Science.gov

Sample records for prokaryotic 5s ribonucleic

  1. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  2. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  3. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  4. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  5. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    PubMed

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. PMID:25261903

  6. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  7. The quantitative histochemistry of ribonucleic acid using gallocyanin.

    PubMed

    Brown, A; Scholtz, C L

    1979-03-01

    A method for the cytophotometric estimation of ribonucleic acid in tissue sections using gallocyanin-chrome alum is described. The dye obeys Beer's law in gelatin sections. The effect of deoxyribonuclease on the staining of ribonucleic acid is also investigated. The results indicate that this method is of value in the quantitation of ribonucleic acid. PMID:91237

  8. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  9. Evolution of prokaryote and eukaryote lines inferred from sequence evidence

    NASA Technical Reports Server (NTRS)

    Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.

    1984-01-01

    This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

  10. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  11. The precarious prokaryotic chromosome.

    PubMed

    Kuzminov, Andrei

    2014-05-01

    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other "precarious" features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction. PMID:24633873

  12. The Precarious Prokaryotic Chromosome

    PubMed Central

    2014-01-01

    Evolutionary selection for optimal genome preservation, replication, and expression should yield similar chromosome organizations in any type of cells. And yet, the chromosome organization is surprisingly different between eukaryotes and prokaryotes. The nuclear versus cytoplasmic accommodation of genetic material accounts for the distinct eukaryotic and prokaryotic modes of genome evolution, but it falls short of explaining the differences in the chromosome organization. I propose that the two distinct ways to organize chromosomes are driven by the differences between the global-consecutive chromosome cycle of eukaryotes and the local-concurrent chromosome cycle of prokaryotes. Specifically, progressive chromosome segregation in prokaryotes demands a single duplicon per chromosome, while other “precarious” features of the prokaryotic chromosomes can be viewed as compensations for this severe restriction. PMID:24633873

  13. Bioinformatics of prokaryotic RNAs

    PubMed Central

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  14. Bioinformatics of prokaryotic RNAs.

    PubMed

    Backofen, Rolf; Amman, Fabian; Costa, Fabrizio; Findeiß, Sven; Richter, Andreas S; Stadler, Peter F

    2014-01-01

    The genome of most prokaryotes gives rise to surprisingly complex transcriptomes, comprising not only protein-coding mRNAs, often organized as operons, but also harbors dozens or even hundreds of highly structured small regulatory RNAs and unexpectedly large levels of anti-sense transcripts. Comprehensive surveys of prokaryotic transcriptomes and the need to characterize also their non-coding components is heavily dependent on computational methods and workflows, many of which have been developed or at least adapted specifically for the use with bacterial and archaeal data. This review provides an overview on the state-of-the-art of RNA bioinformatics focusing on applications to prokaryotes. PMID:24755880

  15. Ribonucleic acid interference (RNAi) and control of citrus pests

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...

  16. [Prokaryotic expression systems].

    PubMed

    Porowińska, Dorota; Wujak, Magdalena; Roszek, Katarzyna; Komoszyński, Michał

    2013-01-01

    For overproduction of recombinant proteins both eukaryotic and prokaryotic expression systems are used. Choosing the right system depends, among other things, on the growth rate and culture of host cells, level of the target gene expression and posttranslational processing of the synthesized protein. Regardless of the type of expression system, its basic elements are the vector and the expression host. The most widely used system for protein overproduction, both on a laboratory and industrial scale, is the prokaryotic system. This system is based primarily on the bacteria E. coli, although increasingly often Bacillus species are used. The prokaryotic system allows one to obtain large quantities of recombinant proteins in a short time. A simple and inexpensive bacterial cell culture and well-known mechanisms of transcription and translation facilitate the use of these microorganisms. The simplicity of genetic modifications and the availability of many bacterial mutants are additional advantages of the prokaryotic system. In this article we characterize the structural elements of prokaryotic expression vectors. Also strategies for preparation of the target protein gene that increase productivity, facilitate detection and purification of recombinant protein and provide its activity are discussed. Bacterial strains often used as host cells in expression systems as well as the potential location of heterologous proteins are characterized. Knowledge of the basic elements of the prokaryotic expression system allows for production of biologically active proteins in a short time and in satisfactory quantities.  PMID:23475488

  17. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  18. Distribution of ribonucleic acid coliphages in animals.

    PubMed Central

    Osawa, S; Furuse, K; Watanabe, I

    1981-01-01

    To determine the distribution pattern of ribonucleic acid (RNA) coliphages (classified by serological groups I through IV) in animal sources, we isolated RNA phages from (i) feces samples from domestic animals (cows, pigs, horses, and fowls), some other animals in a zoological garden, and humans, (ii) the gastrointestinal contents of cows and pigs, and (iii) sewage samples from treatment plants in slaughter houses. These samples were then analyzed serologically. The concentration of RNA phages in the first and second kinds of material was fairly low (10 to 10(3) plaque-forming units per original phage sample), whereas that in the third kind of material was fairly high (10(3) to 10(5) plaque-forming units per original phage sample). Concerning the group types of the RNA phages in the first and second kinds of material, human feces contained RNA phages of groups II and III almost equally, the gastrointestinal contents of pigs included those of groups I and II equally, and the feces or gastrointestinal contents of other mammals other than humans and pigs had those of group I exclusively. In the third type of material we found mostly group I phages with a minor fraction of group II phages. Thus, the prominent features of the distribution pattern of RNA phages are the predominance of groups III and II in humans and the predominance of group I in animals. PMID:7224619

  19. Ecology of prokaryotic viruses.

    PubMed

    Weinbauer, Markus G

    2004-05-01

    The finding that total viral abundance is higher than total prokaryotic abundance and that a significant fraction of the prokaryotic community is infected with phages in aquatic systems has stimulated research on the ecology of prokaryotic viruses and their role in ecosystems. This review treats the ecology of prokaryotic viruses ('phages') in marine, freshwater and soil systems from a 'virus point of view'. The abundance of viruses varies strongly in different environments and is related to bacterial abundance or activity suggesting that the majority of the viruses found in the environment are typically phages. Data on phage diversity are sparse but indicate that phages are extremely diverse in natural systems. Lytic phages are predators of prokaryotes, whereas lysogenic and chronic infections represent a parasitic interaction. Some forms of lysogeny might be described best as mutualism. The little existing ecological data on phage populations indicate a large variety of environmental niches and survival strategies. The host cell is the main resource for phages and the resource quality, i.e., the metabolic state of the host cell, is a critical factor in all steps of the phage life cycle. Virus-induced mortality of prokaryotes varies strongly on a temporal and spatial scale and shows that phages can be important predators of bacterioplankton. This mortality and the release of cell lysis products into the environment can strongly influence microbial food web processes and biogeochemical cycles. Phages can also affect host diversity, e.g., by 'killing the winner' and keeping in check competitively dominant species or populations. Moreover, they mediate gene transfer between prokaryotes, but this remains largely unknown in the environment. Genomics or proteomics are providing us now with powerful tools in phage ecology, but final testing will have to be performed in the environment. PMID:15109783

  20. Prokaryote and eukaryote evolvability.

    PubMed

    Poole, Anthony M; Phillips, Matthew J; Penny, David

    2003-05-01

    The concept of evolvability covers a broad spectrum of, often contradictory, ideas. At one end of the spectrum it is equivalent to the statement that evolution is possible, at the other end are untestable post hoc explanations, such as the suggestion that current evolutionary theory cannot explain the evolution of evolvability. We examine similarities and differences in eukaryote and prokaryote evolvability, and look for explanations that are compatible with a wide range of observations. Differences in genome organisation between eukaryotes and prokaryotes meets this criterion. The single origin of replication in prokaryote chromosomes (versus multiple origins in eukaryotes) accounts for many differences because the time to replicate a prokaryote genome limits its size (and the accumulation of junk DNA). Both prokaryotes and eukaryotes appear to switch from genetic stability to genetic change in response to stress. We examine a range of stress responses, and discuss how these impact on evolvability, particularly in unicellular organisms versus complex multicellular ones. Evolvability is also limited by environmental interactions (including competition) and we describe a model that places limits on potential evolvability. Examples are given of its application to predator competition and limits to lateral gene transfer. We suggest that unicellular organisms evolve largely through a process of metabolic change, resulting in biochemical diversity. Multicellular organisms evolve largely through morphological changes, not through extensive changes to cellular biochemistry. PMID:12689728

  1. Photoregulation in prokaryotes.

    PubMed

    Purcell, Erin B; Crosson, Sean

    2008-04-01

    The spectroscopic identification of sensory rhodopsin I by Bogomolni and Spudich in 1982 provided a molecular link between the light environment and phototaxis in Halobacterium salinarum, and thus laid the foundation for the study of signal transducing photosensors in prokaryotes. In recent years, a number of new prokaryotic photosensory receptors have been discovered across a broad range of taxa, including dozens in chemotrophic species. Among these photoreceptors are new classes of rhodopsins, BLUF-domain proteins, bacteriophytochromes, cryptochromes, and LOV-family photosensors. Genetic and biochemical analyses of these receptors have demonstrated that they can regulate processes ranging from photosynthetic pigment biosynthesis to virulence. PMID:18400553

  2. PolyGuanine methacrylate cryogels for ribonucleic acid purification.

    PubMed

    Köse, Kazım; Uzun, Lokman

    2016-05-01

    The isolation and purification of ribonucleic acid have attracted attention recently for the understanding of the functions in detail because of the necessity for the treatment of genetic diseases. In this study, guanine-incorporated polymeric cryogels were developed to obtain highly purified ribonucleic acid. The satisfactory purification performance was achieved with the guanine-incorporated poly (2-hydroxyethyl methacrylate-guanine methacrylate) cryogels. The most crucial advantages to use guanine as a functional monomer are to obtain a real natural interaction between guanine on the polymeric material and cytosine on the ribonucleic acid. Moreover, using cryogel with a highly porous structure and high swelling ratio provide advantages of getting more water within the structure to get more analyte to interact. The characterization of cryogels has proved the success of the synthesis and the perfect natural interaction to be taken place between the ligand (guanine methacrylate) and the cytosine in the ribonucleic acid molecules. Although the pores within the structure of cryogels are small, they provide efficient and fast adsorption. The chromatographic separation performance was investigated for different conditions (pH, temperature etc.). The desorption ratio and reusability were also analyzed at the end of the five adsorption-desorption cycles with no significant changes. PMID:27004613

  3. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  4. Cell Biology of Prokaryotic Organelles

    PubMed Central

    Murat, Dorothee; Byrne, Meghan; Komeili, Arash

    2010-01-01

    Mounting evidence in recent years has challenged the dogma that prokaryotes are simple and undefined cells devoid of an organized subcellular architecture. In fact, proteins once thought to be the purely eukaryotic inventions, including relatives of actin and tubulin control prokaryotic cell shape, DNA segregation, and cytokinesis. Similarly, compartmentalization, commonly noted as a distinguishing feature of eukaryotic cells, is also prevalent in the prokaryotic world in the form of protein-bounded and lipid-bounded organelles. In this article we highlight some of these prokaryotic organelles and discuss the current knowledge on their ultrastructure and the molecular mechanisms of their biogenesis and maintenance. PMID:20739411

  5. Thiol biochemistry of prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, Robert C.

    1986-01-01

    The present studies have shown that GSH metabolism arose in the purple bacteria and cyanobacteria where it functions to protect against oxygen toxicity. Evidence was obtained indicating that GSH metabolism was incorporated into eucaryotes via the endosymbiosis giving rise to mitochrondria and chloroplasts. Aerobic bacteria lacking GSH utilize other thiols for apparently similar functions, the thiol being coenzyme A in Gram positive bacteria and chi-glutamylcysteine in the halobacteria. The thiol biochemistry of prokaryotes is thus seen to be much more highly diversified than that of eucaryotes and much remains to be learned about this subject.

  6. Do prokaryotes contain microtubules?

    PubMed Central

    Bermudes, D; Hinkle, G; Margulis, L

    1994-01-01

    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins. Images PMID:7968920

  7. Promoter propagation in prokaryotes.

    PubMed

    Matus-Garcia, Mariana; Nijveen, Harm; van Passel, Mark W J

    2012-11-01

    Transcriptional activation or 'rewiring' of silent genes is an important, yet poorly understood, phenomenon in prokaryotic genomes. Anecdotal evidence coming from experimental evolution studies in bacterial systems has shown the promptness of adaptation upon appropriate selective pressure. In many cases, a partial or complete promoter is mobilized to silent genes from elsewhere in the genome. We term hereafter such recruited regulatory sequences as Putative Mobile Promoters (PMPs) and we hypothesize they have a large impact on rapid adaptation of novel or cryptic functions. Querying all publicly available prokaryotic genomes (1362) uncovered >4000 families of highly conserved PMPs (50 to 100 long with ≥80% nt identity) in 1043 genomes from 424 different genera. The genomes with the largest number of PMP families are Anabaena variabilis (28 families), Geobacter uraniireducens (27 families) and Cyanothece PCC7424 (25 families). Family size varied from 2 to 93 homologous promoters (in Desulfurivibrio alkaliphilus). Some PMPs are present in particular species, but some are conserved across distant genera. The identified PMPs represent a conservative dataset of very recent or conserved events of mobilization of non-coding DNA and thus they constitute evidence of an extensive reservoir of recyclable regulatory sequences for rapid transcriptional rewiring. PMID:22933716

  8. Do prokaryotes contain microtubules?

    NASA Technical Reports Server (NTRS)

    Bermudes, D.; Hinkle, G.; Margulis, L.

    1994-01-01

    In eukaryotic cells, microtubules are 24-nm-diameter tubular structures composed of a class of conserved proteins called tubulin. They are involved in numerous cell functions including ciliary motility, nerve cell elongation, pigment migration, centrosome formation, and chromosome movement. Although cytoplasmic tubules and fibers have been observed in bacteria, some with diameters similar to those of eukaryotes, no homologies to eukaryotic microtubules have been established. Certain groups of bacteria including azotobacters, cyanobacteria, enteric bacteria, and spirochetes have been frequently observed to possess microtubule-like structures, and others, including archaebacteria, have been shown to be sensitive to drugs that inhibit the polymerization of microtubules. Although little biochemical or molecular biological information is available, the differences observed among these prokaryotic structures suggest that their composition generally differs among themselves as well as from that of eukaryotes. We review the distribution of cytoplasmic tubules in prokaryotes, even though, in all cases, their functions remain unknown. At least some tend to occur in cells that are large, elongate, and motile, suggesting that they may be involved in cytoskeletal functions, intracellular motility, or transport activities comparable to those performed by eukaryotic microtubules. In Escherichia coli, the FtsZ protein is associated with the formation of a ring in the division zone between the newly forming offspring cells. Like tubulin, FtsZ is a GTPase and shares with tubulin a 7-amino-acid motif, making it a promising candidate in which to seek the origin of tubulins.

  9. Desiccation tolerance of prokaryotes.

    PubMed

    Potts, M

    1994-12-01

    The removal of cell-bound water through air drying and the addition of water to air-dried cells are forces that have played a pivotal role in the evolution of the prokaryotes. In bacterial cells that have been subjected to air drying, the evaporation of free cytoplasmic water (Vf) can be instantaneous, and an equilibrium between cell-bound water (Vb) and the environmental water (vapor) potential (psi wv) may be achieved rapidly. In the air-dried state some bacteria survive only for seconds whereas others can tolerate desiccation for thousands, perhaps millions, of years. The desiccated (anhydrobiotic) cell is characterized by its singular lack of water--with contents as low as 0.02 g of H2O g (dry weight)-1. At these levels the monolayer coverage by water of macromolecules, including DNA and proteins, is disturbed. As a consequence the mechanisms that confer desiccation tolerance upon air-dried bacteria are markedly different from those, such as the mechanism of preferential exclusion of compatible solutes, that preserve the integrity of salt-, osmotically, and freeze-thaw-stressed cells. Desiccation tolerance reflects a complex array of interactions at the structural, physiological, and molecular levels. Many of the mechanisms remain cryptic, but it is clear that they involve interactions, such as those between proteins and co-solvents, that derive from the unique properties of the water molecule. A water replacement hypothesis accounts for how the nonreducing disaccharides trehalose and sucrose preserve the integrity of membranes and proteins. Nevertheless, we have virtually no insight into the state of the cytoplasm of an air-dried cell. There is no evidence for any obvious adaptations of proteins that can counter the effects of air drying or for the occurrence of any proteins that provide a direct and a tangible contribution to cell stability. Among the prokaryotes that can exist as anhydrobiotic cells, the cyanobacteria have a marked capacity to do so. One

  10. Desiccation tolerance of prokaryotes.

    PubMed Central

    Potts, M

    1994-01-01

    The removal of cell-bound water through air drying and the addition of water to air-dried cells are forces that have played a pivotal role in the evolution of the prokaryotes. In bacterial cells that have been subjected to air drying, the evaporation of free cytoplasmic water (Vf) can be instantaneous, and an equilibrium between cell-bound water (Vb) and the environmental water (vapor) potential (psi wv) may be achieved rapidly. In the air-dried state some bacteria survive only for seconds whereas others can tolerate desiccation for thousands, perhaps millions, of years. The desiccated (anhydrobiotic) cell is characterized by its singular lack of water--with contents as low as 0.02 g of H2O g (dry weight)-1. At these levels the monolayer coverage by water of macromolecules, including DNA and proteins, is disturbed. As a consequence the mechanisms that confer desiccation tolerance upon air-dried bacteria are markedly different from those, such as the mechanism of preferential exclusion of compatible solutes, that preserve the integrity of salt-, osmotically, and freeze-thaw-stressed cells. Desiccation tolerance reflects a complex array of interactions at the structural, physiological, and molecular levels. Many of the mechanisms remain cryptic, but it is clear that they involve interactions, such as those between proteins and co-solvents, that derive from the unique properties of the water molecule. A water replacement hypothesis accounts for how the nonreducing disaccharides trehalose and sucrose preserve the integrity of membranes and proteins. Nevertheless, we have virtually no insight into the state of the cytoplasm of an air-dried cell. There is no evidence for any obvious adaptations of proteins that can counter the effects of air drying or for the occurrence of any proteins that provide a direct and a tangible contribution to cell stability. Among the prokaryotes that can exist as anhydrobiotic cells, the cyanobacteria have a marked capacity to do so. One

  11. Evolution of small prokaryotic genomes

    PubMed Central

    Martínez-Cano, David J.; Reyes-Prieto, Mariana; Martínez-Romero, Esperanza; Partida-Martínez, Laila P.; Latorre, Amparo; Moya, Andrés; Delaye, Luis

    2015-01-01

    As revealed by genome sequencing, the biology of prokaryotes with reduced genomes is strikingly diverse. These include free-living prokaryotes with ∼800 genes as well as endosymbiotic bacteria with as few as ∼140 genes. Comparative genomics is revealing the evolutionary mechanisms that led to these small genomes. In the case of free-living prokaryotes, natural selection directly favored genome reduction, while in the case of endosymbiotic prokaryotes neutral processes played a more prominent role. However, new experimental data suggest that selective processes may be at operation as well for endosymbiotic prokaryotes at least during the first stages of genome reduction. Endosymbiotic prokaryotes have evolved diverse strategies for living with reduced gene sets inside a host-defined medium. These include utilization of host-encoded functions (some of them coded by genes acquired by gene transfer from the endosymbiont and/or other bacteria); metabolic complementation between co-symbionts; and forming consortiums with other bacteria within the host. Recent genome sequencing projects of intracellular mutualistic bacteria showed that previously believed universal evolutionary trends like reduced G+C content and conservation of genome synteny are not always present in highly reduced genomes. Finally, the simplified molecular machinery of some of these organisms with small genomes may be used to aid in the design of artificial minimal cells. Here we review recent genomic discoveries of the biology of prokaryotes endowed with small gene sets and discuss the evolutionary mechanisms that have been proposed to explain their peculiar nature. PMID:25610432

  12. The chromosome cycle of prokaryotes

    PubMed Central

    Kuzminov, Andrei

    2013-01-01

    Summary In both eukaryotes and prokaryotes, chromosomal DNA undergoes replication, condensation-decondensation and segregation, sequentially, in some fixed order. Other conditions, like sister-chromatid cohesion (SCC), may span several chromosomal events. One set of these chromosomal transactions within a single cell cycle constitutes the “chromosome cycle”. For many years it was generally assumed that the prokaryotic chromosome cycle follows major phases of the eukaryotic one: -replication-condensation-segregation-(cell division)-decondensation-, with SCC of unspecified length. Eventually it became evident that, in contrast to the strictly consecutive chromosome cycle of eukaryotes, all stages of the prokaryotic chromosome cycle run concurrently. Thus, prokaryotes practice “progressive” chromosome segregation separated from replication by a brief SCC, and all three transactions move along the chromosome at the same fast rate. In other words, in addition to replication forks, there are “segregation forks” in prokaryotic chromosomes. Moreover, the bulk of prokaryotic DNA outside the replication-segregation transition stays compacted. I consider possible origins of this concurrent replication-segregation and outline the “nucleoid administration” system that organizes the dynamic part of the prokaryotic chromosome cycle. PMID:23962352

  13. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  14. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  15. INFECTIVITY OF HISTONE-POLIOVIRUS RIBONUCLEIC ACID PREPARATIONS.

    PubMed

    LUDWIG, E H; SMULL, C E

    1963-06-01

    Ludwig, Ernest H. (The Pennsylvania State University, University Park) and Christine E. Smull. Infectivity of histone-poliovirus ribonucleic acid preparations. J. Bacteriol. 85:1334-1338. 1963.-Some properties of histone-poliovirus ribonucleic acid (RNA) preparations, as relate to infectivity for HeLa cell monolayers, were investigated. The histone-RNA preparations were found to lose their infectivity rapidly at room temperature. They were considerably more stable at ice-bath temperature. Dilution of a histone-RNA preparation in a diluent containing an appropriate amount of histone yielded a plaque count which was proportional to the dilution factor, and which regressed linearly through the point of origin. Dilution of a histone-RNA preparation in a diluent containing no histone resulted in a rapidly decreasing plaque count which was not proportional to the dilution factor. The ability of histone to enhance the infectivity of poliovirus RNA was found to be dependent upon the presence of a low concentration of a monovalent salt in the histone-RNA preparations. Histone-RNA preparations containing approximately isotonic levels of NaCl exhibited a high degree of infectivity. When concentrations of NaCl outside this range were used, a great loss in infectivity of the histone-RNA preparations occurred. The NaCl could be replaced by KCl but not by CaCl(2), MgCl(2), or MgSO(4). PMID:14047226

  16. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  17. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  18. The Epigenomic Landscape of Prokaryotes

    PubMed Central

    Blow, Matthew J.; Clark, Tyson A.; Daum, Chris G.; Deutschbauer, Adam M.; Fomenkov, Alexey; Fries, Roxanne; Froula, Jeff; Kang, Dongwan D.; Malmstrom, Rex R.; Morgan, Richard D.; Posfai, Janos; Singh, Kanwar; Visel, Axel; Wetmore, Kelly; Zhao, Zhiying; Rubin, Edward M.; Korlach, Jonas; Pennacchio, Len A.; Roberts, Richard J.

    2016-01-01

    DNA methylation acts in concert with restriction enzymes to protect the integrity of prokaryotic genomes. Studies in a limited number of organisms suggest that methylation also contributes to prokaryotic genome regulation, but the prevalence and properties of such non-restriction-associated methylation systems remain poorly understood. Here, we used single molecule, real-time sequencing to map DNA modifications including m6A, m4C, and m5C across the genomes of 230 diverse bacterial and archaeal species. We observed DNA methylation in nearly all (93%) organisms examined, and identified a total of 834 distinct reproducibly methylated motifs. This data enabled annotation of the DNA binding specificities of 620 DNA Methyltransferases (MTases), doubling known specificities for previously hard to study Type I, IIG and III MTases, and revealing their extraordinary diversity. Strikingly, 48% of organisms harbor active Type II MTases with no apparent cognate restriction enzyme. These active ‘orphan’ MTases are present in diverse bacterial and archaeal phyla and show motif specificities and methylation patterns consistent with functions in gene regulation and DNA replication. Our results reveal the pervasive presence of DNA methylation throughout the prokaryotic kingdoms, as well as the diversity of sequence specificities and potential functions of DNA methylation systems. PMID:26870957

  19. ASM Conference on Prokaryotic Development

    SciTech Connect

    Kaplan, H. B.

    2005-07-13

    Support was provided by DOE for the 2nd ASM Conference on Prokaryotic Development. The final conference program and abstracts book is attached. The conference presentations are organized around topics that are central to the current research areas in prokaryotic development. The program starts with topics that involve relatively simple models systems and ends with systems that are more complex. The topics are: i) the cell cycle, ii) the cytoskeleton, iii) morphogenesis, iv) developmental transcription, v) signaling, vi) multicellularity, and vii) developmental diversity and symbiosis. The best-studied prokaryotic development model systems will be highlighted at the conference through research presentations by leaders in the field. Many of these systems are also model systems of relevance to the DOE mission including carbon sequestration (Bradyrizobium, Synechococcus), energy production (Anabaena, Rhodobacter) and bioremediation (Caulobacter, Mesorhizobium). In addition, many of the highlighted organisms have important practical applications; the actinomycetes and myxobacteria produce antimicrobials that are of commercial interest. It is certain that the cutting-edge science presented at the conference will be applicable to the large group of bacteria relevant to the DOE mission.

  20. NCBI prokaryotic genome annotation pipeline.

    PubMed

    Tatusova, Tatiana; DiCuccio, Michael; Badretdin, Azat; Chetvernin, Vyacheslav; Nawrocki, Eric P; Zaslavsky, Leonid; Lomsadze, Alexandre; Pruitt, Kim D; Borodovsky, Mark; Ostell, James

    2016-08-19

    Recent technological advances have opened unprecedented opportunities for large-scale sequencing and analysis of populations of pathogenic species in disease outbreaks, as well as for large-scale diversity studies aimed at expanding our knowledge across the whole domain of prokaryotes. To meet the challenge of timely interpretation of structure, function and meaning of this vast genetic information, a comprehensive approach to automatic genome annotation is critically needed. In collaboration with Georgia Tech, NCBI has developed a new approach to genome annotation that combines alignment based methods with methods of predicting protein-coding and RNA genes and other functional elements directly from sequence. A new gene finding tool, GeneMarkS+, uses the combined evidence of protein and RNA placement by homology as an initial map of annotation to generate and modify ab initio gene predictions across the whole genome. Thus, the new NCBI's Prokaryotic Genome Annotation Pipeline (PGAP) relies more on sequence similarity when confident comparative data are available, while it relies more on statistical predictions in the absence of external evidence. The pipeline provides a framework for generation and analysis of annotation on the full breadth of prokaryotic taxonomy. For additional information on PGAP see https://www.ncbi.nlm.nih.gov/genome/annotation_prok/ and the NCBI Handbook, https://www.ncbi.nlm.nih.gov/books/NBK174280/. PMID:27342282

  1. Interferon action on parental Semliki forest virus ribonucleic acid.

    PubMed

    Friedman, R M; Fantes, K H; Levy, H B; Carter, W B

    1967-12-01

    Actinomycin D-treated chick fibroblasts were infected with purified (32)P-labeled Semliki forest virus, and ribonucleic acid (RNA) was extracted after 1 or 2 hr. Within 1 hr, viral RNA forms sedimenting in sucrose gradients at 42S, 30S, and 16S were present. The 42S form corresponded to the RNA of the virion. The 16S form appeared to be a double-stranded template for the formation of new viral RNA, since nascent RNA was associated with it and the molecule could be heat-denatured and subsequently reannealed by slow cooling. Interferon treatment before infection, or puromycin (50 mug/ml) or cycloheximide (200 mug/ml) added at the time of virus infection, had no effect on the formation of the 30S RNA but inhibited the production of the 16S form. Several findings made it unlikely that these results were due to breakdown of parental RNA and reincorporation of (32)P into progeny structures. The results suggested that the mechanism of interferon action involves inhibition of protein synthesis by parental viral RNA, since a specific viral RNA polymerase had previously been demonstrated to be necessary for production of 16S RNA. No protein synthesis appears necessary for formation of 30S RNA from parental virus RNA. PMID:5621488

  2. Ribonucleic acid synthesis in normal and immune macrophages after antigenic stimulus.

    PubMed

    Soderberg, L S; Tewari, R P; Solotorovsky, M

    1976-06-01

    Macrophage ribonucleic acid (RNA) synthesis is an important metabolic process intimately related to the function of these cells. Mouse peritoneal macrophage RNA was extracted with phenol in the presence of bentonite and electrophoresed on composite agarose-polyacrylamide gels. The pulse-chase technique was used to follow the precursor relationships in macrophage ribosomal RNA (rRNA) maturation. The rRNA species at 18S and 28S appeared at 15 and 45 min, respectively, after RNA synthesis was halted. Their appearance corresponded closely to decreases in the rRNA precursors at 45S, 36S, and 34S. Studies of RNA methylation aided in confirming the identity of these ribosomal species. Unmethylated RNA species appeared as messenger RNA between 5S and 15S, and at about 55S probably represented heterodisperse nuclear RNA. When normal macrophages were incubated with heat-killed Salmonella enteritidis, an acceleration in the maturation of RNA was observed. The accelerated maturation was indicated by the earlier appearance of 28S rRNA and the more rapid development of an equilibrium state, where further labeling did not change the RNA profile. In macrophage RNA from mice immunized with S. enteritidis, rRNA species appeared rapidly but did not accumulate to the same extent as observed for normal macrophages. Precursor rRNA and other RNA species developed as usual, suggesting specific degradation of mature rRNA. Such rRNA wastage could indicate a mechanism controlling ribosome assembly in the non-proliferating activated macrophage. The pattern of RNA synthesis in immune macrophages was essentially unchanged by the presence of heat-killed S. enteritidis in vitro. PMID:971940

  3. Eukaryotic vs. prokaryotic chemosensory systems.

    PubMed

    Sbarbati, Andrea; Merigo, Flavia; Osculati, Francesco

    2010-04-01

    In the last decades, microbiologists demonstrated that microorganisms possess chemosensory capabilities and communicate with each other via chemical signals. In parallel, it was demonstrated that solitary eukaryotic chemosensory cells are diffusely located on the mucosae of digestive and respiratory apparatuses. It is now evident that on the mucosal surfaces of vertebrates, two chemoreceptorial systems (i.e. eukaryotic and prokaryotic) coexist in a common microenvironment. To date, it is not known if the two chemosensory systems reciprocally interact and compete for detection of chemical cues. This appears to be a fruitful field of study and future researches must consider that the mucosal epithelia possess more chemosensory capabilities than previously supposed. PMID:20347567

  4. The evolution of ecological tolerance in prokaryotes

    NASA Technical Reports Server (NTRS)

    Knoll, A. H.; Bauld, J.

    1989-01-01

    The ecological ranges of Archaeobacteria and Eubacteria are constrained by a requirement for liquid water and the physico-chemical stability limits of biomolecules, but within this broad envelope, prokaryotes have evolved adaptations that permit them to tolerate a remarkable spectrum of habitats. Laboratory experiments indicate that prokaryotes can adapt rapidly to novel environmental conditions, yet geological studies suggest early diversification and long-term stasis within the prokaryotic kingdoms. These apparently contradictory perspectives can be reconciled by understanding that, in general, rates and patterns of prokaryotic evolution reflect the developmental history of the Earth's surface environments. Our understanding of modern microbial ecology provides a lens through which our accumulating knowledge of physiology, molecular phylogeny and the Earth's history can be integrated and focussed on the phenomenon of prokaryotic evolution.

  5. Stygofauna enhance prokaryotic transport in groundwater ecosystems

    PubMed Central

    Smith, Renee J.; Paterson, James S.; Launer, Elise; Tobe, Shanan S.; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G.

    2016-01-01

    More than 97% of the world’s freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The “hitch-hiking” prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  6. Stygofauna enhance prokaryotic transport in groundwater ecosystems.

    PubMed

    Smith, Renee J; Paterson, James S; Launer, Elise; Tobe, Shanan S; Morello, Eliesa; Leijs, Remko; Marri, Shashikanth; Mitchell, James G

    2016-01-01

    More than 97% of the world's freshwater reserves are found in aquifers, making groundwater one of the most important resources on the planet. Prokaryotic communities in groundwater underpin the turnover of energy and matter while also maintaining groundwater purity. Thus, knowledge of microbial transport in the subsurface is crucial for maintaining groundwater health. Here, we describe for the first time the importance of stygofauna as vectors for prokaryotes. The "hitch-hiking" prokaryotes associated with stygofauna may be up to 5 orders of magnitude higher in abundance and transported up to 34× faster than bulk groundwater flow. We also demonstrate that prokaryotic diversity associated with stygofauna may be higher than that of the surrounding groundwater. Stygofauna are a newly recognized prokaryotic niche in groundwater ecosystems that have the potential to transport remediating, water purifying and pathogenic prokaryotes. Therefore, stygofauna may influence ecosystem dynamics and health at a microbial level, and at a larger scale could be a new source of prokaryotic diversity in groundwater ecosystems. PMID:27597322

  7. Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....

  8. Comparison of methods of extracting messenger Ribonucleic Acid from ejaculated Porcine (Sus Scrofa) Spermatozoa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    H. D. Guthrie, G.R. Welch, and L. A. Blomberg. Comparison of Methods of Extracting Messenger Ribonucleic Acid from Ejaculated Porcine (Sus Scrofa) Spermatozoa. Biotechnology and Germplasm Laboratory, Agricultural Research Service U. S. Department of Agriculture, Beltsville, MD 20705 The purpos...

  9. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  10. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  11. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. A critique of prokaryotic species concepts.

    PubMed

    Thane Papke, R

    2009-01-01

    Developments in DNA sequencing and population genetics analyses have revealed unanticipated complexity in prokaryotic variation. The observation that genetic traits are horizontally inherited at unexpected rates within and between closely related asexually reproducing lineages impacts our comprehension of prokaryotic evolution and ecology. As a result, the concepts that point to species as being discrete clusters or monophyletic lineages are at odds with most of the data, suggesting that taxon circumscription can only proceed by informed compromise, pragmatism, and subjectivity. PMID:19271197

  14. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  15. Characterization of a Ribonucleic Acid Polymerase Activity Associated with Purified Cytoplasmic Polyhedrosis Virus of the Silkworm Bombyx mori1

    PubMed Central

    Lewandowski, L. J.; Kalmakoff, J.; Tanada, Y.

    1969-01-01

    Purified cytoplasmic-polyhedrosis virus has been found to have associated with it a polymerase activity capable of catalyzing the synthesis of virus-specific, single-stranded ribonucleic acid (RNA) from the double-stranded RNA genome. PMID:16789118

  16. Prokaryotic and eukaryotic unicellular chronomics

    PubMed Central

    Halberg, F.; Cornélissen, G.; Faraone, P.; Poeggeler, B.; Hardeland, R.; Katinas, G.; Schwartzkopff, O.; Otsuka, K.; Bakken, E. E.

    2008-01-01

    An impeccable time series, published in 1930, consisting of hourly observations on colony advance in a fluid culture of E. coli, was analyzed by a periodogram and power spectrum in 1961. While the original senior author had emphasized specifically periodicity with no estimate of period length, he welcomed further analyses. After consulting his technician, he knew of no environmental periodicity related to human schedules other than an hourly photography. A periodogram analysis in 1961 showed a 20.75-h period. It was emphasized that “… the circadian period disclosed is not of exactly 24-h length.” Confirmations notwithstanding, a committee ruled out microbial circadian rhythms based on grounds that could have led to a different conclusion, namely first, the inability of some committee members to see (presumably by eyeballing) the rhythms in their own data, and second, what hardly follows, that there were “too many analyses” in the published papers. Our point in dealing with microbes and humans is that analyses are indispensable for quantification and for discovering a biologically novel spectrum of cyclicities, matching physical ones. The scope of circadian organization estimated in 1961 has become broader, including about 7-day, about half-yearly, about-yearly and ex-yearly and decadal periodisms, among others. Microbial circadians have become a field of their own with eyeballing, yet time-microscopy can quantify characteristics with their uncertainties and can assess broad chronomes (time structures) with features beyond circadians. As yet only suggestive differences between eukaryotes and prokaryotes further broaden the perspective and may lead to life’s sites of origin and to new temporal aspects of life’ s development as a chronomic tree by eventual rhythm dating in ontogeny and phylogeny. PMID:16275493

  17. [Role of non-coding regulatory ribonucleic acids in chronic inflammatory diseases].

    PubMed

    Heinz, G A; Mashreghi, M-F

    2016-05-01

    Non-coding regulatory ribonucleic acids (RNA), including microRNA, long non-coding RNA and circular RNA, can influence the expression of genes mediating inflammatory processes and therefore affect the course and progression of chronic inflammatory diseases. Recent studies using antisense oligonucleotides suggest that such non-coding regulatory RNAs are suitable as novel therapeutic target molecules for the treatment of inflammatory rheumatic diseases. PMID:27115697

  18. Isolation and analysis of (Gp)nXp sequences of rat liver 5S RNA by means of restricted ribonuclease T2 hydrolysis

    PubMed Central

    Willems, R.; Avdonina, T.; Lund, A.; Kisselev, L.L.

    1974-01-01

    Essentual difficulties arise when base number in oligoguanylic blocks and location of these blocks along the polynucleotide chain need to be determined in the course of determination of the nucleotide sequences in ribonucleic acids. To overcome this difficulty it is suggested to take advantage of a recently discovered resistance of phosphodiester bond between kethoxalated G and its 3′-neighbour against T2 RNase hydrolysis 1,2. The approach is illustrated by analysis of 5S RNA from rat liver. Sequences of general formula (Gp)nXp were isolated from T2 RNase hydrolysate of 5 S RNA rapidly and quantitatively. The information obtained greatly facilitates the whole procedure of sequencing. It is expected that the method proposed would be effective for analysis of 5 S and 4 S RNA and for highmolecular weight fragments of ribosomal and viral RNAs. PMID:4453523

  19. Evolutionary assembly patterns of prokaryotic genomes.

    PubMed

    Press, Maximilian O; Queitsch, Christine; Borenstein, Elhanan

    2016-06-01

    Evolutionary innovation must occur in the context of some genomic background, which limits available evolutionary paths. For example, protein evolution by sequence substitution is constrained by epistasis between residues. In prokaryotes, evolutionary innovation frequently happens by macrogenomic events such as horizontal gene transfer (HGT). Previous work has suggested that HGT can be influenced by ancestral genomic content, yet the extent of such gene-level constraints has not yet been systematically characterized. Here, we evaluated the evolutionary impact of such constraints in prokaryotes, using probabilistic ancestral reconstructions from 634 extant prokaryotic genomes and a novel framework for detecting evolutionary constraints on HGT events. We identified 8228 directional dependencies between genes and demonstrated that many such dependencies reflect known functional relationships, including for example, evolutionary dependencies of the photosynthetic enzyme RuBisCO. Modeling all dependencies as a network, we adapted an approach from graph theory to establish chronological precedence in the acquisition of different genomic functions. Specifically, we demonstrated that specific functions tend to be gained sequentially, suggesting that evolution in prokaryotes is governed by functional assembly patterns. Finally, we showed that these dependencies are universal rather than clade-specific and are often sufficient for predicting whether or not a given ancestral genome will acquire specific genes. Combined, our results indicate that evolutionary innovation via HGT is profoundly constrained by epistasis and historical contingency, similar to the evolution of proteins and phenotypic characters, and suggest that the emergence of specific metabolic and pathological phenotypes in prokaryotes can be predictable from current genomes. PMID:27197212

  20. How crowded is the prokaryotic cytoplasm?

    PubMed

    Spitzer, Jan; Poolman, Bert

    2013-07-11

    We consider biomacromolecular crowding within the cytoplasm of prokaryotic cells as a two-phase system of 'supercrowded' cytogel and 'dilute' cytosol; we simplify and quantify this model for a coccoid cell over a wide range of biomacromolecular crowding. The key result shows that the supercrowded cytogel extends the vectorial character of the plasma membrane deeper into the cytoplasm by about 20-70 nm. We discuss useful physiological insights that this model gives into the functioning of a prokaryotic cell on the micrometer scale. PMID:23735698

  1. Microcompartments and Protein Machines in Prokaryotes

    PubMed Central

    Saier, Milton H.

    2013-01-01

    The prokaryotic cell was once thought of as a “bag of enzymes” with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, non-random collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (i) the bacterial cytoskeleton and the apparati allowing DNA segregation during cells division, (ii) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis, (iii) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces, (iv) machines of protein folding, secretion and degradation, (v) metabolasomes carrying out specific chemical reactions, (vi) 24 hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle and (vii) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bounded prokaryotic organelles were considered in a recent JMMB written symposium concerned with membraneous compartmentalization in bacteria [Saier and Bogdanov, 2013]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple non-compartmentalized cell. PMID:23920489

  2. Stochastic evolution and multifractal classification of prokaryotes

    NASA Astrophysics Data System (ADS)

    Berryman, Matthew J.; Allison, Andrew G.; Abbott, Derek

    2003-05-01

    We introduce a model for simulating mutation of prokaryote DNA sequences. Using that model we can then evaluated traditional techniques like parsimony and maximum likelihood methods for computing phylogenetic relationships. We also use the model to mimic large scale genomic changes, and use this to evaluate multifractal and related information theory techniques which take into account these large changes in determining phylogenetic relationships.

  3. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  4. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  5. Prokaryotic Diacylglycerol Kinase and Undecaprenol Kinase

    PubMed Central

    Van Horn, Wade D.; Sanders, Charles R.

    2013-01-01

    Prokaryotic diacylglycerol kinase (DAGK) and undecaprenol kinase (UDPK) are the lone members of a family of multispan membrane enzymes that are very small, lack relationships to any other family of proteins—including water soluble kinases, and that exhibit an unusual structure and active site architecture. Escherichia coli DAGK plays an important role in recycling diacylglycerol produced as a byproduct of biosynthesis of molecules located in the periplasmic space. UDPK seems to play an analogous role in Gram-positive bacteria, where its importance is evident by the fact that UDPK is essential for biofilm formation by the oral pathogen Streptococcus mutans. DAGK has also long served as a model system for studies of membrane protein biocatalysis, folding, stability, and structure. This review explores our current understanding of the microbial physiology, enzymology, structural biology, and folding of the prokaryotic diacylglycerol kinase family, which is based on over 40 years of studies. PMID:22224599

  6. Microcompartments and protein machines in prokaryotes.

    PubMed

    Saier, Milton H

    2013-01-01

    The prokaryotic cell was once thought of as a 'bag of enzymes' with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, nonrandom collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (1) the bacterial cytoskeleton and the apparati allowing DNA segregation during cell division; (2) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis; (3) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces; (4) machines of protein folding, secretion and degradation; (5) metabolosomes carrying out specific chemical reactions; (6) 24-hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle, and (7) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bound prokaryotic organelles were considered in a recent Journal of Molecular Microbiology and Biotechnology written symposium concerned with membranous compartmentalization in bacteria [J Mol Microbiol Biotechnol 2013;23:1-192]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple noncompartmentalized cell. PMID:23920489

  7. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals' actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a "forgotten organ," functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host's biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID:26664911

  8. Prokaryotes Versus Eukaryotes: Who is Hosting Whom?

    PubMed Central

    Tellez, Guillermo

    2014-01-01

    Microorganisms represent the largest component of biodiversity in our world. For millions of years, prokaryotic microorganisms have functioned as a major selective force shaping eukaryotic evolution. Microbes that live inside and on animals outnumber the animals’ actual somatic and germ cells by an estimated 10-fold. Collectively, the intestinal microbiome represents a “forgotten organ,” functioning as an organ inside another that can execute many physiological responsibilities. The nature of primitive eukaryotes was drastically changed due to the association with symbiotic prokaryotes facilitating mutual coevolution of host and microbe. Phytophagous insects have long been used to test theories of evolutionary diversification; moreover, the diversification of a number of phytophagous insect lineages has been linked to mutualisms with microbes. From termites and honey bees to ruminants and mammals, depending on novel biochemistries provided by the prokaryotic microbiome, the association helps to metabolize several nutrients that the host cannot digest and converting these into useful end products (such as short-chain fatty acids), a process, which has huge impact on the biology and homeostasis of metazoans. More importantly, in a direct and/or indirect way, the intestinal microbiota influences the assembly of gut-associated lymphoid tissue, helps to educate immune system, affects the integrity of the intestinal mucosal barrier, modulates proliferation and differentiation of its epithelial lineages, regulates angiogenesis, and modifies the activity of enteric as well as the central nervous system. Despite these important effects, the mechanisms by which the gut microbial community influences the host’s biology remain almost entirely unknown. Our aim here is to encourage empirical inquiry into the relationship between mutualism and evolutionary diversification between prokaryotes and eukaryotes, which encourage us to postulate: who is hosting whom? PMID

  9. Metabolic Adaptation and Protein Complexes in Prokaryotes

    PubMed Central

    Krüger, Beate; Liang, Chunguang; Prell, Florian; Fieselmann, Astrid; Moya, Andres; Schuster, Stefan; Völker, Uwe; Dandekar, Thomas

    2012-01-01

    Protein complexes are classified and have been charted in several large-scale screening studies in prokaryotes. These complexes are organized in a factory-like fashion to optimize protein production and metabolism. Central components are conserved between different prokaryotes; major complexes involve carbohydrate, amino acid, fatty acid and nucleotide metabolism. Metabolic adaptation changes protein complexes according to environmental conditions. Protein modification depends on specific modifying enzymes. Proteins such as trigger enzymes display condition-dependent adaptation to different functions by participating in several complexes. Several bacterial pathogens adapt rapidly to intracellular survival with concomitant changes in protein complexes in central metabolism and optimize utilization of their favorite available nutrient source. Regulation optimizes protein costs. Master regulators lead to up- and downregulation in specific subnetworks and all involved complexes. Long protein half-life and low level expression detaches protein levels from gene expression levels. However, under optimal growth conditions, metabolite fluxes through central carbohydrate pathways correlate well with gene expression. In a system-wide view, major metabolic changes lead to rapid adaptation of complexes and feedback or feedforward regulation. Finally, prokaryotic enzyme complexes are involved in crowding and substrate channeling. This depends on detailed structural interactions and is verified for specific effects by experiments and simulations. PMID:24957769

  10. A quest for indigenous truffle helper prokaryotes.

    PubMed

    Gryndler, Milan; Soukupová, Lucie; Hršelová, Hana; Gryndlerová, Hana; Borovička, Jan; Streiblová, Eva; Jansa, Jan

    2013-06-01

    Tuber aestivum is the most common European truffle with significant commercial exploitation. Its production originates from natural habitats and from artificially inoculated host tree plantations. Formation of Tuber ectomycorrhizae in host seedling roots is often inefficient. One possible reason is the lack of indigenous associative microbes. Here we aimed at metagenetic characterization and cultivation of indigenous prokaryotes associated with T. aestivum in a field transect cutting through the fungus colony margin. Several operational taxonomic units (OTUs) showed close association with the T. aestivum in the ectomycorrhizae and in the soil, but there was no overlap between the associative prokaryotes in the two different habitats. Among those positively associated with the ectomycorrhizae, we identified several bacterial genera belonging to Pseudonocardineae. Extensive isolation efforts yielded many cultures of ectomycorrhizae-associative bacteria belonging to Rhizobiales and Streptomycineae, but none belonging to the Pseudonocardineae. The specific unculturable Tuber-associated prokaryotes are likely to play important roles in the biology of these ectomycorrhizal fungi, including modulation of competition with other symbiotic and saprotrophic microbes, facilitation of root penetration and/or accessing mineral nutrients in the soil. However, the ultimate proof of this hypothesis will require isolation of the microbes for metabolic studies, using novel cultivation approaches. PMID:23754715

  11. Dissecting the Molecular Properties of Prokaryotic Flotillins

    PubMed Central

    Bach, Juri Niño; Bramkamp, Marc

    2015-01-01

    Flotillins are universally conserved proteins that are present in all kingdoms of life. Recently it was demonstrated that the B. subtilis flotillin YuaG (FloT) has a direct influence on membrane domain formation by orchestrating lipid domains. Thereby it allocates a proper environment for diverse cellular machineries. YuaG creates platforms for signal transduction, processes crucial for biofilm formation, sporulation, competence, secretion, and others. Even though, flotillins are an emerging topic of research in the field of microbiology little is known about the molecular architecture of prokaryotic flotillins. All flotillins share common structural elements and are tethered to the membrane N’- terminally, followed by a so called PHB domain and a flotillin domain. We show here that prokaryotic flotillins are, similarly to eukaryotic flotillins, tethered to the membrane via a hairpin loop. Further it is demonstrated by sedimentation assays that B. subtilis flotillins do not bind to the membrane via their PHB domain contrary to eukaryotic flotillins. Size exclusion chromatography experiments, blue native PAGE and cross linking experiments revealed that B. subtilis YuaG can oligomerize into large clusters via the PHB domain. This illustrates an important difference in the setup of prokaryotic flotillins compared to the organization of eukaryotic flotillins. PMID:25635948

  12. Effect of Ethionine on the Ribonucleic Acid, Deoxyribonucleic Acid, and Protein Content of Escherichia coli

    PubMed Central

    Smith, Robert C.; Salmon, W. D.

    1965-01-01

    Smith, Robert C. (Auburn University, Auburn, Ala.), and W. D. Salmon. Effect of ethionine on the ribonucleic acid, deoxyribonucleic acid, and protein content of Escherichia coli. J. Bacteriol. 89:687–692. 1965.—The addition of ethionine to cultures of Escherichia coli K-12 W6, a methionine-requiring auxotroph, led to inhibition of the rate of increase in optical density when the ratio of ethionine to methionine was 200:1. When the ratio was 600:1, the increase in optical density became linear. When ethionine was substituted for methionine in the medium, the optical density of the culture increased, and there was a parallel increase in protein content. There was no cell division in these cultures. The rate of synthesis of ribonucleic acid (RNA) in a culture containing ethionine was similar to that of a culture deprived of methionine, but the synthesis of deoxyribonucleic acid in a culture with ethionine was about twice that of a culture deprived of methionine. No detectable radioactivity from ethionine-ethyl-1-C14 was incorporated into RNA. Ethionine-ethyl-1-C14 was readily incorporated into the protein fraction. PMID:14273646

  13. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  14. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola

    1970-01-01

    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  15. Regulation of the Tyrosine Biosynthetic Enzymes in Salmonella typhimurium: Analysis of the Involvement of Tyrosyl-Transfer Ribonucleic Acid and Tyrosyl-Transfer Ribonucleic Acid Synthetase1

    PubMed Central

    Heinonen, J.; Artz, S. W.; Zalkin, H.

    1972-01-01

    Mutants of Salmonella typhimurium were isolated that require tyrosine for growth because of an altered tyrosyl-transfer ribonucleic acid (tRNA) synthetase. Extracts of one strain (JK10) contain a labile enzyme with decreased ability to transfer tyrosine to tRNATyr and a higher Km for tyrosine than the wild-type enzyme. Strain JK10 maintains repressed levels of the tyrosine biosynthetic enzymes when the growth rate is restricted due to limitation of charged tRNATyr. Several second-site revertants of strain JK10 exhibit temperature-sensitive growth due to partially repaired, heat-labile tyrosyl-tRNA synthetase. The tyrosine biosynthetic enzymes are not derepressed in thermosensitive strains grown at the restrictive temperature. A class of tyrosine regulatory mutants, designated tyrR, contains normal levels of tyrosyl-tRNA synthetase and tRNATyr. These results suggest that charging of tRNATyr is not necessary for repression. This conclusion is substantiated by the finding that 4-aminophenylalanine, a tyrosine analogue which causes repression of the tyrosine biosynthetic enzymes, is not attached to tRNATyr in vivo, nor does it inhibit the attachment reaction in vitro. A combined regulatory effect due to the simultaneous presence of tyrS and tyrR mutations in the same strain was detected. The possibility of direct participation of tyrosyl-tRNA synthetase in tyrosine regulation is discussed. PMID:4404819

  16. Advantages and limitations of genomics in prokaryotic taxonomy.

    PubMed

    Sentausa, E; Fournier, P-E

    2013-09-01

    Taxonomic classification is an important field of microbiology, as it enables scientists to identify prokaryotes worldwide. Although the current classification system is still based on the one designed by Carolus Linnaeus, the currently available genomic content of several thousands of sequenced prokaryotic genomes represents a unique source of taxonomic information that should not be ignored. In addition, the development of faster, cheaper and improved sequencing methods has made genomics a tool that has a place in the workflow of a routine microbiology laboratory. Thus, genomics has reached a stage where it may be used in prokaryotic taxonomic classification, with criteria such as the genome index of average nucleotide identity being an alternative to DNA-DNA hybridization. However, several hurdles remain, including the lack of genomic sequences of many prokaryotic taxonomic representatives, and consensus procedures to describe new prokaryotic taxa that do not, as yet, accommodate genomic data. We herein review the advantages and disadvantages of using genomics in prokaryotic taxonomy. PMID:23490121

  17. Control of larval and egg development in Aedes aegypti with Ribonucleic acid interference (RNAi) against juvenile hormone acid methyl transferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi) is a powerful approach for elucidating gene functions in a variety of organisms, including mosquitoes and many other insects. Little has been done, however, to harness this approach in order to control adult and larval mosquitoes. Juvenile hormone (JH) plays a pi...

  18. Evolution of gene order conservation in prokaryotes

    PubMed Central

    Tamames, Javier

    2001-01-01

    Background As more complete genomes are sequenced, conservation of gene order between different organisms is emerging as an informative property of the genomes. Conservation of gene order has been used for predicting function and functional interactions of proteins, as well as for studying the evolutionary relationships between genomes. The reasons for the maintenance of gene order are still not well understood, as the organization of the prokaryote genome into operons and lateral gene transfer cannot possibly account for all the instances of conservation found. Comprehensive studies of gene order are one way of elucidating the nature of these maintaining forces. Results Gene order is extensively conserved between closely related species, but rapidly becomes less conserved among more distantly related organisms, probably in a cooperative fashion. This trend could be universal in prokaryotic genomes, as archaeal genomes are likely to behave similarly to bacterial genomes. Gene order conservation could therefore be used as a valid phylogenetic measure to study relationships between species. Even between very distant species, remnants of gene order conservation exist in the form of highly conserved clusters of genes. This suggests the existence of selective processes that maintain the organization of these regions. Because the clusters often span more than one operon, common regulation probably cannot be invoked as the cause of the maintenance of gene order. Conclusions Gene order conservation is a genomic measure that can be useful for studying relationships between prokaryotes and the evolutionary forces shaping their genomes. Gene organization is extensively conserved in some genomic regions, and further studies are needed to elucidate the reason for this conservation. PMID:11423009

  19. Simple sequence repeats in prokaryotic genomes

    PubMed Central

    Mrázek, Jan; Guo, Xiangxue; Shah, Apurva

    2007-01-01

    Simple sequence repeats (SSRs) in DNA sequences are composed of tandem iterations of short oligonucleotides and may have functional and/or structural properties that distinguish them from general DNA sequences. They are variable in length because of slip-strand mutations and may also affect local structure of the DNA molecule or the encoded proteins. Long SSRs (LSSRs) are common in eukaryotes but rare in most prokaryotes. In pathogens, SSRs can enhance antigenic variance of the pathogen population in a strategy that counteracts the host immune response. We analyze representations of SSRs in >300 prokaryotic genomes and report significant differences among different prokaryotes as well as among different types of SSRs. LSSRs composed of short oligonucleotides (1–4 bp length, designated LSSR1–4) are often found in host-adapted pathogens with reduced genomes that are not known to readily survive in a natural environment outside the host. In contrast, LSSRs composed of longer oligonucleotides (5–11 bp length, designated LSSR5–11) are found mostly in nonpathogens and opportunistic pathogens with large genomes. Comparisons among SSRs of different lengths suggest that LSSR1–4 are likely maintained by selection. This is consistent with the established role of some LSSR1–4 in enhancing antigenic variance. By contrast, abundance of LSSR5–11 in some genomes may reflect the SSRs' general tendency to expand rather than their specific role in the organisms' physiology. Differences among genomes in terms of SSR representations and their possible interpretations are discussed. PMID:17485665

  20. Emerging spatial patterns in Antarctic prokaryotes

    PubMed Central

    Chong, Chun-Wie; Pearce, David A.; Convey, Peter

    2015-01-01

    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  1. Emerging spatial patterns in Antarctic prokaryotes.

    PubMed

    Chong, Chun-Wie; Pearce, David A; Convey, Peter

    2015-01-01

    Recent advances in knowledge of patterns of biogeography in terrestrial eukaryotic organisms have led to a fundamental paradigm shift in understanding of the controls and history of life on land in Antarctica, and its interactions over the long term with the glaciological and geological processes that have shaped the continent. However, while it has long been recognized that the terrestrial ecosystems of Antarctica are dominated by microbes and their processes, knowledge of microbial diversity and distributions has lagged far behind that of the macroscopic eukaryote organisms. Increasing human contact with and activity in the continent is leading to risks of biological contamination and change in a region whose isolation has protected it for millions of years at least; these risks may be particularly acute for microbial communities which have, as yet, received scant recognition and attention. Even a matter apparently as straightforward as Protected Area designation in Antarctica requires robust biodiversity data which, in most parts of the continent, remain almost completely unavailable. A range of important contributing factors mean that it is now timely to reconsider the state of knowledge of Antarctic terrestrial prokaryotes. Rapid advances in molecular biological approaches are increasingly demonstrating that bacterial diversity in Antarctica may be far greater than previously thought, and that there is overlap in the environmental controls affecting both Antarctic prokaryotic and eukaryotic communities. Bacterial dispersal mechanisms and colonization patterns remain largely unaddressed, although evidence for regional evolutionary differentiation is rapidly accruing and, with this, there is increasing appreciation of patterns in regional bacterial biogeography in this large part of the globe. In this review, we set out to describe the state of knowledge of Antarctic prokaryote diversity patterns, drawing analogy with those of eukaryote groups where appropriate

  2. Inhibition of ribonucleic acid polymerase by a bacteriocin from Bacteroides fragilis.

    PubMed Central

    Mossie, K G; Robb, F T; Jones, D T; Woods, D R

    1981-01-01

    The Bacteroides fragilis bacteriocin which inhibits ribonucleic acid (RNA) polymerase activity had a narrow activity spectrum in vivo and only inhibited the growth of certain B. fragilis strains. In vitro the bacteriocin was not specific and inhibited RNA polymerases from widely diverse bacterial genera. RNA polymerases from rifampin-resistant strains of Bacteroides thetaiotaomicron and Clostridium acetobutylicum were resistant to the bacteriocin in vitro. Purified bacteriocin bound to partially purified RNA polymerase, and both proteins were cosedimented in a glycerol gradient. In the RNA polymerase reaction, the bacteriocin acted as a competitive inhibitor for adenosine, cytidine, and uridine 5'-triphosphates and as a noncompetitive inhibitor for guanosine 5'-triphosphate. The bacteriocin did not inhibit RNA polymerase from chicken embryos. PMID:6177280

  3. Transcription In Vitro by Reovirus-Associated Ribonucleic Acid-Dependent Polymerase 1

    PubMed Central

    Banerjee, A. K.; Shatkin, A. J.

    1970-01-01

    Digestion of purified reovirus type 3 with chymotrypsin degrades 70% of the viral protein and converts the virions to subviral particles (SVP). The SVP contain 3 of the 6 viral structural proteins and all 10 double-stranded ribonucleic acid (RNA) genome segments but not adenine-rich, single-stranded RNA. An RNA polymerase which is structurally associated with SVP transcribes one strand of each genome segment by a conservative mechanism in vitro. The single-stranded products include large (1.2 × 106 daltons), medium (0.7 × 106 daltons), and small (0.4 × 106 daltons) molecules which hybridize exclusively with the corresponding genome segments. The enzyme obtained by heating virions at 60 C synthesizes similar products. Kinetic and pulse-chase studies indicate that the different-sized products are synthesized simultaneously but at rates which are in the order: small > medium > large. Images PMID:5529847

  4. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    SciTech Connect

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2014-09-15

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitated lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.

  5. The role of renin-angiotensin aldosterone system related micro-ribonucleic acids in hypertension

    PubMed Central

    Wang, Hui-Bo; Yang, Jun

    2015-01-01

    Micro-ribonucleic acids (miRNAs) are small (21-25 nucleotide) single-stranded, evolutionarily conserved non-protein-coding RNAs, which control diverse cellular functions by interacting with the 3’ untranslated region of specific target messenger RNAs at the post-transcriptional level. Research shows that an aberrant expression profile of miRNAs has been linked to a series of diseases, including hypertension. In the past few decades, it has been demonstrated that excessive activation of the renin-angiotensin aldosterone system (RAAS) involves in the pathogenesis of hypertension. This article reviews the latest insights in the identification of RAAS-correlative miRNAs and the potential mechanisms for their roles in hypertension. PMID:26446323

  6. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  7. Prokaryotic Ubiquitin-Like Protein Modification

    PubMed Central

    Maupin-Furlow, Julie A.

    2016-01-01

    Prokaryotes form ubiquitin (Ub)-like isopeptide bonds on the lysine residues of proteins by at least two distinct pathways that are reversible and regulated. In mycobacteria, the C-terminal Gln of Pup (prokaryotic ubiquitin-like protein) is deamidated and isopeptide linked to proteins by a mechanism distinct from ubiquitylation in enzymology yet analogous to ubiquitylation in targeting proteins for destruction by proteasomes. Ub-fold proteins of archaea (SAMPs, small archaeal modifier proteins) and Thermus (TtuB, tRNA-two-thiouridine B) that differ from Ub in amino acid sequence, yet share a common β-grasp fold, also form isopeptide bonds by a mechanism that appears streamlined compared with ubiquitylation. SAMPs and TtuB are found to be members of a small group of Ub-fold proteins that function not only in protein modification but also in sulfur-transfer pathways associated with tRNA thiolation and molybdopterin biosynthesis. These multifunctional Ub-fold proteins are thought to be some of the most ancient of Ub-like protein modifiers. PMID:24995873

  8. Prokaryotic silicon utilizing microorganisms in the biosphere

    NASA Astrophysics Data System (ADS)

    Gupta, D.; Das, S.

    2012-12-01

    Although a little study has been done to determine the silicon utilizing prokaryotes, our previous experiments indicated that almost all Gram-positive bacteria are silicon utilizing; one of them, Streptococci survived exposure on the lunar surface for a long period in experiment done by others. Our initial experiments with these Gram positive microorganisms showed that there were limited growths of these microorganisms on carbon free silicate medium probably with the help of some carry over carbon and nitrogen during cultivation procedures. However, increase in growth rate after repeated subcultures could not be explained at present. The main groups of prokaryotes which were found silicon utilizing microorganisms were Mycobacterium, Bacillus, Nocardia, Streptomyces, Staphylococcus, Streptococcus, Lactobacillus, and Clostridium. In a another previous study by us when silicon level was studied in such grown up cells on carbon "free" silicate medium by electron prove microanalyser, it was found that silicon in cells grown on carbon "free" silicate medium was much higher (24.9%) than those grown on conventional carbon based medium (0.84%). However, these initial findings are encouraging for our future application of this group of organisms on extraterrestrial surfaces for artificial micro-ecosystem formation. It was found that when electropositive elements are less in extraterrestrial situation, then polymerization of silicon-oxygen profusion may occur easily, particularly in carbon and nitrogen paucity in the rocky worlds of the Universe.

  9. PEPR: pipelines for evaluating prokaryotic references.

    PubMed

    Olson, Nathan D; Zook, Justin M; Samarov, Daniel V; Jackson, Scott A; Salit, Marc L

    2016-04-01

    The rapid adoption of microbial whole genome sequencing in public health, clinical testing, and forensic laboratories requires the use of validated measurement processes. Well-characterized, homogeneous, and stable microbial genomic reference materials can be used to evaluate measurement processes, improving confidence in microbial whole genome sequencing results. We have developed a reproducible and transparent bioinformatics tool, PEPR, Pipelines for Evaluating Prokaryotic References, for characterizing the reference genome of prokaryotic genomic materials. PEPR evaluates the quality, purity, and homogeneity of the reference material genome, and purity of the genomic material. The quality of the genome is evaluated using high coverage paired-end sequence data; coverage, paired-end read size and direction, as well as soft-clipping rates, are used to identify mis-assemblies. The homogeneity and purity of the material relative to the reference genome are characterized by comparing base calls from replicate datasets generated using multiple sequencing technologies. Genomic purity of the material is assessed by checking for DNA contaminants. We demonstrate the tool and its output using sequencing data while developing a Staphylococcus aureus candidate genomic reference material. PEPR is open source and available at https://github.com/usnistgov/pepr . PMID:26935931

  10. Biophysical Adaptations of Prokaryotic Voltage-Gated Sodium Channels.

    PubMed

    Vien, T N; DeCaen, P G

    2016-01-01

    This chapter describes the adaptive features found in voltage-gated sodium channels (NaVs) of prokaryotes and eukaryotes. These two families are distinct, having diverged early in evolutionary history but maintain a surprising degree of convergence in function. While prokaryotic NaVs are required for growth and motility, eukaryotic NaVs selectively conduct fast electrical currents for short- and long-range signaling across cell membranes in mammalian organs. Current interest in prokaryotic NaVs is stoked by their resolved high-resolution structures and functional features which are reminiscent of eukaryotic NaVs. In this chapter, comparisons between eukaryotic and prokaryotic NaVs are made to highlight the shared and unique aspects of ion selectivity, voltage sensitivity, and pharmacology. Examples of prokaryotic and eukaryotic NaV convergent evolution will be discussed within the context of their structural features. PMID:27586280

  11. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  12. International code of nomenclature of prokaryotes

    SciTech Connect

    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.

    2015-11-20

    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate application of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.

  13. International code of nomenclature of prokaryotes

    DOE PAGESBeta

    Garrity, George M.; Parker, Charles T.; Tindall, Brian J.

    2015-11-20

    Here, this volume contains the edition of the International Code of Nomenclature of Prokaryotes that was presented in draft form and available for comment at the Plenary Session of the Fourteenth International Congress of Bacteriology and Applied Microbiology (BAM), Montréal, 2014, together with updated lists of conserved and rejected bacterial names and of Opinions issued by the Judicial Commission. As in the past it brings together those changes accepted, published and documented by the ICSP and the Judicial Commission since the last revision was published. Several new appendices have been added to this edition. Appendix 11 addresses the appropriate applicationmore » of the Candidatus concept, Appendix 12 contains the history of the van Niel Prize, and Appendix 13 contains the summaries of Congresses.« less

  14. Evolution of thiol protective systems in prokaryotes

    NASA Technical Reports Server (NTRS)

    Fahey, R. C.; Newton, G. L.

    1986-01-01

    Biological thiols are essential elements in most aspects of cell function but undergo rapid oxidation to disulfides in the presence of oxygen. The evolution of systems to protect against such oxygen toxicity was essential to the emergence of aerobic life. The protection system used by eukaryotes is based upon glutathione (GSH) and GSH-dependent enzymes but many bacteria lack GSH and apparently use other mechanisms. The objective of this research is to elaborate the thiol protective mechanisms employed by prokaryotes of widely divergent evolutionary origin and to understand why GSH became the central thiol employed in essentially all higher organisms. Thiol-selective fluorescent labeling and HPLC analysis has been used to determine key monothiol components.

  15. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  16. Magnetite as a prokaryotic biomarker: A review

    NASA Astrophysics Data System (ADS)

    Jimenez-Lopez, Concepcion; Romanek, Christopher S.; Bazylinski, Dennis A.

    2010-06-01

    Over the years, nanometer-sized magnetite (Fe3O4) crystals have been recovered from many modern and ancient environments including sediments and soils and even meteorites. In some cases these crystals have been used as "magnetofossils" for evidence of the past presence of specific microbes. Magnetite nanocrystals can be formed by a number of different biological and inorganic mechanisms resulting in crystals with different physical and magnetic characteristics. Prokaryotes (bacteria) biomineralize magnetite through two methods that differ mechanistically, including: biologically induced mineralization (BIM) and biologically controlled mineralization (BCM). Magnetite nanocrystals produced by BIM are known to be synthesized by the dissimilatory iron-reducing bacteria, are deposited external to the cell, and generally are physically indistinguishable from magnetite particles formed inorganically. BCM magnetites, in contrast, are synthesized by the magnetotactic bacteria and some higher organisms and are precipitated intracellularly as membrane-bounded structures called magnetosomes. These magnetites appear to have unique crystal morphologies and a narrow size range leading to their original use as magnetofossils. Because of the discovery of nanometer-sized crystals of magnetite in the Martian meteorite ALH84001, the use of these criteria for the determination of whether magnetite crystals could constitute a prokaryotic biomarker was questioned. Thus, there is currently great debate over what criteria to use in the determination of whether specific magnetite crystals are biogenic or not. In the last decade, additional criteria have been established (e.g., the Magnetite Assay for Biogenicity), and new tools and technologies have been developed to determine the origin of specific types of magnetite crystals.

  17. Translational Selection Is Ubiquitous in Prokaryotes

    PubMed Central

    Supek, Fran; Škunca, Nives; Repar, Jelena; Vlahoviček, Kristian; Šmuc, Tomislav

    2010-01-01

    Codon usage bias in prokaryotic genomes is largely a consequence of background substitution patterns in DNA, but highly expressed genes may show a preference towards codons that enable more efficient and/or accurate translation. We introduce a novel approach based on supervised machine learning that detects effects of translational selection on genes, while controlling for local variation in nucleotide substitution patterns represented as sequence composition of intergenic DNA. A cornerstone of our method is a Random Forest classifier that outperformed previous distance measure-based approaches, such as the codon adaptation index, in the task of discerning the (highly expressed) ribosomal protein genes by their codon frequencies. Unlike previous reports, we show evidence that translational selection in prokaryotes is practically universal: in 460 of 461 examined microbial genomes, we find that a subset of genes shows a higher codon usage similarity to the ribosomal proteins than would be expected from the local sequence composition. These genes constitute a substantial part of the genome—between 5% and 33%, depending on genome size—while also exhibiting higher experimentally measured mRNA abundances and tending toward codons that match tRNA anticodons by canonical base pairing. Certain gene functional categories are generally enriched with, or depleted of codon-optimized genes, the trends of enrichment/depletion being conserved between Archaea and Bacteria. Prominent exceptions from these trends might indicate genes with alternative physiological roles; we speculate on specific examples related to detoxication of oxygen radicals and ammonia and to possible misannotations of asparaginyl–tRNA synthetases. Since the presence of codon optimizations on genes is a valid proxy for expression levels in fully sequenced genomes, we provide an example of an “adaptome” by highlighting gene functions with expression levels elevated specifically in thermophilic

  18. Detecting uber-operons in prokaryotic genomes

    PubMed Central

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: , the first of its kind. PMID:16682449

  19. Ribosomal ribonucleic acid isolated from Salmonella typhimurium: absence of the intact 23S species.

    PubMed Central

    Winkler, M E

    1979-01-01

    Ribonucleic acid (RNA) isolated by four distinct methods and from a variety of Salmonella typhimurium strains lacked intact 23S ribosomal RNA (rRNA). On sucrose gradients which minimize aggregation, the vast majority of S. typhimurium rRNA sedimented as a 16S peak with a 14S shoulder. RNA from this region of the gradient was resolved into three discrete bands by electrophoresis in formamide. Two very minor S. typhimurium RNA peaks were resolved at 21S and 10S on sucrose gradients, and each peak formed discrete bands in electrophoresis. It is concluded that if S. typhimurium does possess an intact 23S rRNA species, this species is extremely "labile." The absence of isolatable S. typhimurium 23S rRNA possibly reflected in vivo processing of the rRNA before isolation. Under certain conditions, S. typhimurium rRNA formed discrete aggregates which sedimented similarly to intact Escherichia coli 23S rRNA. Images PMID:383696

  20. Evaluating the reproducibility of quantifying modified nucleosides from ribonucleic acids by LC-UV-MS.

    PubMed

    Russell, Susan P; Limbach, Patrick A

    2013-04-01

    Post-transcriptional chemical covalent modification of adenosine, guanosine, uridine and cytidine occurs frequently in all types of ribonucleic acids (RNAs). In ribosomal RNA (rRNA) and transfer RNA (tRNA) these modifications make important contributions to RNA structure and stability and to the accuracy and efficiency of protein translation. The functional dynamics, synergistic nature and regulatory roles of these posttranscriptional nucleoside modifications within the cell are not well characterized. These modifications are present at very low levels and isolation of individual nucleosides for analysis requires a complex multi-step approach. The focus of this study is to characterize the reproducibility of a liquid chromatography method used to isolate and quantitatively characterize modified nucleosides in tRNA and rRNA when nucleoside detection is performed using ultraviolet and mass spectrometric detection (UV and MS, respectively). Despite the analytical challenges of sample isolation and dynamic range, quantitative profiling of modified nucleosides obtained from bacterial tRNAs and rRNAs is feasible at relative standard deviations of 5% RSD or less. PMID:23500350

  1. Aggregates of Small Nuclear Ribonucleic Acids (snRNAs) in Alzheimer’s Disease’

    PubMed Central

    Hales, Chadwick M.; Dammer, Eric B.; Diner, Ian; Yi, Hong; Seyfried, Nicholas T.; Gearing, Marla; Glass, Jonathan D.; Montine, Thomas J.; Levey, Allan I.; Lah, James J.

    2014-01-01

    We recently discovered that protein components of the ribonucleic acid (RNA) spliceosome form cytoplasmic aggregates in Alzheimer’s disease (AD) brain, resulting in widespread changes in RNA splicing. However, the involvement of small nuclear RNAs (snRNAs), also key components of the spliceosome complex, in the pathology of AD remains unknown. Using immunohistochemical staining of post-mortem human brain and spinal cord, we identified cytoplasmic tangle-shaped aggregates of snRNA in both sporadic and familial AD cases but not in aged controls or other neurodegenerative disorders. Immunofluorescence using antibodies reactive with the 2,2,7-trimethylguanosine cap of snRNAs and transmission electron microscopy demonstrated snRNA localization with tau and paired helical filaments, the main component of neurofibrillary tangles. Quantitative real-time polymerase chain reaction (PCR) showed U1 snRNA accumulation in the insoluble fraction of AD brains whereas other U snRNAs were not enriched. In combination with our previous results, these findings demonstrate that aggregates of U1 snRNA and U1 small nuclear ribonucleoproteins represent a new pathological hallmark of AD. PMID:24571648

  2. Kinetic models of ribonucleic acid fermentation and continuous culture by Candida tropicalis no.121.

    PubMed

    Li, Bingbing; Chen, Xiaochun; Ren, Huajing; Li, Lei; Xiong, Jian; Bai, Jianxin; Chen, Yong; Wu, Jinglan; Ying, Hanjie

    2012-03-01

    During ribonucleic acid fermentation, the fermentative processes were researched at pH controlled at 4.0 and under natural conditions. Unstructured models in a 50-L airlift fermentor were established for batch RNA production at pH 4.0 using the Verhulst equation for microbial growth, the Luedeking-Piret equation for product formation and a Luedeking-Piret-like equation for substrate uptake. Parameters of the kinetic models were determined using origin 7.5. Based on the models estimated above, another batch fermentation experiment was conducted in a 300-L airlift fermentor, which demonstrated that the models could be useful for RNA production on an industrial scale. Additionally, continuous fermentation based on kinetic models was proposed to make full use of substrates and reduce the cost of waste water treatment. As a result, although the DCW and RNA concentration were 11.5 and 1.68 g L(-1), which were lower than that of batch fermentation, the sugar utilization increased by 14.3%, while the waste water decreased by more than 90%. PMID:21853330

  3. Mutants of Salmonella typhimurium with an Altered Leucyl-Transfer Ribonucleic Acid Synthetase

    PubMed Central

    Alexander, Renee R.; Calvo, J. M.; Freundlich, M.

    1971-01-01

    Two trifluoroleucine-resistant mutants of Salmonella typhimurium, strains CV69 and CV117, had an altered leucyl-transfer ribonucleic acid (tRNA) synthetase. The mutant enzymes had higher apparent Km values for leucine (ca. 10-fold) and lower specific activities (ca. twofold) than the parent enzyme when tested in crude extracts. Preparations of synthetase purified ca. 60-fold from the parent and strain CV117 differed sixfold in their leucine Km values. In addition, the mutant enzyme was inactivated faster than the parent enzyme at 50 C. The growth rates of strains CV69 and CV117 at 37 C were not significantly different from that of the parent, whereas at 42 C strain CV69 grew more slowly than the parent. Leucine-, valine-, and isoleucine-forming enzymes were partially derepressed when the mutants were grown in minimal medium; the addition of leucine repressed these enzymes to wild-type levels. During growth in minimal medium, the proportion of leucine tRNA that was charged in the mutants was about 75% of that in the parent. The properties of strain CV117 were shown to result from a single mutation located near gal at minute 18 on the genetic map. These studies suggest that leucyl-tRNA synthetase is involved in repression of the enzymes required for the synthesis of branched-chain amino acids. PMID:4928008

  4. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  5. Regulation of prokaryotic gene expression by eukaryotic-like enzymes

    PubMed Central

    Burnside, Kellie; Rajagopal, Lakshmi

    2011-01-01

    Summary A growing body of evidence indicates that serine/threonine kinases (STK) and phosphatases (STP) regulate gene expression in prokaryotic organisms. As prokaryotic STKs and STPs are not DNA binding proteins, regulation of gene expression is accomplished through post-translational modification of their targets. These include two-component response regulators, DNA binding proteins and proteins that mediate transcription and translation. This review summarizes our current understanding of how STKs and STPs mediate gene expression in prokaryotes. Further studies to identify environmental signals that trigger the signaling cascade and elucidation of mechanisms that regulate cross-talk between eukaryotic-like signaling enzymes, two-component systems, and components of the transcriptional and translational machinery will facilitate a greater understanding of prokaryotic gene regulation. PMID:22221896

  6. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  7. Horizontal Transfer and Evolution of Prokaryote Transposable Elements in Eukaryotes

    PubMed Central

    Gilbert, Clément; Cordaux, Richard

    2013-01-01

    Horizontal transfer (HT) of transposable elements (TEs) plays a key role in prokaryotic evolution, and mounting evidence suggests that it has also had an important impact on eukaryotic evolution. Although many prokaryote-to-prokaryote and eukaryote-to-eukaryote HTs of TEs have been characterized, only few cases have been reported between prokaryotes and eukaryotes. Here, we carried out a comprehensive search for all major groups of prokaryotic insertion sequences (ISs) in 430 eukaryote genomes. We uncovered a total of 80 sequences, all deriving from the IS607 family, integrated in the genomes of 14 eukaryote species belonging to four distinct phyla (Amoebozoa, Ascomycetes, Basidiomycetes, and Stramenopiles). Given that eukaryote IS607-like sequences are most closely related to cyanobacterial IS607 and that their phylogeny is incongruent with that of their hosts, we conclude that the presence of IS607-like sequences in eukaryotic genomes is the result of several HT events. Selection analyses further suggest that our ability to detect these prokaryote TEs today in eukaryotes is because HT of these sequences occurred recently and/or some IS607 elements were domesticated after HT, giving rise to new eukaryote genes. Supporting the recent age of some of these HTs, we uncovered intact full-length, potentially active IS607 copies in the amoeba Acanthamoeba castellani. Overall, our study shows that prokaryote-to-eukaryote HT of TEs occurred at relatively low frequency during recent eukaryote evolution and it sets IS607 as the most widespread TE (being present in prokaryotes, eukaryotes, and viruses). PMID:23563966

  8. Eukaryotic and Prokaryotic Cytoskeletons: Structure and Mechanics

    NASA Astrophysics Data System (ADS)

    Gopinathan, Ajay

    2013-03-01

    The eukaryotic cytoskeleton is an assembly of filamentous proteins and a host of associated proteins that collectively serve functional needs ranging from spatial organization and transport to the production and transmission of forces. These systems can exhibit a wide variety of non-equilibrium, self-assembled phases depending on context and function. While much recent progress has been made in understanding the self-organization, rheology and nonlinear mechanical properties of such active systems, in this talk, we will concentrate on some emerging aspects of cytoskeletal physics that are promising. One such aspect is the influence of cytoskeletal network topology and its dynamics on both active and passive intracellular transport. Another aspect we will highlight is the interplay between chirality of filaments, their elasticity and their interactions with the membrane that can lead to novel conformational states with functional implications. Finally we will consider homologs of cytoskeletal proteins in bacteria, which are involved in templating cell growth, segregating genetic material and force production, which we will discuss with particular reference to contractile forces during cell division. These prokaryotic structures function in remarkably similar yet fascinatingly different ways from their eukaryotic counterparts and can enrich our understanding of cytoskeletal functioning as a whole.

  9. How prokaryotes deal with arsenic(†).

    PubMed

    Slyemi, Djamila; Bonnefoy, Violaine

    2012-12-01

    Arsenic is a notorious poison classified as a carcinogen, a teratogen and a clastogen that ranks number one on the Environmental Protection Agency's priority list of drinking water contaminants. It is ubiquitous and relatively abundant in the Earth's crust. Its mobilization in waters by weathering, volcanic, anthropogenic or biological activities represents a major hazard to public health, exemplified in India and Bangladesh where 50 million people are acutely at risk. Since basically the origin of life, microorganisms have been exposed to this toxic compound and have evolved a variety of resistance mechanisms, such as extracellular precipitation, chelation, intracellular sequestration, active extrusion from the cell or biochemical transformation (redox or methylation). Arsenic efflux systems are widespread and are found in nearly all organisms. Some microorganisms are also able to utilize this metalloid as a metabolic energy source through either arsenite oxidation or arsenate reduction. The energy metabolism involving redox reactions of arsenic has been suggested to have evolved during early life on Earth. This review highlights the different systems evolved by prokaryotes to cope with arsenic and how they participate in its biogeochemical cycle. PMID:23760928

  10. Identification of replication origins in prokaryotic genomes.

    PubMed

    Sernova, Natalia V; Gelfand, Mikhail S

    2008-09-01

    The availability of hundreds of complete bacterial genomes has created new challenges and simultaneously opportunities for bioinformatics. In the area of statistical analysis of genomic sequences, the studies of nucleotide compositional bias and gene bias between strands and replichores paved way to the development of tools for prediction of bacterial replication origins. Only a few (about 20) origin regions for eubacteria and archaea have been proven experimentally. One reason for that may be that this is now considered as an essentially bioinformatics problem, where predictions are sufficiently reliable not to run labor-intensive experiments, unless specifically needed. Here we describe the main existing approaches to the identification of replication origin (oriC) and termination (terC) loci in prokaryotic chromosomes and characterize a number of computational tools based on various skew types and other types of evidence. We also classify the eubacterial and archaeal chromosomes by predictability of their replication origins using skew plots. Finally, we discuss possible combined approaches to the identification of the oriC sites that may be used to improve the prediction tools, in particular, the analysis of DnaA binding sites using the comparative genomic methods. PMID:18660512

  11. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  12. Mining featured micro ribonucleic acids associated with lung cancer based on bioinformatics

    PubMed Central

    Su, Lin; Li, Na; Huo, Xueyun

    2015-01-01

    Background Few genetic markers useful for the screening of lung cancer risk exist. Although related research has shown that certain expression profiles of micro ribonucleic acids (miRNAs) are different in lung cancer versus the normal lung, such as miR-29a and miR-29s, the precise molecular mechanism of lung cancer remains obscure. In order to get a better understanding of the pathogenetic mechanism of lung cancer, we analyzed the differentially expressed genes (DEGs) and identified featured miRNAs in lung cancer tissues. Methods We used the gene expression profile GSE10072, including 49 gene chips of non-tumor tissues and 58 gene chips of lung tumor specimens. The DEGs between these two groups were identified by Limma package in R language. The TarBase database was used to construct the networks of miRNA regulating DEGs related to lung cancer. After ordering miRNAs regulating DEGs, we further screened featured miRNAs combined with the miR2Disease database. Results A total of 5572 DEGs were obtained between lung cancer and control specimens. After constructing a miRNA regulatory network, a total of 398 regulations between 57 miRNAs and 321 target genes existed. By intergrating the miR2Disease database and using a sorting algorithm, a total of six featured miRNAs related to lung cancer were identified, including miR-520h, miR-133a, miR-34, miR-103, miR-370, and miR-148. They might be involved in lung cancer progression by regulating ABCG2, PKM2, VAMP2, GPD1, MAP3K8, and DNMT3B, respectively. Conclusion The top 10 significant miRNAs, such as miR-520h, miR-133a, miR-34, and miR-103 may be potential therapeutic targets for lung cancer. PMID:26273407

  13. The developmental transcriptome landscape of bovine skeletal muscle defined by Ribo-Zero ribonucleic acid sequencing.

    PubMed

    Sun, X; Li, M; Sun, Y; Cai, H; Li, R; Wei, X; Lan, X; Huang, Y; Lei, C; Chen, H

    2015-12-01

    Ribonucleic acid sequencing (RNA-Seq) libraries are normally prepared with oligo(dT) selection of poly(A)+ mRNA, but it depends on intact total RNA samples. Recent studies have described Ribo-Zero technology, a novel method that can capture both poly(A)+ and poly(A)- transcripts from intact or fragmented RNA samples. We report here the first application of Ribo-Zero RNA-Seq for the analysis of the bovine embryonic, neonatal, and adult skeletal muscle whole transcriptome at an unprecedented depth. Overall, 19,893 genes were found to be expressed, with a high correlation of expression levels between the calf and the adult. Hundreds of genes were found to be highly expressed in the embryo and decreased at least 10-fold after birth, indicating their potential roles in embryonic muscle development. In addition, we present for the first time the analysis of global transcript isoform discovery in bovine skeletal muscle and identified 36,694 transcript isoforms. Transcriptomic data were also analyzed to unravel sequence variations; 185,036 putative SNP and 12,428 putative short insertions-deletions (InDel) were detected. Specifically, many stop-gain, stop-loss, and frameshift mutations were identified that probably change the relative protein production and sequentially affect the gene function. Notably, the numbers of stage-specific transcripts, alternative splicing events, SNP, and InDel were greater in the embryo than in the calf and the adult, suggesting that gene expression is most active in the embryo. The resulting view of the transcriptome at a single-base resolution greatly enhances the comprehensive transcript catalog and uncovers the global trends in gene expression during bovine skeletal muscle development. PMID:26641174

  14. The bacterial magnetosome: a unique prokaryotic organelle.

    PubMed

    Lower, Brian H; Bazylinski, Dennis A

    2013-01-01

    The bacterial magnetosome is a unique prokaryotic organelle comprising magnetic mineral crystals surrounded by a phospholipid bilayer. These inclusions are biomineralized by the magnetotactic bacteria which are ubiquitous, aquatic, motile microorganisms. Magnetosomes cause cells of magnetotactic bacteria to passively align and swim along the Earth's magnetic field lines, as miniature motile compass needles. These specialized compartments consist of a phospholipid bilayer membrane surrounding magnetic crystals of magnetite (Fe3O4) or greigite (Fe3S4). The morphology of these membrane-bound crystals varies by species with a nominal magnetic domain size between 35 and 120 nm. Almost all magnetotactic bacteria arrange their magnetosomes in a chain within the cell there by maximizing the magnetic dipole moment of the cell. It is presumed that magnetotactic bacteria use magnetotaxis in conjunction with chemotaxis to locate and maintain an optimum position for growth and survival based on chemistry, redox and physiology in aquatic habitats with vertical chemical concentration and redox gradients. The biosynthesis of magnetosomes is a complex process that involves several distinct steps including cytoplasmic membrane modifications, iron uptake and transport, initiation of crystallization, crystal maturation and magnetosome chain formation. While many mechanistic details remain unresolved, magnetotactic bacteria appear to contain the genetic determinants for magnetosome biomineralization within their genomes in clusters of genes that make up what is referred to as the magnetosome gene island in some species. In addition, magnetosomes contain a unique set of proteins, not present in other cellular fractions, which control the biomineralization process. Through the development of genetic systems, proteomic and genomic work, and the use of molecular and biochemical tools, the functions of a number of magnetosome membrane proteins have been demonstrated and the molecular

  15. Connected gene neighborhoods in prokaryotic genomes

    PubMed Central

    Rogozin, Igor B.; Makarova, Kira S.; Murvai, Janos; Czabarka, Eva; Wolf, Yuri I.; Tatusov, Roman L.; Szekely, Laszlo A.; Koonin, Eugene V.

    2002-01-01

    A computational method was developed for delineating connected gene neighborhoods in bacterial and archaeal genomes. These gene neighborhoods are not typically present, in their entirety, in any single genome, but are held together by overlapping, partially conserved gene arrays. The procedure was applied to comparing the orders of orthologous genes, which were extracted from the database of Clusters of Orthologous Groups of proteins (COGs), in 31 prokaryotic genomes and resulted in the identification of 188 clusters of gene arrays, which included 1001 of 2890 COGs. These clusters were projected onto actual genomes to produce extended neighborhoods including additional genes, which are adjacent to the genes from the clusters and are transcribed in the same direction, which resulted in a total of 2387 COGs being included in the neighborhoods. Most of the neighborhoods consist predominantly of genes united by a coherent functional theme, but also include a minority of genes without an obvious functional connection to the main theme. We hypothesize that although some of the latter genes might have unsuspected roles, others are maintained within gene arrays because of the advantage of expression at a level that is typical of the given neighborhood. We designate this phenomenon ‘genomic hitchhiking’. The largest neighborhood includes 79 genes (COGs) and consists of overlapping, rearranged ribosomal protein superoperons; apparent genome hitchhiking is particularly typical of this neighborhood and other neighborhoods that consist of genes coding for translation machinery components. Several neighborhoods involve previously undetected connections between genes, allowing new functional predictions. Gene neighborhoods appear to evolve via complex rearrangement, with different combinations of genes from a neighborhood fixed in different lineages. PMID:12000841

  16. Enzymatic Characterization of a Prokaryotic Urea Carboxylase

    PubMed Central

    Kanamori, Takeshi; Kanou, Norihisa; Atomi, Haruyuki; Imanaka, Tadayuki

    2004-01-01

    We identified the first prokaryotic urea carboxylase (UCA) from a member of the alpha subclass of the class Proteobacteria, Oleomonas sagaranensis. This enzyme (O. sagaranensis Uca) was composed of 1,171 amino acids, and its N-terminal region resembled the biotin carboxylase domains of various biotin-dependent carboxylases. The C-terminal region of the enzyme harbored the Met-Lys-Met motif found in biotin carboxyl carrier proteins. The primary structure of the enzyme was 45% identical to that of the urea carboxylase domain of urea amidolyase from Saccharomyces cerevisiae. O. sagaranensis Uca did not harbor the allophanate hydrolase domain found in the yeast enzyme, but a separate gene with structural similarity was found to be adjacent to the uca gene. Purified recombinant O. sagaranensis Uca displayed ATP-dependent carboxylase activity towards urea (Vmax = 21.2 μmol mg−1 min−1) but not towards acetyl coenzyme A (acetyl-CoA) and propionyl-CoA, indicating that the gene encoded a bona fide UCA and not an acetyl-CoA or propionyl-CoA carboxylase. The enzyme also exhibited high levels of activity towards acetamide and formamide. Kinetic parameters of the enzyme reaction were determined with ATP, urea, acetamide, and formamide. O. sagaranensis could grow on urea, acetamide, and formamide as sole nitrogen sources; moreover, ATP-dependent urea-degrading activity was found in cells grown with urea but not in cells grown with ammonia. The results suggest that the UCA of this organism may be involved in the assimilation of these compounds as nitrogen sources. Furthermore, orthologues of the O. sagaranensis uca gene were found to be widely distributed among Bacteria. This implies that there are two systems of urea degradation in Bacteria, a pathway catalyzed by the previously described ureases and the UCA-allophanate hydrolase pathway identified in this study. PMID:15090492

  17. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  19. Evolutionary constraints of phosphorylation in eukaryotes, prokaryotes, and mitochondria.

    PubMed

    Gnad, Florian; Forner, Francesca; Zielinska, Dorota F; Birney, Ewan; Gunawardena, Jeremy; Mann, Matthias

    2010-12-01

    High accuracy mass spectrometry has proven to be a powerful technology for the large scale identification of serine/threonine/tyrosine phosphorylation in the living cell. However, despite many described phosphoproteomes, there has been no comparative study of the extent of phosphorylation and its evolutionary conservation in all domains of life. Here we analyze the results of phosphoproteomics studies performed with the same technology in a diverse set of organisms. For the most ancient organisms, the prokaryotes, only a few hundred proteins have been found to be phosphorylated. Applying the same technology to eukaryotic species resulted in the detection of thousands of phosphorylation events. Evolutionary analysis shows that prokaryotic phosphoproteins are preferentially conserved in all living organisms, whereas-site specific phosphorylation is not. Eukaryotic phosphosites are generally more conserved than their non-phosphorylated counterparts (with similar structural constraints) throughout the eukaryotic domain. Yeast and Caenorhabditis elegans are two exceptions, indicating that the majority of phosphorylation events evolved after the divergence of higher eukaryotes from yeast and reflecting the unusually large number of nematode-specific kinases. Mitochondria present an interesting intermediate link between the prokaryotic and eukaryotic domains. Applying the same technology to this organelle yielded 174 phosphorylation sites mapped to 74 proteins. Thus, the mitochondrial phosphoproteome is similarly sparse as the prokaryotic phosphoproteomes. As expected from the endosymbiotic theory, phosphorylated as well as non-phosphorylated mitochondrial proteins are significantly conserved in prokaryotes. However, mitochondrial phosphorylation sites are not conserved throughout prokaryotes, consistent with the notion that serine/threonine phosphorylation in prokaryotes occurred relatively recently in evolution. Thus, the phosphoproteome reflects major events in the

  20. A Rapid Technique for the Estimation of Polynucleotide Adenylyltransferase and Ribonucleic Acid Polymerase in Plant Tissues 1

    PubMed Central

    Walter, Trevor J.; Mans, Rusty J.

    1975-01-01

    Nucleic acid-dependent polynucleotide adenylytransferase (EC 2.7.7.19) and ribonucleic acid polymerase (EC 2.7.7.6) have been partially purified from maize tissues (Zea mays L.) utilizing ammonium sulfate precipitation and batch diethylaminoethylcellulose chromatography. The technique is applicable to the simultaneous processing of up to eight samples of plant tissue and affords a rapid and reproducible means of assaying these two enzymes from small quantities of kernels or seedlings. The kinetic characteristics of the partially purified enzymes resemble those from more extensively purified preparations. PMID:16659402

  1. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  2. Why keep the pressure to estimate prokaryotic activities? (Invited)

    NASA Astrophysics Data System (ADS)

    Tamburini, C.

    2013-12-01

    Recent discoveries challenge the paradigm that cycling of organic matter is slow in the deep sea and mediated by microbial food webs of static structure and function. Data showing spatial variation in prokaryotic abundance and activity support the hypothesis that deep-sea microorganisms respond dynamically to variations in organic matter input to the bathypelagic realm. Moreover, almost half of the total water column heterotrophic prokaryotic production takes place below the epipelagic layer. Compiled global budgets suggest that the estimate of metabolic activity in the dark pelagic ocean exceeds the input of organic carbon. However, these conclusions are based mainly on measurements done at atmospheric pressure without taking into account pressure effects on natural prokaryotic assemblages. In this presentation, I will clarify the effect of hydrostatic pressure on prokaryotes living in the dark ocean and inform experimental design and the achievement of more accurate estimates of microbial activity in the deep ocean. Finally, their potential capabilities to degrade complex compounds as well as the chemolithoautrophy in the deep ocean represent examples of ways to explore deeper the role of deep-sea prokaryotes in the global cycles.

  3. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  4. Inhibition of Peptidoglycan, Ribonucleic Acid, and Protein Synthesis in Tolerant Strains of Streptococcus mutans

    PubMed Central

    Mychajlonka, Myron; McDowell, Thomas D.; Shockman, Gerald D.

    1980-01-01

    Exposure of exponentially growing cultures of Streptococcus mutans strains FA-1 and GS-5 to various concentrations of benzylpenicillin (Pen G) resulted in inhibition of turbidity increases at low concentrations (0.02 to 0.04 μg/ml). However, in contrast to some other streptococcal species, growth inhibition was not accompanied by cellular lysis or by a rapid loss of viability. In both strains, synthesis of insoluble cell wall peptidoglycan was very sensitive to Pen G inhibition and responded in a dose-dependent manner to concentrations of about 0.2 and 0.5 μg/ml for strains GS-5 and FA-1, respectively. Higher Pen G concentrations failed to inhibit further either growth or insoluble peptidoglycan assembly. Somewhat surprisingly, Pen G also inhibited both ribonucleic acid (RNA) and protein syntheses, each in a dose-dependent manner. Compared with inhibition of peptidoglycan synthesis, inhibition of RNA and protein syntheses by Pen G was less rapid and less extensive. Maximum amounts of radiolabeled Pen G were specifically bound to intact cells upon exposure to about 0.2 and 0.5 μg/ml of Pen G for strains GS-5 and FA-1, respectively, concentrations consistent with those that resulted in maximum or near-maximum inhibitions of the synthesis of cellular peptidoglycan, RNA, and protein. Five polypeptide bands that had a very high affinity for [14C]Pen G were detected in a crude cell envelope preparation of strain FA-1. After exposure of cultures of strain FA-1 to the effects of saturating concentrations of the drug for up to 3 h, addition of penicillinase was followed by recovery of growth after a lag. The length of the lag before regrowth depended on both Pen G concentration and time of exposure. On the basis of these and other observations, it is proposed that the secondary inhibitions of cellular RNA or protein synthesis, or both, are involved in the tolerance of these organisms to lysis and killing by Pen G and other inhibitors of insoluble peptidoglycan assembly

  5. Boletus edulis ribonucleic acid - a potent apoptosis inducer in human colon adenocarcinoma cells.

    PubMed

    Lemieszek, Marta Kinga; Ribeiro, Miguel; Guichard Alves, Helena; Marques, Guilhermina; Nunes, Fernando Milheiro; Rzeski, Wojciech

    2016-07-13

    Despite the large popularity of the Boletus edulis mushroom, little is known about its influence on human health and the possibilities of its therapeutic use. Nevertheless, several reports revealed the usefulness of biopolymers isolated from it in cancer treatment. Our previous studies have shown that B. edulis water soluble biopolymers are not toxic against normal colon epithelial cells (CCD841 CoTr) and at the same concentration range elicited a very prominent antiproliferative effect in colon cancer cells (LS180) which was accompanied with cell cycle arrest in the G0/G1 phase. The purpose of the present study was to verify the proapoptotic properties of a selected fraction from B. edulis - BE3, as well as determine its chemical nature. The BE3 fraction was extracted with hot water and purified by anion-exchange chromatography. Further chemical examinations revealed that BE3 consists mainly of ribonucleic acid (59.1%). The ability of BE3 to induce programmed cell death was examined in human colon cancer cell lines LS180 and HT-29 by measuring caspase activation, DNA fragmentation and expression of BAX, BCL2, TP53 and CDKN1A genes. The sensitivity of colon cancer cells with silenced BAX, TP53 and CDKN1A expression to BE3 treatment was also evaluated. We have demonstrated for the first time that the BE3 fraction is a potent apoptosis inducer in human colon cancer cells. The revealed mechanism of apoptosis triggering was dependent on the presence of functional p53 and consequently was a little different in investigated cell lines. Our results indicated that BE3 stimulated proapoptotic genes BAX (LS180, HT-29), TP53 (LS180) and CDKN1A (HT-29) while at the same time silenced the expression of the key prosurvival gene BCL2 (LS180, HT-29). The obtained results indicate the high therapeutic potential of the BE3 fraction against colon cancer, yet it is necessary to further confirm fraction efficacy and safety in animal and clinical studies. PMID:27302173

  6. Roary: rapid large-scale prokaryote pan genome analysis

    PubMed Central

    Page, Andrew J.; Cummins, Carla A.; Hunt, Martin; Wong, Vanessa K.; Reuter, Sandra; Holden, Matthew T.G.; Fookes, Maria; Falush, Daniel; Keane, Jacqueline A.; Parkhill, Julian

    2015-01-01

    Summary: A typical prokaryote population sequencing study can now consist of hundreds or thousands of isolates. Interrogating these datasets can provide detailed insights into the genetic structure of prokaryotic genomes. We introduce Roary, a tool that rapidly builds large-scale pan genomes, identifying the core and accessory genes. Roary makes construction of the pan genome of thousands of prokaryote samples possible on a standard desktop without compromising on the accuracy of results. Using a single CPU Roary can produce a pan genome consisting of 1000 isolates in 4.5 hours using 13 GB of RAM, with further speedups possible using multiple processors. Availability and implementation: Roary is implemented in Perl and is freely available under an open source GPLv3 license from http://sanger-pathogens.github.io/Roary Contact: roary@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26198102

  7. Coevolution of the Organization and Structure of Prokaryotic Genomes.

    PubMed

    Touchon, Marie; Rocha, Eduardo P C

    2016-01-01

    The cytoplasm of prokaryotes contains many molecular machines interacting directly with the chromosome. These vital interactions depend on the chromosome structure, as a molecule, and on the genome organization, as a unit of genetic information. Strong selection for the organization of the genetic elements implicated in these interactions drives replicon ploidy, gene distribution, operon conservation, and the formation of replication-associated traits. The genomes of prokaryotes are also very plastic with high rates of horizontal gene transfer and gene loss. The evolutionary conflicts between plasticity and organization lead to the formation of regions with high genetic diversity whose impact on chromosome structure is poorly understood. Prokaryotic genomes are remarkable documents of natural history because they carry the imprint of all of these selective and mutational forces. Their study allows a better understanding of molecular mechanisms, their impact on microbial evolution, and how they can be tinkered in synthetic biology. PMID:26729648

  8. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A

    1981-01-01

    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  9. Advanced nuclear magnetic resonance lanthanide probe analyses of short-range conformational interrelations controlling ribonucleic acid structures.

    PubMed

    Yokoyama, S; Inagaki, F; Miyazawa, T

    1981-05-12

    An advanced method was developed for lanthanide-probe analyses of the conformations of flexible biomolecules such as nucleotides. The new method is to determine structure parameters (such as internal-rotation angles) and population parameters for local conformational equilibria of flexible sites, together with standard deviations of these parameters. As the prominent advantage of this method, the interrelations among local conformations of flexible sites may be quantitatively elucidated from the experimental data of lanthanide-induced shifts and relaxations and vicinal coupling constants. As a structural unit of ribonucleic acids, the molecular conformations and conformational equilibria of uridine 3'-monophosphate in aqueous solution were analyzed. The stable local conformers about the C3'-O3' bond are the G+ (phi' = 281 +/- 11 degrees) and G- (phi' = 211 +/- 8 degrees) forms. The internal rotation about the C3'-O3' bond and the ribose-ring puckering are interrelated; 97 +/- 5% of the C3'-endo ribose ring is associated with the G- form while 70 +/- 22% o the C2'-endo ribose ring is associated with the G+ form. An interdependency also exists between the internal rotation about the C4'-C5' bond and the ribose-ring puckering. These short-range conformational interrelations are probably important in controlling the dynamic aspects of ribonucleic acid structures. PMID:6166319

  10. Hydroxyquinolines inhibit ribonucleic acid-dependent deoxyribonucleic acid polymerase and inactivate Rous sarcoma virus and herpes simplex virus.

    PubMed

    Rohde, W; Mikelens, P; Jackson, J; Blackman, J; Whitcher, J; Levinson, W

    1976-08-01

    8-Hydroxyquinoline and several of its derivatives inactivate the transforming ability of Rous sarcoma virus and inhibit its ribonucleic acid-dependent deoxyribonucleic acid polymerase activity. The copper complex of these metal-binding ligands is as active as the free ligand. The activity of the 8-hydroxyquinolines is approximately 50-fold more effective than another group of metal-binding compounds that we have tested, the thiosemicarbazones. In contrast to the potency of the 8-hydroxyquinolines to inactivate Rous sarcoma virus, no intracellular inhibition of transformation could be demonstrated at a concentration that did not affect the growth and appearance of the cells. Cellular deoxyribonucleic acid synthesis was inhibited to a greater extent than was ribonucleic acid or protein synthesis. The phenomenon of "concentration quenching" was observed with high concentrations of drug, causing less inhibition of deoxyribonucleic acid synthesis than was observed with lower concentrations. Herpes simplex virus type 1 was inactivated also by the 8-hydroxyquinolines and their copper complexes. No intracellular inhibition of plaque formation was observed. Treatment with 8-hydroxyquinoline sulfate had no effect on the resolution of herpetic keratitis in rabbits. Some 8-hydroxyquinolines bind to deoxyribonucleic acid in the presence of copper, a phenomenon that may be important in their antiviral activity. PMID:185949

  11. Energetics and genetics across the prokaryote-eukaryote divide

    PubMed Central

    2011-01-01

    Background All complex life on Earth is eukaryotic. All eukaryotic cells share a common ancestor that arose just once in four billion years of evolution. Prokaryotes show no tendency to evolve greater morphological complexity, despite their metabolic virtuosity. Here I argue that the eukaryotic cell originated in a unique prokaryotic endosymbiosis, a singular event that transformed the selection pressures acting on both host and endosymbiont. Results The reductive evolution and specialisation of endosymbionts to mitochondria resulted in an extreme genomic asymmetry, in which the residual mitochondrial genomes enabled the expansion of bioenergetic membranes over several orders of magnitude, overcoming the energetic constraints on prokaryotic genome size, and permitting the host cell genome to expand (in principle) over 200,000-fold. This energetic transformation was permissive, not prescriptive; I suggest that the actual increase in early eukaryotic genome size was driven by a heavy early bombardment of genes and introns from the endosymbiont to the host cell, producing a high mutation rate. Unlike prokaryotes, with lower mutation rates and heavy selection pressure to lose genes, early eukaryotes without genome-size limitations could mask mutations by cell fusion and genome duplication, as in allopolyploidy, giving rise to a proto-sexual cell cycle. The side effect was that a large number of shared eukaryotic basal traits accumulated in the same population, a sexual eukaryotic common ancestor, radically different to any known prokaryote. Conclusions The combination of massive bioenergetic expansion, release from genome-size constraints, and high mutation rate favoured a protosexual cell cycle and the accumulation of eukaryotic traits. These factors explain the unique origin of eukaryotes, the absence of true evolutionary intermediates, and the evolution of sex in eukaryotes but not prokaryotes. Reviewers This article was reviewed by: Eugene Koonin, William Martin

  12. Origins of prokaryotes, eukaryotes, mitochondria, and chloroplasts

    NASA Technical Reports Server (NTRS)

    Schwartz, R. M.; Dayhoff, M. O.

    1978-01-01

    A computer branching model is used to analyze cellular evolution. Attention is given to certain key amino acids and nucleotide residues (ferredoxin, 5s ribosomal RNA, and c-type cytochromes) because of their commonality over a wide variety of cell types. Each amino acid or nucleotide residue is a sequence in an inherited biological trait; and the branching method is employed to align sequences so that changes reflect substitution of one residue for another. Based on the computer analysis, the symbiotic theory of cellular evolution is considered the most probable. This theory holds that organelles, e.g., mitochondria and chloroplasts invaded larger bodies, e.g., bacteria, and combined functions to form eucaryotic cells.

  13. Genome Networks Root the Tree of Life between Prokaryotic Domains

    PubMed Central

    Dagan, Tal; Roettger, Mayo; Bryant, David; Martin, William

    2010-01-01

    Eukaryotes arose from prokaryotes, hence the root in the tree of life resides among the prokaryotic domains. The position of the root is still debated, although pinpointing it would aid our understanding of the early evolution of life. Because prokaryote evolution was long viewed as a tree-like process of lineage bifurcations, efforts to identify the most ancient microbial lineage split have traditionally focused on positioning a root on a phylogenetic tree constructed from one or several genes. Such studies have delivered widely conflicting results on the position of the root, this being mainly due to methodological problems inherent to deep gene phylogeny and the workings of lateral gene transfer among prokaryotes over evolutionary time. Here, we report the position of the root determined with whole genome data using network-based procedures that take into account both gene presence or absence and the level of sequence similarity among all individual gene families that are shared across genomes. On the basis of 562,321 protein-coding gene families distributed across 191 genomes, we find that the deepest divide in the prokaryotic world is interdomain, that is, separating the archaebacteria from the eubacteria. This result resonates with some older views but conflicts with the results of most studies over the last decade that have addressed the issue. In particular, several studies have suggested that the molecular distinctness of archaebacteria is not evidence for their antiquity relative to eubacteria but instead stems from some kind of inherently elevated rate of archaebacterial sequence change. Here, we specifically test for such a rate elevation across all prokaryotic lineages through the analysis of all possible quartets among eight genes duplicated in all prokaryotes, hence the last common ancestor thereof. The results show that neither the archaebacteria as a group nor the eubacteria as a group harbor evidence for elevated evolutionary rates in the sampled

  14. Terminal sequence studies of high-molecular-weight ribonucleic acid. The 3′-termini of rabbit globin messenger ribonucleic acid

    PubMed Central

    Hunt, John A.

    1973-01-01

    Haemoglobin mRNA isolated from EDTA-treated polyribosomes has an apparent molecular weight of 120000–180000 estimated by condensation with 3H-labelled isoniazid after periodate oxidation. Analysis of the ribonuclease digests of isoniazid-labelled RNA by paper electrophoresis and column chromatography enables the amount of contaminating 18S, 7S, 5S and 4S RNA to be estimated, and a corrected molecular weight of globin mRNA as the acid is 161000 or 500 nucleotides in length. This molecule contains two groups of 3′-terminal sequences in equal yield; G-Y-A6 and G-Y-A7 in the ratio 3:2, and G-N9–16-Y-A2 and G-N9–16-Y-N3 in the ratio 3:2. The significance of these sequences is discussed in relation to the poly(A) content of globin mRNA, the specificity of the sequences, and possible function in processing and biosynthesis of mRNA. PMID:4737318

  15. Cytokinesis in Prokaryotes and Eukaryotes: Common Principles and Different Solutions

    PubMed Central

    Nanninga, Nanne

    2001-01-01

    Cytokinesis requires duplication of cellular structures followed by bipolarization of the predivisional cell. As a common principle, this applies to prokaryotes as well as eukaryotes. With respect to eukaryotes, the discussion has focused mainly on Saccharomyces cerevisiae and on Schizosaccharomyces pombe. Escherichia coli and to a lesser extent Bacillus subtilis have been used as prokaryotic examples. To establish a bipolar cell, duplication of a eukaryotic origin of DNA replication as well as its genome is not sufficient. Duplication of the microtubule-organizing center is required as a prelude to mitosis, and it is here that the dynamic cytoskeleton with all its associated proteins comes to the fore. In prokaryotes, a cytoskeleton that pervades the cytoplasm appears to be absent. DNA replication and the concomitant DNA segregation seem to occur without help from extensive cytosolic supramacromolecular assemblies but with help from the elongating cellular envelope. Prokaryotic cytokinesis proceeds through a contracting ring, which has a roughly 100-fold-smaller circumference than its eukaryotic counterpart. Although the ring contains proteins that can be considered as predecessors of actin, tubulin, and microtubule-associated proteins, its macromolecular composition is essentially different. PMID:11381104

  16. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  17. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  18. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes

    PubMed Central

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F.

    2015-01-01

    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners—the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)—and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic—and plant and algal—lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller’s ratchet—the origin of eukaryotic recombination, or sex—might have required surprisingly little evolutionary innovation. PMID:25733873

  19. Gene duplications in prokaryotes can be associated with environmental adaptation

    PubMed Central

    2010-01-01

    Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism

  20. Top-Down Control of Diesel-Degrading Prokaryotic Communities.

    PubMed

    Sauret, Caroline; Böttjer, Daniela; Talarmin, Agathe; Guigue, Catherine; Conan, Pascal; Pujo-Pay, Mireille; Ghiglione, Jean-François

    2015-08-01

    Biostimulation through the addition of inorganic nutrients has been the most widely practiced bioremediation strategy in oil-polluted marine waters. However, little attention has so far been paid to the microbial food web and the impact of top-down control that directly or indirectly influences the success of the bioremediation. We designed a mesocosm experiment using pre-filtered (<50 μm) surface seawater from the Bay of Banyuls-sur-Mer (North-Western Mediterranean Sea) and examined the top-down effect exerted by heterotrophic nanoflagellates (HNF) and virus-like particles (VLP) on prokaryotic abundance, activity and diversity in the presence or absence of diesel fuel. Prokaryotes, HNF and VLP abundances showed a predator-prey succession, with a co-development of HNF and VLP. In the polluted system, we observed a stronger impact of viral lysis on prokaryotic abundances than in the control. Analysis of the diversity revealed that a bloom of Vibrio sp. occurred in the polluted mesocosm. That bloom was rapidly followed by a less abundant and more even community of predation-resistant bacteria, including known hydrocarbon degraders such as Oleispira spp. and Methylophaga spp. and opportunistic bacteria such as Percisivirga spp., Roseobacter spp. and Phaeobacter spp. The shift in prokaryotic dominance in response to viral lysis provided clear evidence of the 'killing the winner' model. Nevertheless, despite clear effects on prokaryotic abundance, activity and diversity, the diesel degradation was not impacted by top-down control. The present study investigates for the first time the functioning of a complex microbial network (including VLP) using a nutrient-based biostimulation strategy and highlights some key processes useful for tailoring bioremediation. PMID:25805213

  1. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.

    PubMed

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F

    2015-08-18

    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation. PMID:25733873

  2. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  3. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  4. Ribonuclease "XlaI," an activity from Xenopus laevis oocytes that excises intervening sequences from yeast transfer ribonucleic acid precursors.

    PubMed Central

    Otsuka, A; de Paolis, A; Tocchini-Valentini, G P

    1981-01-01

    A ribonuclease (RNase) activity, RNase "XlaI," responsible for the excision of intervening sequences from two yeast transfer ribonucleic acid (tRNA) precursors, pre-tRNA(Tyr) and pre-tRNA(3Leu), has been purified 54-fold from nuclear extracts of Xenopus laevis oocytes. The RNase preparation is essentially free of contaminating RNase. A quantitative assay for RNase XlaI was developed, and the reaction products were characterized. RNase XlaI cleavage sites in the yeast tRNA precursors were identical to those made by yeast extracts (including 3'-phosphate and 5'-hydroxyl termini). Cleavage of pre-tRNA(3Leu) by RNase XlaI and subsequent ligation of the half-tRNA molecules do not require removal of the 5' leader or 3' trailer sequences. Images PMID:6765601

  5. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France)

    PubMed Central

    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore

    2016-01-01

    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1–63.5 × 107 ml-1) and viral infection rates of prokaryotes (range = 5.3–32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  6. Viral Regulation of Prokaryotic Carbon Metabolism in a Hypereutrophic Freshwater Reservoir Ecosystem (Villerest, France).

    PubMed

    Pradeep Ram, Angia Sriram; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Télesphore

    2016-01-01

    The current consensus concerning the viral regulation of prokaryotic carbon metabolism is less well-studied, compared to substrate availability. We explored the seasonal and vertical distribution of viruses and its relative influence on prokaryotic carbon metabolism in a hypereutrophic reservoir, Lake Villerest (France). Flow cytometry and transmission electron microscopy (TEM) analyses to determine viral abundance (VA; range = 6.1-63.5 × 10(7) ml(-1)) and viral infection rates of prokaryotes (range = 5.3-32%) respectively suggested that both the parameters varied more significantly with depths than with seasons. Prokaryotic growth efficiency (PGE, considered as a proxy of prokaryotic carbon metabolism) calculated from prokaryotic production and respiration measurements (PGE = prokaryotic production/[prokaryotic production + prokaryotic respiration] × 100) varied from 14 to 80% across seasons and depths. Viruses through selective lyses had antagonistic impacts on PGE by regulating key prokaryotic metabolic processes (i.e., production and respiration). Higher viral lysis accompanied by higher respiration rates and lower PGE in the summer (mean = 22.9 ± 10.3%) than other seasons (mean = 59.1 ± 18.6%), led to significant loss of carbon through bacterial-viral loop and shifted the reservoir system to net heterotrophy. Our data therefore suggests that the putative adverse impact of viruses on the growth efficiency of the prokaryotic community can have strong implications on nutrient flux patterns and on the overall ecosystem metabolism in anthropogenic dominated aquatic systems such as Lake Villerest. PMID:26903963

  7. Geochemical Interactions and Viral-Prokaryote Relationships in Freshwater Environments

    NASA Astrophysics Data System (ADS)

    Kyle, J. E.; Ferris, G.

    2009-05-01

    Viral and prokaryotic abundances were surveyed throughout southern Ontario aquatic habitats to determine relationships with geochemical parameters in the natural environment. Surface water samples were collected from acid mine drainage in summer of 2007 and 2008 and from circum-neutral pH environments in October to November 2008. Site determination was based on collecting samples from various aquatic habitats (acid mine drainage, lakes, rivers, tributaries, wetlands) with differing bedrock geology (limestone and shale dominated vs granitic Canadian Shield) to obtain a range of geochemical conditions. At each site, measurements of temperature, pH, and Eh were conducted. Samples collected for microbial counts and electron imaging were preserved to a final concentration of 2.5 % (v/v) glutaraldehyde. Additional sample were filtered into 60 mL nalgene bottles and amber EPA certified 40 mL glass vials to determine chemical constituents and dissolved organic carbon (DOC), respectively. Water was also collected to determine additional physiochemical parameters (dissolved total iron, ferric iron, nitrate, sulfate, phosphate, alkalinity, and turbidity). All samples were stored at 4 °C until analysis. Viral and prokaryotic abundance was determined by staining samples with SYBR Green I and examining with a epifluorescence microscope under blue excitation. Multiple regression analysis using stepwise backwards regression and general linear models revealed that viral abundance was the most influential predictor of prokaryotic abundance. Additional predictors include pH, sulfate, phosphate, and magnesium. The strength of the model was very strong with 90 % of the variability explained (R2 = 0.90, p < 0.007). This is the first report, to our knowledge, of viruses exhibiting such strong controls over prokaryotic abundance in the natural environment. All relationships are positively correlated with the exception of Mg, which is negatively correlated. Iron was also noted as a

  8. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  9. Pyrophosphate-Fueled Na+ and H+ Transport in Prokaryotes

    PubMed Central

    Malinen, Anssi M.; Luoto, Heidi H.

    2013-01-01

    SUMMARY In its early history, life appeared to depend on pyrophosphate rather than ATP as the source of energy. Ancient membrane pyrophosphatases that couple pyrophosphate hydrolysis to active H+ transport across biological membranes (H+-pyrophosphatases) have long been known in prokaryotes, plants, and protists. Recent studies have identified two evolutionarily related and widespread prokaryotic relics that can pump Na+ (Na+-pyrophosphatase) or both Na+ and H+ (Na+,H+-pyrophosphatase). Both these transporters require Na+ for pyrophosphate hydrolysis and are further activated by K+. The determination of the three-dimensional structures of H+- and Na+-pyrophosphatases has been another recent breakthrough in the studies of these cation pumps. Structural and functional studies have highlighted the major determinants of the cation specificities of membrane pyrophosphatases and their potential use in constructing transgenic stress-resistant organisms. PMID:23699258

  10. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome

    PubMed Central

    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S.

    2016-01-01

    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  11. Detection of Prokaryotic Genes in the Amphimedon queenslandica Genome.

    PubMed

    Conaco, Cecilia; Tsoulfas, Pantelis; Sakarya, Onur; Dolan, Amanda; Werren, John; Kosik, Kenneth S

    2016-01-01

    Horizontal gene transfer (HGT) is common between prokaryotes and phagotrophic eukaryotes. In metazoans, the scale and significance of HGT remains largely unexplored but is usually linked to a close association with parasites and endosymbionts. Marine sponges (Porifera), which host many microorganisms in their tissues and lack an isolated germ line, are potential carriers of genes transferred from prokaryotes. In this study, we identified a number of potential horizontally transferred genes within the genome of the sponge, Amphimedon queenslandica. We further identified homologs of some of these genes in other sponges. The transferred genes, most of which possess catalytic activity for carbohydrate or protein metabolism, have assimilated host genome characteristics and are actively expressed. The diversity of functions contributed by the horizontally transferred genes is likely an important factor in the adaptation and evolution of A. queenslandica. These findings highlight the potential importance of HGT on the success of sponges in diverse ecological niches. PMID:26959231

  12. Gene and cell survival: lessons from prokaryotic plasmid R1.

    PubMed

    de la Cueva-Méndez, Guillermo; Pimentel, Belén

    2007-05-01

    Plasmids are units of extrachromosomal genetic inheritance found in all kingdoms of life. They replicate autonomously and undergo stable propagation in their hosts. Despite their small size, plasmid replication and gene expression constitute a metabolic burden that compromises their stable maintenance in host cells. This pressure has driven the evolution of strategies to increase plasmid stability--a process accelerated by the ability of plasmids to transfer horizontally between cells and to exchange genetic material with their host and other resident episomal DNAs. These abilities drive the adaptability and diversity of plasmids and their host cells. Indeed, survival functions found in plasmids have chromosomal homologues that have an essential role in cellular responses to stress. An analysis of these functions in the prokaryotic plasmid R1, and of their intricate interrelationships, reveals remarkable overall similarities with other gene- and cell-survival strategies found within and beyond the prokaryotic world. PMID:17471262

  13. Classification of prokaryotic genetic replicators: between selfishness and altruism

    PubMed Central

    Jalasvuori, Matti; Koonin, Eugene V.

    2015-01-01

    Prokaryotes harbor a variety of genetic replicators, including plasmids, viruses, and chromosomes, each having differing effects on the phenotype of the hosting cell. Here, we propose a classification for replicators of bacteria and archaea on the basis of their horizontal-transfer potential and the type of relationships (mutualistic, symbiotic, commensal, or parasitic) that they have with the host cell vehicle. Horizontal movement of replicators can be either active or passive, reflecting whether or not the replicator encodes the means to mediate its own transfer from one cell to another. Some replicators also have an infectious extracellular state, thus separating viruses from other mobile elements. From the perspective of the cell vehicle, the different types of replicators form a continuum from genuinely mutualistic to completely parasitic replicators. This classification provides a general framework for dissecting prokaryotic systems into evolutionarily meaningful components. PMID:25703428

  14. Next Generation Prokaryotic Engineering: The CRISPR-Cas Toolkit.

    PubMed

    Mougiakos, Ioannis; Bosma, Elleke F; de Vos, Willem M; van Kranenburg, Richard; van der Oost, John

    2016-07-01

    The increasing demand for environmentally friendly production processes of green chemicals and fuels has stimulated research in microbial metabolic engineering. CRISPR-Cas-based tools for genome editing and expression control have enabled fast, easy, and accurate strain development for established production platform organisms, such as Escherichia coli and Saccharomyces cerevisiae. However, the growing interest in alternative production hosts, for which genome editing options are generally limited, requires further developing such engineering tools. In this review, we discuss established and emerging CRISPR-Cas-based tools for genome editing and transcription control of model and non-model prokaryotes, and we analyse the possibilities for further improvement and expansion of these tools for next generation prokaryotic engineering. PMID:26944793

  15. Functional Advantages Conferred by Extracellular Prokaryotic Membrane Vesicles

    PubMed Central

    Manning, Andrew J.; Kuehn, Meta J.

    2015-01-01

    The absence of subcellular organelles is a characteristic typically used to distinguish prokaryotic from eukaryotic cells. But recent discoveries do not support this dogma. Over the past 50 years, researchers have begun to appreciate and characterize Gram-negative bacterial outer membrane derived vesicles and Gram-positive and archaeal membrane vesicles. These extracellular, membrane-bound organelles can perform a variety of functions, including binding and delivery of DNA, transport of virulence factors, protection of the cell from outer membrane targeting antimicrobials, and ridding the cell of toxic envelope proteins. Here we review the contributions of these extracellular organelles to prokaryotic physiology and compare these with the contributions of the bacterial interior membrane bound organelles responsible for harvesting light energy and for generating magnetic crystals of heavy metals. Understanding the roles of these multifunctional extracellular vesicle organelles as microbial tools will help us to better realize the diverse interactions that occur in our polymicrobial world. PMID:23615201

  16. Proteogenomic analysis and global discovery of posttranslational modifications in prokaryotes

    PubMed Central

    Yang, Ming-kun; Yang, Yao-hua; Chen, Zhuo; Zhang, Jia; Lin, Yan; Wang, Yan; Xiong, Qian; Li, Tao; Ge, Feng; Bryant, Donald A.; Zhao, Jin-dong

    2014-01-01

    We describe an integrated workflow for proteogenomic analysis and global profiling of posttranslational modifications (PTMs) in prokaryotes and use the model cyanobacterium Synechococcus sp. PCC 7002 (hereafter Synechococcus 7002) as a test case. We found more than 20 different kinds of PTMs, and a holistic view of PTM events in this organism grown under different conditions was obtained without specific enrichment strategies. Among 3,186 predicted protein-coding genes, 2,938 gene products (>92%) were identified. We also identified 118 previously unidentified proteins and corrected 38 predicted gene-coding regions in the Synechococcus 7002 genome. This systematic analysis not only provides comprehensive information on protein profiles and the diversity of PTMs in Synechococcus 7002 but also provides some insights into photosynthetic pathways in cyanobacteria. The entire proteogenomics pipeline is applicable to any sequenced prokaryotic organism, and we suggest that it should become a standard part of genome annotation projects. PMID:25512518

  17. Prokaryotic Phylogeny Based on Complete Genomes Without Sequence Alignment

    NASA Astrophysics Data System (ADS)

    Hao, Bailin; Qi, Ji; Wang, Bin

    We present a brief review of a series of on-going work on bacterial phylogeny. We propose a new method to infer relatedness of prokaryotes from their complete genome data without using sequence alignment, leading to results comparable with the bacteriologist's systematics as reflected in the latest 2001 edition of Bergey's Manual of Systematic Bacteriology.1 We only touch on the mathematical aspects of the method. The biological implications of our results will be published elsewhere.

  18. A comprehensive repertoire of prokaryotic species identified in human beings.

    PubMed

    Hugon, Perrine; Dufour, Jean-Charles; Colson, Philippe; Fournier, Pierre-Edouard; Sallah, Kankoe; Raoult, Didier

    2015-10-01

    The compilation of the complete prokaryotic repertoire associated with human beings as commensals or pathogens is a major goal for the scientific and medical community. The use of bacterial culture techniques remains a crucial step to describe new prokaryotic species. The large number of officially acknowledged bacterial species described since 1980 and the recent increase in the number of recognised pathogenic species have highlighted the absence of an exhaustive compilation of species isolated in human beings. By means of a thorough investigation of several large culture databases and a search of the scientific literature, we built an online database containing all human-associated prokaryotic species described, whether or not they had been validated and have standing in nomenclature. We list 2172 species that have been isolated in human beings. They were classified in 12 different phyla, mostly in the Proteobacteria, Firmicutes, Actinobacteria, and Bacteroidetes phyla. Our online database is useful for both clinicians and microbiologists and forms part of the Human Microbiome Project, which aims to characterise the whole human microbiota and help improve our understanding of the human predisposition and susceptibility to infectious agents. PMID:26311042

  19. Distribution of glucan-branching enzymes among prokaryotes.

    PubMed

    Suzuki, Eiji; Suzuki, Ryuichiro

    2016-07-01

    Glucan-branching enzyme plays an essential role in the formation of branched polysaccharides, glycogen, and amylopectin. Only one type of branching enzyme, belonging to glycoside hydrolase family 13 (GH13), is found in eukaryotes, while two types of branching enzymes (GH13 and GH57) occur in prokaryotes (Bacteria and Archaea). Both of these types are the members of protein families containing the diverse specificities of amylolytic glycoside hydrolases. Although similarities are found in the catalytic mechanism between the two types of branching enzyme, they are highly distinct from each other in terms of amino acid sequence and tertiary structure. Branching enzymes are found in 29 out of 30 bacterial phyla and 1 out of 5 archaeal phyla, often along with glycogen synthase, suggesting the existence of α-glucan production and storage in a wide range of prokaryotes. Enormous variability is observed as to which type and how many copies of branching enzyme are present depending on the phylum and, in some cases, even among species of the same genus. Such a variation may have occurred through lateral transfer, duplication, and/or differential loss of genes coding for branching enzyme during the evolution of prokaryotes. PMID:27141939

  20. Function and structure of a prokaryotic formylglycine-generating enzyme.

    PubMed

    Carlson, Brian L; Ballister, Edward R; Skordalakes, Emmanuel; King, David S; Breidenbach, Mark A; Gilmore, Sarah A; Berger, James M; Bertozzi, Carolyn R

    2008-07-18

    Type I sulfatases require an unusual co- or post-translational modification for their activity in hydrolyzing sulfate esters. In eukaryotic sulfatases, an active site cysteine residue is oxidized to the aldehyde-containing C(alpha)-formylglycine residue by the formylglycine-generating enzyme (FGE). The machinery responsible for sulfatase activation is poorly understood in prokaryotes. Here we describe the identification of a prokaryotic FGE from Mycobacterium tuberculosis. In addition, we solved the crystal structure of the Streptomyces coelicolor FGE homolog to 2.1 A resolution. The prokaryotic homolog exhibits remarkable structural similarity to human FGE, including the position of catalytic cysteine residues. Both biochemical and structural data indicate the presence of an oxidized cysteine modification in the active site that may be relevant to catalysis. In addition, we generated a mutant M. tuberculosis strain lacking FGE. Although global sulfatase activity was reduced in the mutant, a significant amount of residual sulfatase activity suggests the presence of FGE-independent sulfatases in this organism. PMID:18390551

  1. Birth, Death, and Diversification of Mobile Promoters in Prokaryotes

    PubMed Central

    van Passel, Mark W.J.; Nijveen, Harm; Wahl, Lindi M.

    2014-01-01

    A previous study of prokaryotic genomes identified large reservoirs of putative mobile promoters (PMPs), that is, homologous promoter sequences associated with nonhomologous coding sequences. Here we extend this data set to identify the full complement of mobile promoters in sequenced prokaryotic genomes. The expanded search identifies nearly 40,000 PMP sequences, 90% of which occur in noncoding regions of the genome. To gain further insight from this data set, we develop a birth–death–diversification model for mobile genetic elements subject to sequence diversification; applying the model to PMPs we are able to quantify the relative importance of duplication, loss, horizontal gene transfer (HGT), and diversification to the maintenance of the PMP reservoir. The model predicts low rates of HGT relative to the duplication and loss of PMP copies, rapid dynamics of PMP families, and a pool of PMPs that exist as a single copy in a genome at any given time, despite their mobility. We report evidence of these “singletons” at high frequencies in prokaryotic genomes. We also demonstrate that including selection, either for or against PMPs, was not necessary to describe the observed data. PMID:24578351

  2. The Prokaryote-Eukaryote Dichotomy: Meanings and Mythology

    PubMed Central

    Sapp, Jan

    2005-01-01

    Drawing on documents both published and archival, this paper explains how the prokaryote-eukaryote dichotomy of the 1960s was constructed, the purposes it served, and what it implied in terms of classification and phylogeny. In doing so, I first show how the concept was attributed to Edouard Chatton and the context in which he introduced the terms. Following, I examine the context in which the terms were reintroduced into biology in 1962 by Roger Stanier and C. B. van Niel. I study the discourse over the subsequent decade to understand how the organizational dichotomy took on the form of a natural classification as the kingdom Monera or superkingdom Procaryotae. Stanier and van Niel admitted that, in regard to constructing a natural classification of bacteria, structural characteristics were no more useful than physiological properties. They repeatedly denied that bacterial phylogenetics was possible. I thus examine the great historical irony that the “prokaryote,” in both its organizational and phylogenetic senses, was defined (negatively) on the basis of structure. Finally, we see how phylogenetic research based on 16S rRNA led by Carl Woese and his collaborators confronted the prokaryote concept while moving microbiology to the center of evolutionary biology. PMID:15944457

  3. Distributions of Virus-Like Particles and Prokaryotes within Microenvironments

    PubMed Central

    Dann, Lisa M.; Paterson, James S.; Newton, Kelly; Oliver, Rod; Mitchell, James G.

    2016-01-01

    Microbial interactions are important for ecosystem function, but occur at the microscale and so are difficult to observe. Previous studies in marine systems have shown significant shifts in microbial community abundance and composition over scales of micrometres to centimetres. This study investigates the microscale abundance distributions of virus-like particles (VLPs) and prokaryotes in the lower reaches of a river to determine the extent to which microscale microbial patchiness exists in freshwater systems. Here we report local hotspots surrounded by gradients that reach a maximum 80 and 107 fold change in abundance over 0.9 cm for prokaryotic and VLP subpopulations. Changes in prokaryotic and VLP hotspots were tightly coupled. There were no gradients at tens of centimetres across the boundary layers, which is consistent with strong mixing and turbulence-driven aggregation found in river systems. Quantification of the patchiness shows a marked asymmetry with patches 10 times greater than background common, but depletions being rare or absent in most samples. This consistent asymmetry suggests that coldspots depleted by grazing and lysis are rapidly mixed to background concentrations, while the prevalence of hotspots indicates persistence against disruption. The hotspot to coldspot relative abundance may be useful for understanding microbial river dynamics. The patchiness indicates that the mean- field approach of bulk phase sampling misses the microbially relevant community variation and may underestimate the concentrations of these important microbial groups. PMID:26785114

  4. Prokaryotic community structure and respiration during long-term incubations

    PubMed Central

    Baltar, Federico; Lindh, Markus V; Parparov, Arkadi; Berman, Tom; Pinhassi, Jarone

    2012-01-01

    Despite the importance of incubation assays for studies in microbial ecology that frequently require long confinement times, few reports are available in which changes in the assemblage structure of aquatic prokaryotes were monitored during long-term incubations. We measured rates of dissolved organic carbon degradation and microbial respiration by consumption of dissolved oxygen (DO) in four experiments with Lake Kinneret near-surface water and, concomitantly, we analyzed the variability in prokaryotic community structure during long-term dark bottle incubations. During the first 24 h, there were only minor changes in bacterial community composition. Thereafter there were marked changes in the prokaryotic community structure during the incubations. In contrast, oxygen consumption rates (a proxy for both respiration and dissolved organic carbon degradation rates) remained stable for up to 10–23 days. This study is one of the first to examine closely the phylo-genetic changes that occur in the microbial community of untreated freshwater during long-term (days) incubations in dark, sealed containers. Novel information on the diversity of the main bacterial phylotypes that may be involved in dissolved organic matter degradation in lake Kinneret is also provided. Our results suggest that, under certain ecological settings, constant community metabolic rates can be maintained as a result of shifts in community composition. PMID:22950026

  5. Predatory prokaryotes: predation and primary consumption evolved in bacteria

    NASA Technical Reports Server (NTRS)

    Guerrero, R.; Pedros-Alio, C.; Esteve, I.; Mas, J.; Chase, D.; Margulis, L.

    1986-01-01

    Two kinds of predatory bacteria have been observed and characterized by light and electron microscopy in samples from freshwater sulfurous lakes in northeastern Spain. The first bacterium, named Vampirococcus, is Gram-negative and ovoidal (0.6 micrometer wide). An anaerobic epibiont, it adheres to the surface of phototrophic bacteria (Chromatium spp.) by specific attachment structures and, as it grows and divides by fission, destroys its prey. An important in situ predatory role can be inferred for Vampirococcus from direct counts in natural samples. The second bacterium, named Daptobacter, is a Gram-negative, facultatively anaerobic straight rod (0.5 x 1.5 micrometers) with a single polar flagellum, which collides, penetrates, and grows inside the cytoplasm of its prey (several genera of Chromatiaceae). Considering also the well-known case of Bdellovibrio, a Gram-negative, aerobic curved rod that penetrates and divides in the periplasmic space of many chemotrophic Gram-negative bacteria, there are three types of predatory prokaryotes presently known (epibiotic, cytoplasmic, and periplasmic). Thus, we conclude that antagonistic relationships such as primary consumption, predation, and scavenging had already evolved in microbial ecosystems prior to the appearance of eukaryotes. Furthermore, because they represent methods by which prokaryotes can penetrate other prokaryotes in the absence of phagocytosis, these associations can be considered preadaptation for the origin of intracellular organelles.

  6. Evolution of early life inferred from protein and ribonucleic acid sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  7. Linking host prokaryotic physiology to viral lifestyle dynamics in a temperate freshwater lake (Lake Pavin, France).

    PubMed

    Palesse, S; Colombet, J; Pradeep Ram, A S; Sime-Ngando, T

    2014-11-01

    In aquatic ecosystems, fluctuations in environmental conditions and prokaryotic host physiological states can strongly affect the dynamics of viral life strategies. The influence of prokaryote physiology and environmental factors on viral replication cycles (lytic and lysogeny) was investigated from April to September 2011 at three different strata (epi, meta, and hypolimnion) in the mixolimnion of deep volcanic temperate freshwater Lake Pavin (France). Overall, the euphotic region (epi and metalimnion) was more dynamic and showed significant variation in microbial standing stocks, prokaryotic physiological state, and viral life strategies compared to the aphotic hypolimnion which was stable within sampled months. The prokaryotic host physiology as inferred from the nucleic acid content of prokaryotic cells (high or low nucleic acid) was strongly regulated by the chlorophyll concentration. The predominance of the high nucleic acid (HNA) prokaryotes (cells) over low nucleic acid (LNA) prokaryotes (cells) in the spring (HNA/LNA = 1.2) and vice versa in the summer period (HNA/LNA = 0.4) suggest that the natural prokaryotic communities underwent major shifts in their physiological states during investigated time period. The increase in the percentage of inducible lysogenic prokaryotes in the summer period was associated with the switch in the dominance of LNA over HNA cells, which coincided with the periods of strong resource (nutrient) limitation. This supports the idea that lysogeny represents a maintenance strategy for viruses in unproductive or harsh nutrient/host conditions. A negative correlation of percentage of lysogenic prokaryotes with HNA cell abundance and chlorophyll suggest that lysogenic cycle is closely related to prokaryotic cells which are stressed or starved due to unavailability of resources for its growth and activity. Our results provide support to previous findings that changes in prokaryote physiology are critical for the promotion and

  8. The Occurrence and Distribution of Poly(A) Ribonucleic Acid in Soybean

    PubMed Central

    Key, Joe L.; Silflow, Carolyn

    1975-01-01

    The occurrence and distribution of poly(A) sequences in the RNA of soybean (Glycine max var. Wayne) have been studied. Only one of the two species of AMP-rich RNA contains poly(A). D-RNA does not contain detectable poly(A) sequences. The TB-RNA is the poly(A) RNA in this system. At least a part (up to 50% or more) of the mRNA in polyribosomes contains a poly(A) sequence. The poly(A) RNA is heterodisperse in size but has a mean size of approximately 18S (2,000 nucleotides) in urea and formamide gels. The poly(A) fragment resulting from ribonuclease A and T1 digestion migrates as a broad band overlapping the 4 to 5.8S regions of the gels with a mean size of somewhat greater than 5S. No evidence was found for the occurrence of a discrete oligo(A) fragment in the poly(A) RNA; however, oligonucleotides which migrate faster than the poly(A) fraction were observed in preparations which were not bound to oligo(dT) cellulose prior to electrophoresis. This oligonucleotide region was enriched in AMP (up to about 65%) as would be expected after ribonuclease A and T1 digestion. PMID:16659304

  9. Impact of size, secondary structure, and counterions on the binding of small ribonucleic acids to layered double hydroxide nanoparticles.

    PubMed

    Rodriguez, Blanca V; Pescador, Jorge; Pollok, Nicole; Beall, Gary W; Maeder, Corina; Lewis, L Kevin

    2015-01-01

    Use of ribonucleic acid (RNA) interference to regulate protein expression has become an important research topic and gene therapy tool, and therefore, finding suitable vehicles for delivery of small RNAs into cells is of crucial importance. Layered double metal hydroxides such as hydrotalcite (HT) have shown great promise as nonviral vectors for transport of deoxyribose nucleic acid (DNA), proteins, and drugs into cells, but the adsorption of RNAs to these materials has been little explored. In this study, the binding of small RNAs with different lengths and levels of secondary structure to HT nanoparticles has been analyzed and compared to results obtained with small DNAs in concurrent experiments. Initial experiments established the spectrophotometric properties of HT in aqueous solutions and determined that HT particles could be readily sedimented with near 100% efficiencies. Use of RNA+HT cosedimentation experiments as well as electrophoretic mobility shift assays demonstrated strong adsorption of RNA 25mers to HT, with twofold greater binding of single-stranded RNAs relative to double-stranded molecules. Strong affinities were also observed with ssRNA and dsRNA 54mers and with more complex transfer RNA molecules. Competition binding and RNA displacement experiments indicated that RNA-HT associations were strong and were only modestly affected by the presence of high concentrations of inorganic anions. PMID:26620852

  10. Synthesis of Capsid and Noncapsid Viral Proteins in Response to Encephalomyocarditis Virus Ribonucleic Acid in Animal Cell-Free Systems

    PubMed Central

    Dobos, P.; Kerr, Ian M.; Martin, E. M.

    1971-01-01

    The polypeptide products formed in two cell-free protein-synthetic systems programmed with encephalomyocarditis (EMC) virus ribonucleic acid (RNA) have been compared with the virus-specific proteins found in EMC-infected cells and with the capsid proteins of the purified virion. Tryptic peptides of 35S-methioninelabeled proteins from these three sources were compared by co-chromatography and electrophoresis and by isoelectric focussing. Fifty-two methionine-containing peptides were resolved in digests of material from infected cells, of which about one-third were also clearly present in digests of the virion capsid proteins. The product formed in response to EMC RNA in cell-free systems from Krebs mouse ascites tumor cells yielded 26 to 29 such peptides. Most of these peptides were shown to behave identically with virus-specific peptides from infected cells, whereas just under half of them appeared to be identical with peptides from the virion capsid proteins. The product formed in response to EMC RNA in the L-cell cell-free system was similar, whereas six additional EMC-specific peptides were detected in mixed Krebs L-cell systems. The results indicate that the EMC RNA genome is partially translated in the mouse cell-free systems used to yield products containing both virion capsid and virus-specific noncapsid polypeptides. Images PMID:4331652

  11. Gradient enhanced-fluidity liquid hydrophilic interaction chromatography of ribonucleic acid nucleosides and nucleotides: A "green" technique.

    PubMed

    Beilke, Michael C; Beres, Martin J; Olesik, Susan V

    2016-03-01

    A "green" hydrophilic interaction liquid chromatography (HILIC) technique for separating the components of mixtures with a broad range of polarities is illustrated using enhanced-fluidity liquid mobile phases. Enhanced-fluidity liquid chromatography (EFLC) involves the addition of liquid CO2 to conventional liquid mobile phases. Decreased mobile phase viscosity and increased analyte diffusivity results when a liquefied gas is dissolved in common liquid mobile phases. The impact of CO2 addition to a methanol:water (MeOH:H2O) mobile phase was studied to optimize HILIC gradient conditions. For the first time a fast separation of 16 ribonucleic acid (RNA) nucleosides/nucleotides was achieved (16min) with greater than 1.3 resolution for all analyte pairs. By using a gradient, the analysis time was reduced by over 100% compared to similar separations conducted under isocratic conditions. The optimal separation using MeOH:H2O:CO2 mobile phases was compared to MeOH:H2O and acetonitrile:water (ACN:H2O) mobile phases. Based on chromatographic performance parameters (efficiency, resolution and speed of analysis) and an assessment of the environmental impact of the mobile phase mixtures, MeOH:H2O:CO2 mixtures are preferred over ACN:H2O or MeOH:H2O mobile phases for the separation of mixtures of RNA nucleosides and nucleotides. PMID:26860052

  12. Dynamic evolution of translation initiation mechanisms in prokaryotes

    PubMed Central

    Nakagawa, So; Niimura, Yoshihito; Miura, Kin-ichiro; Gojobori, Takashi

    2010-01-01

    It is generally believed that prokaryotic translation is initiated by the interaction between the Shine-Dalgarno (SD) sequence in the 5′ UTR of an mRNA and the anti-SD sequence in the 3′ end of a 16S ribosomal RNA. However, there are two exceptional mechanisms, which do not require the SD sequence for translation initiation: one is mediated by a ribosomal protein S1 (RPS1) and the other used leaderless mRNA that lacks its 5′ UTR. To understand the evolutionary changes of the mechanisms of translation initiation, we examined how universal the SD sequence is as an effective initiator for translation among prokaryotes. We identified the SD sequence from 277 species (249 eubacteria and 28 archaebacteria). We also devised an SD index that is a proportion of SD-containing genes in which the differences of GC contents are taken into account. We found that the SD indices varied among prokaryotic species, but were similar within each phylum. Although the anti-SD sequence is conserved among species, loss of the SD sequence seems to have occurred multiple times, independently, in different phyla. For those phyla, RPS1-mediated or leaderless mRNA-used mechanisms of translation initiation are considered to be working to a greater extent. Moreover, we also found that some species, such as Cyanobacteria, may acquire new mechanisms of translation initiation. Our findings indicate that, although translation initiation is indispensable for all protein-coding genes in the genome of every species, its mechanisms have dynamically changed during evolution. PMID:20308567

  13. A computational genomics pipeline for prokaryotic sequencing projects

    PubMed Central

    Kislyuk, Andrey O.; Katz, Lee S.; Agrawal, Sonia; Hagen, Matthew S.; Conley, Andrew B.; Jayaraman, Pushkala; Nelakuditi, Viswateja; Humphrey, Jay C.; Sammons, Scott A.; Govil, Dhwani; Mair, Raydel D.; Tatti, Kathleen M.; Tondella, Maria L.; Harcourt, Brian H.; Mayer, Leonard W.; Jordan, I. King

    2010-01-01

    Motivation: New sequencing technologies have accelerated research on prokaryotic genomes and have made genome sequencing operations outside major genome sequencing centers routine. However, no off-the-shelf solution exists for the combined assembly, gene prediction, genome annotation and data presentation necessary to interpret sequencing data. The resulting requirement to invest significant resources into custom informatics support for genome sequencing projects remains a major impediment to the accessibility of high-throughput sequence data. Results: We present a self-contained, automated high-throughput open source genome sequencing and computational genomics pipeline suitable for prokaryotic sequencing projects. The pipeline has been used at the Georgia Institute of Technology and the Centers for Disease Control and Prevention for the analysis of Neisseria meningitidis and Bordetella bronchiseptica genomes. The pipeline is capable of enhanced or manually assisted reference-based assembly using multiple assemblers and modes; gene predictor combining; and functional annotation of genes and gene products. Because every component of the pipeline is executed on a local machine with no need to access resources over the Internet, the pipeline is suitable for projects of a sensitive nature. Annotation of virulence-related features makes the pipeline particularly useful for projects working with pathogenic prokaryotes. Availability and implementation: The pipeline is licensed under the open-source GNU General Public License and available at the Georgia Tech Neisseria Base (http://nbase.biology.gatech.edu/). The pipeline is implemented with a combination of Perl, Bourne Shell and MySQL and is compatible with Linux and other Unix systems. Contact: king.jordan@biology.gatech.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:20519285

  14. Microdiversity of extracellular enzyme genes among sequenced prokaryotic genomes

    PubMed Central

    Zimmerman, Amy E; Martiny, Adam C; Allison, Steven D

    2013-01-01

    Understanding the relationship between prokaryotic traits and phylogeny is important for predicting and modeling ecological processes. Microbial extracellular enzymes have a pivotal role in nutrient cycling and the decomposition of organic matter, yet little is known about the phylogenetic distribution of genes encoding these enzymes. In this study, we analyzed 3058 annotated prokaryotic genomes to determine which taxa have the genetic potential to produce alkaline phosphatase, chitinase and β-N-acetyl-glucosaminidase enzymes. We then evaluated the relationship between the genetic potential for enzyme production and 16S rRNA phylogeny using the consenTRAIT algorithm, which calculated the phylogenetic depth and corresponding 16S rRNA sequence identity of clades of potential enzyme producers. Nearly half (49.2%) of the genomes analyzed were found to be capable of extracellular enzyme production, and these were non-randomly distributed across most prokaryotic phyla. On average, clades of potential enzyme-producing organisms had a maximum phylogenetic depth of 0.008004–0.009780, though individual clades varied broadly in both size and depth. These values correspond to a minimum 16S rRNA sequence identity of 98.04–98.40%. The distribution pattern we found is an indication of microdiversity, the occurrence of ecologically or physiologically distinct populations within phylogenetically related groups. Additionally, we found positive correlations among the genes encoding different extracellular enzymes. Our results suggest that the capacity to produce extracellular enzymes varies at relatively fine-scale phylogenetic resolution. This variation is consistent with other traits that require a small number of genes and provides insight into the relationship between taxonomy and traits that may be useful for predicting ecological function. PMID:23303371

  15. Multivariate entropy distance method for prokaryotic gene identification.

    PubMed

    Ouyang, Zhengqing; Zhu, Huaiqiu; Wang, Jin; She, Zhen-Su

    2004-06-01

    A new simple method is found for efficient and accurate identification of coding sequences in prokaryotic genome. The method employs a Shannon description of artificial language for DNA sequences. It consists in translating a DNA sequence into a pseudo-amino acid sequence with 20 fundamental words according to the universal genetic code. With an entropy-density profile (EDP), the method maps a sequence of finite length to a vector and then analyzes its position in the 20-dimensional phase space depending on its nature. It is found that the ratio of the relative distance to an averaged coding and non-coding EDP over a small number (up to one) of open reading frames (ORFs) can serve as a good coding potential. An iterative algorithm is designed for finding a set of "root" sequences using this coding potential. A multivariate entropy distance (MED) algorithm is then proposed for the identification of prokaryotic genes; it has a feature to combine the use of a coding potential and an EDP-based sequence similarity analysis. The current version of MED is unsupervised, parameter-free and simple to implement. It is demonstrated to be able to detect 95-99% genes with 10-30% of additional genes when tested against the RefSeq database of NCBI and to detect 97.5-99.8% of confirmed genes with known functions. It is also shown to be able to find a set of (functionally known) genes that are missed by other well-known gene finding algorithms. All measurements show that the MED algorithm reaches a similar performance level as the algorithms like GeneMark and Glimmer for prokaryotic gene prediction. PMID:15297987

  16. Prokaryotic Phylogeny Based on Complete Genomes Without Sequence Alignment

    NASA Astrophysics Data System (ADS)

    Hao, Bailin; Qi, Ji; Wang, Bin

    2003-04-01

    This is a brief review of a series of on-going work on bacterial phylogeny. We have proposed a new method to infer relatedness of prokaryotes from their complete genome data without using sequence alignment. It has led to results comparable with the bacteriologists' systematics as reflected in the latest 2001 edition of the Bergey's Manual of Systematic Bacteriology1. In what follows we only touch on the mathematical aspects of the method. The biological implications of our results will be published elsewhere.

  17. A new view into prokaryotic cell biology from electron cryotomography.

    PubMed

    Oikonomou, Catherine M; Jensen, Grant J

    2016-04-01

    Electron cryotomography (ECT) enables intact cells to be visualized in 3D in an essentially native state to 'macromolecular' (∼4 nm) resolution, revealing the basic architectures of complete nanomachines and their arrangements in situ. Since its inception, ECT has advanced our understanding of many aspects of prokaryotic cell biology, from morphogenesis to subcellular compartmentalization and from metabolism to complex interspecies interactions. In this Review, we highlight how ECT has provided structural and mechanistic insights into the physiology of bacteria and archaea and discuss prospects for the future. PMID:26923112

  18. The Gas Vacuole - an Early Organelle of Prokaryote Motility

    NASA Astrophysics Data System (ADS)

    Staley, James T.

    1980-06-01

    Several lines of evidence suggest that the gas vesicle may have been an early organelle of prokaryote motility. First, it is found in bacteria that are thought to be representatives of primitive groups. Second, it is a simple structure, and the structure alone imparts the function of motility. Thirdly, it is widely distributed amongst prokaryotes, having been found in the purple and green sulfur photosynthetic bacteria, cyanobacteria, methanogenic bacteria, obligate and facultative anaerobic heterotrophic bacteria, as well as aerobic heterotrophic bacteria that divide by budding and binary transverse fission. Recent evidence suggests that in some bacteria the genes for gas vesicle synthesis occur on plasmids. Thus, the wide distribution of this characteristic could be due to recent evolution and rapid dispersal, though early evolution is not precluded. Though the gas vesicle structure itself appears to be highly conserved among the various groups of bacteria, it seems doubtful that the regulatory mechanism to control its synthesis could be the same for the diverse gas vacuolate bacterial groups.

  19. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes.

    PubMed

    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard

    2015-01-01

    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  20. Co-polymer tracts in eukaryotic, prokaryotic, and organellar DNA.

    PubMed

    Behe, M J; Beasty, A M

    1991-01-01

    Large variations in DNA base composition and noticeable strand asymmetries are known to occur between different organisms and within different regions of the genomes of single organisms. Apparently such composition and sequence biases occur to fulfill structural rather than informational requirements. Here we report the wide occurrence of a more subtle biasing of DNA sequence that can have structural consequences: an increase or a suppression of the number of long tracts of two-base co-polymers. Strong biases were observed when the DNA sequences of the longest eukaryotic, prokaryotic, and organellar entries in the GenBank data base (totaling 773 kilobases) were analyzed for the number of occurrences of tracts of the two-base co-polymers (A,T)n, (G,C)n, and (A,C)n as a function of tract length. (The expression (A,T)n is used here to denote an uninterrupted tract, n nucleotides in length, of A and T bases in any proportion or order, terminated at each end by a G or C residue.) Characteristic differences are also observed in tract biases of eukaryotic vs. prokaryotic organisms. PMID:1799681

  1. Environmental Pressure May Change the Composition Protein Disorder in Prokaryotes

    PubMed Central

    Vicedo, Esmeralda; Schlessinger, Avner; Rost, Burkhard

    2015-01-01

    Many prokaryotic organisms have adapted to incredibly extreme habitats. The genomes of such extremophiles differ from their non-extremophile relatives. For example, some proteins in thermophiles sustain high temperatures by being more compact than homologs in non-extremophiles. Conversely, some proteins have increased volumes to compensate for freezing effects in psychrophiles that survive in the cold. Here, we revealed that some differences in organisms surviving in extreme habitats correlate with a simple single feature, namely the fraction of proteins predicted to have long disordered regions. We predicted disorder with different methods for 46 completely sequenced organisms from diverse habitats and found a correlation between protein disorder and the extremity of the environment. More specifically, the overall percentage of proteins with long disordered regions tended to be more similar between organisms of similar habitats than between organisms of similar taxonomy. For example, predictions tended to detect substantially more proteins with long disordered regions in prokaryotic halophiles (survive high salt) than in their taxonomic neighbors. Another peculiar environment is that of high radiation survived, e.g. by Deinococcus radiodurans. The relatively high fraction of disorder predicted in this extremophile might provide a shield against mutations. Although our analysis fails to establish causation, the observed correlation between such a simplistic, coarse-grained, microscopic molecular feature (disorder content) and a macroscopic variable (habitat) remains stunning. PMID:26252577

  2. Transcriptome dynamics-based operon prediction in prokaryotes

    PubMed Central

    2014-01-01

    Background Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. Results In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. Conclusion We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available. PMID:24884724

  3. Deciphering unusual uncultured magnetotactic multicellular prokaryotes through genomics

    PubMed Central

    Abreu, Fernanda; Morillo, Viviana; Nascimento, Fabrícia F; Werneck, Clarissa; Cantão, Mauricio Egidio; Ciapina, Luciane Prioli; de Almeida, Luiz Gonzaga Paula; Lefèvre, Christopher T; Bazylinski, Dennis A; de Vasconcelos, Ana Tereza Ribeiro; Lins, Ulysses

    2014-01-01

    Candidatus Magnetoglobus multicellularis (Ca. M. multicellularis) is a member of a group of uncultured magnetotactic prokaryotes that possesses a unique multicellular morphology. To better understand this organism's physiology, we used a genomic approach through pyrosequencing. Genomic data analysis corroborates previous structural studies and reveals the proteins that are likely involved in multicellular morphogenesis of this microorganism. Interestingly, some detected protein sequences that might be involved in cell adhesion are homologues to phylogenetically unrelated filamentous multicellular bacteria proteins, suggesting their contribution in the early development of multicellular organization in Bacteria. Genes related to the behavior of Ca. M. multicellularis (chemo-, photo- and magnetotaxis) and its metabolic capabilities were analyzed. On the basis of the genomic–physiologic information, enrichment media were tested. One medium supported chemoorganoheterotrophic growth of Ca. M. multicellularis and allowed the microorganisms to maintain their multicellular morphology and cell cycle, confirming for the first time that the entire life cycle of the MMP occurs in a multicellular form. Because Ca. M. multicellularis has a unique multicellular life style, its cultivation is an important achievement for further studies regarding the multicellular evolution in prokaryotes. PMID:24196322

  4. Lengths of Orthologous Prokaryotic Proteins Are Affected by Evolutionary Factors

    PubMed Central

    Tatarinova, Tatiana; Dien Bard, Jennifer; Cohen, Irit

    2015-01-01

    Proteins of the same functional family (for example, kinases) may have significantly different lengths. It is an open question whether such variation in length is random or it appears as a response to some unknown evolutionary driving factors. The main purpose of this paper is to demonstrate existence of factors affecting prokaryotic gene lengths. We believe that the ranking of genomes according to lengths of their genes, followed by the calculation of coefficients of association between genome rank and genome property, is a reasonable approach in revealing such evolutionary driving factors. As we demonstrated earlier, our chosen approach, Bubble-sort, combines stability, accuracy, and computational efficiency as compared to other ranking methods. Application of Bubble Sort to the set of 1390 prokaryotic genomes confirmed that genes of Archaeal species are generally shorter than Bacterial ones. We observed that gene lengths are affected by various factors: within each domain, different phyla have preferences for short or long genes; thermophiles tend to have shorter genes than the soil-dwellers; halophiles tend to have longer genes. We also found that species with overrepresentation of cytosines and guanines in the third position of the codon (GC3 content) tend to have longer genes than species with low GC3 content. PMID:26114113

  5. Prokaryotic diversity of arctic ice shelf microbial mats.

    PubMed

    Bottos, Eric M; Vincent, Warwick F; Greer, Charles W; Whyte, Lyle G

    2008-04-01

    The prokaryotic diversity and respiratory activity of microbial mat communities on the Markham Ice Shelf and Ward Hunt Ice Shelf in the Canadian high Arctic were analysed. All heterotrophic isolates and > 95% of bacterial 16S rRNA gene clone library sequences from both ice shelves grouped within the phyla Bacteroidetes, Proteobacteria and Actinobacteria. Clone library analyses showed that the bacterial communities were diverse and varied significantly between the two ice shelves, with the Markham library having a higher estimated diversity (Chao1 = 243; 105 operational taxonomic units observed in 189 clones) than the Ward Hunt library (Chao1 = 106; 52 operational taxonomic units observed in 128 clones). Archaeal 16S rRNA gene clone libraries from both ice shelves were dominated by a single Euryarchaeota sequence, which appears to represent a novel phylotype. Analyses of community activity by radiorespiration assays detected metabolism in mat samples from both ice shelves at temperatures as low as -10 degrees C. These findings provide the first insight into the prokaryotic biodiversity of Arctic ice shelf communities and underscore the importance of these cryo-ecosystems as a rich source of microbiota that are adapted to extreme cold. PMID:18215157

  6. A Proposed Genus Boundary for the Prokaryotes Based on Genomic Insights

    PubMed Central

    Qin, Qi-Long; Xie, Bin-Bin; Zhang, Xi-Ying; Chen, Xiu-Lan; Zhou, Bai-Cheng; Zhou, Jizhong; Oren, Aharon

    2014-01-01

    Genomic information has already been applied to prokaryotic species definition and classification. However, the contribution of the genome sequence to prokaryotic genus delimitation has been less studied. To gain insights into genus definition for the prokaryotes, we attempted to reveal the genus-level genomic differences in the current prokaryotic classification system and to delineate the boundary of a genus on the basis of genomic information. The average nucleotide sequence identity between two genomes can be used for prokaryotic species delineation, but it is not suitable for genus demarcation. We used the percentage of conserved proteins (POCP) between two strains to estimate their evolutionary and phenotypic distance. A comprehensive genomic survey indicated that the POCP can serve as a robust genomic index for establishing the genus boundary for prokaryotic groups. Basically, two species belonging to the same genus would share at least half of their proteins. In a specific lineage, the genus and family/order ranks showed slight or no overlap in terms of POCP values. A prokaryotic genus can be defined as a group of species with all pairwise POCP values higher than 50%. Integration of whole-genome data into the current taxonomy system can provide comprehensive information for prokaryotic genus definition and delimitation. PMID:24706738

  7. Links between viruses and prokaryotes throughout the water column along a North Atlantic latitudinal transect.

    PubMed

    De Corte, Daniele; Sintes, Eva; Yokokawa, Taichi; Reinthaler, Thomas; Herndl, Gerhard J

    2012-08-01

    Viruses are an abundant, diverse and dynamic component of marine ecosystems and have a key role in the biogeochemical processes of the ocean by controlling prokaryotic and phytoplankton abundance and diversity. However, most of the studies on virus-prokaryote interactions in marine environments have been performed in nearshore waters. To assess potential variations in the relation between viruses and prokaryotes in different oceanographic provinces, we determined viral and prokaryotic abundance and production throughout the water column along a latitudinal transect in the North Atlantic. Depth-related trends in prokaryotic and viral abundance (both decreasing by one order of magnitude from epi- to abyssopelagic waters), and prokaryotic production (decreasing by three orders of magnitude) were observed along the latitudinal transect. The virus-to-prokaryote ratio (VPR) increased from ~19 in epipelagic to ~53 in the bathy- and abyssopelagic waters. Although the lytic viral production decreased significantly with depth, the lysogenic viral production did not vary with depth. In bathypelagic waters, pronounced differences in prokaryotic and viral abundance were found among different oceanic provinces with lower leucine incorporation rates and higher VPRs in the North Atlantic Gyre province than in the provinces further north and south. The percentage of lysogeny increased from subpolar regions toward the more oligotrophic lower latitudes. Based on the observed trends over this latitudinal transect, we conclude that the viral-host interactions significantly change among different oceanic provinces in response to changes in the biotic and abiotic variables. PMID:22258100

  8. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    PubMed Central

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems. PMID:26781165

  9. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems.

    PubMed

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m(2) quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems. PMID:26781165

  10. Coupling of soil prokaryotic diversity and plant diversity across latitudinal forest ecosystems

    NASA Astrophysics Data System (ADS)

    Wang, Jun-Tao; Zheng, Yuan-Ming; Hu, Hang-Wei; Li, Jing; Zhang, Li-Mei; Chen, Bao-Dong; Chen, Wei-Ping; He, Ji-Zheng

    2016-01-01

    The belowground soil prokaryotic community plays a cardinal role in sustaining the stability and functions of forest ecosystems. Yet, the nature of how soil prokaryotic diversity co-varies with aboveground plant diversity along a latitudinal gradient remains elusive. By establishing three hundred 400-m2 quadrats from tropical rainforest to boreal forest in a large-scale parallel study on both belowground soil prokaryote and aboveground tree and herb communities, we found that soil prokaryotic diversity couples with the diversity of herbs rather than trees. The diversity of prokaryotes and herbs responds similarly to environmental factors along the latitudinal gradient. These findings revealed that herbs provide a good predictor of belowground biodiversity in forest ecosystems, and provide new perspective on the aboveground and belowground interactions in forest ecosystems.

  11. Age-related differences in messenger ribonucleic acid expression of key proteins involved in adipose cell differentiation and metabolism.

    PubMed

    Imbeault, P; Vidal, H; Tremblay, A; Vega, N; Nadeau, A; Després, J P; Mauriège, P

    2001-02-01

    This study was performed to compare the expression of key proteins [lipoprotein lipase (LPL), hormone-sensitive lipase (HSL), complement 3 (C3), and peroxisome proliferator-stimulated receptor-gamma (PPAR gamma)] involved in sc abdominal adipose tissue (AT) metabolism of young (n = 13) vs. middle-aged (n = 16) men. The sc abdominal AT-LPL activity as well as fat cell lipolysis were also measured in both groups of men. Young and middle-aged men displayed similar body weight and sc abdominal fat accumulation, measured by computed tomography. However, middle-aged men were characterized by a higher percent body fat (28 +/- 5% vs. 22 +/- 7%; P < 0.05) than young subjects. No difference between groups was observed in sc abdominal adipose tissue LPL activity. On the other hand, maximal lipolytic responses of sc abdominal adipocytes to isoproterenol (beta-adrenergic agonist) or to postadrenoceptor agents such as dibutyryl cAMP, forskolin, and theophylline were lower in middle-aged than in young men (P < 0.05). AT-LPL messenger ribonucleic acid (mRNA) levels were similar regardless of the subject's age. However, HSL, C3, and PPAR gamma mRNA levels were higher in middle-aged than in young individuals (P < 0.01-0.05). After correction for percent body fat, only HSL and C3 mRNA levels remained significantly different between groups (P < 0.05). Taken together, these results suggest that aging has an effect on the up-regulation of HSL and C3 mRNA levels, whereas PPAR gamma expression seems to be related mainly to increased adiposity. PMID:11158053

  12. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  13. Prolactin messenger ribonucleic acid levels, prolactin synthesis, and radioimmunoassayable prolactin during the estrous cycle in the Golden Syrian hamster

    SciTech Connect

    Massa, J.S. ); Blask, D.E. )

    1990-01-01

    The purpose of this study was to observe the molecular dynamics of pituitary prolactin (PRL) gene expression during the estrous cycle of the Golden Syrian hamster. PRL messenger ribonucleic acid (mRNA) levels, PRL synthesis were measured in the morning on each day of the cycle. We observed that all of these PRL indices declined or did not change from Day 2 to Day 3 of the cycle. From Day 3 to Day 4 however, PRL mRNA levels increased 33-38% and media {sup 3}H-PRL increased 32-42%, while there were no significant changes in pituitary {sup 3}H-PRL, or RIA-PRL in the media or pituitary. From Day 4 to Day 1 (estrus) there was reciprocal change in the levels of {sup 3}H-PRL in the pituitary vs. the media, with the former increasing 37-50% and the latter decreasing 25-32%. Pituitary RIA-PRL did also increased 45-64% from Day 4 to Day 1 while media RIA-PRL did not change. These data are consistent with the following hypothesis: On the morning of proestrus(Day 4) in the hamster, PRL mRNA levels are elevated compared to those on Day 3, signaling an increase in PRL synthesis. This newly synthesized PRL is shunted into a readily releasable pool on the morning of Day 4 (contributing to the afternoon surge of serum PRL), and into a preferentially stored pool by the morning of Day 1.

  14. Fossils of Prokaryotic Microorganisms in the Orgueil Meteorite

    NASA Technical Reports Server (NTRS)

    Hoover, Richard B.

    2006-01-01

    The Orgueil CII meteorite, which fell in southern France on the evening of May 14, 1864, has been one of the most extensively studied of all known carbonaceous meteorites. Field Emission Scanning Electron Microscopy (FESEM) studies of freshly fractured interior surfaces of the Orgueil meteorite have resulted in the detection of the fossilized remains of a large and diverse population of filamentous prokaryotic microorganisms. The taphonomy and the diverse modes of the preservation of these remains ,are diverse. Some of the remains exhibit carbonization of a hollow sheath and in other cases the remains are permineralized with water-soluble evaporite minerals, such as magnesium sulfate or ammonium salts. After the sample is fractured and the interior surfaces are exposed to the atmospheric moisture, some of these friable remains have been observed to exhibit significant alterations in appearance with time. Images are presented to document the changes that have been observed in some forms within the past two years. Images and EDS spectral data will also be presented to document the studies carried out on abiotic forms to search for possible nonbiological interpretations of the indigenous filamentous microstructures that have been found in the Orgueil meteorite. Images and EDS data will be presented showing the size, size range, morphology and chemical compositions of abiotic microstructures found in native crystalline and fibrous Epsomites from Poison Lake, Washington, USA and Catalayud, Zaragoza, Aragon, Spain. Many of these embedded forms are consistent in size and microstructure with cyanobacteria morphotypes. Some of the forms are exhibit known characteristics differentiation of cells, and reproductive structures of filamentous trichomic prokaryotes (bacteria and cyanobacteria) and the degraded remains of microfibrils associated with sheaths of cyanobacteria. In this paper, recently obtained comparative images and EDS data will be presented for the mineralized

  15. Single-Molecule Observation of Prokaryotic DNA Replication

    PubMed Central

    Tanner, Nathan A.; van Oijen, Antoine M.

    2010-01-01

    Recent advances in optical imaging and molecular manipulation techniques have made it possible to observe the activity of individual enzymes and study the dynamic properties of processes that are challenging to elucidate using ensemble-averaging techniques. The use of single-molecule approaches has proven to be particularly successful in the study of the dynamic interactions between the components at the replication fork. In this section, we describe the methods necessary for in vitro single-molecule studies of prokaryotic replication systems. Through these experiments, accurate information can be obtained on the rates and processivities of DNA unwinding and polymerization. The ability to monitor in real time the progress of a single replication fork allows for the detection of short-lived, intermediate states that would be difficult to visualize in bulk-phase assays. PMID:19563119

  16. A chimeric prokaryotic ancestry of mitochondria and primitive eukaryotes.

    PubMed

    Karlin, S; Brocchieri, L; Mrázek, J; Campbell, A M; Spormann, A M

    1999-08-01

    We provide data and analysis to support the hypothesis that the ancestor of animal mitochondria (Mt) and many primitive amitochondrial (a-Mt) eukaryotes was a fusion microbe composed of a Clostridium-like eubacterium and a Sulfolobus-like archaebacterium. The analysis is based on several observations: (i) The genome signatures (dinucleotide relative abundance values) of Clostridium and Sulfolobus are compatible (sufficiently similar) and each has significantly more similarity in genome signatures with animal Mt sequences than do all other available prokaryotes. That stable fusions may require compatibility in genome signatures is suggested by the compatibility of plasmids and hosts. (ii) The expanded energy metabolism of the fusion organism was strongly selective for cementing such a fusion. (iii) The molecular apparatus of endospore formation in Clostridium serves as raw material for the development of the nucleus and cytoplasm of the eukaryotic cell. PMID:10430918

  17. Metabolic Compensation and Circadian Resilience in Prokaryotic Cyanobacteria

    PubMed Central

    Johnson, Carl Hirschie; Egli, Martin

    2014-01-01

    For a biological oscillator to function as a circadian pacemaker that confers a fitness advantage, its timing functions must be stable in response to environmental and metabolic fluctuations. One such stability enhancer, temperature compensation, has long been a defining characteristic of these timekeepers. However, an accurate biological timekeeper must also resist changes in metabolism, and this review suggests that temperature compensation is actually a subset of a larger phenomenon, namely metabolic compensation, which maintains the frequency of circadian oscillators in response to a host of factors that impinge on metabolism and would otherwise destabilize these clocks. The circadian system of prokaryotic cyanobacteria is an illustrative model because it is composed of transcriptional and nontranscriptional oscillators that are coupled to promote resilience. Moreover, the cyanobacterial circadian program regulates gene activity and metabolic pathways, and it can be manipulated to improve the expression of bioproducts that have practical value. PMID:24905782

  18. Pi sensing and signalling: from prokaryotic to eukaryotic cells.

    PubMed

    Qi, Wanjun; Baldwin, Stephen A; Muench, Stephen P; Baker, Alison

    2016-06-15

    Phosphorus is one of the most important macronutrients and is indispensable for all organisms as a critical structural component as well as participating in intracellular signalling and energy metabolism. Sensing and signalling of phosphate (Pi) has been extensively studied and is well understood in single-cellular organisms like bacteria (Escherichia coli) and Saccharomyces cerevisiae In comparison, the mechanism of Pi regulation in plants is less well understood despite recent advances in this area. In most soils the available Pi limits crop yield, therefore a clearer understanding of the molecular basis underlying Pi sensing and signalling is of great importance for the development of plants with improved Pi use efficiency. This mini-review compares some of the main Pi regulation pathways in prokaryotic and eukaryotic cells and identifies similarities and differences among different organisms, as well as providing some insight into future research. PMID:27284040

  19. Arabidopsis thaliana SEPALLATA3 protein prokaryotic expression and purification.

    PubMed

    He, Q; Fu, A Y; Zhang, G C; Li, T J; Zhang, J H

    2015-01-01

    SEPALLATA3 (SEP3) can be attributed to E class gene of the ABCE model of floral organ development. In order to reveal how SEP3 proteins form polymers, and the relationship between the polymers and their biological functions, the experiments of Arabidopsis thaliana AtSEP3 protein soluble expression in vitro were performed to construct a vector of prokaryotic expression, and investigate induced expression of recombinant proteins in Escherichia coli cells. The protein soluble expression was analyzed through the aspects of different protein domains, induction time, induction temperature, etc. Different structural domains and expression conditions were screened, and 0.1% IPTG inducing at 22 oC for 15 h was estimated as an optimal expression strategy. The nickel chelating resin was used to purify the protein in size exclusion chromatography (SEC) and the results indicated that AtSEP3 protein was present in the form of tetramer. PMID:26025404

  20. Prokaryotic Production of Virus-Like Particle Vaccine of Betanodavirus.

    PubMed

    Xie, Junfeng; Huang, Runqing; Lai, Yuxiong

    2016-01-01

    Betanodaviruses are the causative agents of viral nervous necrosis (VNN), a serious disease of cultured marine fish worldwide. To control this disease, vaccines of subunit capsid proteins (recombinant proteins or peptides), inactivated viruses, and virus-like particles (VLPs) were developed. VLP, which is highly similar to the wild-type virus in virion structure and contains no viral genome, was proved as one of the good and safe vaccines that can activate humoral immune response in the long term and induce cellular and innate immunities in the early stage post-immunization. The VLP vaccines can be expressed in vitro either by Baculovirus-based or yeast-based eukaryotic system or by bacterial expression system. In this chapter, the prokaryotic expression and the subsequent purification of VLP of betanodavirus orange-spotted grouper nervous necrosis virus (OGNNV) are presented. PMID:27076301

  1. Disulfide Bond Formation in Prokaryotes: History, Diversity and Design

    PubMed Central

    Hatahet, Feras; Boyd, Dana; Beckwith, Jon

    2014-01-01

    The formation of structural disulfide bonds is essential for the function and stability of a great number of proteins, particularly those that are secreted. There exists a variety of dedicated cellular catalysts and pathways from Archaea to humans that ensure the formation of native disulfide bonds. In this review we describe the initial discoveries of these pathways and report progress in recent years in our understanding of the diversity of these pathways in prokaryotes, including those newly discovered in some Archaea. We will also discuss the various successful efforts to achieve laboratory-based evolution and design of synthetic disulfide bond formation machineries in the bacterium E. coli. These latter studies have also led to new more general insights into the redox environment of the cytoplasm and bacterial cell envelope. PMID:24576574

  2. There must be a prokaryote somewhere: microbiology's search for itself

    NASA Technical Reports Server (NTRS)

    Woese, C. R.

    1994-01-01

    While early microbiologists showed considerable interest in the problem of the natural (evolutionary) relationships among prokaryotes, by the middle of this century that problem had largely been discarded as being unsolvable. In other words, the science of microbiology developed without an evolutionary framework, the lack of which kept it a weak discipline, defined largely by external forces. Modern technology has allowed microbiology finally to develop the needed evolutionary framework, and with this comes a sense of coherence, a sense of identity. Not only is this development radically changing microbiology itself, but also it will change microbiology's relationship to the other biological disciplines. Microbiology of the future will become the primary biological science, the base upon which our future understanding of the living world rests, and the font from which new understanding of it flows.

  3. Isolation and Partial Characterization of Temperature-Sensitive Escherichia coli Mutants with Altered Leucyl- and Seryl-Transfer Ribonucleic Acid Synthetases

    PubMed Central

    Low, B.; Gates, F.; Goldstein, T.; Söll, D.

    1971-01-01

    Two temperature-sensitive mutants of Escherichia coli have been found in which the conditional growth is a result of a thermosensitive leucyl-transfer ribonucleic acid (tRNA) synthetase and seryl-tRNA synthetase, respectively. The corresponding genetic loci, leuS and serS, cotransduce with lip and serC, respectively. As a result of the mutationally altered leucyl-tRNA synthetase, some leucine-, valine-, and isoleucine-forming enzymes were derepressed. Thus, leucyl-tRNA synthetase is involved in the repression of the enzymes needed for the synthesis of branched-chain amino acids. PMID:4942762

  4. Function of prokaryotic and eukaryotic ABC proteins in lipid transport.

    PubMed

    Pohl, Antje; Devaux, Philippe F; Herrmann, Andreas

    2005-03-21

    ATP binding cassette (ABC) proteins of both eukaryotic and prokaryotic origins are implicated in the transport of lipids. In humans, members of the ABC protein families A, B, C, D and G are mutated in a number of lipid transport and metabolism disorders, such as Tangier disease, Stargardt syndrome, progressive familial intrahepatic cholestasis, pseudoxanthoma elasticum, adrenoleukodystrophy or sitosterolemia. Studies employing transfection, overexpression, reconstitution, deletion and inhibition indicate the transbilayer transport of endogenous lipids and their analogs by some of these proteins, modulating lipid transbilayer asymmetry. Other proteins appear to be involved in the exposure of specific lipids on the exoplasmic leaflet, allowing their uptake by acceptors and further transport to specific sites. Additionally, lipid transport by ABC proteins is currently being studied in non-human eukaryotes, e.g. in sea urchin, trypanosomatides, arabidopsis and yeast, as well as in prokaryotes such as Escherichia coli and Lactococcus lactis. Here, we review current information about the (putative) role of both pro- and eukaryotic ABC proteins in the various phenomena associated with lipid transport. Besides providing a better understanding of phenomena like lipid metabolism, circulation, multidrug resistance, hormonal processes, fertilization, vision and signalling, studies on pro- and eukaryotic ABC proteins might eventually enable us to put a name on some of the proteins mediating transbilayer lipid transport in various membranes of cells and organelles. It must be emphasized, however, that there are still many uncertainties concerning the functions and mechanisms of ABC proteins interacting with lipids. In particular, further purification and reconstitution experiments with an unambiguous role of ATP hydrolysis are needed to demonstrate a clear involvement of ABC proteins in lipid transbilayer asymmetry. PMID:15749056

  5. Viral and grazer regulation of prokaryotic growth efficiency in temperate freshwater pelagic environments.

    PubMed

    Pradeep Ram, A S; Colombet, Jonathan; Perriere, Fanny; Thouvenot, Antoine; Sime-Ngando, Telesphore

    2015-02-01

    In aquatic systems, limited data exists on the impact of mortality forces such as viral lysis and flagellate grazing when seeking to explain factors regulating prokaryotic metabolism. We explored the relative influence of top-down factors (viral lysis and heterotrophic nanoflagellate grazing) on prokaryotic mortality and their subsequent impact on their community metabolism in the euphotic zone of 21 temperate freshwater lakes located in the French Massif Central. Prokaryotic growth efficiency (PGE, index of prokaryotic community metabolism) determined from prokaryotic production and respiration measurements varied from 5 to 74% across the lakes. Viral and potential grazer-induced mortality of prokaryotes had contrasting impact on PGE. Potential flagellate grazing was found to enhance PGE whereas viral lysis had antagonistic impacts on PGE. The average PGE value in the grazing and viral lysis dominated lake water samples was 35.4% (±15.2%) and 17.2% (±8.1%), respectively. Selective viral lysis or flagellate grazing on prokaryotes together with the nature of contrasted substrates released through mortality processes can perhaps explain for the observed variation and differences in PGE among the studied lakes. The influences of such specific top-down processes on PGE can have strong implications on the carbon and nutrient fluxes in freshwater pelagic environments. PMID:25764557

  6. Effects of starvation for potassium and other inorganic ions on protein degradation and ribonucleic acid synthesis in Escherichia coli.

    PubMed

    St John, A C; Goldberg, A L

    1980-09-01

    Starvation of Escherichia coli for potassium, phosphate, or magnesium ions leads to a reversible increase in the rate of protein degradation and an inhibition of ribonucleic acid (RNA) synthesis. In cells deprived of potassium, the breakdown of the more stable cell proteins increased two- to threefold, whereas the hydrolysis of short-lived proteins, both normal ones and analog-containing polypeptides, did not change. The mechanisms initiating the enhancement of proteolysis during starvation for these ions were examined. Upon starvation for amino acids or amino acyl-transfer RNA (tRNA), protein breakdown increases in relA+ (but not relA) cells as a result of the rapid synthesis of guanosine-5'-diphosphate-3'-diphosphate (ppGpp). However, a lack of amino acyl-tRNA does not appear to be responsible for the increased protein breakdown in cells starved for inorganic ions, since protein breakdown increased in the absence of these ions in both relA+ and relA cultures, and since a large excess of amino acids did not affect this response. In bacteria in which energy production is restricted, ppGpp levels also rise, and protein breakdown increases. The ion-deprived cultures did show a 40 to 75% reduction in adenosine-5'-triphosphate levels,l similar to that seen upon glucose starvation. However, this decrease in ATP content does not appear to cause the increase in protein breakdown or lead to an accumulation of ppGpp. No consistent change in intracellular ppGpp levels was found in relA+ or relA cells starved for these ions. In addition, in relX mutants, removal of these ions led to accelerated protein degradation even though relX cells are unable to increase ppGpp levels or proteolysis when deprived of a carbon source. In the potassium-, phosphate-, and magnesium-deprived cultures, the addition of choramphenicol or tetracycline caused a reduction in protein breakdown toward basal levels. Such findings, however, do not indicate that protein synthesis is essential for the

  7. Prophage Finder: a prophage loci prediction tool for prokaryotic genome sequences.

    PubMed

    Bose, M; Barber, Robert D

    2006-01-01

    Prophage loci often remain under-annotated or even unrecognized in prokaryotic genome sequencing projects. A PHP application, Prophage Finder, has been developed and implemented to predict prophage loci, based upon clusters of phage-related gene products encoded within DNA sequences. This application provides results detailing several facets of these clusters to facilitate rapid prediction and analysis of prophage sequences. Prophage Finder was tested using previously annotated prokaryotic genomic sequences with manually curated prophage loci as benchmarks. Additional analyses from Prophage Finder searches of several draft prokaryotic genome sequences are available through the Web site (http://bioinformatics.uwp.edu/~phage/DOEResults.php) to illustrate the potential of this application. PMID:16922685

  8. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  9. Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans

    PubMed Central

    Chowdhury, Rasheduzzaman; Krojer, Tobias; Ho, Chia-hua; Ng, Stanley S.; Clifton, Ian J.; Ge, Wei; Kershaw, Nadia J.; Fox, Gavin C.; Muniz, Joao R. C.; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S.; Kavanagh, Kathryn L.; von Delft, Frank; Oppermann, Udo; McDonough, Michael A.; Doherty, Aiden J.; Schofield, Christopher J.

    2014-01-01

    2-Oxoglutarate (2OG)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of N-methylated chromatin components1,2, hydroxylation of transcription factors3, and of splicing factor proteins4. Recently, 2OG-oxygenases that catalyze hydroxylation of tRNA5-7 and ribosomal proteins8, have been shown to play roles in translation relating to cellular growth, TH17-cell differentiation and translational accuracy9-12. The finding that the ribosomal oxygenases (ROX) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships. In Escherichia coli, ycfD catalyzes arginine-hydroxylation in the ribosomal protein L16; in humans, Mina53 (MYC-induced nuclear antigen) and NO66 (Nucleolar protein 66) catalyze histidine-hydroxylation in ribosomal proteins rpL27a and rpL8, respectively. The functional assignments of the ROX open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in residue- and protein-selectivities of prokaryotic and eukaryotic ROX, crystal structures of ycfD and ycfDRM from E. coli and Rhodothermus marinus with those of human Mina53 and NO66 (hROX) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-oxygenases. ROX structures in complex with/without their substrates, support their functional assignments as hydroxylases, but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-hydroxylases including the hypoxia-inducible factor asparaginyl-hydroxylase (FIH) and histone Nε-methyl lysine demethylases (KDMs) identifies branchpoints in 2OG-oxygenase evolution and distinguishes between JmjC-hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery. The

  10. From photon to signal in phytochromes: similarities and differences between prokaryotic and plant phytochromes.

    PubMed

    Nagano, Soshichiro

    2016-03-01

    Phytochromes represent a diverse family of red/far-red-light absorbing chromoproteins which are widespread across plants, cyanobacteria, non-photosynthetic bacteria, and more. Phytochromes play key roles in regulating physiological activities in response to light, a critical element in the acclimatization to the environment. The discovery of prokaryotic phytochromes facilitated structural studies which deepened our understanding on the general mechanisms of phytochrome action. An extrapolation of this information to plant phytochromes is justified for universally conserved functional aspects, but it is also true that there are many aspects which are unique to plant phytochromes. Here I summarize some structural studies carried out to date on both prokaryotic and plant phytochromes. I also attempt to identify aspects which are common or unique to plant and prokaryotic phytochromes. Phytochrome themselves, as well as the downstream signaling pathway in plants are more complex than in their prokaryotic counterparts. Thus many structural and functional aspects of plant phytochrome remain unresolved. PMID:26818948

  11. Modest proposals to expand the type material for naming of prokaryotes.

    PubMed

    Whitman, William B

    2016-05-01

    Gene sequences are herein proposed to be suitable type material for the description of prokaryotic species. This proposal follows from the principles described in the International Code of Nomenclature of Prokaryotes. This simple change in the Code will allow for the stability of naming of Candidatus taxa, endosymbionts and uncultivated prokaryotes and will meet an important need within microbiology. In addition, modern molecular techniques allow the identification of genera even when the species remain obscure. The Code should be modified to allow gene sequences to serve as the type material for genera in the absence of described species. This simple change will unite the nomenclature of the cultured and uncultured prokaryotes into a single, robust system. PMID:26902077

  12. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water

    PubMed Central

    Frank, Alexander H.; Garcia, Juan A. L.; Herndl, Gerhard J.

    2016-01-01

    Summary To decipher the influence of depth stratification and surface provincialism on the dark ocean prokaryotic community composition, we sampled the major deep‐water masses in the eastern North Atlantic covering three biogeographic provinces. Their diversity was evaluated using ordination and canonical analysis of 454 pyrotag sequences. Variance partitioning suggested that 16% of the variation in the bacterial community composition was based on depth stratification while 9% of the variation was due to geographic location. General linear mixed effect models showed that the community of the subsurface waters was connected to the dark ocean prokaryotic communities in different biogeographic provinces. Cluster analysis indicated that some prokaryotic taxa are specific to distinct regions in bathypelagic water masses. Taken together, our data suggest that the dark ocean prokaryotic community composition of the eastern North Atlantic is primed by the formation and the horizontal transport of water masses. PMID:26914787

  13. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water.

    PubMed

    Frank, Alexander H; Garcia, Juan A L; Herndl, Gerhard J; Reinthaler, Thomas

    2016-06-01

    To decipher the influence of depth stratification and surface provincialism on the dark ocean prokaryotic community composition, we sampled the major deep-water masses in the eastern North Atlantic covering three biogeographic provinces. Their diversity was evaluated using ordination and canonical analysis of 454 pyrotag sequences. Variance partitioning suggested that 16% of the variation in the bacterial community composition was based on depth stratification while 9% of the variation was due to geographic location. General linear mixed effect models showed that the community of the subsurface waters was connected to the dark ocean prokaryotic communities in different biogeographic provinces. Cluster analysis indicated that some prokaryotic taxa are specific to distinct regions in bathypelagic water masses. Taken together, our data suggest that the dark ocean prokaryotic community composition of the eastern North Atlantic is primed by the formation and the horizontal transport of water masses. PMID:26914787

  14. ASSOCIATION OF PROKARYOTES WITH SYMPTOMATIC APPEARANCE OF WITHERING SYNDROME IN BLACK ABALONE HALIOTIS CRACHERODII

    EPA Science Inventory

    Withering syndrome (WS) is an epizootic fatal wasting disease that is devastating California Channel Island populations of black abalone Haliotis cracherodii. ur studies suggest a strong pathogen-disease association. he pathogen is an intracellular prokaryote that infects epithel...

  15. PHYLOGENETIC ANALYSIS OF PROKARYOTIC AND EUKAROYOTIC MICROOORGANISMS IN A DRINKING WATER PIPE LOOP SYSTEM

    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  16. PHYLOGENETIC ANALYSIS OF PROKARYOTIC AND EUKARYOTIC MICROORGANISMS IN A DRINKING WATER PIPE LOOP SYSTEM

    EPA Science Inventory

    Within potable water distribution systems, opportunistic pathogens such as Legionella species infect protozoa, gaining protection from disinfectant residuals. Analyzing the prokaryotic and eukaryotic populations in distribution system water provides a basis for understanding the...

  17. Identification and Detection of Prokaryotic Symbionts in the Ciliate Metopus from Anaerobic Granular Sludge

    PubMed Central

    Hirakata, Yuga; Oshiki, Mamoru; Kuroda, Kyohei; Hatamoto, Masashi; Kubota, Kengo; Yamaguchi, Takashi; Harada, Hideki; Araki, Nobuo

    2015-01-01

    The aim of the present study was to investigate the prokaryotic community structure of the anaerobic ciliate, Metopus sp. using rRNA sequencing, fluorescence in situ hybridization (FISH), and transmission electron microscopy (TEM). Metopus sp. was physically separated from anaerobic granular sludge in a domestic wastewater treatment plant and anoxically cultivated for 7 d. 16S rRNA gene sequences from the prokaryotes Methanoregula boonei and Clostridium aminobutyricum were abundantly detected in Metopus ciliates. The FISH analysis using the oligonucleotide probes Mg1200b and Cla568 demonstrated that these prokaryotes were localized within Metopus cells. These results identify M. boonei- and C. aminobutyricum-like prokaryotes as novel endosymbionts of Metopus ciliates. PMID:26639580

  18. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  19. Can ends justify the means? Digging deep for human fusion genes of prokaryotic origin.

    PubMed

    Yiting, Yu; Chaturvedi, Iti; Meow, Liew Kim; Kangueane, Pandjassarame; Sakharkar, Meena Kishore

    2004-09-01

    Gene fusion has been described as an important evolutionary phenomenon. This report focuses on identifying, analyzing, and tabulating human fusion proteins of prokaryotic origin. These fusion proteins are found to mimic operons, simulate protein-protein interfaces in prokaryotes, exhibiting multiple functions and alternative splicing in humans. The accredited biological functions for each of these proteins is made available as a database at http://sege.ntu.edu.sg/wester/fusion/ PMID:15353329

  20. Microscopic Identification of Prokaryotes in Modern and Ancient Halite, Saline Valley and Death Valley, California

    NASA Astrophysics Data System (ADS)

    Schubert, Brian A.; Lowenstein, Tim K.; Timofeeff, Michael N.

    2009-06-01

    Primary fluid inclusions in halite crystallized in Saline Valley, California, in 1980, 2004-2005, and 2007, contain rod- and coccoid-shaped microparticles the same size and morphology as archaea and bacteria living in modern brines. Primary fluid inclusions from a well-dated (0-100,000 years), 90 m long salt core from Badwater Basin, Death Valley, California, also contain microparticles, here interpreted as halophilic and halotolerant prokaryotes. Prokaryotes are distinguished from crystals on the basis of morphology, optical properties (birefringence), and uniformity of size. Electron micrographs of microparticles from filtered modern brine (Saline Valley), dissolved modern halite crystals (Saline Valley), and dissolved ancient halite crystals (Death Valley) support in situ microscopic observations that prokaryotes are present in fluid inclusions in ancient halite. In the Death Valley salt core, prokaryotes in fluid inclusions occur almost exclusively in halite precipitated in perennial saline lakes 10,000 to 35,000 years ago. This suggests that trapping and preservation of prokaryotes in fluid inclusions is influenced by the surface environment in which the halite originally precipitated. In all cases, prokaryotes in fluid inclusions in halite from the Death Valley salt core are miniaturized (<1 μm diameter cocci, <2.5 μm long, very rare rod shapes), which supports interpretations that the prokaryotes are indigenous to the halite and starvation survival may be the normal response of some prokaryotes to entrapment in fluid inclusions for millennia. These results reinforce the view that fluid inclusions in halite and possibly other evaporites are important repositories of microbial life and should be carefully examined in the search for ancient microorganisms on Earth, Mars, and elsewhere in the Solar System.

  1. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  2. Prokaryotic and eukaryotic RNA polymerases have homologous core subunits.

    PubMed Central

    Sweetser, D; Nonet, M; Young, R A

    1987-01-01

    Eukaryotic RNA polymerases are complex aggregates whose component subunits are functionally ill-defined. The gene that encodes the 140,000-dalton subunit of Saccharomyces cerevisiae RNA polymerase II was isolated and studied in detail to obtain clues to the protein's function. This gene, RPB2, exists in a single copy in the haploid genome. Disruption of the gene is lethal to the yeast cell. RPB2 encodes a protein of 138,750 daltons, which contains sequences implicated in binding purine nucleotides and zinc ions and exhibits striking sequence homology with the beta subunit of Escherichia coli RNA polymerase. These observations suggest that the yeast and the E. coli subunit have similar roles in RNA synthesis, as the beta subunit contains binding sites for nucleotide substrates and a portion of the catalytic site for RNA synthesis. The subunit homologies reported here, and those observed previously with the largest RNA polymerase subunit, indicate that components of the prokaryotic RNA polymerase "core" enzyme have counterparts in eukaryotic RNA polymerases. PMID:3547406

  3. Integrating prokaryotes and eukaryotes: DNA transposases in light of structure.

    PubMed

    Hickman, Alison Burgess; Chandler, Michael; Dyda, Fred

    2010-02-01

    DNA rearrangements are important in genome function and evolution. Genetic material can be rearranged inadvertently during processes such as DNA repair, or can be moved in a controlled manner by enzymes specifically dedicated to the task. DNA transposases comprise one class of such enzymes. These move DNA segments known as transposons to new locations, without the need for sequence homology between transposon and target site. Several biochemically distinct pathways have evolved for DNA transposition, and genetic and biochemical studies have provided valuable insights into many of these. However, structural information on transposases - particularly with DNA substrates - has proven elusive in most cases. On the other hand, large-scale genome sequencing projects have led to an explosion in the number of annotated prokaryotic and eukaryotic mobile elements. Here, we briefly review biochemical and mechanistic aspects of DNA transposition, and propose that integrating sequence information with structural information using bioinformatics tools such as secondary structure prediction and protein threading can lead not only to an additional level of understanding but possibly also to testable hypotheses regarding transposition mechanisms. Detailed understanding of transposition pathways is a prerequisite for the long-term goal of exploiting DNA transposons as genetic tools and as a basis for genetic medical applications. PMID:20067338

  4. Evolution of animal Piwi-interacting RNAs and prokaryotic CRISPRs.

    PubMed

    Kumar, M Senthil; Chen, Kevin C

    2012-07-01

    Piwi-interacting RNAs (piRNAs) and CRISPR RNAs (crRNAs) are two recently discovered classes of small noncoding RNA that are found in animals and prokaryotes, respectively. Both of these novel RNA species function as components of adaptive immune systems that protect their hosts from foreign nucleic acids-piRNAs repress transposable elements in animal germlines, whereas crRNAs protect their bacterial hosts from phage and plasmids. The piRNA and CRISPR systems are nonhomologous but rather have independently evolved into logically similar defense mechanisms based on the specificity of targeting via nucleic acid base complementarity. Here we review what is known about the piRNA and CRISPR systems with a focus on comparing their evolutionary properties. In particular, we highlight the importance of several factors on the pattern of piRNA and CRISPR evolution, including the population genetic environment, the role of alternate defense systems and the mechanisms of acquisition of new piRNAs and CRISPRs. PMID:22539610

  5. Tracing the path of a prokaryotic paracrine signal.

    PubMed

    Mullineaux, Conrad W; Nürnberg, Dennis J

    2014-12-01

    Filamentous heterocyst-forming cyanobacteria are a beautiful example of prokaryotic multicellularity. The filaments can achieve simultaneous nitrogen fixation and oxygenic photosynthesis by cooperation between two cell types: the photosynthetic vegetative cells and the nitrogen-fixing heterocysts. The multicellular features exhibited by the system include differentiation of different cell types, metabolic interdependence and even pattern formation, as the spacing of heterocysts along the filament is non-random. Recent years have seen exciting progress both in understanding the control of heterocyst differentiation, and also in understanding the function of 'septal junctions': an array of pore-like structures at the cell junctions that allow intercellular communication by facilitating the diffusion of small molecules from cell to cell. A new report by Rivers et al. (2014) makes the connection between pattern formation and intercellular communication by showing that a mutation that partially disables the septal junctions leads to a decrease in the range of a signal dependent on the HetN protein that is one of the factors controlling heterocyst spacing. This suggests that the signal travels from cell to cell by diffusion through the septal junctions, opening the door to quantitative understanding of the mechanism that controls heterocyst spacing in filamentous cyanobacteria. PMID:25362990

  6. Prokaryotic diversity in a Tunisian hypersaline lake, Chott El Jerid.

    PubMed

    Abdallah, Manel Ben; Karray, Fatma; Mhiri, Najla; Mei, Nan; Quéméneur, Marianne; Cayol, Jean-Luc; Erauso, Gaël; Tholozan, Jean-Luc; Alazard, Didier; Sayadi, Sami

    2016-03-01

    Prokaryotic diversity was investigated in a Tunisian salt lake, Chott El Jerid, by quantitative real-time PCR, denaturing gradient gel electrophoresis (DGGE) fingerprinting methods targeting the 16S rRNA gene and culture-dependent methods. Two different samples S1-10 and S2-10 were taken from under the salt crust of Chott El Jerid in the dry season. DGGE analysis revealed that bacterial sequences were related to Firmicutes, Proteobacteria, unclassified bacteria, and Deinococcus-Thermus phyla. Anaerobic fermentative and sulfate-reducing bacteria were also detected in this ecosystem. Within the domain archaea, all sequences were affiliated to Euryarchaeota phylum. Quantitative real-time PCR showed that 16S rRNA gene copy numbers of bacteria was 5 × 10(6) DNA copies g(-1) whereas archaea varied between 5 × 10(5) and 10(6) DNA copies g(-1) in these samples. Eight anaerobic halophilic fermentative bacterial strains were isolated and affiliated with the species Halanaerobium alcaliphilum, Halanaerobium saccharolyticum, and Sporohalobacter salinus. These data showed an abundant and diverse microbial community detected in the hypersaline thalassohaline environment of Chott El Jerid. PMID:26724953

  7. Genomic Mining of Prokaryotic Repressors for Orthogonal Logic Gates

    PubMed Central

    Stanton, Brynne C.; Nielsen, Alec A.K.; Tamsir, Alvin; Clancy, Kevin; Peterson, Todd; Voigt, Christopher A.

    2014-01-01

    Genetic circuits perform computational operations based on interactions between freely diffusing molecules within a cell. When transcription factors are combined to build a circuit, unintended interactions can disrupt its function. Here, we apply “part mining” to build a library of 73 TetR-family repressors gleaned from prokaryotic genomes. The operators of a subset were determined using an in vitro method and this information was used to build synthetic promoters. The promoters and repressors were screened for cross-reactions. Of these, 16 were identified that both strongly repress their cognate promoter (5- to 207-fold) and do not interact with other promoters. Each repressor:promoter pair was converted to a NOT gate and characterized. Used as a set of 16 NOR gates, there are >1054 circuits that could be built by changing the pattern of input and output promoters. This represents a large set of compatible gates that can be used to construct user-defined circuits. PMID:24316737

  8. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    PubMed

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes. PMID:25261947

  9. The prokaryotic pathway of lipid synthesis in oat leaf plastids

    SciTech Connect

    Gillanders, B.; Mackender, R. )

    1990-05-01

    Evidence for the operation of the prokaryotic pathway of acyl lipid synthesis is an 18:3 plant was sought by incubating plastids from 6 sequential segments from oat seedling leaves as described previously except that {sup 14}C-G3P was used. Proplastids were the most biosynthetically active plastids (x2-3) and DAG and PA were the most heavily labelled acyl lipids (>75% of label). Analysis of MGDG and DGDG molecular species (MS) following pre-incubation with {sup 14}C-G3P (40 mins) and subsequently with UDP{sup 3}H-gal (30 mins), showed that only MS 16:0/18:0 and MS 16:0/18:1 were significantly labelled with {sup 14}C whereas all 5 MS were labelled with {sup 3}H-gal. However most of the {sup 3}H label was in the same MS as the {sup 14}C except when 18:2/18:2 DAG or PC was added with the {sup 3}H-gal, in which case considerably additional {sup 3}H-gal (up to 100%) appeared in the 18:2/18:2 MS of both these lipids.

  10. ICDS database: interrupted CoDing sequences in prokaryotic genomes.

    PubMed

    Perrodou, Emmanuel; Deshayes, Caroline; Muller, Jean; Schaeffer, Christine; Van Dorsselaer, Alain; Ripp, Raymond; Poch, Olivier; Reyrat, Jean-Marc; Lecompte, Odile

    2006-01-01

    Unrecognized frameshifts, in-frame stop codons and sequencing errors lead to Interrupted CoDing Sequence (ICDS) that can seriously affect all subsequent steps of functional characterization, from in silico analysis to high-throughput proteomic projects. Here, we describe the Interrupted CoDing Sequence database containing ICDS detected by a similarity-based approach in 80 complete prokaryotic genomes. ICDS can be retrieved by species browsing or similarity searches via a web interface (http://www-bio3d-igbmc.u-strasbg.fr/ICDS/). The definition of each interrupted gene is provided as well as the ICDS genomic localization with the surrounding sequence. Furthermore, to facilitate the experimental characterization of ICDS, we propose optimized primers for re-sequencing purposes. The database will be regularly updated with additional data from ongoing sequenced genomes. Our strategy has been validated by three independent tests: (i) ICDS prediction on a benchmark of artificially created frameshifts, (ii) comparison of predicted ICDS and results obtained from the comparison of the two genomic sequences of Bacillus licheniformis strain ATCC 14580 and (iii) re-sequencing of 25 predicted ICDS of the recently sequenced genome of Mycobacterium smegmatis. This allows us to estimate the specificity and sensitivity (95 and 82%, respectively) of our program and the efficiency of primer determination. PMID:16381882

  11. Metabolic Design and Control for Production in Prokaryotes

    SciTech Connect

    Chhabra, Swapnil R.; Keasling, J.D.

    2010-11-10

    Prokaryotic life on earth is manifested by its diversity and omnipresence. These microbes serve as natural sources of a large variety of compounds with the potential to serve the ever growing, medicinal, chemical and transportation needs of the human population. However, commercially viable production of these compounds can be realized only through significant improvement of the native production capacity of natural isolates. The most favorable way to achieve this goal is through the genetic manipulation of metabolic pathways that direct the production of these molecules. While random mutagenesis and screening have dominated the industrial production of such compounds in the past our increased understanding of microbial physiology over the last five decades has shifted this trend towards rational approaches for metabolic design. Major drivers of this trend include recombinant DNA technology, high throughput characterization of macromolecular cellular components, quantitative modeling for metabolic engine ring, targeted combinatorial engineering and synthetic biology. In this chapter we track the evolution of microbial engineering technologies from the black box era of random mutagenesis to the science and engineering-driven era of metabolic design.

  12. Single-molecule observation of prokaryotic DNA replication.

    PubMed

    Geertsema, Hylkje J; Duderstadt, Karl E; van Oijen, Antoine M

    2015-01-01

    Replication of DNA requires the coordinated activity of a number of proteins within a multiprotein complex, the replisome. Recent advances in single-molecule techniques have enabled the observation of dynamic behavior of individual replisome components and of the replisome as a whole, aspects that previously often have been obscured by ensemble averaging in more classical solution-phase biochemical experiments. To improve robustness and reproducibility of single-molecule assays of replication and allow objective analysis and comparison of results obtained from such assays, common practices should be established. Here, we describe the technical details of two assays to study replisome activity. In one, the kinetics of replication are observed as length changes in DNA molecules mechanically stretched by a laminar flow applied to attached beads. In the other, fluorescence imaging is used to determine both the kinetics and stoichiometry of individual replisome components. These in vitro single-molecule methods allow for elucidation of the dynamic behavior of individual replication proteins of prokaryotic replication systems. PMID:25916715

  13. Diversity of aquatic prokaryotic communities in the Cuatro Cienegas basin.

    PubMed

    Escalante, Ana E; Eguiarte, Luis E; Espinosa-Asuar, Laura; Forney, Larry J; Noguez, Ana M; Souza Saldivar, Valeria

    2008-07-01

    The Cuatro Cienegas basin (Coahuila, México) is a composite of different water systems in the middle of the desert with unusually high levels of endemism and diversity in different taxa. Although the diversity of macrobiota has been well described, little is known about the diversity and distribution of microorganisms in the oligotrophic ponds. Here we describe the extent and distribution of diversity found in aquatic prokaryotic communities by analysis of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes and phylogenetic analysis of cloned genes. Twelve locations within the basin were sampled. Among all the samples, we found a total of 117 operational taxonomic units (OTUs) using T-RFLPs, which ranged in any single sample from four to 49. OTU richness and Shannon diversity indices for different sites varied, but none were particularly high. 16S rRNA gene sequence data showed 68 different phylotypes among 198 clones. The most abundant phylotypes were Gamma- and Betaproteobacteria, and extreme halophiles. The differences among sites were significant; 45 TRFs were found only once, and 37% of the total diversity was represented by differences between sites, suggesting high beta-diversity. Further studies are needed to test whether this is a direct consequence of environmental heterogeneity in the basin. PMID:18479448

  14. Comparative analysis of essential genes in prokaryotic genomic islands

    PubMed Central

    Zhang, Xi; Peng, Chong; Zhang, Ge; Gao, Feng

    2015-01-01

    Essential genes are thought to encode proteins that carry out the basic functions to sustain a cellular life, and genomic islands (GIs) usually contain clusters of horizontally transferred genes. It has been assumed that essential genes are not likely to be located in GIs, but systematical analysis of essential genes in GIs has not been explored before. Here, we have analyzed the essential genes in 28 prokaryotes by statistical method and reached a conclusion that essential genes in GIs are significantly fewer than those outside GIs. The function of 362 essential genes found in GIs has been explored further by BLAST against the Virulence Factor Database (VFDB) and the phage/prophage sequence database of PHAge Search Tool (PHAST). Consequently, 64 and 60 eligible essential genes are found to share the sequence similarity with the virulence factors and phage/prophages-related genes, respectively. Meanwhile, we find several toxin-related proteins and repressors encoded by these essential genes in GIs. The comparative analysis of essential genes in genomic islands will not only shed new light on the development of the prediction algorithm of essential genes, but also give a clue to detect the functionality of essential genes in genomic islands. PMID:26223387

  15. Shifting the genomic gold standard for the prokaryotic species definition

    PubMed Central

    Richter, Michael; Rosselló-Móra, Ramon

    2009-01-01

    DNA-DNA hybridization (DDH) has been used for nearly 50 years as the gold standard for prokaryotic species circumscriptions at the genomic level. It has been the only taxonomic method that offered a numerical and relatively stable species boundary, and its use has had a paramount influence on how the current classification has been constructed. However, now, in the era of genomics, DDH appears to be an outdated method for classification that needs to be substituted. The average nucleotide identity (ANI) between two genomes seems the most promising method since it mirrors DDH closely. Here we examine the work package JSpecies as a user-friendly, biologist-oriented interface to calculate ANI and the correlation of the tetranucleotide signatures between pairwise genomic comparisons. The results agreed with the use of ANI to substitute DDH, with a narrowed boundary that could be set at ≈95–96%. In addition, the JSpecies package implemented the tetranucleotide signature correlation index, an alignment-free parameter that generally correlates with ANI and that can be of help in deciding when a given pair of organisms should be classified in the same species. Moreover, for taxonomic purposes, the analyses can be produced by simply randomly sequencing at least 20% of the genome of the query strains rather than obtaining their full sequence. PMID:19855009

  16. Linking environmental prokaryotic viruses and their host through CRISPRs.

    PubMed

    Sanguino, Laura; Franqueville, Laure; Vogel, Timothy M; Larose, Catherine

    2015-05-01

    The ecological pressure that viruses place on microbial communities is not only based on predation, but also on gene transfer. In order to determine the potential impact of viruses and transduction, we need a better understanding of the dynamics of interactions between viruses and their hosts in the environment. Data on environmental viruses are scarce, and methods for tracking their interactions with prokaryotes are needed. Clustered regularly interspaced short palindromic repeats (CRISPRs), which contain viral sequences in bacterial genomes, might help document the history of virus-host interactions in the environment. In this study, a bioinformatics network linking viruses and their hosts using CRISPR sequences obtained from metagenomic data was developed and applied to metagenomes from Arctic glacial ice and soil. The application of our network approach showed that putative interactions were more commonly detected in the ice samples than the soil which would be consistent with the ice viral-bacterial interactions being more dynamic than those in soil. Further analysis of the viral sequences in the CRISPRs indicated that Ralstonia phages might be agents of transduction in the Arctic glacial ice. PMID:25908869

  17. Novel species and expanded distribution of ellipsoidal multicellular magnetotactic prokaryotes.

    PubMed

    Chen, Yi-ran; Zhang, Wen-yan; Zhou, Ke; Pan, Hong-miao; Du, Hai-jian; Xu, Cong; Xu, Jian-hong; Pradel, Nathalie; Santini, Claire-Lise; Li, Jin-hua; Huang, Hui; Pan, Yong-xin; Xiao, Tian; Wu, Long-fei

    2016-04-01

    Multicellular magnetotactic prokaryotes (MMPs) are a peculiar group of magnetotactic bacteria, each comprising approximately 10-100 cells of the same phylotype. Two morphotypes of MMP have been identified, including several species of globally distributed spherical mulberry-like MMPs (s-MMPs), and two species of ellipsoidal pineapple-like MMPs (e-MMPs) from China (Qingdao and Rongcheng cities). We recently collected e-MMPs from Mediterranean Sea sediments (Six-Fours-les-Plages) and Drummond Island, in the South China Sea. Phylogenetic analysis revealed that the MMPs from Six-Fours-les-Plages and the previously reported e-MMP Candidatus Magnetananas rongchenensis have 98.5% sequence identity and are the same species, while the MMPs from Drummond Island appear to be a novel species, having > 7.1% sequence divergence from the most closely related e-MMP, Candidatus Magnetananas tsingtaoensis. Identification of the novel species expands the distribution of e-MMPs to Tropical Zone. Comparison of nine physical and chemical parameters revealed that sand grain size and the content of inorganic nitrogen (nitrate, ammonium and nitrite) in the sediments from Rongcheng City and Six-Fours-les-Plages were similar, and lower than found for sediments from the other two sampling sites. The results of the study reveal broad diversity and wide distribution of e-MMPs. PMID:26711721

  18. Current Developments in Prokaryotic Single Cell Whole Genome Amplification

    SciTech Connect

    Goudeau, Danielle; Nath, Nandita; Ciobanu, Doina; Cheng, Jan-Fang; Malmstrom, Rex

    2014-03-14

    Our approach to prokaryotic single-cell Whole Genome Amplification at the JGI continues to evolve. To increase both the quality and number of single-cell genomes produced, we explore all aspects of the process from cell sorting to sequencing. For example, we now utilize specialized reagents, acoustic liquid handling, and reduced reaction volumes eliminate non-target DNA contamination in WGA reactions. More specifically, we use a cleaner commercial WGA kit from Qiagen that employs a UV decontamination procedure initially developed at the JGI, and we use the Labcyte Echo for tip-less liquid transfer to set up 2uL reactions. Acoustic liquid handling also dramatically reduces reagent costs. In addition, we are exploring new cell lysis methods including treatment with Proteinase K, lysozyme, and other detergents, in order to complement standard alkaline lysis and allow for more efficient disruption of a wider range of cells. Incomplete lysis represents a major hurdle for WGA on some environmental samples, especially rhizosphere, peatland, and other soils. Finding effective lysis strategies that are also compatible with WGA is challenging, and we are currently assessing the impact of various strategies on genome recovery.

  19. Engineering input/output nodes in prokaryotic regulatory circuits.

    PubMed

    de Las Heras, Aitor; Carreño, Carlos A; Martínez-García, Esteban; de Lorenzo, Víctor

    2010-09-01

    A large number of prokaryotic regulatory elements have been interfaced artificially with biological circuits that execute specific expression programs. Engineering such circuits involves the association of input/output components that perform discrete signal-transfer steps in an autonomous fashion while connected to the rest of the network with a defined topology. Each of these nodes includes a signal-recognition component for the detection of the relevant physicochemical or biological stimulus, a molecular device able to translate the signal-sensing event into a defined output and a genetic module capable of understanding such an output as an input for the next component of the circuit. The final outcome of the process can be recorded by means of a reporter product. This review addresses three such aspects of forward engineering of signal-responding genetic parts. We first recap natural and non-natural regulatory assets for designing gene expression in response to predetermined signals - chemical or otherwise. These include transcriptional regulators developed by in vitro evolution (or designed from scratch), and synthetic riboswitches derived from in vitro selection of aptamers. Then we examine recent progress on reporter genes, whose expression allows the quantification and parametrization of signal-responding circuits in their entirety. Finally, we critically examine recent work on other reporters that confer bacteria with gross organoleptic properties (e.g. distinct odour) and the interfacing of signal-sensing devices with determinants of community behaviour. PMID:20618867

  20. Vertical distribution of the prokaryotic cell size in the Mediterranean Sea

    NASA Astrophysics Data System (ADS)

    La Ferla, R.; Maimone, G.; Azzaro, M.; Conversano, F.; Brunet, C.; Cabral, A. S.; Paranhos, R.

    2012-12-01

    Distributions of prokaryotic cell size and morphology were studied in different areas of the Mediterranean Sea by using image analysis on samples collected from surface down to bathypelagic layers (max depth 4,900 m) in the Southern Tyrrhenian, Southern Adriatic and Eastern Mediterranean Seas. Distribution of cell size of prokaryotes in marine ecosystem is very often not considered, which makes our study first in the context of prokaryotic ecology. In the deep Mediterranean layers, an usually-not-considered form of carbon sequestration through prokaryotic cells has been highlighted, which is consistent with an increase in cell size with the depth of the water column. A wide range in prokaryotic cell volumes was observed (between 0.045 and 0.566 μm3). Increase in cell size with depth was opposed to cell abundance distribution. Our results from microscopic observations were confirmed by the increasing HNA/LNA ratio (HNA, cells with high nucleic acid content; LNA, cells with low nucleic acid content) along the water column. Implications of our results on the increasing cell size with depth are in the fact that the quantitative estimation of prokaryotic biomass changes along the water column and the amount of carbon sequestered in the deep biota is enhanced.

  1. A cost-effective and universal strategy for complete prokaryotic genomic sequencing proposed by computer simulation

    PubMed Central

    2012-01-01

    Background Pyrosequencing techniques allow scientists to perform prokaryotic genome sequencing to achieve the draft genomic sequences within a few days. However, the assemblies with shotgun sequencing are usually composed of hundreds of contigs. A further multiplex PCR procedure is needed to fill all the gaps and link contigs into complete chromosomal sequence, which is the basis for prokaryotic comparative genomic studies. In this article, we study various pyrosequencing strategies by simulated assembling from 100 prokaryotic genomes. Findings Simulation study shows that a single end 454 Jr. run combined with a paired end 454 Jr. run (8 kb library) can produce: 1) ~90% of 100 assemblies with < 10 scaffolds and ~95% of 100 assemblies with < 150 contigs; 2) average contig N50 size is over 331 kb; 3) average single base accuracy is > 99.99%; 4) average false gene duplication rate is < 0.7%; 5) average false gene loss rate is < 0.4%. Conclusions A single end 454 Jr. run combined with a paired end 454 Jr. run (8 kb library) is a cost-effective way for prokaryotic whole genome sequencing. This strategy provides solution to produce high quality draft assemblies for most of prokaryotic organisms within days. Due to the small number of assembled scaffolds, the following multiplex PCR procedure (for gap filling) would be easy. As a result, large scale prokaryotic whole genome sequencing projects may be finished within weeks. PMID:22289569

  2. Prokaryotic Community Diversity Along an Increasing Salt Gradient in a Soda Ash Concentration Pond.

    PubMed

    Simachew, Addis; Lanzén, Anders; Gessesse, Amare; Øvreås, Lise

    2016-02-01

    The effect of salinity on prokaryotic community diversity in Abijata-Shalla Soda Ash Concentration Pond system was investigated by using high-throughput 16S rRNA gene 454 pyrosequencing. Surface water and brine samples from five sites spanning a salinity range of 3.4 % (Lake Abijata) to 32 % (SP230F, crystallizer pond) were analyzed. Overall, 33 prokaryotic phyla were detected, and the dominant prokaryotic phyla accounted for more than 95 % of the reads consisting of Planctomycetes, Bacteroidetes, candidate division TM7, Deinococcus-Thermus, Firmicutes, Actinobacteria, Proteobacteria, and Euryarchaeota. Diversity indices indicated that operational taxonomic unit (OTU) richness decreases drastically with increasing salinity in the pond system. A total of 471 OTUs were found at 3.4 % salinity whereas 49 OTUs were detected in pond SP211 (25 % salinity), and only 19 OTUs in the crystallization pond at 32 % salinity (SP230F). Along the salinity gradient, archaeal community gradually replaced bacterial community. Thus, archaeal community accounted for 0.4 % in Lake Abijata while 99.0 % in pond SP230F. This study demonstrates that salinity appears to be the key environmental parameter in structuring the prokaryotic communities of haloalkaline environments. Further, it confirmed that the prokaryotic diversity in Lake Abijata is high and it harbors taxa with low or no phylogenetic similarities to existing prokaryotic taxa and thus represents novel microorganisms. PMID:26408190

  3. Prokaryote diversity and viral production in deep-sea sediments and seamounts

    NASA Astrophysics Data System (ADS)

    Danovaro, Roberto; Corinaldesi, Cinzia; Luna, Gian Marco; Magagnini, Mirko; Manini, Elena; Pusceddu, Antonio

    2009-05-01

    Despite the fact that marine prokaryotes and viruses have been increasingly investigated over the last decade, knowledge on prokaryote diversity and viral production in bathyal sediments is limited. We investigated microbial variables in the deep-sea sediments around two seamounts at 3000-m depth in the Tyrrhenian Sea and sediments located at the same depth, but not affected by the presence of the seamounts. We hypothesized that seamounts altered significantly prokaryotes-viruses interactions in surrounding deep-sea sediments. Sediments surrounding seamounts were characterised by prokaryotic abundances significantly higher than those observed in non-seamount sediments. Benthic viral production was about double in sediments close to seamounts than in non-seamount sediments, where virus turnover was up to 3 times lower. Total Bacteria, as assessed by CARD-FISH, dominated prokaryotic community structure, whereas Archaea accounted on average for approximately 10%. The fraction of Crenarchaeota was always higher than Euryarchaeota. Bacterial diversity, estimated using ARISA, was high, with up to 127 different microbial operational taxonomic units (OTUs) in a single sample. Archaeal richness (determined using T-RFLP of the 16S rRNA gene) ranged from 12 to 20 OTUs, while Archaeal evenness was comprised between 0.529±0.018 and 0.623±0.08. Results represent a pointer for future investigations dealing with the interactions between viruses and prokaryotes in deep-sea sediments.

  4. Chloramphenicol-induced changes in the synthesis of ribosomal, transfer, and messenger ribonucleic acids in Escherichia coli B/r.

    PubMed

    Shen, V; Bremer, H

    1977-06-01

    The synthesis of ribosomal ribonucleic acid (rRNA), transfer RNA (tRNA) and messenger RNA (mRNA) was measured in Escherichia coli B/r after the addition of 100 mug of chloramphenicol (CAM) per ml to cultures growing either in one of three minimal media (succinate, glycerol, or glucose) or in one of the same three media supplemented with 20 amino acids. (i) During CAM treatment, rRNA and tRNA were synthesized in the same relative proportions (85:15) as during exponential growth. The faster accumulation of tRNA relative to rRNA in CAM was due to a decreased stability of rRNA that is synthesized in the presence of or immediately before the addition of CAM. (ii) CAM stimulated the synthesis of rRNA and tRNA two- to eightfold. The results fell into two groups; one group was from studies done in minimal media and the other was from amino acid-supplemented media. In each group the stimulation decreased with increasing growth rate of the culture during exponential growth before the addition of CAM; however, the stimulation in minimal media was lower than that in amino acid-supplemented media. (iii) CAM caused an increase in the proportion of rRNA and tRNA synthesis and a corresponding decrease in the proportion of mRNA synthesis. In minimal media, the residual proportion of mRNA synthesis after CAM treatment was 10 to 15% of total RNA synthesis; in amino acid-supplemented media this proportion was 0 to 10%. In either case, the residual proportion of mRNA synthesis was independent of the proportions observed during exponential growth in these media. (iv) The absolute rate of mRNA synthesis decreased severalfold with the addition of CAM; i.e., the rate of synthesis of rRNA and tRNA was increased at the expense of mRNA synthesis. (v) During exponential growth, the fraction of the instantaneous rate of total RNA synthesis that corresponds to mRNA is a function of both the growth rate and the presence or absence of amino acids in the growth medium: in the absence of amino acids

  5. ATGC: a database of orthologous genes from closely related prokaryotic genomes and a research platform for microevolution of prokaryotes

    SciTech Connect

    Novichkov, Pavel S.; Ratnere, Igor; Wolf, Yuri I.; Koonin, Eugene V.; Dubchak, Inna

    2009-07-23

    The database of Alignable Tight Genomic Clusters (ATGCs) consists of closely related genomes of archaea and bacteria, and is a resource for research into prokaryotic microevolution. Construction of a data set with appropriate characteristics is a major hurdle for this type of studies. With the current rate of genome sequencing, it is difficult to follow the progress of the field and to determine which of the available genome sets meet the requirements of a given research project, in particular, with respect to the minimum and maximum levels of similarity between the included genomes. Additionally, extraction of specific content, such as genomic alignments or families of orthologs, from a selected set of genomes is a complicated and time-consuming process. The database addresses these problems by providing an intuitive and efficient web interface to browse precomputed ATGCs, select appropriate ones and access ATGC-derived data such as multiple alignments of orthologous proteins, matrices of pairwise intergenomic distances based on genome-wide analysis of synonymous and nonsynonymous substitution rates and others. The ATGC database will be regularly updated following new releases of the NCBI RefSeq. The database is hosted by the Genomics Division at Lawrence Berkeley National laboratory and is publicly available at http://atgc.lbl.gov.

  6. Systematic Transfer of Prokaryotic Sensors and Circuits to Mammalian Cells

    PubMed Central

    2015-01-01

    Prokaryotic regulatory proteins respond to diverse signals and represent a rich resource for building synthetic sensors and circuits. The TetR family contains >105 members that use a simple mechanism to respond to stimuli and bind distinct DNA operators. We present a platform that enables the transfer of these regulators to mammalian cells, which is demonstrated using human embryonic kidney (HEK293) and Chinese hamster ovary (CHO) cells. The repressors are modified to include nuclear localization signals (NLS) and responsive promoters are built by incorporating multiple operators. Activators are also constructed by modifying the protein to include a VP16 domain. Together, this approach yields 15 new regulators that demonstrate 19- to 551-fold induction and retain both the low levels of crosstalk in DNA binding specificity observed between the parent regulators in Escherichia coli, as well as their dynamic range of activity. By taking advantage of the DAPG small molecule sensing mediated by the PhlF repressor, we introduce a new inducible system with 50-fold induction and a threshold of 0.9 μM DAPG, which is comparable to the classic Dox-induced TetR system. A set of NOT gates is constructed from the new repressors and their response function quantified. Finally, the Dox- and DAPG- inducible systems and two new activators are used to build a synthetic enhancer (fuzzy AND gate), requiring the coordination of 5 transcription factors organized into two layers. This work introduces a generic approach for the development of mammalian genetic sensors and circuits to populate a toolbox that can be applied to diverse applications from biomanufacturing to living therapeutics. PMID:25360681

  7. Interaction of Low Temperature Plasmas with Prokaryotic and Eukaryotic Cells

    NASA Astrophysics Data System (ADS)

    Laroussi, Mounir

    2008-10-01

    Due to promising possibilities for their use in medical applications such as wound healing, surface modification of biocompatible materials, and the sterilization of reusable heat-sensitive medical instruments, low temperature plasmas and plasma jets are making big strides as a technology that can potentially be used in medicine^1-2. At this stage of research, fundamental questions about the effects of plasma on prokaryotic and eukaryotic cells are still not completely answered. An in-depth understanding of the pathway whereby cold plasma interact with biological cells is necessary before real applications can emerge. In this paper, first an overview of non-equilibrium plasma sources (both low and high pressures) will be presented. Secondly, the effects of plasma on bacterial cells will be discussed. Here, the roles of the various plasma agents in the inactivation process will be outlined. In particular, the effects of UV and that of various reactive species (O3, O, OH) are highlighted. Thirdly, preliminary findings on the effects of plasma on few types of eukaryotic cells will be presented. How plasma affects eukaryotic cells, such as mammalian cells, is very important in applications where the viability/preservation of the cells could be an issue (such as in wound treatment). Another interesting aspect is the triggering of apoptosis (programmed cell death). Some investigators have claimed that plasma is able to induce apoptosis in some types of cancer cells. If successfully replicated, this can open up a novel method of cancer treatment. In this talk however, I will briefly focus more on the wound healing potential of cold plasmas. ^1E. A. Blakely, K. A. Bjornstad, J. E. Galvin, O. R. Monteiro, and I. G. Brown, ``Selective Neuron Growth on Ion Implanted and Plasma Deposited Surfaces'', In Proc. IEEE Int. Conf. Plasma Sci., (2002), p. 253. ^2M. Laroussi, ``Non-thermal Decontamination of Biological Media by Atmospheric Pressure Plasmas: Review, Analysis, and

  8. Phylogenomic analysis of the cystatin superfamily in eukaryotes and prokaryotes

    PubMed Central

    2009-01-01

    Background The cystatin superfamily comprises cysteine protease inhibitors that play key regulatory roles in protein degradation processes. Although they have been the subject of many studies, little is known about their genesis, evolution and functional diversification. Our aim has been to obtain a comprehensive insight into their origin, distribution, diversity, evolution and classification in Eukaryota, Bacteria and Archaea. Results We have identified in silico the full complement of the cystatin superfamily in more than 2100 prokaryotic and eukaryotic genomes. The analysis of numerous eukaryotic genomes has provided strong evidence for the emergence of this superfamily in the ancestor of eukaryotes. The progenitor of this superfamily was most probably intracellular and lacked a signal peptide and disulfide bridges, much like the extant Giardia cystatin. A primordial gene duplication produced two ancestral eukaryotic lineages, cystatins and stefins. While stefins remain encoded by a single or a small number of genes throughout the eukaryotes, the cystatins have undergone a more complex and dynamic evolution through numerous gene and domain duplications. In the cystatin superfamily we discovered twenty vertebrate-specific and three angiosperm-specific orthologous families, indicating that functional diversification has occurred only in multicellular eukaryotes. In vertebrate orthologous families, the prevailing trends were loss of the ancestral inhibitory activity and acquisition of novel functions in innate immunity. Bacterial cystatins and stefins may be emergency inhibitors that enable survival of bacteria in the host, defending them from the host's proteolytic activity. Conclusion This study challenges the current view on the classification, origin and evolution of the cystatin superfamily and provides valuable insights into their functional diversification. The findings of this comprehensive study provide guides for future structural and evolutionary studies

  9. Toward a standard in structural genome annotation for prokaryotes

    SciTech Connect

    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia

    2015-07-25

    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found that the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.

  10. Toward a standard in structural genome annotation for prokaryotes

    DOE PAGESBeta

    Tripp, H. James; Sutton, Granger; White, Owen; Wortman, Jennifer; Pati, Amrita; Mikhailova, Natalia; Ovchinnikova, Galina; Payne, Samuel H.; Kyrpides, Nikos C.; Ivanova, Natalia

    2015-07-25

    In an effort to identify the best practice for finding genes in prokaryotic genomes and propose it as a standard for automated annotation pipelines, we collected 1,004,576 peptides from various publicly available resources, and these were used as a basis to evaluate various gene-calling methods. The peptides came from 45 bacterial replicons with an average GC content from 31 % to 74 %, biased toward higher GC content genomes. Automated, manual, and semi-manual methods were used to tally errors in three widely used gene calling methods, as evidenced by peptides mapped outside the boundaries of called genes. We found thatmore » the consensus set of identical genes predicted by the three methods constitutes only about 70 % of the genes predicted by each individual method (with start and stop required to coincide). Peptide data was useful for evaluating some of the differences between gene callers, but not reliable enough to make the results conclusive, due to limitations inherent in any proteogenomic study. A single, unambiguous, unanimous best practice did not emerge from this analysis, since the available proteomics data were not adequate to provide an objective measurement of differences in the accuracy between these methods. However, as a result of this study, software, reference data, and procedures have been better matched among participants, representing a step toward a much-needed standard. In the absence of sufficient amount of experimental data to achieve a universal standard, our recommendation is that any of these methods can be used by the community, as long as a single method is employed across all datasets to be compared.« less