plastidial localization of the encoded enzyme. Arabidopsis plants expressing PPO versions either lacking or harbouring a plastid-targeting signal allowed examining fitness consequences associated with its subcellular localization. Markedly, a deleterious effect on plant growth was highly correlated with PPO activity only when producing the non-targeted enzyme, suggesting that selection favoured the fixation of plastid-targeted protein versions. Our results reveal a possible evolutionary mechanism of how selection against heterologous genes encoding cytosolic proteins contributed in incrementing plastid proteome complexity from non-endosymbiotic gene sources, a process that may also impact mitochondrial evolution. PMID:26750147

  7. Establishing homology between mitochondrial calcium uniporters, prokaryotic magnesium channels and chlamydial IncA proteins

    PubMed Central

    Lee, Andre; Vastermark, Ake

    2014-01-01

    Mitochondrial calcium uniporters (MCUs) (TC no. 1.A.77) are oligomeric channel proteins found in the mitochondrial inner membrane. MCUs have two well-conserved transmembrane segments (TMSs), connected by a linker, similar to bacterial MCU homologues. These proteins and chlamydial IncA proteins (of unknown function; TC no. 9.B.159) are homologous to prokaryotic Mg2+ transporters, AtpI and AtpZ, based on comparison scores of up to 14.5 sds. A phylogenetic tree containing all of these proteins showed that the AtpZ proteins cluster coherently as a subset within the large and diverse AtpI cluster, which branches separately from the MCUs and IncAs, both of which cluster coherently. The MCUs and AtpZs share the same two TMS topology, but the AtpIs have four TMSs, and IncAs can have either two (most frequent) or four (less frequent) TMSs. Binary alignments, comparison scores and motif analyses showed that TMSs 1 and 2 align with TMSs 3 and 4 of the AtpIs, suggesting that the four TMS AtpI proteins arose via an intragenic duplication event. These findings establish an evolutionary link interconnecting eukaryotic and prokaryotic Ca2+ and Mg2+ transporters with chlamydial IncAs, and lead us to suggest that all members of the MCU superfamily, including IncAs, function as divalent cation channels. PMID:24869855

  8. Directed Shotgun Proteomics Guided by Saturated RNA-seq Identifies a Complete Expressed Prokaryotic Proteome

    SciTech Connect

    Omasits, U.; Quebatte, Maxime; Stekhoven, Daniel J.; Fortes, Claudia; Roschitzki, Bernd; Robinson, Mark D.; Dehio, Christoph; Ahrens, Christian H.

    2013-11-01

    Prokaryotes, due to their moderate complexity, are particularly amenable to the comprehensive identification of the protein repertoire expressed under different conditions. We applied a generic strategy to identify a complete expressed prokaryotic proteome, which is based on the analysis of RNA and proteins extracted from matched samples. Saturated transcriptome profiling by RNA-seq provided an endpoint estimate of the protein-coding genes expressed under two conditions which mimic the interaction of Bartonella henselae with its mammalian host. Directed shotgun proteomics experiments were carried out on four subcellular fractions. By specifically targeting proteins which are short, basic, low abundant, and membrane localized, we could eliminate their initial underrepresentation compared to the estimated endpoint. A total of 1250 proteins were identified with an estimated false discovery rate below 1%. This represents 85% of all distinct annotated proteins and ~90% of the expressed protein-coding genes. Genes that were detected at the transcript but not protein level, were found to be highly enriched in several genomic islands. Furthermore, genes that lacked an ortholog and a functional annotation were not detected at the protein level; these may represent examples of overprediction in genome annotations. A dramatic membrane proteome reorganization was observed, including differential regulation of autotransporters, adhesins, and hemin binding proteins. Particularly noteworthy was the complete membrane proteome coverage, which included expression of all members of the VirB/D4 type IV secretion system, a key virulence factor.

  9. A Comprehensive Curation Shows the Dynamic Evolutionary Patterns of Prokaryotic CRISPRs

    PubMed Central

    Sun, Guoquan; Meng, Qinghan

    2016-01-01

    Motivation. Clustered regularly interspaced short palindromic repeat (CRISPR) is a genetic element with active regulation roles for foreign invasive genes in the prokaryotic genomes and has been engineered to work with the CRISPR-associated sequence (Cas) gene Cas9 as one of the modern genome editing technologies. Due to inconsistent definitions, the existing CRISPR detection programs seem to have missed some weak CRISPR signals. Results. This study manually curates all the currently annotated CRISPR elements in the prokaryotic genomes and proposes 95 updates to the annotations. A new definition is proposed to cover all the CRISPRs. The comprehensive comparison of CRISPR numbers on the taxonomic levels of both domains and genus shows high variations for closely related species even in the same genus. The detailed investigation of how CRISPRs are evolutionarily manipulated in the 8 completely sequenced species in the genus Thermoanaerobacter demonstrates that transposons act as a frequent tool for splitting long CRISPRs into shorter ones along a long evolutionary history. PMID:27195295

  10. Prokaryotic Diversity in Aran-Bidgol Salt Lake, the Largest Hypersaline Playa in Iran

    PubMed Central

    Makhdoumi-Kakhki, Ali; Amoozegar, Mohammad Ali; Kazemi, Bahram; Pašić, Lejla; Ventosa, Antonio

    2012-01-01

    Prokaryotic diversity in Aran-Bidgol salt lake, a thalasohaline lake in Iran, was studied by fluorescence in situ hybridization (FISH), cultivation techniques, denaturing gradient gel electrophoresis (DGGE) of PCR-amplified fragments of 16S rRNA genes and 16S rRNA gene clone library analysis. Viable counts obtained (2.5–4 × 106 cells mL−1) were similar to total cell abundance in the lake determined by DAPI direct count (3–4×107 cells mL−1). The proportion of Bacteria to Archaea in the community detectable by FISH was unexpectedly high and ranged between 1:3 and 1:2. We analyzed 101 archaeal isolates and found that most belonged to the genera Halorubrum (55%) and Haloarcula (18%). Eleven bacterial isolates obtained in pure culture were affiliated with the genera Salinibacter (18.7%), Salicola (18.7%) and Rhodovibrio (35.3%). Analysis of inserts of 100 clones from the eight 16S rRNA clone libraries constructed revealed 37 OTUs. The majority (63%) of these sequences were not related to any previously identified taxa. Within this sampling effort we most frequently retrieved phylotypes related to Halorhabdus (16% of archaeal sequences obtained) and Salinibacter (36% of bacterial sequences obtained). Other prokaryotic groups that were abundant included representatives of Haloquadratum, the anaerobic genera Halanaerobium and Halocella, purple sulfur bacteria of the genus Halorhodospira and Cyanobacteria. PMID:22185719

  11. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions

    PubMed Central

    Koonin, Eugene V.

    2016-01-01

    The wide spread of gene exchange and loss in the prokaryotic world has prompted the concept of ‘lateral genomics’ to the point of an outright denial of the relevance of phylogenetic trees for evolution. However, the pronounced coherence congruence of the topologies of numerous gene trees, particularly those for (nearly) universal genes, translates into the notion of a statistical tree of life (STOL), which reflects a central trend of vertical evolution. The STOL can be employed as a framework for reconstruction of the evolutionary processes in the prokaryotic world. Quantitatively, however, horizontal gene transfer (HGT) dominates microbial evolution, with the rate of gene gain and loss being comparable to the rate of point mutations and much greater than the duplication rate. Theoretical models of evolution suggest that HGT is essential for the survival of microbial populations that otherwise deteriorate due to the Muller’s ratchet effect. Apparently, at least some bacteria and archaea evolved dedicated vehicles for gene transfer that evolved from selfish elements such as plasmids and viruses. Recent phylogenomic analyses suggest that episodes of massive HGT were pivotal for the emergence of major groups of organisms such as multiple archaeal phyla as well as eukaryotes. Similar analyses appear to indicate that, in addition to donating hundreds of genes to the emerging eukaryotic lineage, mitochondrial endosymbiosis severely curtailed HGT. These results shed new light on the routes of evolutionary transitions, but caution is due given the inherent uncertainty of deep phylogenies. PMID:27508073

  12. Functional characterization of recombinant bromelain of Ananas comosus expressed in a prokaryotic system.

    PubMed

    George, Susan; Bhasker, Salini; Madhav, Harish; Nair, Archana; Chinnamma, Mohankumar

    2014-02-01

    Bromelain (BRM) is a defense protein present in the fruit and stem of pineapple (Ananas comosus) and it is grouped as a cysteine protease enzyme with diversified medicinal uses. Based on its therapeutic applications, bromelain has got sufficient attention in pharmaceutical industries. In the present study, the full coding gene of bromelain in pineapple stem (1,093 bp) was amplified by RT-PCR. The PCR product was cloned, sequenced, and characterized. The sequence analysis of the gene revealed the single nucleotide polymorphism and its phylogenetic relatedness. The peptide sequence deduced from the gene showed the amino acid variations, physicochemical properties and secondary and tertiary structural features of the protein. The full BRM gene was transformed to prokaryotic vector pET32b and expressed in Escherichia coli BL21 DE3pLysS host cells successfully. The identity of the recombinant bromelain (rBRM) protein was confirmed by Western blot analysis using anti-BRM-rabbit IgG antibody. The activity of recombinant bromelain compared with purified native bromelain was determined by protease assay. The inhibitory effect of rBRM compared with native BRM in the growth of Gram-positive and Gram-negative strains of Streptococcus agalactiae and Escherichia coli O111 was evident from the antibacterial sensitivity test. To the best of our knowledge, this is the first report showing the bactericidal property of rBRM expressed in a prokaryotic system. PMID:23921698

  13. Structures of benthic prokaryotic communities and their hydrolytic enzyme activities resuspended from samples of intertidal mudflats: An experimental approach

    NASA Astrophysics Data System (ADS)

    Mallet, Clarisse; Agogué, Hélène; Bonnemoy, Frédérique; Guizien, Katell; Orvain, Francis; Dupuy, Christine

    2014-09-01

    Resuspended sediment can increase plankton biomass and the growth of bacteria, thus influencing the coastal planktonic microbial food web. But little is known about resuspension itself: is it a single massive change or a whole series of events and how does it affect the quantity and quality of resuspended prokaryotic cells? We simulated the sequential erosion of mud cores to better understand the fate and role of benthic prokaryotes resuspended in the water column. We analyzed the total, attached and free-living prokaryotic cells resuspended, their structure and the activities of their hydrolytic enzymes in terms of the biotic and abiotic factors that affect the composition of microphytobenthic biofilm. Free living prokaryotes were resuspended during the fluff layer erosion phase (for shear velocities below 5 cm · s- 1) regardless of the bed sediment composition. At the higher shear velocities, resuspended prokaryotes were attached to particulate matter. Free and attached cells are thus unevenly distributed, scattered throughout the organic matter (OM) in the uppermost mm of the sediment. Only 10-27% of the total cells initially resuspended were living and most of the Bacteria were Cyanobacteria and Gamma-proteobacteria; their numbers increased to over 30% in parallel with the hydrolytic enzyme activity at highest shear velocity. These conditions released prokaryotic cells having different functions that lie deep in the sediment; the most important of them are Archaea. Finally, composition of resuspended bacterial populations varied with resuspension intensity, and intense resuspension events boosted the microbial dynamics and enzyme activities in the bottom layers of sea water.

  14. Metabolism of free-living and particle-associated prokaryotes: Consequences for carbon flux around a Southern Ocean archipelago

    NASA Astrophysics Data System (ADS)

    Schapira, Mathilde; McQuaid, Christopher D.; Froneman, Pierre W.

    2012-02-01

    The sub-Antarctic Prince Edward archipelago lies in the path of the Antarctic Circumpolar Current, giving the islands a distinct upstream/downstream axis. Here we examined the possibility of an Island Mass Effect on the prokaryotic community, comparing prokaryotic metabolism in the upstream, inter-island and downstream regions of the islands. Abundance and flow cytometric community structure, heterotrophic production (PHP) and respiration rates (R-ETS) were investigated separately for the particle-associated (PA) and free-living (FL) prokaryote communities. Temperature, salinity structure and low chlorophyll a concentrations (< 0.4 μg l- 1) suggested a flow-through hydrological regime prevailed during the study. FL and PA abundances and PHP did not vary significantly over the study area. In contrast, FL and PA R-ETS decreased significantly along the upstream to downstream axis. This decrease in R-ETS resulted in high prokaryotic growth efficiencies (PGE) downstream of the islands. This suggests higher carbon sequestration efficiency downstream than upstream of the islands. No significant differences were observed between FL and PA-PGE downstream. In contrast, PA-PGE was significantly higher than FL-PGE at most upstream stations, suggesting quite different carbon utilisation by free-living and particle-associated prokaryotes with potentially important implications for overall carbon flux around the Archipelago. These findings provide new insights into the metabolic and functional roles of the two prokaryotic fractions within pelagic ecosystems. In particular, the observation that carbon consumption on particles is higher than would be expected from estimates of bulk PGE has important implications for our understanding of carbon cycling in the ocean.

  15. High prokaryotic biodiversity associated with gut contents of the holothurian Molpadia musculus from the Nazaré Canyon (NE Atlantic)

    NASA Astrophysics Data System (ADS)

    Amaro, Teresa; Luna, Gian Marco; Danovaro, Roberto; Billett, David S. M.; Cunha, Marina R.

    2012-05-01

    Sediments in the Nazaré Canyon (NE Atlantic) are inhabited by unexpectedly high abundances of the deposit-feeding holothurian Molpadia musculus. The energetic demand of such a large megafaunal biomass is presumably high and requires the efficient exploitation of the food inputs coming from the photic zone. We hypothesise the existence of cooperative interactions between these deep-sea holothurians and prokaryotes in their guts. To investigate these interactions, sediment samples and holothurians were collected at ca. 3500 m depth using a Remote Operated Vehicle (ROV) and an incubation chamber used to "harvest" faeces from the holothurian. In all of these samples (ingested sediment from different sectors of the holothurian gut content, faeces and sediments) we determined total prokaryotic abundance, the relative abundance of Bacteria and Archaea (by means of Catalysed Reporter Deposition-Fluorescence in situ Hybridisation) and bacterial diversity (by means of fingerprinting techniques: ARISA and T-RFLP). Prokaryotic abundances and bacterial diversity in the holothurian gut were very high (up to 105 bacterial Operational Taxonomic Units) and significantly greater than in surrounding bottom sediments. Archaea represented a key component within the gut of the holothurians and in certain tracts dominated the prokaryotic assemblage. We also found that ca. 40% of bacterial OTUs were associated uniquely with the gut contents (i.e., absent in surrounding sediments). These findings suggest the occurrence of wide and highly diversified interactions between prokaryotes and deep-sea holothurians. Results presented here provide new insights into the potential relationships between deep-sea holothurians and specific associations of Archaea and Bacteria within their guts. The work opens new perspectives for investigating the diversity of prokaryotes associated to deep-sea megafauna.

  16. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  17. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  18. Prokaryotic dynamics and heterotrophic metabolism in a deep convection site of Eastern Mediterranean Sea (the Southern Adriatic Pit)

    NASA Astrophysics Data System (ADS)

    Azzaro, M.; La Ferla, R.; Maimone, G.; Monticelli, L. S.; Zaccone, R.; Civitarese, G.

    2012-08-01

    We report on investigations of prokaryotic abundance, biomass, extracellular enzymatic activity, prokaryotic heterotrophic production and respiration in the full water column (˜1200 m) of a deep convection site (the Southern Adriatic Pit), carried out on six cruises in 2006-2008. Prokaryotic abundance (PA) varied vertically and temporally and ranged from 1.2 to 20.4×105 cell ml-1. Cell volumes, generally increased with depth; the lowest mean cell volume was observed in a period with no active convective process (Feb-07) and the highest in a period of stratification (Jun-08) following the convection process occurred in Feb-08. Prokaryotic biomass decreased with the depth and was related with both seasonal cycles of organic matter and hydrological processes. The picophytoplankton ranged in the upper layer (UL) from 0.089 to 10.71×104 cell ml-1. Cells were also recorded till 500 m depth in Feb-08 and this finding could be linked to water convection occurred in the Southern Adriatic Pit in that month. In UL the variations of enzymatic activities as well as leucine-aminopeptidase/ß-glucosidase ratio showed a seasonal trend probably linked to the productive processes of the photic layer. An inverse relation between alkaline phosphatase activity (APA) and phosphate concentrations was found (APA=0.0003PO4-1.7714, R2=0.333, P<0.05). Generally cell-specific enzymatic activities increased with depth as did cell-specific carbon dioxide production rates, while cell-specific prokaryotic heterotrophic production had an opposite trend. High values of prokaryotic growth efficiency registered in the deep layers in Nov-06 reflected a supply of preformed C transported within the deep water masses. Overall, in 2007 when no convective phenomenon was observed, the variability of prokaryotic metabolism was governed by the seasonal cycle of the organic matter, while in Nov-06 and Jun-08 the dynamics of deep water ventilation influenced the trend along the water column of many microbial

  19. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  20. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  1. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  2. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  3. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  4. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  5. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  6. Dynamics of Planktonic Prokaryotes and Dissolved Carbon in a Subtropical Coastal Lake

    PubMed Central

    Fontes, Maria Luiza S.; Tonetta, Denise; Dalpaz, Larissa; Antônio, Regina V.; Petrucio, Maurício M.

    2013-01-01

    To understand the dynamics of planktonic prokaryotes in a subtropical lake and its relationship with carbon, we conducted water sampling through four 48-h periods in Peri Lake for 1 year. Planktonic prokaryotes were characterized by the abundance and biomass of heterotrophic bacteria (HB) and of cyanobacteria (coccoid and filamentous cells). During all samplings, we measured wind speed, water temperature (WT), pH, dissolved oxygen (DO), precipitation, dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), and carbon dioxide (CO2). DOC was higher in the summer (average = 465 μM – WT = 27°C) and lower in the winter (average = 235 μM – WT = 17°C), with no significant variability throughout the daily cycles. CO2 concentrations presented a different pattern, with a minimum in the warm waters of the summer period (8.31 μM) and a maximum in the spring (37.13 μM). Daily trends were observed for pH, DO, WT, and CO2. At an annual scale, both biological and physical-chemical controls were important regulators of CO2. HB abundance and biomass were higher in the winter sampling (5.60 × 109 cells L−1 and 20.83 μmol C L−1) and lower in the summer (1.87 × 109 cells L−1 and 3.95 μmol C L−1). Filamentous cyanobacteria (0.23 × 108–0.68 × 108 filaments L−1) produced up to 167.16 μmol C L−1 as biomass (during the warmer period), whereas coccoid cyanobacteria contributed only 0.38 μmol C L−1. Precipitation, temperature, and the biomass of HB were the main regulators of CO2 concentrations. Temperature had a negative effect on the concentration of CO2, which may be indirectly attributed to high heterotroph activity in the autumn and winter periods. DOC was positively correlated with the abundance of total cyanobacteria and negatively with HB. Thus, planktonic prokaryotes have played an important role in the dynamics of both dissolved inorganic and organic carbon in

  7. Dynamics of planktonic prokaryotes and dissolved carbon in a subtropical coastal lake.

    PubMed

    Fontes, Maria Luiza S; Tonetta, Denise; Dalpaz, Larissa; Antônio, Regina V; Petrucio, Maurício M

    2013-01-01

    To understand the dynamics of planktonic prokaryotes in a subtropical lake and its relationship with carbon, we conducted water sampling through four 48-h periods in Peri Lake for 1 year. Planktonic prokaryotes were characterized by the abundance and biomass of heterotrophic bacteria (HB) and of cyanobacteria (coccoid and filamentous cells). During all samplings, we measured wind speed, water temperature (WT), pH, dissolved oxygen (DO), precipitation, dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), and carbon dioxide (CO2). DOC was higher in the summer (average = 465 μM - WT = 27°C) and lower in the winter (average = 235 μM - WT = 17°C), with no significant variability throughout the daily cycles. CO2 concentrations presented a different pattern, with a minimum in the warm waters of the summer period (8.31 μM) and a maximum in the spring (37.13 μM). Daily trends were observed for pH, DO, WT, and CO2. At an annual scale, both biological and physical-chemical controls were important regulators of CO2. HB abundance and biomass were higher in the winter sampling (5.60 × 10(9) cells L(-1) and 20.83 μmol C L(-1)) and lower in the summer (1.87 × 10(9) cells L(-1) and 3.95 μmol C L(-1)). Filamentous cyanobacteria (0.23 × 10(8)-0.68 × 10(8) filaments L(-1)) produced up to 167.16 μmol C L(-1) as biomass (during the warmer period), whereas coccoid cyanobacteria contributed only 0.38 μmol C L(-1). Precipitation, temperature, and the biomass of HB were the main regulators of CO2 concentrations. Temperature had a negative effect on the concentration of CO2, which may be indirectly attributed to high heterotroph activity in the autumn and winter periods. DOC was positively correlated with the abundance of total cyanobacteria and negatively with HB. Thus, planktonic prokaryotes have played an important role in the dynamics of both dissolved inorganic and organic carbon in

  8. Sodium channel selectivity and conduction: Prokaryotes have devised their own molecular strategy

    PubMed Central

    Finol-Urdaneta, Rocio K.; Wang, Yibo; Al-Sabi, Ahmed; Zhao, Chunfeng

    2014-01-01

    Striking structural differences between voltage-gated sodium (Nav) channels from prokaryotes (homotetramers) and eukaryotes (asymmetric, four-domain proteins) suggest the likelihood of different molecular mechanisms for common functions. For these two channel families, our data show similar selectivity sequences among alkali cations (relative permeability, Pion/PNa) and asymmetric, bi-ionic reversal potentials when the Na/K gradient is reversed. We performed coordinated experimental and computational studies, respectively, on the prokaryotic Nav channels NaChBac and NavAb. NaChBac shows an “anomalous,” nonmonotonic mole-fraction dependence in the presence of certain sodium–potassium mixtures; to our knowledge, no comparable observation has been reported for eukaryotic Nav channels. NaChBac’s preferential selectivity for sodium is reduced either by partial titration of its highly charged selectivity filter, when extracellular pH is lowered from 7.4 to 5.8, or by perturbation—likely steric—associated with a nominally electro-neutral substitution in the selectivity filter (E191D). Although no single molecular feature or energetic parameter appears to dominate, our atomistic simulations, based on the published NavAb crystal structure, revealed factors that may contribute to the normally observed selectivity for Na over K. These include: (a) a thermodynamic penalty to exchange one K+ for one Na+ in the wild-type (WT) channel, increasing the relative likelihood of Na+ occupying the binding site; (b) a small tendency toward weaker ion binding to the selectivity filter in Na–K mixtures, consistent with the higher conductance observed with both sodium and potassium present; and (c) integrated 1-D potentials of mean force for sodium or potassium movement that show less separation for the less selective E/D mutant than for WT. Overall, tight binding of a single favored ion to the selectivity filter, together with crucial inter-ion interactions within the pore

  9. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  10. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  11. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  12. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  13. Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyprinid herpesvirus 3 (CyHV-3) is causing severe economic losses worldwide in the carp industry, and a safe and efficacious attenuated vaccine compatible with mass vaccination is needed. We produced single deleted recombinants using prokaryotic mutagenesis. When producing a recombinant lacking open...

  14. Dietary differences are reflected on the gut prokaryotic community structure of wild and commercially reared sea bream (Sparus aurata)

    PubMed Central

    Kormas, Konstantinos A; Meziti, Alexandra; Mente, Eleni; Frentzos, Athanasios

    2014-01-01

    We compared the gut prokaryotic communities in wild, organically-, and conventionally reared sea bream (Sparus aurata) individuals. Gut microbial communities were identified using tag pyrosequencing of the 16S rRNA genes. There were distinct prokaryotic communities in the three different fish nutritional treatments, with the bacteria dominating over the Archaea. Most of the Bacteria belonged to the Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes. The number of bacterial operational taxonomic units (OTUs) was reduced from the wild to the conventionally reared fish, implying a response of the gut microorganisms to the supplied food and possibly alterations in food assimilation. The dominant bacterial OTU in all examined fish was closely related to the genus Diaphorobacter. This is the first time that a member of the β-Proteobacteria, which dominate in freshwaters, are so important in a marine fish gut. In total the majority of the few Archaea OTUs found, were related to methane metabolism. The inferred physiological roles of the dominant prokaryotes are related to the metabolism of carbohydrates and nitrogenous compounds. This study showed the responsive feature of the sea bream gut prokaryotic communities to their diets and also the differences of the conventional in comparison to the organic and wild sea bream gut microbiota. PMID:25066034

  15. Prokaryotic BirA ligase biotinylates K4, K9, K18 and K23 in eukaryotic histone H3

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BirA ligase, a prokaryotic ortholog of human holocarboxylase synthetase (HCS), is known to biotinylate proteins. Here, we tested the hypothesis that BirA ligase may also catalyze biotinylation of eukaryotic histones. If so, this would render recombinant BirA ligase a useful surrogate for HCS in stud...

  16. Impact of the biocide Irgarol on meiofauna and prokaryotes from the sediments of the Bizerte lagoon-an experimental study.

    PubMed

    Hannachi, Amel; Elarbaoui, Soumaya; Khazri, Abdelhafidh; Sellami, Badreddine; Rastelli, Eugenio; D'Agostino, Fabio; Beyrem, Hamouda; Mahmoudi, Ezzeddine; Corinaldesi, Cinzia; Danovaro, Roberto

    2016-04-01

    The biocide Irgarol 1051 has been reported to have negative effects on a large number of living components including non-target organisms, but information on its impact on the marine meiofauna and benthic prokaryotes is completely lacking. Here, we report the results of long-term experimental studies in which we determined the effects of increasing Irgarol concentrations (from 11.5 to 315 ng g(-1) sediment dry weight) on meiofauna and benthic prokaryotes. We found that this biocide had a significant impact on meiofauna abundance, even at the lowest concentrations, causing a drastic decline in the abundance of nematodes (the dominant meiofaunal taxon) and an increase of the relative importance of oligochaetes. Even if no direct effects of Irgarol were found on prokaryotic abundance and biomass, the molecular fingerprinting analyses (automated ribosomal intergenic spacer analysis) showed that the prokaryotic diversity was significantly altered by the biocide. The results of the present study indicate that Irgarol 1051 in marine sediments has a significant impact on the smallest eukaryotic and microbial components also at very low concentrations (ca 12 ng g(-1)). PMID:26746401

  17. Dietary differences are reflected on the gut prokaryotic community structure of wild and commercially reared sea bream (Sparus aurata).

    PubMed

    Kormas, Konstantinos A; Meziti, Alexandra; Mente, Eleni; Frentzos, Athanasios

    2014-10-01

    We compared the gut prokaryotic communities in wild, organically-, and conventionally reared sea bream (Sparus aurata) individuals. Gut microbial communities were identified using tag pyrosequencing of the 16S rRNA genes. There were distinct prokaryotic communities in the three different fish nutritional treatments, with the bacteria dominating over the Archaea. Most of the Bacteria belonged to the Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes. The number of bacterial operational taxonomic units (OTUs) was reduced from the wild to the conventionally reared fish, implying a response of the gut microorganisms to the supplied food and possibly alterations in food assimilation. The dominant bacterial OTU in all examined fish was closely related to the genus Diaphorobacter. This is the first time that a member of the β-Proteobacteria, which dominate in freshwaters, are so important in a marine fish gut. In total the majority of the few Archaea OTUs found, were related to methane metabolism. The inferred physiological roles of the dominant prokaryotes are related to the metabolism of carbohydrates and nitrogenous compounds. This study showed the responsive feature of the sea bream gut prokaryotic communities to their diets and also the differences of the conventional in comparison to the organic and wild sea bream gut microbiota. PMID:25066034

  18. Next-Generation Annotation of Prokaryotic Genomes with EuGene-P: Application to Sinorhizobium meliloti 2011

    PubMed Central

    Sallet, Erika; Roux, Brice; Sauviac, Laurent; Jardinaud, Marie-Franc¸oise; Carrère, Sébastien; Faraut, Thomas; de Carvalho-Niebel, Fernanda; Gouzy, Jérôme; Gamas, Pascal; Capela, Delphine; Bruand, Claude; Schiex, Thomas

    2013-01-01

    The availability of next-generation sequences of transcripts from prokaryotic organisms offers the opportunity to design a new generation of automated genome annotation tools not yet available for prokaryotes. In this work, we designed EuGene-P, the first integrative prokaryotic gene finder tool which combines a variety of high-throughput data, including oriented RNA-Seq data, directly into the prediction process. This enables the automated prediction of coding sequences (CDSs), untranslated regions, transcription start sites (TSSs) and non-coding RNA (ncRNA, sense and antisense) genes. EuGene-P was used to comprehensively and accurately annotate the genome of the nitrogen-fixing bacterium Sinorhizobium meliloti strain 2011, leading to the prediction of 6308 CDSs as well as 1876 ncRNAs. Among them, 1280 appeared as antisense to a CDS, which supports recent findings that antisense transcription activity is widespread in bacteria. Moreover, 4077 TSSs upstream of protein-coding or non-coding genes were precisely mapped providing valuable data for the study of promoter regions. By looking for RpoE2-binding sites upstream of annotated TSSs, we were able to extend the S. meliloti RpoE2 regulon by ∼3-fold. Altogether, these observations demonstrate the power of EuGene-P to produce a reliable and high-resolution automatic annotation of prokaryotic genomes. PMID:23599422

  19. Next-generation annotation of prokaryotic genomes with EuGene-P: application to Sinorhizobium meliloti 2011.

    PubMed

    Sallet, Erika; Roux, Brice; Sauviac, Laurent; Jardinaud, Marie-Francoise; Carrère, Sébastien; Faraut, Thomas; de Carvalho-Niebel, Fernanda; Gouzy, Jérôme; Gamas, Pascal; Capela, Delphine; Bruand, Claude; Schiex, Thomas

    2013-08-01

    The availability of next-generation sequences of transcripts from prokaryotic organisms offers the opportunity to design a new generation of automated genome annotation tools not yet available for prokaryotes. In this work, we designed EuGene-P, the first integrative prokaryotic gene finder tool which combines a variety of high-throughput data, including oriented RNA-Seq data, directly into the prediction process. This enables the automated prediction of coding sequences (CDSs), untranslated regions, transcription start sites (TSSs) and non-coding RNA (ncRNA, sense and antisense) genes. EuGene-P was used to comprehensively and accurately annotate the genome of the nitrogen-fixing bacterium Sinorhizobium meliloti strain 2011, leading to the prediction of 6308 CDSs as well as 1876 ncRNAs. Among them, 1280 appeared as antisense to a CDS, which supports recent findings that antisense transcription activity is widespread in bacteria. Moreover, 4077 TSSs upstream of protein-coding or non-coding genes were precisely mapped providing valuable data for the study of promoter regions. By looking for RpoE2-binding sites upstream of annotated TSSs, we were able to extend the S. meliloti RpoE2 regulon by ∼3-fold. Altogether, these observations demonstrate the power of EuGene-P to produce a reliable and high-resolution automatic annotation of prokaryotic genomes. PMID:23599422

  20. Metagenomic sequence of prokaryotic microbiota from an intermediate-salinity pond of a saltern in isla cristina, Spain.

    PubMed

    Fernández, Ana B; León, María José; Vera, Blanca; Sánchez-Porro, Cristina; Ventosa, Antonio

    2014-01-01

    Marine salterns are artificial multipond systems designed for the commercial production of salt by evaporation of seawater. We report here the metagenomic sequence of the prokaryotic microbiota of a pond with intermediate salinity (21% total salts) of a saltern located in Isla Cristina, Huelva, southwest Spain. PMID:24526635

  1. Freshwater prokaryote and virus communities can adapt to a controlled increase in salinity through changes in their structure and interactions

    NASA Astrophysics Data System (ADS)

    Marine, Combe; Thierry, Bouvier; Olivier, Pringault; Emma, Rochelle-Newall; Corinne, Bouvier; Martin, Agis; The Thu, Pham; Jean-Pascal, Torreton; Van Thuoc, Chu; Bettarel, Yvan

    2013-11-01

    Little information exists on the ecological adaptive responses of riverine microorganisms to the salinity changes that typically occur in transitional waters. This study examined the precise effects of a gradual increase in salinity (+3 units per day for 12 days) on freshwater virus and prokaryote communities collected in the Red River Delta (northern Vietnam). The abundance, activity, morphology and diversity of both communities were examined along this simulated salinity gradient (0-36). Three main successive ecological stages were observed: (1) a continuous decline in prokaryotic and viral abundance from the start of the salinization process up to salinity 12-15 together with a strong decrease in the proportion of active cells, (2) a shift in both community compositions (salinity 9-15) and (3) a marked prevalence of lysogenic over lytic cycles up to salinity 21 followed by a collapse of both types of viral infection. Finally, after salinity 21, and up to seawater salinities (i.e. 36) the prokaryotic community showed multiple signs of recovery with their abundance and function even reaching initial levels. These results suggest that most of the physiological and phylogenetic changes that occurred within the salinity range 10-20 seemed to favor the installation of osmotically adapted prokaryotes accompanied by a specific cortege of viral parasites which might both be able to survive and even proliferate in saltwater conditions.

  2. Promoters responsive to DNA bending: a common theme in prokaryotic gene expression.

    PubMed Central

    Pérez-Martín, J; Rojo, F; de Lorenzo, V

    1994-01-01

    The early notion of DNA as a passive target for regulatory proteins has given way to the realization that higher-order DNA structures and DNA-protein complexes are at the basis of many molecular processes, including control of promoter activity. Protein binding may direct the bending of an otherwise linear DNA, exacerbate the angle of an intrinsic bend, or assist the directional flexibility of certain sequences within prokaryotic promoters. The important, sometimes essential role of intrinsic or protein-induced DNA bending in transcriptional regulation has become evident in virtually every system examined. As discussed throughout this article, not every function of DNA bends is understood, but their presence has been detected in a wide variety of bacterial promoters subjected to positive or negative control. Nonlinear DNA structures facilitate and even determine proximal and distal DNA-protein and protein-protein contacts involved in the various steps leading to transcription initiation. PMID:8078436

  3. Powered by light: Phototrophy and photosynthesis in prokaryotes and its evolution.

    PubMed

    Nowicka, Beatrycze; Kruk, Jerzy

    2016-01-01

    Photosynthesis is a complex metabolic process enabling photosynthetic organisms to use solar energy for the reduction of carbon dioxide into biomass. This ancient pathway has revolutionized life on Earth. The most important event was the development of oxygenic photosynthesis. It had a tremendous impact on the Earth's geochemistry and the evolution of living beings, as the rise of atmospheric molecular oxygen enabled the development of a highly efficient aerobic metabolism, which later led to the evolution of complex multicellular organisms. The mechanism of photosynthesis has been the subject of intensive research and a great body of data has been accumulated. However, the evolution of this process is not fully understood, and the development of photosynthesis in prokaryota in particular remains an unresolved question. This review is devoted to the occurrence and main features of phototrophy and photosynthesis in prokaryotes. Hypotheses concerning the origin and spread of photosynthetic traits in bacteria are also discussed. PMID:27242148

  4. The diversity-generating benefits of a prokaryotic adaptive immune system.

    PubMed

    van Houte, Stineke; Ekroth, Alice K E; Broniewski, Jenny M; Chabas, Hélène; Ashby, Ben; Bondy-Denomy, Joseph; Gandon, Sylvain; Boots, Mike; Paterson, Steve; Buckling, Angus; Westra, Edze R

    2016-04-21

    Prokaryotic CRISPR-Cas adaptive immune systems insert spacers derived from viruses and other parasitic DNA elements into CRISPR loci to provide sequence-specific immunity. This frequently results in high within-population spacer diversity, but it is unclear if and why this is important. Here we show that, as a result of this spacer diversity, viruses can no longer evolve to overcome CRISPR-Cas by point mutation, which results in rapid virus extinction. This effect arises from synergy between spacer diversity and the high specificity of infection, which greatly increases overall population resistance. We propose that the resulting short-lived nature of CRISPR-dependent bacteria-virus coevolution has provided strong selection for the evolution of sophisticated virus-encoded anti-CRISPR mechanisms. PMID:27074511

  5. The JCVI standard operating procedure for annotating prokaryotic metagenomic shotgun sequencing data.

    PubMed

    Tanenbaum, David M; Goll, Johannes; Murphy, Sean; Kumar, Prateek; Zafar, Nikhat; Thiagarajan, Mathangi; Madupu, Ramana; Davidsen, Tanja; Kagan, Leonid; Kravitz, Saul; Rusch, Douglas B; Yooseph, Shibu

    2010-01-01

    The JCVI metagenomics analysis pipeline provides for the efficient and consistent annotation of shotgun metagenomics sequencing data for sampling communities of prokaryotic organisms. The process can be equally applied to individual sequence reads from traditional Sanger capillary electrophoresis sequences, newer technologies such as 454 pyrosequencing, or sequence assemblies derived from one or more of these data types. It includes the analysis of both coding and non-coding genes, whether full-length or, as is often the case for shotgun metagenomics, fragmentary. The system is designed to provide the best-supported conservative functional annotation based on a combination of trusted homology-based scientific evidence and computational assertions and an annotation value hierarchy established through extensive manual curation. The functional annotation attributes assigned by this system include gene name, gene symbol, GO terms, EC numbers, and JCVI functional role categories. PMID:21304707

  6. Repurposing a Prokaryotic Toxin-Antitoxin System for the Selective Killing of Oncogenically Stressed Human Cells.

    PubMed

    Preston, Mark A; Pimentel, Belén; Bermejo-Rodríguez, Camino; Dionne, Isabelle; Turnbull, Alice; de la Cueva-Méndez, Guillermo

    2016-07-15

    Prokaryotes express intracellular toxins that pass unnoticed to carrying cells until coexpressed antitoxin partners are degraded in response to stress. Although not evolved to function in eukaryotes, one of these toxins, Kid, induces apoptosis in mammalian cells, an effect that is neutralized by its cognate antitoxin, Kis. Here we engineered this toxin-antitoxin pair to create a synthetic system that becomes active in human cells suffering a specific oncogenic stress. Inspired by the way Kid becomes active in bacterial cells, we produced a Kis variant that is selectively degraded in human cells expressing oncoprotein E6. The resulting toxin-antitoxin system functions autonomously in human cells, distinguishing those that suffer the oncogenic insult, which are killed by Kid, from those that do not, which remain protected by Kis. Our results provide a framework for developing personalized anticancer strategies avoiding off-target effects, a challenge that has been hardly tractable by other means thus far. PMID:26230535

  7. Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase) from Streptomyces griseochromogenes, the first prokaryotic UDP-glucuronosyltransferase.

    PubMed Central

    Gould, S J; Guo, J

    1994-01-01

    Cytosylglucuronic acid synthase (cytosine: UDP-glucuronosyltransferase), the first prokaryotic UDP-GT and a key enzyme in the biosynthesis of the antibiotic blasticidin S, was purified 870-fold. It has optimum activity at a pH of 8.4 to 8.6, Kms of 6.0 (UDP-glucuronic acid) and 243 (cytosine) microM, and a maximum rate of metabolism of 14.6 mumol/min/mg. The apparent M(r) is 43,000. Activity was slightly enhanced by Mg2+ or Ca2+ but was not inhibited by EDTA. Activity was strongly inhibited by UDP. Cytosylglucuronic acid differs from eukaryotic UDP-glucuronosyltransferases in being a soluble protein with no apparent phospholipid requirement. Images PMID:8113166

  8. Phylogenetic Analysis and Comparative Genomics of Purine Riboswitch Distribution in Prokaryotes

    PubMed Central

    Singh, Payal; Sengupta, Supratim

    2012-01-01

    Riboswitches are regulatory RNA that control gene expression by undergoing conformational changes on ligand binding. Using phylogenetic analysis and comparative genomics we have been able to identify the class of genes/operons regulated by the purine riboswitch and obtain a high-resolution map of purine riboswitch distribution across all bacterial groups. In the process, we are able to explain the absence of purine riboswitches upstream to specific genes in certain genomes. We also identify the point of origin of various purine riboswitches and argue that not all purine riboswitches are of primordial origin, and that some purine riboswitches must have originated after the divergence of certain Firmicute orders in the course of evolution. Our study also reveals the role of horizontal transfer events in accounting for the presence of purine riboswitches in some gammaproteobacterial species. Our work provides significant insights into the origin, distribution and regulatory role of purine riboswitches in prokaryotes. PMID:23170063

  9. SUMO fusion technology for enhanced protein expression and purification in prokaryotes and eukaryotes.

    PubMed

    Peroutka Iii, Raymond J; Orcutt, Steven J; Strickler, James E; Butt, Tauseef R

    2011-01-01

    The preparation of sufficient amounts of high-quality protein samples is the major bottleneck for structural proteomics. The use of recombinant proteins has increased significantly during the past decades. The most commonly used host, Escherichia coli, presents many challenges including protein misfolding, protein degradation, and low solubility. A novel SUMO fusion technology appears to enhance protein expression and solubility ( http://www.lifesensors.com ). Efficient removal of the SUMO tag by SUMO protease in vitro facilitates the generation of target protein with a native N-terminus. In addition to its physiological relevance in eukaryotes, SUMO can be used as a powerful biotechnology tool for enhanced functional protein expression in prokaryotes and eukaryotes. PMID:21125378

  10. TnpPred: A Web Service for the Robust Prediction of Prokaryotic Transposases.

    PubMed

    Riadi, Gonzalo; Medina-Moenne, Cristobal; Holmes, David S

    2012-01-01

    Transposases (Tnps) are enzymes that participate in the movement of insertion sequences (ISs) within and between genomes. Genes that encode Tnps are amongst the most abundant and widely distributed genes in nature. However, they are difficult to predict bioinformatically and given the increasing availability of prokaryotic genomes and metagenomes, it is incumbent to develop rapid, high quality automatic annotation of ISs. This need prompted us to develop a web service, termed TnpPred for Tnp discovery. It provides better sensitivity and specificity for Tnp predictions than given by currently available programs as determined by ROC analysis. TnpPred should be useful for improving genome annotation. The TnpPred web service is freely available for noncommercial use. PMID:23251097

  11. TnpPred: A Web Service for the Robust Prediction of Prokaryotic Transposases

    PubMed Central

    Riadi, Gonzalo; Medina-Moenne, Cristobal; Holmes, David S.

    2012-01-01

    Transposases (Tnps) are enzymes that participate in the movement of insertion sequences (ISs) within and between genomes. Genes that encode Tnps are amongst the most abundant and widely distributed genes in nature. However, they are difficult to predict bioinformatically and given the increasing availability of prokaryotic genomes and metagenomes, it is incumbent to develop rapid, high quality automatic annotation of ISs. This need prompted us to develop a web service, termed TnpPred for Tnp discovery. It provides better sensitivity and specificity for Tnp predictions than given by currently available programs as determined by ROC analysis. TnpPred should be useful for improving genome annotation. The TnpPred web service is freely available for noncommercial use. PMID:23251097

  12. EVpedia: A community web resource for prokaryotic and eukaryotic extracellular vesicles research.

    PubMed

    Kim, Dae-Kyum; Lee, Jaewook; Simpson, Richard J; Lötvall, Jan; Gho, Yong Song

    2015-04-01

    For cell-to-cell communication, all living cells including archaea, bacteria, and eukaryotes secrete nano-sized membrane vesicles into the extracellular space. These extracellular vesicles harbor specific subsets of proteins, mRNAs, miRNAs, lipids, and metabolites that represent their cellular status. These vesicle-specific cargos are considered as novel diagnostic biomarkers as well as therapeutic targets. With the advancement in high-throughput technologies on multiomics studies and improvements in bioinformatics approaches, a huge number of vesicular proteins, mRNAs, miRNAs, lipids, and metabolites have been identified, and our understanding of these complex extracellular organelles has considerably increased during these past years. In this review, we highlight EVpedia (http://evpedia.info), a community web portal for systematic analyses of prokaryotic and eukaryotic extracellular vesicles research. PMID:25704310

  13. Membrane regulation of the stress response from prokaryotic models to mammalian cells.

    PubMed

    Vigh, Laszlo; Nakamoto, Hitoshi; Landry, Jacques; Gomez-Munoz, Antonio; Harwood, John L; Horvath, Ibolya

    2007-10-01

    "Membrane regulation" of stress responses in various systems is widely studied. In poikilotherms, membrane rigidification could be the first reaction to cold perception: reducing membrane fluidity of membranes at physiological temperatures is coupled with enhanced cold inducibility of a number of genes, including desaturases (see J.L. Harwood's article in this Proceedings volume). A similar role of changes in membrane physical state in heat (oxidative stress, etc.) sensing- and signaling gained support recently from prokaryotes to mammalian cells. Stress-induced remodeling of membrane lipids could influence generation, transduction, and deactivation of stress signals, either through global effects on the fluidity of the membrane matrix, or by specific interactions of boundary (or raft) lipids with receptor proteins, lipases, ion channels, etc. Our data point to membranes not only as targets of stress, but also as sensors in activating a stress response. PMID:17656573

  14. GenomePeek—an online tool for prokaryotic genome and metagenome analysis

    DOE PAGESBeta

    McNair, Katelyn; Edwards, Robert A.

    2015-06-16

    As increases in prokaryotic sequencing take place, a method to quickly and accurately analyze this data is needed. Previous tools are mainly designed for metagenomic analysis and have limitations; such as long runtimes and significant false positive error rates. The online tool GenomePeek (edwards.sdsu.edu/GenomePeek) was developed to analyze both single genome and metagenome sequencing files, quickly and with low error rates. GenomePeek uses a sequence assembly approach where reads to a set of conserved genes are extracted, assembled and then aligned against the highly specific reference database. GenomePeek was found to be faster than traditional approaches while still keeping errormore » rates low, as well as offering unique data visualization options.« less

  15. GenomePeek—an online tool for prokaryotic genome and metagenome analysis

    SciTech Connect

    McNair, Katelyn; Edwards, Robert A.

    2015-06-16

    As increases in prokaryotic sequencing take place, a method to quickly and accurately analyze this data is needed. Previous tools are mainly designed for metagenomic analysis and have limitations; such as long runtimes and significant false positive error rates. The online tool GenomePeek (edwards.sdsu.edu/GenomePeek) was developed to analyze both single genome and metagenome sequencing files, quickly and with low error rates. GenomePeek uses a sequence assembly approach where reads to a set of conserved genes are extracted, assembled and then aligned against the highly specific reference database. GenomePeek was found to be faster than traditional approaches while still keeping error rates low, as well as offering unique data visualization options.

  16. Regulatory Interactions in ProKaryotes from RegTransBase

    DOE Data Explorer

    Dubchak, Inna; Gelfand, Mikhail

    RegTransBase, a manually curated database of regulatory interactions in prokaryotes, captures the knowledge in published scientific literature using a controlled vocabulary. RegTransBase describes a large number of regulatory interactions reported in many organisms and contains various types of experimental data, in particular: the activation or repression of transcription by an identified direct regulator determining the transcriptional regulatory function of a protein (or RNA) directly binding to DNA or RNA mapping or prediction of binding sites for a regulatory protein characterization of regulatory mutations. RegTransBase also contains manually created position weight matrices (PWM) that can be used to identify candidate regulatory sites in over 60 species. (Specialized Interface)

  17. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  18. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  19. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  20. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.