Science.gov

Sample records for proline rich region

  1. Proline-rich regions and motifs in trafficking: from ESCRT interaction to viral exploitation.

    PubMed

    Ren, Xuefeng; Hurley, James H

    2011-10-01

    Most membrane-enveloped viruses bud from infected cells by hijacking the host ESCRT machinery. The ESCRTs are recruited to the budding sites by viral proteins that contain short proline (Pro)-rich motifs (PRMs) known as late domains. The late domains probably evolved by co-opting host PRMs involved in the normal functions of ESCRTs in endosomal sorting and cytokinesis. The solution and crystal structures of PRMs bound to their interaction partners explain the conserved roles of Pro and other residues that predominate in these sequences. PRMs are often grouped together in much larger Pro-rich regions (PRRs) of as many as 150 residues. The PRR of the ESCRT-associated protein, ALIX, autoregulates its conformation and activity. The robustness of different viral budding and host pathways to impairments in Pro-based interactions varies considerably. The known biology of PRM recognition in the ESCRT pathway seems, in principle, compatible with antiviral development, given our increasingly nuanced understanding of the relative weakness and robustness of the host and viral processes. PMID:21518163

  2. Multiple Src Homology 3 Binding to the Ubiquitin Ligase Itch Conserved Proline-Rich Region.

    PubMed

    Desrochers, Guillaume; Lussier-Price, Mathieu; Omichinski, James G; Angers, Annie

    2015-12-22

    Itch is a member of the C2-WW-HECT (CWH) family of ubiquitin ligases involved in the control of inflammatory signaling pathways, several transcription factors, and sorting of surface receptors to the degradative pathway. In addition to these common domains, Itch also contains a conserved proline-rich region (PRR) allowing its interaction with Src homology 3 (SH3) domain-containing proteins. This region is composed of 20 amino acids and contains one consensus class I and three class II SH3-binding motifs. Several SH3 domain-containing partners have been shown to recognize the Itch PRR, but their binding properties have been poorly defined. Here we compare a subset of endocytic SH3 domain-containing proteins using bioluminescence resonance energy transfer, isothermal titration calorimetry, and pull-down assays. Results indicate that Endophilin is a high-affinity binding partner of Itch both in vivo and in vitro, with a calculated KD placing this complex among the highest-affinity SH3 domain-mediated interactions reported to date. All of the SH3 domains tested here bind to Itch with a 1:1 stoichiometry, except for β-PIX that binds with a 2:1 stoichiometry. Together, these results indicate that Itch PRR is a versatile binding module that can accommodate several different SH3 domain-containing proteins but has a preference for Endophilin. Interestingly, the catalytic activity of Itch toward different SH3 domain-containing proteins was similar, except for β-PIX that was not readily ubiquitylated even though it could interact with an affinity comparable to those of other substrates tested. PMID:26613292

  3. Tyrosine Nitration within the Proline-Rich Region of Tau in Alzheimer's Disease

    PubMed Central

    Reyes, Juan F.; Fu, Yifan; Vana, Laurel; Kanaan, Nicholas M.; Binder, Lester I.

    2011-01-01

    A substantial body of evidence suggests that nitrative injury contributes to neurodegeneration in Alzheimer's disease (AD) and other neurodegenerative disorders. Previously, we showed in vitro that within the tau protein the N-terminal tyrosine residues (Y18 and Y29) are more susceptible to nitrative modifications than other tyrosine sites (Y197 and Y394). Using site-specific antibodies to nitrated tau at Y18 and Y29, we identified tau nitrated in both glial (Y18) and neuronal (Y29) tau pathologies. In this study, we report the characterization of two novel monoclonal antibodies, Tau-nY197 and Tau-nY394, recognizing tau nitrated at Y197 and Y394, respectively. By Western blot analysis, Tau-nY197 labeled soluble tau and insoluble paired helical filament proteins (PHF-tau) nitrated at Y197 from control and AD brain samples. Tau-nY394 failed to label soluble tau isolated from control or severe AD samples, but labeled insoluble PHF-tau to a limited extent. Immunohistochemical analysis using Tau-nY197 revealed the hallmark tau pathology associated with AD; Tau-nY394 did not detect any pathological lesions characteristic of the disorder. These data suggest that a subset of the hallmark pathological inclusions of AD contain tau nitrated at Y197. However, nitration at Y197 was also identified in soluble tau from all control samples, including those at Braak stage 0, suggesting that nitration at this site in the proline-rich region of tau may have normal biological functions in the human brain. PMID:21514440

  4. Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

    PubMed

    Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

    2006-12-01

    The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD. PMID:17161366

  5. A Linear Surface Epitope in a Proline-Rich Region of ORF3 Product of Genotype 1 Hepatitis E Virus.

    PubMed

    Yang, Yonglin; Lin, Shaoli; Nan, Yuchen; Ma, Zexu; Yang, Liping; Zhang, Yanjin

    2016-01-01

    Hepatitis E virus (HEV) is one of the viral pathogens causing hepatitis in humans. HEV open reading frame 3 (ORF3) encodes a small multifunctional protein (VP13), which is essential for HEV infection. In this study, a linear epitope was identified in a polyproline (PXXP) motif from VP13 of genotype 1 HEV by using a monoclonal antibody. The epitope was detected in enzyme-linked immunosorbent assay (ELISA), immunoblotting and immunofluorescence assays. Epitope mapping showed that the epitope locates in a proline-rich region containing a PXXP motif in amino acid residues 66-75 of VP13. The epitope was also detected in HEV-infected liver cells and reacted with genotype 1-specific antibodies in an HEV-positive human serum sample. The results demonstrated that the epitope in the PXXP motif of the genotype 1 VP13 is linear and surface-oriented, which should facilitate in-depth studies on the viral protein and HEV biology. PMID:27548202

  6. Deletion of the huntingtin proline-rich region does not significantly affect normal huntingtin function in mice

    PubMed Central

    Neveklovska, Michelle; Clabough, Erin B. D.; Steffan, Joan S.; Zeitlin, Scott O.

    2012-01-01

    The N-terminus of Huntingtin, the protein encoded by the Huntington’s disease gene, contains a stretch of polyglutamine residues that is expanded in Huntington’s disease. The polyglutamine stretch is flanked by two conserved protein domains in vertebrates: an N1-17 domain, and a proline-rich region (PRR). The PRR can modulate the structure of the adjacent polyglutamine stretch, and is a binding site for several interacting proteins. To determine the role of the PRR in Huntingtin function, we have generated a knock-in allele of the mouse Huntington’s disease gene homolog that expresses full-length normal huntingtin lacking the PRR. Mice that are homozygous for the huntingtin PRR deletion are born at the normal Mendelian frequency, suggesting that the PRR is not required for essential huntingtin functions during embryonic development. Moreover, adult homozygous mutants did not exhibit any significant differences from wild-type controls in general motor function and motor learning. However, 18 month-old male, but not female, homozygous PRR deletion mutants exhibited deficits in the Morris water task, suggesting that age-dependent spatial learning and memory may be affected in a sex-specific fashion by the huntingtin PRR deletion. PMID:22956985

  7. A Linear Surface Epitope in a Proline-Rich Region of ORF3 Product of Genotype 1 Hepatitis E Virus

    PubMed Central

    Yang, Yonglin; Lin, Shaoli; Nan, Yuchen; Ma, Zexu; Yang, Liping; Zhang, Yanjin

    2016-01-01

    Hepatitis E virus (HEV) is one of the viral pathogens causing hepatitis in humans. HEV open reading frame 3 (ORF3) encodes a small multifunctional protein (VP13), which is essential for HEV infection. In this study, a linear epitope was identified in a polyproline (PXXP) motif from VP13 of genotype 1 HEV by using a monoclonal antibody. The epitope was detected in enzyme-linked immunosorbent assay (ELISA), immunoblotting and immunofluorescence assays. Epitope mapping showed that the epitope locates in a proline-rich region containing a PXXP motif in amino acid residues 66-75 of VP13. The epitope was also detected in HEV-infected liver cells and reacted with genotype 1-specific antibodies in an HEV-positive human serum sample. The results demonstrated that the epitope in the PXXP motif of the genotype 1 VP13 is linear and surface-oriented, which should facilitate in-depth studies on the viral protein and HEV biology. PMID:27548202

  8. Phosphorylation of Calcineurin at a Novel Serine-Proline Rich Region Orchestrates Hyphal Growth and Virulence in Aspergillus fumigatus

    PubMed Central

    Juvvadi, Praveen R.; Gehrke, Christopher; Fortwendel, Jarrod R.; Lamoth, Frédéric; Soderblom, Erik J.; Cook, Erik C.; Hast, Michael A.; Asfaw, Yohannes G.; Moseley, M. Arthur; Creamer, Trevor P.; Steinbach, William J.

    2013-01-01

    The fungus Aspergillus fumigatus is a leading infectious killer in immunocompromised patients. Calcineurin, a calmodulin (CaM)-dependent protein phosphatase comprised of calcineurin A (CnaA) and calcineurin B (CnaB) subunits, localizes at the hyphal tips and septa to direct A. fumigatus invasion and virulence. Here we identified a novel serine-proline rich region (SPRR) located between two conserved CnaA domains, the CnaB-binding helix and the CaM-binding domain, that is evolutionarily conserved and unique to filamentous fungi and also completely absent in human calcineurin. Phosphopeptide enrichment and tandem mass spectrometry revealed the phosphorylation of A. fumigatus CnaA in vivo at four clustered serine residues (S406, S408, S410 and S413) in the SPRR. Mutation of the SPRR serine residues to block phosphorylation led to significant hyphal growth and virulence defects, indicating the requirement of calcineurin phosphorylation at the SPRR for its activity and function. Complementation analyses of the A. fumigatus ΔcnaA strain with cnaA homologs from the pathogenic basidiomycete Cryptococcus neoformans, the pathogenic zygomycete Mucor circinelloides, the closely related filamentous fungi Neurospora crassa, and the plant pathogen Magnaporthe grisea, revealed filamentous fungal-specific phosphorylation of CnaA in the SPRR and SPRR homology-dependent restoration of hyphal growth. Surprisingly, circular dichroism studies revealed that, despite proximity to the CaM-binding domain of CnaA, phosphorylation of the SPRR does not alter protein folding following CaM binding. Furthermore, mutational analyses in the catalytic domain, CnaB-binding helix, and the CaM-binding domains revealed that while the conserved PxIxIT substrate binding motif in CnaA is indispensable for septal localization, CaM is required for its function at the hyphal septum but not for septal localization. We defined an evolutionarily conserved novel mode of calcineurin regulation by phosphorylation

  9. The heptad repeats region is essential for AcMNPV P10 filament formation and not the proline-rich or the C-terminus basic regions

    SciTech Connect

    Dong Chunsheng; Deng Fei; Li Dan; Wang Hualin; Hu Zhihong

    2007-09-01

    Baculovirus P10 protein is a small conserved protein and is expressed as bundles of filaments in the host cell during the late phase of virus infection. So far the published results on the domain responsible for filament structural formation have been contradictory. Electron microscopy revealed that the C-terminus basic region was involved in filament structural formation in the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) [van Oers, M.M., Flipsen, J.T., Reusken, C.B., Sliwinsky, E.L., Vlak, J.M., 1993. Functional domains of the p10 protein of Autographa californica nuclear polyhedorsis virus. J. Gen. Virol. 74, 563-574.]. While in the Helicoverpa armigera nucleopolyhedrovirus (HearNPV), the heptad repeats region but not the C-terminus domain was proven to be responsible for filament formation [Dong, C., Li, D., Long, G., Deng, F., Wang, H., Hu, Z., 2005. Identification of functional domains required for HearNPV P10 filament formation. Virology 338, 112-120.]. In this manuscript, fluorescence confocal microscopy was applied to study AcMNPV P10 filament formation. A set of plasmids containing different P10 structural domains fused with a fluorescent protein were constructed and transfected into Sf-9 cells. The data indicated that the heptad repeats region, but not the proline-rich region or the C-terminus basic region, is essential for AcMNPV P10 filament formation. Co-transfection of P10s tagged with different fluorescent revealed that P10s with defective heptad repeats region could not interact with intact heptad repeats region or even full-length P10s to form filament structure. Within the heptad repeats region, deletion of the three amino acids spacing of AcMNPV P10 appeared to have no significant impact on the formation of filament structures, but the content of the heptad repeats region appeared to play a role in the morphology of the filaments.

  10. Structure-Activity Relationships of the Antimicrobial Peptide Arasin 1 — And Mode of Action Studies of the N-Terminal, Proline-Rich Region

    PubMed Central

    Paulsen, Victoria S.; Blencke, Hans-Matti; Benincasa, Monica; Haug, Tor; Eksteen, Jacobus J.; Styrvold, Olaf B.; Scocchi, Marco; Stensvåg, Klara

    2013-01-01

    Arasin 1 is a 37 amino acid long proline-rich antimicrobial peptide isolated from the spider crab, Hyas araneus. In this work the active region of arasin 1 was identified through structure-activity studies using different peptide fragments derived from the arasin 1 sequence. The pharmacophore was found to be located in the proline/arginine-rich NH2 terminus of the peptide and the fragment arasin 1(1–23) was almost equally active to the full length peptide. Arasin 1 and its active fragment arasin 1(1–23) were shown to be non-toxic to human red blood cells and arasin 1(1–23) was able to bind chitin, a component of fungal cell walls and the crustacean shell. The mode of action of the fully active N-terminal arasin 1(1–23) was explored through killing kinetic and membrane permeabilization studies. At the minimal inhibitory concentration (MIC), arasin 1(1–23) was not bactericidal and had no membrane disruptive effect. In contrast, at concentrations of 5×MIC and above it was bactericidal and interfered with membrane integrity. We conclude that arasin 1(1–23) has a different mode of action than lytic peptides, like cecropin P1. Thus, we suggest a dual mode of action for arasin 1(1–23) involving membrane disruption at peptide concentrations above MIC, and an alternative mechanism of action, possibly involving intracellular targets, at MIC. PMID:23326415

  11. Proline rich motifs as drug targets in immune mediated disorders.

    PubMed

    Srinivasan, Mythily; Dunker, A Keith

    2012-01-01

    The current version of the human immunome network consists of nearly 1400 interactions involving approximately 600 proteins. Intermolecular interactions mediated by proline-rich motifs (PRMs) are observed in many facets of the immune response. The proline-rich regions are known to preferentially adopt a polyproline type II helical conformation, an extended structure that facilitates transient intermolecular interactions such as signal transduction, antigen recognition, cell-cell communication and cytoskeletal organization. The propensity of both the side chain and the backbone carbonyls of the polyproline type II helix to participate in the interface interaction makes it an excellent recognition motif. An advantage of such distinct chemical features is that the interactions can be discriminatory even in the absence of high affinities. Indeed, the immune response is mediated by well-orchestrated low-affinity short-duration intermolecular interactions. The proline-rich regions are predominantly localized in the solvent-exposed regions such as the loops, intrinsically disordered regions, or between domains that constitute the intermolecular interface. Peptide mimics of the PRM have been suggested as potential antagonists of intermolecular interactions. In this paper, we discuss novel PRM-mediated interactions in the human immunome that potentially serve as attractive targets for immunomodulation and drug development for inflammatory and autoimmune pathologies. PMID:22666276

  12. Proline Rich Motifs as Drug Targets in Immune Mediated Disorders

    PubMed Central

    Srinivasan, Mythily; Dunker, A. Keith

    2012-01-01

    The current version of the human immunome network consists of nearly 1400 interactions involving approximately 600 proteins. Intermolecular interactions mediated by proline-rich motifs (PRMs) are observed in many facets of the immune response. The proline-rich regions are known to preferentially adopt a polyproline type II helical conformation, an extended structure that facilitates transient intermolecular interactions such as signal transduction, antigen recognition, cell-cell communication and cytoskeletal organization. The propensity of both the side chain and the backbone carbonyls of the polyproline type II helix to participate in the interface interaction makes it an excellent recognition motif. An advantage of such distinct chemical features is that the interactions can be discriminatory even in the absence of high affinities. Indeed, the immune response is mediated by well-orchestrated low-affinity short-duration intermolecular interactions. The proline-rich regions are predominantly localized in the solvent-exposed regions such as the loops, intrinsically disordered regions, or between domains that constitute the intermolecular interface. Peptide mimics of the PRM have been suggested as potential antagonists of intermolecular interactions. In this paper, we discuss novel PRM-mediated interactions in the human immunome that potentially serve as attractive targets for immunomodulation and drug development for inflammatory and autoimmune pathologies. PMID:22666276

  13. Hypothalamic proline rich polypeptide regulates hematopoiesis.

    PubMed

    Bezirganyan, Kristina B; Davtyan, Tigran K; Galoyan, Armen A

    2010-06-01

    The AGAPEPAEPAQPGVY proline-rich polypeptide (PRP-1) was isolated from neurosecretory granules of the bovine neurohypophysis; it is produced by N. supraopticus and N. paraventricularis. It has been shown that PRP-1 has many potentially beneficial biological effects including immunoregulatory, hematopoietic, antimicrobial and anti-neurodegenerative properties. Here we demonstrated that PRP-1 administration influence on redistribution of monocytes, granulocytes and lymphocytes between bone marrow (BM) and peripheral blood and promotes the influx of granulocytes and monocytes/macrophages from BM into peripheral blood and accumulation of immature granulocyte and monocyte in BM and delayed the maturation of T cells in BM. PRP-1 increased colony-forming cell proliferation in rat cells in vivo. In PRP-treated rat BM, the CFU number at day 4, 7 and 14 was considerably increased in comparison with untreated rats BM and no difference was found at day 21 and day 28. We found that PRP-1 enhances erythroid and myeloid colonies formation in human CD34(+) progenitor cell culture in the presence of different growth factors and down-regulates T cells colony formation and specific surface markers expression during induction of human CD34(+) progenitor cells differentiation into T lymphocytes lineage. We suggested that the hypothalamic PRP-1 possibly represents an endogenous peptide whose primary functions are to regulate neuronal survival and differentiation and hematopoiesis within neurosecretory hypothalamus-bone marrow humoral axis. PMID:20020325

  14. Binding of the proline-rich region of the epithelial Na+ channel to SH3 domains and its association with specific cellular proteins.

    PubMed Central

    McDonald, F J; Welsh, M J

    1995-01-01

    The amiloride-sensitive epithelial Na+ channel (ENaC) is an important component of the Na(+)-reabsorption pathway in many epithelia. The identification of three subunits of ENaC (alpha, beta and gamma), as well as results from a number of functional and biochemical studies, suggests that functional Na+ channels are composed of a complex of proteins. To learn about possible interactions of the channel with other proteins, we studied the alpha-subunit of rat and human ENaC. We found that the proline-rich C-terminal domains of both rat and human alpha-ENaC, expressed as glutathione S-transferase fusion proteins, bound to SH3 domains in vitro. A 116 kDa protein from a human lung adenocarcinoma cell line (H441) was specifically bound by the human alpha-ENaC C-terminal fusion protein and by a shorter 18-amino acid proline-rich peptide derived from the larger fusion protein. The 116 kDa protein was not glycosylated and was not phosphorylated on tyrosine or by cyclic AMP-dependent protein kinase (PKA). A 134 kDa protein which was also bound by the human alpha-ENaC C-terminal fusion protein was a substrate for phosphorylation by PKA. These data suggest that the proline-rich C-terminal tail of alpha-ENaC may interact with other proteins that control its function, regulation or localization. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:8526861

  15. A Synthetic Virus-Like Particle Streptococcal Vaccine Candidate Using B-Cell Epitopes from the Proline-Rich Region of Pneumococcal Surface Protein A

    PubMed Central

    Tamborrini, Marco; Geib, Nina; Marrero-Nodarse, Aniebrys; Jud, Maja; Hauser, Julia; Aho, Celestine; Lamelas, Araceli; Zuniga, Armando; Pluschke, Gerd; Ghasparian, Arin; Robinson, John A.

    2015-01-01

    Alternatives to the well-established capsular polysaccharide-based vaccines against Streptococcus pneumoniae that circumvent limitations arising from limited serotype coverage and the emergence of resistance due to capsule switching (serotype replacement) are being widely pursued. Much attention is now focused on the development of recombinant subunit vaccines based on highly conserved pneumococcal surface proteins and virulence factors. A further step might involve focusing the host humoral immune response onto protective protein epitopes using as immunogens structurally optimized epitope mimetics. One approach to deliver such epitope mimetics to the immune system is through the use of synthetic virus-like particles (SVLPs). SVLPs are made from synthetic coiled-coil lipopeptides that are designed to spontaneously self-assemble into 20–30 nm diameter nanoparticles in aqueous buffer. Multivalent display of epitope mimetics on the surface of SVLPs generates highly immunogenic nanoparticles that elicit strong epitope-specific humoral immune responses without the need for external adjuvants. Here, we set out to demonstrate that this approach can yield vaccine candidates able to elicit a protective immune response, using epitopes derived from the proline-rich region of pneumococcal surface protein A (PspA). These streptococcal SVLP-based vaccine candidates are shown to elicit strong humoral immune responses in mice. Following active immunization and challenge with lethal doses of streptococcus, SVLP-based immunogens are able to elicit significant protection in mice. Furthermore, a mimetic-specific monoclonal antibody is shown to mediate partial protection upon passive immunization. The results show that SVLPs combined with synthetic epitope mimetics may have potential for the development of an effective vaccine against Streptococcus pneumoniae. PMID:26501327

  16. A Synthetic Virus-Like Particle Streptococcal Vaccine Candidate Using B-Cell Epitopes from the Proline-Rich Region of Pneumococcal Surface Protein A.

    PubMed

    Tamborrini, Marco; Geib, Nina; Marrero-Nodarse, Aniebrys; Jud, Maja; Hauser, Julia; Aho, Celestine; Lamelas, Araceli; Zuniga, Armando; Pluschke, Gerd; Ghasparian, Arin; Robinson, John A

    2015-01-01

    Alternatives to the well-established capsular polysaccharide-based vaccines against Streptococcus pneumoniae that circumvent limitations arising from limited serotype coverage and the emergence of resistance due to capsule switching (serotype replacement) are being widely pursued. Much attention is now focused on the development of recombinant subunit vaccines based on highly conserved pneumococcal surface proteins and virulence factors. A further step might involve focusing the host humoral immune response onto protective protein epitopes using as immunogens structurally optimized epitope mimetics. One approach to deliver such epitope mimetics to the immune system is through the use of synthetic virus-like particles (SVLPs). SVLPs are made from synthetic coiled-coil lipopeptides that are designed to spontaneously self-assemble into 20-30 nm diameter nanoparticles in aqueous buffer. Multivalent display of epitope mimetics on the surface of SVLPs generates highly immunogenic nanoparticles that elicit strong epitope-specific humoral immune responses without the need for external adjuvants. Here, we set out to demonstrate that this approach can yield vaccine candidates able to elicit a protective immune response, using epitopes derived from the proline-rich region of pneumococcal surface protein A (PspA). These streptococcal SVLP-based vaccine candidates are shown to elicit strong humoral immune responses in mice. Following active immunization and challenge with lethal doses of streptococcus, SVLP-based immunogens are able to elicit significant protection in mice. Furthermore, a mimetic-specific monoclonal antibody is shown to mediate partial protection upon passive immunization. The results show that SVLPs combined with synthetic epitope mimetics may have potential for the development of an effective vaccine against Streptococcus pneumoniae. PMID:26501327

  17. The proline-rich focal adhesion and microfilament protein VASP is a ligand for profilins.

    PubMed Central

    Reinhard, M; Giehl, K; Abel, K; Haffner, C; Jarchau, T; Hoppe, V; Jockusch, B M; Walter, U

    1995-01-01

    Profilins are small proteins that form complexes with G-actin and phosphoinositides and are therefore considered to link the microfilament system to signal transduction pathways. In addition, they bind to poly-L-proline, but the biological significance of this interaction is not yet known. The recent molecular cloning of the vasodilator-stimulated phosphoprotein (VASP), an established in vivo substrate of cAMP- and cGMP-dependent protein kinases, revealed the presence of a proline-rich domain which prompted us to investigate a possible interaction with profilins. VASP is a microfilament and focal adhesion associated protein which is also concentrated in highly dynamic regions of the cell cortex. Here, we demonstrate that VASP is a natural proline-rich profilin ligand. Human platelet VASP bound directly to purified profilins from human platelets, calf thymus and birch pollen. Moreover, VASP and a novel protein were specifically extracted from total cell lysates by profilin affinity chromatography and subsequently eluted either with poly-L-proline or a peptide corresponding to a proline-rich VASP motif. Finally, the subcellular distributions of VASP and profilin suggest that both proteins also interact within living cells. Our data support the hypothesis that profilin and VASP act in concert to convey signal transduction to actin filament formation. Images PMID:7737110

  18. Proline rich-oligopeptides: diverse mechanisms for antihypertensive action.

    PubMed

    Morais, Katia L P; Ianzer, Danielle; Miranda, José Rodolfo R; Melo, Robson L; Guerreiro, Juliano R; Santos, Robson A S; Ulrich, Henning; Lameu, Claudiana

    2013-10-01

    Bradykinin-potentiating peptides from Bothrops jararaca (Bj) discovered in the early 1960s, were the first natural inhibitors of the angiotensin-converting enzyme (ACE). These peptides belong to a large family of snake venom proline-rich oligopeptides (PROs). One of these peptides, Bj-PRO-9a, was essential for defining ACE as effective drug target and development of captopril, an active site-directed inhibitor of ACE used worldwide for the treatment of human arterial hypertension. Recent experimental evidences demonstrated that cardiovascular effects exerted by different Bj-PROs are due to distinct mechanisms besides of ACE inhibition. In the present work, we have investigated the cardiovascular actions of four Bj-PROs, namely Bj-PRO-9a, -11e, -12b and -13a. Bj-PRO-9a acts upon ACE and BK activities to promote blood pressure reduction. Although the others Bj-PROs are also able to inhibit the ACE activity and to potentiate the BK effects, our results indicate that antihypertensive effect evoked by them involve new mechanisms. Bj-PRO-11e and Bj-PRO-12b involves induction of [Ca(2+)]i transients by so far unknown receptor proteins. Moreover, we have suggested argininosuccinate synthetase and M3 muscarinic receptor as targets for cardiovascular effects elicited by Bj-PRO-13a. In summary, the herein reported results provide evidence that Bj-PRO-mediated effects are not restricted to ACE inhibition or potentiation of BK-induced effects and suggest different actions for each peptide for promoting arterial pressure reduction. The present study reveals the complexity of the effects exerted by Bj-PROs for cardiovascular control, opening avenues for the better understanding of blood pressure regulation and for the development of novel therapeutic approaches. PMID:23933300

  19. Alternatively spliced proline-rich cassettes link WNK1 to aldosterone action

    PubMed Central

    Roy, Ankita; Al-Qusairi, Lama; Donnelly, Bridget F.; Ronzaud, Caroline; Marciszyn, Allison L.; Gong, Fan; Chang, Y.P. Christy; Butterworth, Michael B.; Pastor-Soler, Núria M.; Hallows, Kenneth R.; Staub, Olivier; Subramanya, Arohan R.

    2015-01-01

    The thiazide-sensitive NaCl cotransporter (NCC) is important for renal salt handling and blood-pressure homeostasis. The canonical NCC-activating pathway consists of With-No-Lysine (WNK) kinases and their downstream effector kinases SPAK and OSR1, which phosphorylate NCC directly. The upstream mechanisms that connect physiological stimuli to this system remain obscure. Here, we have shown that aldosterone activates SPAK/OSR1 via WNK1. We identified 2 alternatively spliced exons embedded within a proline-rich region of WNK1 that contain PY motifs, which bind the E3 ubiquitin ligase NEDD4-2. PY motif–containing WNK1 isoforms were expressed in human kidney, and these isoforms were efficiently degraded by the ubiquitin proteasome system, an effect reversed by the aldosterone-induced kinase SGK1. In gene-edited cells, WNK1 deficiency negated regulatory effects of NEDD4-2 and SGK1 on NCC, suggesting that WNK1 mediates aldosterone-dependent activity of the WNK/SPAK/OSR1 pathway. Aldosterone infusion increased proline-rich WNK1 isoform abundance in WT mice but did not alter WNK1 abundance in hypertensive Nedd4-2 KO mice, which exhibit high baseline WNK1 and SPAK/OSR1 activity toward NCC. Conversely, hypotensive Sgk1 KO mice exhibited low WNK1 expression and activity. Together, our findings indicate that the proline-rich exons are modular cassettes that convert WNK1 into a NEDD4-2 substrate, thereby linking aldosterone and other NEDD4-2–suppressing antinatriuretic hormones to NCC phosphorylation status. PMID:26241057

  20. The 7-amino-acid site in the proline-rich region of the N-terminal domain of p53 is involved in the interaction with FAK and is critical for p53 functioning.

    PubMed

    Golubovskaya, Vita M; Finch, Richard; Zheng, Min; Kurenova, Elena V; Cance, William G

    2008-04-01

    It is known that p53 alterations are commonly found in tumour cells. Another marker of tumorigenesis is FAK (focal adhesion kinase), a non-receptor kinase that is overexpressed in many types of tumours. Previously we determined that the N-terminal domain of FAK physically interacted with the N-terminal domain of p53. In the present study, using phage display, sitedirected mutagenesis, pulldown and immunoprecipitation assays we localized the site of FAK binding to a 7-amino-acid region(amino acids 65-71) in the N-terminal proline-rich domain of human p53. Mutation of the binding site in p53 reversed the suppressive effect of FAK on p53-mediated transactivation ofp21, BAX (Bcl-2-associated X protein) and Mdm2 (murine double minute 2) promoters. In addition, to functionally test this p53 site, we conjugated p53 peptides [wild-type (containing the wild-type binding site) and mutant (with a mutated 7-aminoacid binding site)] to a TAT peptide sequence to penetrate the cells, and demonstrated that the wild-type p53 peptide disrupted binding of FAK and p53 proteins and significantly inhibited cell viability of HCT116 p53+/+ cells compared with the control mutant peptide and HCT116 p53-/- cells. Furthermore, the TAT-p53 peptide decreased the viability of MCF-7 cells, whereas the mutant peptide did not cause this effect. Normal fibroblast p53+/+ and p53-/- MEF (murine embryonic fibroblast) cells and breast MCF10A cells were not sensitive to p53 peptide. Thus, for the first time, we have identified the binding site of the p53 andFAK interaction and have demonstrated that mutating this site and targeting the site with peptides affects p53 functioning and viability in the cells. PMID:18215142

  1. Susceptibility to Dental Caries and the Salivary Proline-Rich Proteins

    PubMed Central

    Levine, Martin

    2011-01-01

    Early childhood caries affects 28% of children aged 2–6 in the US and is not decreasing. There is a well-recognized need to identify susceptible children at birth. Caries-free adults neutralize bacterial acids in dental biofilms better than adults with severe caries. Saliva contains acidic and basic proline-rich proteins (PRPs) which attach to oral streptococci. The PRPs are encoded within a small region of chromosome 12. An acidic PRP allele (Db) protects Caucasian children from caries but is more common in African Americans. Some basic PRP allelic phenotypes have a three-fold greater frequency in caries-free adults than in those with severe caries. Early childhood caries may associate with an absence of certain basic PRP alleles which bind oral streptococci, neutralize biofilm acids, and are in linkage disequilibrium with Db in Caucasians. The encoding of basic PRP alleles is updated and a new technology for genotyping them is described. PMID:22190937

  2. Susceptibility to dental caries and the salivary proline-rich proteins.

    PubMed

    Levine, Martin

    2011-01-01

    Early childhood caries affects 28% of children aged 2-6 in the US and is not decreasing. There is a well-recognized need to identify susceptible children at birth. Caries-free adults neutralize bacterial acids in dental biofilms better than adults with severe caries. Saliva contains acidic and basic proline-rich proteins (PRPs) which attach to oral streptococci. The PRPs are encoded within a small region of chromosome 12. An acidic PRP allele (Db) protects Caucasian children from caries but is more common in African Americans. Some basic PRP allelic phenotypes have a three-fold greater frequency in caries-free adults than in those with severe caries. Early childhood caries may associate with an absence of certain basic PRP alleles which bind oral streptococci, neutralize biofilm acids, and are in linkage disequilibrium with Db in Caucasians. The encoding of basic PRP alleles is updated and a new technology for genotyping them is described. PMID:22190937

  3. The Binding of Syndapin SH3 Domain to Dynamin Proline-rich Domain Involves Short and Long Distance Elements.

    PubMed

    Luo, Lin; Xue, Jing; Kwan, Ann; Gamsjaeger, Roland; Wielens, Jerome; von Kleist, Lisa; Cubeddu, Liza; Guo, Zhong; Stow, Jennifer L; Parker, Michael W; Mackay, Joel P; Robinson, Phillip J

    2016-04-29

    Dynamin is a GTPase that mediates vesicle fission during synaptic vesicle endocytosis. Its long C-terminal proline-rich domain contains 13 PXXP motifs, which orchestrate its interactions with multiple proteins. The SH3 domains of syndapin and endophilin bind the PXXP motifs called Site 2 and 3 (Pro-786-Pro-793) at the N-terminal end of the proline-rich domain, whereas the amphiphysin SH3 binds Site 9 (Pro-833-Pro-836) toward the C-terminal end. In some proteins, SH3/peptide interactions also involve short distance elements, which are 5-15 amino acid extensions flanking the central PXXP motif for high affinity binding. Here we found two previously unrecognized elements in the central and the C-terminal end of the dynamin proline-rich domain that account for a significant increase in syndapin binding affinity compared with a previously reported Site 2 and Site 3 PXXP peptide alone. The first new element (Gly-807-Gly-811) is short distance element on the C-terminal side of Site 2 PXXP, which might contact a groove identified under the RT loop of the SH3 domain. The second element (Arg-838-Pro-844) is located about 50 amino acids downstream of Site 2. These two elements provide additional specificity to the syndapin SH3 domain outside of the well described polyproline-binding groove. Thus, the dynamin/syndapin interaction is mediated via a network of multiple contacts outside the core PXXP motif over a previously unrecognized extended region of the proline-rich domain. To our knowledge this is the first example among known SH3 interactions to involve spatially separated and extended long-range elements that combine to provide a higher affinity interaction. PMID:26893375

  4. The Role of Histidine-Proline-Rich Glycoprotein as Zinc Chaperone for Skeletal Muscle AMP Deaminase

    PubMed Central

    Ranieri-Raggi, Maria; Moir, Arthur J. G.; Raggi, Antonio

    2014-01-01

    Metallochaperones function as intracellular shuttles for metal ions. At present, no evidence for the existence of any eukaryotic zinc-chaperone has been provided although metallochaperones could be critical for the physiological functions of Zn2+ metalloenzymes. We propose that the complex formed in skeletal muscle by the Zn2+ metalloenzyme AMP deaminase (AMPD) and the metal binding protein histidine-proline-rich glycoprotein (HPRG) acts in this manner. HPRG is a major plasma protein. Recent investigations have reported that skeletal muscle cells do not synthesize HPRG but instead actively internalize plasma HPRG. X-ray absorption spectroscopy (XAS) performed on fresh preparations of rabbit skeletal muscle AMPD provided evidence for a dinuclear zinc site in the enzyme compatible with a (μ-aqua)(μ-carboxylato)dizinc(II) core with two histidine residues at each metal site. XAS on HPRG isolated from the AMPD complex showed that zinc is bound to the protein in a dinuclear cluster where each Zn2+ ion is coordinated by three histidine and one heavier ligand, likely sulfur from cysteine. We describe the existence in mammalian HPRG of a specific zinc binding site distinct from the His-Pro-rich region. The participation of HPRG in the assembly and maintenance of skeletal muscle AMPD by acting as a zinc chaperone is also demonstrated. PMID:24970226

  5. Proteolytic activity of Escherichia coli oligopeptidase B against proline-rich antimicrobial peptides.

    PubMed

    Mattiuzzo, Maura; De Gobba, Cristian; Runti, Giulia; Mardirossian, Mario; Bandiera, Antonella; Gennaro, Renato; Scocchi, Marco

    2014-02-28

    Oligopeptidase B (OpdB) is a serine peptidase widespread among bacteria and protozoa that has emerged as a virulence factor despite its function has not yet been precisely established. By using an OpdB-overexpressing Escherichia coli strain, we found that the overexpressed peptidase makes the bacterial cells specifically less susceptible to several proline-rich antimicrobial peptides known to penetrate into the bacterial cytosol, and that its level of activity directly correlates with the degree of resistance. We established that E. coli OpdB can efficiently hydrolyze in vitro cationic antimicrobial peptides up to 30 residues in length, even though they contained several prolines, shortening them to inactive fragments. Two consecutive basic residues are a preferred cleavage site for the peptidase. In the case of a single basic residue, there is no cleavage if proline residues are present in the P1 and P2 positions. These results also indicate that cytosolic peptidases may cause resistance to antimicrobial peptides that have an intracellular mechanism of action, such as the proline-rich peptides, and may contribute to define the substrate specificity of the E. coli OpdB. PMID:24225368

  6. Coordinated activation of the Rac-GAP β2-chimaerin by an atypical proline-rich domain and diacylglycerol.

    PubMed

    Gutierrez-Uzquiza, Alvaro; Colon-Gonzalez, Francheska; Leonard, Thomas A; Canagarajah, Bertram J; Wang, HongBin; Mayer, Bruce J; Hurley, James H; Kazanietz, Marcelo G

    2013-01-01

    Chimaerins, a family of GTPase activating proteins for the small G-protein Rac, have been implicated in development, neuritogenesis and cancer. These Rac-GTPase activating proteins are regulated by the lipid second messenger diacylglycerol generated by tyrosine kinases such as the epidermal growth factor receptor. Here we identify an atypical proline-rich motif in chimaerins that binds to the adaptor protein Nck1. Unlike most Nck1 partners, chimaerins bind to the third SH3 domain of Nck1. This association is mediated by electrostatic interactions of basic residues within the Pro-rich motif with acidic clusters in the SH3 domain. Epidermal growth factor promotes the binding of β2-chimaerin to Nck1 in the cell periphery in a diacylglycerol-dependent manner. Moreover, β2-chimaerin translocation to the plasma membrane and its peripheral association with Rac1 requires Nck1. Our studies underscore a coordinated mechanism for β2-chimaerin activation that involves lipid interactions via the C1 domain and protein-protein interactions via the N-terminal proline-rich region. PMID:23673634

  7. Proline-rich peptides: multifunctional bioactive molecules as new potential therapeutic drugs.

    PubMed

    Vitali, Alberto

    2015-01-01

    Proline-rich peptides (PRPs) include a large and heterogeneous group of small-medium sized peptides characterized by the presence of proline residues often constituting peculiar sequences. This feature confers them a typical structure that determines the various biological functions endowed by these molecules. In particular the left-handed-polyproline-II helix is essential for the expression of the antimicrobial, immunomodulatory, antioxidant properties and to finely modulate protein-protein interactions, thus playing crucial roles in many cell signal transduction pathways. These peptides are widely diffuse in the animal kingdom and in humans, where they are present in many tissues and biological fluids. This review highlights the most relevant biological properties of these peptides, focusing on the potential therapeutic role that the PRPs may play as a promising source of new peptidebased novel drugs. PMID:25692951

  8. Post-Translational Modification and Secretion of Azelaic Acid Induced 1 (AZI1), a Hybrid Proline-Rich Protein from Arabidopsis

    PubMed Central

    Pitzschke, Andrea; Xue, Hui; Persak, Helene; Datta, Sneha; Seifert, Georg J.

    2016-01-01

    Arabidopsis EARLI-type hybrid proline-rich proteins (HyPRPs) consist of a putative N-terminal secretion signal, a proline-rich domain (PRD), and a characteristic eight-cysteine-motif (8-CM). They have been implicated in biotic and abiotic stress responses. AZI1 is required for systemic acquired resistance and it has recently been identified as a target of the stress-induced mitogen-activated protein kinase MPK3. AZI1 gel migration properties strongly indicate AZI1 to undergo major post-translational modifications. These occur in a stress-independent manner and are unrelated to phosphorylation by MAPKs. As revealed by transient expression of AZI1 in Nicotiana benthamiana and Tropaeolum majus, the Arabidopsis protein is similarly modified in heterologous plant species. Proline-rich regions, resembling arabinogalactan proteins point to a possible proline hydroxylation and subsequent O-glycosylation of AZI1. Consistently, inhibition of prolyl hydroxylase reduces its apparent protein size. AZI1 secretion was examined using Arabidopsis protoplasts and seedling exudates. Employing Agrobacterium-mediated leaf infiltration of N. benthamiana, we attempted to assess long-distance movement of AZI1. In summary, the data point to AZI1 being a partially secreted protein and a likely new member of the group of hydroxyproline-rich glycoproteins. Its dual location suggests AZI1 to exert both intra- and extracellular functions. PMID:26771603

  9. Proline-rich sequences that bind to Src homology 3 domains with individual specificities.

    PubMed Central

    Alexandropoulos, K; Cheng, G; Baltimore, D

    1995-01-01

    To study the binding specificity of Src homology 3 (SH3) domains, we have screened a mouse embryonic expression library for peptide fragments that interact with them. Several clones were identified that express fragments of proteins which, through proline-rich binding sites, exhibit differential binding specificity to various SH3 domains. Src-SH3-specific binding uses a sequence of 7 aa of the consensus RPLPXXP, in which the N-terminal arginine is very important. The SH3 domains of the Src-related kinases Fyn, Lyn, and Hck bind to this sequence with the same affinity as that of the Src SH3. In contrast, a quite different proline-rich sequence from the Btk protein kinase binds to the Fyn, Lyn, and Hck SH3 domains, but not to the Src SH3. Specific binding of the Abl SH3 requires a longer, more proline-rich sequence but no arginine. One clone that binds to both Src and Abl SH3 domains through a common site exhibits reversed binding orientation, in that an arginine indispensable for binding to all tested SH3 domains occurs at the C terminus. Another clone contains overlapping yet distinct Src and Abl SH3 binding sites. Binding to the SH3 domains is mediated by a common PXXP amino acid sequence motif present on all ligands, and specificity comes about from other interactions, often ones involving arginine. The rules governing in vivo usage of particular sites by particular SH3 domains are not clear, but one binding orientation may be more specific than another. Images Fig. 1 Fig. 2 Fig. 3 PMID:7536925

  10. [Rheological properties of human bronchial secretions: demonstration of proline-rich polypeptides and their role (author's transl)].

    PubMed

    Bailleul, V; Richet, C; Hayem, A; Degand, P

    1977-01-17

    Human bronchial secretions were examined for chemical components and rheological properties. Proline-rich polypeptides (PRP) obtained by ultrasonic treatment and by contact with a cationic resin (AG 50WX2) were purified by gel-filtration chromatography and high-voltage electrophoresis. The chemical composition of these components allowed a classification according to their proline, glycine, glutamic acid and lysine contents. Rheological experiments suggest a biological role for the PRP in the fibrillar structure of sputum. PMID:12892

  11. Identification of a Novel Proline-Rich Antimicrobial Peptide from Brassica napus.

    PubMed

    Cao, Huihui; Ke, Tao; Liu, Renhu; Yu, Jingyin; Dong, Caihua; Cheng, Mingxing; Huang, Junyan; Liu, Shengyi

    2015-01-01

    Proline-rich antimicrobial peptides (PR-AMPs) are a group of cationic host defense peptides that are characterized by a high content of proline residues. Up to now, they have been reported in some insects, vertebrate and invertebrate animals, but are not found in plants. In this study, we performed an in silico screening of antimicrobial peptides, which led to discovery of a Brassica napus gene encoding a novel PR-AMP. This gene encodes a 35-amino acid peptide with 13 proline residues, designated BnPRP1. BnPRP1 has 40.5% identity with a known proline-rich antimicrobial peptide SP-B from the pig. BnPRP1 was artificially synthetized and cloned into the prokaryotic expression vector pET30a/His-EDDIE-GFP. Recombinant BnPRP1 was produced in Escherichia coli and has a predicted molecular mass of 3.8 kDa. Analysis of its activity demonstrated that BnPRP1 exhibited strong antimicrobial activity against Gram-positive bacterium, Gram-negative bacterium, yeast and also had strong antifungal activity against several pathogenic fungi, such as Sclerotinia sclerotiorum, Mucor sp., Magnaporthe oryzae and Botrytis cinerea. Circular dichroism (CD) revealed the main secondary structure of BnPRP1 was the random coil. BnPRP1 gene expression detected by qRT-PCR is responsive to pathogen inoculation. At 48 hours after S. sclerotiorum inoculation, the expression of BnPRP1 increased significantly in the susceptible lines while slight decrease occurred in resistant lines. These suggested that BnPRP1 might play a role in the plant defense response against S. sclerotiorum. BnPRP1 isolated from B. napus was the first PR-AMP member that was characterized in plants, and its homology sequences were found in some other Brassicaceae plants by the genome sequences analysis. Compared with the known PR-AMPs, BnPRP1 has the different primary sequences and antimicrobial activity. Above all, this study gives a chance to cast a new light on further understanding about the AMPs' mechanism and application

  12. Identification of a Novel Proline-Rich Antimicrobial Peptide from Brassica napus

    PubMed Central

    Liu, Renhu; Yu, Jingyin; Dong, Caihua; Cheng, Mingxing; Huang, Junyan; Liu, Shengyi

    2015-01-01

    Proline-rich antimicrobial peptides (PR-AMPs) are a group of cationic host defense peptides that are characterized by a high content of proline residues. Up to now, they have been reported in some insects, vertebrate and invertebrate animals, but are not found in plants. In this study, we performed an in silico screening of antimicrobial peptides, which led to discovery of a Brassica napus gene encoding a novel PR-AMP. This gene encodes a 35-amino acid peptide with 13 proline residues, designated BnPRP1. BnPRP1 has 40.5% identity with a known proline-rich antimicrobial peptide SP-B from the pig. BnPRP1 was artificially synthetized and cloned into the prokaryotic expression vector pET30a/His-EDDIE-GFP. Recombinant BnPRP1 was produced in Escherichia coli and has a predicted molecular mass of 3.8 kDa. Analysis of its activity demonstrated that BnPRP1 exhibited strong antimicrobial activity against Gram-positive bacterium, Gram-negative bacterium, yeast and also had strong antifungal activity against several pathogenic fungi, such as Sclerotinia sclerotiorum, Mucor sp., Magnaporthe oryzae and Botrytis cinerea. Circular dichroism (CD) revealed the main secondary structure of BnPRP1 was the random coil. BnPRP1 gene expression detected by qRT-PCR is responsive to pathogen inoculation. At 48 hours after S. sclerotiorum inoculation, the expression of BnPRP1 increased significantly in the susceptible lines while slight decrease occurred in resistant lines. These suggested that BnPRP1 might play a role in the plant defense response against S. sclerotiorum. BnPRP1 isolated from B. napus was the first PR-AMP member that was characterized in plants, and its homology sequences were found in some other Brassicaceae plants by the genome sequences analysis. Compared with the known PR-AMPs, BnPRP1 has the different primary sequences and antimicrobial activity. Above all, this study gives a chance to cast a new light on further understanding about the AMPs’ mechanism and application

  13. Cotton Effect in Copper-Proline Complexes in the Visible Region

    ERIC Educational Resources Information Center

    Volkov, Victor; Pfister, Rolf

    2005-01-01

    The electronic properties of Cu(II) complex with proline are considered to demonstrate the Cotton effect in the visible region. A series of experiments in optical rotatory dispersion spectroscopy with free D- and L-proline and their complexes with the Cu(II) ion in aqueous solution is suggested.

  14. RNAi-based functional elucidation of PtrPRP, a gene encoding a hybrid proline rich protein, in cold tolerance of Poncirus trifoliata

    PubMed Central

    Peng, Ting; Jia, Mao-Mao; Liu, Ji-Hong

    2015-01-01

    Hybrid proline-rich proteins (HyPRPs) have been suggested to play important roles in various plant development and stress response. In this study, we report the cloning and functional analysis of PtrPRP, a HyPRP-encoding gene of Poncirus trifoliata. PtrPRP contains 176 amino acids, among which 21% are proline residues, and has an 8-cysteine motif (8 CM) domain at the C terminal, a signal peptide and a proline-rich region at the N terminal. PtrPRP is constitutively expressed in root, stem and leaf, with the highest expression levels in leaf. It was progressively induced by cold, but transiently upregulated by salt and ABA. Transgenic P. trifoliata plants with knock-down PtrPRP by RNA interference (RNAi) were generated to investigate the role of PtrPRP in cold tolerance. When challenged by low temperature, the PtrPRP-RNAi plants displayed more sensitive performance compared with wild type (WT), as shown by higher electrolyte leakage and malondialdehyde content. In addition, the RNAi lines accumulated more reactive oxygen species (ROS) and lower levels of proline relative to WT. These results suggested that PtrPRP might be positively involved in cold tolerance by maintaining membrane integrity and ROS homeostasis. PMID:26483822

  15. RNAi-based functional elucidation of PtrPRP, a gene encoding a hybrid proline rich protein, in cold tolerance of Poncirus trifoliata.

    PubMed

    Peng, Ting; Jia, Mao-Mao; Liu, Ji-Hong

    2015-01-01

    Hybrid proline-rich proteins (HyPRPs) have been suggested to play important roles in various plant development and stress response. In this study, we report the cloning and functional analysis of PtrPRP, a HyPRP-encoding gene of Poncirus trifoliata. PtrPRP contains 176 amino acids, among which 21% are proline residues, and has an 8-cysteine motif (8 CM) domain at the C terminal, a signal peptide and a proline-rich region at the N terminal. PtrPRP is constitutively expressed in root, stem and leaf, with the highest expression levels in leaf. It was progressively induced by cold, but transiently upregulated by salt and ABA. Transgenic P. trifoliata plants with knock-down PtrPRP by RNA interference (RNAi) were generated to investigate the role of PtrPRP in cold tolerance. When challenged by low temperature, the PtrPRP-RNAi plants displayed more sensitive performance compared with wild type (WT), as shown by higher electrolyte leakage and malondialdehyde content. In addition, the RNAi lines accumulated more reactive oxygen species (ROS) and lower levels of proline relative to WT. These results suggested that PtrPRP might be positively involved in cold tolerance by maintaining membrane integrity and ROS homeostasis. PMID:26483822

  16. A modular toolkit to inhibit proline-rich motif–mediated protein–protein interactions

    PubMed Central

    Opitz, Robert; Müller, Matthias; Reuter, Cédric; Barone, Matthias; Soicke, Arne; Roske, Yvette; Piotukh, Kirill; Huy, Peter; Beerbaum, Monika; Wiesner, Burkhard; Beyermann, Michael; Schmieder, Peter; Freund, Christian; Volkmer, Rudolf; Oschkinat, Hartmut; Schmalz, Hans-Günther; Kühne, Ronald

    2015-01-01

    Small-molecule competitors of protein–protein interactions are urgently needed for functional analysis of large-scale genomics and proteomics data. Particularly abundant, yet so far undruggable, targets include domains specialized in recognizing proline-rich segments, including Src-homology 3 (SH3), WW, GYF, and Drosophila enabled (Ena)/vasodilator-stimulated phosphoprotein (VASP) homology 1 (EVH1) domains. Here, we present a modular strategy to obtain an extendable toolkit of chemical fragments (ProMs) designed to replace pairs of conserved prolines in recognition motifs. As proof-of-principle, we developed a small, selective, peptidomimetic inhibitor of Ena/VASP EVH1 domain interactions. Highly invasive MDA MB 231 breast-cancer cells treated with this ligand showed displacement of VASP from focal adhesions, as well as from the front of lamellipodia, and strongly reduced cell invasion. General applicability of our strategy is illustrated by the design of an ErbB4-derived ligand containing two ProM-1 fragments, targeting the yes-associated protein 1 (YAP1)-WW domain with a fivefold higher affinity. PMID:25848013

  17. Conformational change of Sos-derived proline-rich peptide upon binding Grb2 N-terminal SH3 domain probed by NMR

    NASA Astrophysics Data System (ADS)

    Ogura, Kenji; Okamura, Hideyasu

    2013-10-01

    Growth factor receptor-bound protein 2 (Grb2) is a small adapter protein composed of a single SH2 domain flanked by two SH3 domains. The N-terminal SH3 (nSH3) domain of Grb2 binds a proline-rich region present in the guanine nucleotide releasing factor, son of sevenless (Sos). Using NMR relaxation dispersion and chemical shift analysis methods, we investigated the conformational change of the Sos-derived proline-rich peptide during the transition between the free and Grb2 nSH3-bound states. The chemical shift analysis revealed that the peptide does not present a fully random conformation but has a relatively rigid structure. The relaxation dispersion analysis detected conformational exchange of several residues of the peptide upon binding to Grb2 nSH3.

  18. Conformational change of Sos-derived proline-rich peptide upon binding Grb2 N-terminal SH3 domain probed by NMR.

    PubMed

    Ogura, Kenji; Okamura, Hideyasu

    2013-01-01

    Growth factor receptor-bound protein 2 (Grb2) is a small adapter protein composed of a single SH2 domain flanked by two SH3 domains. The N-terminal SH3 (nSH3) domain of Grb2 binds a proline-rich region present in the guanine nucleotide releasing factor, son of sevenless (Sos). Using NMR relaxation dispersion and chemical shift analysis methods, we investigated the conformational change of the Sos-derived proline-rich peptide during the transition between the free and Grb2 nSH3-bound states. The chemical shift analysis revealed that the peptide does not present a fully random conformation but has a relatively rigid structure. The relaxation dispersion analysis detected conformational exchange of several residues of the peptide upon binding to Grb2 nSH3. PMID:24105423

  19. The involvement of proline-rich protein Mus musculus predicted gene 4736 in ocular surface functions

    PubMed Central

    Qi, Xia; Ren, Sheng-Wei; Zhang, Feng; Wang, Yi-Qiang

    2016-01-01

    AIM To research the two homologous predicted proline-rich protein genes, Mus musculus predicted gene 4736 (MP4) and proline-rich protein BstNI subfamily 1 (Prb1) which were significantly upregulated in cultured corneal organs when encountering fungal pathogen preparations. This study was to confirm the expression and potential functions of these two genes in ocular surface. METHODS A Pseudomonas aeruginosa keratitis model was established in Balb/c mice. One day post infection, mRNA level of MP4 was measured using real-time polymerase chain reaction (PCR), and MP4 protein detected by immunohistochemistry (IHC) or Western blot using a customized polyclonal anti-MP4 antibody preparation. Lacrimal glands from normal mice were also subjected to IHC staining for MP4. An online bioinformatics program, BioGPS, was utilized to screen public data to determine other potential locations of MP4. RESULTS One day after keratitis induction, MP4 was upregulated in the corneas at both mRNA level as measured using real-time PCR and protein levels as measured using Western blot and IHC. BioGPS analysis of public data suggested that the MP4 gene was most abundantly expressed in the lacrimal glands, and IHC revealed that normal murine lacrimal glands were positive for MP4 staining. CONCLUSION MP4 and Prb1 are closely related with the physiology and pathological processes of the ocular surface. Considering the significance of ocular surface abnormalities like dry eye, we propose that MP4 and Prb1 contribute to homeostasis of ocular surface, and deserve more extensive functional and disease correlation studies. PMID:27588265

  20. A Novel Vasoactive Proline-Rich Oligopeptide from the Skin Secretion of the Frog Brachycephalus ephippium.

    PubMed

    Arcanjo, Daniel Dias Rufino; Vasconcelos, Andreanne Gomes; Comerma-Steffensen, Simón Gabriel; Jesus, Joilson Ramos; Silva, Luciano Paulino; Pires Júnior, Osmindo Rodrigues; Costa-Neto, Claudio Miguel; Oliveira, Eduardo Brandt; Migliolo, Ludovico; Franco, Octávio Luiz; Restini, Carolina Baraldi Araújo; Paulo, Michele; Bendhack, Lusiane Maria; Bemquerer, Marcelo Porto; Oliveira, Aldeidia Pereira; Simonsen, Ulf; Leite, José Roberto de Souza de Almeida

    2015-01-01

    Proline-rich oligopeptides (PROs) are a large family which comprises the bradykinin-potentiating peptides (BPPs). They inhibit the activity of the angiotensin I-converting enzyme (ACE) and have a typical pyroglutamyl (Pyr)/proline-rich structure at the N- and C-terminus, respectively. Furthermore, PROs decrease blood pressure in animals. In the present study, the isolation and biological characterization of a novel vasoactive BPP isolated from the skin secretion of the frog Brachycephalus ephippium is described. This new PRO, termed BPP-Brachy, has the primary structure WPPPKVSP and the amidated form termed BPP-BrachyNH2 inhibits efficiently ACE in rat serum. In silico molecular modeling and docking studies suggest that BPP-BrachyNH2 is capable of forming a hydrogen bond network as well as multiple van der Waals interactions with the rat ACE, which blocks the access of the substrate to the C-domain active site. Moreover, in rat thoracic aorta BPP-BrachyNH2 induces potent endothelium-dependent vasodilatation with similar magnitude as captopril. In DAF-FM DA-loaded aortic cross sections examined by confocal microscopy, BPP-BrachyNH2 was found to increase the release of nitric oxide (NO). Moreover, BPP-BrachyNH2 was devoid of toxicity in endothelial and smooth muscle cell cultures. In conclusion, the peptide BPP-BrachyNH2 has a novel sequence being the first BPP isolated from the skin secretion of the Brachycephalidae family. This opens for exploring amphibians as a source of new biomolecules. The BPP-BrachyNH2 is devoid of cytotoxicity and elicits endothelium-dependent vasodilatation mediated by NO. These findings open for the possibility of potential application of these peptides in the treatment of endothelial dysfunction and cardiovascular diseases. PMID:26661890

  1. A Novel Vasoactive Proline-Rich Oligopeptide from the Skin Secretion of the Frog Brachycephalus ephippium

    PubMed Central

    Arcanjo, Daniel Dias Rufino; Vasconcelos, Andreanne Gomes; Comerma-Steffensen, Simón Gabriel; Jesus, Joilson Ramos; Silva, Luciano Paulino; Pires, Osmindo Rodrigues; Costa-Neto, Claudio Miguel; Oliveira, Eduardo Brandt; Migliolo, Ludovico; Franco, Octávio Luiz; Restini, Carolina Baraldi Araújo; Paulo, Michele; Bendhack, Lusiane Maria; Bemquerer, Marcelo Porto; Oliveira, Aldeidia Pereira; Simonsen, Ulf; Leite, José Roberto de Souza de Almeida

    2015-01-01

    Proline-rich oligopeptides (PROs) are a large family which comprises the bradykinin-potentiating peptides (BPPs). They inhibit the activity of the angiotensin I-converting enzyme (ACE) and have a typical pyroglutamyl (Pyr)/proline-rich structure at the N- and C-terminus, respectively. Furthermore, PROs decrease blood pressure in animals. In the present study, the isolation and biological characterization of a novel vasoactive BPP isolated from the skin secretion of the frog Brachycephalus ephippium is described. This new PRO, termed BPP-Brachy, has the primary structure WPPPKVSP and the amidated form termed BPP-BrachyNH2 inhibits efficiently ACE in rat serum. In silico molecular modeling and docking studies suggest that BPP-BrachyNH2 is capable of forming a hydrogen bond network as well as multiple van der Waals interactions with the rat ACE, which blocks the access of the substrate to the C-domain active site. Moreover, in rat thoracic aorta BPP-BrachyNH2 induces potent endothelium-dependent vasodilatation with similar magnitude as captopril. In DAF-FM DA-loaded aortic cross sections examined by confocal microscopy, BPP-BrachyNH2 was found to increase the release of nitric oxide (NO). Moreover, BPP-BrachyNH2 was devoid of toxicity in endothelial and smooth muscle cell cultures. In conclusion, the peptide BPP-BrachyNH2 has a novel sequence being the first BPP isolated from the skin secretion of the Brachycephalidae family. This opens for exploring amphibians as a source of new biomolecules. The BPP-BrachyNH2 is devoid of cytotoxicity and elicits endothelium-dependent vasodilatation mediated by NO. These findings open for the possibility of potential application of these peptides in the treatment of endothelial dysfunction and cardiovascular diseases. PMID:26661890

  2. A Novel Topology of Proline-rich Transmembrane Protein 2 (PRRT2)

    PubMed Central

    Rossi, Pia; Sterlini, Bruno; Castroflorio, Enrico; Marte, Antonella; Onofri, Franco; Valtorta, Flavia; Maragliano, Luca; Corradi, Anna; Benfenati, Fabio

    2016-01-01

    Proline-rich transmembrane protein 2 (PRRT2) has been identified as the single causative gene for a group of paroxysmal syndromes of infancy, including epilepsy, paroxysmal movement disorders, and migraine. On the basis of topology predictions, PRRT2 has been assigned to the recently characterized family of Dispanins, whose members share the two-transmembrane domain topology with a large N terminus and short C terminus oriented toward the outside of the cell. Because PRRT2 plays a role at the synapse, it is important to confirm the exact orientation of its N and C termini with respect to the plasma membrane to get clues regarding its possible function. Using a combination of different experimental approaches, including live immunolabeling, immunogold electron microscopy, surface biotinylation and computational modeling, we demonstrate a novel topology for this protein. PRRT2 is a type II transmembrane protein in which only the second hydrophobic segment spans the plasma membrane, whereas the first one is associated with the internal surface of the membrane and forms a helix-loop-helix structure without crossing it. Most importantly, the large proline-rich N-terminal domain is not exposed to the extracellular space but is localized intracellularly, and only the short C terminus is extracellular (Ncyt/Cexo topology). Accordingly, we show that PRRT2 interacts with the Src homology 3 domain-bearing protein Intersectin 1, an intracellular protein involved in synaptic vesicle cycling. These findings will contribute to the clarification of the role of PRRT2 at the synapse and the understanding of pathogenic mechanisms on the basis of PRRT2-related neurological disorders. PMID:26797119

  3. Association of purified skeletal-muscle AMP deaminase with a histidine-proline-rich-glycoprotein-like molecule.

    PubMed Central

    Ranieri-Raggi, M; Montali, U; Ronca, F; Sabbatini, A; Brown, P E; Moir, A J; Raggi, A

    1997-01-01

    Denaturation of rabbit skeletal-muscle AMP deaminase in acidic medium followed by chromatography on DEAE-cellulose in 8 M urea atpH 8.0 allows separation of two main peptide components of similar apparent molecular mass (75-80 kDa) that we tentatively assume correspond to two different enzyme subunits. Whereas the amino acid composition of one of the two peptides is in good agreement with that derived from the nucleotide sequence of the known rat and human AMPD1 cDNAs, the second component shows much higher contents of proline, glycine and histidine. N-Terminal sequence analysis of the fragments liberated by limited proteolysis with trypsin of the novel peptide reveals a striking similarity to the fragments produced by plasmin cleavage of the rabbit plasma protein called histidine-proline-rich glycoprotein (HPRG). However, some divergence is observed between the sequence of one of the fragments liberated from AMP deaminase by a more extensive trypsinization and rabbit plasma HPRG in the region containing residues 472-477. A fragment with a blocked N-terminus, which was found among those liberated by proteolysis with pepsin of either whole AMP deaminase or the novel component of the enzyme, shows an amino acid composition quite different from that of the N-terminus of the known subunit of AMP deaminase. By coupling this observation with the detection in freshly prepared AMP deaminase of a low yield of the sequence (LTPTDX) corresponding to that of HPRG N-terminus, it can be deduced that in comparison with HPRG, the putative HPRG-like component of AMP deaminase contains an additional fragment with a blocked N-terminus, which is liberated by a proteolytic process during purification of the enzyme. The implications of the association to rabbit skeletal-muscle AMP deaminase of a HPRG-like protein species are discussed. PMID:9307011

  4. The proline-rich region of 18.5 kDa myelin basic protein binds to the SH3-domain of Fyn tyrosine kinase with the aid of an upstream segment to form a dynamic complex in vitro

    PubMed Central

    De Avila, Miguel; Vassall, Kenrick A.; Smith, Graham S. T.; Bamm, Vladimir V.; Harauz, George

    2014-01-01

    The intrinsically disordered 18.5 kDa classic isoform of MBP (myelin basic protein) interacts with Fyn kinase during oligodendrocyte development and myelination. It does so primarily via a central proline-rich SH3 (Src homology 3) ligand (T92–R104, murine 18.5 kDa MBP sequence numbering) that is part of a molecular switch due to its high degree of conservation and modification by MAP (mitogen-activated protein) and other kinases, especially at residues T92 and T95. Here, we show using co-transfection experiments of an early developmental oligodendroglial cell line (N19) that an MBP segment upstream of the primary ligand is involved in MBP–Fyn–SH3 association in cellula. Using solution NMR spectroscopy in vitro, we define this segment to comprise MBP residues (T62–L68), and demonstrate further that residues (V83–P93) are the predominant SH3-target, assessed by the degree of chemical shift change upon titration. We show by chemical shift index analysis that there is no formation of local poly-proline type II structure in the proline-rich segment upon binding, and by NOE (nuclear Overhauser effect) and relaxation measurements that MBP remains dynamic even while complexed with Fyn–SH3. The association is a new example first of a non-canonical SH3-domain interaction and second of a fuzzy MBP complex. PMID:25343306

  5. A Proline-Rich Domain in the Genotype 4 Hepatitis E Virus ORF3 C-Terminus Is Crucial for Downstream V105DLP108 Immunoactivity.

    PubMed

    Wang, Heng; Ji, Fangxiao; Liang, Huanbin; Gu, Honglang; Ning, Zhangyong; Liu, Rongchang; Zhang, Guihong

    2015-01-01

    The hepatitis E virus (HEV) is responsible for serious viral hepatitis worldwide. Animals are considered a reservoir of HEV, particularly pigs. While HEV infection in pigs and dogs is always asymptomatic, the virus causes high death rates in patients with pre-existing chronic liver disease and pregnant women in developing countries. HEV open reading frame 2 (ORF2) has been used as a diagnostic target to detect specific antibodies against HEV in serum samples. Recent research has additionally supported the potential utility of the ORF3 protein as a target in serum anti-HEV detection. However, the epitope distribution of ORF3 protein remains ambiguous. In the current study, we showed that continuous amino acid motif, VDLP, at the C-terminus of genotype 4 HEV ORF3 is a core sequence of the ORF3 protein epitope. Moreover, cooperative interaction with upstream elements is essential for its immunoactivity. Three proline residues (P99, P102 and P103) in the upstream proline-rich domain exerted significant effects on the immunocompetence of VDLP. ELISA results revealed that SAPPLPPVVDLP and SAPPLPPVVDLPQLGL peptides containing the identified VDLP epitope display weaker reactions with anti-HEV serum than the commercial ELISA kit. Our collective findings provide valuable information on the epitope distribution characteristics of HEV ORF3 and improve our understanding of the influence of the proline-rich domain on the immunoactivity of downstream amino acids in the C-terminal region. PMID:26177202

  6. Cell wall-associated ROOT HAIR SPECIFIC 10, a proline-rich receptor-like kinase, is a negative modulator of Arabidopsis root hair growth.

    PubMed

    Hwang, Youra; Lee, Hyodong; Lee, Young-Sook; Cho, Hyung-Taeg

    2016-03-01

    Plant cell growth is restricted by the cell wall, and cell wall dynamics act as signals for the cytoplasmic and nuclear events of cell growth. Among various receptor kinases, ROOT HAIR SPECIFIC 10 (RHS10) belongs to a poorly known receptor kinase subfamily with a proline-rich extracellular domain. Here, we report that RHS10 defines the root hair length of Arabidopsis thaliana by negatively regulating hair growth. RHS10 modulates the duration of root hair growth rather than the growth rate. As poplar and rice RHS10 orthologs also showed a root hair-inhibitory function, this receptor kinase-mediated function appears to be conserved in angiosperms. RHS10 showed a strong association with the cell wall, most probably through its extracellular proline-rich domain (ECD). Deletion analysis of the ECD demonstrated that a minimal extracellular part, which includes a few proline residues, is required for RHS10-mediated root hair inhibition. RHS10 suppressed the accumulation of reactive oxygen species (ROS) in the root, which are necessary for root hair growth. A yeast two-hybrid screening identified an RNase (RNS2) as a putative downstream target of RHS10. Accordingly, RHS10 overexpression decreased and RHS10 loss increased RNA levels in the hair-growing root region. Our results suggest that RHS10 mediates cell wall-associated signals to maintain proper root hair length, at least in part by regulating RNA catabolism and ROS accumulation. PMID:26884603

  7. Cell wall-associated ROOT HAIR SPECIFIC 10, a proline-rich receptor-like kinase, is a negative modulator of Arabidopsis root hair growth

    PubMed Central

    Hwang, Youra; Lee, Hyodong; Lee, Young-Sook; Cho, Hyung-Taeg

    2016-01-01

    Plant cell growth is restricted by the cell wall, and cell wall dynamics act as signals for the cytoplasmic and nuclear events of cell growth. Among various receptor kinases, ROOT HAIR SPECIFIC 10 (RHS10) belongs to a poorly known receptor kinase subfamily with a proline-rich extracellular domain. Here, we report that RHS10 defines the root hair length of Arabidopsis thaliana by negatively regulating hair growth. RHS10 modulates the duration of root hair growth rather than the growth rate. As poplar and rice RHS10 orthologs also showed a root hair-inhibitory function, this receptor kinase-mediated function appears to be conserved in angiosperms. RHS10 showed a strong association with the cell wall, most probably through its extracellular proline-rich domain (ECD). Deletion analysis of the ECD demonstrated that a minimal extracellular part, which includes a few proline residues, is required for RHS10-mediated root hair inhibition. RHS10 suppressed the accumulation of reactive oxygen species (ROS) in the root, which are necessary for root hair growth. A yeast two-hybrid screening identified an RNase (RNS2) as a putative downstream target of RHS10. Accordingly, RHS10 overexpression decreased and RHS10 loss increased RNA levels in the hair-growing root region. Our results suggest that RHS10 mediates cell wall-associated signals to maintain proper root hair length, at least in part by regulating RNA catabolism and ROS accumulation. PMID:26884603

  8. Shuttling gold nanoparticles into tumoral cells with an amphipathic proline-rich peptide.

    PubMed

    Pujals, Sílvia; Bastús, Neus G; Pereiro, Eva; López-Iglesias, Carmen; Puntes, Víctor F; Kogan, Marcelo J; Giralt, Ernest

    2009-04-17

    Cell-penetrating peptides (CPPs) are a potential tool for intracellular delivery of different kinds of cargoes. Because of their growing use in nanobiomedicine, both for diagnostics and for treatment, metal nanoparticles are an interesting cargo for CPPs. Here, gold nanoparticles (AuNps) and the amphipathic proline-rich peptide SAP have been used. Conjugation of the peptide onto the AuNps was achieved by addition of a cysteine to the SAP sequence for thiol chemisorption on gold, and the attachment was confirmed by visible spectroscopy, dynamic light scattering (DLS), zeta-potential (ZP), stability towards ionic strength (as high as 1 M NaCl), X-ray photoelectron spectroscopy (XPS) and high-resolution transmission electron microscopy (HR-TEM) coupled to electron energy loss spectroscopy (EELS). AuNp-C-SAP internalization in HeLa cells was observed by three different microscopy techniques-TEM, confocal laser scanning microscopy (CLSM) and transmission X-ray microscopy (TXM)-and all of them have confirmed the effective intracellular delivery of AuNps by SAP. PMID:19322842

  9. Hybrid proline-rich proteins: novel players in plant cell elongation?

    PubMed Central

    Dvořáková, Lenka; Srba, Miroslav; Opatrny, Zdenek; Fischer, Lukas

    2012-01-01

    Background and Aims Hybrid proline-rich proteins (HyPRPs) represent a large family of putative cell-wall proteins characterized by the presence of a variable N-terminal domain and a conserved C-terminal domain that is related to non-specific lipid transfer proteins. The function of HyPRPs remains unclear, but their widespread occurrence and abundant expression patterns indicate that they may be involved in a basic cellular process. Methods To elucidate the cellular function of HyPRPs, we modulated the expression of three HyPRP genes in tobacco (Nicotiana tabacum) BY-2 cell lines and in potato (Solanum tuberosum) plants. Key Results In BY-2 lines, over-expression of the three HyPRP genes with different types of N-terminal domains resulted in similar phenotypic changes, namely increased cell elongation, both in suspension culture and on solid media where the over-expression resulted in enhanced calli size. The over-expressing cells showed increased plasmolysis in a hypertonic mannitol solution and accelerated rate of protoplast release, suggesting loosening of the cell walls. In contrast to BY-2 lines, no phenotypic changes were observed in potato plants over-expressing the same or analogous HyPRP genes, presumably due to more complex compensatory mechanisms in planta. Conclusions Based on the results from BY-2 lines, we propose that HyPRPs, more specifically their C-terminal domains, represent a novel group of proteins involved in cell expansion. PMID:22028464

  10. Effect of hypothalamic proline-rich peptide (PRP-1) on neuronal and bone marrow cell apoptosis.

    PubMed

    Galoyan, Armen A; Krieglstein, Josef; Klumpp, Susanne; Danielian, Kristina E; Galoian, Karine A; Kremers, Wolfram; Bezirganyan, Kristina B; Davtyan, Tigran K

    2007-11-01

    The AGAPEPAEPAQPGVY proline-rich peptide (PRP-1) was isolated from neurosecretory granules of the bovine neurohypophysis; it is produced by N. supraopticus and N. paraventricularis. It has been shown that PRP-1 has many potentially beneficial biological effects including immunoregulatory, hematopoietic, antimicrobial and anti-neurodegenerative properties. Here we investigated the influence of PRP-1 on staurosporine-induced apoptosis of postnatal hippocampal cells and on doxorubicin-induced bone marrow granulocyte- and monocyte apoptosis. The intention was to further characterize the effect of PRP-1 on the survival rate of neurons and in context with myelopoiesis. We demonstrate that PRP-1 significantly reduced apoptosis of postnatal hippocampal cells induced by staurosporine. The protective effect of PRP-1 against apoptotic cell death was shown to be both time- and dose-dependent. Neuroprotection was more pronounced after prolonged pretreatment of the cells with PRP-1 before the induction of apoptosis with staurosporine. The related peptide [arg(8)]vasopressin did not reveal neuroprotection. PRP-1 also significantly reduced apoptosis of bone marrow monocytes and granulocytes induced by doxorubicin. This protective effect lasted for 2-4 h and was not detectable anymore after 24 h when PRP-1 and doxorubicin were added simultaneously. Previously obtained data and results of the current studies suggested that the hypothalamic PRP-1 possibly represents an endogenous peptide whose primary functions are to regulate myelopoiesis and neuron survival as we provide evidence that PRP can differentially reduce both staurosporine- and doxorubicin-induced hippocampal and bone marrow cell apoptosis. PMID:17549627

  11. Overexpression of Ste20-related proline/alanine-rich kinase exacerbates experimental colitis in mice.

    PubMed

    Yan, Yutao; Laroui, Hamed; Ingersoll, Sarah A; Ayyadurai, Saravanan; Charania, Moiz; Yang, Stephen; Dalmasso, Guillaume; Obertone, Tracy S; Nguyen, Hang; Sitaraman, Shanthi V; Merlin, Didier

    2011-08-01

    Inflammatory bowel disease, mainly Crohn's disease and ulcerative colitis, are characterized by epithelial barrier disruption and altered immune regulation. Colonic Ste20-like proline/alanine-rich kinase (SPAK) plays a role in intestinal inflammation, but its underlying mechanisms need to be defined. Both SPAK-transfected Caco2-BBE cells and villin-SPAK transgenic (TG) FVB/6 mice exhibited loss of intestinal barrier function. Further studies demonstrated that SPAK significantly increased paracellular intestinal permeability to FITC-dextran. In vivo studies using the mouse models of colitis induced by dextran sulfate sodium (DSS) and trinitrobenzene sulfonic acid showed that TG FVB/6 mice were more susceptible to DSS and trinitrobenzene sulfonic acid treatment than wild-type FVB/6 mice, as demonstrated by clinical and histological characteristics and enzymatic activities. Consistent with this notion, we found that SPAK increased intestinal epithelial permeability, which likely facilitated the production of inflammatory cytokines in vitro and in vivo, aggravated bacterial translocation in TG mice under DSS treatment, and consequently established a context favorable for the triggering of intestinal inflammation cascades. In conclusion, overexpression of SPAK inhibits maintenance of intestinal mucosal innate immune homeostasis, which makes regulation of SPAK important to attenuate pathological responses in inflammatory bowel disease. PMID:21705622

  12. Distribution of the SynDIG4/proline-rich transmembrane protein 1 in rat brain.

    PubMed

    Kirk, Lyndsey M; Ti, Shu W; Bishop, Hannah I; Orozco-Llamas, Mayra; Pham, Michelle; Trimmer, James S; Díaz, Elva

    2016-08-01

    The modulation of AMPA receptor (AMPAR) content at synapses is thought to be an underlying molecular mechanism of memory and learning. AMPAR content at synapses is highly plastic and is regulated by numerous AMPAR accessory transmembrane proteins such as TARPs, cornichons, and CKAMPs. SynDIG (synapse differentiation-induced gene) defines a family of four genes (SynDIG1-4) expressed in distinct and overlapping patterns in the brain. SynDIG1 was previously identified as a novel transmembrane AMPAR-associated protein that regulates synaptic strength. The related protein SynDIG4 [also known as Prrt1 (proline-rich transmembrane protein 1)] has recently been identified as a component of AMPAR complexes. In this study, we show that SynDIG1 and SynDIG4 have distinct yet overlapping patterns of expression in the central nervous system, with SynDIG4 having especially prominent expression in the hippocampus and particularly within CA1. In contrast to SynDIG1 and other traditional AMPAR auxiliary subunits, SynDIG4 is de-enriched at the postsynaptic density and colocalizes with extrasynaptic GluA1 puncta in primary dissociated neuron culture. These results indicate that, although SynDIG4 shares sequence similarity with SynDIG1, it might act through a unique mechanism as an auxiliary factor for extrasynaptic GluA1-containing AMPARs. J. Comp. Neurol. 524:2266-2280, 2016. © 2015 Wiley Periodicals, Inc. PMID:26660156

  13. Clinical Manifestations in Paroxysmal Kinesigenic Dyskinesia Patients with Proline-Rich Transmembrane Protein 2 Gene Mutation

    PubMed Central

    Youn, Jinyoung; Kim, Ji Sun; Lee, Munhyang; Lee, Jeehun; Roh, Hakjae

    2014-01-01

    Background and Purpose Given the diverse phenotypes including combined non-dyskinetic symptoms in patients harboring mutations of the gene encoding proline-rich transmembrane protein 2 (PRRT2), the clinical significance of these mutations in paroxysmal kinesigenic dyskinesia (PKD) is questionable. In this study, we investigated the clinical characteristics of PKD patients with PRRT2 mutations. Methods Familial and sporadic PKD patients were enrolled and PRRT2 gene sequencing was performed. Demographic and clinical data were compared between PKD patients with and without a PRRT2 mutation. Results Among the enrolled PKD patients (8 patients from 5 PKD families and 19 sporadic patients), PRRT2 mutations were detected in 3 PKD families (60%) and 2 sporadic cases (10.5%). All familial patients with a PRRT2 gene mutation had the c.649dupC mutation, which is the most commonly reported mutation. Two uncommon mutations (c.649delC and c.629dupC) were detected only in the sporadic cases. PKD patients with PRRT2 mutation were younger at symptom onset and had more non-dyskinetic symptoms than those without PRRT2 mutation. However, the characteristics of dyskinetic movement did not differ between the two groups. Conclusions This is the first study of PRRT2 mutations in Korea. The presence of a PRRT2 mutation was more strongly related to familial PKD, and was clinically related with earlier age of onset and common non-dyskinetic symptoms in PKD patients. PMID:24465263

  14. Knockout of Ste20-like proline/alanine-rich kinase (SPAK) attenuates intestinal inflammation in mice.

    PubMed

    Zhang, Yuchen; Viennois, Emilie; Xiao, Bo; Baker, Mark T; Yang, Stephen; Okoro, Ijeoma; Yan, Yutao

    2013-05-01

    Inflammatory bowel diseases are characterized by epithelial barrier disruption and alterations in immune regulation. Ste20-like proline/alanine-rich kinase (SPAK) plays a role in intestinal inflammation, but the underlying mechanisms need to be defined. Herein, SPAK knockout (KO) C57BL/6 mice exhibited significant increases in intestinal transepithelial resistance, a marked decrease in paracellular permeability to fluorescence isothiocyanate-dextran, and altered apical side tight junction sodium ion selectivity, compared with wild-type mice. Furthermore, the expression of junction protein, claudin-2, decreased. In contrast, expressions of occludin, E-cadherin, β-catenin, and claudin-5 increased significantly, whereas no obvious change of claudin-1, claudin-4, zonula occludens protein 1, and zonula occludens protein 2 expressions was observed. In murine models of colitis induced by dextran sulfate sodium and trinitrobenzene sulfuric acid, KO mice were more tolerant than wild-type mice, as demonstrated by colonoscopy features, histological characteristics, and myeloperoxidase activities. Consistent with these findings, KO mice showed increased IL-10 levels and decreased proinflammatory cytokine secretion, ameliorated bacterial translocation on treatment with dextran sulfate sodium, and regulation of with no lysine (WNK) kinase activity. Together, these features may reduce epithelial permeability. In conclusion, SPAK deficiency increases intestinal innate immune homeostasis, which is important for control or attenuation of pathological responses in inflammatory bowel diseases. PMID:23499375

  15. Membrane interactions of proline-rich antimicrobial peptide, Chex1-Arg20, multimers.

    PubMed

    Li, Wenyi; Sani, Marc-Antoine; Jamasbi, Elaheh; Otvos, Laszlo; Hossain, Mohammed Akhter; Wade, John D; Separovic, Frances

    2016-06-01

    The increasing prevalence of antibiotic-resistant pathogens requires the development of new antibiotics. Proline-rich antimicrobial peptides (PrAMPs), including native apidaecins, Bac7, and oncocins or designed A3APO, show multi-modal actions against pathogens together with immunostimulatory activities. The interactions of the designed PrAMP, Chex1-Arg20, and its dimeric and tetrameric oligomers with different model membranes were investigated by circular dichroism spectroscopy, dynamic light scattering, zeta potential, differential scanning calorimetry, and dye leakage. Chex1-Arg20 oligomers showed stronger affinity and preferential binding to negatively charged phospholipid bilayers and led to lipid aggregation and neutralization. Fluorescence microscopy of negatively charged giant unilamellar vesicles with AlexFluor-647-labeled Chex1-Arg20 dimers and tetramers displayed aggregation at a peptide/lipid low ratio of 1:200 and at higher peptide concentrations (1:100/1:50) for Chex1-Arg20 monomer. Such interactions, aggregation, and neutralization of PrAMP oligomers additionally showed the importance of interactions of PrAMPs with negatively charged membranes. PMID:26926423

  16. Carbon Monoxide Modulates α–Smooth Muscle Actin and Small Proline Rich-1a Expression in Fibrosis

    PubMed Central

    Zheng, Liang; Zhou, Zhihong; Lin, Ling; Alber, Sean; Watkins, Simon; Kaminski, Naftali; Choi, Augustine M. K.; Morse, Danielle

    2009-01-01

    Carbon monoxide (CO) is a biologically active molecule produced in the body by the stress-inducible enzyme, heme oxygenase. We have previously shown that CO suppresses fibrosis in a murine bleomycin model. To investigate the mechanisms by which CO opposes fibrogenesis, we performed gene expression profiling of fibroblasts treated with transforming growth factor-β1 and CO. The most highly differentially expressed categories of genes included those related to muscular system development and the small proline-rich family of proteins. We confirmed in vitro, and in an in vivo bleomycin model of lung fibrosis, that CO suppresses α–smooth muscle actin expression and enhances small proline-rich protein-1a expression. We further show that these effects of CO depend upon signaling via the extracellular signal–regulated kinase pathway. Our results demonstrate novel transcriptional targets for CO and further elucidate the mechanism by which CO suppresses fibrosis. PMID:19097987

  17. Subcellular localization of proline-rich tyrosine kinase 2 during oocyte fertilization and early-embryo development in mice.

    PubMed

    Meng, Xiao-Qian; Dai, Yuan-Yuan; Jing, Lai-Dong; Bai, Jing; Liu, Shu-Zhen; Zheng, Ke-Gang; Pan, Jie

    2016-08-25

    Proline-rich tyrosine kinase 2 (Pyk2), a non-receptor tyrosine kinase, is a member of the focal adhesion kinase family and is highly expressed in oocytes. Using a combination of confocal microscopy and RNAi, we localized and studied the function of both Pyk2 and tyrosine-phosphorylated Pyk2 (p-Pyk2) during mouse oocyte fertilization and early embryo development. At the onset of fertilization, Pyk2 and p-Pyk2 were detected predominantly in sperm heads and the oocyte cytoplasm. Upon formation of male and female pronuclei, Pyk2 and its activated form leave the cytoplasm and accumulate in the two pronuclei. We detected Pyk2 in blastomere nuclei and found both Pyk2 and p-Pyk2 in the pre-blastula cytoplasm. Pyk2 and its activated form then disappeared from the blastula nuclei and localized to the perinuclear regions, where blastula cells come into contact with each other. Pyk2 knockdown via microinjection of siRNA into the zygote did not inhibit early embryo development. Our results suggest that Pyk2 plays multiple functional roles in mouse oocyte fertilization as well as throughout early embryo development. PMID:27086609

  18. The rad9 gene of Coprinus cinereus encodes a proline-rich protein required for meiotic chromosome condensation and synapsis

    SciTech Connect

    Seitz, L.C.; Tang, Keliang; Cummings, W.J.; Zolan, M.E.

    1996-04-01

    The rad9 gene of Coprinus cinereus is essential for the normal completion of meiosis. We examined surface-spread preparations of wild-type and rad9-1 nuclei from the meiotic stages of karyogamy through metaphase I, and we determined the primary sequence, structure, and meiotic expression of the rad9 gene. In wild-type C. cinereus, karyogamy is followed by condensation and alignment of homologous chromosomes. Condensation and axial core development largely precede synapsis, which often initiates at telomeres. A diffuse diplotene phase coincides with dissolution of the synaptonemal complex, and subsequently chromosomes further condense as the cells progress into metaphase I. In contrast, although karyogamy and nucleolar fusion are apparently normal in rad9-1 basidia, only short stretches of synaptonemal complex form. These correlate with stretches of condensed chromatin, mostly at apparent chromosome ends, and regions of presumptive triple synapsis are numerous. rad9-1 basidia enter the diffuse stages of early diplotene, and then 50% of these cells enter metaphase I by the criteria of nucleolar elimination and at least some chromatin condensation. rad9 gene expression is induced after gamma irradiation and during meiosis. The gene has 27 exons and encodes a predicted protein of 2157 amino acids, with a proline-rich amino terminus. 62 refs., 10 figs.

  19. Subcellular localization of proline-rich tyrosine kinase 2 during oocyte fertilization and early-embryo development in mice

    PubMed Central

    MENG, Xiao-qian; DAI, Yuan-yuan; JING, Lai-dong; BAI, Jing; LIU, Shu-zhen; ZHENG, Ke-gang; PAN, Jie

    2016-01-01

    Proline-rich tyrosine kinase 2 (Pyk2), a non-receptor tyrosine kinase, is a member of the focal adhesion kinase family and is highly expressed in oocytes. Using a combination of confocal microscopy and RNAi, we localized and studied the function of both Pyk2 and tyrosine-phosphorylated Pyk2 (p-Pyk2) during mouse oocyte fertilization and early embryo development. At the onset of fertilization, Pyk2 and p-Pyk2 were detected predominantly in sperm heads and the oocyte cytoplasm. Upon formation of male and female pronuclei, Pyk2 and its activated form leave the cytoplasm and accumulate in the two pronuclei. We detected Pyk2 in blastomere nuclei and found both Pyk2 and p-Pyk2 in the pre-blastula cytoplasm. Pyk2 and its activated form then disappeared from the blastula nuclei and localized to the perinuclear regions, where blastula cells come into contact with each other. Pyk2 knockdown via microinjection of siRNA into the zygote did not inhibit early embryo development. Our results suggest that Pyk2 plays multiple functional roles in mouse oocyte fertilization as well as throughout early embryo development. PMID:27086609

  20. The Involvement of Proline-Rich 15 in Early Conceptus Development in Sheep1

    PubMed Central

    Purcell, Scott H.; Cantlon, Jeremy D.; Wright, Casey D.; Henkes, Luiz E.; Seidel, George E.; Anthony, Russell V.

    2009-01-01

    The ruminant conceptus undergoes a period of elongation that is required for maternal recognition of pregnancy, prior to attaching to the endometrium. The purpose of these studies was to investigate the role of proline-rich 15 (PRR15) in the sheep conceptus by examining mRNA expression, protein localization, and the effect of PRR15 mRNA degradation. Conceptuses were collected on Days 11, 13, 15, 16, 17, 21, and 30 after mating. Quantitative RT-PCR showed expression of PRR15 mRNA corresponded with the process of trophoblast elongation, with peak expression occurring on Days 15 and 16. A recombinant ovine PRR15 was generated and used to create polyclonal antibodies against PRR15. Immunohistochemistry of a Day 15 conceptus indicated that PRR15 was localized predominantly in the nucleus of the trophectoderm and extraembryonic primitive endoderm. To test whether PRR15 was required during early conceptus development, RNA interference was employed. Blastocysts collected on Day 8 after mating were infected with a lentivirus expressing a short-hairpin RNA (shRNA) that targeted PRR15 mRNA for degradation, an shRNA containing a three-nucleotide mismatch to PRR15 mRNA, or a lentivirus expressing no shRNA. After infection, blastocysts were transferred into recipient ewes and collected back on Day 15 of gestation. Although the majority of the control and mismatched shRNA-treated conceptuses elongated and survived to Day 15, none of the embryos treated with the lentivirus expressing shRNA against PRR15 mRNA elongated, and most died. In conclusion, expression of PRR15 mRNA occurred during a narrow window of conceptus development, and degradation of PRR15 mRNA led to conceptus demise or abnormal development. PMID:19605793

  1. The proline-rich N-terminal sequence of calcineurin Abeta determines substrate binding.

    PubMed

    Kilka, Susann; Erdmann, Frank; Migdoll, Alexander; Fischer, Gunter; Weiwad, Matthias

    2009-03-10

    Three different genes of catalytic subunit A of the Ca(2+)-dependent serine/threonine protein phosphatase calcineurin (CaN) are encoded in the human genome forming heterodimers with regulatory subunit B. Even though physiological roles of CaN have been investigated extensively, less is known about the specific functions of the different catalytic isoforms. In this study, all human CaN holoenzymes containing either the alpha, beta, or gamma isoform of the catalytic subunit (CaN alpha, beta, or gamma, respectively) were expressed for the first time. Comparative kinetic analysis of the dephosphorylation of five specific CaN substrates provided evidence that the distinct isoforms of the catalytic subunit confer substrate specificities to the holoenzymes. CaN alpha dephosphorylates the transcription factor Elk-1 with 7- and 2-fold higher catalytic efficiencies than the beta and gamma isoforms, respectively. CaN gamma exhibits the highest k(cat)/K(m) value for DARPP-32, whereas the catalytic efficiencies for the dephosphorylation of NFAT and RII peptide were 3- and 5-fold lower, respectively, when compared with the other isoforms. Elk-1 and NFAT reporter gene activity measurements revealed even more pronounced substrate preferences of CaNA isoforms. Moreover, kinetic analysis demonstrated that CaN beta exhibits for all tested protein substrates the lowest K(m) values. Enzymatic characterization of the CaN beta(P14G/P18G) variant as well as the N-terminal truncated form CaN beta(22-524) revealed that the proline-rich sequence of CaN beta is involved in substrate recognition. CaN beta(22-524) exhibits an at least 4-fold decreased substrate affinity and a 5-fold increased turnover number. Since this study demonstrates that all CaN isoforms display the same cytoplasmic subcellular distribution and are expressed in each tested cell line, differences in substrate specificities may determine specific physiological functions of the distinct isoforms. PMID:19154138

  2. Active sites of salivary proline-rich protein for binding to Porphyromonas gingivalis fimbriae.

    PubMed Central

    Kataoka, K; Amano, A; Kuboniwa, M; Horie, H; Nagata, H; Shizukuishi, S

    1997-01-01

    Porphyromonas gingivalis fimbriae specifically bind salivary acidic proline-rich protein 1 (PRP1) through protein-protein interactions. The binding domains of fimbrillin (a subunit of fimbriae) for PRP1 were analyzed previously (A. Amano, A. Sharma, J.-Y. Lee, H. T. Sojar, P. A. Raj, and R. J. Genco, Infect. Immun. 64:1631-1637, 1996). In this study, we investigated the sites of binding of the PRP1 molecules to the fimbriae. PRP1 (amino acid residues 1 to 150) was proteolysed to three fragments (residues 1 to 74 [fragment 1-74], 75 to 129, and 130 to 150). 125I-labeled fimbriae clearly bound fragments 75-129 and 130-150, immobilized on a polyvinylidene difluoride membrane; both fragments also inhibited whole-cell binding to PRP1-coated hydroxyapatite (HAP) beads by 50 and 83%, respectively. However, the N-terminal fragment failed to show any effect. Analogous peptides corresponding to residues 75 to 89, 90 to 106, 107 to 120, 121 to 129, and 130 to 150 of PRP1 were synthesized. The fimbriae significantly bound peptide 130-150, immobilized on 96-well plates, and the peptide also inhibited binding of 125I-labeled fimbriae to PRP1-coated HAP beads by almost 100%. Peptides 75-89, 90-106, and 121-129, immobilized on plates, showed considerable ability to bind fimbriae. For further analysis of active sites in residues 130 to 150, synthetic peptides corresponding to residues 130 to 137, 138 to 145, and 146 to 150 were prepared. Peptide 138-145 (GRPQGPPQ) inhibited fimbrial binding to PRP1-coated HAP beads by 97%. This amino acid sequence was shared in the alignment of residues 75 to 89, 90 to 106, and 107 to 120. Six synthetic peptides were prepared by serial deletions of individual residues from the N and C termini of peptide GRPQGPPQ. Peptide PQGPPQ was as inhibitory as peptide GRPQGPPQ. Further deletions of the dipeptide Pro-Gln from the N and C termini of peptide PQGPPQ resulted in significant loss of the inhibitory effect. These results strongly suggest that PQGPPQ

  3. Primary structure and possible origin of the non-glycosylated basic proline-rich protein of human submandibular/sublingual saliva.

    PubMed Central

    Robinson, R; Kauffman, D L; Waye, M M; Blum, M; Bennick, A; Keller, P J

    1989-01-01

    Human submandibular/sublingual saliva contains one non-glycosylated basic proline-rich protein whereas parotid saliva contains multiple such components. The submandibular protein has a primary structure identical with the C-terminal segment [TZ] of the human parotid acidic proline-rich proteins that contain 150 amino acid residues (Mr 16,000). Northern-blot analyses of human parotid and submandibular glands revealed that mRNAs containing the HaeIII repeat sequence typical for acidic proline-rich proteins are expressed in both of these salivary glands whereas mRNAs for non-glycosylated basic proline-rich proteins containing a typical BstN1 repeat sequence are expressed in the parotid but not in the submandibular gland. Products of translation in vitro of mRNAs from human parotid and submandibular glands were also examined. Two immunoprecipitable bands with Mr 29,000 and 28,000 were obtained by translation of both parotid and submandibular mRNA. In the presence of microsomal membranes these proteins gave rise to proteins electrophoretically identical with the secreted acidic proline-rich proteins of Mr 16,000. These proteins were cleaved by kallikrein, giving rise to proteins with electrophoretic mobilities identical with those of a smaller acidic proline-rich protein with Mr 11,000 and peptide TZ. Additional immunoprecipitable bands with Mr ranging from 35,000 to 46,000 were seen when parotid mRNA was used for translation in vitro, and are believed to be precursors of the basic proline-rich proteins encoded by the BstN1 repeat type mRNA. Neither these bands nor a separate precursor for the basic non-glycosylated proline-rich protein was detected when submandibular mRNA was used for translation in vitro. It is suggested that the non-glycosylated basic proline-rich protein present in human submandibular saliva arises by cleavage of acidic proline-rich proteins. Images Fig. 1. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:2688632

  4. Molecular characterization and evolution of the SPRR family of keratinocyte differentiation markers encoding small proline-rich proteins

    SciTech Connect

    Gibbs, S.; Fijneman, R.; Wiegant, J.; Van De Putte, P.; Backendorf, C. ); Van Kessel, A.D. )

    1993-06-01

    SPRR genes (formerly SPR) encode a novel class of polypeptides (small proline rich proteins) that are strongly induced during differentiation of human epidermal keratinocytes in vitro and in vivo. Recently the authors found that the N- and C-terminal domains of these proteins show strong sequence homology to loricrin and involucrin, suggesting that SPRR proteins constitute a new class of cornified envelope precursor proteins. Here they show that SPRR proteins are encoded by closely related members of a gene family, consisting of two genes for SPRR1, approximately seven genes for SPRR2, and a single gene for SPRR3. All SPRR genes are closely linked within a 300-kb DNA segment on human chromosome 1 band q21-q22, a region where the related loricrin and involucrin genes have also been mapped. The most characteristic feature of the SPRR gene family resides in the structure of the central segments of the encoded polypeptides that are built up from tandemly repeated units of either eight (SPRR1 and SPRR3) or nine (SPRR2) amino acids with the general consensus *K*PEP**. Sequencing data of the different members, together with their clustered chromosomal organization, strongly suggest that this gene family has evolved from a single progenitor gene by multiple intra- and intergenic duplications. Analysis of the different SPRR subfamilies reveals a gene-specific bias to either intra- or intergenic duplication. The authors propose that a process of homogenization has acted on the different members of one subfamily, whereas the different subfamilies appear to have diverged from each other, at the levels of both protein structure and gene regulation. 25 refs., 7 figs., 2 tab.

  5. Molecular cloning, structural analysis and functional expression of the proline-rich focal adhesion and microfilament-associated protein VASP.

    PubMed Central

    Haffner, C; Jarchau, T; Reinhard, M; Hoppe, J; Lohmann, S M; Walter, U

    1995-01-01

    The vasodilator-stimulated phosphoprotein (VASP), a substrate for cAMP- and cGMP-dependent protein kinases in vitro and in intact cells, is associated with actin filaments, focal adhesions and dynamic membrane regions. VASP, cloned here from human HL-60 and canine MDCK cells, is organized into three distinct domains. A central proline-rich domain contains a GPPPPP motif as a single copy and as a 3-fold tandem repeat, as well as three conserved phosphorylation sites for cyclic nucleotide-dependent protein kinases. A C-terminal domain contains a repetitive mixed-charge cluster which is predicted to form an alpha-helix. The hydrodynamic properties of purified human VASP together with the calculated molecular mass of cloned VASP suggest that the native protein is a homotetramer with an elongated structure. VASP over-expressed in transiently transfected BHK21 cells was predominantly detected at stress fibres, at focal adhesions and in F-actin-containing cell surface protrusions, whereas truncated VASP lacking the C-terminal domain was no longer concentrated at focal adhesions. These data indicate that the C-terminal domain is required for anchoring VASP at focal adhesion sites, whereas the central domain is suggested to mediate VASP interaction with profilin. Our results provide evidence for the structural basis by which VASP, both a target of the cAMP and cGMP signal transduction pathways and a component of the actin-based cytoskeleton, including the cytoskeleton-membrane interface, may be able to exchange signals between these networks. Images PMID:7828592

  6. Proline-, glutamic acid-, and leucine-rich protein 1 mediates estrogen rapid signaling and neuroprotection in the brain

    PubMed Central

    Sareddy, Gangadhara R.; Zhang, Quanguang; Wang, Ruimin; Scott, Erin; Zou, Yi; O'Connor, Jason C.; Chen, Yidong; Dong, Yan; Vadlamudi, Ratna K.; Brann, Darrell

    2015-01-01

    17-β estradiol (E2) has been implicated as neuroprotective in a variety of neurodegenerative disorders. However, the underlying mechanism remains unknown. Here, we provide genetic evidence, using forebrain-specific knockout (FBKO) mice, that proline-, glutamic acid-, and leucine-rich protein 1 (PELP1), an estrogen receptor coregulator protein, is essential for the extranuclear signaling and neuroprotective actions of E2 in the hippocampal CA1 region after global cerebral ischemia (GCI). E2-mediated extranuclear signaling (including activation of extracellular signal-regulated kinase and Akt) and antiapoptotic effects [such as attenuation of JNK signaling and increase in phosphorylation of glycogen synthase kinase-3β (GSK3β)] after GCI were compromised in PELP1 FBKO mice. Mechanistic studies revealed that PELP1 interacts with GSK3β, E2 modulates interaction of PELP1 with GSK3β, and PELP1 is a novel substrate for GSK3β. RNA-seq analysis of control and PELP1 FBKO mice after ischemia demonstrated alterations in several genes related to inflammation, metabolism, and survival in PELP1 FBKO mice, as well as a significant reduction in the activation of the Wnt/β-catenin signaling pathway. In addition, PELP1 FBKO studies revealed that PELP1 is required for E2-mediated neuroprotection and for E2-mediated preservation of cognitive function after GCI. Collectively, our data provide the first direct in vivo evidence, to our knowledge, of an essential role for PELP1 in E2-mediated rapid extranuclear signaling, neuroprotection, and cognitive function in the brain. PMID:26627258

  7. A Proline-Rich Motif Downstream of the Receptor Binding Domain Modulates Conformation and Fusogenicity of Murine Retroviral Envelopes

    PubMed Central

    Lavillette, Dimitri; Maurice, Marielle; Roche, Catherine; Russell, Stephen J.; Sitbon, Marc; Cosset, François-Loïc

    1998-01-01

    The entry of retroviruses into cells depends on receptor recognition by the viral envelope surface subunit SU followed by membrane fusion, which is thought to be mediated by a fusion peptide located at the amino terminus of the envelope transmembrane subunit TM. Several fusion determinants have been previously identified in murine leukemia virus (MLV) envelopes, but their functional interrelationships as well as the processes involved in fusion activation upon retroviral receptor recognition remain unelucidated. Despite both structural and functional similarities of their envelope glycoproteins, ecotropic and amphotropic MLVs display two different postbinding properties: (i) while amphotropic MLVs fuse the cells at neutral pH, penetration of ecotropic MLVs is relatively acid pH dependent and (ii) ecotropic envelopes are more efficient than amphotropic envelopes in inducing cell-to-cell fusion and syncytium formation. By exploiting the latter characteristic in the analysis of chimeras of ecotropic and amphotropic MLV envelopes, we show here that substitution of the ecotropic MLV proline-rich region (PRR), located in the SU between the amino-terminal receptor binding domain and the TM-interacting SU carboxy-terminal domains, is sufficient to revert the amphotropic low-fusogenic phenotype into a high-fusogenic one. Furthermore, we have identified potential β-turns in the PRR that control the stability of SU-TM associations as well as the thresholds required to trigger either cell-to-cell or virus-to-cell fusion. These data, demonstrating that the PRR functions as a signal which induces envelope conformational changes leading to fusion, have enabled us to derive envelopes which can infect cells harboring low levels of available amphotropic receptors. PMID:9811733

  8. Allotides: Proline-Rich Cystine Knot α-Amylase Inhibitors from Allamanda cathartica.

    PubMed

    Nguyen, Phuong Q T; Luu, Thuy T; Bai, Yang; Nguyen, Giang K T; Pervushin, Konstantin; Tam, James P

    2015-04-24

    Cystine knot α-amylase inhibitors belong to a knottin family of peptidyl inhibitors of 30-32 residues and contain two to four prolines. Thus far, only four members of the group of cystine knot α-amylase inhibitors have been characterized. Herein, the discovery and characterization of five cystine knot α-amylase inhibitors, allotides C1-C5 (Ac1-Ac5) (1-5), from the medicinal plant Allamanda cathartica are reported using both proteomic and genomic methods. Proteomic analysis showed that 1-5 are 30 amino acids in length with three or four proline residues. NMR determination of 4 revealed that it has two cis- and one trans-proline residues and adopts two equally populated conformations in solution. Determination of disulfide connectivity of 2 by differential S-reduction and S-alkylation provided clues of its unfolding process. Genomic analysis showed that allotide precursors contain a three-domain arrangement commonly found in plant cystine knot peptides with conserved residues flanking the processing sites of the mature allotide domain. This work expands the number of known cystine knot α-amylase inhibitors and furthers the understanding of both the structural and biological diversity of this type of knottin family. PMID:25832441

  9. The designer proline-rich antibacterial peptide A3-APO prevents Bacillus anthracis mortality by deactivating bacterial toxins.

    PubMed

    Otvos, Laszlo; Flick-Smith, Helen; Fox, Marc; Ostorhazi, Eszter; Dawson, Raymond M; Wade, John D

    2014-04-01

    Proline-rich antibacterial peptides protect experimental animals from bacterial challenge even if they are unable to kill the microorganisms in vitro. Their major in vivo modes of action are inhibition of bacterial protein folding and immunostimulation. Here we investigated whether the proline-rich antibacterial peptide dimer A3-APO was able to inhibit Bacillus cereus enterotoxin production in vitro and restrict the proliferation of lethal toxin-induced Bacillus anthracis replication in mouse macrophages. After 24 h incubation, peptide A3-APO and its single chain metabolite reduced the amount of properly folded B. cereus diarrhoeal enterotoxin production in a concentration-dependent manner leading to only 10-25% of the original amount of toxin detectable by a conformation-sensitive immunoassay. Likewise, after 4 h incubation, A3-APO restricted the proliferation of B. anthracis in infected macrophages by 40-45% compared to untreated cells both intracellularly and in the extracellular cell culture milieu. Although the peptide had a minimal inhibitory concentration of >512 mg/L against B. anthracis in vitro, in systemic mouse challenge models it improved survival by 20- 37%, exhibiting statistically significant cumulative efficacy when administered at 3x5 mg/kg intraperitoneally or intramuscularly. We hypothesize that the activity in isolated murine macrophages and in vivo is due to deactivation of bacterial toxins. Bacterial protein folding inhibition in synergy with other types of antimicrobial modes offers a remarkable novel strategy in combating resistant or life-threatening infections. PMID:24164262

  10. Antagonistic Effect of a Salivary Proline-Rich Peptide on the Cytosolic Ca2+ Mobilization Induced by Progesterone in Oral Squamous Cancer Cells

    PubMed Central

    Palmerini, Carlo Alberto; Mazzoni, Michela; Radicioni, Giorgia; Marzano, Valeria; Granieri, Letizia; Iavarone, Federica; Longhi, Renato; Messana, Irene; Cabras, Tiziana; Sanna, Maria Teresa; Castagnola, Massimo; Vitali, Alberto

    2016-01-01

    A salivary proline-rich peptide of 1932 Da showed a dose-dependent antagonistic effect on the cytosolic Ca2+ mobilization induced by progesterone in a tongue squamous carcinoma cell line. Structure-activity studies showed that the activity of the peptide resides in the C-terminal region characterized by a proline stretch flanked by basic residues. Furthermore, lack of activity of the retro-inverso peptide analogue suggested the involvement of stereospecific recognition. Mass spectrometry-based shotgun analysis, combined with Western blotting tests and biochemical data obtained with the Progesterone Receptor Membrane Component 1 (PGRMC1) inhibitor AG205, showed strong evidence that p1932 performs its modulatory action through an interaction with the progesterone receptor PGRMC1, which is predominantly expressed in this cell line and, clearly, plays a role in progesterone induced Ca2+ response. Thus, our results point to p1932 as a modulator of the transduction signal pathway mediated by this protein and, given a well-established involvement of PGRMC1 in tumorigenesis, highlight a possible therapeutic potential of p1932 for the treatment of oral cancer. PMID:26814504

  11. Bio-mimicking of Proline-Rich Motif Applied to Carbon Nanotube Reveals Unexpected Subtleties Underlying Nanoparticle Functionalization

    PubMed Central

    Zhang, Yuanzhao; Jimenez-Cruz, Camilo A.; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

    2014-01-01

    Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to “trapping and clamping” by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same “clamping” phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs. PMID:25427563

  12. Bio-mimicking of proline-rich motif applied to carbon nanotube reveals unexpected subtleties underlying nanoparticle functionalization.

    PubMed

    Zhang, Yuanzhao; Jimenez-Cruz, Camilo A; Wang, Jian; Zhou, Bo; Yang, Zaixing; Zhou, Ruhong

    2014-01-01

    Here, we report computational studies of the SH3 protein domain interacting with various single-walled carbon nanotubes (SWCNT) either bare or functionalized by mimicking the proline-rich motif (PRM) ligand (PPPVPPRR) and compare it to the SH3-PRM complex binding. With prolines or a single arginine attached, the SWCNT gained slightly on specificity when compared with the bare control, whereas with multi-arginine systems the specificity dropped dramatically to our surprise. Although the electrostatic interaction provided by arginines is crucial in the recognition between PRM and SH3 domain, our results suggest that attaching multiple arginines to the SWCNT has a detrimental effect on the binding affinity. Detailed analysis of the MD trajectories found two main factors that modulate the specificity of the binding: the existence of competing acidic patches at the surface of SH3 that leads to "trapping and clamping" by the arginines, and the rigidity of the SWCNT introducing entropic penalties in the proper binding. Further investigation revealed that the same "clamping" phenomenon exits in the PRM-SH3 system, which has not been reported in previous literature. The competing effects between nanoparticle and its functionalization components revealed by our model system should be of value to current and future nanomedicine designs. PMID:25427563

  13. Importance of the proline-rich multimerization domain on the oligomerization and nucleic acid binding properties of HIV-1 Vif.

    PubMed

    Bernacchi, Serena; Mercenne, Gaëlle; Tournaire, Clémence; Marquet, Roland; Paillart, Jean-Christophe

    2011-03-01

    The HIV-1 viral infectivity factor (Vif) is required for productive infection of non-permissive cells, including most natural HIV-1 targets, where it counteracts the antiviral activities of the cellular cytosine deaminases APOBEC-3G (A3G) and A3F. Vif is a multimeric protein and the conserved proline-rich domain (161)PPLP(164) regulating Vif oligomerization is crucial for its function and viral infectivity. Here, we expressed and purified wild-type Vif and a mutant protein in which alanines were substituted for the proline residues of the (161)PPLP(164) domain. Using dynamic light scattering, circular dichroism and fluorescence spectroscopy, we established the impact of these mutations on Vif oligomerization, secondary structure content and nucleic acids binding properties. In vitro, wild-type Vif formed oligomers of five to nine proteins, while Vif AALA formed dimers and/or trimers. Up to 40% of the unbound wild-type Vif protein appeared to be unfolded, but binding to the HIV-1 TAR apical loop promoted formation of β-sheets. Interestingly, alanine substitutions did not significantly affect the secondary structure of Vif, but they diminished its binding affinity and specificity for nucleic acids. Dynamic light scattering showed that Vif oligomerization, and interaction with folding-promoting nucleic acids, favor formation of high molecular mass complexes. These properties could be important for Vif functions involving RNAs. PMID:21076154

  14. Importance of the proline-rich multimerization domain on the oligomerization and nucleic acid binding properties of HIV-1 Vif

    PubMed Central

    Bernacchi, Serena; Mercenne, Gaëlle; Tournaire, Clémence; Marquet, Roland; Paillart, Jean-Christophe

    2011-01-01

    The HIV-1 viral infectivity factor (Vif) is required for productive infection of non-permissive cells, including most natural HIV-1 targets, where it counteracts the antiviral activities of the cellular cytosine deaminases APOBEC-3G (A3G) and A3F. Vif is a multimeric protein and the conserved proline-rich domain 161PPLP164 regulating Vif oligomerization is crucial for its function and viral infectivity. Here, we expressed and purified wild-type Vif and a mutant protein in which alanines were substituted for the proline residues of the 161PPLP164 domain. Using dynamic light scattering, circular dichroism and fluorescence spectroscopy, we established the impact of these mutations on Vif oligomerization, secondary structure content and nucleic acids binding properties. In vitro, wild-type Vif formed oligomers of five to nine proteins, while Vif AALA formed dimers and/or trimers. Up to 40% of the unbound wild-type Vif protein appeared to be unfolded, but binding to the HIV-1 TAR apical loop promoted formation of β-sheets. Interestingly, alanine substitutions did not significantly affect the secondary structure of Vif, but they diminished its binding affinity and specificity for nucleic acids. Dynamic light scattering showed that Vif oligomerization, and interaction with folding-promoting nucleic acids, favor formation of high molecular mass complexes. These properties could be important for Vif functions involving RNAs. PMID:21076154

  15. N- and O-linked glycosylation site profiling of the human basic salivary proline-rich protein 3M.

    PubMed

    Manconi, Barbara; Cabras, Tiziana; Sanna, Monica; Piras, Valentina; Liori, Barbara; Pisano, Elisabetta; Iavarone, Federica; Vincenzoni, Federica; Cordaro, Massimo; Faa, Gavino; Castagnola, Massimo; Messana, Irene

    2016-05-01

    In the present study, we show that the heterogeneous mixture of glycoforms of the basic salivary proline-rich protein 3M, encoded by PRB3-M locus, is a major component of the acidic soluble fraction of human whole saliva in the first years of life. Reversed-phase high-performance liquid chromatography with high-resolution electrospray ionization mass spectrometry analysis of the intact proteoforms before and after N-deglycosylation with Peptide-N-Glycosidase F and tandem mass spectrometry sequencing of peptides obtained after Endoproteinase GluC digestion allowed the structural characterization of the peptide backbone and identification of N- and O-glycosylation sites. The heterogeneous mixture of the proteoforms derives from the combination of 8 different neutral and sialylated glycans O-linked to Threonine 50, and 33 different glycans N-linked to Asparagine residues at positions 66, 87, 108, 129, 150, 171, 192, and 213. PMID:26991339

  16. Comparison of inhibitory activity on calcium phosphate precipitation by acidic proline-rich proteins, statherin, and histatin-1.

    PubMed

    Tamaki, N; Tada, T; Morita, M; Watanabe, T

    2002-07-01

    This study quantitatively compares the inhibition of calcium phosphate (CaP) precipitation by the salivary acidic proline-rich proteins (PRPs) statherin and histatin-1. Saliva and CaCl2 in 125 mM imidazole buffer (pH 7.0) were incubated with potassium phosphate and a hydroxyapatite (HAP) suspension, for 30 min at 25 degrees C, then filtered through nitrocellulose. The calcium (Ca) concentration in the filtrate was measured by atomic absorption spectrophotometry, then deducted from that in the initial solution to determine the amount of CaP precipitation after 30 min. The values of the inhibitory activities on CaP precipitation relative to crude parotid saliva were 4.7, 4.9, 6.9, and 65.8 for histatin-1, large PRPs, small PRPs, and statherin, respectively. PMID:12060866

  17. Abscisic Acid- and Stress-Induced Highly Proline-Rich Glycoproteins Regulate Root Growth in Rice1[W][OPEN

    PubMed Central

    Tseng, I-Chieh; Hong, Chwan-Yang; Yu, Su-May; Ho, Tuan-Hua David

    2013-01-01

    In the root of rice (Oryza sativa), abscisic acid (ABA) treatment, salinity, or water deficit stress induces the expression of a family of four genes, REPETITIVE PROLINE-RICH PROTEIN (RePRP). These genes encode two subclasses of novel proline-rich glycoproteins with highly repetitive PX1PX2 motifs, RePRP1 and RePRP2. RePRP orthologs exist only in monocotyledonous plants, and their functions are virtually unknown. Rice RePRPs are heavily glycosylated with arabinose and glucose on multiple hydroxyproline residues. They are significantly different from arabinogalactan proteins that have glycan chains composed of arabinose and galactose. Transient and stable expressions of RePRP-green fluorescent protein reveal that a fraction of this protein is localized to the plasma membrane. In rice roots, ABA treatment increases RePRP expression preferentially in the elongation zone. Overexpression of RePRP in transgenic rice reduces root cell elongation in the absence of ABA, similar to the effect of ABA on wild-type roots. Conversely, simultaneous knockdown of the expression of RePRP1 and RePRP2 reduces the root sensitivity to ABA, indicating that RePRP proteins play an essential role in ABA/stress regulation of root growth and development. Moreover, rice RePRPs specifically interact with a polysaccharide, arabinogalactan, in a dosage-dependent manner. It is suggested that RePRP1 and RePRP2 are functionally redundant suppressors of root cell expansion and probably act through interactions with cell wall components near the plasma membrane. PMID:23886623

  18. A Novel Topology of Proline-rich Transmembrane Protein 2 (PRRT2): HINTS FOR AN INTRACELLULAR FUNCTION AT THE SYNAPSE.

    PubMed

    Rossi, Pia; Sterlini, Bruno; Castroflorio, Enrico; Marte, Antonella; Onofri, Franco; Valtorta, Flavia; Maragliano, Luca; Corradi, Anna; Benfenati, Fabio

    2016-03-18

    Proline-rich transmembrane protein 2 (PRRT2) has been identified as the single causative gene for a group of paroxysmal syndromes of infancy, including epilepsy, paroxysmal movement disorders, and migraine. On the basis of topology predictions, PRRT2 has been assigned to the recently characterized family of Dispanins, whose members share the two-transmembrane domain topology with a large N terminus and short C terminus oriented toward the outside of the cell. Because PRRT2 plays a role at the synapse, it is important to confirm the exact orientation of its N and C termini with respect to the plasma membrane to get clues regarding its possible function. Using a combination of different experimental approaches, including live immunolabeling, immunogold electron microscopy, surface biotinylation and computational modeling, we demonstrate a novel topology for this protein. PRRT2 is a type II transmembrane protein in which only the second hydrophobic segment spans the plasma membrane, whereas the first one is associated with the internal surface of the membrane and forms a helix-loop-helix structure without crossing it. Most importantly, the large proline-rich N-terminal domain is not exposed to the extracellular space but is localized intracellularly, and only the short C terminus is extracellular (N cyt/C exo topology). Accordingly, we show that PRRT2 interacts with the Src homology 3 domain-bearing protein Intersectin 1, an intracellular protein involved in synaptic vesicle cycling. These findings will contribute to the clarification of the role of PRRT2 at the synapse and the understanding of pathogenic mechanisms on the basis of PRRT2-related neurological disorders. PMID:26797119

  19. Structure of the dimeric exonuclease TREX1 in complex with DNA displays a proline-rich binding site for WW Domains.

    PubMed

    Brucet, Marina; Querol-Audí, Jordi; Serra, Maria; Ramirez-Espain, Ximena; Bertlik, Kamila; Ruiz, Lidia; Lloberas, Jorge; Macias, Maria J; Fita, Ignacio; Celada, Antonio

    2007-05-11

    TREX1 is the most abundant mammalian 3' --> 5' DNA exonuclease. It has been described to form part of the SET complex and is responsible for the Aicardi-Goutières syndrome in humans. Here we show that the exonuclease activity is correlated to the binding preferences toward certain DNA sequences. In particular, we have found three motifs that are selected, GAG, ACA, and CTGC. To elucidate how the discrimination occurs, we determined the crystal structures of two murine TREX1 complexes, with a nucleotide product of the exonuclease reaction, and with a single-stranded DNA substrate. Using confocal microscopy, we observed TREX1 both in nuclear and cytoplasmic subcellular compartments. Remarkably, the presence of TREX1 in the nucleus requires the loss of a C-terminal segment, which we named leucine-rich repeat 3. Furthermore, we detected the presence of a conserved proline-rich region on the surface of TREX1. This observation points to interactions with proline-binding domains. The potential interacting motif "PPPVPRPP" does not contain aromatic residues and thus resembles other sequences that select SH3 and/or Group 2 WW domains. By means of nuclear magnetic resonance titration experiments, we show that, indeed, a polyproline peptide derived from the murine TREX1 sequence interacted with the WW2 domain of the elongation transcription factor CA150. Co-immunoprecipitation studies confirmed this interaction with the full-length TREX1 protein, thereby suggesting that TREX1 participates in more functional complexes than previously thought. PMID:17355961

  20. A Proline/Arginine-Rich End Leucine-Rich Repeat Protein (PRELP) Variant Is Uniquely Expressed in Chronic Lymphocytic Leukemia Cells

    PubMed Central

    Mikaelsson, Eva; Österborg, Anders; Jeddi-Tehrani, Mahmood; Kokhaei, Parviz; Ostadkarampour, Mahyar; Hadavi, Reza; Gholamin, Mehran; Akhondi, Mehdi; Shokri, Fazel; Rabbani, Hodjattallah; Mellstedt, Håkan

    2013-01-01

    Proline/arginine-rich end leucine-rich repeat protein (PRELP) belongs to the small leucine-rich proteoglycan (SLRP) family, normally expressed in extracellular matrix of collagen-rich tissues. We have previously reported on another SLRP, fibromodulin (FMOD) in patients with chronic lymphocytic leukemia (CLL). PRELP is structurally similar to FMOD with adjacent localization on chromosome 1 (1q32.1). As cluster-upregulation of genes may occur in malignancies, the aim of our study was to analyze PRELP expression in CLL. PRELP was expressed (RT-PCR) in all CLL patients (30/30), as well as in some patients with mantle cell lymphoma (3/5), but not in healthy donor leukocytes (0/20) or tumor samples from other hematological malignancies (0/35). PRELP was also detected in CLL cell-lines (4/4) but not in cell-lines from other hematological tumors (0/9). PRELP protein was detected in all CLL samples but not in normal leukocytes. Deglycosylation experiments revealed a CLL-unique 38 kDa core protein, with an intact signal peptide. This 38 kDa protein was, in contrast to the normal 55 kDa size, not detected in serum which, in combination with the uncleaved signal peptide, suggests cellular retention. The unique expression of a 38 kDa PRELP in CLL cells may suggest involvement in the pathobiology of CLL and merits further studies. PMID:23826326

  1. A proline/arginine-rich end leucine-rich repeat protein (PRELP) variant is uniquely expressed in chronic lymphocytic leukemia cells.

    PubMed

    Mikaelsson, Eva; Österborg, Anders; Jeddi-Tehrani, Mahmood; Kokhaei, Parviz; Ostadkarampour, Mahyar; Hadavi, Reza; Gholamin, Mehran; Akhondi, Mehdi; Shokri, Fazel; Rabbani, Hodjattallah; Mellstedt, Håkan

    2013-01-01

    Proline/arginine-rich end leucine-rich repeat protein (PRELP) belongs to the small leucine-rich proteoglycan (SLRP) family, normally expressed in extracellular matrix of collagen-rich tissues. We have previously reported on another SLRP, fibromodulin (FMOD) in patients with chronic lymphocytic leukemia (CLL). PRELP is structurally similar to FMOD with adjacent localization on chromosome 1 (1q32.1). As cluster-upregulation of genes may occur in malignancies, the aim of our study was to analyze PRELP expression in CLL. PRELP was expressed (RT-PCR) in all CLL patients (30/30), as well as in some patients with mantle cell lymphoma (3/5), but not in healthy donor leukocytes (0/20) or tumor samples from other hematological malignancies (0/35). PRELP was also detected in CLL cell-lines (4/4) but not in cell-lines from other hematological tumors (0/9). PRELP protein was detected in all CLL samples but not in normal leukocytes. Deglycosylation experiments revealed a CLL-unique 38 kDa core protein, with an intact signal peptide. This 38 kDa protein was, in contrast to the normal 55 kDa size, not detected in serum which, in combination with the uncleaved signal peptide, suggests cellular retention. The unique expression of a 38 kDa PRELP in CLL cells may suggest involvement in the pathobiology of CLL and merits further studies. PMID:23826326

  2. Accumulation of extracellular proteins bearing unique proline-rich motifs in intercellular spaces of the legume nodule parenchyma.

    PubMed

    Sherrier, D J; Taylor, G S; Silverstein, K A T; Gonzales, M B; VandenBosch, K A

    2005-04-01

    Nodulins encoding repetitive proline-rich cell wall proteins (PRPs) are induced during early interactions with rhizobia, suggesting a massive restructuring of the plant extracellular matrix during infection and nodulation. However, the proteins corresponding to these gene products have not been isolated or characterized, nor have cell wall localizations been confirmed. Posttranslational modifications, conformation, and interactions with other wall polymers are difficult to predict on the basis of only the deduced amino acid sequence of PRPs. PsENOD2 is expressed in nodule parenchyma tissue during nodule organogenesis and encodes a protein with distinctive PRP motifs that are rich in glutamate and basic amino acids. A database search for the ENOD2 signature motifs indicates that similar proteins may have a limited phylogenetic distribution, as they are presently only known from legumes. To determine the ultrastructural location of the proteins, antibodies were raised against unique motifs from the predicted ENOD2 sequence. The antibodies recognized nodule-specific proteins in pea (Pisum sativum), with a major band detected at 110 kDa, representing a subset of PRPs from nodules. The protein was detected specifically in organelles of the secretory pathway and intercellular spaces in the nodule parenchyma, but it was not abundant in primary walls. Similar proteins with an analogous distribution were detected in soybean (Glycine max). The use of polyclonal antibodies raised against signature motifs of extracellular matrix proteins thus appears to be an effective strategy to identify and isolate specific structural proteins for functional analysis. PMID:15868212

  3. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

    PubMed Central

    Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; Florin, Tanja; Mankin, Alexander S.; Steitz, Thomas A.

    2016-01-01

    With bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac71–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac71–35, Pyrrhocoricin, Metalnikowin and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibiotic-binding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics. PMID:26809677

  4. Hypothalamic proline-rich polypeptide enhances bone marrow colony-forming cell proliferation and stromal progenitor cell differentiation.

    PubMed

    Galoyan, A A; Korochkin, L I; Rybalkina, E J; Pavlova, G V; Saburina, I N; Zaraiski, E I; Galoyan, N A; Davtyan, T K; Bezirganyan, K B; Revishchin, A V

    2008-01-01

    The AGAPEPAEPAQPGVY proline-rich peptide (PRP-1) was isolated from neurosecretory granules of the bovine neurohypophysis; it is produced by N. supraopticus and N. paraventricularis. It has been shown that PRP-1 has many potentially beneficial biological effects, including immunoregulatory, hematopoietic, antimicrobial, and antineurodegenerative properties. Here we showed that PRP increased colony-forming cell (CFC) proliferation in rat bone marrow (BM) cells in vivo. In PRP-treated rat BM, the CFU number at day 7 and day 14 was considerably increased in comparison with untreated rat BM and no difference was found at day 21 and day 28. The related peptide [arg8]vasopressin did not reveal CFC proliferation. PRP failed to farther increase CFC proliferation in vitro in BM obtained from PRP-treated or untreated rats. After 3-4 days of human BM stromal cell cultivation in the presence of 2-20 microg/ml PRP the appearance of cells expressing CD15, CD10, CD11a, CD11b, CD3, CD4, and CD16 surface antigens did not differ from the untreated cells. PRP increased the appearance of CD14-positive cells upon 3-4-day incubation with both adult and fetal BM stromal cells. Our results suggest a previously undescribed role for the hypothalamic peptide within neurosecretory hypothalamus-bone marrow humoral axis, because PRP enhances BM colony-forming cell proliferation and stromal cell differentiation. PMID:19177842

  5. Cbl-b accelerates trypsin-induced cell detachment through ubiquitination and degradation of proline-rich tyrosine kinase 2.

    PubMed

    Fan, Yibo; Qu, Xiujuan; Ma, Yanju; Qu, Jinglei; Liu, Yunpeng; Hu, Xuejun

    2014-11-01

    Trypsin is a digestive enzyme that is widely used for cell detachment, which is the first stage of tumor metastasis. Recent studies show that adhesion-related kinases are involved in cell detachment. Proline-rich tyrosine kinase 2 (Pyk2) is a crucial kinase in the regulation of cell adhesion and detachment. However, the effect of Pyk2 on cell detachment is controversial. In the present study, we found that Pyk2 expression was rapidly decreased after trypsin treatment in gastric cancer, breast cancer, colon cancer, lung cancer, and human gastric epithelial cells. Knockdown of Pyk2 accelerated cell detachment. Furthermore, lysosome inhibitor NH4CL suppressed cell detachment and increased ubiquitination of Pyk2. Cbl-b is a type of E3 ubiquitin ligase that interacted with Pyk2, reduced the expression of Pyk2, and promoted trypsin-induced degradation of Pyk2. These findings suggest that Cbl-b promoted cell detachment through mono-ubiquitination of Pyk2. Our data provide a new insight into the role of Cbl-b in cell detachment. PMID:25099615

  6. Structures of proline-rich peptides bound to the ribosome reveal a common mechanism of protein synthesis inhibition

    DOE PAGESBeta

    Gagnon, Matthieu G.; Roy, Raktim N.; Lomakin, Ivan B.; Florin, Tanja; Mankin, Alexander S.; Steitz, Thomas A.

    2016-01-24

    Here, with bacterial resistance becoming a serious threat to global public health, antimicrobial peptides (AMPs) have become a promising area of focus in antibiotic research. AMPs are derived from a diverse range of species, from prokaryotes to humans, with a mechanism of action that often involves disruption of the bacterial cell membrane. Proline-rich antimicrobial peptides (PrAMPs) are instead actively transported inside the bacterial cell where they bind and inactivate specific targets. Recently, it was reported that some PrAMPs, such as Bac71–35, oncocins and apidaecins, bind and inactivate the bacterial ribosome. Here we report the crystal structures of Bac71–35, Pyrrhocoricin, Metalnikowinmore » and two oncocin derivatives, bound to the Thermus thermophilus 70S ribosome. Each of the PrAMPs blocks the peptide exit tunnel of the ribosome by simultaneously occupying three well characterized antibioticbinding sites and interferes with the initiation step of translation, thereby revealing a common mechanism of action used by these PrAMPs to inactivate protein synthesis. Our study expands the repertoire of PrAMPs and provides a framework for designing new-generation therapeutics.« less

  7. Ste20-related proline/alanine-rich kinase (SPAK) regulated transcriptionally by hyperosmolarity is involved in intestinal barrier function.

    PubMed

    Yan, Yutao; Dalmasso, Guillaume; Nguyen, Hang Thi Thu; Obertone, Tracy S; Sitaraman, Shanthi V; Merlin, Didier

    2009-01-01

    The Ste20-related protein proline/alanine-rich kinase (SPAK) plays important roles in cellular functions such as cell differentiation and regulation of chloride transport, but its roles in pathogenesis of intestinal inflammation remain largely unknown. Here we report significantly increased SPAK expression levels in hyperosmotic environments, such as mucosal biopsy samples from patients with Crohn's disease, as well as colon tissues of C57BL/6 mice and Caco2-BBE cells treated with hyperosmotic medium. NF-kappaB and Sp1-binding sites in the SPAK TATA-less promoter are essential for SPAK mRNA transcription. Hyperosmolarity increases the ability of NF-kappaB and Sp1 to bind to their binding sites. Knock-down of either NF-kappaB or Sp1 by siRNA reduces the hyperosmolarity-induced SPAK expression levels. Furthermore, expression of NF-kappaB, but not Sp1, was upregulated by hyperosmolarity in vivo and in vitro. Nuclear run-on assays showed that hyperosmolarity increases SPAK expression levels at the transcriptional level, without affecting SPAK mRNA stability. Knockdown of SPAK expression by siRNA or overexpression of SPAK in cells and transgenic mice shows that SPAK is involved in intestinal permeability in vitro and in vivo. Together, our data suggest that SPAK, the transcription of which is regulated by hyperosmolarity, plays an important role in epithelial barrier function. PMID:19343169

  8. Lacrimal Proline Rich 4 (LPRR4) Protein in the Tear Fluid Is a Potential Biomarker of Dry Eye Syndrome

    PubMed Central

    Aluru, Saijyothi Venkata; Agarwal, Shweta; Srinivasan, Bhaskar; Iyer, Geetha Krishnan; Rajappa, Sivakumar M.; Tatu, Utpal; Padmanabhan, Prema; Subramanian, Nirmala; Narayanasamy, Angayarkanni

    2012-01-01

    Dry eye syndrome (DES) is a complex, multifactorial, immune-associated disorder of the tear and ocular surface. DES with a high prevalence world over needs identification of potential biomarkers so as to understand not only the disease mechanism but also to identify drug targets. In this study we looked for differentially expressed proteins in tear samples of DES to arrive at characteristic biomarkers. As part of a prospective case-control study, tear specimen were collected using Schirmer strips from 129 dry eye cases and 73 age matched controls. 2D electrophoresis (2DE) and Differential gel electrophoresis (DIGE) was done to identify differentially expressed proteins. One of the differentially expressed protein in DES is lacrimal proline rich 4 protein (LPRR4). LPRR4 protein expression was quantified by enzyme immune sorbent assay (ELISA). LPRR4 was down regulated significantly in all types of dry eye cases, correlating with the disease severity as measured by clinical investigations. Further characterization of the protein is required to assess its therapeutic potential in DES. PMID:23272196

  9. Perspective of future drugs targeting sterile 20/SPS1-related proline/alanine-rich kinase for blood pressure control

    PubMed Central

    Lin, Gen-Min; Liu, Pang-Yen; Wu, Ching-Fen; Wang, Wen-Been; Han, Chih-Lu

    2015-01-01

    According to a genome-wide association study, intronic SNPs within the human sterile 20/SPS1-related proline/alanine-rich kinase (SPAK) gene was linked to 20% of the general population and may be associated with elevated blood pressure. As cell volume changes, mammalian SPAK kinases respond to phosphorylate and regulate cation-coupled chloride co-transporter activity. To our knowledge, phosphorylation of upstream with-no-lysine (K) (WNK) kinases would activate SPAK kinases. The activation of WNK-OSR1/SPAK cascade on the kidneys and aortic tissue is related to the development of hypertension. Several regulators of the WNK pathway such as the Kelch kinase protein 3 - Cullin 3 E3 ligase, hyperinsulinemia, and low potassium intake to mediate hypertension have been identified. In addition, the SPAK kinases may affect the action of renin-angiotensin-aldosterone system on blood pressure as well. In 2010, two SPAK knock-in and knock-out mouse models have clarified the pathogenesis of lowering blood pressure by influencing the receptors on the kidneys and aortic smooth muscle. More recently, two novel SPAK inhibitors for mice, Stock 1S-14279 and Closantel were discovered in 2014. Targeting of SPAK seems to be promising for future antihypertensive therapy. Therefore we raised some viewpoints for the issue for the antihypertensive therapy on the SPAK (gene or kinase). PMID:26131334

  10. Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice.

    PubMed

    Mellacheruvu, Sunitha; Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2015-01-01

    In this study, we report the overexpression of Cajanus cajan hybrid-proline-rich protein encoding gene (CcHyPRP) in rice which resulted in increased tolerance to both abiotic and biotic stresses. Compared to the control plants, the transgenic rice lines, expressing CcHyPRP, exhibited high-level tolerance against major abiotic stresses, viz., drought, salinity, and heat, as evidenced by increased biomass, chlorophyll content, survival rate, root, and shoot growth. Further, transgenic rice lines showed increased panicle size and grain number compared to the control plants under different stress conditions. The CcHyPRP transgenics, as compared to the control, revealed enhanced activities of catalase and superoxide dismutase (SOD) enzymes and reduced malondialdehyde (MDA) levels. Expression pattern of CcHyPRP::GFP fusion-protein confirmed its predominant localization in cell walls. Moreover, the CcHyPRP transgenics, as compared to the control, exhibited increased resistance to the fungal pathogen Magnaporthe grisea which causes blast disease in rice. Higher levels of bZIP and endochitinase transcripts as well as endochitinase activity were observed in transgenic rice compared to the control plants. The overall results demonstrate the intrinsic role of CcHyPRP in conferring multiple stress tolerance at the whole-plant level. The multipotent CcHyPRP seems promising as a prime candidate gene to fortify crop plants for enhanced tolerance/resistance to different stress factors. PMID:26834756

  11. Actin binding and proline rich motifs of CR16 play redundant role in growth of vrp1Delta cells.

    PubMed

    Meng, Lei; Rajmohan, Rajamuthiah; Yu, Shangjuan; Thanabalu, Thirumaran

    2007-05-25

    CR16, (Glucocorticoid-regulated) belongs to the verprolin family of proteins which are characterized by the presence of a V domain (verprolin) at the N-terminal. Expression of CR16 suppressed the growth and endocytosis defect of vrp1Delta strain without correcting the actin patch polarization defect. The V domain of CR16 is critical for suppression of the growth defect of vrp1Delta strain but not for localisation to cortical actin patches. Mutations in the actin binding motif alone did not abolish the activity of CR16 but the mutations in combination with deletion of N-terminal proline rich motif abolished the ability of CR16 to suppress the growth defect. This suggests that the V domain of CR16 has two functionally redundant motifs and either one of these motifs is sufficient for suppressing the growth defect of vrp1Delta strain. This is in contrast to the observation that both WIP and WIRE require the actin binding motif for their activity. PMID:17418095

  12. Pigeonpea Hybrid-Proline-Rich Protein (CcHyPRP) Confers Biotic and Abiotic Stress Tolerance in Transgenic Rice

    PubMed Central

    Mellacheruvu, Sunitha; Tamirisa, Srinath; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2016-01-01

    In this study, we report the overexpression of Cajanus cajan hybrid-proline-rich protein encoding gene (CcHyPRP) in rice which resulted in increased tolerance to both abiotic and biotic stresses. Compared to the control plants, the transgenic rice lines, expressing CcHyPRP, exhibited high-level tolerance against major abiotic stresses, viz., drought, salinity, and heat, as evidenced by increased biomass, chlorophyll content, survival rate, root, and shoot growth. Further, transgenic rice lines showed increased panicle size and grain number compared to the control plants under different stress conditions. The CcHyPRP transgenics, as compared to the control, revealed enhanced activities of catalase and superoxide dismutase (SOD) enzymes and reduced malondialdehyde (MDA) levels. Expression pattern of CcHyPRP::GFP fusion-protein confirmed its predominant localization in cell walls. Moreover, the CcHyPRP transgenics, as compared to the control, exhibited increased resistance to the fungal pathogen Magnaporthe grisea which causes blast disease in rice. Higher levels of bZIP and endochitinase transcripts as well as endochitinase activity were observed in transgenic rice compared to the control plants. The overall results demonstrate the intrinsic role of CcHyPRP in conferring multiple stress tolerance at the whole-plant level. The multipotent CcHyPRP seems promising as a prime candidate gene to fortify crop plants for enhanced tolerance/resistance to different stress factors. PMID:26834756

  13. Promoter-specific transactivation of hepatitis B virus transcription by a glutamine- and proline-rich domain of hepatocyte nuclear factor 1.

    PubMed Central

    Raney, A K; Easton, A J; Milich, D R; McLachlan, A

    1991-01-01

    The cloned transcription factor hepatocyte nuclear factor 1 (HNF1) transactivates transcription from the hepatitis B virus (HBV) large surface antigen promoter but does not influence the transcriptional activities of the other three HBV promoters. This indicates that this transcription factor can differentially influence the activities of the HBV promoter. By using a transient-transfection system, the major domain of the HNF1 polypeptide involved in transcriptional activation of the large surface antigen promoter in the human hepatoma cell line HepG2.1 has been mapped to a region that is rich in glutamine and proline residues (9 of 18) and is different from the previously identified regions of this factor responsible for in vitro transcriptional activation of a promoter containing human albumin promoter HNF1 binding sites. The human albumin promoter HNF1 binding site mediates transcriptional activation through the same HNF1 polypeptide domain as the HBV large surface antigen promoter HNF1 binding site in transient-transfection assays with HepG2.1 cells, suggesting that HNF1 may possess multiple transcriptional activation domains. Images PMID:1656070

  14. Characterization of a novel spore wall protein NbSWP16 with proline-rich tandem repeats from Nosema bombycis (microsporidia).

    PubMed

    Wang, Ying; Dang, Xiaoqun; Ma, Qiang; Liu, Fangyan; Pan, Guoqing; Li, Tian; Zhou, Zeyang

    2015-04-01

    Nosema bombycis, a pathogen of silkworm pebrine, is an obligate unicellular eukaryotic parasite. It is reported that the spore wall proteins have essential functions in the adherence and infection process of microsporidia. To date, the information related to spore wall proteins from microsporidia is still limited. Here, a 44 kDa spore wall protein NbSWP16 was characterized in N. bombycis. In NbSWP16, a 25 amino acids signal peptide and 3 heparin binding motifs were predicted. Interestingly, a region that contains 3 proline-rich tandem repeats lacking homology to any known protein was also present in this protein. The immunofluorescence analysis (IFA) demonstrated that distinct fluorescent signals were detected both on the surface of mature spores and the germinated spore coats. Immunolocation by electron microscopy revealed that NbSWP16 localized on the exospore regions. Finally, spore adherence analysis indicated that spore adherence to host cell was decreased more than 20% by anti-NbSWP16 blocking compared with the negative control in vitro. In contrast with anti-NbSWP16, no remarkable decrement inhibition was detected when antibodies of NbSWP16 and NbSWP5 were used simultaneously. Collectively, these results suggest that NbSWP16 is a new exospore protein and probably be involved in spore adherence of N. bombycis. PMID:25363531

  15. Human tastin, a proline-rich cytoplasmic protein, associates with the microtubular cytoskeleton.

    PubMed Central

    Nadano, Daita; Nakayama, Jun; Matsuzawa, Shu-Ichi; Sato, Taka-Aki; Matsuda, Tsukasa; Fukuda, Michiko N

    2002-01-01

    Tastin was originally identified as an accessory protein for trophinin, a cell adhesion molecule that potentially mediates the initial attachment of the human embryo to the uterine epithelium. However, no information regarding tastin's function is available to date. The present study is aimed at understanding the role of tastin in mammalian cells. Hence, we examined the intracellular localization of tastin in human cell lines transfected with an expression vector encoding influenza virus haemagglutinin (HA)-tagged tastin. Ectopically expressed HA-tastin was seen as a pattern resembling the fibres that overlap the microtubular cytoskeleton. When HA-tastin-expressing cells were cultured with nocodazole to disrupt microtubule (MT) polymerization, tastin was dispersed to the entire cytoplasm and an MT sedimentation assay showed tastin in the supernatant; however, tastin was sedimented with polymeric MTs in cell lysates not treated with nocodazole. Sedimentation assays using HA-tastin mutants deleted at the N- or C-terminus revealed MT-binding activity associated with the N-terminal basic region of tastin. A yeast two-hybrid screen for tastin-interacting proteins identified Tctex-1, one of the light chains of cytoplasmic dynein, as a tastin-binding protein. Immunoprecipitation and Western-blot analysis confirmed binding of HA-tagged tastin and FLAG (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys epitope)-tagged Tctex-1 in human cells. Furthermore, in vitro assays have demonstrated the binding between a fusion protein, glutathione S-transferase-Tctex-1, and in vitro translated (35)S-labelled tastin. As Tctex-1 is a component of a MT-based molecular motor, these results suggest that tastin plays an important role in mammalian cells by associating with the microtubular cytoskeleton. PMID:12049630

  16. The Influence of Pathological Mutations and Proline Substitutions in TDP-43 Glycine-Rich Peptides on Its Amyloid Properties and Cellular Toxicity

    PubMed Central

    Sun, Chia-Sui; Wang, Cindy Yu-Hsiang; Chen, Bryan Po-Wen; He, Ruei-Yu; Liu, Gerard Chun-Hao; Wang, Chih-Hsien; Chen, Wenlung; Chern, Yijuang; Huang, Joseph Jen-Tse

    2014-01-01

    TAR DNA-binding protein (TDP-43) was identified as the major ubiquitinated component deposited in the inclusion bodies in amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U) in 2006. Later on, numerous ALS-related mutations were found in either the glycine or glutamine/asparagine-rich region on the TDP-43 C-terminus, which hinted on the importance of mutations on the disease pathogenesis. However, how the structural conversion was influenced by the mutations and the biological significance of these peptides remains unclear. In this work, various peptides bearing pathogenic or de novo designed mutations were synthesized and displayed their ability to form twisted amyloid fibers, cause liposome leakage, and mediate cellular toxicity as confirmed by transmission electron microscopy (TEM), circular dichroism (CD), Thioflavin T (ThT) assay, Raman spectroscopy, calcein leakage assay, and cell viability assay. We have also shown that replacing glycines with prolines, known to obstruct β-sheet formation, at the different positions in these peptides may influence the amyloidogenesis process and neurotoxicity. In these cases, GGG308PPP mutant was not able to form beta-amyloid, cause liposome leakage, nor jeopardized cell survival, which hinted on the importance of the glycines (308–310) during amyloidogenesis. PMID:25090004

  17. The influence of pathological mutations and proline substitutions in TDP-43 glycine-rich peptides on its amyloid properties and cellular toxicity.

    PubMed

    Sun, Chia-Sui; Wang, Cindy Yu-Hsiang; Chen, Bryan Po-Wen; He, Ruei-Yu; Liu, Gerard Chun-Hao; Wang, Chih-Hsien; Chen, Wenlung; Chern, Yijuang; Huang, Joseph Jen-Tse

    2014-01-01

    TAR DNA-binding protein (TDP-43) was identified as the major ubiquitinated component deposited in the inclusion bodies in amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U) in 2006. Later on, numerous ALS-related mutations were found in either the glycine or glutamine/asparagine-rich region on the TDP-43 C-terminus, which hinted on the importance of mutations on the disease pathogenesis. However, how the structural conversion was influenced by the mutations and the biological significance of these peptides remains unclear. In this work, various peptides bearing pathogenic or de novo designed mutations were synthesized and displayed their ability to form twisted amyloid fibers, cause liposome leakage, and mediate cellular toxicity as confirmed by transmission electron microscopy (TEM), circular dichroism (CD), Thioflavin T (ThT) assay, Raman spectroscopy, calcein leakage assay, and cell viability assay. We have also shown that replacing glycines with prolines, known to obstruct β-sheet formation, at the different positions in these peptides may influence the amyloidogenesis process and neurotoxicity. In these cases, GGG308PPP mutant was not able to form beta-amyloid, cause liposome leakage, nor jeopardized cell survival, which hinted on the importance of the glycines (308-310) during amyloidogenesis. PMID:25090004

  18. Multimeric and differential binding of CIN85/CD2AP with two atypical proline-rich sequences from CD2 and Cbl-b*.

    PubMed

    Ceregido, M Angeles; Garcia-Pino, Abel; Ortega-Roldan, Jose L; Casares, Salvador; López Mayorga, Obdulio; Bravo, Jeronimo; van Nuland, Nico A J; Azuaga, Ana I

    2013-07-01

    The CD2AP (CD2-associated protein) and CIN85 (Cbl-interacting protein of 85 kDa) adaptor proteins each employ three Src homology 3 (SH3) domains to cluster protein partners and ensure efficient signal transduction and down-regulation of tyrosine kinase receptors. Using NMR, isothermal titration calorimetry and small-angle X-ray scattering methods, we have characterized several binding modes of the N-terminal SH3 domain (SH3A) of CD2AP and CIN85 with two natural atypical proline-rich regions in CD2 (cluster of differentiation 2) and Cbl-b (Casitas B-lineage lymphoma), and compared these data with previous studies and published crystal structures. Our experiments show that the CD2AP-SH3A domain forms a type II dimer with CD2 and both type I and type II dimeric complexes with Cbl-b. Like CD2AP, the CIN85-SH3A domain forms a type II complex with CD2, but a trimeric complex with Cbl-b, whereby the type I and II interactions take place at the same time. Together, these results explain how multiple interactions among similar SH3 domains and ligands produce a high degree of diversity in tyrosine kinase, cell adhesion or T-cell signaling pathways. PMID:23663663

  19. The central nervous system as target for antihypertensive actions of a proline-rich peptide from Bothrops jararaca venom.

    PubMed

    Lameu, Claudiana; Hayashi, Mirian A F; Guerreiro, Juliano R; Oliveira, Eduardo F; Lebrun, Ivo; Pontieri, Vera; Morais, Kátia L P; Camargo, Antonio C M; Ulrich, Henning

    2010-03-01

    Pyroglutamyl proline-rich oligopeptides, present in the venom of the pit viper Bothrops jararaca (Bj-PROs), are the first described naturally occurring inhibitors of the angiotensin I-converting enzyme (ACE). The inhibition of ACE by the decapeptide Bj-PRO-10c (

  20. Group A Streptococcus Adheres to Pharyngeal Epithelial Cells with Salivary Proline-rich Proteins via GrpE Chaperone Protein*

    PubMed Central

    Murakami, Jumpei; Terao, Yutaka; Morisaki, Ichijiro; Hamada, Shigeyuki; Kawabata, Shigetada

    2012-01-01

    Group A Streptococcus pyogenes (GAS) is an important human pathogen that frequently causes pharyngitis. GAS organisms can adhere to and invade pharyngeal epithelial cells, which are overlaid by salivary components. However, the role of salivary components in GAS adhesion to pharyngeal cells has not been reported precisely. We collected human saliva and purified various salivary components, including proline-rich protein (PRP), statherin, and amylase, and performed invasion assays. The GAS-HEp-2 association ratio (invasion/adhesion ratio) and invasion ratio of GAS were increased significantly with whole human saliva and PRP, while the anti-PRP antibody inhibited the latter. GAS strain NY-5, which lacks M and F proteins on the cell surface, was promoted to cohere with HEp-2 cells by whole human saliva and PRP. The 28-kDa protein of GAS bound to PRP and was identified as GrpE, a chaperone protein, whereas the N-terminal of GrpE was found to bind to PRP. A GrpE-deficient mutant of GAS strain B514Sm, TR-45, exhibited a reduced ability to adhere to and invade HEp-2 cells. Microscopic observations showed the GrpE was mainly expressed on the surface of the cell division site of GAS. Furthermore, GrpE-deficient mutants of GAS and Streptococcus pneumoniae showed an elongated morphology as compared with the wild type. Taken together, this is the first study to show an interaction between salivary PRP and GAS GrpE, which plays an important role in GAS infection on the pharynx, whereas the expression of GrpE on the surface of GAS helps to maintain morphology. PMID:22566698

  1. Neutralization of endotoxin in vitro and in vivo by Bac7(1-35), a proline-rich antibacterial peptide.

    PubMed

    Ghiselli, Roberto; Giacometti, Andrea; Cirioni, Oscar; Circo, Raffaella; Mocchegiani, Federico; Skerlavaj, Barbara; D'Amato, Giuseppina; Scalise, Giorgio; Zanetti, Margherita; Saba, Vittorio

    2003-06-01

    Lipopolysaccharides (LPS), or endotoxins, are structural components of gram-negative bacteria implicated in the pathogenesis of septic shock. In this study the antiendotoxin activity of Bac7(1-35), a synthetic peptide based on the sequence of a proline-rich antibacterial peptide from bovine neutrophils, was investigated in vitro and in an experimental rat model of gram-negative septic shock. The ability of Bac7(1-35) to bind LPS from Escherichia coli O111:B4 was determined using a sensitive Limulus chromogenic assay. In the in vivo study, adult male Wistar rats were given an intraperitoneal injection of 1 x 10(9) colony-forming units of E. coli ATCC 25922. All animals were randomized to receive intraperitoneally 1 mg/kg Bac7(1-35), or isotonic sodium chloride solution (control group C1), 60 mg/kg of piperacillin and 1 mg/kg polymyxin B, 1 mg/kg of polymyxin B plus 60 mg/kg of piperacillin, and 1 mg/kg of Bac7(1-35) plus 60 mg/kg of piperacillin. Each group included 15 animals. Bac7(1-35) was found to completely inhibit the LPS procoagulant activity at approximately 10 microM peptide concentration, as determined by in vitro LAL chromogenic assay. Treatment with Bac7(1-35) resulted in significant decrease in plasma endotoxin levels and lethality rates compared with saline injected control animals. No statistically significant differences were noted between Bac7(1-35) and polymyxin B in reducing all variables measured. These results provide evidence for the ability of Bac7(1-35) to effectively bind LPS and protect animals from lethal effects of this molecule, and point to its potential use for the treatment of endotoxin-induced septic shock. PMID:12785015

  2. Aggregation of the salivary proline-rich protein IB5 in the presence of the tannin EgCG.

    PubMed

    Canon, Francis; Paté, Franck; Cheynier, Véronique; Sarni-Manchado, Pascale; Giuliani, Alexandre; Pérez, Javier; Durand, Dominique; Li, Joaquim; Cabane, Bernard

    2013-02-12

    In the mouth, proline-rich proteins (PRP), which are major components of stimulated saliva, interact with tannins contained in food. We report in vitro interactions of the tannin epigallocatechin gallate (EgCG), with a basic salivary PRP, IB5, studied through electrospray ionization mass spectrometry (ESI-MS), small-angle X-ray scattering (SAXS), and dynamic light scattering (DLS). In dilute protein (IB5) solutions of low ionic strength (1 mM), the proteins repel each other, and the tannins bind to nonaggregated proteins. ESI-MS experiments determine the populations of nonaggregated proteins that have bound various numbers of tannin molecules. These populations match approximately the Poisson distribution for binding to n = 8 sites on the protein. MS/MS experiments confirm that complexes containing n = 1 to 8 EgCG molecules are dissociated with the same energy. Assuming that the 8 sites are equivalent, we calculate a binding isotherm, with a binding free energy Δμ = 7.26RT(a) (K(d) = 706 μM). In protein solutions that are more concentrated (0.21 mM) and at higher ionic strength (50 mM, pH 5.5), the tannins can bridge the proteins together. DLS experiments measure the number of proteins per aggregate. This number rises rapidly when the EgCG concentration exceeds a threshold (0.2 mM EgCG for 0.21 mM of IB5). SAXS experiments indicate that the aggregates have a core-corona structure. The core contains proteins that have bound at least 3 tannins and the corona has proteins with fewer bound tannins. These aggregates coexist with nonaggregated proteins. Increasing the tannin concentration beyond the threshold causes the transfer of proteins to the aggregates and a fast rise of the number of proteins per aggregate. A poisoned growth model explains this fast rise. Very large cationic aggregates, containing up to 10,000 proteins, are formed at tannin concentrations (2 mM) slightly above the aggregation threshold (0.2 mM). PMID:23297743

  3. Production and characterization of two major Aspergillus oryzae secreted prolyl endopeptidases able to efficiently digest proline-rich peptides of gliadin.

    PubMed

    Eugster, Philippe J; Salamin, Karine; Grouzmann, Eric; Monod, Michel

    2015-12-01

    Prolyl endopeptidases are key enzymes in the digestion of proline-rich proteins. Fungal extracts rich in prolyl endopeptidases produced by a species such as Aspergillus oryzae used in food fermentation would be of particular interest for the development of an oral enzyme therapy product in patients affected by intolerance to gluten. Two major A. oryzae secreted prolyl endopeptidases of the MEROPS S28 peptidase family, AoS28A and AoS28B, were identified when this fungus was grown at acidic pH in a medium containing soy meal protein or wheat gliadin as the sole source of nitrogen. AoS28B was produced by 12 reference A. oryzae strains used in food fermentation. AoS28A was secreted by six of these 12 strains. This protease is the orthologue of the previously characterized Aspergillus fumigatus (AfuS28) and Aspergillus niger (AN-PEP) prolyl endopeptidases which are encoded by genes with a similar intron-exon structure. Large amounts of secreted AoS28A and AoS28B were obtained by gene overexpression in A. oryzae. AoS28A and AoS28B are endoproteases able to cleave N-terminally blocked proline substrates. Both enzymes very efficiently digested the proline-rich 33-mer of gliadin, the most representative immunotoxic peptide deriving from gliadin, with some differences in terms of specificity and optimal pH. Digestion of the gliadin peptide in short peptides with both enzymes was found to occur from its N terminus. PMID:26464108

  4. Genome-wide analyses and functional classification of proline repeat-rich proteins: potential role of eIF5A in eukaryotic evolution.

    PubMed

    Mandal, Ajeet; Mandal, Swati; Park, Myung Hee

    2014-01-01

    The eukaryotic translation factor, eIF5A has been recently reported as a sequence-specific elongation factor that facilitates peptide bond formation at consecutive prolines in Saccharomyces cerevisiae, as its ortholog elongation factor P (EF-P) does in bacteria. We have searched the genome databases of 35 representative organisms from six kingdoms of life for PPP (Pro-Pro-Pro) and/or PPG (Pro-Pro-Gly)-encoding genes whose expression is expected to depend on eIF5A. We have made detailed analyses of proteome data of 5 selected species, Escherichia coli, Saccharomyces cerevisiae, Drosophila melanogaster, Mus musculus and Homo sapiens. The PPP and PPG motifs are low in the prokaryotic proteomes. However, their frequencies markedly increase with the biological complexity of eukaryotic organisms, and are higher in newly derived proteins than in those orthologous proteins commonly shared in all species. Ontology classifications of S. cerevisiae and human genes encoding the highest level of polyprolines reveal their strong association with several specific biological processes, including actin/cytoskeletal associated functions, RNA splicing/turnover, DNA binding/transcription and cell signaling. Previously reported phenotypic defects in actin polarity and mRNA decay of eIF5A mutant strains are consistent with the proposed role for eIF5A in the translation of the polyproline-containing proteins. Of all the amino acid tandem repeats (≥3 amino acids), only the proline repeat frequency correlates with functional complexity of the five organisms examined. Taken together, these findings suggest the importance of proline repeat-rich proteins and a potential role for eIF5A and its hypusine modification pathway in the course of eukaryotic evolution. PMID:25364902

  5. Genome-Wide Analyses and Functional Classification of Proline Repeat-Rich Proteins: Potential Role of eIF5A in Eukaryotic Evolution

    PubMed Central

    Mandal, Ajeet; Mandal, Swati; Park, Myung Hee

    2014-01-01

    The eukaryotic translation factor, eIF5A has been recently reported as a sequence-specific elongation factor that facilitates peptide bond formation at consecutive prolines in Saccharomyces cerevisiae, as its ortholog elongation factor P (EF-P) does in bacteria. We have searched the genome databases of 35 representative organisms from six kingdoms of life for PPP (Pro-Pro-Pro) and/or PPG (Pro-Pro-Gly)-encoding genes whose expression is expected to depend on eIF5A. We have made detailed analyses of proteome data of 5 selected species, Escherichia coli, Saccharomyces cerevisiae, Drosophila melanogaster, Mus musculus and Homo sapiens. The PPP and PPG motifs are low in the prokaryotic proteomes. However, their frequencies markedly increase with the biological complexity of eukaryotic organisms, and are higher in newly derived proteins than in those orthologous proteins commonly shared in all species. Ontology classifications of S. cerevisiae and human genes encoding the highest level of polyprolines reveal their strong association with several specific biological processes, including actin/cytoskeletal associated functions, RNA splicing/turnover, DNA binding/transcription and cell signaling. Previously reported phenotypic defects in actin polarity and mRNA decay of eIF5A mutant strains are consistent with the proposed role for eIF5A in the translation of the polyproline-containing proteins. Of all the amino acid tandem repeats (≥3 amino acids), only the proline repeat frequency correlates with functional complexity of the five organisms examined. Taken together, these findings suggest the importance of proline repeat-rich proteins and a potential role for eIF5A and its hypusine modification pathway in the course of eukaryotic evolution. PMID:25364902

  6. C-Terminal proline-rich sequence broadens the optimal temperature and pH ranges of recombinant xylanase from Geobacillus thermodenitrificans C5.

    PubMed

    Irfan, Muhammad; Guler, Halil Ibrahim; Ozer, Aysegul; Sapmaz, Merve Tuncel; Belduz, Ali Osman; Hasan, Fariha; Shah, Aamer Ali

    2016-09-01

    Efficient utilization of hemicellulose entails high catalytic capacity containing xylanases. In this study, proline rich sequence was fused together with a C-terminal of xylanase gene from Geobacillus thermodenitrificans C5 and designated as GthC5ProXyl. Both GthC5Xyl and GthC5ProXyl were expressed in Escherichia coli BL21 host in order to determine effect of this modification. The C-terminal oligopeptide had noteworthy effects and instantaneously extended the optimal temperature and pH ranges and progressed the specific activity of GthC5Xyl. Compared with GthC5Xyl, GthC5ProXyl revealed improved specific activity, a higher temperature (70°C versus 60°C) and pH (8 versus 6) optimum, with broad ranges of temperature and pH (60-80°C and 6.0-9.0 versus 40-60°C and 5.0-8.0, respectively). The modified enzyme retained more than 80% activity after incubating in xylan for 3h at 80°C as compared to wild -type with only 45% residual activity. Our study demonstrated that proper introduction of proline residues on C-terminal surface of xylanase family might be very effective in improvement of enzyme thermostability. Moreover, this study reveals an engineering strategy to improve the catalytic performance of enzymes. PMID:27444327

  7. Epigenetic regulation of embryonic stem cell marker miR302C in human chondrosarcoma as determinant of antiproliferative activity of proline-rich polypeptide 1.

    PubMed

    Galoian, Karina; Qureshi, Amir; D'Ippolito, Gianluca; Schiller, Paul C; Molinari, Marco; Johnstone, Andrea L; Brothers, Shaun P; Paz, Ana C; Temple, H T

    2015-08-01

    Metastatic chondrosarcoma of mesenchymal origin is the second most common bone malignancy and does not respond either to chemotherapy or radiation; therefore, the search for new therapies is relevant and urgent. We described recently that tumor growth inhibiting cytostatic proline-rich polypeptide 1, (PRP-1) significantly upregulated tumor suppressor miRNAs, downregulated onco-miRNAs in human chondrosarcoma JJ012 cell line, compared to chondrocytes culture. In this study we hypothesized the existence and regulation of a functional marker in cancer stem cells, correlated to peptides antiproliferative activity. Experimental results indicated that among significantly downregulated miRNA after PRP-1treatment was miRNAs 302c*. This miRNA is a part of the cluster miR302‑367, which is stemness regulator in human embryonic stem cells and in certain tumors, but is not expressed in adult hMSCs and normal tissues. PRP-1 had strong inhibitory effect on viability of chondrosarcoma and multilineage induced multipotent adult cells (embryonic primitive cell type). Unlike chondrosarcoma, in glioblastoma, PRP-1 does not have any inhibitory activity on cell proliferation, because in glioblastoma miR-302-367 cluster plays an opposite role, its expression is sufficient to suppress the stemness inducing properties. The observed correlation between the antiproliferative activity of PRP-1 and its action on downregulation of miR302c explains the peptides opposite effects on the upregulation of proliferation of adult mesenchymal stem cells, and the inhibition of the proliferation of human bone giant-cell tumor stromal cells, reported earlier. PRP-1 substantially downregulated the miR302c targets, the stemness markers Nanog, c-Myc and polycomb protein Bmi-1. miR302c expression is induced by JMJD2-mediated H3K9me2 demethylase activity in its promoter region. JMJD2 was reported to be a positive regulator for Nanog. Our experimental results proved that PRP-1 strongly inhibited H3K9 activity

  8. Epigenetic regulation of embryonic stem cell marker miR302C in human chondrosarcoma as determinant of antiproliferative activity of proline-rich polypeptide 1

    PubMed Central

    GALOIAN, KARINA; QURESHI, AMIR; D’IPPOLITO, GIANLUCA; SCHILLER, PAUL C.; MOLINARI, MARCO; JOHNSTONE, ANDREA L.; BROTHERS, SHAUN P.; PAZ, ANA C.; TEMPLE, H.T.

    2015-01-01

    Metastatic chondrosarcoma of mesenchymal origin is the second most common bone malignancy and does not respond either to chemotherapy or radiation; therefore, the search for new therapies is relevant and urgent. We described recently that tumor growth inhibiting cytostatic proline-rich polypeptide 1, (PRP-1) significantly upregulated tumor suppressor miRNAs, downregulated onco-miRNAs in human chondrosarcoma JJ012 cell line, compared to chondrocytes culture. In this study we hypothesized the existence and regulation of a functional marker in cancer stem cells, correlated to peptides antiproliferative activity. Experimental results indicated that among significantly downregulated miRNA after PRP-1treatment was miRNAs 302c*. This miRNA is a part of the cluster miR302-367, which is stemness regulator in human embryonic stem cells and in certain tumors, but is not expressed in adult hMSCs and normal tissues. PRP-1 had strong inhibitory effect on viability of chondrosarcoma and multilineage induced multipotent adult cells (embryonic primitive cell type). Unlike chondrosarcoma, in glioblastoma, PRP-1 does not have any inhibitory activity on cell proliferation, because in glioblastoma miR-302-367 cluster plays an opposite role, its expression is sufficient to suppress the stemness inducing properties. The observed correlation between the antiproliferative activity of PRP-1 and its action on downregulation of miR302c explains the peptides opposite effects on the upregulation of proliferation of adult mesenchymal stem cells, and the inhibition of the proliferation of human bone giant-cell tumor stromal cells, reported earlier. PRP-1 substantially downregulated the miR302c targets, the stemness markers Nanog, c-Myc and polycomb protein Bmi-1. miR302c expression is induced by JMJD2-mediated H3K9me2 demethylase activity in its promoter region. JMJD2 was reported to be a positive regulator for Nanog. Our experimental results proved that PRP-1 strongly inhibited H3K9 activity

  9. Proline puckering parameters for collagen structure simulations

    SciTech Connect

    Wu, Di

    2015-03-15

    Collagen is made of triple helices rich in proline residues, and hence is influenced by the conformational motions of prolines. Because the backbone motions of prolines are restricted by the helical structures, the only side chain motion—proline puckering—becomes an influential factor that may affect the stability of collagen structures. In molecular simulations, a proper proline puckering population is desired so to yield valid results of the collagen properties. Here we design the proline puckering parameters in order to yield suitable proline puckering populations as demonstrated in the experimental results. We test these parameters in collagen and the proline dipeptide simulations. Compared with the results of the PDB and the quantum calculations, we propose the proline puckering parameters for the selected collagen model simulations.

  10. Proteomic analysis of MCF-7 cell lines expressing the zinc-finger or the proline-rich domain of retinoblastoma-interacting-zinc-finger protein.

    PubMed

    Chambery, Angela; Farina, Annarita; Di Maro, Antimo; Rossi, Mariangela; Abbondanza, Ciro; Moncharmont, Bruno; Malorni, Livia; Cacace, Giuseppina; Pocsfalvi, Gabriella; Malorni, Antonio; Parente, Augusto

    2006-05-01

    To identify a growth-promoting activity related to retinoblastoma-interacting-zinc-finger (RIZ) protein, differential protein expression of MCF-7 cell lines expressing the zinc-finger or the proline-rich domain of RIZ protein was analyzed by a robust bottom-up mass-spectrometry proteomic approach. Spots corresponding to qualitative and quantitative differences in protein expression have been selected and identified. Some of these proteins have been previously reported as being associated with different types of carcinomas or involved in cell proliferation and differentiation. Knowledge of specific differentially expressed proteins by MCF-7-derived cell lines expressing RIZ different domains will provide the basis for identifying a growth-promoting activity related to RIZ gene products. PMID:16674107

  11. A Proline-Rich Motif within the Matrix Protein of Vesicular Stomatitis Virus and Rabies Virus Interacts with WW Domains of Cellular Proteins: Implications for Viral Budding

    PubMed Central

    Harty, Ronald N.; Paragas, Jason; Sudol, Marius; Palese, Peter

    1999-01-01

    The matrix (M) protein of rhabdoviruses has been shown to play a key role in virus assembly and budding; however, the precise mechanism by which M mediates these processes remains unclear. We have associated a highly conserved, proline-rich motif (PPxY or PY motif, where P denotes proline, Y represents tyrosine, and x denotes any amino acid) of rhabdoviral M proteins with a possible role in budding mediated by the M protein. Point mutations that disrupt the PY motif of the M protein of vesicular stomatitis virus (VSV) have no obvious effect on membrane localization of M but instead lead to a decrease in the amount of M protein released from cells in a functional budding assay. Interestingly, the PPxY sequence within rhabdoviral M proteins is identical to that of the ligand which interacts with WW domains of cellular proteins. Indeed, results from two in vitro binding assays demonstrate that amino acids 17 through 33 and 29 through 44, which contain the PY motifs of VSV and rabies virus M proteins, respectively, mediate interactions with WW domains of specific cellular proteins. Point mutations that disrupt the consensus PY motif of VSV or rabies virus M protein result in a significant decrease in their ability to interact with the WW domains. These properties of the PY motif of rhabdovirus M proteins are strikingly analogous to those of the late (L) budding domain identified in the gag-specific protein p2b of Rous sarcoma virus. Thus, it is possible that rhabdoviruses may usurp host proteins to facilitate the budding process and that late stages in the budding process of rhabdoviruses and retroviruses may have features in common. PMID:10074141

  12. Transcriptional activation by the sexual pheromone and wounding: a new gene family from Volvox encoding modular proteins with (hydroxy)proline-rich and metalloproteinase homology domains.

    PubMed

    Hallmann, A; Amon, P; Godl, K; Heitzer, M; Sumper, M

    2001-06-01

    The green alga Volvox represents the simplest kind of multicellular organism: it is composed of only two cell types, somatic and reproductive, making it suitable as a model system. The sexual development of males and females of Volvox carteri is triggered by a sex-inducing pheromone at a concentration of < 10-16 M. Early biochemical responses to the pheromone involve structural modifications within the extracellular matrix (ECM). By differential screenings of cDNA libraries made from mRNAs of pheromone-treated Volvox, four novel genes were identified that encode four closely related Volvox metalloproteinases that we use to define a new protein family, the VMPs. The existence of several features common to matrix glycoproteins, such as signal peptides, a (hydroxy)proline content of 12-25%, and Ser(Pro)2-4 repeats, suggest an extracellular localization of the VMPs within the ECM. Synthesis of VMP cDNAs is triggered not only by the sex-inducing pheromone, but also by wounding, and is restricted to the somatic cell type. Sequence comparisons suggest that the VMPs are members of the MB clan of zinc-dependent matrix metalloproteinases, although the putative zinc binding site of all VMPs is QEXXHXXGXXH rather than HEXXHXXGXXH. The presence of glutamine instead of histidine in the zinc binding motif suggests a novel family, or even clan, of peptidases. Like the matrixin family of human collagenases, Volvox VMPs exhibit a modular structure: they possess a metalloproteinase homology domain and a (hydroxy)proline-rich domain, and one of them, VMP4, also has two additional domains. Metalloproteinases seem to be crucial for biochemical modifications of the ECM during development or after wounding in the lower eukaryote Volvox with only two cell types, just as in higher organisms. PMID:11489172

  13. RNA-Seq Profiling of a Defective Seed Coat Mutation in Glycine max Reveals Differential Expression of Proline-Rich and Other Cell Wall Protein Transcripts

    PubMed Central

    Kour, Anupreet; Boone, Anne M.; Vodkin, Lila O.

    2014-01-01

    The plant cell wall performs a number of essential functions including providing shape to many different cell types and serving as a defense against potential pathogens. The net pattern mutation creates breaks in the seed coat of soybean (Glycine max) because of ruptured cell walls. Using RNA-Seq, we examined the seed coat transcriptome from three stages of immature seed development in two pairs of isolines with normal or defective seed coat phenotypes due to the net pattern. The genome-wide comparative study of the transcript profiles of these isolines revealed 364 differentially expressed genes in common between the two varieties that were further divided into different broad functional categories. Genes related to cell wall processes accounted for 19% of the differentially expressed genes in the middle developmental stage of 100–200 mg seed weight. Within this class, the cell wall proline-rich and glycine-rich protein genes were highly differentially expressed in both genetic backgrounds. Other genes that showed significant expression changes in each of the isoline pairs at the 100–200 mg seed weight stage were xylem serine proteinase, fasciclin-related genes, auxin and stress response related genes, TRANSPARENT TESTA 1 (TT1) and other transcription factors. The mutant appears to shift the timing of either the increase or decrease in the levels of some of the transcripts. The analysis of these data sets reveals the physiological changes that the seed coat undergoes during the formation of the breaks in the cell wall. PMID:24828743

  14. Structural Characterization of Proline-rich Tyrosine Kinase 2 (PYK2) Reveals a Unique (DFG-out) Conformation and Enables Inhibitor Design

    PubMed Central

    Han, Seungil; Mistry, Anil; Chang, Jeanne S.; Cunningham, David; Griffor, Matt; Bonnette, Peter C.; Wang, Hong; Chrunyk, Boris A.; Aspnes, Gary E.; Walker, Daniel P.; Brosius, Arthur D.; Buckbinder, Leonard

    2009-01-01

    Proline-rich tyrosine kinase 2 (PYK2) is a cytoplasmic, non-receptor tyrosine kinase implicated in multiple signaling pathways. It is a negative regulator of osteogenesis and considered a viable drug target for osteoporosis treatment. The high-resolution structures of the human PYK2 kinase domain with different inhibitor complexes establish the conventional bilobal kinase architecture and show the conformational variability of the DFG loop. The basis for the lack of selectivity for the classical kinase inhibitor, PF-431396, within the FAK family is explained by our structural analyses. Importantly, the novel DFG-out conformation with two diarylurea inhibitors (BIRB796, PF-4618433) reveals a distinct subclass of non-receptor tyrosine kinases identifiable by the gatekeeper Met-502 and the unique hinge loop conformation of Leu-504. This is the first example of a leucine residue in the hinge loop that blocks the ATP binding site in the DFG-out conformation. Our structural, biophysical, and pharmacological studies suggest that the unique features of the DFG motif, including Leu-504 hinge-loop variability, can be exploited for the development of selective protein kinase inhibitors. PMID:19244237

  15. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    SciTech Connect

    Chen, J.; Varner, J.E.

    1985-07-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.

  16. Structural Characterization of Proline-rich Tyrosine Kinase 2 (PYK2) Reveals a Unique (DFG-out) Conformation and Enables Inhibitor Design

    SciTech Connect

    Han, Seungil; Mistry, Anil; Chang, Jeanne S.; Cunningham, David; Griffor, Matt; Bonnette, Peter C.; Wang, Hong; Chrunyk, Boris A.; Aspnes, Gary E.; Walker, Daniel P.; Brosius, Arthur D.; Buckbinder, Leonard; Pfizer

    2009-05-21

    Proline-rich tyrosine kinase 2 (PYK2) is a cytoplasmic, non-receptor tyrosine kinase implicated in multiple signaling pathways. It is a negative regulator of osteogenesis and considered a viable drug target for osteoporosis treatment. The high-resolution structures of the human PYK2 kinase domain with different inhibitor complexes establish the conventional bilobal kinase architecture and show the conformational variability of the DFG loop. The basis for the lack of selectivity for the classical kinase inhibitor, PF-431396, within the FAK family is explained by our structural analyses. Importantly, the novel DFG-out conformation with two diarylurea inhibitors (BIRB796, PF-4618433) reveals a distinct subclass of non-receptor tyrosine kinases identifiable by the gatekeeper Met-502 and the unique hinge loop conformation of Leu-504. This is the first example of a leucine residue in the hinge loop that blocks the ATP binding site in the DFG-out conformation. Our structural, biophysical, and pharmacological studies suggest that the unique features of the DFG motif, including Leu-504 hinge-loop variability, can be exploited for the development of selective protein kinase inhibitors.

  17. Small proline-rich repeat protein 3 enhances the sensitivity of esophageal cancer cells in response to DNA damage-induced apoptosis.

    PubMed

    Luo, Aiping; Chen, Hongyan; Ding, Fang; Zhang, Yu; Wang, Mingrong; Xiao, Zefen; Liu, Zhihua

    2013-10-01

    Small proline-rich repeat protein 3 (SPRR3) has been linked with the altered chemoradiosensitivity, however the underlying molecular mechanisms remain elusive. Here, we report that ectopic overexpression of SPRR3 enhanced the sensitivity of cells in response to DNA damage-induced apoptosis via loss of mitochondrial membrane potential (MMP), and increasing activation of caspase 3 in human esophageal cancer cell lines. Conversely, siRNA knockdown of SPRR3 reduced apoptosis. We found that SPRR3 was localized in mitochondria and interacted with Bcl-2 in vivo, thus facilitating Bax mitochondrial translocation and the subsequent release of cytochrome c, and thereby enhancing cell sensitivity to DNA damage stimuli. In clinical samples, expression of SPRR3 was associated with the pathologic response (P = 0.007 in radiotherapy group, P = 0.035 in preoperative radiotherapy group) and good survival of patients with locally advanced esophageal squamous cell carcinoma (ESCC, P = 0.008). Taken together, our results implicate that SPRR3 might serve as a radiation-sensitive predictor of ESCC. PMID:23820115

  18. Binding Mechanism of the N-Terminal SH3 Domain of CrkII and Proline-Rich Motifs in cAbl.

    PubMed

    Bhatt, Veer S; Zeng, Danyun; Krieger, Inna; Sacchettini, James C; Cho, Jae-Hyun

    2016-06-21

    The N-terminal Src homology 3 (nSH3) domain of a signaling adaptor protein, CT-10 regulator of kinase II (CrkII), recognizes proline-rich motifs (PRMs) of binding partners, such as cAbl kinase. The interaction between CrkII and cAbl kinase is involved in the regulation of cell spreading, microbial pathogenesis, and cancer metastasis. Here, we report the detailed biophysical characterizations of the interactions between the nSH3 domain of CrkII and PRMs in cAbl. We identified that the nSH3 domain of CrkII binds to three PRMs in cAbl with virtually identical affinities. Structural studies, by using x-ray crystallography and NMR spectroscopy, revealed that the binding modes of all three nSH3:PRM complexes are highly similar to each other. Van 't Hoff analysis revealed that nSH3:PRM interaction is associated with favorable enthalpy and unfavorable entropy change. The combination of experimentally determined thermodynamic parameters, structure-based calculations, and (15)N NMR relaxation analysis highlights the energetic contribution of conformational entropy change upon the complex formation, and water molecules structured in the binding interface of the nSH3:PRM complex. Understanding the molecular basis of nSH3:PRM interaction will provide, to our knowledge, new insights for the rational design of small molecules targeting the interaction between CrkII and cAbl. PMID:27332121

  19. Proline-rich tyrosine kinase 2 via enhancing signal transducer and activator of transcription 3-dependent cJun expression mediates retinal neovascularization

    PubMed Central

    Kumar, Raj; Singh, Nikhlesh K.; Rao, Gadiparthi N.

    2016-01-01

    Despite the involvement of proline-rich tyrosine kinase 2 (Pyk2) in endothelial cell angiogenic responses, its role in pathological retinal angiogenesis is not known. In the present study, we show that vascular endothelial growth factor A (VEGFA) induces Pyk2 activation in mediating human retinal microvascular endothelial cell (HRMVEC) migration, sprouting and tube formation. Downstream to Pyk2, VEGFA induced signal transducer and activator of transcription 3 (STAT3) activation and cJun expression in the modulation of HRMVEC migration, sprouting and tube formation. Consistent with these observations, hypoxia induced activation of Pyk2-STAT3-cJun signaling axis and siRNA-mediated downregulation of Pyk2, STAT3 or cJun levels substantially inhibited hypoxia-induced retinal endothelial cell proliferation, tip cell formation and neovascularization. Together, these observations suggest that activation of Pyk2-mediated STAT3-cJun signaling is required for VEGFA-induced HRMVEC migration, sprouting and tube formation in vitro and hypoxia-induced retinal endothelial cell proliferation, tip cell formation and neovascularization in vivo. PMID:27210483

  20. Identification of a Premature Termination Mutation in the Proline-Rich Transmembrane Protein 2 Gene in a Chinese Family with Febrile Seizures.

    PubMed

    Zheng, Wen; Zhang, Jie; Deng, Xiong; Xiao, Jingjing; Yuan, Lamei; Yang, Yan; Guan, Liping; Song, Zhi; Yang, Zhijian; Deng, Hao

    2016-03-01

    Febrile seizures (FS), the most frequent type of seizures in children, occur in neurologically normal infants and children between the ages of 3 months and 5 years with genetic predisposition. The aim of this study was to identify the responsible gene in a four-generation Chinese Han pedigree with autosomal dominant FS. Seven family members (three affected and four unaffected) were enrolled in this study. Exome sequencing was conducted and a duplication mutation c.649dupC (p.R217Pfs*8) in the proline-rich transmembrane protein 2 gene (PRRT2) was identified. The mutation co-segregated with the disorder and was absent in normal controls. To our knowledge, this is the first report of a pedigree with complete penetrance of FS, which is caused by mutation in the PRRT2 gene. FS is a novel phenotype of the c.649dupC (p.R217Pfs*8) mutation. Our discovery broadens the spectrum of genetic causes of FS and the spectrum of phenotypes linked to mutation in the PRRT2 gene. PMID:25502464

  1. PRELP (proline/arginine-rich end leucine-rich repeat protein) promotes osteoblastic differentiation of preosteoblastic MC3T3-E1 cells by regulating the β-catenin pathway.

    PubMed

    Li, Haiying; Cui, Yazhou; Luan, Jing; Zhang, Xiumei; Li, Chengzhi; Zhou, Xiaoyan; Shi, Liang; Wang, Huaxin; Han, Jinxiang

    2016-02-12

    Proline/arginine-rich end leucine-rich repeat protein (PRELP) is a collagen-binding proteoglycan highly expressed in the developing bones. Recent studies indicated that PRELP could inhibit osteoclastogenesis as a NF-κB inhibitor. However, its role during osteoblast differentiation is still unclear. In this study, we confirmed that the expression of PRELP increased with the osteogenesis induction of preosteoblastic MC3T3-E1 cells. Down-regulation of PRELP expression by shRNA reduced ALP activity, mineralization and expression of osteogenic marker gene Runx2. Our microarray analysis data suggested that β-catenin may act as a hub gene in the PRELP-mediated gene network. We validated furtherly that PRELP knockdown could inhibit the level of connexin43, a key regulator of osteoblast differentiation by affecting β-catenin protein expression, and its nuclear translocation in MC3T3-E1 preosteoblasts. Therefore, this study established a new role of PRELP in modulating β-catenin/connexin43 pathway and osteoblast differentiation. PMID:26809092

  2. Metallofullerenol Gd@C82(OH)22 distracts the proline-rich-motif from putative binding on the SH3 domain

    NASA Astrophysics Data System (ADS)

    Kang, Seung-Gu; Huynh, Tien; Zhou, Ruhong

    2013-03-01

    Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses due to the complicated protein-protein interactions. Here, we investigate a potential interference of a metallofullerenol, Gd@C82(OH)22, on the function of SH3 domain, a highly promiscuous protein-protein interaction mediator involved in signaling and regulatory pathways through its binding with the proline-rich motif (PRM) peptides, using the atomistic molecular dynamics simulation. Our study shows that when only Gd@C82(OH)22 and the SH3 domain are present (without the PRM ligand), Gd@C82(OH)22 can interact with the SH3 domain by either directly blocking the hydrophobic active site or binding with a hydrophilic off-site with almost equal probability, which can be understood from its intrinsic amphiphilic nature. In a binding competition with the PRM onto the SH3 domain, however, the on-site binding mode is depleted while Gd@C82(OH)22 effectively intercepts the PRM from the putative binding site of the SH3 domain, implying that Gd@C82(OH)22 can disturb protein-protein interactions mediated by the SH3 domain. Despite a successful surface modification in an aqueous biological medium and a more recent demonstration as potential de novo cancer therapeutics, our study indicates that greater attention is needed in assessing the potential cytotoxicity of these nanomaterials.Biocompatibility is often regarded as one important aspect of de novo designed nanomaterials for biosafety. However, the toxicological effect, appearing along with its latency, is much more difficult to address by linearly mapping physicochemical properties of related nanomaterials with biological effects such as immune or cellular regulatory responses

  3. Effect of enamel matrix derivative and of proline-rich synthetic peptides on the differentiation of human mesenchymal stem cells toward the osteogenic lineage.

    PubMed

    Ramis, Joana Maria; Rubert, Marina; Vondrasek, Jiri; Gayà, Antoni; Lyngstadaas, Staale Petter; Monjo, Marta

    2012-06-01

    With the aim of discovering new molecules for induction of bone formation and biomineralization, combination of bioinformatics and simulation methods were used to design the structure of artificial peptides based on proline-rich domains of enamel matrix proteins. In this study, the effect of such peptides on the differentiation toward the osteogenic lineage of human umbilical cord mesenchymal stem cells (hUCMSCs) was evaluated with or without osteogenic supplements (hydrocortisone, β-glycerol phosphate, and ascorbic acid) and compared to the effect of the commercially available enamel matrix derivative (EMD). It was hypothesized that the differentiation toward the osteogenic lineage of hUCMSCs would be promoted by the treatment with the synthetic peptides when combined with differentiation media, or it could even be directed exclusively by the synthetic peptides. Osteoinductivity was assessed by cell proliferation, bone morphogenetic protein-2 secretion, and gene expression of osteogenic markers after 1, 3, and 14 days of treatment. All peptides were safe with the dosages used, showing lower cell toxicity. P2, P4, and P6 reduced cell proliferation with growing media by 10%-15%. Higher expression of early osteoblast markers was found after 3 days of treatment with EMD in combination with osteogenic supplements, while after 14 days of treatment, cells treated by the different synthetic peptides in combination with osteogenic supplements showed higher osteocalcin mRNA levels. We can conclude that osteogenic differentiation of hUCMSCs is promoted by short-term EMD treatment in combination with osteogenic supplements and by long-term treatment by the synthetic peptides in combination with osteogenic supplements, showing similar results for all the peptide variants analyzed in this study. PMID:22429009

  4. Arginine methylation and citrullination of splicing factor proline- and glutamine-rich (SFPQ/PSF) regulates its association with mRNA

    PubMed Central

    Snijders, Ambrosius P.; Hautbergue, Guillaume M.; Bloom, Alex; Williamson, James C.; Minshull, Thomas C.; Phillips, Helen L.; Mihaylov, Simeon R.; Gjerde, Douglas T.; Hornby, David P.; Wilson, Stuart A.; Hurd, Paul J.

    2015-01-01

    Splicing factor proline- and glutamine-rich (SFPQ) also commonly known as polypyrimidine tract-binding protein-associated-splicing factor (PSF) and its binding partner non-POU domain-containing octamer-binding protein (NONO/p54nrb), are highly abundant, multifunctional nuclear proteins. However, the exact role of this complex is yet to be determined. Following purification of the endogeneous SFPQ/NONO complex, mass spectrometry analysis identified a wide range of interacting proteins, including those involved in RNA processing, RNA splicing, and transcriptional regulation, consistent with a multifunctional role for SFPQ/NONO. In addition, we have identified several sites of arginine methylation in SFPQ/PSF using mass spectrometry and found that several arginines in the N-terminal domain of SFPQ/PSF are asymmetrically dimethylated. Furthermore, we find that the protein arginine N-methyltransferase, PRMT1, catalyzes this methylation in vitro and that this is antagonized by citrullination of SFPQ. Arginine methylation and citrullination of SFPQ/PSF does not affect complex formation with NONO. However, arginine methylation was shown to increase the association with mRNA in mRNP complexes in mammalian cells. Finally we show that the biochemical properties of the endogenous complex from cell lysates are significantly influenced by the ionic strength during purification. At low ionic strength, the SFPQ/NONO complex forms large heterogeneous protein assemblies or aggregates, preventing the purification of the SFPQ/NONO complex. The ability of the SFPQ/NONO complex to form varying protein assemblies, in conjunction with the effect of post-translational modifications of SFPQ modulating mRNA binding, suggests key roles affecting mRNP dynamics within the cell. PMID:25605962

  5. Pyrrhocoricin, a proline-rich antimicrobial peptide derived from insect, inhibits the translation process in the cell-free Escherichia coli protein synthesis system.

    PubMed

    Taniguchi, Masayuki; Ochiai, Akihito; Kondo, Hiroshi; Fukuda, Shun; Ishiyama, Yohei; Saitoh, Eiichi; Kato, Tetsuo; Tanaka, Takaaki

    2016-05-01

    Previous studies have shown that pyrrhocoricin, a proline-rich antimicrobial peptide (PrAMP), killed sensitive species in a dose-dependent manner by specifically binding to DnaK. Here, on the basis of the finding that DnaK-deficient Escherichia coli strains are susceptible to PrAMPs, we used pyrrhocoricin to investigate internal targets other than DnaK. Using conventional antibiotics (bleomycin, streptomycin, and fosfomycin) that have known modes of action, first, we validated the availability of an assay using a cell-free rapid translation system (RTS), which is an in vitro protein synthesis system based on E. coli lysate, for evaluating inhibition of protein synthesis. We found that, similarly to bleomycin and streptomycin, pyrrhocoricin inhibited GFP synthesis in RTS in a concentration-dependent manner. In addition, blockage of transcription and translation steps in RTS was individually estimated using RT-PCR after gene expression to determine mRNA products and using sodium dodecyl sulfate-polyacrylamide gel electrophoresis to determine the amounts of GFP expressed from purified mRNA, respectively. The results demonstrated that this inhibition of GFP synthesis by pyrrhocoricin did not occur at the transcription step but rather at the translation step, in a manner similar to that of GFP synthesis by streptomycin, an inhibitor of the translation step by causing misreading of tRNA. These results suggest that RTS is a powerful assay system for determining if antimicrobial peptides inhibit protein synthesis and its transcription and/or translation steps. This is the first study to have shown that pyrrhocoricin inhibited protein synthesis by specifically repressing the translation step. PMID:26472128

  6. Proline-rich tyrosine kinase 2 downregulates peroxisome proliferator-activated receptor gamma to promote hypoxia-induced pulmonary artery smooth muscle cell proliferation.

    PubMed

    Bijli, Kaiser M; Kang, Bum-Yong; Sutliff, Roy L; Hart, C Michael

    2016-06-01

    Hypoxia stimulates pulmonary hypertension (PH), in part by increasing the proliferation of human pulmonary artery smooth muscle cells (HPASMCs) via sustained activation of mitogen-activated protein kinase, extracellular signal-regulated kinases 1 and 2 (ERK 1/2), and nuclear factor-kappa B (NF-κB); elevated expression of NADPH oxidase 4 (Nox4); and downregulation of peroxisome proliferator-activated receptor gamma (PPARγ) levels. However, the upstream mediators that control these responses remain largely unknown. We hypothesized that proline-rich tyrosine kinase 2 (Pyk2) plays a critical role in the mechanism of hypoxia-induced HPASMC proliferation. To test this hypothesis, HPASMCs were exposed to normoxia or hypoxia (1% O2) for 72 hours. Hypoxia activated Pyk2 (detected as Tyr402 phosphorylation), and inhibition of Pyk2 with small interfering RNA (siRNA) or tyrphostin A9 attenuated hypoxia-induced HPASMC proliferation. Pyk2 inhibition attenuated ERK 1/2 activation as early as 24 hours after the onset of hypoxia, suggesting a proximal role for Pyk2 in this response. Pyk2 inhibition also attenuated hypoxia-induced NF-κB activation, reduced HPASMC PPARγ messenger RNA levels and activity, and increased NF-κB-mediated Nox4 levels. The siRNA-mediated PPARγ knockdown enhanced Pyk2 activation, whereas PPARγ overexpression reduced Pyk2 activation in HPASMCs, confirming a reciprocal relationship between Pyk2 and PPARγ. Pyk2 depletion also attenuated hypoxia-induced NF-κB p65 activation and reduced PPARγ protein levels in human pulmonary artery endothelial cells. These in vitro findings suggest that Pyk2 plays a central role in the proliferative phenotype of pulmonary vascular wall cells under hypoxic conditions. Coupled with recent reports that hypoxia-induced PH is attenuated in Pyk2 knockout mice, these findings suggest that Pyk2 may represent a novel therapeutic target in PH. PMID:27252847

  7. Despite sequence homologies to gluten, salivary proline-rich proteins do not elicit immune responses central to the pathogenesis of celiac disease.

    PubMed

    Tian, Na; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Marietta, Eric V; Murray, Joseph A; Schuppan, Detlef; Helmerhorst, Eva J

    2015-12-01

    Celiac disease (CD) is an inflammatory disorder triggered by ingested gluten, causing immune-mediated damage to the small-intestinal mucosa. Gluten proteins are strikingly similar in amino acid composition and sequence to proline-rich proteins (PRPs) in human saliva. On the basis of this feature and their shared destination in the gastrointestinal tract, we hypothesized that salivary PRPs may modulate gluten-mediated immune responses in CD. Parotid salivary secretions were collected from CD patients, refractory CD patients, non-CD patients with functional gastrointestinal complaints, and healthy controls. Structural similarities of PRPs with gluten were probed with anti-gliadin antibodies. Immune responses to PRPs were investigated toward CD patient-derived peripheral blood mononuclear cells and in a humanized transgenic HLA-DQ2/DQ8 mouse model for CD. Anti-gliadin antibodies weakly cross-reacted with the abundant salivary amylase but not with PRPs. Likewise, the R5 antibody, recognizing potential antigenic gluten epitopes, showed negligible reactivity to salivary proteins from all groups. Inflammatory responses in peripheral blood mononuclear cells were provoked by gliadins whereas responses to PRPs were similar to control levels, and PRPs did not compete with gliadins in immune stimulation. In vivo, PRP peptides were well tolerated and nonimmunogenic in the transgenic HLA-DQ2/DQ8 mouse model. Collectively, although structurally similar to dietary gluten, salivary PRPs were nonimmunogenic in CD patients and in a transgenic HLA-DQ2/DQ8 mouse model for CD. It is possible that salivary PRPs play a role in tolerance induction to gluten early in life. Deciphering the structural basis for the lack of immunogenicity of salivary PRPs may further our understanding of the toxicity of gluten. PMID:26505973

  8. Proline-rich tyrosine kinase 2 downregulates peroxisome proliferator–activated receptor gamma to promote hypoxia-induced pulmonary artery smooth muscle cell proliferation

    PubMed Central

    2016-01-01

    Abstract Hypoxia stimulates pulmonary hypertension (PH), in part by increasing the proliferation of human pulmonary artery smooth muscle cells (HPASMCs) via sustained activation of mitogen-activated protein kinase, extracellular signal–regulated kinases 1 and 2 (ERK 1/2), and nuclear factor-kappa B (NF-κB); elevated expression of NADPH oxidase 4 (Nox4); and downregulation of peroxisome proliferator–activated receptor gamma (PPARγ) levels. However, the upstream mediators that control these responses remain largely unknown. We hypothesized that proline-rich tyrosine kinase 2 (Pyk2) plays a critical role in the mechanism of hypoxia-induced HPASMC proliferation. To test this hypothesis, HPASMCs were exposed to normoxia or hypoxia (1% O2) for 72 hours. Hypoxia activated Pyk2 (detected as Tyr402 phosphorylation), and inhibition of Pyk2 with small interfering RNA (siRNA) or tyrphostin A9 attenuated hypoxia-induced HPASMC proliferation. Pyk2 inhibition attenuated ERK 1/2 activation as early as 24 hours after the onset of hypoxia, suggesting a proximal role for Pyk2 in this response. Pyk2 inhibition also attenuated hypoxia-induced NF-κB activation, reduced HPASMC PPARγ messenger RNA levels and activity, and increased NF-κB-mediated Nox4 levels. The siRNA-mediated PPARγ knockdown enhanced Pyk2 activation, whereas PPARγ overexpression reduced Pyk2 activation in HPASMCs, confirming a reciprocal relationship between Pyk2 and PPARγ. Pyk2 depletion also attenuated hypoxia-induced NF-κB p65 activation and reduced PPARγ protein levels in human pulmonary artery endothelial cells. These in vitro findings suggest that Pyk2 plays a central role in the proliferative phenotype of pulmonary vascular wall cells under hypoxic conditions. Coupled with recent reports that hypoxia-induced PH is attenuated in Pyk2 knockout mice, these findings suggest that Pyk2 may represent a novel therapeutic target in PH. PMID:27252847

  9. Microparticles Mediate the Intercellular Regulation of microRNA-503 and Proline-Rich Tyrosine Kinase 2 to Alter the Migration and Invasion Capacity of Breast Cancer Cells

    PubMed Central

    Gong, Joyce; Luk, Frederick; Jaiswal, Ritu; Bebawy, Mary

    2014-01-01

    The successful treatment of cancer is hampered by drug resistance and metastasis. While these two obstacles were once considered separately, recent evidence associates resistance with an enhanced metastatic capacity. However, the underlying mechanisms remain undefined. We previously described the intercellular transfer of drug resistance via submicron vesicles called microparticles (MPs). We now propose that MPs derived from drug-resistant cells are also involved in the intercellular transfer of components to enhance the migration and invasion capacity of cells. Thus, MPs may be a conduit between resistance and metastasis. We used microarray analysis to identify regulatory microRNAs (miRNAs), which contribute to the dissemination of metastatic traits. miR-503 was downregulated in recipient cells following co-culture with MPs isolated from drug-resistant cells. miR-503 was inversely associated with metastasis, as demonstrated using wound healing/scratch migration assays and Matrigel®-coated transwell invasion assays. Proline-rich tyrosine kinase 2 (PYK2) was upregulated in recipient cells and associated with increased migration and invasion, with these phenotypes being reversed using a pharmacological inhibitor of PYK2 phosphorylation, tyrphostin A9. However, the MP-mediated promotion of metastatic traits was not due to the presence of these effectors in the MP cargo but rather due to down stream effector molecules in these pathways. This is the first demonstration that the role of MPs in trait acquisition extends beyond the direct transfer of vesicle components and also includes transfer of intermediary regulators that induce down stream mediators following transfer to recipient cells. This implicates an expanding role of MPs in cancer pathogenesis. PMID:25177548

  10. Responsiveness to 6-n-Propylthiouracil (PROP) Is Associated with Salivary Levels of Two Specific Basic Proline-Rich Proteins in Humans

    PubMed Central

    Cabras, Tiziana; Melis, Melania; Castagnola, Massimo; Padiglia, Alessandra; Tepper, Beverly J.; Messana, Irene; Tomassini Barbarossa, Iole

    2012-01-01

    Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y) to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the ‘taster’ variant (PAV haplotype) of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs) family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait. PMID:22312435

  11. Responsiveness to 6-n-propylthiouracil (PROP) is associated with salivary levels of two specific basic proline-rich proteins in humans.

    PubMed

    Cabras, Tiziana; Melis, Melania; Castagnola, Massimo; Padiglia, Alessandra; Tepper, Beverly J; Messana, Irene; Tomassini Barbarossa, Iole

    2012-01-01

    Thiourea tasting can be predictive of individual differences in bitter taste responses, general food preferences and eating behavior, and could be correlated with saliva chemical composition. We investigated the possible relationship between PROP bitter taste responsiveness and the salivary proteome in subjects genotyped for TAS2R38 and gustin gene polymorphisms. Taste perception intensity evoked by PROP and NaCl solutions was measured in sixty-three volunteers (21 males, 42 females, age 25±3 y) to establish their PROP taster status, and 24 PROP super-tasters and 21 nontasters were selected to participate in the study. TAS2R38 and gustin gene molecular analysis were performed using PCR techniques. Qualitative and quantitative determination of salivary proteins was performed by HPLC-ESI-MS before and after PROP taste stimulation. PROP super-tastings was strongly associated with the 'taster' variant (PAV haplotype) of TAS2R38 and the A allele of rs2274333 polymorphism in the gustin gene and nontasting was associated with the minor alleles at both loci. ANOVA revealed that basal levels of II-2 and Ps-1 proteins, belonging to the basic proline-rich protein (bPRPs) family, were significantly higher in PROP super-taster than in nontaster un-stimulated saliva, and that PROP stimulation elicited a rapid increase in the levels of these same proteins only in PROP super-taster saliva. These data show for the first time that responsiveness to PROP is associated with salivary levels of II-2 peptide and Ps-1 protein, which are products of the PRB1 gene. These findings suggest that PRB1, in addition to TAS2R38 and gustin, could contribute to individual differences in thiourea sensitivity, and the expression of the PROP phenotype as a complex genetic trait. PMID:22312435

  12. Force-dependent isomerization kinetics of a highly conserved proline switch modulates the mechanosensing region of filamin

    PubMed Central

    Rognoni, Lorenz; Möst, Tobias; Žoldák, Gabriel; Rief, Matthias

    2014-01-01

    Proline switches, controlled by cis–trans isomerization, have emerged as a particularly effective regulatory mechanism in a wide range of biological processes. In this study, we use single-molecule mechanical measurements to develop a full kinetic and energetic description of a highly conserved proline switch in the force-sensing domain 20 of human filamin and how prolyl isomerization modulates the force-sensing mechanism. Proline isomerization toggles domain 20 between two conformations. A stable cis conformation with slow unfolding, favoring the autoinhibited closed conformation of filamin’s force-sensing domain pair 20–21, and a less stable, uninhibited conformation promoted by the trans form. The data provide detailed insight into the folding mechanisms that underpin the functionality of this binary switch and elucidate its remarkable efficiency in modulating force-sensing, thus combining two previously unconnected regulatory mechanisms, proline switches and mechanosensing. PMID:24706888

  13. The presence of prolines in the flanking region of an immunodominant HIV‐2 gag epitope influences the quality and quantity of the epitope generated

    PubMed Central

    Leligdowicz, Aleksandra; Kramer, Holger B.; Onyango, Clayton; Cotten, Matthew; Wright, Cynthia; Whittle, Hilton C.; McMichael, Andrew; Dong, Tao; Kessler, Benedikt M.; Rowland‐Jones, Sarah L.

    2015-01-01

    Both the recognition of HIV‐infected cells and the immunogenicity of candidate CTL vaccines depend on the presentation of a peptide epitope at the cell surface, which in turn depends on intracellular antigen processing. Differential antigen processing maybe responsible for the differences in both the quality and the quantity of epitopes produced, influencing the immunodominance hierarchy of viral epitopes. Previously, we showed that the magnitude of the HIV‐2 gag‐specific T‐cell response is inversely correlated with plasma viral load, particularly when responses are directed against an epitope, 165DRFYKSLRA173, within the highly conserved Major Homology Region of gag‐p26. We also showed that the presence of three proline residues, at positions 119, 159 and 178 of gag‐p26, was significantly correlated with low viral load. Since this proline motif was also associated with stronger gag‐specific CTL responses, we investigated the impact of these prolines on proteasomal processing of the protective 165DRFYKSLRA173 epitope. Our data demonstrate that the 165DRFYKSLRA173 epitope is most efficiently processed from precursors that contain two flanking proline residues, found naturally in low viral‐load patients. Superior antigen processing and enhanced presentation may account for the link between infection with HIV‐2 encoding the “PPP‐gag” sequence and both strong gag‐specific CTL responses as well as lower viral load. PMID:26018465

  14. Disturbance alters local-regional richness relationships in appalachian forests

    USGS Publications Warehouse

    Belote, R.T.; Sanders, N.J.; Jones, R.H.

    2009-01-01

    Whether biological diversity within communities is limited by local interactions or regional species pools remains an important question in ecology. In this paper, we investigate how an experimentally applied tree-harvesting disturbance gradient influenced local-regional richness relationships. Plant species richness was measured at three spatial scales (2 ha = regional; 576 m2 and 1 m2 = local) on three occasions (one year pre-disturbance, one year post-disturbance, and 10 years post-disturbance) across five disturbance treatments (uncut control through clearcut) replicated throughout the southern Appalachian Mountains, USA. We investigated whether species richness in 576-m2 plots and 1-m2 subplots depended on species richness in 2-ha experimental units and whether this relationship changed through time before and after canopy disturbance. We found that, before disturbance, the relationship between local and regional richness was weak or nonexistent. One year after disturbance local richness was a positive function of regional richness, because local sites were colonized from the regional species pool. Ten years after disturbance, the positive relationship persisted, but the slope had decreased by half. These results suggest that disturbance can set the stage for strong influences of regional species pools on local community assembly in temperate forests. However, as time since disturbance increases, local controls on community assembly decouple the relationships between regional and local diversity. ?? 2009 by the Ecological Society of America.

  15. A new subfamily of penaeidin with an additional serine-rich region from kuruma shrimp (Marsupenaeus japonicus) contributes to antimicrobial and phagocytic activities.

    PubMed

    An, Ming-Yu; Gao, Jie; Zhao, Xiao-Fan; Wang, Jin-Xing

    2016-06-01

    Penaeidins are an important family of antimicrobial peptides (AMPs) in penaeid shrimp. To date, five groups of penaeidins have been identified in penaeid shrimp. All are composed of a proline-rich N-terminus and a C-terminus containing six cysteine residues engaged in three disulfide bridges. In this study, a new type of penaeidin from Marsupenaeus japonicus was identified. The full-length penaeidin contains a unique serine-rich region and a penaeidin domain, which consists of a proline-rich region and a cysteine-rich region. Here, we classify all penaeidins into two subfamilies. All reported penaeidins are in subfamily I, and the new penaeidin identified in M. japonicus is designated as Penaeidin subfamily II (MjPen-II). MjPen-II was expressed in hemocytes, heart, hepatopancreas, gills, stomach and intestine, and was upregulated after bacterial challenge. A liquid bacteriostatic assay showed that MjPen-II had antibacterial activity to some Gram-positive and Gram-negative bacteria. MjPen-II could bind to bacteria by binding to polysaccharides on the surface of bacteria, thus promoting bacterial agglutination. The serine-rich region enhanced the agglutination activity of MjPen-II. The proline-rich domain had a stronger bacterial-binding activity and polysaccharide-binding activity than the cysteine-rich domain. MjPen-II was also found to be involved in the phagocytosis of bacteria and efficiently improved the phagocytosis rate. Therefore, MjPen-II eliminates bacteria through direct bacterial inhibition as well as by promoting phagocytosis in shrimp. PMID:26855016

  16. STE20/SPS1-related proline/alanine-rich kinase (SPAK) is critical for sodium reabsorption in isolated, perfused thick ascending limb

    PubMed Central

    Yoon, Joonho; Baum, Michel; Huang, Chou-Long

    2014-01-01

    SPAK [STE20 (sterile 20)/SPS1-related proline/alanine-rich kinase] kinase consists of a full-length (FL-) and an alternatively spliced kidney-specific (KS-) isoform. SPAK regulates the NaCl cotransporter (NCC) in the distal convoluted tubule (DCT). The relative abundance and role of FL- vs. KS-SPAK in regulating Na+-K+-2Cl− cotransporter (NKCC2) in thick ascending limb (TAL) are not completely understood. Here, we report that FL-SPAK mRNA was the most abundant in medullary TAL (mTAL), followed by cortical TAL (cTAL) and DCT. KS-SPAK mRNA abundance was relatively lower than FL-SPAK. The ratios of FL-SPAK to KS-SPAK in mTAL, cTAL, and DCT were 12.3, 12.5, and 10.2, respectively. To examine the role of SPAK in the regulation of sodium transport in TAL, we used in vitro microperfusion of mTAL and cTAL isolated from wild-type (WT) and SPAK knockout mice (SPAK-KO) that lack both FL- and KS-SPAK. The rates of sodium absorption in cTAL and mTAL of SPAK-KO mice were 34.5 and 12.5% of WT tubules, respectively. The mRNA levels of related OSR1 kinase and SPAK protease Dnpep in SPAK-KO tubules were not significantly different from WT tubules. We next examined the role of SPAK in the regulation of sodium reabsorption by vasopressin in TAL. Vasopressin increased sodium reabsorption by ∼80% in both mTAL and cTAL from WT mice. While baseline sodium reabsorption was lower in SPAK-KO tubules, vasopressin increased sodium reabsorption over twofold. In conclusion, the combined net effect of SPAK isoforms on sodium reabsorption in TAL is stimulatory. SPAK is not essential for vasopressin stimulation of sodium reabsorption in TAL. PMID:25477470

  17. A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer.

    PubMed

    Shen, Huaishun; Cao, Kaiming; Wang, Xiping

    2007-10-19

    Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors. PMID:17719007

  18. A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer

    SciTech Connect

    Shen Huaishun; Cao Kaiming; Wang Xiping

    2007-10-19

    Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors.

  19. The proline-rich P65 protein of Mycoplasma pneumoniae is a component of the Triton X-100-insoluble fraction and exhibits size polymorphism in the strains M129 and FH.

    PubMed Central

    Proft, T; Hilbert, H; Layh-Schmitt, G; Herrmann, R

    1995-01-01

    Previously, we described the identification of a novel Mycoplasma pneumoniae M129 protein, named P65 because of its apparent molecular mass of 65 kDa estimated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (T. Proft and R. Herrmann, Mol. Microbiol. 13:337-348, 1994). DNA sequence analysis of the P65 open reading frame (orfp65), however, revealed an ORF encoding a protein with a molecular weight of 47,034. This discrepancy can be explained by the unusual amino acid composition of this protein. According to the deduced amino acid sequence, the N-terminal half of P65 contains several penta- and hexapeptides (DPNAY and DPNQAY) forming a proline-rich acidic domain. Secondary-structure predictions indicated beta-sheets and turns within that region, suggesting an extended and rigid conformation. Near the C terminus of P65 the tripeptide Arg-Gly-Asp (RGD) was found. This motif is known to play an important role in binding of extracellular matrix proteins to integrins. P65 could be located exclusively to the Triton X-100-insoluble cell fraction. The results of immunofluorescence microscopy and of immunoadsorption experiments indicated that P65 carries surface-exposed regions. Mild treatment of whole cells with proteases resulted in cleavage of a limited amount of P65 molecules, suggesting either that only a small percentage of P65 molecules are exposed on the surface or that protease cleavage is hampered by a compact protein conformation or by binding of an unknown component to P65. P65 exhibits size polymorphism in M. pneumoniae M129 and FH. This is caused by an intragenetic duplication of a 54-bp sequence within the FH orfp65. As a consequence, the number of DPNAY pentapeptides increased from 9 to 12 repeats in the FH strain. PMID:7768845

  20. A novel role for proline in plant floral nectars

    NASA Astrophysics Data System (ADS)

    Carter, Clay; Shafir, Sharoni; Yehonatan, Lia; Palmer, Reid G.; Thornburg, Robert

    2006-02-01

    Plants offer metabolically rich floral nectar to attract visiting pollinators. The composition of nectar includes not only sugars, but also amino acids. We have examined the amino acid content of the nectar of ornamental tobacco and found that it is extremely rich (2 mM) in proline. Because insect pollinators preferentially utilize proline during the initial phases of insect flight and can reportedly taste proline, we determined whether honeybees showed a preference for synthetic nectars rich in proline. We therefore established an insect preference test and found that honeybees indeed prefer nectars rich in the amino acid proline. To determine whether this was a general phenomenon, we also examined the nectars of two insect-pollinated wild perennial species of soybean. These species also showed high levels of proline in their nectars demonstrating that plants often produce proline-rich floral nectar. Because insects such as honeybees prefer proline-rich nectars, we hypothesize that some plants offer proline-rich nectars as a mechanism to attract visiting pollinators.

  1. Proline-Rich Tyrosine Kinase 2 Mediates Gonadotropin-Releasing Hormone Signaling to a Specific Extracellularly Regulated Kinase-Sensitive Transcriptional Locus in the Luteinizing Hormone β-Subunit Gene

    PubMed Central

    Maudsley, Stuart; Naor, Zvi; Bonfil, David; Davidson, Lindsay; Karali, Dimitra; Pawson, Adam J.; Larder, Rachel; Pope, Caroline; Nelson, Nancy; Millar, Robert P.; Brown, Pamela

    2007-01-01

    G protein-coupled receptor regulation of gene transcription primarily occurs through the phosphorylation of transcription factors by MAPKs. This requires transduction of an activating signal via scaffold proteins that can ultimately determine the outcome by binding signaling kinases and adapter proteins with effects on the target transcription factor and locus of activation. By investigating these mechanisms, we have elucidated how pituitary gonadotrope cells decode an input GnRH signal into coherent transcriptional output from the LH β-subunit gene promoter. We show that GnRH activates c-Src and multiple members of the MAPK family, c-Jun NH2-terminal kinase 1/2, p38MAPK, and ERK1/2. Using dominant-negative point mutations and chemical inhibitors, we identified that calcium-dependent proline-rich tyrosine kinase 2 specifically acts as a scaffold for a focal adhesion/cytoskeleton-dependent complex comprised of c-Src, Grb2, and mSos that translocates an ERK-activating signal to the nucleus. The locus of action of ERK was specifically mapped to early growth response-1 (Egr-1) DNA binding sites within the LH β-subunit gene proximal promoter, which was also activated by p38MAPK, but not c-Jun NH2-terminal kinase 1/2. Egr-1 was confirmed as the transcription factor target of ERK and p38MAPK by blockade of protein expression, transcriptional activity, and DNA binding. We have identified a novel GnRH-activated proline-rich tyrosine kinase 2-dependent ERK-mediated signal transduction pathway that specifically regulates Egr-1 activation of the LH β-subunit proximal gene promoter, and thus provide insight into the molecular mechanisms required for differential regulation of gonadotropin gene expression. PMID:17327421

  2. Identification of antigenic epitopes in an alanine-rich repeating region of a surface protein antigen of Streptococcus mutants.

    PubMed Central

    Okahashi, N; Takahashi, I; Nakai, M; Senpuku, H; Nisizawa, T; Koga, T

    1993-01-01

    A surface protein antigen (PAc) of Streptococcus mutans with a molecular mass of 190 kDa is considered to play an important role in the initial attachment of this streptococcus to the tooth surface. Two internal repeating amino acid sequences are present in the PAc molecule. One repeating region located in the N-terminal region is rich in alanine (A-region), and the other, located in the central region, is rich in proline (P-region). To identify antigenic epitopes on the A-region of the PAc protein, 82 sequential overlapping synthetic decapeptides covering one of the repetitive units of the A-region were synthesized. In the epitope scanning analyses using murine antisera raised against recombinant PAc (rPAc), multiple antigenic epitopes were found in the repetitive unit of the A-region, and some of them reacted with antisera to rPAc from BALB/c, B10, B10.D2, and B10.BR mice. In particular, a peptide YEAALKQY (residues 366 to 373) was recognized by anti-rPAc sera from all four strains of mice. The reactivities of anti-rPAc sera in the epitope scanning were confirmed by using a purified synthetic peptide, NAKATYEAALKQYEADLAA (corresponding to residues 361 to 379). Furthermore, antisera against a surface protein antigen PAg (SpaA) of Streptococcus sobrinus from BALB/c mice reacted strongly to residues 330 to 337, 362 to 369, and 366 to 373 of the PAc protein by the epitope scanning analysis. An AKATYEAALKQY (residues 362 to 373 of the PAc protein)-like sequence, AKANYEAKLAQY, was found within the A-region of S. sobrinus PAg, suggesting that the amino acid sequences AKA-YEA and YEA-L-QY may be major cross-reactive epitopes of the S. mutans PAc protein and the S. sobrinus PAg protein. PMID:7681043

  3. Proline and lysine residues provide modulatory switches in amyloid formation: Insights from prion protein.

    PubMed

    Kraus, Allison

    2016-01-01

    Amyloidogenic proteins have an increased propensity to reorganize into the highly structured, β sheet rich structures that characterize amyloid. The probability of attaining these highly structured assemblies is influenced by multiple factors, including amino acid composition and environmental conditions. Evolutionary selection for amino acid sequences that prevent amyloid formation could further modulate amyloid-forming propensity. Indeed, we have recently identified specific proline and lysine residues, contained within a highly conserved central region of prion protein (PrP), that impede PrP amyloid formation in vitro. These prolines are mutated in certain forms of the human familial genetic disease, Gerstmann-Straüssler-Schneiker (GSS) syndrome. Here, I discuss the influence of these proline and lysine residues on PrP amyloid formation and how such anti-amyloidogenic primary amino acid sequences might be modulated to influence protein amyloidogenicity. PMID:26864641

  4. Star forming regions in gas-rich SO galaxies

    NASA Technical Reports Server (NTRS)

    Pogge, Richard W.; Eskridge, Paul B.

    1987-01-01

    The first results of an H alpha imaging survey of HI rich SO galaxies, which were searched for HII regions and other sources of emission, are presented. The charge coupled device H alpha interference filter images were made of 16 galaxies. Eight of these galaxies show evidence for on-going star formation, one has nuclear emission but no HII regions, and the remaining seven have no emissions detected within well defined upper limits. With the exception of one notably peculiar galaxy in which the emission from HII regions appears pervasive, the HII regions are either organized into inner-disk rings or randomly distributed throughout the disk. A few of these galaxies are found to be clearly not SO's; or peculiar objects atypical of the SO class. Using simple models star formation rates (SFRs) and gas depletion times from the observed H alpha fluxes were estimated. In general, the derived SFRs are much lower than those found in isolated field spiral galaxies and the corresponding gas depletion time scales are also longer.

  5. Two novel mutations in the glycine-rich region of human PAX6 gene: Implications for an association of cataracts and anosmia with aniridia

    SciTech Connect

    Martha, A.; Ferrel, R.E.; Hittner, H.M.; Saunders, G.F.

    1994-09-01

    Aniridia (iris hyplasia) is a autosomal dominant congenital disorder of the eye. Mutations in the human aniridia (PAX6) gene have now been identified in many patients from various ethnic groups. In the present study we describe new mutations in this gene. Out of four mutations found, three were novel mutations; the fourth one is identical to the previously reported mutations (C{yields}T transition at nt 240). The three novel mutations analyzed were in the glycine-rich region (two) and in the proline/serine/threonine-rich (PST) region (one). Previously no mutations were reported for the glycine-rich region in humans. One of the mutations found in this region is associated with cataracts in an aniridia family. The other splice mutation found in the PST domain is associated with anosmia (lack of sensation to smell) in a sporadic aniridia case. Two of the mutations presented here, one in the glycine-rich region and the other in the PST domain, were not detected by SSCR. These mutations could be detected by using MDE gel and heteroduplex information. All mutations found in the present study are similar in that 32 of 33 PAX6 mutations result in protein truncation and haploinsufficiency.

  6. Structural Biology of Proline Catabolism

    PubMed Central

    2009-01-01

    Summary The proline catabolic enzymes proline dehydrogenase and Δ1-pyrroline-5-carboxylate dehydrogenase catalyze the 4-electron oxidation of proline to glutamate. These enzymes play important roles in cellular redox control, superoxide generation, apoptosis and cancer. In some bacteria, the two enzymes are fused into the bifunctional enzyme, proline utilization A. Here we review the three-dimensional structural information that is currently available for proline catabolic enzymes. Crystal structures have been determined for bacterial monofunctional proline dehydrogenase and Δ1-pyrroline-5-carboxylate dehydrogenase, as well as the proline dehydrogenase and DNA-binding domains of proline utilization A. Some of the functional insights provided by analyses of these structures are discussed, including substrate recognition, catalytic mechanism, biochemical basis of inherited proline catabolic disorders and DNA recognition by proline utilization A. PMID:18369526

  7. Homodimerization of the G Protein Srbeta in the Nucleotide-Free State Involves Proline cis/trans Isomerication in the Switch II Region

    SciTech Connect

    Schwartz,T.; Schmidt, D.; Brohawn, S.; Blobel, G.

    2006-01-01

    Protein translocation across and insertion into membranes is essential to all life forms. Signal peptide-bearing nascent polypeptide chains emerging from the ribosome are first sampled by the signal-recognition particle (SRP), then targeted to the membrane via the SRP receptor (SR), and, finally, transferred to the protein-conducting channel. In eukaryotes, this process is tightly controlled by the concerted action of three G proteins, the 54-kD subunit of SRP and the {alpha}- and {beta}-subunits of SR. We have determined the 2.2-Angstroms crystal structure of the nucleotide-free SR{beta} domain. Unexpectedly, the structure is a homodimer with a highly intertwined interface made up of residues from the switch regions of the G domain. The remodeling of the switch regions does not resemble any of the known G protein switch mechanisms. Biochemical analysis confirms homodimerization in vitro, which is incompatible with SR{alpha} binding. The switch mechanism involves cis/trans isomerization of a strictly conserved proline, potentially implying a new layer of regulation of cotranslational transport.

  8. High-resolution high-performance liquid chromatography with electrospray ionization mass spectrometry and tandem mass spectrometry characterization of a new isoform of human salivary acidic proline-rich proteins named Roma-Boston Ser22(Phos) → Phe variant

    PubMed Central

    Iavarone, Federica; D’Alessandro, Alfredo; Tian, Na; Cabras, Tiziana; Messana, Irene; Helmerhorst, Eva J.; Oppenheim, Frank G.; Castagnola, Massimo

    2015-01-01

    During a survey of human saliva by a top-down reversed-phase high-performance liquid chromatography with electrospray ionization mass spectrometry approach, two proteins eluting at 27.4 and 28.4 min, with average masses of 15 494 ± 1 and 11 142 ± 1 Da, were detected in a subject from Boston. The Δmass value (4352 Da) of the two proteins was similar to the difference in mass values between intact (150 amino acids, [a.a.]) and truncated acidic proline-rich proteins (aPRPs; 106 a.a.) suggesting an a.a. substitution in the first 106 residues resulting in a strong reduction in polarity, since under the same experimental conditions aPRPs eluted at ~22.5 min (intact) and 23.5 min (truncated forms). Manual inspection of the high-resolution high-performance liquid chromatography with electrospray ionization tandem mass spectra of the truncated isoform showed the replacement of the phosphorylated Ser-22 in PRP-3 with a Phe residue. Inspection of the tandem mass spectra of the intact isoform confirmed the substitution, which is allowed by the code transition TCT→TTT and is in agreement with the dramatic increase in elution time. The isoform was also detected in two other subjects, one from Boston (unrelated to the previous) and one from Rome. For this reason we propose to name this variant PRP-1 (PRP-3) RB (Roma-Boston) Ser22(phos)→Phe. PMID:24771659

  9. Leukemia breakpoint region in 3q21 is gene rich.

    PubMed

    Rynditch, A; Pekarsky, Y; Schnittger, S; Gardiner, K

    1997-07-01

    Rearrangements of the long arm of human chromosome 3, including reciprocal translocations, inversions and deletion/duplication of bands 3q21-3q26, as well as deletions of 3q21 and reciprocal translocations between 3q21 and other chromosomes, are well documented in leukemia. Previous studies showed that the breakpoints within 3q21 cluster within a 10-40 kb region but no candidate genes were described. In this work, we have identified partial cDNAs corresponding to five to nine new transcripts from an 80 kb P1 clone that spans ten breakpoints. These transcripts, with one exception, appear to be expressed only at low levels in the set of cancer cell lines examined. Four transcripts are located between the previously mapped Ribophorin I gene and the most centromeric breakpoint; three map directly within the 20 kb spanning nine independent breakpoints. These data (i) show that among characterized leukemia breakpoint regions 3q21 is unusually gene rich, (ii) provide new candidates for relevance to leukemia in 3q21, and (iii) suggest possibilities for chromatin configuration effects. PMID:9249066

  10. Solar source regions of 3HE-rich particle events

    NASA Technical Reports Server (NTRS)

    Reames, D. V.; Stone, R. G.; Kahler, S. W.; Lin, R. P.; Liggett, M.

    1985-01-01

    Hydrogen alpha X-ray, and metric and kilometric radio data to examine the solar sources of energetic 3He-rich particle events observed near earth in association with impulsive 2 to 100 keV electron events were applied. Each 3He/electron event is associated with a kilometric type 3 burst belonging to a family of such bursts characterized by similar interplanetary propagation paths from the same solar active region. The 3He/electron events correlate very well with the interplanetary low frequency radio brightnesses of these events, but progressively worse with signatures from regions closer to the Sun. When H alpha brightnings can be associated with 3He/electron events, they have onsets coinciding to within 1 min of that of the associated metric type 3 burst but are often too small to be reported. The data are consistent with the earlier idea that many type 3 bursts, the 3He/electron events, are due to particle acceleration in the corona, well above the associated H alpha and X-ray flares.

  11. The puckering free-energy surface of proline

    NASA Astrophysics Data System (ADS)

    Wu, Di

    2013-03-01

    Proline has two preferred puckering states, which are often characterized by the pseudorotation phase angle and amplitude. Although proline's five endocyclic torsion angles can be utilized to calculate the phase angle and amplitude, it is not clear if there is any direct correlation between each torsion angle and the proline-puckering pathway. Here we have designed five proline puckering pathways utilizing each torsion angle χj (j = 1˜5) as the reaction coordinate. By examining the free-energy surfaces of the five puckering pathways, we find they can be categorized into two groups. The χ2 pathway (χ2 is about the Cβ—Cγ bond) is especially meaningful in describing proline puckering: it changes linearly with the puckering amplitude and symmetrically with the phase angle. Our results show that this conclusion applies to both trans and cis proline conformations. We have also analyzed the correlations of proline puckering and its backbone torsion angles ϕ and ψ. We show proline has preferred puckering states at the specific regions of ϕ, ψ angles. Interestingly, the shapes of ψ-χ2 free-energy surfaces are similar among the trans proline in water, cis proline in water and cis proline in the gas phase, but they differ substantially from that of the trans proline in the gas phase. Our calculations are conducted using molecular simulations; we also verify our results using the proline conformations selected from the Protein Data Bank. In addition, we have compared our results with those calculated by the quantum mechanical methods.

  12. Proline Mechanisms of Stress Survival

    PubMed Central

    Liang, Xinwen; Zhang, Lu; Natarajan, Sathish Kumar

    2013-01-01

    Abstract Significance: The imino acid proline is utilized by different organisms to offset cellular imbalances caused by environmental stress. The wide use in nature of proline as a stress adaptor molecule indicates that proline has a fundamental biological role in stress response. Understanding the mechanisms by which proline enhances abiotic/biotic stress response will facilitate agricultural crop research and improve human health. Recent Advances: It is now recognized that proline metabolism propels cellular signaling processes that promote cellular apoptosis or survival. Studies have shown that proline metabolism influences signaling pathways by increasing reactive oxygen species (ROS) formation in the mitochondria via the electron transport chain. Enhanced ROS production due to proline metabolism has been implicated in the hypersensitive response in plants, lifespan extension in worms, and apoptosis, tumor suppression, and cell survival in animals. Critical Issues: The ability of proline to influence disparate cellular outcomes may be governed by ROS levels generated in the mitochondria. Defining the threshold at which proline metabolic enzyme expression switches from inducing survival pathways to cellular apoptosis would provide molecular insights into cellular redox regulation by proline. Are ROS the only mediators of proline metabolic signaling or are other factors involved? Future Directions: New evidence suggests that proline biosynthesis enzymes interact with redox proteins such as thioredoxin. An important future pursuit will be to identify other interacting partners of proline metabolic enzymes to uncover novel regulatory and signaling networks of cellular stress response. Antioxid. Redox Signal. 19, 998–1011. PMID:23581681

  13. Paxillin binding to the alpha 4 integrin subunit stimulates LFA-1 (integrin alpha L beta 2)-dependent T cell migration by augmenting the activation of focal adhesion kinase/proline-rich tyrosine kinase-2.

    PubMed

    Rose, David M; Liu, Shouchun; Woodside, Darren G; Han, Jaewon; Schlaepfer, David D; Ginsberg, Mark H

    2003-06-15

    Engagement of very late Ag-4 (integrin alpha(4)beta(1)) by ligands such as VCAM-1 markedly stimulates leukocyte migration mediated by LFA-1 (integrin alpha(L)beta(2)). This form of integrin trans-regulation in T cells requires the binding of paxillin to the alpha(4) integrin cytoplasmic domain. This conclusion is based on the abolition of trans-regulation in Jurkat T cells by an alpha(4) mutation (alpha(4)(Y991A)) that disrupts paxillin binding. Furthermore, cellular expression of an alpha(4)-binding fragment of paxillin that blocks the alpha(4)-paxillin interaction, selectively blocked VCAM-1 stimulation of alpha(L)beta(2)-dependent cell migration. The alpha(4)-paxillin association mediates trans-regulation by enhancing the activation of tyrosine kinases, focal adhesion kinase (FAK) and/or proline-rich tyrosine kinase-2 (Pyk2), based on two lines of evidence. First, disruption of the paxillin-binding site in the alpha(4) tail resulted in much less alpha(4)beta(1)-mediated phosphorylation of Pyk2 and FAK. Second, transfection with cDNAs encoding C-terminal fragments of Pyk2 and FAK, which block the function of the intact kinases, blocked alpha(4)beta(1) stimulation of alpha(L)beta(2)-dependent migration. These results define a proximal protein-protein interaction of an integrin cytoplasmic domain required for trans-regulation between integrins, and establish that augmented activation of Pyk2 and/or FAK is an immediate signaling event required for the trans-regulation of integrin alpha(L)beta(2) by alpha(4)beta(1). PMID:12794117

  14. Urokinase-type Plasminogen Activator (uPA) Promotes Angiogenesis by Attenuating Proline-rich Homeodomain Protein (PRH) Transcription Factor Activity and De-repressing Vascular Endothelial Growth Factor (VEGF) Receptor Expression.

    PubMed

    Stepanova, Victoria; Jayaraman, Padma-Sheela; Zaitsev, Sergei V; Lebedeva, Tatiana; Bdeir, Khalil; Kershaw, Rachael; Holman, Kelci R; Parfyonova, Yelena V; Semina, Ekaterina V; Beloglazova, Irina B; Tkachuk, Vsevolod A; Cines, Douglas B

    2016-07-15

    Urokinase-type plasminogen activator (uPA) regulates angiogenesis and vascular permeability through proteolytic degradation of extracellular matrix and intracellular signaling initiated upon its binding to uPAR/CD87 and other cell surface receptors. Here, we describe an additional mechanism by which uPA regulates angiogenesis. Ex vivo VEGF-induced vascular sprouting from Matrigel-embedded aortic rings isolated from uPA knock-out (uPA(-/-)) mice was impaired compared with vessels emanating from wild-type mice. Endothelial cells isolated from uPA(-/-) mice show less proliferation and migration in response to VEGF than their wild type counterparts or uPA(-/-) endothelial cells in which expression of wild type uPA had been restored. We reported previously that uPA is transported from cell surface receptors to nuclei through a mechanism that requires its kringle domain. Intranuclear uPA modulates gene transcription by binding to a subset of transcription factors. Here we report that wild type single-chain uPA, but not uPA variants incapable of nuclear transport, increases the expression of cell surface VEGF receptor 1 (VEGFR1) and VEGF receptor 2 (VEGFR2) by translocating to the nuclei of ECs. Intranuclear single-chain uPA binds directly to and interferes with the function of the transcription factor hematopoietically expressed homeodomain protein or proline-rich homeodomain protein (HHEX/PRH), which thereby lose their physiologic capacity to repress the activity of vehgr1 and vegfr2 gene promoters. These studies identify uPA-dependent de-repression of vegfr1 and vegfr2 gene transcription through binding to HHEX/PRH as a novel mechanism by which uPA mediates the pro-angiogenic effects of VEGF and identifies a potential new target for control of pathologic angiogenesis. PMID:27151212

  15. Systematic Analysis of Intracellular-targeting Antimicrobial Peptides, Bactenecin 7, Hybrid of Pleurocidin and Dermaseptin, Proline-Arginine-rich Peptide, and Lactoferricin B, by Using Escherichia coli Proteome Microarrays.

    PubMed

    Ho, Yu-Hsuan; Shah, Pramod; Chen, Yi-Wen; Chen, Chien-Sheng

    2016-06-01

    Antimicrobial peptides (AMPs) act either through membrane lysis or by attacking intracellular targets. Intracellular targeting AMPs are a resource for antimicrobial agent development. Several AMPs have been identified as intracellular targeting peptides; however, the intracellular targets of many of these peptides remain unknown. In the present study, we used an Escherichia coli proteome microarray to systematically identify the protein targets of three intracellular targeting AMPs: bactenecin 7 (Bac7), a hybrid of pleurocidin and dermaseptin (P-Der), and proline-arginine-rich peptide (PR-39). In addition, we also included the data of lactoferricin B (LfcinB) from our previous study for a more comprehensive analysis. We analyzed the unique protein hits of each AMP in the Kyoto Encyclopedia of Genes and Genomes. The results indicated that Bac7 targets purine metabolism and histidine kinase, LfcinB attacks the transcription-related activities and several cellular carbohydrate biosynthetic processes, P-Der affects several catabolic processes of small molecules, and PR-39 preferentially recognizes proteins involved in RNA- and folate-metabolism-related cellular processes. Moreover, both Bac7 and LfcinB target purine metabolism, whereas LfcinB and PR-39 target lipopolysaccharide biosynthesis. This suggested that LfcinB and Bac7 as well as LfcinB and PR-39 have a synergistic effect on antimicrobial activity, which was validated through antimicrobial assays. Furthermore, common hits of all four AMPs indicated that all of them target arginine decarboxylase, which is a crucial enzyme for Escherichia coli survival in extremely acidic environments. Thus, these AMPs may display greater inhibition to bacterial growth in extremely acidic environments. We have also confirmed this finding in bacterial growth inhibition assays. In conclusion, this comprehensive identification and systematic analysis of intracellular targeting AMPs reveals crucial insights into the intracellular

  16. Influence of the yjiL-mdtM Gene Cluster on the Antibacterial Activity of Proline-Rich Antimicrobial Peptides Overcoming Escherichia coli Resistance Induced by the Missing SbmA Transporter System

    PubMed Central

    Krizsan, Andor; Knappe, Daniel

    2015-01-01

    In view of increasing health threats from multiresistant pathogens, antimicrobial peptides (AMPs) and, specifically, proline-rich AMPs (PrAMPs) have been investigated in animal models. PrAMPs enter bacteria via the ABC transporter SbmA and inhibit intracellular targets. We used phage transduction (Tn10 insertion) to screen by random mutagenesis for alternative uptake mechanisms for analogs of apidaecin 1b, a honeybee-derived PrAMP. All 24 apidaecin-resistant mutants had the Tn10 insertion in the sbmA gene. These sbmA::Tn10 insertion mutants and the Escherichia coli BW25113 ΔsbmA (JW0368) strain were still susceptible to the bactenecin PrAMP Bac7(1-35) and oncocin PrAMPs Onc18 and Onc112, as well as to Chex1-Arg20, despite significantly reduced internalizations. In a second round of random mutagenesis, the remaining susceptibility was linked to the yjiL-mdtM gene cluster. E. coli BW25113 and its ΔyjiL null mutant (JW5785) were equally susceptible to all PrAMPs tested, whereas the BW25113 ΔmdtM mutant was less susceptible to oncocins. The JW0368 yjiL::Tn10 transposon mutant (BS2) was resistant to all short PrAMPs and susceptible only to full-length Bac7 and A3-APO. Interestingly, PrAMPs appear to enter bacteria via MdtM, a multidrug resistance transporter (drug/H+ antiporter) of the major facilitator superfamily (MFS) that can efflux antibiotics, biocides, and bile salts. In conclusion, PrAMPs enter bacteria via ABC and MFS transporters that efflux antibiotics and cytotoxic compounds from the cytoplasm to the periplasm. PMID:26169420

  17. A C-terminal proline-rich sequence simultaneously broadens the optimal temperature and pH ranges and improves the catalytic efficiency of glycosyl hydrolase family 10 ruminal xylanases.

    PubMed

    Li, Zhongyuan; Xue, Xianli; Zhao, Heng; Yang, Peilong; Luo, Huiying; Zhao, Junqi; Huang, Huoqing; Yao, Bin

    2014-06-01

    Efficient degradation of plant polysaccharides in rumen requires xylanolytic enzymes with a high catalytic capacity. In this study, a full-length xylanase gene (xynA) was retrieved from the sheep rumen. The deduced XynA sequence contains a putative signal peptide, a catalytic motif of glycoside hydrolase family 10 (GH10), and an extra C-terminal proline-rich sequence without a homolog. To determine its function, both mature XynA and its C terminus-truncated mutant, XynA-Tr, were expressed in Escherichia coli. The C-terminal oligopeptide had significant effects on the function and structure of XynA. Compared with XynA-Tr, XynA exhibited improved specific activity (12-fold) and catalytic efficiency (14-fold), a higher temperature optimum (50°C versus 45°C), and broader ranges of temperature and pH optima (pH 5.0 to 7.5 and 40 to 60°C versus pH 5.5 to 6.5 and 40 to 50°C). Moreover, XynA released more xylose than XynA-Tr when using beech wood xylan and wheat arabinoxylan as the substrate. The underlying mechanisms responsible for these changes were analyzed by substrate binding assay, circular dichroism (CD) spectroscopy, isothermal titration calorimetry (ITC), and xylooligosaccharide hydrolysis. XynA had no ability to bind to any of the tested soluble and insoluble polysaccharides. However, it contained more α helices and had a greater affinity and catalytic efficiency toward xylooligosaccharides, which benefited complete substrate degradation. Similar results were obtained when the C-terminal sequence was fused to another GH10 xylanase from sheep rumen. This study reveals an engineering strategy to improve the catalytic performance of enzymes. PMID:24657866

  18. Nuclear magnetic resonance spectroscopic and computer-stimulated structural analyses of a heptapeptide sequence found around the N-glycosylation site of a proline-rich glycoprotein from human parotid saliva.

    PubMed Central

    Loomis, R E; Bhandary, K K; Tseng, C C; Bergey, E J; Levine, M J

    1987-01-01

    The proline-rich glycoprotein from human parotid saliva has a common heptapeptide sequence around four of six N-glycosylation sites (Maeda, N., H. S. Kim, E. A. Azen, and O. J. Smithies, 1985, J. Biol. Chem., 20:11123-11130). A synthetic model of the heptamer protein sequence, NH2-Q(1)-G(2)-G(3)-N(4)-Q(5)-S(6)-Q(7)-CONH2, was examined by nuclear magnetic resonance (NMR) spectroscopy and the ECEPP/2-VAO4A (Empirical Conformation Energy Program for Peptides) energy minimization computer algorithm (Scheraga, H. A., 1982, Quantum Chemistry Program Exchange, 454; Powell, M. J. D., 1964, Quantum Chemistry Program Exchange, 60). The NMR spectrum was almost completely assigned in dimethylsulfoxide-d6 (DMSO), and the amide chemical shift temperature dependence, phi dihedral angles, and chi 1 rotamer populations elucidated. These data indicated that a significant population of the heptamer could exist as a type I beta-turn [4----1 between Q(5) and G(2)] and/or a type II' beta-turn [4----1 between (Q)5 and G(2) and/or a gamma-turn [3----1 between Q(5) and G(3)] with the amino acid chi 1 torsion angles weighted toward the gauche- conformation. Starting from these three possible conformations, the ECEPP/2-VAO4A rigid geometry energy minimization program was used to find the localized predominant in vacuo structures of this heptapeptide sequence. The type II' beta-turn conformation best fits the data based on internuclear hydrogen-bonding distances, minimum potential energy considerations, and the NMR parameters. Images FIGURE 7 FIGURE 8 FIGURE 9 PMID:3828456

  19. The upregulation of NR2A-containing N-methyl-D-aspartate receptor function by tyrosine phosphorylation of postsynaptic density 95 via facilitating Src/proline-rich tyrosine kinase 2 activation.

    PubMed

    Zhao, Chao; Du, Cai-Ping; Peng, Yan; Xu, Zhen; Sun, Chang-Cheng; Liu, Yong; Hou, Xiao-Yu

    2015-04-01

    The activation of postsynaptic N-methyl-D-aspartate (NMDA) receptors is required for long-term potentiation (LTP) of synaptic transmission. Postsynaptic density 95 (PSD-95) serves as a scaffold protein that tethers NMDA receptor subunits, kinases, and signal molecules. Our previous study proves that PSD-95 is a substrate of Src/Fyn and identifies Y523 on PSD-95 as a principal phosphorylation site. In this paper, we try to define an involvement and molecular consequences of PSD-95 phosphorylation by Src in NMDA receptor regulation. We found that either NMDA or chemical LTP induction leads to rapid phosphorylation of PSD-95 by Src in cultured cortical neurons. The phosphorylation of Y523 on PSD-95 potentiates NR2A-containing NMDA receptor current amplitude, implying an important role of Src-mediated PSD-95 phosphorylation in NMDA receptor activation. Comparing to wild-type PSD-95, overexpression of nonphosphorylatable mutant PSD-95Y523F attenuated the NMDA-stimulated NR2A tyrosine phosphorylation that enhances electrophysiological responses of NMDA receptor channels, while did not affect the membrane localization of NR2A subunits. PSD-95Y523D, a phosphomimetic mutant of PSD-95, induced NR2A tyrosine phosphorylation even if there was no NMDA treatment. In addition, the deficiency of Y523 phosphorylation on PSD-95 impaired the facilitatory effect of PSD-95 on the activation of Src and proline-rich tyrosine kinase 2 (Pyk2) and decreased the binding of Pyk2 with PSD-95. These results indicate that PSD-95 phosphorylation by Src facilitates the integration of Pyk2 to PSD-95 signal complex, the activation of Pyk2/Src, as well as the subsequent tyrosine phosphorylation of NR2A, which ultimately results in the upregulation of NMDA receptor function and synaptic transmission. PMID:24981431

  20. Regional and local species richness in an insular environment: Serpentine plants in California

    USGS Publications Warehouse

    Harrison, S.; Safford, H.D.; Grace, J.B.; Viers, J.H.; Davies, K.F.

    2006-01-01

    We asked how the richness of the specialized (endemic) flora of serpentine rock outcrops in California varies at both the regional and local scales. Our study had two goals: first, to test whether endemic richness is affected by spatial habitat structure (e.g., regional serpentine area, local serpentine outcrop area, regional and local measures of outcrop isolation), and second, to conduct this test in the context of a broader assessment of environmental influences (e.g., climate, soils, vegetation, disturbance) and historical influences (e.g., geologic age, geographic province) on local and regional species richness. We measured endemic and total richness and environmental variables in 109 serpentine sites (1000-m2 paired plots) in 78 serpentine-containing regions of the state. We used structural equation modeling (SEM) to simultaneously relate regional richness to regionalscale predictors, and local richness to both local-scale and regional-scale predictors. Our model for serpentine endemics explained 66% of the variation in local endemic richness based on local environment (vegetation, soils, rock cover) and on regional endemic richness. It explained 73% of the variation in regional endemic richness based on regional environment (climate and productivity), historical factors (geologic age and geographic province), and spatial structure (regional total area of serpentine, the only significant spatial variable in our analysis). We did not find a strong influence of spatial structure on species richness. However, we were able to distinguish local vs. regional influences on species richness to a novel extent, despite the existence of correlations between local and regional conditions. ?? 2006 by the Ecological Society of America.

  1. Two proline residues are essential in the calcium-binding activity of rotavirus VP7 outer capsid protein.

    PubMed Central

    Gajardo, R; Vende, P; Poncet, D; Cohen, J

    1997-01-01

    Rotavirus maturation and stability of the outer capsid are calcium-dependent processes. It has been shown previously that the concentration of Ca2+-solubilizing outer capsid proteins from rotavirus particles is dependent on the virus strain. This property of viral particles has been associated with the gene coding for VP7 (gene 9). In this study the correlation between VP7 and resistance to low [Ca2+] was confirmed by analyzing the origin of gene 9 from reassortant viruses prepared under the selective pressure of low [Ca2+]. After chemical mutagenesis, we selected mutant viruses of the bovine strain RF that are more resistant to low [Ca2+]. The genes coding for the VP7 proteins of these independent mutants have been sequenced. Sequence analysis confirmed that these mutants are independent and revealed that all mutant VP7 proteins have proline 75 changed to leucine and have an outer capsid that solubilized at low [Ca2+]. The mutation of proline 279 to serine is found in all but two mutants. The phenotype of mutants having a single proline change can be distinguished from the phenotype of mutants having two proline changes. Sequence analysis showed that position 75 is in a region (amino acids 65 to 78) of great variability and that proline 75 is present in most of the bovine strains. In contrast, proline 279 is in a conserved region and is conserved in all the VP7 sequences in data banks. This region is rich in oxygenated residues that are correctly allocated in the metal-coordinating positions of the Ca2+-binding EF-hand structure pattern, suggesting that this region is important in the Ca2+ binding of VP7. PMID:9032355

  2. Disentangling the determinants of species richness of vascular plants and mammals from national to regional scales.

    PubMed

    Xu, Haigen; Cao, Mingchang; Wu, Yi; Cai, Lei; Cao, Yun; Wu, Jun; Lei, Juncheng; Le, Zhifang; Ding, Hui; Cui, Peng

    2016-01-01

    Understanding the spatial patterns in species richness gets new implication for biodiversity conservation in the context of climate change and intensified human intervention. Here, we created a database of the geographical distribution of 30,519 vascular plant species and 565 mammal species from 2,376 counties across China and disentangled the determinants that explain species richness patterns both at national and regional scales using spatial linear models. We found that the determinants of species richness patterns varied among regions: elevational range was the most powerful predictor for the species richness of plants and mammals across China. However, species richness patterns in the Qinghai-Tibetan Plateau Region (QTR) are quite unique, where net primary productivity was the most important predictor. We also detected that elevational range was positively related to plant species richness when it is less than 1,900 m, whereas the relationship was not significant when elevational range is larger than 1,900 m. It indicated that elevational range often emerges as the predominant controlling factor within the regions where energy is sufficient. The effects of land use on mammal species richness should attract special attention. Our study suggests that region-specific conservation policies should be developed based on the regional features of species richness. PMID:26902418

  3. Disentangling the determinants of species richness of vascular plants and mammals from national to regional scales

    PubMed Central

    Xu, Haigen; Cao, Mingchang; Wu, Yi; Cai, Lei; Cao, Yun; Wu, Jun; Lei, Juncheng; Le, Zhifang; Ding, Hui; Cui, Peng

    2016-01-01

    Understanding the spatial patterns in species richness gets new implication for biodiversity conservation in the context of climate change and intensified human intervention. Here, we created a database of the geographical distribution of 30,519 vascular plant species and 565 mammal species from 2,376 counties across China and disentangled the determinants that explain species richness patterns both at national and regional scales using spatial linear models. We found that the determinants of species richness patterns varied among regions: elevational range was the most powerful predictor for the species richness of plants and mammals across China. However, species richness patterns in the Qinghai-Tibetan Plateau Region (QTR) are quite unique, where net primary productivity was the most important predictor. We also detected that elevational range was positively related to plant species richness when it is less than 1,900 m, whereas the relationship was not significant when elevational range is larger than 1,900 m. It indicated that elevational range often emerges as the predominant controlling factor within the regions where energy is sufficient. The effects of land use on mammal species richness should attract special attention. Our study suggests that region-specific conservation policies should be developed based on the regional features of species richness. PMID:26902418

  4. Fragmentation reactions of deprotonated peptides containing proline. The proline effect.

    PubMed

    Harrison, Alex G; Young, Alex B

    2005-09-01

    The collision-induced dissociation (CID) fragmentation reactions of a variety of deprotonated peptides containing proline have been studied in detail using MS(2) and MS(3) experiments, deuterium labelling and accurate mass measurements when necessary. The [M--H--CO(2)](-) (a(2)) ion derived from H-Pro-Xxx-OH dipeptides shows an unusual fragmentation involving loss of C(2)H(4); this fragmentation reaction is not observed for larger peptides. The primary fragmentation reactions of deprotonated tripeptides with an N-terminal proline are formation of a(3) and y(1) ions. When proline is in the central position of tripeptides, a(3), y(2) and y(1) ions are the primary fragmentation products of [M--H](-), while when the proline is in the C-terminal position, a(3)and y(1) ions are the major primary products. In the latter case, the a(3) ion fragments primarily to the ''b(2) ion; further evidence is presented that the ''b(2) ions have a deprotonated oxazolone structure. Larger deprotonated peptides having at least two amino acid residues N-terminal to proline show a distinct preference for cleavage of the amide bond N-terminal to proline to form, mainly, the appropriate y ion. This proline effect is compared and contrasted with the similar proline effect observed in the fragmentation of protonated peptides containing proline. PMID:16041740

  5. Cluster of genes controlling proline degradation in Salmonella typhimurium.

    PubMed Central

    Ratzkin, B; Roth, J

    1978-01-01

    A cluster of genes essential for degradation of proline to glutamate (put) is located between the pyrC and pyrD loci at min 22 of the Salmonella chromosome. A series of 25 deletion mutants of this region have been isolated and used to construct a fine-structure map of the put genes. The map includes mutations affecting the proline degradative activities, proline oxidase and pyrroline-5-carboxylic dehydrogenase. Also included are mutations affecting the major proline permease and a regulatory mutation that affects both enzyme and permease production. The two enzymatic activities appear to be encoded by a single gene (putA). The regulatory mutation maps between the putA gene and the proline permease gene (putP). PMID:342507

  6. New Isomers in the Neutron-Rich Region Beyond 208Pb

    NASA Astrophysics Data System (ADS)

    Gottardo, A.; Valiente-Dobón, J. J.; Benzoni, G.; Gadea, A.; Lunardi, S.; Boutachkov, P.; Bruce, A. M.; Górska, M.; Grebosz, J.; Pietri, S.; Podolyák, Zs.; Pfützner, M.; Regan, P. H.; Weick, H.; Alcántara Núñez, J.; Algora, A.; Al-Dahan, N.; de Angelis, G.; Ayyad, Y.; Alkhomashi, N.; Allegro, P. R. P.; Bazzacco, D.; Benlliure, J.; Bowry, M.; Bracco, A.; Bunce, M.; Camera, F.; Casarejos, E.; Cortes, M. L.; Crespi, F. C. L.; Corsi, A.; Bacelar, A. M. Denis; Deo, A. Y.; Domingo-Pardo, C.; Doncel, M.; Dombradi, Zs.; Engert, T.; Eppinger, K.; Farrelly, G. F.; Farinon, F.; Farnea, E.; Geissel, H.; Gerl, J.; Goel, N.; Gregor, E.; Habermann, T.; Hoischen, R.; Janik, R.; John, P. R.; Klupp, S.; Kojouharov, I.; Kurz, N.; Lenzi, S. M.; Leoni, S.; Mandal, S.; Menegazzo, R.; Mengoni, D.; Million, B.; Modamio, V.; Morales, A. I.; Napoli, D. R.; Naqvi, F.; Nicolini, R.; Nociforo, C.; Prochazka, A.; Prokopowicz, W.; Recchia, F.; Ribas, R. V.; Reed, M. W.; Rudolph, D.; Sahin, E.; Schaffner, H.; Sharma, A.; Sitar, B.; Siwal, D.; Steiger, K.; Strmen, P.; Swan, T. P. D.; Szarka, I.; Ur, C. A.; Walker, P. M.; Wieland, O.; Wollersheim, H.-J.

    2014-03-01

    The region of neutron-rich nuclei beyond 208Pb has been very difficult to explore due to its high mass and exoticity. However, recent experimental improvements allowed one to perform a quite extended isomer decay spectroscopy of these nuclei.

  7. Substrate channeling in proline metabolism

    PubMed Central

    Arentson, Benjamin W.; Sanyal, Nikhilesh; Becker, Donald F.

    2012-01-01

    Proline metabolism is an important pathway that has relevance in several cellular functions such as redox balance, apoptosis, and cell survival. Results from different groups have indicated that substrate channeling of proline metabolic intermediates may be a critical mechanism. One intermediate is pyrroline-5-carboxylate (P5C), which upon hydrolysis opens to glutamic semialdehyde (GSA). Recent structural and kinetic evidence indicate substrate channeling of P5C/GSA occurs in the proline catabolic pathway between the proline dehydrogenase and P5C dehydrogenase active sites of bifunctional proline utilization A (PutA). Substrate channeling in PutA is proposed to facilitate the hydrolysis of P5C to GSA which is unfavorable at physiological pH. The second intermediate, gamma-glutamyl phosphate, is part of the proline biosynthetic pathway and is extremely labile. Substrate channeling of gamma-glutamyl phosphate is thought to be necessary to protect it from bulk solvent. Because of the unfavorable equilibrium of P5C/GSA and the reactivity of gamma-glutamyl phosphate, substrate channeling likely improves the efficiency of proline metabolism. Here, we outline general strategies for testing substrate channeling and review the evidence for channeling in proline metabolism. PMID:22201749

  8. A global assessment of endemism and species richness across island and mainland regions

    PubMed Central

    Kier, Gerold; Kreft, Holger; Lee, Tien Ming; Jetz, Walter; Ibisch, Pierre L.; Nowicki, Christoph; Mutke, Jens; Barthlott, Wilhelm

    2009-01-01

    Endemism and species richness are highly relevant to the global prioritization of conservation efforts in which oceanic islands have remained relatively neglected. When compared to mainland areas, oceanic islands in general are known for their high percentage of endemic species but only moderate levels of species richness, prompting the question of their relative conservation value. Here we quantify geographic patterns of endemism-scaled richness (“endemism richness”) of vascular plants across 90 terrestrial biogeographic regions, including islands, worldwide and evaluate their congruence with terrestrial vertebrates. Endemism richness of plants and vertebrates is strongly related, and values on islands exceed those of mainland regions by a factor of 9.5 and 8.1 for plants and vertebrates, respectively. Comparisons of different measures of past and future human impact and land cover change further reveal marked differences between mainland and island regions. While island and mainland regions suffered equally from past habitat loss, we find the human impact index, a measure of current threat, to be significantly higher on islands. Projected land-cover changes for the year 2100 indicate that land-use-driven changes on islands might strongly increase in the future. Given their conservation risks, smaller land areas, and high levels of endemism richness, islands may offer particularly high returns for species conservation efforts and therefore warrant a high priority in global biodiversity conservation in this century. PMID:19470638

  9. OcculterCut: A Comprehensive Survey of AT-Rich Regions in Fungal Genomes

    PubMed Central

    Testa, Alison C.; Oliver, Richard P.; Hane, James K.

    2016-01-01

    We present a novel method to measure the local GC-content bias in genomes and a survey of published fungal species. The method, enacted as “OcculterCut” (https://sourceforge.net/projects/occultercut, last accessed April 30, 2016), identified species containing distinct AT-rich regions. In most fungal taxa, AT-rich regions are a signature of repeat-induced point mutation (RIP), which targets repetitive DNA and decreases GC-content though the conversion of cytosine to thymine bases. RIP has in turn been identified as a driver of fungal genome evolution, as RIP mutations can also occur in single-copy genes neighboring repeat-rich regions. Over time RIP perpetuates “two speeds” of gene evolution in the GC-equilibrated and AT-rich regions of fungal genomes. In this study, genomes showing evidence of this process are found to be common, particularly among the Pezizomycotina. Further analysis highlighted differences in amino acid composition and putative functions of genes from these regions, supporting the hypothesis that these regions play an important role in fungal evolution. OcculterCut can also be used to identify genes undergoing RIP-assisted diversifying selection, such as small, secreted effector proteins that mediate host-microbe disease interactions. PMID:27289099

  10. OcculterCut: A Comprehensive Survey of AT-Rich Regions in Fungal Genomes.

    PubMed

    Testa, Alison C; Oliver, Richard P; Hane, James K

    2016-01-01

    We present a novel method to measure the local GC-content bias in genomes and a survey of published fungal species. The method, enacted as "OcculterCut" (https://sourceforge.net/projects/occultercut, last accessed April 30, 2016), identified species containing distinct AT-rich regions. In most fungal taxa, AT-rich regions are a signature of repeat-induced point mutation (RIP), which targets repetitive DNA and decreases GC-content though the conversion of cytosine to thymine bases. RIP has in turn been identified as a driver of fungal genome evolution, as RIP mutations can also occur in single-copy genes neighboring repeat-rich regions. Over time RIP perpetuates "two speeds" of gene evolution in the GC-equilibrated and AT-rich regions of fungal genomes. In this study, genomes showing evidence of this process are found to be common, particularly among the Pezizomycotina. Further analysis highlighted differences in amino acid composition and putative functions of genes from these regions, supporting the hypothesis that these regions play an important role in fungal evolution. OcculterCut can also be used to identify genes undergoing RIP-assisted diversifying selection, such as small, secreted effector proteins that mediate host-microbe disease interactions. PMID:27289099

  11. Condensation of Si-rich region inside soda-lime glass by parallel femtosecond laser irradiation.

    PubMed

    Sakakura, Masaaki; Yoshimura, Kouhei; Kurita, Torataro; Shimizu, Masahiro; Shimotsuma, Yasuhiko; Fukuda, Naoaki; Hirao, Kazuyuki; Miura, Kiyotaka

    2014-06-30

    Local melting and modulation of elemental distributions can be induced inside a glass by focusing femtosecond (fs) laser pulses at high repetition rate (>100 kHz). Using only a single beam of fs laser pulses, the shape of the molten region is ellipsoidal, so the induced elemental distributions are often circular and elongate in the laser propagation direction. In this study, we show that the elongation of the fs laser-induced elemental distributions inside a soda-lime glass could be suppressed by parallel fsing of 250 kHz and 1 kHz fs laser pulses. The thickness of a Si-rich region became about twice thinner than that of a single 250 kHz laser irradiation. Interestingly, the position of the Si-rich region depended on the relative positions between 1 kHz and 250 kHz photoexcited regions. The observation of glass melt during laser exposure showed that the vortex flow of glass melt occurred and it induced the formation of a Si-rich region. Based on the simulation of the transient temperature and viscosity distributions during laser exposure, we temporally interpreted the origin of the vortex flow of glass melt and the mechanism of the formation of the Si-rich region. PMID:24977898

  12. Genome-Wide Chromatin Remodeling Identified at GC-Rich Long Nucleosome-Free Regions

    PubMed Central

    Hochreiter, Sepp

    2012-01-01

    To gain deeper insights into principles of cell biology, it is essential to understand how cells reorganize their genomes by chromatin remodeling. We analyzed chromatin remodeling on next generation sequencing data from resting and activated T cells to determine a whole-genome chromatin remodeling landscape. We consider chromatin remodeling in terms of nucleosome repositioning which can be observed most robustly in long nucleosome-free regions (LNFRs) that are occupied by nucleosomes in another cell state. We found that LNFR sequences are either AT-rich or GC-rich, where nucleosome repositioning was observed much more prominently in GC-rich LNFRs — a considerable proportion of them outside promoter regions. Using support vector machines with string kernels, we identified a GC-rich DNA sequence pattern indicating loci of nucleosome repositioning in resting T cells. This pattern appears to be also typical for CpG islands. We found out that nucleosome repositioning in GC-rich LNFRs is indeed associated with CpG islands and with binding sites of the CpG-island-binding ZF-CXXC proteins KDM2A and CFP1. That this association occurs prominently inside and also prominently outside of promoter regions hints at a mechanism governing nucleosome repositioning that acts on a whole-genome scale. PMID:23144837

  13. Proline transport in rat kidney mitochondria.

    PubMed

    Atlante, A; Passarella, S; Pierro, P; Quagliariello, E

    1994-02-15

    Proline transport in rat kidney mitochondria was investigated both by using isotopic techniques and by spectroscopic measurements, in which proline metabolism was essentially allowed to occur. Widely used criteria for demonstrating the occurrence of carrier-mediated transport were successfully applied in both cases. Differences found in the Km and Vmax values, in pH and temperature dependence of proline transport, and in the inhibitor sensitivity demonstrate the existence of two separate translocators for proline in rat kidney mitochondria, i.e., the proline uniporter and the proline/glutamate antiporter. Efflux of glutamate via glutamate/OH- translocator following proline uptake by mitochondria was experimentally ruled out. Discussion is also made of the possible role of such translocators in proline metabolism and in the putative proline/glutamate shuttle. PMID:7906935

  14. Proline derivatives in fruits of bergamot (Citrus bergamia Risso et Poit): presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine.

    PubMed

    Servillo, Luigi; Giovane, Alfonso; Balestrieri, Maria Luisa; Cautela, Domenico; Castaldo, Domenico

    2011-01-12

    The content of proline and various compounds deriving from its metabolism (4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine) was determined in fruits and seeds of Bergamot (Citrus bergamia Risso et Poit), growing in the Calabria region (South Italy). A HPLC-ESI-tandem mass spectrometry method, which allowed rapid determination of L-proline, 4-hydroxy-L-proline, N-methyl-L-proline, N,N-dimethylproline, and 4-hydroxy-L-prolinebetaine in juice and extracts of bergamot fruit with minimum sample preparation and short analysis time (about 10 min), is presented. Proline and 4-hydroxy-L-proline levels in the samples were also determined by HPLC analysis with fluorescence detection and the results compared to those obtained with HPLC-ESI-tandem mass spectrometry. For the first time, the presence of N-methyl-L-proline and 4-hydroxy-L-prolinebetaine in the fruits of a plant of the Citrus genus is reported. PMID:21128667

  15. Importance of SARS-CoV spike protein Trp-rich region in viral infectivity

    SciTech Connect

    Lu Yanning; Neo, T.L.; Liu, D.Xi.; Tam, James P.

    2008-07-04

    SARS-CoV entry is mediated by spike glycoprotein. During the viral and host cellular membrane fusion, HR1 and HR2 form 6-helix bundle, positioning the fusion peptide closely to the C-terminal region of ectodomain to drive apposition and subsequent membrane fusion. Connecting to the HR2 region is a Trp-rich region which is absolutely conserved in members of coronaviruses. To investigate the importance of Trp-rich region in SARS-CoV entry, we produced different mutated S proteins using Alanine scan strategy. SARS-CoV pseudotyped with mutated S protein was used to measure viral infectivity. To restore the aromaticity of Ala-mutants, we performed rescue experiments using phenylalanine substitutions. Our results show that individually substituted Ala-mutants substantially decrease infectivity by >90%, global Ala-mutants totally abrogated infectivity. In contrast, Phe-substituted mutants are able to restore 10-25% infectivity comparing to the wild-type. The results suggest that the Trp-rich region of S protein is essential for SARS-CoV infectivity.

  16. Sites of Calcium Uptake of Fish Otoliths correspond with macular Regions rich of Carbonic Anhydrase

    NASA Astrophysics Data System (ADS)

    Beier, M.; Anken, R.; Hilbig, R.

    Based on pharmacological data, it has been suggested that the enzyme carbonic anhydrase (CA) plays a prominent role in the mineralization of fish otoliths. In order to directly test this proposal, the topographical distribution of CA was histochemically analyzed in the utricular and saccular maculae of larval cichlid fish Oreochromis mossambicus. Further investigations were focussed on the sites of otolithic calcium uptake using the fluorescent calcium tracer alizarin-complexone (AC). Both in the utricle and the saccule, CA-rich areas were located on both sides of the sensory macula which reportedly contain ionocytes, specialized cells regulating the ionic composition of the endolymph. The reactivity of CA per μm^2 was similar in all of these regions. In the saccule, the size of the dorsal and ventral CA-rich regions did not differ (and thus yielded the same total CA-reactivity), whereas, in the utricle, the medial CA-rich portion was considerably larger (and therefore had a higher total CA-reactivity) as compared to the laterally located area (the CA-rich regions are homologous in the both endorgans; however, anatomical references relative to the body axes of a fish differ, since the two maculae are located perpendicular to each other). AC-incubation resulted in a fluorescent band on the proximal surface of the otoliths (this surface lies next to the sensory epithelium). In saccular otoliths (sagittae), AC-fluorescence was distributed evenly within the band. However, in the utricular otoliths (lapilli), the medial portion of the AC-band was considerably broader as compared to its lateral aspect. These results strongly suggest that calcium uptake of otoliths takes place especially in those regions of their proximal face which are located adjacent to CA-rich areas of the macular epithelium. It is thus concluded that CA is directly involved in otolith calcification. Acknowledgement: This work was financially supported by the German Aerospace Center (DLR) (FKZ: 50 WB

  17. Identification of the P-body component PATL1 as a novel ALG-2-interacting protein by in silico and far-Western screening of proline-rich proteins.

    PubMed

    Osugi, Kanae; Suzuki, Hironori; Nomura, Tomomi; Ariumi, Yasuo; Shibata, Hideki; Maki, Masatoshi

    2012-06-01

    ALG-2 (also named PDCD6) is a 22-kDa Ca(2+)-binding protein that belongs to the penta-EF-hand family including calpain small subunit and interacts with various proteins such as ALIX and Sec31A at their specific sites containing an ALG-2-binding motif (ABM) present in their respective Pro-rich region (PRR). In this study, to search for novel ALG-2-interacting proteins, we first performed in silico screening of ABM-containing PRRs in a human protein database. After selecting 17 sequences, we expressed the PRR or full-length proteins fused with green fluorescent protein (GFP) in HEK293T cells and analysed their abilities to bind to ALG-2 by Far-Western blotting using biotinylated ALG-2 as a probe. As a result, we found 10 positive new ALG-2-binding candidates with different degrees of binding ability. For further investigation, we selected PATL1 (alternatively designated Pat1b), a component of the P-body, which is a cytoplasmic non-membranous granule composed of translation-inactive mRNAs and proteins involved in mRNA decay. Interactions between endogenous PATL1 and ALG-2 proteins were demonstrated by a co-immunoprecipitation assay using their specific antibodies. Furthermore, in immunofluorescence microscopic analyses, PATL1 as well as DCP1A, a well-known P-body marker, co-localized with a subset of ALG-2. This is the first report showing interaction of ALG-2 with a P-body component. PMID:22437941

  18. Proline dehydrogenase (oxidase) in cancer.

    PubMed

    Liu, Wei; Phang, James M

    2012-01-01

    Proline dehydrogenase (oxidase, PRODH/POX), the first enzyme in the proline degradative pathway, plays a special role in tumorigenesis and tumor development. Proline metabolism catalyzed by PRODH/POX is closely linked with the tricarboxylic acid (TCA) cycle and urea cycle. The proline cycle formed by the interconversion of proline and Δ(1) -pyrroline-5-carboxylate (P5C) between mitochondria and cytosol interlocks with pentose phosphate pathway. Importantly, by catalyzing proline to P5C, PRODH/POX donates electrons into the electron transport chain to generate ROS or ATP. In earlier studies, we found that PRODH/POX functions as a tumor suppressor to initiate apoptosis, inhibit tumor growth, and block the cell cycle, all by ROS signaling. It also suppresses hypoxia inducible factor signaling by increasing α-ketoglutarate. During tumor progression, PRODH/POX is under the control of various tumor-associated factors, such as tumor suppressor p53, inflammatory factor peroxisome proliferator-activated receptor gamma (PPARγ), onco-miRNA miR-23b*, and oncogenic transcription factor c-MYC. Recent studies revealed the two-sided features of PRODH/POX-mediated regulation. Under metabolic stress such as oxygen and glucose deprivation, PRODH/POX can be induced to serve as a tumor survival factor through ATP production or ROS-induced autophagy. The paradoxical roles of PRODH/POX can be understood considering the temporal and spatial context of the tumor. Further studies will provide additional insights into this protein and on its metabolic effects in tumors, which may lead to new therapeutic strategies. PMID:22886911

  19. Biogeographic affinity helps explain productivity-richness relationships at regional and local scales

    USGS Publications Warehouse

    Harrison, S.; Grace, J.B.

    2007-01-01

    The unresolved question of what causes the observed positive relationship between large-scale productivity and species richness has long interested ecologists and evolutionists. Here we examine a potential explanation that we call the biogeographic affinity hypothesis, which proposes that the productivity-richness relationship is a function of species' climatic tolerances that in turn are shaped by the earth's climatic history combined with evolutionary niche conservatism. Using botanical data from regions and sites across California, we find support for a key prediction of this hypothesis, namely, that the productivity-species richness relationship differs strongly and predictably among groups of higher taxa on the basis of their biogeographic affinities (i.e., between families or genera primarily associated with north-temperate, semiarid, or desert zones). We also show that a consideration of biogeographic affinity can yield new insights on how productivity-richness patterns at large geographic scales filter down to affect patterns of species richness and composition within local communities. ?? 2007 by The University of Chicago. All rights reserved.

  20. Biogeographic affinity helps explain productivity-richness relationships at regional and local scales.

    PubMed

    Harrison, Susan; Grace, James B

    2007-08-01

    The unresolved question of what causes the observed positive relationship between large-scale productivity and species richness has long interested ecologists and evolutionists. Here we examine a potential explanation that we call the biogeographic affinity hypothesis, which proposes that the productivity-richness relationship is a function of species' climatic tolerances that in turn are shaped by the earth's climatic history combined with evolutionary niche conservatism. Using botanical data from regions and sites across California, we find support for a key prediction of this hypothesis, namely, that the productivity-species richness relationship differs strongly and predictably among groups of higher taxa on the basis of their biogeographic affinities (i.e., between families or genera primarily associated with north-temperate, semiarid, or desert zones). We also show that a consideration of biogeographic affinity can yield new insights on how productivity-richness patterns at large geographic scales filter down to affect patterns of species richness and composition within local communities. PMID:17874384

  1. Role of proline in cell wall synthesis and plant development and its implications in plant ontogeny.

    PubMed

    Kavi Kishor, Polavarapu B; Hima Kumari, P; Sunita, M S L; Sreenivasulu, Nese

    2015-01-01

    Proline is a proteogenic amino acid and accumulates both under stress and non-stress conditions as a beneficial solute in plants. Recent discoveries point out that proline plays an important role in plant growth and differentiation across life cycle. It is a key determinant of many cell wall proteins that plays important roles in plant development. The role of extensins, arabinogalactan proteins and hydroxyproline- and proline-rich proteins as important components of cell wall proteins that play pivotal roles in cell wall signal transduction cascades, plant development and stress tolerance is discussed in this review. Molecular insights are also provided here into the plausible roles of proline transporters modulating key events in plant development. In addition, the roles of proline during seed developmental transitions including storage protein synthesis are discussed. PMID:26257754

  2. Role of proline in cell wall synthesis and plant development and its implications in plant ontogeny

    PubMed Central

    Kavi Kishor, Polavarapu B.; Hima Kumari, P.; Sunita, M. S. L.; Sreenivasulu, Nese

    2015-01-01

    Proline is a proteogenic amino acid and accumulates both under stress and non-stress conditions as a beneficial solute in plants. Recent discoveries point out that proline plays an important role in plant growth and differentiation across life cycle. It is a key determinant of many cell wall proteins that plays important roles in plant development. The role of extensins, arabinogalactan proteins and hydroxyproline- and proline-rich proteins as important components of cell wall proteins that play pivotal roles in cell wall signal transduction cascades, plant development and stress tolerance is discussed in this review. Molecular insights are also provided here into the plausible roles of proline transporters modulating key events in plant development. In addition, the roles of proline during seed developmental transitions including storage protein synthesis are discussed. PMID:26257754

  3. Nuclear structure in the neutron-rich doubly magic sup 78 Ni region

    SciTech Connect

    Hill, J.C.; Wohn, F.K.; Winger, J.A.; Warburton, E.K.; Gill, R.L.; Schuhmann, R.B.; Brookhaven National Lab., Upton, NY; Clark Univ., Worcester, MA )

    1989-01-01

    The magic numbers Z=28 and N=50 imply that very neutron-rich {sup 78}Ni, which has not yet been observed, is doubly magic. The {sup 78}Ni region was investigated by studying the N=50 isotones and neutron-rich Zn isotopes. Results on the level structure of {sup 83}As, {sup 74}Zn, and {sup 76}Zn populated in the decays of {sup 83}Ge, {sup 74}Cu, and {sup 76}Cu are presented. The parent nuclides were produced and mass separated using the TRISTAN facility on-line to the High-Flux Beam Reactor at Brookhaven. The systematics of the N=50 isotones and even-A Zn isotopes are discussed and compared with shell-model calculations involving active nucleons outside of a {sup 78}Ni and {sup 66}Ni core, respectively. The extent to which the {sup 78}Ni region can be considered doubly magic is assessed. 43 refs., 7 figs.

  4. Landscape correlates of breeding bird richness across the United States mid-Atlantic region

    USGS Publications Warehouse

    Jones, K.B.; Neale, A.C.; Nash, M.S.; Riitters, K.H.; Wickham, J.D.; O'Neill, R. V.; Van Remortel, R. D.

    2000-01-01

    Using a new set of landscape indicator data generated by the U.S.EPA, and a comprehensive breeding bird database from the National Breeding Bird Survey, we evaluated associations between breeding bird richness and landscape characteristics across the entire mid-Atlantic region of the United States. We evaluated how these relationships varied among different groupings (guilds) of birds based on functional, structural, and compositional aspects of individual species demographics. Forest edge was by far the most important landscape attribute affecting the richness of the lumped specialist and generalist guilds; specialist species richness was negatively associated with forest edge and generalist richness was positively associated with forest edge. Landscape variables (indicators) explained a greater proportion of specialist species richness than the generalist guild (46% and 31%, respectively). The lower value in generalists may reflect freer-scale distributions of open habitat that go undetected by the Landsat satellite, open habitats created by roads (the areas from which breeding bird data are obtained), and the lumping of a wide variety of species into the generalist category. A further breakdown of species into 16 guilds showed considerable variation in the response of breeding birds to landscape conditions; forest obligate species had the strongest association with landscape indicators measured in this study (55% of the total variation explained) and forest generalists and open ground nesters the lowest (17% of the total variation explained). The variable response of guild species richness to landscape pattern suggests that one must consider species' demographics when assessing the consequences of landscape change on breeding birds.Using a new set of landscape indicator data generated by the U.S. EPA, and a comprehensive breeding bird database from the National Breeding Bird Survey, we evaluated associations between breeding bird richness and landscape

  5. Characteristics and osmoregulatory roles of uptake systems for proline and glycine betaine in Lactococcus lactis.

    PubMed Central

    Molenaar, D; Hagting, A; Alkema, H; Driessen, A J; Konings, W N

    1993-01-01

    Lactococcus lactis subsp. lactis ML3 contains high pools of proline or betaine when grown under conditions of high osmotic strength. These pools are created by specific transport systems. A high-affinity uptake system for glycine betaine (betaine) with a Km of 1.5 microM is expressed constitutively. The activity of this system is not stimulated by high osmolarities of the growth or assay medium but varies strongly with the medium pH. A low-affinity proline uptake system (Km, > 5 mM) is expressed at high levels only in chemically defined medium (CDM) with high osmolarity. This transport system is also stimulated by high osmolarity. The expression of this proline uptake system is repressed in rich broth with low or high osmolarity and in CDM with low osmolarity. The accumulated proline can be exchanged for betaine. Proline uptake is also effectively inhibited by betaine (Ki of between 50 and 100 microM). The proline transport system therefore probably also transports betaine. The inhibition of proline transport by betaine results in low proline pools in cells grown in high-osmotic-strength, betaine-containing CDM. The energy and pH dependency and the influence of ionophores on the activity of both transport systems suggest that these systems are not proton motive force driven. At low osmolarities, proline uptake is low but significant. This low proline uptake is also inhibited by betaine, although to a lesser extent than in cells grown in high-osmotic-strength CDM. These data indicate that proline uptake in L. lactis is enzyme mediated and is not dependent on passive diffusion, as was previously believed. PMID:8366030

  6. Specific Mg 2+ binding to AT-rich regions of chromatin in the evolution of eukaryotes

    NASA Astrophysics Data System (ADS)

    Strissel, P. L.; Gavrilov, K. L.; Levi-Setti, R.; Strick, R.

    2006-07-01

    At SIMS XIV, we reported SIMS evidence of specific Mg 2+ binding to the AT-rich regions of human metaphase chromosomes represented by G-bands. Subsequent Mg 2+-depletion experiments supported a direct role for Mg 2+ in promoting and maintaining the higher order chromatin structure originating G-bands, possibly due to both Mg 2+-DNA and Mg 2+-protein interactions. An in-depth study, reported elsewhere, implicated also Ca 2+ in the maintenance of chromatin ultrastructure in the scaffold of mammalian chromosomes, in association with topoisomerase II. We examine here the association of Mg 2+ with AT-rich regions of chromatin in the chromosomes of the Indian muntjac deer (IMD), leading to conclusions similar to the above. To answer the question whether the presumed divalent cation role in the chromosomes of advanced eukaryotes had an evolutionary history to be traced back to earlier evolutionary stages, we have SIMS-mapped Ca 2+ and Mg 2+ in BrdU-labeled polytene chromosomes from the salivary gland of the Dipteran Drosophila melanogaster. Striking Ca 2+ and Mg 2+ SIMS banding patterns correlating with those of the Br label (a thymidine analogue) implicate unequivocally a close association of both these cations with the AT-rich regions of DNA for these primitive eukaryotes.

  7. 21 CFR 582.5650 - Proline.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS... § 582.5650 Proline. (a) Product. Proline (L- and DL-forms). (b) Conditions of use. This substance...

  8. 21 CFR 582.5650 - Proline.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Proline. 582.5650 Section 582.5650 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS... § 582.5650 Proline. (a) Product. Proline (L- and DL-forms). (b) Conditions of use. This substance...

  9. Multiple determinants of anuran richness and occurrence in an agricultural region in South-eastern Brazil.

    PubMed

    Prado, Vitor H M; Rossa-Feres, Denise de C

    2014-04-01

    In agricultural landscapes, studies that identify factors driving species richness and occupancy are important because they can guide farmers to use conservation practices that minimize species loss. In this context, anurans are threatened by habitat loss because they depend on the characteristics of both local water bodies and adjacent landscapes. We used a model selection approach to evaluate the influence of local and landscape variables in determining anuran species richness and occurrence in 40 freshwater bodies in a heavily deforested region of semideciduous Atlantic Forest in southeastern Brazil. Our aim was to develop recommendations for conservation of anuran communities in rural areas. Pond hydroperiod and area were the most important variables for explaining anuran species richness and occupancy, with greatest species richness being found in water bodies with intermediate hydroperiod and area. Other important variables that reflected individual species occupancies were the number of vegetation types and pond isolation. In addition, recent studies evidenced that water bodies near forest fragments have higher anuran abundance or diversity. In conclusion, we suggest the maintenance of semi-permanent ponds, isolated from large rivers or reservoirs and near forest fragments, as an effective strategy to conserve anuran fauna in agricultural landscapes of southeastern Brazil. Brazilian government requires the maintenance of forests as legal reserve in each farm, and farmers need to maintain ponds as drinking water for cattle or crop irrigation. For this reason, the guidelines suggested in the present study can be easily adopted, without additional costs to rural productivity. PMID:24488040

  10. Multiple Determinants of Anuran Richness and Occurrence in an Agricultural Region in South-Eastern Brazil

    NASA Astrophysics Data System (ADS)

    Prado, Vitor H. M.; Rossa-Feres, Denise de C.

    2014-04-01

    In agricultural landscapes, studies that identify factors driving species richness and occupancy are important because they can guide farmers to use conservation practices that minimize species loss. In this context, anurans are threatened by habitat loss because they depend on the characteristics of both local water bodies and adjacent landscapes. We used a model selection approach to evaluate the influence of local and landscape variables in determining anuran species richness and occurrence in 40 freshwater bodies in a heavily deforested region of semideciduous Atlantic Forest in southeastern Brazil. Our aim was to develop recommendations for conservation of anuran communities in rural areas. Pond hydroperiod and area were the most important variables for explaining anuran species richness and occupancy, with greatest species richness being found in water bodies with intermediate hydroperiod and area. Other important variables that reflected individual species occupancies were the number of vegetation types and pond isolation. In addition, recent studies evidenced that water bodies near forest fragments have higher anuran abundance or diversity. In conclusion, we suggest the maintenance of semi-permanent ponds, isolated from large rivers or reservoirs and near forest fragments, as an effective strategy to conserve anuran fauna in agricultural landscapes of southeastern Brazil. Brazilian government requires the maintenance of forests as legal reserve in each farm, and farmers need to maintain ponds as drinking water for cattle or crop irrigation. For this reason, the guidelines suggested in the present study can be easily adopted, without additional costs to rural productivity.

  11. Saturation mapping of a gene-rich recombination hot spot region in wheat.

    PubMed Central

    Faris, J D; Haen, K M; Gill, B S

    2000-01-01

    Physical mapping of wheat chromosomes has revealed small chromosome segments of high gene density and frequent recombination interspersed with relatively large regions of low gene density and infrequent recombination. We constructed a detailed genetic and physical map of one highly recombinant region on the long arm of chromosome 5B. This distally located region accounts for 4% of the physical size of the long arm and at least 30% of the recombination along the entire chromosome. Multiple crossovers occurred within this region, and the degree of recombination is at least 11-fold greater than the genomic average. Characteristics of the region such as gene order and frequency of recombination appear to be conserved throughout the evolution of the Triticeae. The region is more prone to chromosome breakage by gametocidal gene action than gene-poor regions, and evidence for genomic instability was implied by loss of gene collinearity for six loci among the homeologous regions. These data suggest that a unique level of chromatin organization exists within gene-rich recombination hot spots. The many agronomically important genes in this region should be accessible by positional cloning. PMID:10655233

  12. Organic-rich source beds and hydrocarbon production in Gulf Coast region

    SciTech Connect

    Williams, D.F.; Lerche, I.

    1988-09-01

    Two models (I and II) are presented that relate the production of hydrocarbons in the Gulf Coast region to organic-rich source beds of ancient intraslope basins. Model I is empirical, based on present-day depositional environments like the anoxic Orca basin of the northern Gulf of Mexico and the Bannock basin of the eastern Mediterranean Sea. Model I proposed that low oxygen levels in intraslope basins of the northwestern Gulf of Mexico (GOM) have been a common mechanism for the accumulation of sediments with significantly increased amounts of marine organic carbon. In Model I progradation of the shelf-slope and regional salt tectonics control the occurrence and stratigraphic distribution of source beds throughout the Tertiary of the GOM. In turn, the maturation history of these organic-rich sediments is influenced by the high thermal conductivity of the underlying salt structures. Model II is statistical; it uses random number theory to suggest that the occurrence of organic-rich black muds in intraslope basins of the northwestern GOM had sufficient capacity to account for a dynamic range estimate of 30 to 500 billion bbl oil total and 30 to 300 bcf/million years per ephemeral basin of gas. These estimates, while approximate, clearly indicate the enormous hydrocarbon potential for generating oil and gas reserves in the Gulf Coast geosyncline. Such estimates underscore the need for a better understanding of intraslope basins of the northwestern GOM.

  13. Germination of Candida albicans induced by proline.

    PubMed Central

    Dabrowa, N; Taxer, S S; Howard, D H

    1976-01-01

    Blastospores of Candida albicans germinated in proline-biotin-buffer medium incubated at 37 C. Certain other amino acids in the glatamate, asparate, and pyruvate families also fostered germinaton but generally to a lesser extent than did proline. L-Cysteine, D-proline, and certain structural analogues of L-proline inhibited proline-stimualted germination. The concentration of phosphate and glucose was crucial to amino acid-stimulated germination of C. albicans. Clinical isolates and stock cultures varied in their response to the germ tube-inducing activity of proline or other amino acids. The proline-buffer medium cannot be used in a diagnostic test for production of germ tubes by isolates of yeasts. PMID:5375

  14. Phase boundary of the Zr-rich region in commercial grade Zr Nb alloys

    NASA Astrophysics Data System (ADS)

    Kim, Hyun-Gil; Park, Jeong-Yong; Jeong, Yong-Hwan

    2005-12-01

    The α/(α + β)/β transformation temperature, the solubility limit of Nb, and the monotectoid temperature of the Zr-Nb binary system were investigated using commercial grade Zr containing 1400 ppm O and 700 ppm Fe and different Nb levels with a high purity. The microstructure characterization was carried out using OM, SEM and TEM and the phase transformation behavior was also investigated using DSC. From the microstructure examination using OM and SEM, it was revealded that the (α + β) region was expanded in commercial grade Zr containing 1400 ppm O and 700 ppm Fe. From the microstructure characterization using TEM, it was revealed that the Nb solubility in α-Zr of quaternary alloy was 0.2 wt%. And the monotectoid temperature of the commercial grade quaternary system of Zr, O, Fe, and Nb was revealed as 585 °C from the SEM, TEM and XRD analysis. The phase boundary of the Zr-rich region in a restricted quaternary alloy of Zr-0.14O-0.07Fe- xNb system was established on the basis of the results obtained in this study using sponge-type Zr. The results of this study were largely different compared with results of the Zr-Nb binary alloy, however, these results could be used at the case of the Zr-rich corner of the phase diagram for a restricted quaternary alloy of Zr-0.14O-0.07Fe- xNb system.

  15. Bridging Between Proline Structure, Functions, Metabolism, and Involvement in Organism Physiology.

    PubMed

    Saibi, Walid; Feki, Kaouthar; Yacoubi, Ines; Brini, Faiçal

    2015-08-01

    Much is now known about proline multifunctionality and metabolism; some aspects of its biological functions are still unclear. Here, we discuss some cases in the proline, structure, definition, metabolism, compartmentalization, accumulation, plausible functions and also its implication in homeostasis and organism physiology. Indeed, we report the role of proline in cellular homeostasis, including redox balance and energy status and their implication as biocatalyst for aldolase activity. Proline can act as a signaling molecule to modulate mitochondrial functions, influence cell proliferation or cell death, and trigger specific gene expression, which can be essential for plant recovery from stresses. Although, the regulation and the function of proline accumulation, during abiotic stresses, are not yet completely understood. The engineering of proline metabolism could lead to new opportunities to improve plant tolerance against environmental stresses. This atypical amino acid has a potential role in the toxicity during growth of some microorganism, vegetal, and mammalian species. Furthermore, we note that the purpose through the work is to provide a rich, concise, and mostly cohesive source on proline, considered as a platform and an anchor between several disciplines and biological functions. PMID:26100388

  16. Trypanosoma cruzi Proline Transport Presents a Cell Density-dependent Regulation.

    PubMed

    Sayé, Melisa; Miranda, Mariana R; Reigada, Chantal; Pereira, Claudio A

    2016-07-01

    Trypanosoma cruzi, the etiological agent of Chagas disease, uses proline as its main carbon source, essential for parasite growth and stage differentiation in epimastigotes and amastigotes. Since proline is mainly obtained from extracellular medium by transport proteins, in this work we studied the regulation of the T. cruzi proline transporter TcAAAP069. Proline uptake and intracellular concentration presented oscillations during epimastigote growth phases, increasing during the early exponential phase (322 pmol/min) and decreasing to undetectable levels during the late exponential phase. Transporter expression rate correlated with proline uptake, and its subcellular localization alternated from both, the plasma membrane and close to the flagellar pocket, when the transport is higher, to only the flagellar pocket region, when the transport decreased until proline uptake and TcAAAP069 protein became undetectable at the end of the growth curve. Interestingly, when parasites were treated with conditioned medium or were concentrated to artificially increase the culture density, the proline transport was completely abolished resembling the effects observed in late exponential phase. These data highlight for the first time the existence of a density-associated regulation of relevant physiological processes such as proline metabolism. PMID:26750517

  17. Influence of proline position upon the ion channel activity of alamethicin.

    PubMed Central

    Kaduk, C; Duclohier, H; Dathe, M; Wenschuh, H; Beyermann, M; Molle, G; Bienert, M

    1997-01-01

    Alamethicin, a 20-residue peptaibol, induces voltage-dependent ion channels in lipid bilayers according to the barrel-stave model. To study relationships between the proline-14-induced kink region and the channel-forming behavior of the peptide, a set of alamethicin analogs with proline incorporated at positions 11, 12, 13, 14, 15, 16, and 17, respectively, as well as an analog with alanine instead of proline at position 14 were synthesized. Macroscopic conductance experiments show that the voltage dependence of the peptides is conserved although slightly influenced, but the apparent mean number of monomers forming the channels is significantly reduced when proline is not located at position 14. This is confirmed in single-channel experiments. The analogs with proline next to position 14 (i.e., 13, 15, 16) show stable conductance levels, but of reduced number, which follows the order Alam-P14 > Alam-P15 > Alam-P16 > Alam-P13. This reduction in the number of levels is connected with changes in the lifetime of the channels. Analogs with proline at position 11, 12, or 17 produce erratic, extremely short-lived current events that could not be resolved. The changes in functional properties are related to structural properties as probed by circular dichroism. The results indicate that proline at position 14 results in optimal channel activity, whereas channels formed by the analogs bearing proline at different positions are considerably less stable. PMID:9129817

  18. Proline metabolism and transport in plant development.

    PubMed

    Lehmann, Silke; Funck, Dietmar; Szabados, László; Rentsch, Doris

    2010-10-01

    Proline fulfils diverse functions in plants. As amino acid it is a structural component of proteins, but it also plays a role as compatible solute under environmental stress conditions. Proline metabolism involves several subcellular compartments and contributes to the redox balance of the cell. Proline synthesis has been associated with tissues undergoing rapid cell divisions, such as shoot apical meristems, and appears to be involved in floral transition and embryo development. High levels of proline can be found in pollen and seeds, where it serves as compatible solute, protecting cellular structures during dehydration. The proline concentrations of cells, tissues and plant organs are regulated by the interplay of biosynthesis, degradation and intra- as well as intercellular transport processes. Among the proline transport proteins characterized so far, both general amino acid permeases and selective compatible solute transporters were identified, reflecting the versatile role of proline under stress and non-stress situations. The review summarizes our current knowledge on proline metabolism and transport in view of plant development, discussing regulatory aspects such as the influence of metabolites and hormones. Additional information from animals, fungi and bacteria is included, showing similarities and differences to proline metabolism and transport in plants. PMID:20204435

  19. Using species distribution modeling to delineate the botanical richness patterns and phytogeographical regions of China

    NASA Astrophysics Data System (ADS)

    Zhang, Ming-Gang; Slik, J. W. Ferry; Ma, Ke-Ping

    2016-03-01

    The millions of plant specimens that have been collected and stored in Chinese herbaria over the past ~110 years have recently been digitized and geo-referenced. Here we use this unique collection data set for species distribution modeling exercise aiming at mapping & explaining the botanical richness; delineating China’s phytogeographical regions and investigating the environmental drivers of the dissimilarity patterns. We modeled distributions of 6,828 woody plants using MaxEnt and remove the collection bias using null model. The continental China was divided into different phytogeographical regions based on the dissimilarity patterns. An ordination and Getis-Ord Gi* hotspot spatial statistics were used to analysis the environmental drivers of the dissimilarity patterns. We found that the annual precipitation and temperature stability were responsible for observed species diversity. The mechanisms causing dissimilarity pattern seems differ among biogeographical regions. The identified environmental drivers of the dissimilarity patterns for southeast, southwest, northwest and northeast are annual precipitation, topographic & temperature stability, water deficit and temperature instability, respectively. For effective conservation of China’s plant diversity, identifying the historical refuge and protection of high diversity areas in each of the identified floristic regions and their subdivisions will be essential.

  20. Projected impacts of climate change on regional capacities for global plant species richness.

    PubMed

    Sommer, Jan Henning; Kreft, Holger; Kier, Gerold; Jetz, Walter; Mutke, Jens; Barthlott, Wilhelm

    2010-08-01

    Climate change represents a major challenge to the maintenance of global biodiversity. To date, the direction and magnitude of net changes in the global distribution of plant diversity remain elusive. We use the empirical multi-variate relationships between contemporary water-energy dynamics and other non-climatic predictor variables to model the regional capacity for plant species richness (CSR) and its projected future changes. We find that across all analysed Intergovernmental Panel on Climate Change emission scenarios, relative changes in CSR increase with increased projected temperature rise. Between now and 2100, global average CSR is projected to remain similar to today (+0.3%) under the optimistic B1/+1.8 degrees C scenario, but to decrease significantly (-9.4%) under the 'business as usual' A1FI/+4.0 degrees C scenario. Across all modelled scenarios, the magnitude and direction of CSR change are geographically highly non-uniform. While in most temperate and arctic regions, a CSR increase is expected, the projections indicate a strong decline in most tropical and subtropical regions. Countries least responsible for past and present greenhouse gas emissions are likely to incur disproportionately large future losses in CSR, whereas industrialized countries have projected moderate increases. Independent of direction, we infer that all changes in regional CSR will probably induce on-site species turnover and thereby be a threat to native floras. PMID:20335215

  1. Using species distribution modeling to delineate the botanical richness patterns and phytogeographical regions of China.

    PubMed

    Zhang, Ming-Gang; Slik, J W Ferry; Ma, Ke-Ping

    2016-01-01

    The millions of plant specimens that have been collected and stored in Chinese herbaria over the past ~110 years have recently been digitized and geo-referenced. Here we use this unique collection data set for species distribution modeling exercise aiming at mapping &explaining the botanical richness; delineating China's phytogeographical regions and investigating the environmental drivers of the dissimilarity patterns. We modeled distributions of 6,828 woody plants using MaxEnt and remove the collection bias using null model. The continental China was divided into different phytogeographical regions based on the dissimilarity patterns. An ordination and Getis-Ord Gi* hotspot spatial statistics were used to analysis the environmental drivers of the dissimilarity patterns. We found that the annual precipitation and temperature stability were responsible for observed species diversity. The mechanisms causing dissimilarity pattern seems differ among biogeographical regions. The identified environmental drivers of the dissimilarity patterns for southeast, southwest, northwest and northeast are annual precipitation, topographic &temperature stability, water deficit and temperature instability, respectively. For effective conservation of China's plant diversity, identifying the historical refuge and protection of high diversity areas in each of the identified floristic regions and their subdivisions will be essential. PMID:26928763

  2. Projected impacts of climate change on regional capacities for global plant species richness

    PubMed Central

    Sommer, Jan Henning; Kreft, Holger; Kier, Gerold; Jetz, Walter; Mutke, Jens; Barthlott, Wilhelm

    2010-01-01

    Climate change represents a major challenge to the maintenance of global biodiversity. To date, the direction and magnitude of net changes in the global distribution of plant diversity remain elusive. We use the empirical multi-variate relationships between contemporary water-energy dynamics and other non-climatic predictor variables to model the regional capacity for plant species richness (CSR) and its projected future changes. We find that across all analysed Intergovernmental Panel on Climate Change emission scenarios, relative changes in CSR increase with increased projected temperature rise. Between now and 2100, global average CSR is projected to remain similar to today (+0.3%) under the optimistic B1/+1.8°C scenario, but to decrease significantly (−9.4%) under the ‘business as usual’ A1FI/+4.0°C scenario. Across all modelled scenarios, the magnitude and direction of CSR change are geographically highly non-uniform. While in most temperate and arctic regions, a CSR increase is expected, the projections indicate a strong decline in most tropical and subtropical regions. Countries least responsible for past and present greenhouse gas emissions are likely to incur disproportionately large future losses in CSR, whereas industrialized countries have projected moderate increases. Independent of direction, we infer that all changes in regional CSR will probably induce on-site species turnover and thereby be a threat to native floras. PMID:20335215

  3. Using species distribution modeling to delineate the botanical richness patterns and phytogeographical regions of China

    PubMed Central

    Zhang, Ming-Gang; Slik, J. W. Ferry; Ma, Ke-Ping

    2016-01-01

    The millions of plant specimens that have been collected and stored in Chinese herbaria over the past ~110 years have recently been digitized and geo-referenced. Here we use this unique collection data set for species distribution modeling exercise aiming at mapping & explaining the botanical richness; delineating China’s phytogeographical regions and investigating the environmental drivers of the dissimilarity patterns. We modeled distributions of 6,828 woody plants using MaxEnt and remove the collection bias using null model. The continental China was divided into different phytogeographical regions based on the dissimilarity patterns. An ordination and Getis-Ord Gi* hotspot spatial statistics were used to analysis the environmental drivers of the dissimilarity patterns. We found that the annual precipitation and temperature stability were responsible for observed species diversity. The mechanisms causing dissimilarity pattern seems differ among biogeographical regions. The identified environmental drivers of the dissimilarity patterns for southeast, southwest, northwest and northeast are annual precipitation, topographic & temperature stability, water deficit and temperature instability, respectively. For effective conservation of China’s plant diversity, identifying the historical refuge and protection of high diversity areas in each of the identified floristic regions and their subdivisions will be essential. PMID:26928763

  4. Proline dehydrogenase is essential for proline protection against hydrogen peroxide induced cell death

    PubMed Central

    Natarajan, Sathish Kumar; Zhu, Weidong; Liang, Xinwen; Zhang, Lu; Demers, Andrew J.; Zimmerman, Matthew C.; Simpson, Melanie A.; Becker, Donald F.

    2012-01-01

    Proline metabolism has an underlying role in apoptotic signaling that impacts tumorigenesis. Proline is oxidized to glutamate in the mitochondria with the rate limiting step catalyzed by proline dehydrogenase (PRODH). PRODH expression is inducible by p53 leading to increased proline oxidation, reactive oxygen species (ROS) formation, and induction of apoptosis. Paradoxical to its role in apoptosis, proline also protects cells against oxidative stress. Here we explore the mechanism of proline protection against hydrogen peroxide stress in melanoma WM35 cells. Treatment of WM35 cells with proline significantly increased cell viability, diminished oxidative damage of cellular lipids and proteins, and retained ATP and NADPH levels after exposure to hydrogen peroxide. Inhibition or siRNA-mediated knockdown of PRODH abolished proline protection against oxidative stress whereas knockdown of Δ1-pyrroline-5-carboxylate reductase, a key enzyme in proline biosynthesis, had no impact on proline protection. Potential linkages between proline metabolism and signaling pathways were explored. The combined inhibition of the mammalian target of rapamycin complex 1 (mTORC1) and mTORC2 eliminated proline protection. A significant increase in Akt activation was observed in proline treated cells after hydrogen peroxide stress along with a corresponding increase in the phosphorylation of the fork head transcription factor class O3a (FoxO3a). The role of PRODH in proline mediated protection was validated in the prostate carcinoma cell line, PC3. Knockdown of PRODH in PC3 cells attenuated phosphorylated levels of Akt and FoxO3a and decreased cell survival during hydrogen peroxide stress. The results provide evidence that PRODH is essential in proline protection against hydrogen peroxide mediated cell death and that proline/PRODH helps activate Akt in cancer cells. PMID:22796327

  5. Localization of human platelet autoantigens to the cysteine-rich region of glycoprotein IIIa.

    PubMed Central

    Kekomaki, R; Dawson, B; McFarland, J; Kunicki, T J

    1991-01-01

    The object of this study was to further localize autoantigenic structures on IIb-IIIa and, if possible, to precisely identify the epitopes recognized by human autoantibodies. In this paper, we identify a 50-kD chymotryptic fragment of IIIa that is recognized by a high percentage of human autoantibodies, typified by the prototype IgG autoantibody RA, which binds to IIIa on intact platelets as well as in an immunoblot assay under nonreduced conditions. Using an immunoblot assay, a carboxy-terminal region of this fragment (33 kD) that contains the cysteine-rich domains of IIIa was found to carry the epitope(s) recognized by the prototype autoantibody RA. The amino-terminal amino acid sequence of the reduced 33-kD fragment, the smallest fragment that retains the RA epitope, is XPSQQDEXSP, and that of the reduced 50-kD fragment is IVQVTFD. This indicates that the 33-kD fragment consists of approximately 175 amino acids beginning at residue 479 and extending at least through residues 636-654, while the 50-kD fragment spans the same region but begins at residue 427. It is apparent that the 33-kD fragment is generated from the 50-kD fragment by additional chymotryptic hydrolysis but remains associated because of the multiple disulfide bonds that are characteristic of this cysteine-rich domain. Sera from 48% of patients with chronic ITP and 2 of 8 patients with acute ITP contain antibodies that bind to the 50-kD fragment in an ELISA. Antibodies of the same specificity are also found in one-third of patients with either secondary immune thrombocytopenia or apparent non-immune thrombocytopenia. We conclude that the 50-kD cysteine-rich region of IIIa is a frequent target of autoantibodies in ITP, but that such antibodies may also be present in cases of thrombocytopenia that cannot be linked to an apparent autoimmune process. Images PMID:1715887

  6. PAC investigation on the Zr-rich region of the PZT phase diagram

    NASA Astrophysics Data System (ADS)

    Alonso, R. E.; Ayala, A. P.; López García, A. R.; Eiras, J. A.

    2007-02-01

    Previous studies using perturbed angular correlation (PAC) spectroscopy in the PbZr 1-xTi xO 3 (PZT) family of compounds show that whereas PbZrO 3 is characterized by a single probes site with a very well-defined hyperfine interaction, in PZT with x⩾0.1 the probes occupy two distributed sites. In this work, we investigate the Zr-rich region of the PZT phase diagram from x=0.02 up to x=0.08 using PAC in order to correlate the hyperfine parameters with the antiferroelectric-ferroelectric phase transition reported to occur at x=0.05. Two static electric quadrupole interactions, one of them fairly distributed, were detected over the whole Ti concentration range, and an abrupt change in the hyperfine parameters for 0.02< x<0.04 is observed. The behaviour of these parameters and the existence of two probe sites is discussed.

  7. High contrast ultrasonic imaging of resin-rich regions in graphite/epoxy composites using entropy

    NASA Astrophysics Data System (ADS)

    Hughes, Michael S.; McCarthy, John E.; Bruillard, Paul. J.; Marsh, Jon N.; Wickline, Samuel A.

    2016-02-01

    This study compares different approaches for imaging a near-surface resin-rich defect in a thin graphite/epoxy plate using backscattered ultrasound. The specimen was created by cutting a circular hole in the second ply; this region filled with excess resin from the graphite/epoxy sheets during the curing process. Backscat-tered waveforms were acquired using a 4 in. focal length, 5MHz center frequency broadband transducer, scanned on a 100 × 100 grid of points that were 0.03 × 0.03 in. apart. The specimen was scanned with the defect side closest to the transducer. Consequently, the reflection from the resin-rich region cannot be gated from the large front-wall echo. At each point in the grid 256 waveforms were averaged together and subsequently used to produce peak-to-peak, Signal Energy (sum of squared digitized waveform values), as well as entropy images of two different types (a Renyi entropy, and a joint entropy). As the figure shows, all of the entropy images exhibit better border delineation and defect contrast than the either the peak-to-peak or Signal Energy. The best results are obtained using the joint entropy of the backscattered waveforms with a reference function. Two different references are examined. The first is a reflection of the insonifying pulse from a stainless steel reflector. The second is an approximate optimum obtained from an iterative parametric search. The joint entropy images produced using this reference exhibit three times the contrast obtained in previous studies.

  8. The cysteine-rich region of T1R3 determines responses to intensely sweet proteins.

    PubMed

    Jiang, Peihua; Ji, Qingzhou; Liu, Zhan; Snyder, Lenore A; Benard, Lumie M J; Margolskee, Robert F; Max, Marianna

    2004-10-22

    A wide variety of chemically diverse compounds taste sweet, including natural sugars such as glucose, fructose, sucrose, and sugar alcohols, small molecule artificial sweeteners such as saccharin and acesulfame K, and proteins such as monellin and thaumatin. Brazzein, like monellin and thaumatin, is a naturally occurring plant protein that humans, apes, and Old World monkeys perceive as tasting sweet but that is not perceived as sweet by other species including New World monkeys, mouse, and rat. It has been shown that heterologous expression of T1R2 plus T1R3 together yields a receptor responsive to many of the above-mentioned sweet tasting ligands. We have determined that the molecular basis for species-specific sensitivity to brazzein sweetness depends on a site within the cysteine-rich region of human T1R3. Other mutations in this region of T1R3 affected receptor activity toward monellin, and in some cases, overall efficacy to multiple sweet compounds, implicating this region as a previously unrecognized important determinant of sweet receptor function. PMID:15299024

  9. Untangling human and environmental effects on geographical gradients of mammal species richness: a global and regional evaluation.

    PubMed

    Torres-Romero, Erik Joaquín; Olalla-Tárraga, Miguel Á

    2015-05-01

    Different hypotheses (geographical, ecological, evolutionary or a combination of them) have been suggested to account for the spatial variation in species richness. However, the relative importance of environment and human impacts in explaining these patterns, either globally or at the biogeographical region level, remains largely unexplored. Here, we jointly evaluate how current environmental conditions and human impacts shape global and regional gradients of species richness in terrestrial mammals. We processed IUCN global distributional data for 3939 mammal species and a set of seven environmental and two human impact variables at a spatial resolution of 96.5 × 96.5 km. We used simple, multiple and partial regression techniques to evaluate environmental and human effects on species richness. Actual evapotranspiration (AET) is the main driver of mammal species richness globally. Together with our results at the biogeographical realm level, this lends strong support for the water-energy hypothesis (i.e. global diversity gradients are best explained by the interaction of water and energy, with a latitudinal shift in the relative importance of ambient energy vs. water availability as we move from the poles to the equator). While human effects on species richness are not easily detected at a global scale due to the large proportion of shared variance with the environment, these effects significantly emerge at the regional level. In the Nearctic, Palearctic and Oriental regions, the independent contribution of human impacts is almost as important as current environmental conditions in explaining richness patterns. The intersection of human impacts with climate drives the geographical variation in mammal species richness in the Palearctic, Nearctic and Oriental regions. Using a human accessibility variable, we show, for the first time, that the zones most accessible to humans are often those where we find lower mammal species richness. PMID:25355656

  10. Stereoselective Synthesis of Quaternary Proline Analogues

    PubMed Central

    Calaza, M. Isabel

    2009-01-01

    This review describes available methods for the diastereoselective and asymmetric synthesis of quaternary prolines. The focus is on the preparation of α-functionalized prolines with the pyrrolidine moiety not embedded in a polycyclic frame. The diverse synthetic approaches are classified according to the bond which is formed to complete the quaternary skeleton. PMID:19655047

  11. Hypothesis about the function of membrane-buried proline residues in transport proteins.

    PubMed Central

    Brandl, C J; Deber, C M

    1986-01-01

    In a survey of the bilayer-spanning regions of integral membrane proteins, membrane-buried proline residues were found in nearly all transport proteins examined, whereas membrane-buried regions of nontransport proteins were largely devoid of intramembranous proline residues. When amino acids from the complete sequences of representative sets of transport and nontransport membrane proteins were analyzed for the distribution of proline residues between aqueous vs. membranous domains, proline was shown to be selectively excluded from membranous domains of the nontransport proteins, in accord with expectation from energetic and structural considerations. In contrast, proline residues in transport proteins were evenly distributed between aqueous and membranous domains, consistent with the notion that functional membrane-buried proline residues are selectively included in transport proteins. As cis peptide bonds involving proline arise in proteins and have been implicated in protein dynamic processes, the cis-trans isomerization of an Xaa-Pro peptide bond (Xaa = unspecified amino acid) buried within the membrane--and the resulting redirection of the protein chain--is proposed to provide the reversible conformational change requisite for the regulation (opening/closing) of a transport channel. Parallel to this function, the relatively negative character of the carbonyl groups of Xaa-Pro peptide bonds may promote their participation as intramembranous liganding sites for positive species in proton/cation transport processes. PMID:3456574

  12. The oil rich Niger Delta region: a framework for improved performance of the Nigerian regulatory process.

    PubMed

    Onu, N Chukemeka Hemanachi

    2003-06-01

    The adoption of this policy framework has the ability to reconcile industry, the environment and community interests, taking into account all factors that are relevant to managing developments that are both sustainable and contributory to the achievement of industrial and community stability. The management of resource development is crucial in sustaining the Niger Delta ecosystem and the human population resident in the Niger Delta region. If these separate bodies are constituted they would have the potential to reduce and discourage: i) the vulnerability of the regulatory body to influential and powerful multinational oil companies; ii) the proclivity for unaccountability to the people of the Niger Delta region, since the people of the Niger Delta would have access to the regulatory body's classified and unclassified information, and are part of the decision-making process; and iii) a reduction in conflict between the oil mining companies and the aggrieved youths of the oil rich Niger Delta region. This policy framework also has the added advantage of producing high quality decisions and more acceptable decisions than those for which the people of the Niger Delta region are excluded from the processes that concern their existence. The agency decision-making could now become a multilateral process and thus promote and enhance the accurate, impartial and rational application of legislative directives to given cases or classes of cases. Most importantly, the Minister of Petroleum Resources should be empowered by legislation to revoke any license or lease in respect of an area designated as marginal if left undeveloped for a period of 5 years and grant a lease or license for the area to a more responsible oil company. PMID:12956601

  13. Regional species richness of families and the distribution of abundance and rarity in a local community of forest Hymenoptera

    NASA Astrophysics Data System (ADS)

    Ulrich, Werner

    2005-09-01

    Recent investigations about the relationship between the number of species of taxonomic lineages and regional patterns of species abundances gave indecisive results. Here, it is shown that mean densities of species of a species-rich community of forest Hymenoptera (673 species out of 25 families) were positively related to the number of European species per family. The fraction of abundant species per family declined and the fraction of rare species increased with species richness. Species rich families contained relatively more species, which were present in only one study year (occasional species), and relatively fewer species present during the whole study period (frequent species).

  14. Assembly of pyrene-modified DNA/RNA duplexes incorporating a G-rich single strand region.

    PubMed

    Seio, Kohji; Tokugawa, Munefumi; Tsunoda, Hirosuke; Ohkubo, Akihiro; Arisaka, Fumio; Sekine, Mitsuo

    2013-12-15

    The structural properties of a DNA/RNA duplex having a pyrene residue at the 5' end of DNA and a G-rich single strand region at the 3' end of RNA were studied in detail. Fluorescence and ultracentrifugation analyses indicated the formation of a complex containing four DNA/RNA duplexes, which required a pyrene residue, G-rich sequence, RNA-type backbone, and high salt concentration. PMID:24183539

  15. Variation and Evolution in the Glutamine-Rich Repeat Region of Drosophila Argonaute-2.

    PubMed

    Palmer, William H; Obbard, Darren J

    2016-01-01

    RNA interference pathways mediate biological processes through Argonaute-family proteins, which bind small RNAs as guides to silence complementary target nucleic acids . In insects and crustaceans Argonaute-2 silences viral nucleic acids, and therefore acts as a primary effector of innate antiviral immunity. Although the function of the major Argonaute-2 domains, which are conserved across most Argonaute-family proteins, are known, many invertebrate Argonaute-2 homologs contain a glutamine-rich repeat (GRR) region of unknown function at the N-terminus . Here we combine long-read amplicon sequencing of Drosophila Genetic Reference Panel (DGRP) lines with publicly available sequence data from many insect species to show that this region evolves extremely rapidly and is hyper-variable within species. We identify distinct GRR haplotype groups in Drosophila melanogaster, and suggest that one of these haplotype groups has recently risen to high frequency in a North American population. Finally, we use published data from genome-wide association studies of viral resistance in D. melanogaster to test whether GRR haplotypes are associated with survival after virus challenge. We find a marginally significant association with survival after challenge with Drosophila C Virus in the DGRP, but we were unable to replicate this finding using lines from the Drosophila Synthetic Population Resource panel. PMID:27317784

  16. Variation and Evolution in the Glutamine-Rich Repeat Region of Drosophila Argonaute-2

    PubMed Central

    Palmer, William H.; Obbard, Darren J.

    2016-01-01

    RNA interference pathways mediate biological processes through Argonaute-family proteins, which bind small RNAs as guides to silence complementary target nucleic acids . In insects and crustaceans Argonaute-2 silences viral nucleic acids, and therefore acts as a primary effector of innate antiviral immunity. Although the function of the major Argonaute-2 domains, which are conserved across most Argonaute-family proteins, are known, many invertebrate Argonaute-2 homologs contain a glutamine-rich repeat (GRR) region of unknown function at the N-terminus . Here we combine long-read amplicon sequencing of Drosophila Genetic Reference Panel (DGRP) lines with publicly available sequence data from many insect species to show that this region evolves extremely rapidly and is hyper-variable within species. We identify distinct GRR haplotype groups in Drosophila melanogaster, and suggest that one of these haplotype groups has recently risen to high frequency in a North American population. Finally, we use published data from genome-wide association studies of viral resistance in D. melanogaster to test whether GRR haplotypes are associated with survival after virus challenge. We find a marginally significant association with survival after challenge with Drosophila C Virus in the DGRP, but we were unable to replicate this finding using lines from the Drosophila Synthetic Population Resource panel. PMID:27317784

  17. Structural studies of the metal-rich region in the ternary Ta-Nb-S system

    SciTech Connect

    Yao, Xiaoqiang.

    1991-10-07

    Six new solid solution type compounds have been prepared using high temperature techniques and characterized by means of single crystal x-ray techniques during a study of the metal-rich region of the ternary Ta-Nb-S system. The structures of Nb{sub x}Ta{sub 11-x}S{sub 4} are reminiscent of niobium-rich sulfides, rather than of tantalum-rich sulfides. The coordinations of sulfur are capped trigonal prismatic while the metal coordinations are capped distorted cubic prismatic for Nb{sub x}Ta{sub 11-x}S{sub 4}, and capped distorted cubic prismatic and pentagonal prismatic for Nb{sub 12-x}Ta{sub x}S{sub 4}. The structures of Nb{sub x}Ta{sub 5-x}S{sub 2} contain homoatomic layers sequenced S-M3-M2-M1-M2-M3-S (M is mixed Nb, Ta) generating six-layer sheets, respectively. Weak S-S interactions at 3.26 and 3.19{Angstrom} between sheets contrast with the M-M binding within and between the sheets in these two novel layered compounds. The former are presumably responsible for the observed graphitic slippage of the samples. Nb{sub 21-x}Ta{sub x}S{sub 8} and Nb{sub x}Ta{sub 2-x}S are isostructural with Nb{sub 21}S{sub 8} and Ta{sub 2}S, respectively. Extended Hueckel band calculations were carried out for two layered compounds, Nb{sub x}Ta{sub 5-x}S{sub 2} (x {approx} 1.72) and Nb{sub x}ta{sub 2-x}S (x {approx} 0.95). Based upon band calculations metallic properties can be expected for these two layered compounds. The relative preference of the metal sites for the two metal elements (Ta, Nb) in two layered compounds is explained by the results of the band calculations. 17 figs., 31 tabs., 80 refs.

  18. Why is a Flare-rich Active Region CME-poor?

    NASA Astrophysics Data System (ADS)

    Liu, Lijuan; Wang, Yuming; Wang, Jingxiu; Shen, Chenglong; Ye, Pinzhong; Liu, Rui; Chen, Jun; Zhang, Quanhao; Wang, S.

    2016-08-01

    Solar active regions (ARs) are the major sources of two of the most violent solar eruptions, namely flares and coronal mass ejections (CMEs). The largest AR in the past 24 years, NOAA AR 12192, which crossed the visible disk from 2014 October 17 to 30, unusually produced more than one hundred flares, including 32 M-class and 6 X-class ones, but only one small CME. Flares and CMEs are believed to be two phenomena in the same eruptive process. Why is such a flare-rich AR so CME-poor? We compared this AR with other four ARs; two were productive in both and two were inert. The investigation of the photospheric parameters based on the SDO/HMI vector magnetogram reveals that the flare-rich AR 12192, as with the other two productive ARs, has larger magnetic flux, current, and free magnetic energy than the two inert ARs but, in contrast to the two productive ARs, it has no strong, concentrated current helicity along both sides of the flaring neutral line, indicating the absence of a mature magnetic structure consisting of highly sheared or twisted field lines. Furthermore, the decay index above the AR 12192 is relatively low, showing strong constraint. These results suggest that productive ARs are always large and have enough current and free energy to power flares, but whether or not a flare is accompanied by a CME is seemingly related to (1) the presence of a mature sheared or twisted core field serving as the seed of the CME, or (2) a weak enough constraint of the overlying arcades.

  19. Evidence that COMT genotype and proline interact on negative-symptom outcomes in schizophrenia and bipolar disorder.

    PubMed

    Clelland, C L; Drouet, V; Rilett, K C; Smeed, J A; Nadrich, R H; Rajparia, A; Read, L L; Clelland, J D

    2016-01-01

    Elevated peripheral proline is associated with psychiatric disorders, and there is evidence that proline is a neuromodulator. The proline dehydrogenase (PRODH) gene, which encodes the enzyme that catalyzes proline catabolism, maps to human chromosome 22q11.2, a region conferring risk of schizophrenia. In the Prodh-null mouse, an interaction between elevated peripheral proline and another 22q11.2 gene, catechol-O-methyltransferase (COMT), on neurotransmission and behavior has been reported. We explored the relationship between fasting plasma proline levels and COMT Val(158)Met genotype on symptoms (positive, negative and total) in schizophrenia patients. In an exploratory study we also examined symptom change in patients with bipolar disorder. There was a significant interaction between peripheral proline and COMT on negative symptoms in schizophrenia (P<0.0001, n=95). In COMT Val/Val patients, high proline was associated with low Scale for the Assessment of Negative Symptom (SANS) scores. In contrast, high proline was associated with high SANS scores in patients carrying a Met allele. The relationship between proline and COMT also appears to modify negative symptoms across psychiatric illness. In bipolar disorder, a significant interaction was also observed on negative-symptom change (P=0.007, n=43). Negative symptoms are intractable and largely unaddressed by current medications. These data indicate a significant interaction between peripheral proline and COMT genotype, influencing negative symptoms in schizophrenia and bipolar disorder. That high proline has converse effects on symptoms by COMT genotype, may have implications for therapeutic decisions. PMID:27622935

  20. Optimising Regionalisation Techniques: Identifying Centres of Endemism in the Extraordinarily Endemic-Rich Cape Floristic Region

    PubMed Central

    Bradshaw, Peter L.; Colville, Jonathan F.; Linder, H. Peter

    2015-01-01

    We used a very large dataset (>40% of all species) from the endemic-rich Cape Floristic Region (CFR) to explore the impact of different weighting techniques, coefficients to calculate similarity among the cells, and clustering approaches on biogeographical regionalisation. The results were used to revise the biogeographical subdivision of the CFR. We show that weighted data (down-weighting widespread species), similarity calculated using Kulczinsky’s second measure, and clustering using UPGMA resulted in the optimal classification. This maximized the number of endemic species, the number of centres recognized, and operational geographic units assigned to centres of endemism (CoEs). We developed a dendrogram branch order cut-off (BOC) method to locate the optimal cut-off points on the dendrogram to define candidate clusters. Kulczinsky’s second measure dendrograms were combined using consensus, identifying areas of conflict which could be due to biotic element overlap or transitional areas. Post-clustering GIS manipulation substantially enhanced the endemic composition and geographic size of candidate CoEs. Although there was broad spatial congruence with previous phytogeographic studies, our techniques allowed for the recovery of additional phytogeographic detail not previously described for the CFR. PMID:26147438

  1. Sites of calcium uptake of fish otoliths correspond with macular regions rich of carbonic anhydrase

    NASA Astrophysics Data System (ADS)

    Beier, M.; Anken, R.; Hilbig, R.

    2006-01-01

    Based on pharmacological data, it has been suggested that the enzyme carbonic anhydrase (CAH) plays a prominent role in the mineralization of fish otoliths. To directly test this proposal, the topographical distribution of CAH was histochemically analyzed in the utricular and saccular maculae of larval cichlid fish Oreochromis mossambicus. Further investigations were focussed on the sites of otolithic calcium uptake using the fluorescent calcium tracer alizarin-complexone (AC). Both in the utricle and the saccule, CAH-reactivity was prominent in regions on both sides of the sensory macula (centrifugal (cf) and centripetal (cp) areas), which reportedly contain ionocytes, specialized cells regulating the ionic composition of the endolymph. (The terms centrifugal and centripetal were chosen instead of lateral and medial, because the saccule is positioned perpendicular to the utricle; “lateral” and “medial” thus do not allow an unambiguous allocation of the respective regions.) In the saccule, the size of cf and cp did not differ from each other, whereas, in the utricle, cp was considerably larger as compared to cf (CAH-reactivity per μm2 was nearly identical in both areas of both endorgans). AC-incubation resulted in a fluorescent band on the proximal surface of the otoliths (this surface lies next to the sensory epithelium). In saccular otoliths (sagittae), the area of the band did not differ between centrifugal and centripetal otolith regions, whereas in the utricular otoliths (lapilli), the area of the centripetal AC-band was larger in size as compared to the centrifugal one (AC-fluorescence per μm2 did not differ between the areas analyzed in both types of otoliths). These results strongly suggest that calcium/carbonate uptake of otoliths takes place especially in those regions of their proximal face which are located adjacent to CAH-rich areas of the macular epithelium. It is thus concluded that CAH is directly involved in otolith calcification. The

  2. Production and identification of new, neutron-rich nuclei in the {sup 208}Pb region

    SciTech Connect

    Rykaczewski, K. ||; Kurpeta, J.; Plochocki, A.

    1998-11-01

    The recently developed methods allowing the experimental studies on new neutron-rich nuclei beyond doubly-magic {sup 208}Pb are briefly described. An identification of new neutron-rich isotopes {sup 215}Pb and {sup 217}Bi, and new decay properties of {sup 216}Bi studied by means of a pulsed release element selective technique at PS Booster-ISOLDE are reported.

  3. On the Split Personality of Penultimate Proline

    NASA Astrophysics Data System (ADS)

    Glover, Matthew S.; Shi, Liuqing; Fuller, Daniel R.; Arnold, Randy J.; Radivojac, Predrag; Clemmer, David E.

    2015-03-01

    The influence of the position of the amino acid proline in polypeptide sequences is examined by a combination of ion mobility spectrometry-mass spectrometry (IMS-MS), amino acid substitutions, and molecular modeling. The results suggest that when proline exists as the second residue from the N-terminus (i.e., penultimate proline), two families of conformers are formed. We demonstrate the existence of these families by a study of a series of truncated and mutated peptides derived from the 11-residue peptide Ser1-Pro2-Glu3-Leu4-Pro5-Ser6-Pro7-Gln8-Ala9-Glu10-Lys11. We find that every peptide from this sequence with a penultimate proline residue has multiple conformations. Substitution of Ala for Pro residues indicates that multiple conformers arise from the cis- trans isomerization of Xaa1-Pro2 peptide bonds as Xaa-Ala peptide bonds are unlikely to adopt the cis isomer, and examination of spectra from a library of 58 peptides indicates that ~80% of sequences show this effect. A simple mechanism suggesting that the barrier between the cis- and trans-proline forms is lowered because of low steric impedance is proposed. This observation may have interesting biological implications as well, and we note that a number of biologically active peptides have penultimate proline residues.

  4. Two proline porters in Escherichia coli K-12.

    PubMed Central

    Stalmach, M E; Grothe, S; Wood, J M

    1983-01-01

    Escherichia coli mutants defective at putP and putA lack proline transport via proline porter I and proline dehydrogenase activity, respectively. They retain a proline uptake system (proline porter II) that is induced during tryptophan-limited growth and are sensitive to the toxic L-proline analog, 3,4-dehydroproline. 3,4-Dehydroproline-resistant mutants derived from a putP putA mutant lack proline porter II. Auxotrophic derivatives derived from putP+ or putP bacteria can grow if provided with proline at low concentration (25 microM); those derived from the 3,4-dehydroproline-resistant mutants require high proline for growth (2.5 mM). We conclude that E. coli, like Salmonella typhimurium, possesses a second proline porter that is inactivated by mutations at the proP locus. PMID:6355059

  5. Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics

    PubMed Central

    2013-01-01

    Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that

  6. Proline Metabolism and Its Implications for Plant-Environment Interaction

    PubMed Central

    Verslues, Paul E.

    2010-01-01

    Proline has long been known to accumulate in plants experiencing water limitation and this has driven studies of proline as a beneficial solute allowing plants to increase cellular osmolarity during water limitation. Proline metabolism also has roles in redox buffering and energy transfer and is involved in plant pathogen interaction and programmed cell death. Some of these unique roles of proline depend on the properties of proline itself, whereas others depend on the “proline cycle” of coordinated proline synthesis in the chloroplast and cytoplasm with proline catabolism in the mitochondria. The regulatory mechanisms controlling proline metabolism, intercellular and intracellular transport and connections of proline to other metabolic pathways are all important to the in vivo functions of proline metabolism. Connections of proline metabolism to the oxidative pentose phosphate pathway and glutamate-glutamine metabolism are of particular interest. The N-acetyl glutamate pathway can also produce ornithine and, potentially, proline but its role and activity are unclear. Use of model systems such as Arabidopsis thaliana to better understand both these long studied and newly emerging functions of proline can help in the design of next-generation experiments testing whether proline metabolism is a promising metabolic engineering target for improving stress resistance of economically important plants. PMID:22303265

  7. Proline porters effect the utilization of proline as nutrient or osmoprotectant for bacteria.

    PubMed

    Wood, J M

    1988-12-01

    Proline is utilized by all organisms as a protein constituent. It may also serve as a source of carbon, energy and nitrogen for growth or as an osmoprotectant. The molecular characteristics of the proline transport systems which mediate the multiple functions of proline in the Gram negative enteric bacteria, Escherichia coli and Salmonella typhimurium, are now becoming apparent. Recent research on those organisms has provided both protocols for the genetic and biochemical characterization of the enzymes mediating proline transport and molecular probes with which the degree of homology among the proline transport systems of archaebacteria, eubacteria and eukaryotes can be assessed. This review has provided a detailed summary of recent research on proline transport in E. coli and S. typhimurium; the properties of other organisms are cited primarily to illustrate the generality of those observations and to show where homologous proline transport systems might be expected to occur. The characteristics of proline transport in eukaryotic microorganisms have recently been reviewed (Horak, 1986). PMID:3072423

  8. Selective vulnerability of Rich Club brain regions is an organizational principle of structural connectivity loss in Huntington's disease.

    PubMed

    McColgan, Peter; Seunarine, Kiran K; Razi, Adeel; Cole, James H; Gregory, Sarah; Durr, Alexandra; Roos, Raymund A C; Stout, Julie C; Landwehrmeyer, Bernhard; Scahill, Rachael I; Clark, Chris A; Rees, Geraint; Tabrizi, Sarah J

    2015-11-01

    Huntington's disease can be predicted many years before symptom onset, and thus makes an ideal model for studying the earliest mechanisms of neurodegeneration. Diffuse patterns of structural connectivity loss occur in the basal ganglia and cortex early in the disease. However, the organizational principles that underlie these changes are unclear. By understanding such principles we can gain insight into the link between the cellular pathology caused by mutant huntingtin and its downstream effect at the macroscopic level. The 'rich club' is a pattern of organization established in healthy human brains, where specific hub 'rich club' brain regions are more highly connected to each other than other brain regions. We hypothesized that selective loss of rich club connectivity might represent an organizing principle underlying the distributed pattern of structural connectivity loss seen in Huntington's disease. To test this hypothesis we performed diffusion tractography and graph theoretical analysis in a pseudo-longitudinal study of 50 premanifest and 38 manifest Huntington's disease participants compared with 47 healthy controls. Consistent with our hypothesis we found that structural connectivity loss selectively affected rich club brain regions in premanifest and manifest Huntington's disease participants compared with controls. We found progressive network changes across controls, premanifest Huntington's disease and manifest Huntington's disease characterized by increased network segregation in the premanifest stage and loss of network integration in manifest disease. These regional and whole brain network differences were highly correlated with cognitive and motor deficits suggesting they have pathophysiological relevance. We also observed greater reductions in the connectivity of brain regions that have higher network traffic and lower clustering of neighbouring regions. This provides a potential mechanism that results in a characteristic pattern of structural

  9. Selective vulnerability of Rich Club brain regions is an organizational principle of structural connectivity loss in Huntington’s disease

    PubMed Central

    Seunarine, Kiran K.; Razi, Adeel; Cole, James H.; Gregory, Sarah; Durr, Alexandra; Roos, Raymund A. C.; Stout, Julie C.; Landwehrmeyer, Bernhard; Scahill, Rachael I.; Clark, Chris A.; Rees, Geraint

    2015-01-01

    Huntington’s disease can be predicted many years before symptom onset, and thus makes an ideal model for studying the earliest mechanisms of neurodegeneration. Diffuse patterns of structural connectivity loss occur in the basal ganglia and cortex early in the disease. However, the organizational principles that underlie these changes are unclear. By understanding such principles we can gain insight into the link between the cellular pathology caused by mutant huntingtin and its downstream effect at the macroscopic level. The ‘rich club’ is a pattern of organization established in healthy human brains, where specific hub ‘rich club’ brain regions are more highly connected to each other than other brain regions. We hypothesized that selective loss of rich club connectivity might represent an organizing principle underlying the distributed pattern of structural connectivity loss seen in Huntington’s disease. To test this hypothesis we performed diffusion tractography and graph theoretical analysis in a pseudo-longitudinal study of 50 premanifest and 38 manifest Huntington’s disease participants compared with 47 healthy controls. Consistent with our hypothesis we found that structural connectivity loss selectively affected rich club brain regions in premanifest and manifest Huntington’s disease participants compared with controls. We found progressive network changes across controls, premanifest Huntington’s disease and manifest Huntington’s disease characterized by increased network segregation in the premanifest stage and loss of network integration in manifest disease. These regional and whole brain network differences were highly correlated with cognitive and motor deficits suggesting they have pathophysiological relevance. We also observed greater reductions in the connectivity of brain regions that have higher network traffic and lower clustering of neighbouring regions. This provides a potential mechanism that results in a characteristic

  10. Solid-Phase Synthesis of Amine/Carboxyl Substituted Prolines and Proline Homologues: Scope and Limitations.

    PubMed

    Zhou, Ziniu; Scott, William L; O'Donnell, Martin J

    2016-01-01

    A solid-phase procedure is used to synthesize racemic peptidomimetics based on the fundamental peptide unit. The peptidomimetics are constructed around proline or proline homologues variably substituted at the amine and carbonyl sites. The procedure expands the diversity of substituted peptidomimetic molecules available to the Distributed Drug Discovery (D3) project. Using a BAL-based solid-phase synthetic sequence the proline or proline homologue subunit is both constructed and incorporated into the peptidomimetic by an α-alkylation, hydrolysis and intramolecular cyclization sequence. Further transformations on solid-phase provide access to a variety of piperazine derivatives representing a class of molecules known to exhibit central nervous system activity. The procedure works well with proline cores, but with larger six- and seven-membered ring homologues the nature of the carboxylic acid acylating the cyclic amine can lead to side reactions and result in poor overall yields. PMID:26999079

  11. The Proline Regulatory Axis and Cancer

    PubMed Central

    Phang, James Ming; Liu, Wei; Hancock, Chad; Christian, Kyle J.

    2012-01-01

    Studies in metabolism and cancer have characterized changes in core pathways involving glucose and glutamine, emphasizing the provision of substrates for building cell mass. But recent findings suggest that pathways previously considered peripheral may play a critical role providing mechanisms for cell regulation. Several of these mechanisms involve the metabolism of non-essential amino acids, for example, the channeling of glycolytic intermediates into the serine pathway for one-carbon transfers. Historically, we proposed that the proline biosynthetic pathway participated in a metabolic interlock with glucose metabolism. The discovery that proline degradation is activated by p53 directed our attention to the initiation of apoptosis by proline oxidase/dehydrogenase. Now, however, we find that the biosynthetic mechanisms and the metabolic interlock may depend on the pathway from glutamine to proline, and it is markedly activated by the oncogene MYC. These findings add a new dimension to the proline regulatory axis in cancer and present attractive potential targets for cancer treatment. PMID:22737668

  12. ESTIMATING REGIONAL SPECIES RICHNESS USING A LIMITED NUMBER OF SURVEY UNITS

    EPA Science Inventory

    The accurate and precise estimation of species richness at large spatial scales using a limited number of survey units is of great significance for ecology and biodiversity conservation. We used the distribution data of native fish and resident breeding bird species compiled for ...

  13. Effects of Proline and Carbohydrates on the Metabolism of Exogenous Proline by Excised Bean Leaves in the Dark

    PubMed Central

    Stewart, Cecil R.

    1972-01-01

    Proline was metabolized when vacuum infiltrated into starved bean (Phaseolus vulgaris L.) leaves from plants previously in the dark for 48 hours, but an equivalent increase in protein proline was not observed. When 14C-proline was infiltrated into starved leaves, a large percentage of the 14C was recovered in other amino acids, organic acids, and CO2, in addition to that recovered as protein proline. However, extensive oxidation of proline was observed only if enough proline was added to increase substantially the endogenous concentration of proline. Increasing the endogenous concentration did not affect the amount of proline that was incorporated into protein. When added to leaves from plants previously in the light of near saturating intensity for more than 16 hr, very little 14C-proline was oxidized, even when a sufficient amount of proline was added to increase the endogenous concentration. Adding sucrose to starved leaves along with the proline slowed down the oxidation of proline. Thus, it appears that some carbohydrate or intermediate of carbohydrate metabolism may inhibit the oxidation of proline in leaves. Based on kinetics of labeling, the pathway of proline oxidation was by conversion to glutamic acid and subsequent metabolism to intermediates in the Krebs cycle and to CO2. PMID:16658215

  14. Thermoresponsive and Mechanical Properties of Poly(L-proline) Gels.

    PubMed

    Gkikas, Manos; Avery, Reginald K; Olsen, Bradley D

    2016-02-01

    Gelation of the left helical N-substituted homopolypeptide poly(L-proline) (PLP) in water was explored, employing rheological and small-angle scattering studies at different temperatures and concentrations in order to investigate the network structure and its mechanical properties. Stiff gels were obtained at 10 wt % or higher at 5 °C, the first time gelation has been observed for homopolypeptides. The secondary structure and helical rigidity of PLP has large structural similarities to gelatin but as gels the two materials show contrasting trends with temperature. With increasing temperature in D2O, the network stiffens, with broad scattering features of similar correlation length for all concentrations and molar masses of PLP. A thermoresponsive transition was also achieved between 5 and 35 °C, with moduli at 35 °C higher than gelatin at 5 °C. The brittle gels could tolerate strains of 1% before yielding with a frequency-independent modulus over the observed range, similar to natural proline-rich proteins, suggesting the potential for thermoresponsive or biomaterial-based applications. PMID:26736072

  15. Proline: Mother Nature’s cryoprotectant applied to protein crystallography

    PubMed Central

    Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.

    2012-01-01

    l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography. PMID:22868767

  16. Proline: Mother Nature;s cryoprotectant applied to protein crystallography

    SciTech Connect

    Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.

    2012-09-05

    L-Proline is one of Mother Nature's cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that L-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6-8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0-3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that L-proline is an effective cryoprotectant for protein crystallography.

  17. Sinorhizobium meliloti Chemoreceptor McpU Mediates Chemotaxis toward Host Plant Exudates through Direct Proline Sensing

    PubMed Central

    Webb, Benjamin A.; Hildreth, Sherry; Helm, Richard F.

    2014-01-01

    Bacterial chemotaxis is an important attribute that aids in establishing symbiosis between rhizobia and their legume hosts. Plant roots and seeds exude a spectrum of molecules into the soil to attract their bacterial symbionts. The alfalfa symbiont Sinorhizobium meliloti possesses eight chemoreceptors to sense its environment and mediate chemotaxis toward its host. The methyl accepting chemotaxis protein McpU is one of the more abundant S. meliloti chemoreceptors and an important sensor for the potent attractant proline. We established a dominant role of McpU in sensing molecules exuded by alfalfa seeds. Mass spectrometry analysis determined that a single germinating seed exudes 3.72 nmol of proline, producing a millimolar concentration near the seed surface which can be detected by the chemosensory system of S. meliloti. Complementation analysis of the mcpU deletion strain verified McpU as the key proline sensor. A structure-based homology search identified tandem Cache (calcium channels and chemotaxis receptors) domains in the periplasmic region of McpU. Conserved residues Asp-155 and Asp-182 of the N-terminal Cache domain were determined to be important for proline sensing by evaluating mutant strains in capillary and swim plate assays. Differential scanning fluorimetry revealed interaction of the isolated periplasmic region of McpU (McpU40-284) with proline and the importance of Asp-182 in this interaction. Using isothermal titration calorimetry, we determined that proline binds with a Kd (dissociation constant) of 104 μM to McpU40-284, while binding was abolished when Asp-182 was substituted by Glu. Our results show that McpU is mediating chemotaxis toward host plants by direct proline sensing. PMID:24657863

  18. Comparative analysis of chicken chromosome 28 provides new clues to the evolutionary fragility of gene-rich vertebrate regions

    PubMed Central

    Gordon, Laurie; Yang, Shan; Tran-Gyamfi, Mary; Baggott, Dan; Christensen, Mari; Hamilton, Aaron; Crooijmans, Richard; Groenen, Martien; Lucas, Susan; Ovcharenko, Ivan; Stubbs, Lisa

    2007-01-01

    The chicken genome draft sequence has provided a valuable resource for studies of an important agricultural and experimental model species and an important data set for comparative analysis. However, some of the most gene-rich segments are missing from chicken genome draft assemblies, limiting the analysis of a substantial number of genes and preventing a closer look at regions that are especially prone to syntenic rearrangements. To facilitate the functional and evolutionary analysis of one especially gene-rich, rearrangement-prone genomic region, we analyzed sequence from BAC clones spanning chicken microchromosome GGA28; as a complement we also analyzed a gene-sparse, stable region from GGA11. In these two regions we documented the conservation and lineage-specific gain and loss of protein-coding genes and precisely mapped the locations of 31 major human-chicken syntenic breakpoints. Altogether, we identified 72 lineage-specific genes, many of which are found at or near syntenic breaks, implicating evolutionary breakpoint regions as major sites of genetic innovation and change. Twenty-two of the 31 breakpoint regions have been reused repeatedly as rearrangement breakpoints in vertebrate evolution. Compared with stable GC-matched regions, GGA28 is highly enriched in CpG islands, as are break-prone intervals identified elsewhere in the chicken genome; evolutionary breakpoints are further enriched in GC content and CpG islands, highlighting a potential role for these features in genome instability. These data support the hypothesis that chromosome rearrangements have not occurred randomly over the course of vertebrate evolution but are focused preferentially within “fragile” regions with unusual DNA sequence characteristics. PMID:17921355

  19. Detailed Studies of the Quick Mixing Region in Rich Burn Low-NO(x) Combustion

    NASA Technical Reports Server (NTRS)

    Samuelsen, G. S.; St.John, D.

    2003-01-01

    NO(x) reduction is a driving force in combustor design today. The fuel-air mixing process can have a significant effect on NO(x) production. This report describes a set of experiments carried out to assess fuel-air mixing sensitivities to geometric variation in the Rich-Burn/Quick-Mix/Lean-Burn (RQL) combustor concept utilized in stationary gas turbine engine applications and proposed for advanced transport aircraft engines. Specifically, three (3) parameters in the quick-mix zone were examined: jet injection angle, jet-to-expansion distance, and jet count (number of jets).

  20. Latitudinal concordance between biogeographic regionalization, community structure, and richness patterns: a study on the reptiles of China

    NASA Astrophysics Data System (ADS)

    Chen, Youhua; Srivastava, Diane S.

    2015-02-01

    Latitudinal patterns in species richness may be affected by both continuous variations in macroecological factors as well as discrete change between biogeographic regions. We examined whether latitudinal reptilian richness and community structure in China were best explained by three macroecological patterns (mid-domain effects, Rapoport's rule effects, or environmental correlates) within or across the ranges of biogeographic realms. The results showed that (1) there was a weak mid-domain effect within the Oriental Realm. However, the mid-domain effect was detected neither at the overall regional scale nor in the Palaearctic Realm. (2) Rapoport's rule was only weakly supported for reptilian fauna in China at lower latitudinal areas. (3) Environmental variables were more strongly correlated with species' latitudinal community structure and richness patterns at the scale of biogeographic realms. Based on the faunal similarity of reptilian community across latitudinal bands, we proposed a latitudinal delineation scheme at 34° N for dividing East Asia into Oriental and Palaearctic biogeographic realms. At last, at the functional group level, we also evaluated the relevant ecological patterns for lizard and snake species across different latitudinal bins, showing that the distributions of lizards presented strong mid-domain effects at the latitudinal ranges within the Oriental Realm and over the whole range but did not support Rapoport's rule. In comparison, snake species supported Rapoport's rule at low latitudinal zones but did not present any remarkable mid-domain effects at any spatial extents. In conclusion, biogeographic realms are an appropriate scale for studying macroecological patterns. Reptilian latitudinal richness patterns of China were explained by a combination of environmental factors and geometric constraints, while the latitudinal community structure patterns were greatly affected by environmental gradients. Functional guilds present differentiated

  1. Salt stress encourages proline accumulation by regulating proline biosynthesis and degradation in Jerusalem artichoke plantlets.

    PubMed

    Huang, Zengrong; Zhao, Long; Chen, Dandan; Liang, Mingxiang; Liu, Zhaopu; Shao, Hongbo; Long, Xiaohua

    2013-01-01

    Proline accumulation is an important mechanism for osmotic regulation under salt stress. In this study, we evaluated proline accumulation profiles in roots, stems and leaves of Jerusalem artichoke (Helianthus tuberosus L.) plantlets under NaCl stress. We also examined HtP5CS, HtOAT and HtPDH enzyme activities and gene expression patterns of putative HtP5CS1, HtP5CS2, HtOAT, HtPDH1, and HtPDH2 genes. The objective of our study was to characterize the proline regulation mechanisms of Jerusalem artichoke, a moderately salt tolerant species, under NaCl stress. Jerusalem artichoke plantlets were observed to accumulate proline in roots, stems and leaves during salt stress. HtP5CS enzyme activities were increased under NaCl stress, while HtOAT and HtPDH activities generally repressed. Transcript levels of HtP5CS2 increased while transcript levels of HtOAT, HtPDH1 and HtPDH2 generally decreased in response to NaCl stress. Our results supports that for Jerusalem artichoke, proline synthesis under salt stress is mainly through the Glu pathway, and HtP5CS2 is predominant in this process while HtOAT plays a less important role. Both HtPDH genes may function in proline degradation. PMID:23637970

  2. Salt Stress Encourages Proline Accumulation by Regulating Proline Biosynthesis and Degradation in Jerusalem Artichoke Plantlets

    PubMed Central

    Huang, Zengrong; Zhao, Long; Chen, Dandan; Liang, Mingxiang; Liu, Zhaopu; Shao, Hongbo; Long, Xiaohua

    2013-01-01

    Proline accumulation is an important mechanism for osmotic regulation under salt stress. In this study, we evaluated proline accumulation profiles in roots, stems and leaves of Jerusalem artichoke (Helianthus tuberosus L.) plantlets under NaCl stress. We also examined HtP5CS, HtOAT and HtPDH enzyme activities and gene expression patterns of putative HtP5CS1, HtP5CS2, HtOAT, HtPDH1, and HtPDH2 genes. The objective of our study was to characterize the proline regulation mechanisms of Jerusalem artichoke, a moderately salt tolerant species, under NaCl stress. Jerusalem artichoke plantlets were observed to accumulate proline in roots, stems and leaves during salt stress. HtP5CS enzyme activities were increased under NaCl stress, while HtOAT and HtPDH activities generally repressed. Transcript levels of HtP5CS2 increased while transcript levels of HtOAT, HtPDH1 and HtPDH2 generally decreased in response to NaCl stress. Our results supports that for Jerusalem artichoke, proline synthesis under salt stress is mainly through the Glu pathway, and HtP5CS2 is predominant in this process while HtOAT plays a less important role. Both HtPDH genes may function in proline degradation. PMID:23637970

  3. Why are proteins with glutamine- and asparagine-rich regions associated with protein misfolding diseases?

    NASA Astrophysics Data System (ADS)

    Cruzeiro, Leonor

    2005-12-01

    The possibility that vibrational excited states (VESs) are the drivers of protein folding and function (the VES hypothesis) is explored to explain the reason why Gln- and Asn-rich proteins are associated with degenerative diseases. The Davydov/Scott model is extended to describe energy transfer from the water solution to the protein and vice versa. Computer simulations show that, on average, Gln and Asn residues lead to an initial larger absorption of energy from the environment to the protein, something that can explain the greater structural instability of prions. The sporadic, inherited and infectious character of prion diseases is discussed in the light of the VES hypothesis. An alternative treatment for prion diseases is suggested.

  4. Proline: Mother Nature’s cryoprotectant applied to protein crystallography

    SciTech Connect

    Pemberton, Travis A.; Still, Brady R.; Christensen, Emily M.; Singh, Harkewal; Srivastava, Dhiraj; Tanner, John J.

    2012-08-01

    The amino acid l-proline is shown to be a good cryoprotectant for protein crystals. Four examples are provided; the range of proline used for cryoprotection is 2.0–3.0 M. l-Proline is one of Mother Nature’s cryoprotectants. Plants and yeast accumulate proline under freeze-induced stress and the use of proline in the cryopreservation of biological samples is well established. Here, it is shown that l-proline is also a useful cryoprotectant for protein crystallography. Proline was used to prepare crystals of lysozyme, xylose isomerase, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase for low-temperature data collection. The crystallization solutions in these test cases included the commonly used precipitants ammonium sulfate, sodium chloride and polyethylene glycol and spanned the pH range 4.6–8.5. Thus, proline is compatible with typical protein-crystallization formulations. The proline concentration needed for cryoprotection of these crystals is in the range 2.0–3.0 M. Complete data sets were collected from the proline-protected crystals. Proline performed as well as traditional cryoprotectants based on the diffraction resolution and data-quality statistics. The structures were refined to assess the binding of proline to these proteins. As observed with traditional cryoprotectants such as glycerol and ethylene glycol, the electron-density maps clearly showed the presence of proline molecules bound to the protein. In two cases, histidine acid phosphatase and 1-pyrroline-5-carboxylate dehydrogenase, proline binds in the active site. It is concluded that l-proline is an effective cryoprotectant for protein crystallography.

  5. Silica-rich deposits and hydrated minerals at Gusev Crater, Mars: Vis-NIR spectral characterization and regional mapping

    USGS Publications Warehouse

    Rice, M.S.; Bell, J.F., III; Cloutis, E.A.; Wang, A.; Ruff, S.W.; Craig, M.A.; Bailey, D.T.; Johnson, J. R.; De Souza, P.A., Jr.; Farrand, W. H.

    2010-01-01

    The Mars Exploration Rover (MER) Spirit has discovered surprisingly high concentrations of amorphous silica in soil and nodular outcrops in the Inner Basin of the Columbia Hills. In Pancam multispectral observations, we find that an absorption feature at the longest Pancam wavelength (1009 nm) appears to be characteristic of these silica-rich materials; however, spectral analyses of amorphous silica suggest that the ???1009 nm spectral feature is not a direct reflection of their silica-rich nature. Based on comparisons with spectral databases, we hypothesize that the presence of H2O or OH, either free (as water ice), adsorbed or bound in a mineral structure, is responsible for the spectral feature observed by Pancam. The Gertrude Weise soil, which is nearly pure opaline silica, may have adsorbed water cold-trapped on mineral grains. The origin of the ???1009 nm Pancam feature observed in the silica-rich nodular outcrops may result from the presence of additional hydrated minerals (specific sulfates, halides, chlorides, sodium silicates, carbonates or borates). Using the ???1009 nm feature with other spectral parameters as a "hydration signature" we have mapped the occurrence of hydrated materials along the extent of Spirit's traverse across the Columbia Hills from West Spur to Home Plate (sols 155-1696). We have also mapped this hydration signature across large panoramic images to understand the regional distribution of materials that are spectrally similar to the silica-rich soil and nodular outcrops. Our results suggest that hydrated materials are common in the Columbia Hills. ?? 2009 Elsevier Inc.

  6. Activation of a new proline transport system in Salmonella typhimurium.

    PubMed

    Ekena, K; Liao, M K; Maloy, S

    1990-06-01

    Proline uptake can be mediated by three different transport systems in wild-type Salmonella typhimurium: a high-affinity proline transport system encoded by the putP gene and two glycine-betaine transport systems with a low affinity for proline encoded by the proP and proU genes. However, only the PutP permease transports proline well enough t allow growth on proline as a sole carbon or nitrogen source. By selecting for mutations that allow a putP mutant to grow on proline as a sole nitrogen source, we isolated mutants (designated proZ) that appeared to activate a cryptic proline transport system. These mutants enhanced the transport of proline and proline analogs but did not require the function of any of the known proline transport genes. The mutations mapped between 75 and 77.5 min on the S. typhimurium linkage map. Proline transport by the proZ mutants was competitively inhibited by isoleucine and leucine, which suggests that the ProZ phenotype may be due to unusual mutations that alter the substrate specificity of the branched-chain amino acid transport system encoded by the liv genes. PMID:2160931

  7. CO2 and CH4 emissions from streams in a lake-rich landscape: Patterns, controls, and regional significance

    NASA Astrophysics Data System (ADS)

    Crawford, John T.; Lottig, Noah R.; Stanley, Emily H.; Walker, John F.; Hanson, Paul C.; Finlay, Jacques C.; Striegl, Robert G.

    2014-03-01

    Aquatic ecosystems are important components of landscape carbon budgets. In lake-rich landscapes, both lakes and streams may be important sources of carbon gases (CO2 and CH4) to the atmosphere, but the processes that control gas concentrations and emissions in these interconnected landscapes have not been adequately addressed. We use multiple data sets that vary in their spatial and temporal extent during 2001-2012 to investigate the carbon gas source strength of streams in a lake-rich landscape and to determine the contribution of lakes, metabolism, and groundwater to stream CO2 and CH4. We show that streams emit roughly the same mass of CO2 (23.4 Gg C yr-1; 0.49 mol CO2 m-2 d-1) as lakes at a regional scale (27 Gg C yr-1) and that stream CH4 emissions (189 Mg C yr-1; 8.46 mmol CH4 m-2 d-1) are an important component of the regional greenhouse gas balance. Gas transfer velocity variability (range = 0.34 to 13.5 m d-1) contributed to the variability of gas flux in this landscape. Groundwater inputs and in-stream metabolism control stream gas supersaturation at the landscape scale, while carbon cycling in lakes and deep groundwaters does not control downstream gas emissions. Our results indicate the need to consider connectivity of all aquatic ecosystems (lakes, streams, wetlands, and groundwater) in lake-rich landscapes and their connections with the terrestrial environment in order to understand the full nature of the carbon cycle.

  8. Engineering of yeast Put4 permease and its application to lager yeast for efficient proline assimilation.

    PubMed

    Omura, Fumihiko; Fujita, Atsushi; Miyajima, Keiji; Fukui, Nobuyuki

    2005-06-01

    The Saccharomyces cerevisiae Put4 permease is significant for the transport of proline, alanine, and glycine. Put4p downregulation is counteracted by npi1 mutation that affects the cellular ubiquitination function. Here we describe mutant Put4 permeases, in which up to nine lysine residues in the cytoplasmic N-terminal domain have been replaced by arginine. The steady-state protein level of the mutant permease Put4-20p (Lys9, Lys34, Lys35, Lys60, Lys68, Lys71, Lys93, Lys105, Lys107 --> Arg) was largely higher compared to that of the wild-type Put4p, indicating that the N-terminal lysines can undergo ubiquitination and the subsequent degradation steps. Proline is the only amino acid that yeast assimilates with difficulty under standard brewing conditions. A lager yeast strain provided with Put4-20p was able to assimilate proline efficiently during beer fermentations. These results suggest possible industrial applications of the mutant Put4 permeases in improved fermentation systems for beer and other alcoholic beverages based on proline-rich fermentable sources. PMID:15973048

  9. An AT-rich region in the APC gene may cause misinterpretation of familial adenomatous polyposis molecular screening.

    PubMed

    Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Leone, Barbara; Valente, Maria Giovanna; Alessandroni, Jhessica; Spila, Antonella; Della-Morte, David; Guadagni, Fiorella

    2012-05-01

    Familial adenomatous polyposis (FAP) is an autosomal-dominant condition mainly due to a mutation of the adenomatous polyposis coli (APC) gene. The present study reports evidence of a technical issue occurring during the mutational analysis of APC exon 4. Genetic conventional direct sequence analysis of a repetitive AT-rich region in the splice acceptor site of APC intron 3 could be misinterpreted as a pathogenetic frameshift result. However, this potential bias may be bypassed adopting a method for random mutagenesis of DNA based on the use of a triphosphate nucleoside analogues mixture. Using this method as a second-level analysis, we also demonstrated the nonpathogenic nature of the variant in the poly A trait in APC exon 4 region (c.423-4delA) that do not result in aberrant splicing of APC exons 3-4; conversely, we did not find a previously reported T deletion/insertion polymorphism. PMID:22447671

  10. The "Boom" and "Bust" Patterns of Communities within the Energy Rich Region of West Virginia: A Case Study of Moundsville

    NASA Astrophysics Data System (ADS)

    Kiger, Brandon S.

    The increasing worldwide demand for energy will provide Energy Rich Regions (ERRs) the opportunity to increase their wealth and quality of living. However, a reoccurring pattern of boom and bust cycles in ERRs suggests the need for more sustainable development strategies. A mixed methods approach (case study) is employed to explore the "wicked human problems" occurring in one community, Moundsville, WV and to discover development patterns that might inform sustainable development strategies for the future. This study explores briefly the distant past development patterns, and in greater detail the pre-boom and most current boom in natural gas. First, data will be derived from a conceptual "Energy Rich Region Template" that explores the sustainability of development from the inclusive wealth forms of natural, human, and physical capital. The qualitative data analysis software (MAXQDA) is used to systematically collect and organize data and information into a community-wide knowledge base (specifically the seven years of city council minutes). This framework can assist future research dedicated to similar cases. Furthermore, this case may support communities and or policymakers in the development of a programming guide for converting the natural capital into other reproducible capital forms, thus avoiding the development cycle of boom and bust.

  11. Identification of significantly mutated regions across cancer types highlights a rich landscape of functional molecular alterations

    PubMed Central

    Araya, Carlos L.; Cenik, Can; Reuter, Jason A.; Kiss, Gert; Pande, Vijay S.; Snyder, Michael P.; Greenleaf, William J.

    2015-01-01

    Cancer sequencing studies have primarily identified cancer-driver genes by the accumulation of protein-altering mutations. An improved method would be annotation-independent, sensitive to unknown distributions of functions within proteins, and inclusive of non-coding drivers. We employed density-based clustering methods in 21 tumor types to detect variably-sized significantly mutated regions (SMRs). SMRs reveal recurrent alterations across a spectrum of coding and non-coding elements, including transcription factor binding sites and untranslated regions mutated in up to ∼15% of specific tumor types. SMRs reveal spatial clustering of mutations at molecular domains and interfaces, often with associated changes in signaling. Mutation frequencies in SMRs demonstrate that distinct protein regions are differentially mutated among tumor types, as exemplified by a linker region of PIK3CA in which biophysical simulations suggest mutations affect regulatory interactions. The functional diversity of SMRs underscores both the varied mechanisms of oncogenic misregulation and the advantage of functionally-agnostic driver identification. PMID:26691984

  12. Harsh corporal punishment is associated with increased T2 relaxation time in dopamine-rich regions.

    PubMed

    Sheu, Yi-Shin; Polcari, Ann; Anderson, Carl M; Teicher, Martin H

    2010-11-01

    Harsh corporal punishment (HCP) was defined as frequent parental administration of corporal punishment (CP) for discipline, with occasional use of objects such as straps, or paddles. CP is linked to increased risk for depression and substance abuse. We examine whether long-term exposure to HCP acts as sub-traumatic stressor that contributes to brain alterations, particularly in dopaminergic pathways, which may mediate their increased vulnerability to drug and alcohol abuse. Nineteen young adults who experienced early HCP but no other forms of maltreatment and twenty-three comparable controls were studied. T2 relaxation time (T2-RT) measurements were performed with an echo planar imaging TE stepping technique and T2 maps were calculated and analyzed voxel-by-voxel to locate regional T2-RT differences between groups. Previous studies indicated that T2-RT provides an indirect index of resting cerebral blood volume. Region of interest (ROI) analyses were also conducted in caudate, putamen, nucleus accumbens, anterior cingulate cortex, dorsolateral prefrontal cortex, thalamus, globus pallidus and cerebellar hemispheres. Voxel-based relaxometry showed that HCP was associated with increased T2-RT in right caudate and putamen. ROI analyses also revealed increased T2-RT in dorsolateral prefrontal cortex, substantia nigra, thalamus and accumbens but not globus pallidus or cerebellum. There were significant associations between T2-RT measures in dopamine target regions and use of drugs and alcohol, and memory performance. Alteration in the paramagnetic or hemodynamic properties of dopaminergic cell body and projection regions were observed in subjects with HCP, and these findings may relate to their increased risk for drug and alcohol abuse. PMID:20600981

  13. Why Is the Great Solar Active Region 12192 Flare-rich but CME-poor?

    NASA Astrophysics Data System (ADS)

    Sun, Xudong; Bobra, Monica G.; Hoeksema, J. Todd; Liu, Yang; Li, Yan; Shen, Chenglong; Couvidat, Sebastien; Norton, Aimee A.; Fisher, George H.

    2015-05-01

    Solar active region (AR) 12192 of 2014 October hosts the largest sunspot group in 24 years. It is the most prolific flaring site of Cycle 24 so far, but surprisingly produced no coronal mass ejection (CME) from the core region during its disk passage. Here, we study the magnetic conditions that prevented eruption and the consequences that ensued. We find AR 12192 to be “big but mild” its core region exhibits weaker non-potentiality, stronger overlying field, and smaller flare-related field changes compared to two other major flare-CME-productive ARs (11429 and 11158). These differences are present in the intensive-type indices (e.g., means) but generally not the extensive ones (e.g., totals). AR 12192's large amount of magnetic free energy does not translate into CME productivity. The unexpected behavior suggests that AR eruptiveness is limited by some relative measure of magnetic non-potentiality over the restriction of background field, and that confined flares may leave weaker photospheric and coronal imprints compared to their eruptive counterparts.

  14. Mycorrhizal-mediated lower proline accumulation in Poncirus trifoliata under water deficit derives from the integration of inhibition of proline synthesis with increase of proline degradation.

    PubMed

    Zou, Ying-Ning; Wu, Qiang-Sheng; Huang, Yong-Ming; Ni, Qiu-Dan; He, Xin-Hua

    2013-01-01

    Proline accumulation was often correlated with drought tolerance of plants infected by arbuscular mycorrhizal fungi (AMF), whereas lower proline in some AM plants including citrus was also found under drought stress and the relevant mechanisms have not been fully elaborated. In this study proline accumulation and activity of key enzymes relative to proline biosynthesis (▵(1)-pyrroline-5-carboxylate synthetase, P5CS; ornithine-δ-aminotransferase, OAT) and degradation (proline dehydrogenase, ProDH) were determined in trifoliate orange (Poncirus trifoliata, a widely used citrus rootstock) inoculated with or without Funneliformis mosseae and under well-watered (WW) or water deficit (WD). AMF colonization significantly increased plant height, stem diameter, leaf number, root volume, biomass production of both leaves and roots and leaf relative water content, irrespectively of water status. Water deficit induced more tissue proline accumulation, in company with an increase of P5CS activity, but a decrease of OAT and ProDH activity, no matter whether under AM or no-AM. Compared with no-AM treatment, AM treatment resulted in lower proline concentration and content in leaf, root, and total plant under both WW and WD. The AMF colonization significantly decreased the activity of both P5CS and OAT in leaf, root, and total plant under WW and WD, except for an insignificant difference of root OAT under WD. The AMF inoculation also generally increased tissue ProDH activity under WW and WD. Plant proline content significantly positively correlated with plant P5CS activity, negatively with plant ProDH activity, but not with plant OAT activity. These results suggest that AM plants may suffer less from WD, thereby inducing lower proline accumulation, which derives from the integration of an inhibition of proline synthesis with an enhancement of proline degradation. PMID:24260421

  15. Mycorrhizal-Mediated Lower Proline Accumulation in Poncirus trifoliata under Water Deficit Derives from the Integration of Inhibition of Proline Synthesis with Increase of Proline Degradation

    PubMed Central

    Zou, Ying-Ning; Wu, Qiang-Sheng; Huang, Yong-Ming; Ni, Qiu-Dan; He, Xin-Hua

    2013-01-01

    Proline accumulation was often correlated with drought tolerance of plants infected by arbuscular mycorrhizal fungi (AMF), whereas lower proline in some AM plants including citrus was also found under drought stress and the relevant mechanisms have not been fully elaborated. In this study proline accumulation and activity of key enzymes relative to proline biosynthesis (▵1-pyrroline-5-carboxylate synthetase, P5CS; ornithine-δ-aminotransferase, OAT) and degradation (proline dehydrogenase, ProDH) were determined in trifoliate orange (Poncirus trifoliata, a widely used citrus rootstock) inoculated with or without Funneliformis mosseae and under well-watered (WW) or water deficit (WD). AMF colonization significantly increased plant height, stem diameter, leaf number, root volume, biomass production of both leaves and roots and leaf relative water content, irrespectively of water status. Water deficit induced more tissue proline accumulation, in company with an increase of P5CS activity, but a decrease of OAT and ProDH activity, no matter whether under AM or no-AM. Compared with no-AM treatment, AM treatment resulted in lower proline concentration and content in leaf, root, and total plant under both WW and WD. The AMF colonization significantly decreased the activity of both P5CS and OAT in leaf, root, and total plant under WW and WD, except for an insignificant difference of root OAT under WD. The AMF inoculation also generally increased tissue ProDH activity under WW and WD. Plant proline content significantly positively correlated with plant P5CS activity, negatively with plant ProDH activity, but not with plant OAT activity. These results suggest that AM plants may suffer less from WD, thereby inducing lower proline accumulation, which derives from the integration of an inhibition of proline synthesis with an enhancement of proline degradation. PMID:24260421

  16. Mass Spectrometric Identification of the Arginine and Lysine deficient Proline Rich Glutamine Rich Wheat Storage Proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tandem mass spectrometry (MS/MS) of enzymatic digest has made possible identification of a wide variety of proteins and complex samples prepared by such techniques as RP-HPLC or 2-D gel electrophoresis. Success requires peptide fragmentation to be indicative of the peptide amino acid sequence. The f...

  17. Internalin of Listeria monocytogenes with an intact leucine-rich repeat region is sufficient to promote internalization.

    PubMed Central

    Lecuit, M; Ohayon, H; Braun, L; Mengaud, J; Cossart, P

    1997-01-01

    Listeria monocytogenes can use two different surface proteins, internalin (InlA) and InlB, to invade mammalian cells. The exact role of these invasiveness factors in vivo remains to be determined. In cultured cells, InlA is necessary to promote Listeria entry into human epithelial cells, such as Caco-2 cells, whereas InlB is necessary to promote Listeria internalization in several other cell types, including hepatocytes, fibroblasts, and epithelioid cells, such as Vero, HeLa, CHO, or Hep-2 cells. We have recently reported that the InlA receptor on Caco-2 cells is the cell adhesion molecule E-cadherin and demonstrated that nonpermissive fibroblasts become permissive for internalin-mediated entry when transfected with the gene coding for LCAM, the chicken homolog of the human E-cadherin gene. In this study, we demonstrate for the first time that the internalin protein alone is sufficient to promote internalization into cells expressing its receptor. Indeed, internalin confers invasiveness to both Enterococcus faecalis and internalin-coated latex beads. As shown by transmission electron microscopy, these beads were phagocytosed via a "zipper" mechanism similar to that observed during the internalin-E-cadherin-mediated entry of Listeria. Moreover, a functional analysis of internalin demonstrates that its amino-terminal region, encompassing the leucine-rich repeat (LRR) region and the inter-repeat (IR) region, is necessary and sufficient to promote bacterial entry into cells expressing its receptor. Several lines of evidence suggest that the LRR region would interact directly with E-cadherin, whereas the IR region would be required for a proper folding of the LRR region. PMID:9393831

  18. Peculiarities of the incorporation of (/sup 3/H)thymidine into AT-rich regions of DNA during replicative synthesis

    SciTech Connect

    Khudolii, G.A.; Khakimov, K.A.; Gorelova, T.V.; Akif'ev, A.P.

    1985-11-01

    The authors studied the role of the AT-rich regions in DNA replication in vivo. The authors selected cells of humans and Drosophila - organisms belonging to different types of alternation of unique and repetitive sequences - as the objects of investigation. The authors then studied the behavior of the AT-rich sequences in replication by the method of thermoelution of (/sup 3/H)thymidine-labeled DNA, fragmented by ultrasound to 350 nucleotide pairs. By measuring the amount of DNA and the amount of the label in the fractions, the authors were able to construct curves of the change in the specific activity of DNA as a function of the temperature of elution from HAP and, consequently, as a function of the AT composition. The authors call them differential temperature chromatograms (DTC). Human peripheral blood lymphocytes were cultured according to the standard procedure with PHA (Difco P). A culture of D. melanogaster cells was labeled with (/sup 3/H)thymidine in the logarithmic phase of growth for 1.2 and 42 h. At the end of the labeling, cell DNA was isolated from the lymphocytes and cell and nuclear DNA from a Drosophila tissue culture by the standard methods.

  19. Structural and functional characterization of EIAV gp45 fusion peptide proximal region and asparagine-rich layer.

    PubMed

    Duan, Liangwei; Du, Jiansen; Wang, Xuefeng; Zhou, Jianhua; Wang, Xiaojun; Liu, Xinqi

    2016-04-01

    Equine infectious anaemia virus (EIAV) and human immunodeficiency virus (HIV) are members of the lentiviral genus. Similar to HIV gp41, EIAV gp45 is a fusogenic protein that mediates fusion between the viral particle and the host cell membrane. The crystal structure of gp45 reported reveals a different conformation in the here that includes the fusion peptide proximal region (FPPR) and neighboring asparagine-rich layer compared with previous HIV-1 gp41 structures. A complicated hydrogen-bond network containing a cluster of solvent molecules appears to be critical for the stability of the gp45 helical bundle. Interestingly, viral replication was relatively unaffected by site-directed mutagenesis of EIAV, in striking contrast to that of HIV-1. Based on these observations, we speculate that EIAV is more adaptable to emergent mutations, which might be important for the evolution of EIAV as a quasi-species, and could potentially contribute to the success of the EIAV vaccine. PMID:26874586

  20. Simulation of mixing in the quick quench region of a rich burn-quick quench mix-lean burn combustor

    NASA Technical Reports Server (NTRS)

    Shih, Tom I.-P.; Nguyen, H. Lee; Howe, Gregory W.; Li, Z.

    1991-01-01

    A computer program was developed to study the mixing process in the quick quench region of a rich burn-quick quench mix-lean burn combustor. The computer program developed was based on the density-weighted, ensemble-averaged conservation equations of mass, momentum (full compressible Navier-Stokes), total energy, and species, closed by a k-epsilon turbulence model with wall functions. The combustion process was modeled by a two-step global reaction mechanism, and NO(x) formation was modeled by the Zeldovich mechanism. The formulation employed in the computer program and the essence of the numerical method of solution are described. Some results obtained for nonreacting and reacting flows with different main-flow to dilution-jet momentum flux ratios are also presented.

  1. A Rich Star-forming Region in the Direction of RCW 95

    NASA Astrophysics Data System (ADS)

    Roman-Lopes, A.; Abraham, Z.

    2004-11-01

    Near-IR imaging in the direction of the IRAS 15408-5356 point source, which is associated with the RCW 95 H II region, revealed a young and massive stellar cluster. We detected 136 member candidates up to our completeness limit, embedded in an infrared nebula and concentrated in an area of about 3 pc2. About 60% of the candidates detected in all three of the J, H, and K bands present infrared excess at 2.2 μm. The UV photons provided by the most massive stars are enough to explain the observed free-free emission at radio wavelengths and the integrated infrared luminosity produced by the heated dust. The near-IR counterpart of the IRAS point source was identified using a more accurate position from the Midcourse Space Experiment (MSX) catalog; it coincides with the peak of emission in the MSX mid-IR bands. The measured integrated flux density of the infrared nebula at the K band is compatible with the expected free-free emission derived from the radio data, but an excess at the J and H bands was detected and may be due to either nonhomogeneous absorption across the nebula or to the presence of scattered stellar light, more prominent at smaller wavelengths. Based on observations made at Laboratório Nacional de Astrofisica/MCT, Brazil.

  2. North African petroleum geology: regional structure and stratigraphic overview of a hydrocarbon-rich cratonic area

    SciTech Connect

    O'Connor, T.E.; Kanes, W.H.

    1985-02-01

    North Africa, including Sinai, contains some of the most important hydrocarbon-producing basins in the world. The North African Symposium is devoted to examining the exploration potential of the North African margin in light of the most recent and promising exploration discoveries. The geologic variety of the region is extraordinary and can challenge any exploration philosophy. Of primary interest are the Sirte basin of Libya, which has produced several billion barrels of oil, and the Gulf of Suez, a narrow, evaporite-capped trough with five fields that will produce more than 5 billion bbl. Both are extensional basins with minimal lateral movement and with good source rocks in direct proximity to reservoirs. Structural models of these basins give firm leads for future exploration. More difficult to evaluate are the Tethyan realm basins of the northern Sinai, and the Western Desert of Egypt, the Cyrenaican Platform of Libya, and the Tunisia-Sicily shelf area, where there are only limited subsurface data. These basins are extensional in origin also, but have been influenced by lateral tectonics. Favorable reservoirs exist, but source rocks have been a problem locally. Structural models with strong stratigraphic response offer several favorable play concepts. The Paleozoic Ghadames basin in Libya, Tunisia, and Algeria has the least complex structural history, and production appears to be limited to small structures. A series of stratigraphic models indicates additional areas with exploration potential. The Paleozoic megabasin of Morocco, with its downfaulted Triassic grabens, remains an untested but attractive area.

  3. Chondrule formation in particle-rich nebular regions at least hundreds of kilometres across.

    PubMed

    Cuzzi, Jeffrey N; Alexander, Conel M O'D

    2006-05-25

    Chondrules are millimetre-sized spherules (mostly silicate) that dominate the texture of primitive meteorites. Their formation mechanism is debated, but their sheer abundance suggests that the mechanism was both energetic and ubiquitous in the early inner Solar System. The processes suggested--such as shock waves, solar flares or nebula lightning--operate on different length scales that have been hard to relate directly to chondrule properties. Chondrules are depleted in volatile elements, but surprisingly they show little evidence for the associated loss of lighter isotopes one would expect. Here we report a model in which molten chondrules come to equilibrium with the gas that was evaporated from other chondrules, and which explains the observations in a natural way. The regions within which the chondrules formed must have been larger than 150-6,000 km in radius, and must have had a precursor number density of at least 10 m(-3). These constraints probably exclude nebula lightning, and also make formation far from the nebula midplane problematic. The wide range of chondrule compositions may be the result of different combinations of the local concentrations of precursors and the local abundance of water ice or vapour. PMID:16724060

  4. Effect of copper-rich regions on tensile properties of VPPA weldments of 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Hartman, J. A.; Beil, R. J.; Hahn, G. T.

    1987-01-01

    This study examines the relations between tensile properties and microstructural features of variable polarity plasma arc (VPPA) weldments of 2219-T87 aluminum. Crack initiation and weld failure of transverse tensile specimens of single and multipass weldments were studied. The specimens fractured on the rising portion of the stress-strain curve prior to necking, signifying that an increase in strength would accompany an increase in ductility. Of particular interest is a shallow, typically 0.001-0.003-in. (0.03-0.08-mm) deep, copper-rich region located in the crown and root corners of the weld. This region is a primary source of crack initiation and growth, due to its brittle nature and highly strained location. The brittle regions were removed by electropolishing and machining to determine their effect on weld tensile properties. The removal increased the ductility of the weld specimens, and in the case of single pass welds, actually increased the load carrying capacity. Local strain measurements and metallographic and chemical analyses are presented.

  5. Glutamine metabolism and function in relation to proline synthesis and the safety of glutamine and proline supplementation.

    PubMed

    Watford, Malcolm

    2008-10-01

    At normal intakes, dietary glutamine and glutamate are metabolized by the small intestine and essentially all glutamine within the body is synthesized de novo through the action of glutamine synthetase. The major sites of net glutamine synthesis are skeletal muscle, lung, and adipose tissue and, under some conditions, the liver. In addition to the small intestine, where glutamine is the major respiratory fuel, other sites of net glutamine utilization include the cells of the immune system, the kidneys, and the liver. The intestine expresses pyrroline 5-carboxylate (P5C) synthase, which means that proline is an end product of intestinal glutamine catabolism. Proline can also be synthesized from ornithine and the exact contribution of the 2 pathways is not certain. Infusion of proline i.v. to increase circulating concentrations is associated with increased proline oxidation and decreased proline synthesis. In contrast, conditions of proline insufficiency, after feeding low-proline diets or in response to high rates of proline catabolism in burn patients, do not result in increased proline synthesis. Glutamine supplementation is widespread and up to 0.57-0.75 g.kg(-1).d(-1) is well tolerated. Similarly, the only study of proline supplementation, in which patients with gyrate atrophy were given 488 mg.kg(-1).d(-1), reported no deleterious side effects. In the absence of controlled trials, it is currently not possible to estimate a safe upper limit for either of these 2 amino acids. PMID:18806115

  6. Volatile-rich Crater Interior Deposits in the Polar Regions of Mars: Evidence for Ice Cap Advance and Retreat

    NASA Technical Reports Server (NTRS)

    Russell, Patrick S.; Head, James W.; Hecht, Michael H.

    2003-01-01

    Many craters on Mars are partially filled by distinctive material emplaced by post-impact processes. This crater fill material is an interior mound which is generally separated from the walls of the crater by a trough that may be continuous along the crater circumference (i.e. a ring-shaped trough), or which may only partially contact the crater walls (i.e. a crescent-shaped trough). The fill deposit is frequently offset from the crater center and may be asymmetric in plan view. Populations of such craters include those in the circum-south polar cap region, in Arabia Terra, associated with the Medusae Fossae Formation, and in the northern lowlands proximal to the north polar cap. We focus on those craters in circumpolar regions and assess their relationship to polar cap advance and retreat, especially the possibility that fill material represents remnants of a formerly larger contiguous cap. Volatile-rich deposits have the property of being modifiable by the local stability of the solid volatile, which is governed by local energy balance. Here we test the hypothesis that asymmetries in volatile fill shape, profile, and center-location within a crater result from asymmetries in local energy balance within the crater, due mainly to variation of solar insolation and radiative effects of the crater walls over the crater interior. Model profiles of crater fill are compared with MOLA topographic profiles to assess this hypothesis. If asymmetry in morphology and location of crater fill are consistent with radiative-dominated asymmetries in energy budget within the crater, then 1) the volatile-rich composition of the fill is supported (this process should not be effective at shaping volcanic or sedimentary deposits), and 2) the dominant factor determining the observed shape of volatile-rich crater fill is the local radiative energy budget (and erosive processes such as eolian deflation are secondary or unnecessary). We also use a geographic and energy model approach to

  7. Regional Variation in Parasite Species Richness and Abundance in the Introduced Range of the Invasive Lionfish, Pterois volitans.

    PubMed

    Sellers, Andrew J; Ruiz, Gregory M; Leung, Brian; Torchin, Mark E

    2015-01-01

    Parasites can play an important role in biological invasions. While introduced species often lose parasites from their native range, they can also accumulate novel parasites in their new range. The accumulation of parasites by introduced species likely varies spatially, and more parasites may shift to new hosts where parasite diversity is high. Considering that parasitism and disease are generally more prevalent at lower latitudes, the accumulation of parasites by introduced hosts may be greater in tropical regions. The Indo-Pacific lionfish (Pterois volitans) has become widely distributed across the Western Atlantic. In this study, we compared parasitism across thirteen locations in four regions, spanning seventeen degrees of latitude in the lionfish's introduced range to examine potential spatial variation in parasitism. In addition, as an initial step to explore how indirect effects of parasitism might influence interactions between lionfish and ecologically similar native hosts, we also compared parasitism in lionfish and two co-occurring native fish species, the graysby grouper, Cephalopholis cruentata, and the lizardfish, Synodus intermedius, in the southernmost region, Panama. Our results show that accumulation of native parasites on lionfish varies across broad spatial scales, and that colonization by ectoparasites was highest in Panama, relative to the other study sites. Endoparasite richness and abundance, on the other hand, were highest in Belize where lionfish were infected by twice as many endoparasite species as lionfish in other regions. The prevalence of all but two parasite species infecting lionfish was below 25%, and we did not detect an association between parasite abundance and host condition, suggesting a limited direct effect of parasites on lionfish, even where parasitism was highest. Further, parasite species richness and abundance were significantly higher in both native fishes compared to lionfish, and parasite abundance was negatively

  8. Regional Variation in Parasite Species Richness and Abundance in the Introduced Range of the Invasive Lionfish, Pterois volitans

    PubMed Central

    2015-01-01

    Parasites can play an important role in biological invasions. While introduced species often lose parasites from their native range, they can also accumulate novel parasites in their new range. The accumulation of parasites by introduced species likely varies spatially, and more parasites may shift to new hosts where parasite diversity is high. Considering that parasitism and disease are generally more prevalent at lower latitudes, the accumulation of parasites by introduced hosts may be greater in tropical regions. The Indo-Pacific lionfish (Pterois volitans) has become widely distributed across the Western Atlantic. In this study, we compared parasitism across thirteen locations in four regions, spanning seventeen degrees of latitude in the lionfish's introduced range to examine potential spatial variation in parasitism. In addition, as an initial step to explore how indirect effects of parasitism might influence interactions between lionfish and ecologically similar native hosts, we also compared parasitism in lionfish and two co-occurring native fish species, the graysby grouper, Cephalopholis cruentata, and the lizardfish, Synodus intermedius, in the southernmost region, Panama. Our results show that accumulation of native parasites on lionfish varies across broad spatial scales, and that colonization by ectoparasites was highest in Panama, relative to the other study sites. Endoparasite richness and abundance, on the other hand, were highest in Belize where lionfish were infected by twice as many endoparasite species as lionfish in other regions. The prevalence of all but two parasite species infecting lionfish was below 25%, and we did not detect an association between parasite abundance and host condition, suggesting a limited direct effect of parasites on lionfish, even where parasitism was highest. Further, parasite species richness and abundance were significantly higher in both native fishes compared to lionfish, and parasite abundance was negatively

  9. Cryobiological Characteristics of L-proline in Mammalian Oocyte Cryopreservation

    PubMed Central

    Zhang, Lu; Xue, Xu; Yan, Jie; Yan, Li-Ying; Jin, Xiao-Hu; Zhu, Xiao-Hui; He, Zhi-Zhu; Liu, Jing; Li, Rong; Qiao, Jie

    2016-01-01

    Background: L-proline is a natural, nontoxic cryoprotectant that helps cells and tissues to tolerate freezing in a variety of plants and animals. The use of L-proline in mammalian oocyte cryopreservation is rare. In this study, we explored the cryobiological characteristics of L-proline and evaluated its protective effect in mouse oocyte cryopreservation. Methods: The freezing property of L-proline was detected by Raman spectroscopy and osmometer. Mature oocytes obtained from 8-week-old B6D2F1 mice were vitrified in a solution consisting various concentration of L-proline with a reduced proportion of dimethyl sulfoxide (DMSO) and ethylene glycol (EG), comparing with the control group (15% DMSO and 15% EG without L-proline). The survival rate, 5-methylcytosine (5-mC) expression, fertilization rate, two-cell rate, and blastocyst rate in vitro were assessed by immunofluorescence and in vitro fertilization. Data were analyzed by Chi-square test. Results: L-proline can penetrate the oocyte membrane within 1 min. The osmotic pressure of 2.00 mol/L L-proline mixture is similar to that of the control group. The survival rate of the postthawed oocyte in 2.00 mol/L L-proline combining 7.5% DMSO and 10% EG is significantly higher than that of the control group. There is no difference of 5-mC expression between the L-proline combination groups and control. The fertilization rate, two-cell rate, and blastocyst rate in vitro from oocyte vitrified in 2.00 mol/L L-proline combining 7.5% DMSO and 10% EG solution are similar to that of control. Conclusions: It indicated that an appropriate concentration of L-proline can improve the cryopreservation efficiency of mouse oocytes with low concentrations of DMSO and EG, which may be applicable to human oocyte vitrification. PMID:27503023

  10. Magnesium Atoms in the Exosphere Above the Volatile-rich Persistently Shadowed Region of Cabeus

    NASA Astrophysics Data System (ADS)

    Wooden, D. H.; Colaprete, A.; Heldmann, J. L.; Retherford, K. D.; Hurley, D. M.; Elphic, R. C.; Ennico, K.

    2011-12-01

    We discuss properties of the lunar exosphere based on analyses of UV-visual spectrometer (VSP) (260--650 nm) data collected from the 1-degree nadir field-of-view, which narrowed in on the persistently shadowed region (PSR) of Cabeus as the spacecraft descended towards the surface. The LCROSS Mission consisted of a ~2000 kg Centaur impactor and a shepherding spacecraft (S-SC) that impacted the Moon 4 minutes after the Centaur. The LCROSS VSP spectra of the nadir-view of Cabeus PSR spectra reveal a forest of UV emission lines. Most of these emission lines were previously predicted [1,2,3] but not yet measured because the Moon has yet to been investigated at these wavelengths at such close distance. In the LCROSS UV spectra, we have identified Mg I (285.2 nm) [4] and tentatively identified lines of Ca, Fe, Ti, and Al; most emission lines appear to be from neutral atoms, with a few possible singly-ionized species, fluorescing in sunlight from near their ground states. The temporal evolution of the lines, derived after subtracting a solar reference spectrum scaled to the scattered light continuum, probe the altitude-dependence of exosphere species. Only a few species appear transient, such as the Na D lines that were released by impact [5] and expelled quickly to high altitudes (45 km, [6]). We are working to derive the column densities of the various species, with particular emphasis on MgI, by application of a fluorescence model. Some of the work involves careful re-calibration of the VSP at wavelengths shortward of 380 nm. We will report and compare the column density of magnesium over Cabeus PSR to the column density expected from exosphere models. Sputtering of materials from the floor of Cabeus may be enhanced because of the particular geometry of the solar wind flowing over polar craters acts to deflect passing ions into the polar craters and enhance sputtering rates [7,8]. Studying the lunar exosphere can tell us generally about volatile transport processes

  11. Unconventional N-H…N Hydrogen Bonds Involving Proline Backbone Nitrogen in Protein Structures.

    PubMed

    Deepak, R N V Krishna; Sankararamakrishnan, Ramasubbu

    2016-05-10

    Contrary to DNA double-helical structures, hydrogen bonds (H-bonds) involving nitrogen as the acceptor are not common in protein structures. We systematically searched N-H…N H-bonds in two different sets of protein structures. Data set I consists of neutron diffraction and ultrahigh-resolution x-ray structures (0.9 Å resolution or better) and the hydrogen atom positions in these structures were determined experimentally. Data set II contains structures determined using x-ray diffraction (resolution ≤ 1.8 Å) and the positions of hydrogen atoms were generated using a computational method. We identified 114 and 14,347 potential N-H…N H-bonds from these two data sets, respectively, and 56-66% of these were of the Ni+1-Hi+1…Ni type, with Ni being the proline backbone nitrogen. To further understand the nature of such unusual contacts, we performed quantum chemical calculations on the model compound N-acetyl-L-proline-N-methylamide (Ace-Pro-NMe) with coordinates taken from the experimentally determined structures. A potential energy profile generated by varying the ψ dihedral angle in Ace-Pro-NMe indicates that the conformation with the N-H…N H-bond is the most stable. An analysis of H-bond-forming proline residues reveals that more than 30% of the proline carbonyl groups are also involved in n → π(∗) interactions with the carbonyl carbon of the preceding residue. Natural bond orbital analyses demonstrate that the strength of N-H…N H-bonds is less than half of that observed for a conventional H-bond. This study clearly establishes the H-bonding capability of proline nitrogen and its prevalence in protein structures. We found many proteins with multiple instances of H-bond-forming prolines. With more than 15% of all proline residues participating in N-H…N H-bonds, we suggest a new, to our knowledge, structural role for proline in providing stability to loops and capping regions of secondary structures in proteins. PMID:27166805

  12. A Proposed Landing Site for the 2001 Lander in a Hematite-Rich Region in Sinus Meridiani

    NASA Technical Reports Server (NTRS)

    Christensen, Philip R.; Bandfield, Joshua; Hamilton, Victoria; Ruff, Steven; Morris, Richard; Lane, Melissa; Malin, Micahel; Edgett, Kenneth

    1999-01-01

    The Thermal Emission Spectrometer (TES) instrument on the Mars Global Surveyor (MGS) mission has identified an accumulation of crystalline hematite (alpha-Fe2O3) that covers an area with very sharp boundaries approximately 350 by 350-750 km in size centered near 2 S latitude between 0 and 5 W longitude (Sinus Meridiani). The depth and shape of the hematite fundamental bands in the TES spectra show that the hematite is relatively coarse grained (> 5-10 microns). The spectrally-derived areal abundance of hematite varies with particle size from approx. 10% for particles > 30 microns in diameter to 40-60% for unpacked 10 micron powders. The hematite in Sinus Meridiani is thus distinct from the fine-grained (diameter < 5-10 microns), red, crystalline hematite considered, on the basis of visible and near-IR data, to be a minor spectral component in Martian bright regions. A map of the hematite index has been constructed using TES data from 11 orbits, including the six in which hematite was detected and five orbits that passed nearby that showed no evidence of hematite. The boundaries of the hematite-rich region are sharp at spatial scales of about 10 km. Within this region there are spatial variations in spectral band depth of a factor of two to three. At the present time the hematite-rich region has not been completely mapped. However, by using the bounding orbits to the east and west in which hematite was not detected, we can establish that this region covers an area that is between 350 and 750 km in length and over -350 km in width (1.2 x 10(exp 5) to 2.6 x 10(exp 5 sq km). The hematite-rich surface discovered by TES closely corresponds with smooth-surfaced unit ('sm') that appears to be the surface of a layered sequence. The presence of small mesas superposed on 'sm' and the degraded nature of the small impact craters suggests that material has been removed from this unit. These layered materials do not appear to be primary volcanic products (i.e., lava flows

  13. Geographic analysis of species richness and community attributes of forest birds from survey data in the mid-Atlantic integrated assessment region

    USGS Publications Warehouse

    Cam, E.; Sauer, J.R.; Nichols, J.D.; Hines, J.E.; Flather, C.H.

    2000-01-01

    Species richness of local communities is a state variable commonly used in community ecology and conservation biology. Investigation of spatial and temporal variations in richness and identification of factors associated with these variations form a basis for specifying management plans, evaluating these plans, and for testing hypotheses of theoretical interest. However, estimation of species richness is not trivial: species can be missed by investigators during sampling sessions. Sampling artifacts can lead to erroneous conclusions on spatial and temporal variation in species richness. Here we use data from the North American Breeding Bird Survey to estimate parameters describing the state of bird communities in the Mid-Atlantic Assessment (MAIA) region: species richness, extinction probability, turnover and relative species richness. We use a recently developed approach to estimation of species richness and related parameters that does not require the assumption that all the species are detected during sampling efforts. The information presented here is intended to visualize the state of bird communities in the MAIA region. We provide information on 1975 and 1990. We also quantified the changes between these years. We summarized and mapped the community attributes at a scale of management interest (watershed units).

  14. Proline metabolism and cancer: emerging links to glutamine and collagen

    PubMed Central

    Phang, James M.; Liu, Wei; Hancock, Chad N.; Fischer, Joseph W.

    2015-01-01

    Purpose of review Proline metabolism impacts a number of regulatory targets in both animals and plants and is especially important in cancer. Glutamine, a related amino acid, is considered second in importance only to glucose as a substrate for tumors. But proline and glutamine are interconvertible and linked in their metabolism. In animals, proline and glutamine have specific regulatory functions and their respective physiologic sources. A comparison of the metabolism of proline and glutamine would help us understand the importance of these two nonessential amino acids in cancer metabolism. Recent findings The regulatory functions of proline metabolism proposed 3 decades ago have found relevance in many areas. For cancer, these functions play a role in apoptosis, autophagy and in response to nutrient and oxygen deprivation. Importantly, proline-derived reactive oxygen species served as a driving signal for reprogramming. This model has been applied by others to metabolic regulation for the insulin-prosurvival axis, induction of adipose triglyceride lipase for lipid metabolism and regulation of embryonic stem cell development. Of special interest, modulatory proteins such as parkinson protein 7 and oral cancer overexpressed 1 interact with pyrroline-5-carboxylate reductase, a critical component of the proline regulatory axis. Although the interconvertibility of proline and glutamine has been long established, recent findings showed that the proto-oncogene, cellular myelocytomatosis oncogene, upregulates glutamine utilization (glutaminase) and routes glutamate to proline biosynthesis (pyrroline-5-carboxylate synthase, pyrroline-5-carboxylate reductases). Additionally, collagen, which contains large amounts of proline, may be metabolized to serve as a reservoir for proline. This metabolic relationship as well as the new regulatory targets of proline metabolism invites an elucidation of the differential effects of these nonessential amino acids and their production

  15. Ornithine cyclodeaminase-based proline production by Corynebacterium glutamicum

    PubMed Central

    2013-01-01

    Background The soil bacterium Corynebacterium glutamicum, best known for its glutamate producing ability, is suitable as a producer of a variety of bioproducts. Glutamate is the precursor of the amino acid proline. Proline biosynthesis typically involves three enzymes and a spontaneous cyclisation reaction. Alternatively, proline can be synthesised from ornithine, an intermediate of arginine biosynthesis. The direct conversion of ornithine to proline is catalysed by ornithine cyclodeaminase. An ornithine overproducing platform strain with deletions of argR and argF (ORN1) has been employed for production of derived compounds such as putrescine. By heterologous expression of ocd this platform strain can be engineered further for proline production. Results Plasmid-based expression of ocd encoding the putative ornithine cyclodeaminase of C. glutamicum did not result in detectable proline accumulation in the culture medium. However, plasmid-based expression of ocd from Pseudomonas putida resulted in proline production with yields up to 0.31 ± 0.01 g proline/g glucose. Overexpression of the gene encoding a feedback-alleviated N-acetylglutamate kinase further increased proline production to 0.36 ± 0.01 g/g. In addition, feedback-alleviation of N-acetylglutamate kinase entailed growth-coupled production of proline and reduced the accumulation of by-products in the culture medium. Conclusions The product spectrum of the platform strain C. glutamicum ORN1 was expanded to include the amino acid L-proline. Upon further development of the ornithine overproducing platform strain, industrial production of amino acids of the glutamate family and derived bioproducts such as diamines might become within reach. PMID:23806148

  16. Proline and hydroxyproline metabolism: implications for animal and human nutrition.

    PubMed

    Wu, Guoyao; Bazer, Fuller W; Burghardt, Robert C; Johnson, Gregory A; Kim, Sung Woo; Knabe, Darrell A; Li, Peng; Li, Xilong; McKnight, Jason R; Satterfield, M Carey; Spencer, Thomas E

    2011-04-01

    Proline plays important roles in protein synthesis and structure, metabolism (particularly the synthesis of arginine, polyamines, and glutamate via pyrroline-5-carboxylate), and nutrition, as well as wound healing, antioxidative reactions, and immune responses. On a per-gram basis, proline plus hydroxyproline are most abundant in collagen and milk proteins, and requirements of proline for whole-body protein synthesis are the greatest among all amino acids. Therefore, physiological needs for proline are particularly high during the life cycle. While most mammals (including humans and pigs) can synthesize proline from arginine and glutamine/glutamate, rates of endogenous synthesis are inadequate for neonates, birds, and fish. Thus, work with young pigs (a widely used animal model for studying infant nutrition) has shown that supplementing 0.0, 0.35, 0.7, 1.05, 1.4, and 2.1% proline to a proline-free chemically defined diet containing 0.48% arginine and 2% glutamate dose dependently improved daily growth rate and feed efficiency while reducing concentrations of urea in plasma. Additionally, maximal growth performance of chickens depended on at least 0.8% proline in the diet. Likewise, dietary supplementation with 0.07, 0.14, and 0.28% hydroxyproline (a metabolite of proline) to a plant protein-based diet enhanced weight gains of salmon. Based on its regulatory roles in cellular biochemistry, proline can be considered as a functional amino acid for mammalian, avian, and aquatic species. Further research is warranted to develop effective strategies of dietary supplementation with proline or hydroxyproline to benefit health, growth, and development of animals and humans. PMID:20697752

  17. Proline and hydroxyproline metabolism: implications for animal and human nutrition

    PubMed Central

    Bazer, Fuller W.; Burghardt, Robert C.; Johnson, Gregory A.; Kim, Sung Woo; Knabe, Darrell A.; Li, Peng; Li, Xilong; McKnight, Jason R.; Satterfield, M. Carey; Spencer, Thomas E.

    2013-01-01

    Proline plays important roles in protein synthesis and structure, metabolism (particularly the synthesis of arginine, polyamines, and glutamate via pyrroline-5-carboxylate), and nutrition, as well as wound healing, antioxidative reactions, and immune responses. On a pergram basis, proline plus hydroxyproline are most abundant in collagen and milk proteins, and requirements of proline for whole-body protein synthesis are the greatest among all amino acids. Therefore, physiological needs for proline are particularly high during the life cycle. While most mammals (including humans and pigs) can synthesize proline from arginine and glutamine/glutamate, rates of endogenous synthesis are inadequate for neonates, birds, and fish. Thus, work with young pigs (a widely used animal model for studying infant nutrition) has shown that supplementing 0.0, 0.35, 0.7, 1.05, 1.4, and 2.1% proline to a proline-free chemically defined diet containing 0.48% arginine and 2% glutamate dose dependently improved daily growth rate and feed efficiency while reducing concentrations of urea in plasma. Additionally, maximal growth performance of chickens depended on at least 0.8% proline in the diet. Likewise, dietary supplementation with 0.07, 0.14, and 0.28% hydroxyproline (a metabolite of proline) to a plant protein-based diet enhanced weight gains of salmon. Based on its regulatory roles in cellular biochemistry, proline can be considered as a functional amino acid for mammalian, avian, and aquatic species. Further research is warranted to develop effective strategies of dietary supplementation with proline or hydroxyproline to benefit health, growth, and development of animals and humans. PMID:20697752

  18. Low affinity binding of phorbol esters to protein kinase C and its recombinant cysteine-rich region in the absence of phospholipids.

    PubMed

    Kazanietz, M G; Barchi, J J; Omichinski, J G; Blumberg, P M

    1995-06-16

    Binding of phorbol esters to protein kinase C (PKC) has been regarded as dependent on phospholipids, with phosphatidylserine being the most effective for reconstituting binding. By using a purified single cysteine-rich region from PKC delta expressed in Escherichia coli we were able to demonstrate that specific binding of [3H]phorbol 12,13-dibutyrate to the receptor still takes place in the absence of the phospholipid cofactor. However, [3H]phorbol 12,13-dibutyrate bound to the cysteine-rich region with 80-fold lower affinity in the absence than in the presence of 100 micrograms/ml phosphatidylserine. Similar results were observed with the intact recombinant PKC delta isolated from insect cells. When different phorbol derivatives were examined, distinct structure-activity relations for the cysteine-rich region were found in the presence and absence of phospholipid. Our results have potential implications for PKC translocation, for inhibitor design, and for PKC structural determination. PMID:7782331

  19. Antibodies to the leucine-rich repeat region of internalin block entry of Listeria monocytogenes into cells expressing E-cadherin.

    PubMed

    Mengaud, J; Lecuit, M; Lebrun, M; Nato, F; Mazie, J C; Cossart, P

    1996-12-01

    Internalin, a surface protein essential for entry of Listeria monocytogenes EGD into epithelial cells, was used as an antigen to raise nine monoclonal antibodies. These monoclonal antibodies recognized seven distinct epitopes which were located in three different regions of the protein. Three of them inhibited internalin-mediated entry and recognized the amino-terminal leucine-rich repeat region of the protein, suggesting that this region is essential for entry. PMID:8945603

  20. Role of proline and GABA in sexual reproduction of angiosperms.

    PubMed

    Biancucci, Marco; Mattioli, Roberto; Forlani, Giuseppe; Funck, Dietmar; Costantino, Paolo; Trovato, Maurizio

    2015-01-01

    Two glutamate derivatives, proline and γ-aminobutyric acid (GABA), appear to play pivotal roles in different aspects of sexual reproduction in angiosperms, although their precise function in plant reproduction and the molecular basis of their action are not yet fully understood. Proline and GABA have long been regarded as pivotal amino acids in pollen vitality and fertility. Proline may constitute up to 70% of the free amino acid pool in pollen grains and it has been recently shown that Arabidopsis mutants affected in the first and rate-limiting step in proline synthesis produce aberrant and infertile pollen grains, indicating that proline synthesis is required for pollen development and fertility. Concerning GABA, a large body of evidence points to this glutamate derivative as a key determinant of post-pollination fertilization. Intriguingly, proline has also been associated with pollination, another aspect of sexual reproduction, since honeybees were reported to show a strong preference for proline-enriched nectars. In this review, we survey current knowledge on the roles of proline and GABA in plant fertility, and discuss future perspectives potentially capable to improve our understanding on the functions of these amino acids in pollen development, pollination, and pollen tube guidance. PMID:26388884

  1. Comparative Aspects of Tissue Glutamine and Proline Metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cellular metabolism of glutamine and proline are closely interrelated since they can be interconverted with glutamate and ornithine via the mitochondrial pathway involving pyrolline-5-carboxylate (P5C). In adults, glutamine and proline are converted via P5C to citrulline in the gut, then citrul...

  2. Role of proline and GABA in sexual reproduction of angiosperms

    PubMed Central

    Biancucci, Marco; Mattioli, Roberto; Forlani, Giuseppe; Funck, Dietmar; Costantino, Paolo; Trovato, Maurizio

    2015-01-01

    Two glutamate derivatives, proline and γ-aminobutyric acid (GABA), appear to play pivotal roles in different aspects of sexual reproduction in angiosperms, although their precise function in plant reproduction and the molecular basis of their action are not yet fully understood. Proline and GABA have long been regarded as pivotal amino acids in pollen vitality and fertility. Proline may constitute up to 70% of the free amino acid pool in pollen grains and it has been recently shown that Arabidopsis mutants affected in the first and rate-limiting step in proline synthesis produce aberrant and infertile pollen grains, indicating that proline synthesis is required for pollen development and fertility. Concerning GABA, a large body of evidence points to this glutamate derivative as a key determinant of post-pollination fertilization. Intriguingly, proline has also been associated with pollination, another aspect of sexual reproduction, since honeybees were reported to show a strong preference for proline-enriched nectars. In this review, we survey current knowledge on the roles of proline and GABA in plant fertility, and discuss future perspectives potentially capable to improve our understanding on the functions of these amino acids in pollen development, pollination, and pollen tube guidance. PMID:26388884

  3. Mammalian Protein Arginine Methyltransferase 7 (PRMT7) Specifically Targets RXR Sites in Lysine- and Arginine-rich Regions*

    PubMed Central

    Feng, You; Maity, Ranjan; Whitelegge, Julian P.; Hadjikyriacou, Andrea; Li, Ziwei; Zurita-Lopez, Cecilia; Al-Hadid, Qais; Clark, Amander T.; Bedford, Mark T.; Masson, Jean-Yves; Clarke, Steven G.

    2013-01-01

    The mammalian protein arginine methyltransferase 7 (PRMT7) has been implicated in roles of transcriptional regulation, DNA damage repair, RNA splicing, cell differentiation, and metastasis. However, the type of reaction that it catalyzes and its substrate specificity remain controversial. In this study, we purified a recombinant mouse PRMT7 expressed in insect cells that demonstrates a robust methyltransferase activity. Using a variety of substrates, we demonstrate that the enzyme only catalyzes the formation of ω-monomethylarginine residues, and we confirm its activity as the prototype type III protein arginine methyltransferase. This enzyme is active on all recombinant human core histones, but histone H2B is a highly preferred substrate. Analysis of the specific methylation sites within intact histone H2B and within H2B and H4 peptides revealed novel post-translational modification sites and a unique specificity of PRMT7 for methylating arginine residues in lysine- and arginine-rich regions. We demonstrate that a prominent substrate recognition motif consists of a pair of arginine residues separated by one residue (RXR motif). These findings will significantly accelerate substrate profile analysis, biological function study, and inhibitor discovery for PRMT7. PMID:24247247

  4. Proline control of the feeding reaction of Cordylophora.

    PubMed

    FULTON, C

    1963-03-01

    The colonial hydroid Cordylophora is a carnivore whose feeding is induced by substances released from captured prey. An active molecule, probably the only one, has been isolated from a fraction of the laboratory food of Cordylophora, brine shrimp larvae, and identified on paper chromatograms as the imino acid proline. Reagent proline induces the feeding reaction at 10(-5)M. The reaction is specific in that only two alpha-imino acids very closely related to proline were found to possess significant activity: azetidine-2-carboxylic acid and pipecolic acid. The response to proline is inhibited by magnesium ions and enhanced by phosphate. Since previous studies have shown that the feeding reactions of Hydra, Physalia, and Campanularia are controlled by reduced glutathione, the phylogenetic implications of the proline control of feeding in Cordylophora are discussed. The feeding reactions of both Cordylophora and Hydra are also induced by proteases, suggesting similar mechanisms of induction in the two hydroids. PMID:13960251

  5. Gene-rich chromosomal regions are preferentially localized in the lamin B deficient nuclear blebs of atypical progeria cells

    PubMed Central

    Bercht Pfleghaar, Katrin; Taimen, Pekka; Butin-Israeli, Veronika; Shimi, Takeshi; Langer-Freitag, Sabine; Markaki, Yolanda; Goldman, Anne E; Wehnert, Manfred; Goldman, Robert D

    2015-01-01

    More than 20 mutations in the gene encoding A-type lamins (LMNA) cause progeria, a rare premature aging disorder. The major pathognomonic hallmarks of progeria cells are seen as nuclear deformations or blebs that are related to the redistribution of A- and B-type lamins within the nuclear lamina. However, the functional significance of these progeria-associated blebs remains unknown. We have carried out an analysis of the structural and functional consequences of progeria-associated nuclear blebs in dermal fibroblasts from a progeria patient carrying a rare point mutation p.S143F (C428T) in lamin A/C. These blebs form microdomains that are devoid of major structural components of the nuclear envelope (NE)/lamina including B-type lamins and nuclear pore complexes (NPCs) and are enriched in A-type lamins. Using laser capture microdissection and comparative genomic hybridization (CGH) analyses, we show that, while these domains are devoid of centromeric heterochromatin and gene-poor regions of chromosomes, they are enriched in gene-rich chromosomal regions. The active form of RNA polymerase II is also greatly enriched in blebs as well as nascent RNA but the nuclear co-activator SKIP is significantly reduced in blebs compared to other transcription factors. Our results suggest that the p.S143F progeria mutation has a severe impact not only on the structure of the lamina but also on the organization of interphase chromatin domains and transcription. These structural defects are likely to contribute to gene expression changes reported in progeria and other types of laminopathies. PMID:25738644

  6. On the evolutionary significance of the size and planarity of the proline ring

    NASA Astrophysics Data System (ADS)

    Behre, Jörn; Voigt, Roland; Althöfer, Ingo; Schuster, Stefan

    2012-10-01

    Proline is a proteinogenic amino acid in which the side chain forms a ring, the pyrrolidine ring. This is a five-membered ring made up of four carbons and one nitrogen. Here, we study the evolutionary significance of this ring size. It is shown that the size of the pyrrolidine ring has the advantage of being nearly planar and strain-free, based on a general mathematical assertion saying that the angular sum of a polygon is maximum if it is planar and convex. We also provide a sketch of the proof to this assertion. The optimality of the ring size of proline can be derived from a triangle inequality for angles. Quasi-planarity is physiologically significant because it allows an easier and evolutionarily old type of fit into binding grooves of proteins with which proline-rich proteins interact. Finally, we present a comparison with other planar, nearly planar and non-planar biomolecules such as neurotransmitters, hormones and toxins, involving, for example, aromatic rings, cyclopentanone and 1,3-dioxole.

  7. α-Quaternary Proline Derivatives by Intramolecular Diastereoselective Arylation of N-Carboxamido Proline Ester Enolates.

    PubMed

    Maury, Julien; Clayden, Jonathan

    2015-11-01

    Pyrrolidine-2-carboxylate esters substituted in the 3-, 4- or 5-positions were converted to their N'-aryl urea derivatives. Deprotonation at the 2-position to form a potassium enolate led to migration of the N'-aryl substituent to the 2 position of the pyrrolidine ring, followed by cyclization of the resulting urea to give bicyclic α-aryl hydantoin derivatives of substituted prolines. Depending on the substitution pattern of the starting material, high diastereoselectivity was observed in the aryl migration, allowing formation of the products in enantiomerically enriched form, despite the intermediacy of a planar enolate. The hydrolysis of the bicyclic hydantoins under basic conditions gave a range of enantiopure and enantioenriched quaternary α-aryl proline derivatives. PMID:26421443

  8. Proline Modulates the Trypanosoma cruzi Resistance to Reactive Oxygen Species and Drugs through a Novel D, L-Proline Transporter

    PubMed Central

    Sayé, Melisa; Miranda, Mariana R.; di Girolamo, Fabio; de los Milagros Cámara, María; Pereira, Claudio A.

    2014-01-01

    Trypanosoma cruzi, the etiological agent of Chagas' disease, has a metabolism largely based on the consumption of glucose and proline. This amino acid is essential for host cells infection and intracellular differentiation. In this work we identified a proline transporter (TcAAAP069) by yeasts complementation assays and overexpression in Trypanosoma cruzi epimastigotes. TcAAAP069 is mono-specific for proline but presents an unusual feature; the lack of stereospecificity, because it is competitively inhibited by the D- enantiomer. Parasites overexpressing TcAAAP069 have an increased intracellular proline concentration, 2.6-fold higher than controls, as a consequence of a higher proline transport rate. Furthermore, augmented proline concentration correlates with an improved resistance to trypanocidal drugs and also to reactive oxygen species including hydrogen peroxide and nitric oxide, emulating natural physiological situations. The IC50s for nifurtimox, benznidazole, H2O2 and NO. were 125%, 68%, 44% and 112% higher than controls, respectively. Finally, proline metabolism generates a higher concentration (48%) of ATP in TcAAAP069 parasites. Since proline participates on essential energy pathways, stress and drug resistance responses, these results provide a novel target for the development of new drugs for the treatments for Chagas' disease. PMID:24637744

  9. Improved Atomistic Monte Carlo Simulations Demonstrate that Poly-L-Proline Adopts Heterogeneous Ensembles of Conformations of Semi-Rigid Segments Interrupted by Kinks

    PubMed Central

    Radhakrishnan, Aditya; Vitalis, Andreas; Mao, Albert H.; Steffen, Adam T.; Pappu, Rohit V.

    2012-01-01

    Poly-L-proline (PLP) polymers are useful mimics of biologically relevant proline-rich sequences. Biophysical and computational studies of PLP polymers in aqueous solutions are challenging because of the diversity of length scales and the slow time scales for conformational conversions. We describe an atomistic simulation approach that combines an improved ABSINTH implicit solvation model, with conformational sampling based on standard and novel Metropolis Monte Carlo moves. Refinements to forcefield parameters were guided by published experimental data for proline-rich systems. We assessed the validity of our simulation results through quantitative comparisons to experimental data that were not used in refining the forcefield parameters. Our analysis shows that PLP polymers form heterogeneous ensembles of conformations characterized by semi-rigid, rod-like segments interrupted by kinks, which result from a combination of internal cis peptide bonds, flexible backbone ψ-angles, and the coupling between ring puckering and backbone degrees of freedom. PMID:22329658

  10. Spectroscopy of Neutron-rich Nuclei of the A{approx_equal}60 region populated through binary heavy-ion collisions

    SciTech Connect

    Lunardi, S.

    2008-11-11

    Neutron-rich nuclei of the mass A = 60 region (from V to Fe) have been studied through multi-nucleon transfer reactions by bombarding a {sup 238}U target with beams of {sup 64}Ni and {sup 70}Zn. Unambiguous identification of prompt {gamma} rays belonging to each nucleus has been achieved by using the efficient gamma-array CLARA coupled to the large-acceptance magnetic spectrometer PRISMA installed at the Legnaro National Laboratories. With the new data, the existence of the N = 32 sub-shell closure has been corroborated through the study of odd V isotopes, whereas a new region of deformation appears for neutron-rich Fe nuclei close to N = 40. The results obtained for all these nuclei are compared with shell model calculations which reproduces quite well the experimental data also for the most neutron-rich nuclei when excitations from the fp shell into the upper g{sub 9/2} orbital are allowed.

  11. Identification and physical localization of useful genes and markers to a major gene-rich region on wheat group 1S chromosomes.

    PubMed Central

    Sandhu, D; Champoux, J A; Bondareva, S N; Gill, K S

    2001-01-01

    The short arm of Triticeae homeologous group 1 chromosomes is known to contain many agronomically important genes. The objectives of this study were to physically localize gene-containing regions of the group 1 short arm, enrich these regions with markers, and study the distribution of genes and recombination. We focused on the major gene-rich region ("1S0.8 region") and identified 75 useful genes along with 93 RFLP markers by comparing 35 different maps of Poaceae species. The RFLP markers were tested by gel blot DNA analysis of wheat group 1 nullisomic-tetrasomic lines, ditelosomic lines, and four single-break deletion lines for chromosome arm 1BS. Seventy-three of the 93 markers mapped to group 1 and detected 91 loci on chromosome 1B. Fifty-one of these markers mapped to two major gene-rich regions physically encompassing 14% of the short arm. Forty-one marker loci mapped to the 1S0.8 region and 10 to 1S0.5 region. Two cDNA markers mapped in the centromeric region and the remaining 24 loci were on the long arm. About 82% of short arm recombination was observed in the 1S0.8 region and 17% in the 1S0.5 region. Less than 1% recombination was observed for the remaining 85% of the physical arm length. PMID:11290727

  12. Association between simple sequence repeat-rich chromosome regions and intergenomic translocation breakpoints in natural populations of allopolyploid wild wheats

    PubMed Central

    Molnár, István; Cifuentes, Marta; Schneider, Annamária; Benavente, Elena; Molnár-Láng, Márta

    2011-01-01

    Background and Aims Repetitive DNA sequences are thought to be involved in the formation of chromosomal rearrangements. The aim of this study was to analyse the distribution of microsatellite clusters in Aegilops biuncialis and Aegilops geniculata, and its relationship with the intergenomic translocations in these allotetraploid species, wild genetic resources for wheat improvement. Methods The chromosomal localization of (ACG)n and (GAA)n microsatellite sequences in Ae. biuncialis and Ae. geniculata and in their diploid progenitors Aegilops comosa and Aegilops umbellulata was investigated by sequential in situ hybridization with simple sequence repeat (SSR) probes and repeated DNA probes (pSc119·2, Afa family and pTa71) and by dual-colour genomic in situ hybridization (GISH). Thirty-two Ae. biuncialis and 19 Ae. geniculata accessions were screened by GISH for intergenomic translocations, which were further characterized by fluorescence in situ hybridization and GISH. Key Results Single pericentromeric (ACG)n signals were localized on most U and on some M genome chromosomes, whereas strong pericentromeric and several intercalary and telomeric (GAA)n sites were observed on the Aegilops chromosomes. Three Ae. biuncialis accessions carried 7Ub–7Mb reciprocal translocations and one had a 7Ub–1Mb rearrangement, while two Ae. geniculata accessions carried 7Ug–1Mg or 5Ug–5Mg translocations. Conspicuous (ACG)n and/or (GAA)n clusters were located near the translocation breakpoints in eight of the ten translocated chromosomes analysed, SSR bands and breakpoints being statistically located at the same chromosomal site in six of them. Conclusions Intergenomic translocation breakpoints are frequently mapped to SSR-rich chromosomal regions in the allopolyploid species examined, suggesting that microsatellite repeated DNA sequences might facilitate the formation of those chromosomal rearrangements. The (ACG)n and (GAA)n SSR motifs serve as additional chromosome markers

  13. Osmotically regulated transport of proline by Lactobacillus acidophilus IFO 3532.

    PubMed

    Jewell, J B; Kashket, E R

    1991-10-01

    We reported previously that, when exposed to high osmotic pressure, Lactobacillus acidophilus IFO 3532 cells accumulated N,N,N-trimethylglycine (glycine betaine), which serves as a compatible intracellular solute. When grown in medium with high osmotic pressure, these cells also accumulated one amino acid, proline. The uptake of [3H]proline by resting, glucose-energized cells was stimulated by increasing the osmotic pressure of the assay medium with 0.5 to 1.0 M KCl, 1.0 M NaCl, or 0.5 M sucrose. The accumulated [3H]proline was not metabolized further. In contrast, there was no osmotic stimulation of [3H]leucine uptake. The uptake of proline was activated rather than induced by exposure of the cells to high osmotic pressure. Only one proline transport system could be discerned from kinetics plots. The affinity of the carrier for proline remained constant over a range of osmotic pressures from 650 to 1,910 mosM (Kt, 7.8 to 15.5 mM). The Vmax, however, increased from 15 nmol/min/mg of dry weight in 0.5 M sucrose to 27 and 40 nmol/min/mg of dry weight in 0.5 M KCl and in 1.0 M KCl or NaCl, respectively. The efflux of proline from preloaded cells occurred rapidly when the osmotic pressure of the suspending buffer was lowered. PMID:1786048

  14. Proline synthesis in barley under iron deficiency and salinity.

    PubMed

    Arias-Baldrich, Cirenia; Bosch, Nadja; Begines, Digna; Feria, Ana B; Monreal, José A; García-Mauriño, Sofía

    2015-07-01

    This work investigates proline synthesis in six barley varieties subjected to iron deficiency, salinity or both stresses. The highest growth under Fe sufficiency corresponded to Belgrano and Shakira. A moderate augment of leaf phosphoenolpyruvate carboxylase (PEPC) activity was observed in all six varieties in response to Fe deficiency, consistently in leaves and sporadically in roots. All six varieties accumulated proline under Fe deficiency, to a higher extent in leaves than in roots. The decrease of Fe supply from 100 μM NaFe(III)-EDTA to 0.5 μM NaFe(III)-EDTA reduced growth and photosynthetic pigments similarly in the six barley varieties. On the contrary, differences between varieties could be observed with respect to increased or, conversely, decreased proline content as a function of the amount of NaFe(III)-EDTA supplied. These two opposite types were represented by Belgrano (higher proline under Fe deficiency) and Shakira (higher proline under Fe sufficiency). Time-course experiments suggested that leaf PEPC activity was not directly responsible for supplying C for proline synthesis under Fe deficiency. High proline levels in the leaves of Fe-deficient Belgrano plants in salinity were associated to a better performance of this variety under these combined stresses. PMID:26125122

  15. Another Role of Proline: Stabilization Interactions in Proteins and Protein Complexes Concerning Proline and Tryptophane

    SciTech Connect

    Biedermannova, Lada; Riley, Kevin E.; Berka, Karel; Hobza, Pavel; Vondrasek, Jiri

    2008-09-11

    Proline–tryptophan complexes derived from experimental structures are investigated by quantum chemical procedures known to properly describe the London dispersion energy. We study two geometrical arrangements: the “L-shaped”, stabilized by an H-bond, and the “stacked-like”, where the two residues are in parallel orientation without any H-bond. Interestingly, the interaction energies in both cases are comparable and very large (~7 kcal mol⁻¹). The strength of stabilization in the stacked arrangement is rather surprising considering the fact that only one partner has an aromatic character. The interaction energy decomposition using the SAPT method further demonstrates the very important role of dispersion energy in such arrangement. To elucidate the structural features responsible for this unexpectedly large stabilization we examined the role of the nitrogen heteroatom and the importance of the cyclicity of the proline residue. We show that the electrostatic interaction due to the presence of the dipole, caused by the nitrogen heteroatom, contributes largely to the strength of the interaction. Nevertheless, the cyclic arrangement of proline, which allows for the largest amount of dispersive contact with the aromatic partner, also has a notable-effect. Geometry optimizations carried out for the “stackedlike” complexes show that the arrangements derived from protein structure are close to their gas phase optimum geometry, suggesting that the environment has only a minor effect on the geometry of the interaction. We conclude that the strength of proline non-covalent interactions, combined with this residue’s rigidity, might be the explanation for its prominent role in protein stabilization and recognition processes.

  16. Predictors of the short-term effect of isoleucine-proline-proline/valine-proline-proline lactotripeptides from casein on office and ambulatory blood pressure in subjects with pharmacologically untreated high-normal blood pressure or first-degree hypertension.

    PubMed

    Cicero, A F G; Rosticci, M; Ferroni, A; Bacchelli, S; Veronesi, M; Strocchi, E; Borghi, C

    2012-01-01

    Our aim was to evaluate the predictors of Isoleucine-Proline-Proline/Valine-Proline-Proline (IPP-VPP) lactotripeptides (LTPs) antihypertensive effect in the context of a short-term large double-blind randomized clinical trial involving 164 pharmacologically untreated subjects in primary prevention for cardiovascular disease. When compared with the baseline, office systolic blood pressure (SBP) (-3.42 mm Hg, P < .001) and diastolic blood pressure (DBP) (-2.35 mm Hg, P < .001) significantly decreased, in the LTP-treated patients only. No significant change in predictors during the study of ambulatory blood pressure measurement (ABPM) parameters was observed. A short-term supplementation with LTPs significantly improves the office SBP and DBP, especially in male subjects. The main predictor of LTP antihypertensive effect was the baseline BP. PMID:22574612

  17. Hydrogen rich gas generator

    NASA Technical Reports Server (NTRS)

    Houseman, J. (Inventor)

    1976-01-01

    A process and apparatus is described for producing a hydrogen rich gas by introducing a liquid hydrocarbon fuel in the form of a spray into a partial oxidation region and mixing with a mixture of steam and air that is preheated by indirect heat exchange with the formed hydrogen rich gas, igniting the hydrocarbon fuel spray mixed with the preheated mixture of steam and air within the partial oxidation region to form a hydrogen rich gas.

  18. Avirulent isolates of Corynebacterium fascians that are unable to utilize agmatine and proline.

    PubMed Central

    Sabart, P R; Gakovich, D; Hanson, R S

    1986-01-01

    Growth of a highly virulent strain of the phytopathogen Corynebacterium fascians on rich media at 37 degrees C resulted in a loss of virulence in a majority of the population within 10 generations. Strains retained virulence during cultivation at 30 degrees C on a minimal medium with ammonia as a nitrogen source. Populations of avirulent strains on the surfaces of pea seedlings decreased, whereas the number of cells of the virulent strain increased 1,000-fold during a 3-week period. All avirulent mutants isolated by growth on rich media at 37 degrees C were unable to grow on media containing agmatine or proline as sole sources of nitrogen. The ability of the mutants to grow on pea seedlings and cause fasciation disease appeared to be related to their ability to utilize nitrogen sources available on plant surfaces. PMID:3729405

  19. Microbial diversity in deep-sea sediment from the cobalt-rich crust deposit region in the Pacific Ocean.

    PubMed

    Liao, Li; Xu, Xue-Wei; Jiang, Xia-Wei; Wang, Chun-Sheng; Zhang, Dong-Sheng; Ni, Jian-Yu; Wu, Min

    2011-12-01

    Cobalt-rich crusts are important metallic mineral resources with great economic potential, usually distributed on seamounts located in the Pacific Ocean. Microorganisms are believed to play a role in the formation of crusts as well as in metal cycling. To explore the microbial diversity related to cobalt-rich crusts, 16S ribosomal RNA gene clone libraries were constructed from three consecutive sediment layers. In total, 417 bacterial clones were obtained from three bacterial clone libraries, representing 17 distinct phylogenetic groups. Proteobacteria dominated in the bacterial communities, followed by Acidobacteria and Planctomycetes. Compared with high bacterial diversity, archaea showed a remarkably low diversity, with all 137 clones belonging to marine archaeal group I except one novel euryarchaeotal clone. The microbial communities were potentially involved in sulfur, nitrogen and metal cycling in the area of cobalt-rich crusts. Sulfur oxidation and metal oxidation were potentially major sources of energy for this ecosystem. This is the first reported investigation of microbial diversity in sediments associated with cobalt-rich crusts, and it casts fresh light on the microbial ecology of these important ecosystems. PMID:22067077

  20. The role of an H2O-rich fluid component in the generation of primitive basaltic andesites and andesites from the Mt. Shasta region, N California

    NASA Astrophysics Data System (ADS)

    Grove, T. L.; Parman, S. W.; Bowring, S. A.; Price, R. C.; Baker, M. B.

    This paper presents analyses of the trace element abundances and isotopic compositions in primitive lavas from the Mt. Shasta region, N California. These data are combined with estimates of pre-eruptive H2O contents and constraints from experimental petrology to develop a model of subduction zone magmatism. These lavas share geochemical characteristics of high-Mg andesites from the Setouchi volcanic belt in SW Japan and Adak-type high-Mg andesites of the western Aleutian arc. Estimates of the pre-eruptive water contents of the Shasta region lavas range from <1 to >8 wt % H2O. The pre-eruptive H2O content and an inferred melt of a harzburgitic residue are used to carry out a mass balance for the relative contributions from a mantle-derived melt and slab-derived fluid-rich component. We assume that elements are contributed either from melting of mantle peridotite or from a subduction-related fluid-rich component. Estimated fluid-rich component compositions are characterized by strong light rare earth element (LREE) enrichments ([La/Gd]N=3 to 7) and variable heavy rare earth element (HREE) depletions ([Dy/Yb]N=1 to 3). Sr and Ba abundances vary by approximately a factor of 2.5 in the fluid compositions calculated for the Mt. Shasta region lavas and large ion lithophile element (LILE) abundances are similar to those calculated by Stolper and Newman (1994) and Eiler et al. (2000). The major elements in the fluid-rich component are H2O ( 55-68 wt%), Na2O ( 25-33 wt%) and K2O ( 5-13 wt%). This composition may be that of a supercritical fluid or a low-degree melt of the slab that has reacted with the overlying mantle wedge. Although the slab beneath Mt. Shasta is inferred to be hot ( 600 - 650 °C), the calculated fluid-rich components do not resemble a pure slab melt. The calculated isotopic composition of the fluid-rich component is bimodal. One component has 87Sr/86Sr=0.7028 and ɛNd=+8, and is most similar to a MORB source. The second component has

  1. The role of an H2O-rich fluid component in the generation of primitive basaltic andesites and andesites from the Mt. Shasta region, N California

    NASA Astrophysics Data System (ADS)

    Grove, T. L.; Parman, S. W.; Bowring, S. A.; Price, R. C.; Baker, M. B.

    2001-10-01

    This paper presents analyses of the trace element abundances and isotopic compositions in primitive lavas from the Mt. Shasta region, N California. These data are combined with estimates of pre-eruptive H2O contents and constraints from experimental petrology to develop a model of subduction zone magmatism. These lavas share geochemical characteristics of high-Mg andesites from the Setouchi volcanic belt in SW Japan and Adak-type high-Mg andesites of the western Aleutian arc. Estimates of the pre-eruptive water contents of the Shasta region lavas range from <1 to >8 wt % H2O. The pre-eruptive H2O content and an inferred melt of a harzburgitic residue are used to carry out a mass balance for the relative contributions from a mantle-derived melt and slab-derived fluid-rich component. We assume that elements are contributed either from melting of mantle peridotite or from a subduction-related fluid-rich component. Estimated fluid-rich component compositions are characterized by strong light rare earth element (LREE) enrichments ([La/Gd]N=3 to 7) and variable heavy rare earth element (HREE) depletions ([Dy/Yb]N=1 to 3). Sr and Ba abundances vary by approximately a factor of 2.5 in the fluid compositions calculated for the Mt. Shasta region lavas and large ion lithophile element (LILE) abundances are similar to those calculated by Stolper and Newman (1994) and Eiler et al. (2000). The major elements in the fluid-rich component are H2O ( 55-68 wt%), Na2O ( 25-33 wt%) and K2O ( 5-13 wt%). This composition may be that of a supercritical fluid or a low-degree melt of the slab that has reacted with the overlying mantle wedge. Although the slab beneath Mt. Shasta is inferred to be hot ( 600 - 650 °C), the calculated fluid-rich components do not resemble a pure slab melt. The calculated isotopic composition of the fluid-rich component is bimodal. One component has 87Sr/86Sr=0.7028 and ɛNd=+8, and is most similar to a MORB source. The second component has more radiogenic 87Sr

  2. Probing the "additive effect" in the proline and proline hydroxamic acid catalyzed asymmetric addition of nitroalkanes to cyclic enones.

    PubMed

    Hanessian, Stephen; Govindan, Subramaniyan; Warrier, Jayakumar S

    2005-11-01

    The effect of chirality and steric bulk of 2,5-disubstituted piperazines as additives in the conjugate addition of 2-nitropropane to cyclohexenone, catalyzed by l-proline, was investigated. Neither chirality nor steric bulk affects the enantioselectivity of addition, which gives 86-93% ee in the presence of achiral and chiral nonracemic 2,5-disubstituted piperazines. Proline hydroxamic acid is shown for the first time to be an effective organocatalyst in the same Michael reaction. PMID:16189834

  3. Guidelines for Dual Energy X-Ray Absorptiometry Analysis of Trabecular Bone-Rich Regions in Mice: Improved Precision, Accuracy, and Sensitivity for Assessing Longitudinal Bone Changes.

    PubMed

    Shi, Jiayu; Lee, Soonchul; Uyeda, Michael; Tanjaya, Justine; Kim, Jong Kil; Pan, Hsin Chuan; Reese, Patricia; Stodieck, Louis; Lin, Andy; Ting, Kang; Kwak, Jin Hee; Soo, Chia

    2016-05-01

    Trabecular bone is frequently studied in osteoporosis research because changes in trabecular bone are the most common cause of osteoporotic fractures. Dual energy X-ray absorptiometry (DXA) analysis specific to trabecular bone-rich regions is crucial to longitudinal osteoporosis research. The purpose of this study is to define a novel method for accurately analyzing trabecular bone-rich regions in mice via DXA. This method will be utilized to analyze scans obtained from the International Space Station in an upcoming study of microgravity-induced bone loss. Thirty 12-week-old BALB/c mice were studied. The novel method was developed by preanalyzing trabecular bone-rich sites in the distal femur, proximal tibia, and lumbar vertebrae via high-resolution X-ray imaging followed by DXA and micro-computed tomography (micro-CT) analyses. The key DXA steps described by the novel method were (1) proper mouse positioning, (2) region of interest (ROI) sizing, and (3) ROI positioning. The precision of the new method was assessed by reliability tests and a 14-week longitudinal study. The bone mineral content (BMC) data from DXA was then compared to the BMC data from micro-CT to assess accuracy. Bone mineral density (BMD) intra-class correlation coefficients of the new method ranging from 0.743 to 0.945 and Levene's test showing that there was significantly lower variances of data generated by new method both verified its consistency. By new method, a Bland-Altman plot displayed good agreement between DXA BMC and micro-CT BMC for all sites and they were strongly correlated at the distal femur and proximal tibia (r=0.846, p<0.01; r=0.879, p<0.01, respectively). The results suggest that the novel method for site-specific analysis of trabecular bone-rich regions in mice via DXA yields more precise, accurate, and repeatable BMD measurements than the conventional method. PMID:26956416

  4. Exogenous proline relieves growth inhibition caused by NaCl in petunia cells: Metabolism of L-( sup 15 M)-proline followed by sup 15 N NMR

    SciTech Connect

    Heyser, J.W.; Chacon, M.J. )

    1989-04-01

    Exogenous proline stimulated the growth of Petunia hybrida cells on 195 mM NaCl 10-fold as compared with cells grown on 195 mM CaCl medium minus proline. L-({sup 15}N)-proline was fed to cells growing on 0 and 195 mM CaCl, and its metabolism was followed by {sup 15}N NMR analysis of cell extracts. Total proline and amino acids were determined by ninhydrin assay. Proline and primary amino acids were easily resolved in NMR spectra and the amount of {sup 15}N-label which remained in proline was determined. Reduced catabolism of proline in cells grown on NaCl was evident. The role of exogenous proline in conferring increased NaCl tolerance in this nonhalophyte will be discussed.

  5. Fine tuning of spatial arrangement of enzymes in a PCNA-mediated multienzyme complex using a rigid poly-L-proline linker.

    PubMed

    Haga, Tomoaki; Hirakawa, Hidehiko; Nagamune, Teruyuki

    2013-01-01

    Inspired by natural multienzyme complexes, many types of artificial multienzyme complexes have recently been constructed. We previously constructed a self-assembled complex of a bacterial cytochrome P450 and its ferredoxin and ferredoxin reductase partners using heterotrimerization of proliferating cell nuclear antigen (PCNA) from Sulfolobus solfataricus. In this study, we inserted different peptide linkers between ferredoxin and the PCNA subunit, and examined the effect on activity of the self-assembled multienzyme complex. Although the activity was affected by the lengths of both the rigid poly-L-proline-rich linkers and the flexible Gly4-Ser repeating linkers, the poly-L-proline-rich linkers provided the greatest activity enhancement. The optimized poly-L-proline-rich linker enhanced the activity 1.9-fold compared with the GGGGSLVPRGSGGGGS linker used in the previously reported complex, while the Gly4-Ser repeating linkers, (G4S)n (n = 1-6), did not yield higher activity than the maximum activity by the optimized poly-L-proline linker. Both the rigidity/flexibility and length of the peptide linker were found to be important for enhancing the overall activity of the multienzyme complex. PMID:24040392

  6. Proteomic and functional analysis of proline dehydrogenase 1 link proline catabolism to mitochondrial electron transport in Arabidopsis thaliana.

    PubMed

    Cabassa-Hourton, Cécile; Schertl, Peter; Bordenave-Jacquemin, Marianne; Saadallah, Kaouthar; Guivarc'h, Anne; Lebreton, Sandrine; Planchais, Séverine; Klodmann, Jennifer; Eubel, Holger; Crilat, Emilie; Lefebvre-De Vos, Delphine; Ghelis, Thanos; Richard, Luc; Abdelly, Chedly; Carol, Pierre; Braun, Hans-Peter; Savouré, Arnould

    2016-09-01

    Proline accumulates in many plant species in response to environmental stresses. Upon relief from stress, proline is rapidly oxidized in mitochondria by proline dehydrogenase (ProDH) and then by pyrroline-5-carboxylate dehydrogenase (P5CDH). Two ProDH genes have been identified in the genome of the model plant Arabidopsis thaliana To gain a better understanding of ProDH1 functions in mitochondria, proteomic analysis was performed. ProDH1 polypeptides were identified in Arabidopsis mitochondria by immunoblotting gels after 2D blue native (BN)-SDS/PAGE, probing them with an anti-ProDH antibody and analysing protein spots by MS. The 2D gels showed that ProDH1 forms part of a low-molecular-mass (70-140 kDa) complex in the mitochondrial membrane. To evaluate the contribution of each isoform to proline oxidation, mitochondria were isolated from wild-type (WT) and prodh1, prodh2, prodh1prodh2 and p5cdh mutants. ProDH activity was high for genotypes in which ProDH, most likely ProDH1, was strongly induced by proline. Respiratory measurements indicate that ProDH1 has a role in oxidizing excess proline and transferring electrons to the respiratory chain. PMID:27303048

  7. Factors reducing and promoting the effectiveness of proline as an osmoprotectant in Escherichia coli K12.

    PubMed

    Milner, J L; McClellan, D J; Wood, J M

    1987-07-01

    Proline accumulation in Escherichia coli is mediated by three proline porters. Proline catabolism is effected by proline porter I (PPI) and proline/delta 1-pyrroline carboxylate dehydrogenase. Proline did not accumulate cytoplasmically when E. coli was subjected to osmotic stress in minimal salts medium. Although PPI is induced when proline is provided as carbon or nitrogen source, its activity decreased following growth of the bacteria in minimal salts medium of high osmotic strength. Proline dehydrogenase was induced by proline in low or high osmotic strength media. Proline porter II (PPII) was both activated and induced in osmotically stressed bacteria, though the dependencies of the two responses on medium osmolarity differed. Osmotic downshift during the transport measurement decreased the uptake of proline, serine and glutamine by bacteria cultured in media of high osmotic strength. Thus, while osmotic upshift caused specific activation of PPII, osmotic downshift caused a non-specific reduction in amino acid uptake. Glycine betaine inhibited the uptake of [14C]proline via PPII and PPIII but not via PPI. The dependence of that inhibition on glycine betaine concentration was similar when PPII was uninduced, induced or activated by osmotic stress, or induced by amino acid limited growth. Thus PPII and PPIII, not PPI, contribute to the mechanism of osmoprotection by proline and glycine betaine. The tendency for exogenous proline to accumulate in the cytoplasm of bacteria exposed to osmotic stress would, however, be countered by increased proline catabolism. PMID:3312483

  8. Immunity related genes in dipterans share common enrichment of AT-rich motifs in their 5' regulatory regions that are potentially involved in nucleosome formation

    PubMed Central

    Hernandez-Romano, Jesus; Carlos-Rivera, Francisco J; Salgado, Heladia; Lamadrid-Figueroa, Hector; Valverde-Garduño, Veronica; Rodriguez, Mario H; Martinez-Barnetche, Jesus

    2008-01-01

    Background Understanding the transcriptional regulation mechanisms in response to environmental challenges is of fundamental importance in biology. Transcription factors associated to response elements and the chromatin structure had proven to play important roles in gene expression regulation. We have analyzed promoter regions of dipteran genes induced in response to immune challenge, in search for particular sequence patterns involved in their transcriptional regulation. Results 5' upstream regions of D. melanogaster and A. gambiae immunity-induced genes and their corresponding orthologous genes in 11 non-melanogaster drosophilid species and Ae. aegypti share enrichment in AT-rich short motifs. AT-rich motifs are associated with nucleosome formation as predicted by two different algorithms. In A. gambiae and D. melanogaster, many immunity genes 5' upstream sequences also showed NFκB response elements, located within 500 bp from the transcription start site. In A. gambiae, the frequency of ATAA motif near the NFκB response elements was increased, suggesting a functional link between nucleosome formation/remodelling and NFκB regulation of transcription. Conclusion AT-rich motif enrichment in 5' upstream sequences in A. gambiae, Ae. aegypti and the Drosophila genus immunity genes suggests a particular pattern of nucleosome formation/chromatin organization. The co-occurrence of such motifs with the NFκB response elements suggests that these sequence signatures may be functionally involved in transcriptional activation during dipteran immune response. AT-rich motif enrichment in regulatory regions in this group of co-regulated genes could represent an evolutionary constrained signature in dipterans and perhaps other distantly species. PMID:18613977

  9. The SAP motif and C-terminal RS- and RD/E-rich region influences the sub-nuclear localization of Acinus isoforms.

    PubMed

    Wang, Fang; Wendling, Karen S; Soprano, Kenneth J; Soprano, Dianne Robert

    2014-12-01

    Acinus has been reported to function in apoptosis, RNA processing and regulation of gene transcription including RA-dependent transcription. There are three different isoforms of Acinus termed Acinus-L, Acinus-S', and Acinus-S. The isoforms of Acinus differ in their N-terminus while the C-terminus is consistent in all isoforms. The sub-nuclear localization of Acinus-L and Acinus-S' was determined using fluorescence microscopy. Acinus-S' colocalizes with SC35 in nuclear speckles while Acinus-L localizes diffusely throughout the nucleoplasm. RA treatment has little effect on the sub-nuclear localization of Acinus-L and Acinus-S'. The domains/regions necessary for the distinct sub-nuclear localization of Acinus-L and Acinus-S' were identified. The speckled sub-nuclear localization of Acinus-S' is dependent on its C-terminal RS- and RD/E-rich region but is independent of the phosphorylation status of Ser-453 and Ser-604 within this region. The unique N-terminal SAP motif of Acinus-L is responsible for its diffuse localization in the nucleus. Moreover, the sub-nuclear localization of Acinus isoforms is affected by each other, which is determined by the combinatorial effect of the more potent SAP motif of Acinus-L and the C-terminal RS- and RD/E-rich region in all Acinus isoforms. The C-terminal RS- and RD/E-rich region of Acinus mediates the colocalization of Acinus isoforms as well as with its interacting protein RNPS1. In conclusion, the SAP motif is responsible for the difference in the nuclear localization between Acinus-L and Acinus-S'. This difference in the nuclear localization of Acinus-S' and Acinus-L may suggest that these two isoforms have different functional roles. PMID:25079509

  10. Adjacent proline residues in the inhibitory domain of the Oct-2 transcription factor play distinct functional roles.

    PubMed Central

    Liu, Y Z; Lee, I K; Locke, I; Dawson, S J; Latchman, D S

    1998-01-01

    A 40 amino acid region of Oct-2 from amino acids 142 to 181 functions as an active repressor domain capable of inhibiting both basal activity and activation of promoters containing a TATA box, but not of those that contain an initiator element. Based on our observation that the equivalent region of the closely related Oct-1 factor does not act as an inhibitory domain, we have mutated specific residues in the Oct-2 domain in an attempt to probe their importance in repressor domain function. Although mutations of several residues have no or minimal effect, mutation of proline 175 to arginine abolishes the ability to inhibit both basal and activated transcription. In contrast, mutation of proline 174 to arginine confers upon the domain the ability to repress activation of an initiator-containing promoter by acidic activation domains, and also suppresses the effect of the proline 175 mutation. Hence, adjacent proline residues play key roles in the functioning of the inhibitory domain and in limiting its specificity to TATA-box-containing promoters. PMID:9580701

  11. Purification and cloning of a proline 3-hydroxylase, a novel enzyme which hydroxylates free L-proline to cis-3-hydroxy-L-proline.

    PubMed Central

    Mori, H; Shibasaki, T; Yano, K; Ozaki, A

    1997-01-01

    Proline 3-hydroxylase was purified from Streptomyces sp. strain TH1, and its structural gene was cloned. The purified enzyme hydroxylated free L-proline to cis-3-hydroxy-L-proline and showed properties of a 2-oxoglutarate-dependent dioxygenase (H. Mori, T. Shibasaki, Y. Uosaki, K. Ochiai, and A. Ozaki, Appl. Environ. Microbiol, 62:1903-1907, 1996). The molecular mass of the purified enzyme was 35 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The isoelectric point of the enzyme was 4.3. The optimal pH and temperature were 7.0 and 35 degrees C, respectively. The K(m) values were 0.56 and 0.11 mM for L-proline and 2-oxoglutarate, respectively. The Kcat value of hydroxylation was 3.2 s-1. Determined N-terminal and internal amino acid sequences of the purified protein were not found in the SwissProt protein database. A DNA fragment of 74 bp was amplified by PCR with degenerate primers based on the determined N-terminal amino acid sequence. With this fragment as a template, a digoxigenin-labeled N-terminal probe was synthesized by PCR. A 6.5-kbp chromosome fragment was cloned by colony hybridization with the labeled probe. The determined DNA sequence of the cloned fragment revealed a 870-bp open reading frame (ORF 3), encoding a protein of 290 amino acids with a calculated molecular weight of 33,158. No sequence homolog was found in EMBL, GenBank, and DDBJ databases. ORF 3 was expressed in Escherichia coli DH1. Recombinants showed hydroxylating activity five times higher than that of the original bacterium, Streptomyces sp. strain TH1. It was concluded that the ORF 3 encodes functional proline 3-hydroxylase. PMID:9294421

  12. Vertebrate Dissimilarity Due to Turnover and Richness Differences in a Highly Beta-Diverse Region: The Role of Spatial Grain Size, Dispersal Ability and Distance

    PubMed Central

    Calderón-Patrón, Jaime M.; Moreno, Claudia E.; Pineda-López, Rubén; Sánchez-Rojas, Gerardo; Zuria, Iriana

    2013-01-01

    We explore the influence of spatial grain size, dispersal ability, and geographic distance on the patterns of species dissimilarity of terrestrial vertebrates, separating the dissimilarity explained by species replacement (turnover) from that resulting from richness differences. With data for 905 species of terrestrial vertebrates distributed in the Isthmus of Tehuantepec, classified into five groups according to their taxonomy and dispersal ability, we calculated total dissimilarity and its additive partitioning as two components: dissimilarity derived from turnover and dissimilarity derived from richness differences. These indices were compared using fine (10 x 10 km), intermediate (20 x 20 km) and coarse (40 x 40 km) grain grids, and were tested for any correlations with geographic distance. The results showed that total dissimilarity is high for the terrestrial vertebrates in this region. Total dissimilarity, and dissimilarity due to turnover are correlated with geographic distance, and the patterns are clearer when the grain is fine, which is consistent with the distance-decay pattern of similarity. For all terrestrial vertebrates tested on the Isthmus of Tehuantepec both the dissimilarity derived from turnover and the dissimilarity resulting from richness differences make important contributions to total dissimilarity, and dispersal ability does not seem to influence the dissimilarity patterns. These findings support the idea that conservation efforts in this region require a system of interconnected protected areas that embrace the environmental, climatic and biogeographic heterogeneity of the area. PMID:24324840

  13. Enhanced translation by Nucleolin via G-rich elements in coding and non-coding regions of target mRNAs

    PubMed Central

    Abdelmohsen, Kotb; Tominaga, Kumiko; Lee, Eun Kyung; Srikantan, Subramanya; Kang, Min-Ju; Kim, Mihee M.; Selimyan, Roza; Martindale, Jennifer L.; Yang, Xiaoling; Carrier, France; Zhan, Ming; Becker, Kevin G.; Gorospe, Myriam

    2011-01-01

    RNA-binding proteins (RBPs) regulate gene expression at many post-transcriptional levels, including mRNA stability and translation. The RBP nucleolin, with four RNA-recognition motifs, has been implicated in cell proliferation, carcinogenesis and viral infection. However, the subset of nucleolin target mRNAs and the influence of nucleolin on their expression had not been studied at a transcriptome-wide level. Here, we globally identified nucleolin target transcripts, many of which encoded cell growth- and cancer-related proteins, and used them to find a signature motif on nucleolin target mRNAs. Surprisingly, this motif was very rich in G residues and was not only found in the 3′-untranslated region (UTR), but also in the coding region (CR) and 5′-UTR. Nucleolin enhanced the translation of mRNAs bearing the G-rich motif, since silencing nucleolin did not change target mRNA stability, but decreased the size of polysomes forming on target transcripts and lowered the abundance of the encoded proteins. In summary, nucleolin binds G-rich sequences in the CR and UTRs of target mRNAs, many of which encode cancer proteins, and enhances their translation. PMID:21737422

  14. Enhanced translation by Nucleolin via G-rich elements in coding and non-coding regions of target mRNAs.

    PubMed

    Abdelmohsen, Kotb; Tominaga, Kumiko; Lee, Eun Kyung; Srikantan, Subramanya; Kang, Min-Ju; Kim, Mihee M; Selimyan, Roza; Martindale, Jennifer L; Yang, Xiaoling; Carrier, France; Zhan, Ming; Becker, Kevin G; Gorospe, Myriam

    2011-10-01

    RNA-binding proteins (RBPs) regulate gene expression at many post-transcriptional levels, including mRNA stability and translation. The RBP nucleolin, with four RNA-recognition motifs, has been implicated in cell proliferation, carcinogenesis and viral infection. However, the subset of nucleolin target mRNAs and the influence of nucleolin on their expression had not been studied at a transcriptome-wide level. Here, we globally identified nucleolin target transcripts, many of which encoded cell growth- and cancer-related proteins, and used them to find a signature motif on nucleolin target mRNAs. Surprisingly, this motif was very rich in G residues and was not only found in the 3'-untranslated region (UTR), but also in the coding region (CR) and 5'-UTR. Nucleolin enhanced the translation of mRNAs bearing the G-rich motif, since silencing nucleolin did not change target mRNA stability, but decreased the size of polysomes forming on target transcripts and lowered the abundance of the encoded proteins. In summary, nucleolin binds G-rich sequences in the CR and UTRs of target mRNAs, many of which encode cancer proteins, and enhances their translation. PMID:21737422

  15. Requirement of proline synthesis during Arabidopsis reproductive development

    PubMed Central

    2012-01-01

    Background Gamete and embryo development are crucial for successful reproduction and seed set in plants, which is often the determining factor for crop yield. Proline accumulation was largely viewed as a specific reaction to overcome stress conditions, while recent studies suggested important functions of proline metabolism also in reproductive development. Both the level of free proline and proline metabolism were proposed to influence the transition to flowering, as well as pollen and embryo development. Results In this study, we performed a detailed analysis of the contribution of individual proline biosynthetic enzymes to vegetative development and reproductive success in Arabidopsis. In contrast to previous reports, we found that pyrroline-5-carboxylate (P5C) synthetase 2 (P5CS2) is not essential for sexual reproduction although p5cs2 mutant plants were retarded in vegetative development and displayed reduced fertility under long-day conditions. Single mutant plants devoid of P5CS1 did not show any developmental defects. Simultaneous absence of both P5CS isoforms resulted in pollen sterility, while fertile egg cells could still be produced. Expression of P5C reductase (P5CR) was indispensable for embryo development but surprisingly not needed for pollen or egg cell fertility. The latter observation could be explained by an extreme stability of P5CR activity, which had a half-life time of greater than 3 weeks in vitro. Expression of P5CR-GFP under the control of the endogenous P5CR promoter was able to restore growth of homozygous p5cr mutant embryos. The analysis of P5CR-GFP-fluorescence in planta supported an exclusively cytoplasmatic localisation of P5CR. Conclusions Our results demonstrate that potential alternative pathways for proline synthesis or inter-generation transfer of proline are not sufficient to overcome a defect in proline biosynthesis from glutamate during pollen development. Proline biosynthesis through P5CS2 and P5CR is limiting for

  16. Coral diversity and the severity of disease outbreaks: a cross-regional comparison of Acropora white syndrome in a species-rich region (American Samoa) with a species-poor region (Northwestern Hawaiian Islands).

    USGS Publications Warehouse

    Aeby, G.S.; Bourne, D.G.; Wilson, B.; Work, Thierry M.

    2011-01-01

    The dynamics of the coral disease, Acropora white syndrome (AWS), was directly compared on reefs in the species-poor region of the Northwestern Hawaiian Islands (NWHI) and the species-rich region of American Samoa (AS) with results suggesting that biodiversity, which can affect the abundance of susceptible hosts, is important in influencing the impacts of coral disease outbreaks. The diversity-disease hypothesis predicts that decreased host species diversity should result in increased disease severity of specialist pathogens. We found that AWS was more prevalent and had a higher incidence within the NWHI as compared to AS. Individual Acropora colonies affected by AWS showed high mortality in both regions, but case fatality rate and disease severity was higher in the NWHI. The site within the NWHI had a monospecific stand of A. cytherea; a species that is highly susceptible to AWS. Once AWS entered the site, it spread easily amongst the abundant susceptible hosts. The site within AS contained numerous Acropora species, which differed in their apparent susceptibility to infection and disease severity, which in turn reduced disease spread. Manipulative studies showed AWS was transmissible through direct contact in three Acropora species. These results will help managers predict and respond to disease outbreaks.

  17. Very low sound velocities in iron-rich (Mg,Fe)O: Implications for the core-mantle boundary region

    NASA Astrophysics Data System (ADS)

    Wicks, J. K.; Jackson, J. M.; Sturhahn, W.

    2010-12-01

    Seismic observations near the base of the core-mantle boundary have revealed 5-20 km thick patches in which the seismic wave velocities are reduced by up to 30%. These ultra-low velocity zones (ULVZs) have previously been attributed to partial melting, a metal-bearing layer (e.g. Knittle and Jeanloz, 1991), or to an iron-enriched post-perovskite phase (Mao et al., 2006). These scenarios all require concomitant iron enrichment to maintain the appropriate densities of these structures. Recent experiments have shown that (Mg,Fe)O is the preferred phase for equilibrium iron partitioning under deep Earth conditions (e.g. Sakai et al., 2010). We propose that in iron-rich assemblages, such as those suggested at the base of the mantle (e.g. Labrosse et al., 2007), the characteristic low sound speeds can be attributed to iron-rich (Mg,Fe)O (Wicks et al., 2010). We present the sound velocities of (Mg.16Fe.84)O measured to 121 GPa at ambient temperature, using nuclear resonant inelastic x-ray scattering. The effect of the electronic environment of the iron sites on the sound velocities were tracked in situ using synchrotron Mössbauer spectroscopy. We found the sound velocities of (Mg.16Fe.84)O to be much lower than those in other presumed mantle phases at similar conditions, most notably at very high pressures. Conservative estimates of the effect of temperature and dilution on aggregate sound velocities show that only a small amount of iron-rich (Mg,Fe)O can greatly reduce the average sound velocity of an assemblage. References: Knittle, E., and Jeanloz, R., Science, 33, L02310 (1991). Labrosse, S. et al., Nature, 450, 866--869 (2007). Mao, W. L. et al., Science, 312, 564--565 (2006). Sakai, T. et al., Phys. Chem. Min., 37, 487--96 (2010). Wicks, J. K., et al., Geophys. Res. Lett., 37, L15304 (2010).

  18. Dominant roles of the polybasic proline motif and copper in the PrP23-89-mediated stress protection response.

    PubMed

    Haigh, Cathryn L; Drew, Simon C; Boland, Martin P; Masters, Colin L; Barnham, Kevin J; Lawson, Victoria A; Collins, Steven J

    2009-05-15

    Beta-cleavage of the neurodegenerative disease-associated prion protein (PrP) protects cells from death induced by oxidative insults. The beta-cleavage event produces two fragments, designated N2 and C2. We investigated the role of the N2 fragment (residues 23-89) in cellular stress response, determining mechanisms involved and regions important for this reaction. The N2 fragment differentially modulated the reactive oxygen species (ROS) response induced by serum deprivation, with amelioration when copper bound. Amino acid residues 23-50 alone mediated a ROS reduction response. PrP23-50 ROS reduction was not due to copper binding or direct antioxidant activity, but was instead mediated through proteoglycan binding partners localised in or interacting with cholesterol-rich membrane domains. Furthermore, mutational analyses of both PrP23-50 and N2 showed that their protective capacity requires the sterically constraining double proline motif within the N-terminal polybasic region. Our findings show that N2 is a biologically active fragment that is able to modulate stress-induced intracellular ROS through interaction of its structurally defined N-terminal polybasic region with cell-surface proteoglycans. PMID:19383722

  19. Fine structure mapping of a gene-rich region of wheat carrying Ph1, a suppressor of crossing over between homoeologous chromosomes

    PubMed Central

    Sidhu, Gaganpreet K.; Rustgi, Sachin; Shafqat, Mustafa N.; von Wettstein, Diter; Gill, Kulvinder S.

    2008-01-01

    The wheat gene-rich region (GRR) 5L0.5 contains many important genes, including Ph1, the principal regulator of chromosome pairing. Comparative marker analysis identified 32 genes for the GRR controlling important agronomic traits. Detailed characterization of this region was accomplished by first physically localizing 213 wheat group 5L-specific markers, using group 5 nulli-tetrasomics, three Ph1 gene deletion/insertion mutants, and nine terminal deletion lines with their breakpoints around the 5L0.5 region. The Ph1 gene was localized to a much smaller region within the GRR (Ph1 gene region). Of the 61 markers that mapped in the four subregions of the GRR, 9 mapped in the Ph1 gene region. High stringency sequence comparison (e < 1 ×10−25) of 157 group 5L-specific wheat ESTs identified orthologs for 80% sequences in rice and 71% in Arabidopsis. Rice orthologs were present on all rice chromosomes, although most (34%) were on rice chromosome 9 (R9). No single collinear region was identified in Arabidopsis even for a smaller region, such as the Ph1 gene region. Seven of the nine Ph1 gene region markers mapped within a 450-kb region on R9 with the same gene order. Detailed domain/motif analysis of the 91 putative genes present in the 450-kb region identified 26 candidates for the Ph1 gene, including genes involved in chromatin reorganization, microtubule attachment, acetyltransferases, methyltransferases, DNA binding, and meiosis/anther specific proteins. Five of these genes shared common domains/motifs with the meiosis specific genes Zip1, Scp1, Cor1, RAD50, RAD51, and RAD57. Wheat and Arabidopsis homologs for these rice genes were identified. PMID:18398005

  20. The Importance of the KR-Rich Region of the Coat Protein of Ourmia melon virus for Host Specificity, Tissue Tropism, and Interference With Antiviral Defense.

    PubMed

    Rossi, Marika; Vallino, Marta; Abbà, Simona; Ciuffo, Marina; Balestrini, Raffaella; Genre, Andrea; Turina, Massimo

    2015-01-01

    The N-terminal region of the Ourmia melon virus (OuMV) coat protein (CP) contains a short lysine/arginine-rich (KR) region. By alanine scanning mutagenesis, we showed that the KR region influences pathogenicity and virulence of OuMV without altering viral particle assembly. A mutant, called OuMV6710, with three basic residue substitutions in the KR region, was impaired in the ability to maintain the initial systemic infection in Nicotiana benthamiana and to infect both cucumber and melon plants systemically. The integrity of this protein region was also crucial for encapsidation of viral genomic RNA; in fact, certain mutations within the KR region partially compromised the RNA encapsidation efficiency of the CP. In Arabidopsis thaliana Col-0, OuMV6710 was impaired in particle accumulation; however, this phenotype was abolished in dcl2/dcl4 and dcl2/dcl3/dcl4 Arabidopsis mutants defective for antiviral silencing. Moreover, in contrast to CPwt, in situ immunolocalization experiments indicated that CP6710 accumulates efficiently in the spongy mesophyll tissue of infected N. benthamiana and A. thaliana leaves but only occasionally infects palisade tissues. These results provided strong evidence of a crucial role for OuMV CP during viral infection and highlighted the relevance of the KR region in determining tissue tropism, host range, pathogenicity, and RNA affinity, which may be all correlated with a possible CP silencing-suppression activity. PMID:25494356

  1. Direct Mass Measurements in the Light Neutron-Rich Region Using a Combined Energy and Time-of-Flight Technique

    NASA Astrophysics Data System (ADS)

    Pillai, C.; Swenson, L. W.; Vieira, D. J.; Butler, G. W.; Wouters, J. M.; Rokni, S. H.; Vaziri, K.; Remsberg, L. P.

    This experiment has demonstrated that direct mass measurements can be performed (albeit of low precision in this first attempt) using the M proportional to ET(2) method. This technique has the advantage that many particle-bound nuclei, produced in fragmentation reactions can be measured simultaneously, independent of their N or Z. The main disadvantage of this approach is that both energy and time-of-flight must be measured precisely on an absolute scale. Although some mass walk with N and Z was observed in this experiment, these uncertainties were largely removed by extrapolating the smooth dependence observed for known nuclei which lie closer to the valley of (BETA)-stability. Mass measurements for several neutron-rich light nuclei ranging from C-17 to NE-26 have been performed. In all cases these measurements agree with the latest mass compilation of Wapstra and Audi. The masses of N-20 N and F-24 have been determined for the first time.

  2. The Trp53 delta proline (Trp53ΔP) mouse exhibits increased genome instability and susceptibility to radiation-induced, but not spontaneous, tumor development.

    PubMed

    Adams, Cassandra J; Yu, Jennifer S; Mao, Jian-Hua; Jen, Kuang-Yu; Costes, Sylvain V; Wade, Mark; Shoemake, Jocelyn; Aina, Olulanu H; Del Rosario, Reyno; Menchavez, Phuong Thuy; Cardiff, Robert D; Wahl, Geoffrey M; Balmain, Allan

    2016-09-01

    The tumor suppressor TP53 can initiate a plethora of anti-proliferative effects to maintain genomic integrity under conditions of genotoxic stress. The N-terminal proline-rich domain (PRD) of TP53 is important in the regulation of TP53 activity and stability. A common polymorphism at codon 72 in this region has been associated with altered cancer risk in humans. The Trp53ΔP mouse, which carries a germline homozygous deletion of a region of the PRD, does not develop spontaneous tumors in a mixed 129/Sv and C57BL/6 genetic background, but is highly susceptible to a broad range of tumor types following total body exposure to 4 Gy gamma (γ) radiation. This contrasts with the tumor spectrum in Trp53 null (-/-) mice, which mainly develop thymic lymphomas and osteosarcomas. Analysis of genomic instability in tissues and cells from Trp53ΔP mice demonstrated elevated basal levels of aneuploidy, but this is not sufficient to drive spontaneous tumorigenesis, which requires an additional DNA damage stimulus. Levels of genomic instability did not increase significantly in Trp53ΔP mice following irradiation exposure, suggesting that other radiation effects including tissue inflammation, altered metabolism or autophagy, may play an important role. The Trp53ΔP mouse is a novel model to dissect the mechanisms of tumor development induced by radiation exposure. © 2015 Wiley Periodicals, Inc. PMID:26310697

  3. Novel proline-hydroxyproline glycopeptides from the dandelion (Taraxacum officinale Wigg.) flowers: de novo sequencing and biological activity.

    PubMed

    Astafieva, Alexandra A; Enyenihi, Atim A; Rogozhin, Eugene A; Kozlov, Sergey A; Grishin, Eugene V; Odintsova, Tatyana I; Zubarev, Roman A; Egorov, Tsezi A

    2015-09-01

    Two novel homologous peptides named ToHyp1 and ToHyp2 that show no similarity to any known proteins were isolated from Taraxacum officinale Wigg. flowers by multidimensional liquid chromatography. Amino acid and mass spectrometry analyses demonstrated that the peptides have unusual structure: they are cysteine-free, proline-hydroxyproline-rich and post-translationally glycosylated by pentoses, with 5 carbohydrates in ToHyp2 and 10 in ToHyp1. The ToHyp2 peptide with a monoisotopic molecular mass of 4350.3Da was completely sequenced by a combination of Edman degradation and de novo sequencing via top down multistage collision induced dissociation (CID) and higher energy dissociation (HCD) tandem mass spectrometry (MS(n)). ToHyp2 consists of 35 amino acids, contains eighteen proline residues, of which 8 prolines are hydroxylated. The peptide displays antifungal activity and inhibits growth of Gram-positive and Gram-negative bacteria. We further showed that carbohydrate moieties have no significant impact on the peptide structure, but are important for antifungal activity although not absolutely necessary. The deglycosylated ToHyp2 peptide was less active against the susceptible fungus Bipolaris sorokiniana than the native peptide. Unique structural features of the ToHyp2 peptide place it into a new family of plant defense peptides. The discovery of ToHyp peptides in T. officinale flowers expands the repertoire of molecules of plant origin with practical applications. PMID:26259198

  4. Targeted Deletion of Regions Rich in Immune-Evasive Genes from the Cytomegalovirus Genome as a Novel Vaccine Strategy▿

    PubMed Central

    Čičin-Šain, Luka; Bubić, Ivan; Schnee, Margit; Ruzsics, Zsolt; Mohr, Christian; Jonjić, Stipan; Koszinowski, Ulrich H.

    2007-01-01

    Human cytomegalovirus (CMV), a ubiquitous human pathogen, is a leading cause of congenital infections and represents a serious health risk for the immunosuppressed patient. A vaccine against CMV is currently not available. CMV is characterized by its large genome and by multiple genes modulating the immunity of the host, which cluster predominantly at genome termini. Here, we tested whether the deletion of gene blocks rich in immunomodulatory genes could be used as a novel concept in the generation of immunogenic but avirulent, herpesvirus vaccines. To generate an experimental CMV vaccine, we selectively deleted 32 genes from the mouse cytomegalovirus (MCMV) genome. The resulting mutant grew to titers similar to that of wild-type MCMV in vitro. In vivo, the mutant was 10,000-fold attenuated and well tolerated, even by highly susceptible mice deficient for B, T, and NK cells or for the interferon type I receptor. Equally relevant for safety concerns, immune suppression did not lead to the mutant's reactivation from latency. Immunization with the replication-competent mutant, but not with inactivated virus, resulted in protective immunity, which increased over time. Vaccination induced MCMV-specific antibodies and a strong T-cell response. We propose that a targeted and rational approach can improve future herpesvirus vaccines and vaccine vectors. PMID:17913824

  5. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    SciTech Connect

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no further increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.

  6. Extending studies of the fusion of heavy nuclei to the neutron rich region using accelerated radioactive ion beams.

    SciTech Connect

    Shapira, Dan

    2011-01-01

    One of the stated goals for proposed and existing facilities that produce and accelerate radioactive ion beams is to explore and achieve a new understanding of the reactions mechanisms leading to the synthesis of the heaviest nuclei. Nuclear synthesis of two large nuclei into a single entity is a complex multistep process. The beam intensities of radioactive ions accelerated at present day facilities are not sufficient to synthesize super heavy elements. However the study of the iso-spin dependence of nuclear synthesis and the many processes competing with it can be carried out at present day facilities. Of special interest are cases where the interacting nuclei and the synthesized product are extremely neutron-rich. The effects of neutron excess on the reaction processes leading to the formation of the synthesized nucleus that emerged in earlier studies are poorly understood and sometimes counter intuitive. Results from measurements performed at HRIBF, as well as our plans for future measurements and the equipment being prepared will be presented.

  7. Phase equilibria and elements partitioning in zirconolite-rich region of Ca-Zr-Ti-Al-Gd-Si-O system

    SciTech Connect

    Knyazev, O.A.; Stefanovsky, S.V.; Ioudintsev, S.V.; Nikonov, B.S.; Omelianenko, B.I.; Mokhov, A.V.; Yakushev, A.I.

    1997-12-31

    Zirconolite-rich ceramics were produced by the cold crucible melting technique in an air atmosphere, at 1550 {+-} 50 C and 1 atm. Four samples with overall composition (in wt.%): 4.9-14.3 CaO; 19.0-41.3 ZrO{sub 2}; 24.1-42.6 TiO{sub 2}; 1.3-11.3 Al{sub 2}O{sub 3}; 6.8-30.0 Gd{sub 2}O{sub 3}; and 1.1-8.5 SiO{sub 2} have been studied. Total phases in the ceramics consist of major zirconolite and minor rutile, perovskite, zirconia, aluminium titanate, and glass. The Gd{sub 2}O{sub 3} content in zirconolite reaches up to 31.4 wt.% corresponding to the formula: (Ca{sub 0.4},Gd{sub 0.7})Zr{sub 1.0}(Ti{sub 1.4},Al{sub 0.5})O{sub 7.0}. The data on the phase composition agree well with coupled Gd incorporation into the mineral structure: Ca(II) + Ti(IV) = Gd(III) + Al(III), and 2Gd(III) = Ca(II) + Zr(IV). The highest Gd contents observed in the other phases are 25.4% for zirconia, 12.6% in glass, 8.8% in perovskite, and 1.4% for rutile. The rest of the elements` distribution in the samples are analyzed.

  8. Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA.

    PubMed Central

    Irwin, N; Baekelandt, V; Goritchenko, L; Benowitz, L I

    1997-01-01

    GAP-43 is a membrane phosphoprotein that is important for the development and plasticity of neural connections. In undifferentiated PC12 pheochromocytoma cells, GAP-43 mRNA degrades rapidly ( t = 5 h), but becomes stable when cells are treated with nerve growth factor. To identify trans- acting factors that may influence mRNA stability, we combined column chromatography and gel mobility shift assays to isolate GAP-43 mRNA binding proteins from neonatal bovine brain tissue. This resulted in the isolation of two proteins that bind specifically and competitively to a pyrimidine-rich sequence in the 3'-untranslated region of GAP-43 mRNA. Partial amino acid sequencing revealed that one of the RNA binding proteins coincides with FBP (far upstream element binding protein), previously characterized as a protein that resembles hnRNP K and which binds to a single-stranded, pyrimidine-rich DNA sequence upstream of the c -myc gene to activate its expression. The other binding protein shares sequence homology with PTB, a polypyrimidine tract binding protein implicated in RNA splicing and regulation of translation initiation. The two proteins bind to a 26 nt pyrimidine-rich sequence lying 300 nt downstream of the end of the coding region, in an area shown by others to confer instability on a reporter mRNA in transient transfection assays. We therefore propose that FBP and the PTB-like protein may compete for binding at the same site to influence the stability of GAP-43 mRNA. PMID:9092640

  9. SSR Markers Associated with Proline in Drought Tolerant Wheat Germplasm.

    PubMed

    Iqbal, Muhammad Javid; Maqsood, Yasir; Abdin, Zain Ul; Manzoor, Atif; Hassan, Muhammad; Jamil, Amer

    2016-03-01

    Water stress causes major agricultural loss throughout the world as survival of the crops remained under stress and loss in yield. Plants respond to drought stress by means of different adaptive mechanisms such as accumulation of osmoprotectants to counteract the water stress. Amino acid proline is known to occur widely in higher plants and normally accumulates in large quantities as an osmolyte in response to environmental stresses. Biochemical estimation of proline was done in the drought-affected wheat genotypes by spectrophotometric method. Proline promoted a positive effect as root/shoot ratio was enhanced in wheat germplasm under drought stress. SSR primer pairs (45) were tested for polymorphism among selected wheat genotypes. The dendrogram results have shown the wheat genotype association with the levels of proline during induced drought stress. The relationship between pattern of drought responsive biochemical attributes and DNA markers in the selected wheat genotypes was recognized to select drought tolerant genotypes for sowing in drought affected areas of the country. PMID:26637362

  10. Molecular cloning and characterization of a putative proline dehydrogenase gene in the Colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Wan, Pin-Jun; Lü, Dong; Guo, Wen-Chao; Ahmat, Tursun; Yang, Lu; Mu, Li-Li; Li, Guo-Qing

    2014-04-01

    Leptinotarsa decemlineata adults exhibit a season-dependent activity. In spring, post-diapause beetles often fly a long distance from overwintering sites to potato fields. In summer and autumn, the flight ability is sharply reduced. Proline is the main energy substrate of L. decemlineata during flight and proline dehydrogenase (ProDH) catalyzes the first step in proline catabolism. Here we identified a putative LdProDH gene; it had three cDNA isoforms which shared the same 5'UTR and coding region, but differed in the lengths of 3'UTRs (515, 1 092 and 1 242 bp for isoforms-1, -2 and -3, respectively). LdProDH encoded a 616 amino acid protein that showed high sequence similarity to ProDH-like proteins from other insect species. LdProDH was expressed in the third and fourth instars larvae and adults, but not in pupae. Dietary ingestion of bacterially expressed LdProDH-dsRNA by adults significantly decreased its messenger RNA (mRNA) level, and caused an elevation of free proline content in the hemolymph. Further observation revealed that three canonical polyadenylation signals (AATAAA) were tandemly located in the 3'UTR of isoform-3. The first, second and third polyadenylation sites gave rise to isoforms-1, -2 and -3, respectively. Analysis of the genomic DNA uncovered that the three isoforms resulted from alternative polyadenylation. The mRNA level of isoform-1, which expressed at low levels in pre-diapause adults, became abundant in post-diapause beetles. It is indicated that the LdProDH expression is fine-tuned through 3'UTR to control proline catabolism for the season-dependent activity of L. decemlineata adults. PMID:23956209

  11. Structural aspects of the interaction of anticancer drug Actinomycin-D to the GC rich region of hmgb1 gene.

    PubMed

    Lohani, Neelam; Singh, Himanshu Narayan; Moganty, R Rajeswari

    2016-06-01

    The high mobility group box 1 protein has been identified as a key player in chromatin homeostasis including transcription regulation, recombination, repair, and chromatin remodeling. Emerging findings indicate HMGB1 protein over expression in nearly all types of human cancers and inflammatory disorders. Thus it is considered as a potential therapeutic target for treating various malignancies. We screened the promoter region of hmgb1 gene and selected a positive regulatory element of 25 base pair duplex (25RY) (-165 to -183) as a potential target for chemotherapeutic intervention. The molecular interaction of actinomycin (ACT) with the regulatory region of hmgb1 gene was characterized by spectroscopic, calorimetric and molecular docking studies. The hypochromic and bathochromic shift in the absorption spectrum, stabilization of 25RY duplex against thermal denaturation, perturbation of CD spectrum of duplex and enhancement of fluorescence intensity of actinomycin indicate strong binding of actinomycin to the hmgb1 promoter region (25RY).The energetics was characterized to be endothermic and entropy driven. All these results are in good agreement with in silico investigation that suggest minor groove binding with effective intercalation at GC bases of actinomycin to 25RY. This study identifies hmgb1 gene promoter region a potential target for the anticancer therapautiucs. PMID:26923673

  12. Formation of Ice-Rich Lobate Debris Aprons Through Regional Icesheet Collapse and Debris-Cover Armoring

    NASA Astrophysics Data System (ADS)

    Fastook, J. L.; Head, J. W.; Marchant, D. R.

    2011-03-01

    We use a flowband model to assess development of lobate debris apron sublimation lag thickness and lateral extent beneath scarps. We obtain estimates of the climate in place as the LDAs were forming during collapse of a larger, regional ice sheet.

  13. Distribution of sup 3 H-proline within transseptal fibers of the rat following release of orthodontic forces

    SciTech Connect

    Row, K.L.; Johnson, R.B. )

    1990-10-01

    Maxillary right first molar teeth of rats were tipped mesially with an orthodontic appliance for 2 weeks (experimental group), {sup 3}H-proline was injected, and orthodontic forces were removed 6 hr later (time 0). The contralateral molar teeth of treated (internal control group) and age- and weight-matched untreated animals (external control group) were also studied. Diastemata were created between the molar teeth by the orthodontic appliance, and transseptal fibers between first and second (P less than 0.001) and second and third molars (P less than 0.005) were significantly lengthened as compared to external and internal controls at time 0. Diastemata between molar teeth were closed 5 days after removal of orthodontic force. Transseptal fibers adjacent to the source of the orthodontic force (mesial region) had the highest mean number of {sup 3}H-proline-labeled proteins at time 0 and at all times following removal of the force (P less than 0.001), and had the highest rate of labeled protein removal (P less than 0.001). Half-lives for removal of 3H-proline-labeled transseptal fiber proteins were significantly greater in mesial and distal regions and significantly less in middle regions of experimentals than in corresponding regions of external controls (P less than 0.001).

  14. STRUCTURE AND KINETICS OF MONOFUNCTIONAL PROLINE DEHYDROGENASE FROM THERMUS THERMOPHILUS

    PubMed Central

    White, Tommi A.; Krishnan, Navasona; Becker, Donald F.; Tanner, John J.

    2009-01-01

    Proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate dehydrogenase (P5CDH) catalyze the two-step oxidation of proline to glutamate. They are distinct monofunctional enzymes in all eukaryotes and some bacteria, but are fused into bifunctional enzymes known as Proline utilization A (PutA) in other bacteria. Here we report the first structure and biochemical data for a monofunctional PRODH. The 2.0 Å resolution structure of Thermus thermophilus PRODH reveals a distorted (βα)8 barrel catalytic core domain and a hydrophobic α-helical domain located above the carboxyl terminal ends of the strands of the barrel. Although the catalytic core is similar to that of the PutA PRODH domain, the FAD conformation of T. thermophilus PRODH is remarkably different and likely reflects unique requirements for membrane association and communication with P5CDH. Also, the FAD of T. thermophilus PRODH is highly solvent exposed compared to PutA due to a 4-Å shift of helix 8. Structure-based sequence analysis of the PutA/PRODH family led us to identify 9 conserved motifs involved in cofactor and substrate recognition. Biochemical studies show that the midpoint potential of the FAD is −75 mV and the kinetic parameters for proline are Km=27 mM and kcat=13 s−1. 3,4-dehydro-L-proline was found to be an efficient substrate and L-tetrahydro-2-furoic acid is a competitive inhibitor (KI=1.0 mM). Finally, we demonstrate that T. thermophilus PRODH reacts with O2 producing superoxide. This is significant because superoxide production underlies the role of human PRODH in p53-mediated apoptosis, implying commonalities between eukaryotic and bacterial monofunctional PRODHs. PMID:17344208

  15. The Sodium/Proline Transporter PutP of Helicobacter pylori

    PubMed Central

    Rivera-Ordaz, Araceli; Bracher, Susanne; Sarrach, Sannia; Li, Zheng; Shi, Lei; Quick, Matthias; Hilger, Daniel; Haas, Rainer; Jung, Heinrich

    2013-01-01

    Helicobacter pylori is cause of chronic gastritis, duodenal ulcer and gastric carcinoma in humans. L-proline is a preferred energy source of the microaerophilic bacterium. Previous analyses revealed that HpputP and HpputA, the genes that are predicted to play a central role in proline metabolism as they encode for the proline transporter and proline dehydrogenase, respectively, are essential for stomach colonization. Here, the molecular basis of proline transport in H. pylori by HpPutP was investigated experimentally for the first time. Measuring radiolabeled substrate transport in H. pylori and E. coli heterologously expressing HpputP as well as in proteoliposomes reconstituted with HpPutP, we demonstrate that the observed proline transport in H. pylori is mediated by HpPutP. HpPutP is specific and exhibits a high affinity for L-proline. Notably, L-proline transport is exclusively dependent on Na+ as coupling ion, i.e., Na+/L-proline symport, reminiscent to the properties of PutP of E. coli even though H. pylori lives in a more acidic environment. Homology model-based structural comparisons and substitution analyses identified amino acids crucial for function. HpPutP-catalyzed proline uptake was efficiently inhibited by the known proline analogs 3,4-dehydro-D,L-proline and L-azetidine-2-carboxylic acid. PMID:24358297

  16. Modeling Complex Groundwater Systems at a Regional Scale: from a "Data-poor" Paradigm to a "Data-rich" Paradigm

    NASA Astrophysics Data System (ADS)

    Li, S.; Liao, H.

    2008-05-01

    Data limitation is probably the most significant challenge in groundwater modeling, especially at a regional scale. In this paper, we explore the use of recently-assembled statewide groundwater databases by the Michigan Department of Environmental Quality for the purpose of groundwater modeling. The databases contain virtually all data needed for typical regional scale flow simulations. In particular, the databases provide data needed for defining physical/hydraulic model boundaries (e.g., watershed delineations, streams, lakes, static water levels, land systems, DEM, lithologies), aquifer elevations (e.g., DEMs, lithologies), aquifer properties (e.g., specific capacities, aquifer test data, lithologies), aquifer stresses (e.g., rainfall, estimated recharge, streams, lakes, wetlands, drains, and water wells). The databases also provide information that can be used to define existing and potential contamination sources (e.g., industrial sites, landfills, underground storage tanks) and data needed for regional scale model calibration (e.g., static water levels, aquifer tests, stream flows, estimated baseflows). One major advantage of these data lies in that they are of a high resolution and available for "free" virtually in any geographic areas in Michigan. The data on aquifer properties, static water levels, and lithologies are particularly detailed and accumulate over time. The databases are seamlessly integrated with the GIS-enabled, hierarchical Interactive Ground Water modeling software system and necessary modeling data can be extracted and processed through built-in statistical and geostatistical filters and utility tools. Here we introduce the GIS-enabled Michigan Groundwater modeling system, with emphasis on its statistical data analysis and iterative hierarchical downscaling and upscaling capabilities, and evaluate systematically the effectiveness of the new statewide groundwater databases for regional-scale groundwater modeling.

  17. γ-(S)-Trifluoromethyl proline: evaluation as a structural substitute of proline for solid state (19)F-NMR peptide studies.

    PubMed

    Kubyshkin, Vladimir; Afonin, Sergii; Kara, Sezgin; Budisa, Nediljko; Mykhailiuk, Pavel K; Ulrich, Anne S

    2015-03-21

    γ-(4S)-Trifluoromethyl proline was synthesised according to a modified literature protocol with improved yield on a multigram scale. Conformational properties of the amide bond formed by the amino acid were characterised using N-acetyl methyl ester model. The amide populations (s-trans vs. s-cis) and thermodynamic parameters of the isomerization were found to be similar to the corresponding values for intact proline. Therefore, the γ-trifluoromethyl proline was suggested as a structurally low-disturbing proline substitution in peptides for their structural studies by (19)F-NMR. Indeed, the exchange of native proline for γ-trifluoromethyl proline in the peptide antibiotic gramicidin S was shown to preserve the overall amphipathic peptide structure. The utility of the amino acid as a selective (19)F-NMR label was demonstrated by observing the re-alignment of the labelled gramicidin S in oriented lipid bilayers. PMID:25703116

  18. Modeling Complex Groundwater Systems at a Regional Scale: From a "Data-poor" Paradigm to a "Data-rich" Paradigm

    NASA Astrophysics Data System (ADS)

    Oztan, M.; Abbas, H.; Li, S.

    2006-12-01

    Data limitation is probably the most significant challenge in groundwater modeling, especially at regional scale. In this paper, we explore the use of a recently-assembled statewide groundwater database by Michigan Department of Environmental Quality for the purpose of groundwater modeling. The database contains virtually all data needed for typical regional scale flow simulations. In particular, the database provides data needed for defining model domain (e.g., watershed delineations, DEM, lithologies), aquifer framework (e.g., DEM, lithologies), aquifer properties (e.g., specific capacities, lithologies), aquifer stresses (e.g., recharge, streams, lakes, wetlands, drains, and wells). The database also provides information that can be used to define existing and potential contamination sources (e.g., industrial sites, landfills, underground storage tanks) and data needed for regional scale model calibration (e.g., water levels and baseflows). The advantage of these data lies in that they are of high resolution and available now for "free" virtually in any geographic areas in Michigan. The data on aquifer properties, water levels, and lithologies are currently available at more than 300,000 well locations across the state, with a particularly good resolution in areas where there are more groundwater problems. The database is seamlessly integrated with the GIS-enabled Interactive Groundwater (IGW) modeling software. The disadvantage lies in that some of these data are of lower quality than traditional measured data and in some cases they are indirectly derived. In this paper, we evaluate systematically how effective this type of data is for groundwater modeling and at what scale it is effective. We demonstrate this through a systematic comparative modeling exercise at a well-characterized watershed where there exists significant amount of traditional monitoring data.

  19. Evaluation of immediately loaded dental implants bioactivated with platelet-rich plasma placed in the mandibular posterior region: A clinico-radiographic study

    PubMed Central

    Anand, Ullas; Mehta, D. S.

    2012-01-01

    Background and Objectives: The purpose of the present study was to clinically and radiographically assess the soft and hard tissue changes around the immediately loaded single tooth implants bioactivated with platelet-rich plasma (PRP), placed in the mandibular posterior region. Materials and Methods: A total of 11 patients having single tooth edentulous space in the mandibular posterior region were selected. An endosseous implant was placed after clinical and radiographic examination in each selected site using single stage surgical approach. The patients were followed up at 3, 6, 9, and at 12 months of post implant insertion. The patients were subjected to recording of clinical parameters like modified plaque index, modified gingival index, probing depth, and clinical implant mobility scale. Radiographs made at different intervals were subjected to assessment of bone level mesial and distal to each implant using computer assisted image analysis. Results: Scores for clinical parameters were minimal and comparable. The probing depth around the implant was measured during the follow-up period and the changes observed were statistically non-significant. None of the implants were clinically mobile during the follow-up period. Radiographically, the peri-implant bone resorption both on mesial and distal sides was within normal limit after one year of immediate loading. Finally, the overall success rate for the immediately loaded bioactivated implant placed in the mandibular posterior region was recorded as 100%. Interpretation and Conclusion: The use of platelet-rich plasma may lead to improved early bone apposition around the implant; and thus, results in increased rate of osseointegration. Single stage implant procedure with the adjunctive use of PRP enhances the ability of peri-implant healing tissue to create favorable soft and hard tissue relationships. It also gives the added advantage of psychological boost for the patient by getting fixed replacement of tooth

  20. Involvement of the β3-α3 loop of the Proline Dehydrogenase Domain in Allosteric Regulation of Membrane Association of Proline Utilization A†,‡

    PubMed Central

    Zhu, Weidong; Haile, Ashley M.; Singh, Ranjan K.; Larson, John D.; Smithen, Danielle; Chan, Jie Y.; Tanner, John J.; Becker, Donald F.

    2013-01-01

    Proline utilization A (PutA) from Escherichia coli is a membrane-associated trifunctional flavoenzyme that catalyzes the oxidation of proline to glutamate and moonlights as a transcriptional regulator. As a regulatory protein, PutA represses transcription of the put regulon, which contains the genes encoding PutA and the proline transporter PutP. The binding of proline to the proline dehydrogenase active site and the subsequent reduction of the flavin induces high affinity membrane association of PutA and relieves repression of the put regulon, thereby causing PutA to switch from its regulatory to its enzymatic role. Here, we present evidence suggesting that residues of the β3-α3 loop of the proline dehydrogenase domain (βα)8 barrel are involved in proline-mediated allosteric regulation of PutA-membrane binding. Mutation of the conserved residues Asp370 and Glu372 in the β3-α3 loop abrogates the ability of proline to induce functional membrane association. Both in vitro lipid/membrane binding assays and in vivo cell-based assays demonstrate that mutagenesis of Asp370 (D370N/A) or Glu372 (E372A) dramatically impedes PutA functional switching. The crystal structures of the proline dehydrogenase domain mutants PutA86-630D370N and PutA86-630D370A complexed with the proline analog L-tetrahydro-2-furoic acid show that the mutations cause only minor perturbations to the active site but no major structural changes, suggesting that the lack of proline response is not due to a failure of the mutated active sites to correctly bind the substrate. Rather, these results suggest that the β3-α3 loop may be involved in transmitting the status of the proline dehydrogenase active site and flavin redox state to the distal membrane association domain. PMID:23713611

  1. The lipid-rich core region of human atherosclerotic fibrous plaques. Prevalence of small lipid droplets and vesicles by electron microscopy.

    PubMed Central

    Guyton, J. R.; Klemp, K. F.

    1989-01-01

    Abundant extracellular lipid deposits are associated with cell necrosis and tissue weakening in the core region of human atherosclerotic fibrous plaques. The ultrastructural morphology of the core region, previously undefined because of lipid extraction artifacts, was studied with the aid of new osmium-thiocarbohydrazide-osmium and osmium-tannic acid-paraphenylenediamine sequences for tissue processing. Small droplets of neutral lipid (30 to 400 nm profile diameter) and lipid vesicles with aqueous centers accounted for more than 90% of the area occupied by lipid-rich structures in the core region. No foam cells were present. Cholesterol crystals, lipid droplets of a size similar to those in foam cells (0.4 to 6 mu), and larger neutral lipid deposits (greater than 6 mu) together occupied less than 10% of the total area of lipid structures. Abundant lipid vesicles were associated with the nearby presence of cholesterol crystals, whereas small lipid droplets were predominant in areas without crystals. Many droplets had surface defects in the form of pits and vesicular blebs. These morphologic findings are explained most concisely by postulating direct accumulation of extracellular lipid from interstitial lipoproteins as a major process in core region formation. Moreover, a dynamic state of ongoing physical/metabolic transformation of extracellular lipid deposits is suggested. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 7 Figure 8 Figure 9 PMID:2646938

  2. Identification and high-density mapping of gene-rich regions in chromosome group 1 of wheat.

    PubMed

    Gill, K S; Gill, B S; Endo, T R; Taylor, T

    1996-12-01

    We studied the distribution of genes and recombination in wheat (Triticum aestivum) group 1 chromosomes by comparing high-density physical and genetic maps. Physical maps of chromosomes 1A, 1B, and 1D were generated by mapping 50 DNA markers on 56 single-break deletion lines. A consensus physical map was compared with the 1D genetic map of Triticum tauschii (68 markers) and a Triticeae group 1 consensus map (288 markers) to generate a cytogenetic ladder map (CLM). Most group 1 markers (86%) were present in five clusters that encompassed only 10% of the group 1 chromosome. This distribution may reflect that of genes because more than half of the probes were cDNA clones and 30% were PstI genomic. All 14 agronomically important genes in group 1 chromosomes were present in these clusters. Most recombination occurred in gene-cluster regions. Markers fell at an average distance of 244 kb in these regions. The CLM involving the Triticeae consensus genetic map revealed that the above distribution of genes and recombination is the same in other Triticeae species. Because of a significant number of common markers, our CLM can be used for comparative mapping and to estimate physical distances among markers in many Poaceae species including rice and maize. PMID:8978071

  3. Evaluation of Z-(R,R)-IQNP for the potential imaging of m2 mAChR rich regions of the brain and heart.

    PubMed

    McPherson, D W; Greenbaum, M; Luo, H; Beets, A L; Knapp, F F

    2000-01-01

    Alterations in the function or density of the m2 muscarinic (mAChR) subtype have been postulated to play an important role in various dementias such as Alzheimer's disease. The ability to image and quantify the m2 mAChR subtype is of importance for a better understanding of the m2 subtype function in various dementias. Z-(R)-1-Azabicyclo[2.2.2]oct-3-y (R)-alpha-hydroxy-alpha-(1-iodo-1-propen-3-yl)-alpha-phenylacetate (Z-(R,R)-IQNP) has demonstrated significant uptake in cerebral regions that contain a high concentration of m2 mAChR subtype in addition to heart tissue. The present study was undertaken to determine if the uptake of Z-(R,R)-IQNP in these regions is a receptor mediated process and to identify the radiospecies responsible for binding at the receptor site. A blocking study demonstrated cerebral and cardiac levels of activity were significantly reduced by pretreatment (2-3 mg/kg) of (R)-3-quinuclidinyl benzilate, dexetimide and scopolamine, established muscarinic antagonists. A direct comparison of the cerebral and cardiac uptake of [I-125]-Z-(R,R)-IQNP and [I-131]-E-(R,R)-IQNP (high uptake in ml, m4 rich mAChR cerebral regions) demonstrated Z-(R,R)-IQNP localized to a higher degree in cerebral and cardiac regions containing a high concentration of the m2 mAChR subtype as directly compared to E-(R,R)-IQNP. In addition, a study utilizing [I-123]-Z-(R,R)-IQNP, [I-131]-iododexetimide and [I-125]-R-3-quinuclidinyl S-4-iodobenzilate, Z-(R,R)-IQNP demonstrated significantly higher uptake and longer residence time in those regions which contain a high concentration of the m2 receptor subtype. Folch extraction of global brain and heart tissue at various times post injection of [I-125]-Z-(R,R)-IQNP demonstrated that approximately 80% of the activity was extracted in the lipid soluble fraction and identified as the parent ligand by TLC and HPLC analysis. These results demonstrate Z-(R,R)-IQNP has significant uptake, long residence time and high stability in

  4. Deconvolution of mixtures with high plagioclase content for the remote interpretation of lunar plagioclase-rich regions

    NASA Astrophysics Data System (ADS)

    Serventi, Giovanna; Carli, Cristian; Sgavetti, Maria

    2016-07-01

    Anorthositic rocks are widespread on the lunar surface and have probably been formed by flotation of PL over a magma ocean. A large portion of pristine rocks are characterized by a low Mg/(Mg+Fe) ratio, and have been classified as ferroan anorthosite, and recently, after observation from SELENE Spectral Profiler,pure anorthosites regions with more than 98% PL have been recognized. In this paper, we analyze a set of mixtures with PL content similar to the ferroan anorthosites and to the pure anorthosite regions, using the Origin Software and the Modified Gaussian Model. We consider three plagioclases with varying FeOwt% contents (PL1, PL2 and PL3)andthree mafic end-members (1) 100% orthopyroxene, (2) 56% orthopyroxene and 44% clinopyroxene, and (3) 100% olivine (OL). The spectral parameters considered here are: band depth, band center, band width, c0 (the continuum intercept) and c1 (the continuum offset). Here we have shown that in pyroxene (PX)-bearing mixtures, the PX is distinguishable even in mixtures with only 1% PX and that PX band at ca. 900 nm is always deeper than PL1 band while PL2 and PL3 are deeperthan OPX 900 nm band from 95, 96% PL. In OL-bearing mixtures, OL detection limit is 2% when mixed with PL1, and 3% and 4% if mixed with PL2 and PL3. We also demonstrated how spectral parameters vary with PL%, and, generally, increasing the PL content: (1) 1250 nm band depth decreases when mixed with OL, while it deepens in mixtures with PX; (2) 1250 nm band centers generally move towards longer wavelength for PL1-bearing mixtures, while do not show significant variations considering PL2/PL3-mixtures; (3) 1250 nm band width of PL1 in E1 and E5-mixtures substantially widens while in other mixtures it only slightly varies. Here we also proposed an application to a real case, from Proclus crater, revealing how studying terrestrial analogues is fundamental to infer hypothesis on the mineralogical composition of a planetary surface, but also how the spectral

  5. High-throughput engineering of a mammalian genome reveals building principles of methylation states at CG rich regions

    PubMed Central

    Krebs, Arnaud R; Dessus-Babus, Sophie; Burger, Lukas; Schübeler, Dirk

    2014-01-01

    The majority of mammalian promoters are CpG islands; regions of high CG density that require protection from DNA methylation to be functional. Importantly, how sequence architecture mediates this unmethylated state remains unclear. To address this question in a comprehensive manner, we developed a method to interrogate methylation states of hundreds of sequence variants inserted at the same genomic site in mouse embryonic stem cells. Using this assay, we were able to quantify the contribution of various sequence motifs towards the resulting DNA methylation state. Modeling of this comprehensive dataset revealed that CG density alone is a minor determinant of their unmethylated state. Instead, these data argue for a principal role for transcription factor binding sites, a prediction confirmed by testing synthetic mutant libraries. Taken together, these findings establish the hierarchy between the two cis-encoded mechanisms that define the DNA methylation state and thus the transcriptional competence of CpG islands. DOI: http://dx.doi.org/10.7554/eLife.04094.001 PMID:25259795

  6. Male-specific region of the bovine Y chromosome is gene rich with a high transcriptomic activity in testis development.

    PubMed

    Chang, Ti-Cheng; Yang, Yang; Retzel, Ernest F; Liu, Wan-Sheng

    2013-07-23

    The male-specific region of the mammalian Y chromosome (MSY) contains clusters of genes essential for male reproduction. The highly repetitive and degenerative nature of the Y chromosome impedes genomic and transcriptomic characterization. Although the Y chromosome sequence is available for the human, chimpanzee, and macaque, little is known about the annotation and transcriptome of nonprimate MSY. Here, we investigated the transcriptome of the MSY in cattle by direct testis cDNA selection and RNA-seq approaches. The bovine MSY differs radically from the primate Y chromosomes with respect to its structure, gene content, and density. Among the 28 protein-coding genes/families identified on the bovine MSY (12 single- and 16 multicopy genes), 16 are bovid specific. The 1,274 genes identified in this study made the bovine MSY gene density the highest in the genome; in comparison, primate MSYs have only 31-78 genes. Our results, along with the highly transcriptional activities observed from these Y-chromosome genes and 375 additional noncoding RNAs, challenge the widely accepted hypothesis that the MSY is gene poor and transcriptionally inert. The bovine MSY genes are predominantly expressed and are differentially regulated during the testicular development. Synonymous substitution rate analyses of the multicopy MSY genes indicated that two major periods of expansion occurred during the Miocene and Pliocene, contributing to the adaptive radiation of bovids. The massive amplification and vigorous transcription suggest that the MSY serves as a genomic niche regulating male reproduction during bovid expansion. PMID:23842086

  7. The TES Hematite-Rich Region in Sinus Meridiani: A Proposed Landing Site for the 2003 Rover

    NASA Technical Reports Server (NTRS)

    Christensen, Philip R.; Bandfield, Joshua; Hamilton, Victoria; Ruff, Steven; Morris, Richard; Lane, Melissa; Malin, Michael

    2001-01-01

    The Thermal Emission Spectrometer (TES) instrument on the Mars Global Surveyor (MGS) mission has identified an accumulation of crystalline hematite (alpha-Fe2O3) that covers an area with very sharp boundaries approximately 350 by 750 km in size centered near 2 S latitude between 0 and 8 W longitude (Sinus Meridiani). The depth and shape of the hematite fundamental bands in the TES spectra show that the hematite is relatively coarse grained (greater than 5-10 micrometers). The spectrally-derived areal abundance of hematite varies with particle size from approximately 10% for particles greater than 30 micrometers in diameter to 40-60% for unpacked 10 micrometer powders. The hematite in Sinus Meridiani is thus distinct from the fine-grained (diameter less than 5-10 micrometers), red, crystalline hematite considered, on the basis of visible and near-IR data, to be a minor spectral component in Martian bright regions. A global map of the hematite abundance has been constructed using TES data from the MGS mapping mission.

  8. Proline-Rich Peptide from the Coral Pathogen Vibrio shiloi That Inhibits Photosynthesis of Zooxanthellae

    PubMed Central

    Banin, Ehud; Khare, Sanjay K.; Naider, Fred; Rosenberg, Eugene

    2001-01-01

    The coral-bleaching bacterium Vibrio shiloi biosynthesizes and secretes an extracellular peptide, referred to as toxin P, which inhibits photosynthesis of coral symbiotic algae (zooxanthellae). Toxin P was produced during the stationary phase when the bacterium was grown on peptone or Casamino Acids media at 29°C. Glycerol inhibited the production of toxin P. Toxin P was purified to homogeneity, yielding the following 12-residue peptide: PYPVYAPPPVVP (molecular weight, 1,295.54). The structure of toxin P was confirmed by chemical synthesis. In the presence of 12.5 mM NH4Cl, pure natural or synthetic toxin P (10 μM) caused a 64% decrease in the photosynthetic quantum yield of zooxanthellae within 5 min. The inhibition was proportional to the toxin P concentration. Toxin P bound avidly to zooxanthellae, such that subsequent addition of NH4Cl resulted in rapid inhibition of photosynthesis. When zooxanthellae were incubated in the presence of NH4Cl and toxin P, there was a rapid decrease in the pH (pH 7.8 to 7.2) of the bulk liquid, suggesting that toxin P facilitates transport of NH3 into the cell. It is known that uptake of NH3 into cells can destroy the pH gradient and block photosynthesis. This mode of action of toxin P can help explain the mechanism of coral bleaching by V. shiloi. PMID:11282602

  9. WIYN Open Cluster Study. LXIII. Abundances in the Super-metal-rich Open Cluster NGC 6253 from Hydra Spectroscopy of the 7774 Å Oxygen Triplet Region

    NASA Astrophysics Data System (ADS)

    Maderak, Ryan M.; Deliyannis, Constantine P.; Anthony-Twarog, Barbara J.; Twarog, Bruce A.; Cummings, Jeffery D.; King, Jeremy R.; Steiman-Cameron, Thomas Y.

    2015-04-01

    We present a spectroscopic abundance analysis of the old, super-metal-rich open cluster NGC 6253, with emphasis on its O abundance. High-dispersion, 7774 Å O i triplet region spectra of 47 stars were obtained using Hydra II on the CTIO Blanco 4 m. Radial velocity analysis confirms 39 stars consistent with single star membership, primarily at the turnoff. Thirty-six of these are included in our abundance analysis. Our differential analysis relative to the Sun yields primarily scaled-solar values, with weighted cluster averages of [O/H] = +0.440 ± 0.020, [Fe/H] = +0.445 ± 0.014, [Al/H] = +0.487 ± 0.020, [Si/H] = +0.504 ± 0.018, and [Ni/H] = +0.702 ± 0.018 (where the errors are {{σ }μ }). We discuss possible origins for the three known super-metal-rich clusters based upon their abundance patterns, Galactic locations, and space motions. The abundance patterns of NGC 6253 are very similar to those of NGC 6791 and NGC 6583. With the possible exception of oxygen, the abundances of these clusters are all close to scaled-solar, and they are similar to patterns seen in metal-rich disk dwarfs and giants. However, they also seem to differ from those of metal-rich bulge stars. We demonstrate that NGC 6253 is unusually oxygen rich (in [O/H]) for its 3.3 Gyr age. While we find [O/Fe] to be scaled-solar for NGC 6253, the more recently reported values for NGC 6791 show a large variation, from values close to scaled-solar down to values at least a factor of two below scaled-solar. We discuss the possibility that the scaled-solar [O/Fe] abundances of NGC 6253 and NGC 6791 might reflect a flattening of the Galactic [O/Fe] versus [Fe/H] relationship. This possibility may be consistent with disk star abundance data, which show an apparent “floor” at [O/Fe] ˜ -0.1 for [Fe/H] \\gt 0, and with chemical evolution model results, which may predict such a flattening due to a decrease in supernova Fe yields at super-solar-metallicities. Orbit solutions for NGC 6791 allow that it

  10. The relationship of meteorological patterns with changes in floristic richness along a large elevational gradient in a seasonally dry region of southern Mexico

    NASA Astrophysics Data System (ADS)

    Salas-Morales, Silvia H.; Meave, Jorge A.; Trejo, Irma

    2015-12-01

    Globally, climate is a fundamental driver of plant species' geographical distributions, yet we still lack a good understanding of climatic variation on tropical mountains and its consequences for elevational floristic patterns. In a seasonally dry region of southern Mexico, we analysed meteorological patterns along a large elevational gradient (0-3670 m a.s.l.) and examined their relationship with changes in floristic richness. Meteorological patterns were characterised using two data sources. First, climatic information was extracted from cartography and records from a few existing meteorological stations. Additionally, air temperature and humidity were recorded hourly during 1 year with data loggers, at sites representing 200-m elevation increments. Floristic information was extracted from a database containing 10,124 records of plant collections, and organized in 200-m elevational belts. Climatic charts distinguished three climate types along the gradient, all with marked rainfall seasonality, but these bore little correspondence with the information obtained with the data loggers. Mean annual air temperature decreased with increasing elevation (lapse rate of 0.542 °C 100 m-1). Thermal oscillation was minimum around 1400 m and increased towards both extremes of the gradient. Relative humidity opposed this pattern, with maxima between 800 and 1800 m, decreasing towards the highest elevations. An analysis of temperature frequency distributions revealed meteorological features undetectable from the annual or monthly means of this variable; despite an overall gradual transition of the proportions of time recorded at different temperatures, some changes did not conform to this pattern. The first discontinuity occurred between 1000-1200 m, where dominant temperatures shifted abruptly; also noticeable was an abrupt increase of the proportion of time elapsed at 0.1-10 °C between 2400 and 2600 m. Air temperature appears to be the most influential climatic factor

  11. Dimers of π Protein Bind the A+T-Rich Region of the R6K γ Origin near the Leading-Strand Synthesis Start Sites: Regulatory Implications

    PubMed Central

    Krüger, Ricardo; Filutowicz, Marcin

    2000-01-01

    The replication of γ origin, a minimal replicon derived from plasmid R6K, is controlled by the Rep protein π. At low intracellular concentrations, π activates the γ origin, while it inhibits replication at elevated concentrations. Additionally, π acts as a transcription factor (auto)repressing its own synthesis. These varied regulatory functions depend on π binding to reiterated DNA sequences bearing a TGAGNG motif. However, π also binds to a “non-iteron” site (i.e., not TGAGNG) that resides in the A+T-rich region adjacent to the iterons. This positioning places the non-iteron site near the start sites for leading-strand synthesis that also occur in the A+T-rich region of γ origin. We have hypothesized that origin activation (at low π levels) would require the binding of π monomers to iterons, while the binding of π dimers to the non-iteron site (at high π levels) would be required to inhibit priming. Although monomers as well as dimers can bind to an iteron, we demonstrate that only dimers bind to the non-iteron site. Two additional pieces of data support the hypothesis of negative replication control by π binding to the non-iteron site. First, π binds to the non-iteron site about eight times less well than it binds to a single iteron. Second, hyperactive variants of π protein (called copy-up) either do not bind to the non-iteron site or bind to it less well than wild-type π. We propose a replication control mechanism whereby π would directly inhibit primer formation. PMID:10762246

  12. The relationship of meteorological patterns with changes in floristic richness along a large elevational gradient in a seasonally dry region of southern Mexico.

    PubMed

    Salas-Morales, Silvia H; Meave, Jorge A; Trejo, Irma

    2015-12-01

    Globally, climate is a fundamental driver of plant species' geographical distributions, yet we still lack a good understanding of climatic variation on tropical mountains and its consequences for elevational floristic patterns. In a seasonally dry region of southern Mexico, we analysed meteorological patterns along a large elevational gradient (0-3670 m a.s.l.) and examined their relationship with changes in floristic richness. Meteorological patterns were characterised using two data sources. First, climatic information was extracted from cartography and records from a few existing meteorological stations. Additionally, air temperature and humidity were recorded hourly during 1 year with data loggers, at sites representing 200-m elevation increments. Floristic information was extracted from a database containing 10,124 records of plant collections, and organized in 200-m elevational belts. Climatic charts distinguished three climate types along the gradient, all with marked rainfall seasonality, but these bore little correspondence with the information obtained with the data loggers. Mean annual air temperature decreased with increasing elevation (lapse rate of 0.542 °C 100 m(-1)). Thermal oscillation was minimum around 1400 m and increased towards both extremes of the gradient. Relative humidity opposed this pattern, with maxima between 800 and 1800 m, decreasing towards the highest elevations. An analysis of temperature frequency distributions revealed meteorological features undetectable from the annual or monthly means of this variable; despite an overall gradual transition of the proportions of time recorded at different temperatures, some changes did not conform to this pattern. The first discontinuity occurred between 1000-1200 m, where dominant temperatures shifted abruptly; also noticeable was an abrupt increase of the proportion of time elapsed at 0.1-10 °C between 2400 and 2600 m. Air temperature appears to be the most influential climatic factor

  13. Mutagenic analysis of herpes simplex virus type 1 glycoprotein L reveals the importance of an arginine-rich region for function

    SciTech Connect

    Klyachkin, Yuri M.; Geraghty, Robert J.

    2008-04-25

    Herpes simplex virus type 1 (HSV-1) glycoproteins H and L (gH and gL) are required for virus-induced membrane fusion. Expression of gH at the virion or infected cell surface is mediated by the chaperone-like activity of gL. We have previously shown that a region between amino acids 155 and 161 is critical for gL chaperone-like activity. Here, we conducted Ala substitution mutagenesis of residues in this region and found that substitution of Cys160, Arg156, Arg158, or Arg156/158/159 with Ala resulted in a gL mutant that bound gH but displayed a reduced ability in gH trafficking and membrane fusion. Substitution of Arg156 with another positively charged amino acid, Lys, restored function. Substitution of Arg158 with Lys restored function in gH trafficking and cell fusion but not virus entry. These results indicate that an arginine-rich region of gL is critical for function.

  14. Cellular model of TAR DNA-binding protein 43 (TDP-43) aggregation based on its C-terminal Gln/Asn-rich region.

    PubMed

    Budini, Mauricio; Buratti, Emanuele; Stuani, Cristiana; Guarnaccia, Corrado; Romano, Valentina; De Conti, Laura; Baralle, Francisco E

    2012-03-01

    TDP-43 is one of the major components of the neuronal and glial inclusions observed in several neurodegenerative diseases such as amyotrophic lateral sclerosis and frontotemporal lobar degeneration. These characteristic aggregates are a "landmark" of the disease, but their role in the pathogenesis is still obscure. In previous works, we have shown that the C-terminal Gln/Asn-rich region (residues 321-366) of TDP-43 is involved in the interaction of this protein with other members of the heterogeneous nuclear ribonucleoprotein protein family. Furthermore, we have shown that the interaction through this region is important for TDP-43 splicing inhibition of cystic fibrosis transmembrane regulator exon 9, and there were indications that it was involved in the aggregation process. Our experiments show that in cell lines and primary rat neuronal cultures, the introduction of tandem repeats carrying the 331-369-residue Gln/Asn region from TDP-43 can trigger the formation of phosphorylated and ubiquitinated aggregates that recapitulate many but not all the characteristics observed in patients. These results establish a much needed cell-based TDP-43 aggregation model useful to investigate the mechanisms involved in the formation of inclusions and the gain- and loss-of-function consequences of TDP-43 aggregation within cells. In addition, it will be a powerful tool to test novel therapeutic strategies/effectors aimed at preventing/reducing this phenomenon. PMID:22235134

  15. Capture and identification of proteins that bind to a GGA-rich sequence from the ERBB2 gene promoter region.

    PubMed

    Zhang, Tian; Zhang, Huiping; Wang, Yuexi; McGown, Linda B

    2012-10-01

    The ERBB2 gene (HER2/neu) is overexpressed in many human breast cancers. It is an important therapeutic target and its product protein is a key biomarker for breast cancer. A 28-bp GGA repeat sequence (Pu28-mer) in the nuclease hypersensitive site of the ERBB2 promoter region may play an important role in the regulation of ERBB2 transcription, possibly involving the formation of a G-quadruplex. In order to investigate this possibility, an affinity MALDI-MS approach was used for in vitro protein capture from nuclear extracts from cultured MCF-7 and BT-474 cancer cells at Pu28-mer and control oligonucleotide-modified surfaces. Captured proteins from MCF-7 cells were analyzed by LC-MS/MS. Based on these results, Western blot was then used to interrogate captured proteins from both MCF-7 and the Her-2/neu-positive BT-474 cells. Results support the formation of a G-quadruplex by Pu28-mer, indicated by circular dichroism spectroscopy, that selectively captures transcription factors including Ku70, Ku80, PURA, nucleolin, and hnRNP K. Chromatin immunoprecipitation confirmed binding of Ku70, Ku80, PURA, and nucleolin to ERBB2 promoter in the live BT-474 cells. These findings may lead to a better understanding of the role of non-duplex DNA structures in gene regulation and provide a more complete picture of the regulation of ErbB2 expression in breast cancer. The results also provide a blueprint for development of "genome-inspired" aptamers based on the Pu28-mer sequence for in vitro and in vivo detection of proteins related to regulation of ERBB2 gene expression and breast cancer. PMID:22899247

  16. Oxidation of the cysteine-rich regions of parkin perturbs its E3 ligase activity and contributes to protein aggregation

    PubMed Central

    2011-01-01

    Background Accumulation of aberrant proteins to form Lewy bodies (LBs) is a hallmark of Parkinson's disease (PD). Ubiquitination-mediated degradation of aberrant, misfolded proteins is critical for maintaining normal cell function. Emerging evidence suggests that oxidative/nitrosative stress compromises the precisely-regulated network of ubiquitination in PD, particularly affecting parkin E3 ligase activity, and contributes to the accumulation of toxic proteins and neuronal cell death. Results To gain insight into the mechanism whereby cell stress alters parkin-mediated ubiquitination and LB formation, we investigated the effect of oxidative stress. We found significant increases in oxidation (sulfonation) and subsequent aggregation of parkin in SH-SY5Y cells exposed to the mitochondrial complex I inhibitor 1-methyl-4-phenlypyridinium (MPP+), representing an in vitro cell-based PD model. Exposure of these cells to direct oxidation via pathological doses of H2O2 induced a vicious cycle of increased followed by decreased parkin E3 ligase activity, similar to that previously reported following S-nitrosylation of parkin. Pre-incubation with catalase attenuated H2O2 accumulation, parkin sulfonation, and parkin aggregation. Mass spectrometry (MS) analysis revealed that H2O2 reacted with specific cysteine residues of parkin, resulting in sulfination/sulfonation in regions of the protein similar to those affected by parkin mutations in hereditary forms of PD. Immunohistochemistry or gel electrophoresis revealed an increase in aggregated parkin in rats and primates exposed to mitochondrial complex I inhibitors, as well as in postmortem human brain from patients with PD with LBs. Conclusion These findings show that oxidative stress alters parkin E3 ligase activity, leading to dysfunction of the ubiquitin-proteasome system and potentially contributing to LB formation. PMID:21595948

  17. Selenazolidine: a selenium containing proline surrogate in peptide science.

    PubMed

    Cordeau, E; Cantel, S; Gagne, D; Lebrun, A; Martinez, J; Subra, G; Enjalbal, C

    2016-09-14

    In the search for new peptide ligands containing selenium in their sequences, we investigated l-4-selenazolidine-carboxylic acid (selenazolidine, Sez) as a proline analog with the chalcogen atom in the γ-position of the ring. In contrast to proteinogenic selenocysteine (Sec) and selenomethionine (SeMet), the incorporation within a peptide sequence of such a non-natural amino acid has never been studied. There is thus a great interest in increasing the possibility of selenium insertion within peptides, especially for sequences that do not possess a sulfur containing amino acid (Cys or Met), by offering other selenated residues suitable for peptide synthesis protocols. Herein, we have evaluated selenazolidine in Boc/Bzl and Fmoc/tBu strategies through the synthesis of a model tripeptide, both in solution and on a solid support. Special attention was paid to the stability of the Sez residue in basic conditions. Thus, generic protocols have been optimized to synthesize Sez-containing peptides, through the use of an Fmoc-Xxx-Sez-OH dipeptide unit. As an example, a new analog of the vasopressin receptor-1A antagonist was prepared, in which Pro was replaced with Sez [3-(4-hydroxyphenyl)-propionyl-d-Tyr(Me)-Phe-Gln-Asn-Arg-Sez-Arg-NH2]. Both proline and such pseudo-proline containing peptides exhibited similar pharmacological properties and endopeptidase stabilities indicating that the presence of the selenium atom has minimal functional effects. Taking into account the straightforward handling of Sez as a dipeptide building block in a conventional Fmoc/tBu SPPS strategy, this result suggested a wide range of potential uses of the Sez amino acid in peptide chemistry, for instance as a viable proline surrogate as well as a selenium probe, complementary to Sec and SeMet, for NMR and mass spectrometry analytical purposes. PMID:27506250

  18. Cyclophilin A catalyzes proline isomerization by an electrostatic handle mechanism

    SciTech Connect

    Camilloni, Carlo; Sahakyan, Aleksander B.; Holliday, Michael; Isern, Nancy G.; Zhang, Fengli; Eisenmesser, Elan Z.; Vendruscolo, Michele

    2014-07-15

    Proline isomerization is a ubiquitous process that plays a key role in the folding of proteins and in the regulation of their functions1-3. Different families of enzymes, known as peptidyl-prolyl isomerases (PPIases), catalyse this reaction, which involves the interconversion between the cis and trans isomers of the Nterminal amide bond of the amino acid proline2,3. A complete description of the mechanisms by which these enzymes function, however, has remained elusive. Here, we show that cyclophilin A, one of the most common PPIases4, provides a catalytic environment that acts on the substrate through an electrostatic lever mechanism. In this mechanism, the electrostatic field in the catalytic site turns the electric dipole associated with the carboxylic group of the amino acid preceding the proline in the substrate, thus causing the rotation of the peptide bond between the two residues. This mechanism resulted from the analysis of an ensemble of conformations populated by cyclophilin A during the enzymatic reaction using a combination of NMR measurements, molecular dynamics simulations and density functional theory calculations. We anticipate that this approach will be helpful in elucidating whether the electrostatic lever mechanism that we describe is common to other PPIases, and more generally to characterise other enzymatic processes.

  19. Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase

    SciTech Connect

    White, Tommi A.; Tanner, John J.

    2005-08-01

    Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ{sup 1}-pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.

  20. Determination of free D-proline and D-leucine in the brains of mutant mice lacking D-amino acid oxidase activity.

    PubMed

    Hamase, K; Inoue, T; Morikawa, A; Konno, R; Zaitsu, K

    2001-11-15

    A new procedure to accurately measure a trace amount of d-proline in biological samples has been developed. This D-amino acid was derivatized with 4-fluoro-7-nitro-2,1,3-benzoxadiazole and was determined by a column-switching HPLC system, a combination of a micro-ODS column and a chiral column. The detection limit for D-proline spiked in a mouse cerebrum sample is 1 fmol (injection amount, S/N = 3). Within-day precision and day-to-day precision obtained for spiked d-proline (10 fmol) are 2.14 and 5.35% (RSD), respectively. Using the new method, the amount of free D-proline in eight brain regions and sera of mutant ddY/DAO- mice, lacking D-amino acid oxidase activity, and control ddY/DAO+ mice was determined. The amount of free D-leucine was also investigated. The amount and distribution of D-proline in the brains of ddY/DAO+ mice and ddY/DAO- mice are almost the same, and relatively high amounts of D-proline have been observed in the pituitary gland and in the pineal gland. On the other hand, the amount of D-leucine is different between the two strains. In the brains of ddY/DAO+ mice, a relatively high amount of D-leucine has been observed in the pineal gland compared with other regions. In the brains of ddY/DAO- mice, D-leucine amounts are approximately 10 times higher than those obtained in ddY/DAO+ mice and regional difference has not been observed, while the amounts of L-proline and L-leucine are not significantly different between the two strains. In the serum, the amounts of both free D-proline and d-leucine are significantly higher in the ddY/DAO- mice than those obtained in ddY/DAO+ mice. PMID:11700980

  1. Vibrational spectroscopy of bacteriorhodopsin mutants: Evidence for the interaction of proline-186 with the retinylidene chromophore

    SciTech Connect

    Rothschild, K.J.; He, Y.W.; Mogi, T.; Marti, T.; Stern, L.J.; Khorana, H.G. )

    1990-06-26

    Fourier-transform infrared difference spectroscopy has been used to study the role of the three membrane-embedded proline residues, Pro-50, Pro-91, and Pro-186, in the structure and function of bacteriorhodopsin. All three prolines were replaced by alanine and glycine; in addition, Pro-186 was changed to valine. Difference spectra were recorded for the bR----K and bR----M photoreactions of each of these mutants and compared to those of wild-type bacteriorhodopsin. Only substitutions of Pro-186 caused significant perturbations in the frequency of the C = C and C - C stretching modes of the retinylidene chromophore. In addition, these substitutions reduced bands in the amide I and II region associated with secondary structural changes and altered signals assigned to the adjacent Tyr-185. Pro-186----Val caused the largest alterations, producing a second species similar to bR548 and nearly blocking chromophore isomerization at 78 K but not at 250 K. These results are consistent with a model of the retinal binding site in which Pro-186 and Tyr-185 are located in direct proximity to the chromophore and may be involved in linking chromophore isomerization to protein structural changes. Evidence is also found that Pro-50 may be structurally active during the bR----K transition and that substitution of this residue by glycine preserves the normal protein structural changes during the photocycle.

  2. Proline is required for male gametophyte development in Arabidopsis

    PubMed Central

    2012-01-01

    Background In crosses between the proline-deficient mutant homozygous for p5cs1 and heterozygous for p5cs2 (p5cs1 p5cs2/P5CS2), used as male, and different Arabidopsis mutants, used as females, the p5cs2 mutant allele was rarely transmitted to the outcrossed progeny, suggesting that the fertility of the male gametophyte carrying mutations in both P5CS1 and P5CS2 is severely compromised. Results To confirm the fertility defects of pollen from p5cs1 p5cs2/P5CS2 mutants, transmission of mutant alleles through pollen was tested in two ways. First, the number of progeny inheriting a dominant sulfadiazine resistance marker linked to p5cs2 was determined. Second, the number of p5cs2/p5cs2 embryos was determined. A ratio of resistant to susceptible plantlets close to 50%, and the absence of aborted embryos were consistent with the hypothesis that the male gametophyte carrying both p5cs1 and p5cs2 alleles is rarely transmitted to the offspring. In addition, in reciprocal crosses with wild type, about 50% of the p5cs2 mutant alleles were transmitted to the sporophytic generation when p5cs1 p5cs2/P5CS2 was used as a female, while less than 1% of the p5cs2 alleles could be transmitted to the outcrossed progeny when p5cs1 p5cs2/P5CS2 was used as a male. Morphological and functional analysis of mutant pollen revealed a population of small, degenerated, and unviable pollen grains, indicating that the mutant homozygous for p5cs1 and heterozygous for p5cs2 is impaired in pollen development, and suggesting a role for proline in male gametophyte development. Consistent with these findings, we found that pollen from p5cs1 homozygous mutants, display defects similar to, but less pronounced than pollen from p5cs1 p5cs2/P5CS2 mutants. Finally, we show that pollen from p5cs1 p5cs2/P5CS2 plants contains less proline than wild type and that exogenous proline supplied from the beginning of another development can partially complement both morphological and functional pollen defects

  3. Anti-tumour effects of antibodies targeting the extracellular cysteine-rich region of the receptor tyrosine kinase EphB4.

    PubMed

    Stephenson, Sally-Anne; Douglas, Evelyn L; Mertens-Walker, Inga; Lisle, Jessica E; Maharaj, Mohanan S N; Herington, Adrian C

    2015-04-10

    EphB4 is a membrane-bound receptor tyrosine kinase (RTK) commonly over-produced by many epithelial cancers but with low to no expression in most normal adult tissues. EphB4 over-production promotes ligand-independent signaling pathways that increase cancer cell viability and stimulate migration and invasion. Several studies have shown that normal ligand-dependent signaling is tumour suppressive and therefore novel therapeutics which block the tumour promoting ligand-independent signaling and/or stimulate tumour suppressive ligand-dependent signaling will find application in the treatment of cancer. An EphB4-specific polyclonal antibody, targeting a region of 200 amino acids in the extracellular portion of EphB4, showed potent in vitro anti-cancer effects measured by an increase in apoptosis and a decrease in anchorage independent growth. Peptide exclusion was used to identify the epitope targeted by this antibody within the cysteine-rich region of the EphB4 protein, a sequence defined as a potential ligand interacting interface. Addition of antibody to cancer cells resulted in phosphorylation and subsequent degradation of the EphB4 protein, suggesting a mechanism that is ligand mimetic and tumour suppressive. A monoclonal antibody which specifically targets this identified extracellular epitope of EphB4 significantly reduced breast cancer xenograft growth in vivo confirming that EphB4 is a useful target for ligand-mimicking antibody-based anti-cancer therapies. PMID:25831049

  4. Anti-tumour effects of antibodies targeting the extracellular cysteine-rich region of the receptor tyrosine kinase EphB4

    PubMed Central

    Stephenson, Sally-Anne; Douglas, Evelyn L.; Mertens-Walker, Inga; Lisle, Jessica E.; Maharaj, Mohanan S.N.; Herington, Adrian C.

    2015-01-01

    EphB4 is a membrane-bound receptor tyrosine kinase (RTK) commonly over-produced by many epithelial cancers but with low to no expression in most normal adult tissues. EphB4 over-production promotes ligand-independent signaling pathways that increase cancer cell viability and stimulate migration and invasion. Several studies have shown that normal ligand-dependent signaling is tumour suppressive and therefore novel therapeutics which block the tumour promoting ligand-independent signaling and/or stimulate tumour suppressive ligand-dependent signaling will find application in the treatment of cancer. An EphB4-specific polyclonal antibody, targeting a region of 200 amino acids in the extracellular portion of EphB4, showed potent in vitro anti-cancer effects measured by an increase in apoptosis and a decrease in anchorage independent growth. Peptide exclusion was used to identify the epitope targeted by this antibody within the cysteine-rich region of the EphB4 protein, a sequence defined as a potential ligand interacting interface. Addition of antibody to cancer cells resulted in phosphorylation and subsequent degradation of the EphB4 protein, suggesting a mechanism that is ligand mimetic and tumour suppressive. A monoclonal antibody which specifically targets this identified extracellular epitope of EphB4 significantly reduced breast cancer xenograft growth in vivo confirming that EphB4 is a useful target for ligand-mimicking antibody-based anti-cancer therapies. PMID:25831049

  5. Motifs within the CA-repeat-rich region of Surfactant Protein B (SFTPB) intron 4 differentially affect mRNA splicing

    PubMed Central

    Yang, Wenjun; Ni, Lan; Silveyra, Patricia; Wang, Guirong; Noutsios, Georgios T; Singh, Anamika; DiAngelo, Susan L; Sanusi, Olabisi; Raval, Manmeet; Floros, Joanna

    2013-01-01

    The first half of the surfactant protein B (SP-B) gene intron 4 is a CA-repeat-rich region that contains 11 motifs. To study the role of this region on SP-B mRNA splicing, minigenes were generated by systematic removal of motifs from either the 5′ or 3′ end. These were transfected in CHO cells to study their splicing efficiency. The latter was determined as the ratio of completely to incompletely spliced SP-B RNA. Our results indicate that SP-B intron 4 motifs differentially affect splicing. Motifs 8 and 9 significantly enhanced and reduced splicing of intron 4, respectively. RNA mobility shift assays performed with a Motif 8 sequence that contains a CAUC cis-element and cell extracts resulted in a RNA:protein shift that was lost upon mutation of the element. Furthermore, in silico analysis of mRNA secondary structure stability for minigenes with and without motif 8 indicated a correlation between mRNA stability and splicing ratio. We conclude that differential loss of specific intron 4 motifs results in one or more of the following: a) altered splicing, b) differences in RNA stability and c) changes in secondary structure. These, in turn, may affect SP-B content in lung health or disease. PMID:23687636

  6. The induction of free proline accumulation by endogenous ABA in Arabidopsis thaliana during drought

    SciTech Connect

    Gottlieb, M.L.; Bray, E.A. )

    1991-05-01

    Endogenous levels of abscisic acid (ABA) and free proline increase in response to drought stress. Exogenous ABA has been shown to induce proline accumulation, suggesting that ABA triggers the amino acid response. To determine if endogenous ABA induces free proline accumulation, increases in ABA and proline during drought stress were compared between wild type (WT), ABA-insensitive (abi) and ABA-deficient (aba) mutants of Arabidopsis thaliana. If elevated levels of endogenous ABA signal the proline response, then the mutants would not be expected to accumulate proline during stress. abi should be unable to respond to increased levels of endogenous ABA, while aba should be unable to accumulate sufficient ABA to elicit a proline response. Drought-stressed three week old shoots of WT, abi, and aba exhibited different patterns of endogenous ABA accumulation, but similar patterns of proline accumulation over 24 hours. Although the patterns of endogenous ABA accumulation differed, maximum levels were similar in WT and abi, but aba produced approximately 25% less. However, free proline accumulated in all three plant lines. abi exhibited a greater, more rapid increase in free proline over that in either WT or aba. aba, however, showed the same pattern and levels of accumulation as that in WT. Since free proline accumulated to at least similar levels in both WT and mutants, regardless of the levels of ABA accumulation, it may be that only a small endogenous ABA accumulation is required for proline accumulation. Alternatively, endogenous ABA may not be the direct signal for the proline response during drought stress.

  7. Hydrogen rich gas generator

    NASA Technical Reports Server (NTRS)

    Houseman, J.; Rupe, J. H.; Kushida, R. O. (Inventor)

    1976-01-01

    A process and apparatus is described for producing a hydrogen rich gas by injecting air and hydrocarbon fuel at one end of a cylindrically shaped chamber to form a mixture and igniting the mixture to provide hot combustion gases by partial oxidation of the hydrocarbon fuel. The combustion gases move away from the ignition region to another region where water is injected to be turned into steam by the hot combustion gases. The steam which is formed mixes with the hot gases to yield a uniform hot gas whereby a steam reforming reaction with the hydrocarbon fuel takes place to produce a hydrogen rich gas.

  8. Proline accumulation and metabolism-related genes expression profiles in Kosteletzkya virginica seedlings under salt stress

    PubMed Central

    Wang, Hongyan; Tang, Xiaoli; Wang, Honglei; Shao, Hong-Bo

    2015-01-01

    Proline accumulation is a common response to salt stress in many plants. Salt stress also increased proline concentration in roots, stems, and leaves of Kosteletzkya virginica seedling treated with 300 mM NaCl for 24 h and reached 3.75-, 4.76-, and 6.83-fold higher than controls. Further study on proline content in leaves under salt stress showed that proline content increased with increasing NaCl concentrations or time. The proline level peaked at 300 mM NaCl for 24 h and reached more than sixfold higher than control, but at 400 mM NaCl for 24 h proline content fell back slightly along with wilting symptom. To explore the cause behind proline accumulation, we first cloned full length genes related to proline metabolism including KvP5CS1, KvOAT, KvPDH, and KvProT from K. virginica and investigated their expression profiles. The results revealed that the expressions of KvP5CS1 and KvProT were sharply up-regulated by salt stress and the expression of KvOAT showed a slight increase with increasing salt concentrations or time, while the expression of KvPDH was not changed much and slightly decreased before 12 h and then returned to the original level. As the key enzyme genes for proline biosynthesis, the up-regulated expression of KvP5CS1 played a more important role than KvOAT for proline accumulation in leaves under salt stress. The low expression of KvPDH for proline catabolism also made a contribution to proline accumulation before 12 h. PMID:26483809

  9. First Evidence for Substrate Channeling between Proline Catabolic Enzymes

    PubMed Central

    Sanyal, Nikhilesh; Arentson, Benjamin W.; Luo, Min; Tanner, John J.; Becker, Donald F.

    2015-01-01

    Proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase (P5CDH) catalyze the four-electron oxidation of proline to glutamate via the intermediates P5C and l-glutamate-γ-semialdehyde (GSA). In Gram-negative bacteria, PRODH and P5CDH are fused together in the bifunctional enzyme proline utilization A (PutA) whereas in other organisms PRODH and P5CDH are expressed as separate monofunctional enzymes. Substrate channeling has previously been shown for bifunctional PutAs, but whether the monofunctional enzymes utilize an analogous channeling mechanism has not been examined. Here, we report the first evidence of substrate channeling in a PRODH-P5CDH two-enzyme pair. Kinetic data for the coupled reaction of PRODH and P5CDH from Thermus thermophilus are consistent with a substrate channeling mechanism, as the approach to steady-state formation of NADH does not fit a non-channeling two-enzyme model. Furthermore, inactive P5CDH and PRODH mutants inhibit NADH production and increase trapping of the P5C intermediate in coupled assays of wild-type PRODH-P5CDH enzyme pairs, indicating that the mutants disrupt PRODH-P5CDH channeling interactions. A dissociation constant of 3 μm was estimated for a putative PRODH-P5CDH complex by surface plasmon resonance (SPR). Interestingly, P5CDH binding to PRODH was only observed when PRODH was immobilized with the top face of its (βα)8 barrel exposed. Using the known x-ray crystal structures of PRODH and P5CDH from T. thermophilus, a model was built for a proposed PRODH-P5CDH enzyme channeling complex. The structural model predicts that the core channeling pathway of bifunctional PutA enzymes is conserved in monofunctional PRODH-P5CDH enzyme pairs. PMID:25492892

  10. Steady-State Kinetic Mechanism of the Proline:Ubiquinone Oxidoreductase Activity of Proline Utilization A (PutA) from Escherichia coli

    PubMed Central

    Moxley, Michael A.; Tanner, John J.; Becker, Donald F.

    2011-01-01

    The multifunctional proline utilization A (PutA) flavoenzyme from Escherichia coli performs the oxidation of proline to glutamate in two catalytic steps using separate proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase domains. In the first reaction, the oxidation of proline is coupled to the reduction of ubiquinone (CoQ) by the PRODH domain, which has a β8α8-barrel structure that is conserved in bacterial and eukaryotic PRODH enzymes. The structural requirements of the benzoquinone moiety were examined by steady-state kinetics using CoQ analogs. PutA displayed activity with all the analogs tested; the highest kcat/Km was obtained with CoQ2. The kinetic mechanism of the PRODH reaction was investigated use a variety of steady-state approaches. Initial velocity patterns measured using proline and CoQ1, combined with dead-end and product inhibition studies, suggested a two-site ping-pong mechanism for PutA. The kinetic parameters for PutA were not strongly influenced by solvent viscosity suggesting that diffusive steps do not significantly limit the overall reaction rate. In summary, the kinetic data reported here, along with analysis of the crystal structure data for the PRODH domain, suggest that the proline:ubiquinone oxidoreductase reaction of PutA occurs via a rapid equilibrium ping-pong mechanism with proline and ubiquinone binding at two distinct sites. PMID:22040654

  11. High Pressure Cosmochemistry of Major Planetary Interiors: Laboratory Studies of the Water-rich Region of the System Ammonia-water

    NASA Technical Reports Server (NTRS)

    Nicol, M.; Johnson, M.; Koumvakalis, A. S.

    1985-01-01

    The behavior of gas-ice mixtures in major planets at very high pressures was studied. Some relevant pressure-temperature-composition (P-T-X) regions of the hydrogen (H2)-helium (He)-water (H2O-ammonia (NH3)-methane (CH4) phase diagram were determined. The studies, and theoretical model, of the relevant phases, are needed to interpret the compositions of ice-gas systems at conditions of planetary interest. The compositions and structures of a multiphase, multicomponent system at very high pressures care characterized, and the goal is to characterize this system over a wide range of low and high temperatures. The NH3-H2O compositions that are relevant to planetary problems yet are easy to prepare were applied. The P-T surface of water was examined and the corresponding surface for NH3 was determined. The T-X diagram of ammonia-water at atmospheric pressure was studied and two water-rich phases were found, NH3-2H2O (ammonia dihydrate), which melts incongruently, and NH3.H2O (ammonia monohydrate), which is nonstoichiometric and melts at a higher temperature than the dihydrate. It is suggested that a P-T surface at approximately the monohydrate composition and the P-X surface at room temperature is determined.

  12. Intercalation of 2-butyl-4-methylphenol to G-C rich region of DNA and the role of hydroxypropyl-β-cyclodextrin.

    PubMed

    Pan, Junhui; Wang, Langhong; Zhang, Guowen; Gong, Deming

    2015-10-01

    The characteristics of binding of 2-tert-butyl-4-methylphenol (TBMP), a synthetic phenolic antioxidant with hydroxypropyl-β-cyclodextrin (Hp-βCD) and calf thymus DNA (ctDNA) were investigated by multi-spectroscopic techniques and molecular simulation. The results indicated that TBMP preferred to form a 1:1 inclusion complex with Hp-βCD, with an inclusion constant of determined to be 7.15 × 10(3) L mol(-1). The intercalative mode of TBMP to ctDNA was supported by ctDNA melting temperature and relative viscosity studies, salt quenching effect, competitive binding with methylene blue and molecular modeling. The changes in Fourier transformed infrared (FT-IR) and circular dichroism (CD) spectra suggested that TBMP mainly bound to the G-C rich region with inducing a significant perturbation in B-like DNA structure. It was also found that Hp-βCD decreased the binding ability of TBMP with ctDNA, but did not affect the interactive mode between TBMP and ctDNA, and the formed inclusion complex of TBMP-Hp-βCD decomposed in the presence of ctDNA. This study may provide insights into the mechanism of binding of TBMP with ctDNA and the role of Hp-βCD in the TBMP-ctDNA interaction. PMID:26245840

  13. Proline as a fuel for insect flight: enhancing carbohydrate oxidation in hymenopterans.

    PubMed

    Teulier, Loïc; Weber, Jean-Michel; Crevier, Julie; Darveau, Charles-A

    2016-07-13

    Bees are thought to be strict users of carbohydrates as metabolic fuel for flight. Many insects, however, have the ability to oxidize the amino acid proline at a high rate, which is a unique feature of this group of animals. The presence of proline in the haemolymph of bees and in the nectar of plants led to the hypothesis that plants may produce proline as a metabolic reward for pollinators. We investigated flight muscle metabolism of hymenopteran species using high-resolution respirometry performed on permeabilized muscle fibres. The muscle fibres of the honeybee, Apis mellifera, do not have a detectable capacity to oxidize proline, as those from the migratory locust, Locusta migratoria, used here as an outgroup representative. The closely related bumblebee, Bombus impatiens, can oxidize proline alone and more than doubles its respiratory capacity when proline is combined with carbohydrate-derived substrates. A distant wasp species, Vespula vulgaris, exhibits the same metabolic phenotype as the bumblebee, suggesting that proline oxidation is common in hymenopterans. Using a combination of mitochondrial substrates and inhibitors, we further show that in B. impatiens, proline oxidation provides reducing equivalents and electrons directly to the electron transport system. Together, these findings demonstrate that some bee and wasp species can greatly enhance the oxidation of carbohydrates using proline as fuel for flight. PMID:27412285

  14. sup 40 Ar- sup 39 Ar and K-Ar dating of K-rich rocks from the Roccamonfina volcano, Roman Comagmatic Region, Italy

    SciTech Connect

    Di Brozolo, F.R.; Di Girolamo, P.; Turi, B.; Oddone, M. )

    1988-06-01

    Roccamonfina is the northernmost Volcano of the Campanian area of the K-rich Roman comagmatic Region of Italy. It erupted a huge amount of pyroclastics and lavas belonging to both the Leucite-Basanite and Leucitite Series (LBLS) and the Shoshonite Series (SS), spread over an area of about 300 km{sup 2}. The above series correspond to the High-K Series (HKS) and Low-K Series (LKS) of Appleton (1971), respectively. {sup 40}Ar-{sup 39}Ar and K-Ar dating of samples from both series gave ages ranging from 0.656 to 0.096 Ma for the SS and from 1.03( ) to 0.053 Ma for the LBLS. These results indicate that the products of the two series were outpoured together at least between 0.7 and 0.1 Ma age, i.e. during both the so-called pre-caldera phase and the post-caldera phase of activity. The latest products of the volcanism at Roccamonfina were erupted just before the deposition of the Grey Campanian Ignimbrite, which erupted from vents located about 50 km to the south in the Phlegrean Fields near Naples and has an age of about 33,000 years. Taking into account all the available all the available radiometric data the authors conclude that Roccamonfina was active between 1.5 and 0.05 Ma ago, in excellent agreement with the stratigraphic evidence. In this same time span is concentrated the activity of all the centers of the Roman Region north of Naples.

  15. Hypoxia stimulates binding of a cytoplasmic protein to a pyrimidine-rich sequence in the 3'-untranslated region of rat tyrosine hydroxylase mRNA.

    PubMed

    Czyzyk-Krzeska, M F; Dominski, Z; Kole, R; Millhorn, D E

    1994-04-01

    Reduced oxygen tension (hypoxia) induces a 3-fold increase in stability of mRNA for tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine synthesis, in the pheochromocytoma (PC12) clonal cell line. To investigate the possibility that RNA-protein interactions are involved in mediating this increase in stability, RNA gel shift assays were performed using different fragments of labeled TH mRNA and the S-100 fraction of PC12 cytoplasmic protein extracts. We identified a sequence within the 3'-untranslated region of TH mRNA that binds cytoplasmic protein. RNase T1 mapping revealed that the protein was bound to a 28 nucleotide long sequence that is located between bases 1551-1579 of TH mRNA. Moreover, protein binding to this fragment was prevented with an antisense oligonucleotide directed against bases 1551-1579 and subsequent RNase H digestion. This fragment of the 3'-untranslated region of TH mRNA is rich in pyrimidine nucleotides, and the binding of cytoplasmic protein to this fragment was reduced by competition with other polypyrimidine sequences including poly(C) but not poly(U) polymers. The binding of the protein to TH mRNA was increased when cytoplasmic proteins were extracted from PC12 cells exposed to hypoxia (5% O2) for 24 h. Electrophoresis of the UV cross-linked RNA-protein complex on SDS-polyacrylamide gel electrophoresis revealed a complex of 74 kDa. The potential role of this protein-TH mRNA interaction in regulation of TH mRNA stability during hypoxia is discussed. PMID:7908289

  16. Determination of proline in honey: comparison between official methods, optimization and validation of the analytical methodology.

    PubMed

    Truzzi, Cristina; Annibaldi, Anna; Illuminati, Silvia; Finale, Carolina; Scarponi, Giuseppe

    2014-05-01

    The study compares official spectrophotometric methods for the determination of proline content in honey - those of the International Honey Commission (IHC) and the Association of Official Analytical Chemists (AOAC) - with the original Ough method. Results show that the extra time-consuming treatment stages added by the IHC method with respect to the Ough method are pointless. We demonstrate that the AOACs method proves to be the best in terms of accuracy and time saving. The optimized waiting time for the absorbance recording is set at 35min from the removal of reaction tubes from the boiling bath used in the sample treatment. The optimized method was validated in the matrix: linearity up to 1800mgL(-1), limit of detection 20mgL(-1), limit of quantification 61mgL(-1). The method was applied to 43 unifloral honey samples from the Marche region, Italy. PMID:24360478

  17. A Thermodynamic Model for Predicting Mineral Reactivity in Supercritical Carbon Dioxide: I. Phase Behavior of Carbon Dioxide - Water - Chloride Salt Systems Across the H2O-Rich to the CO2-Rich Regions

    SciTech Connect

    Springer, Ronald D.; Wang, Zheming; Anderko, Andre; Wang, Peiming; Felmy, Andrew R.

    2012-09-05

    Phase equilibria in mixtures containing carbon dioxide, water, and chloride salts have been investigated using a combination of solubility measurements and thermodynamic modeling. The solubility of water in the CO2-rich phase of ternary mixtures of CO2, H2O and NaCl or CaCl2 was determined, using near infrared spectroscopy, at 90 atm and 40 to 100 °C. These measurements fill a gap in the experimental database for CO2 water salt systems, for which phase composition data have been available only for the H2O-rich phases. A thermodynamic model for CO2 water salt systems has been constructed on the basis of the previously developed Mixed-Solvent Electrolyte (MSE) framework, which is capable of modeling aqueous solutions over broad ranges of temperature and pressure, is valid to high electrolyte concentrations, treats mixed-phase systems (with both scCO2 and water present) and can predict the thermodynamic properties of dry and partially water-saturated supercritical CO2 over broad ranges of temperature and pressure. Within the MSE framework the standard-state properties are calculated from the Helgeson-Kirkham-Flowers equation of state whereas the excess Gibbs energy includes a long-range electrostatic interaction term expressed by a Pitzer-Debye-Hückel equation, a virial coefficient-type term for interactions between ions and a short-range term for interactions involving neutral molecules. The parameters of the MSE model have been evaluated using literature data for both the H2O-rich and CO2-rich phases in the CO2 - H2O binary and for the H2O-rich phase in the CO2 - H2O - NaCl / KCl / CaCl2 / MgCl2 ternary and multicompontent systems. The model accurately represents the properties of these systems at temperatures from 0°C to 300 °C and pressures up to ~4000 atm. Further, the solubilities of H2O in CO2-rich phases that are predicted by the model are in agreement with the new measurements for the CO2 - H2O - NaCl and CO2 - H2O - CaCl2 systems. Thus, the model can be

  18. An N-terminal glycine-rich sequence contributes to retrovirus trimer of hairpins stability

    SciTech Connect

    Wilson, Kirilee A.; Maerz, Anne L.; Baer, Severine; Drummer, Heidi E.; Poumbourios, Pantelis . E-mail: apoumbourios@burnet.edu.au

    2007-08-10

    Retroviral transmembrane proteins (TMs) contain a glycine-rich segment linking the N-terminal fusion peptide and coiled coil core. Previously, we reported that the glycine-rich segment (Met-326-Ser-337) of the human T-cell leukemia virus type 1 (HTLV-1) TM, gp21, is a determinant of membrane fusion function [K.A. Wilson, S. Baer, A.L. Maerz, M. Alizon, P. Poumbourios, The conserved glycine-rich segment linking the N-terminal fusion peptide to the coiled coil of human T-cell leukemia virus type 1 transmembrane glycoprotein gp21 is a determinant of membrane fusion function, J. Virol. 79 (2005) 4533-4539]. Here we show that the reduced fusion activity of an I334A mutant correlated with a decrease in stability of the gp21 trimer of hairpins conformation, in the context of a maltose-binding protein-gp21 chimera. The stabilizing influence of Ile-334 required the C-terminal membrane-proximal sequence Trp-431-Ser-436. Proline substitution of four of five Gly residues altered gp21 trimer of hairpins stability. Our data indicate that flexibility within and hydrophobic interactions mediated by this region are determinants of gp21 stability and membrane fusion function.

  19. An N-terminal glycine-rich sequence contributes to retrovirus trimer of hairpins stability.

    PubMed

    Wilson, Kirilee A; Maerz, Anne L; Bär, Séverine; Drummer, Heidi E; Poumbourios, Pantelis

    2007-08-10

    Retroviral transmembrane proteins (TMs) contain a glycine-rich segment linking the N-terminal fusion peptide and coiled coil core. Previously, we reported that the glycine-rich segment (Met-326-Ser-337) of the human T-cell leukemia virus type 1 (HTLV-1) TM, gp21, is a determinant of membrane fusion function [K.A. Wilson, S. Bär, A.L. Maerz, M. Alizon, P. Poumbourios, The conserved glycine-rich segment linking the N-terminal fusion peptide to the coiled coil of human T-cell leukemia virus type 1 transmembrane glycoprotein gp21 is a determinant of membrane fusion function, J. Virol. 79 (2005) 4533-4539]. Here we show that the reduced fusion activity of an I334A mutant correlated with a decrease in stability of the gp21 trimer of hairpins conformation, in the context of a maltose-binding protein-gp21 chimera. The stabilizing influence of Ile-334 required the C-terminal membrane-proximal sequence Trp-431-Ser-436. Proline substitution of four of five Gly residues altered gp21 trimer of hairpins stability. Our data indicate that flexibility within and hydrophobic interactions mediated by this region are determinants of gp21 stability and membrane fusion function. PMID:17577584

  20. Remelting of refractory inclusions in the chondrule-forming regions: Evidence from chondrule-bearing type C calcium-aluminum-rich inclusions from Allende

    NASA Astrophysics Data System (ADS)

    Krot, Alexander N.; Yurimoto, Hisayoshi; Hutcheon, Ian D.; Chaussidon, Marc; MacPherson, Glenn J.; Paque, Julie

    2007-08-01

    We describe the mineralogy, petrology, oxygen, and magnesium isotope compositions of three coarse-grained, igneous, anorthite-rich (type C) Ca-Al-rich inclusions (CAIs) (ABC, TS26, and 93) that are associated with ferromagnesian chondrule-like silicate materials from the CV carbonaceous chondrite Allende. The CAIs consist of lath-shaped anorthite (An99), Cr-bearing Al-Ti-diopside (Al and Ti contents are highly variable), spinel, and highly åkermanitic and Na-rich melilite (Åk63-74, 0.4-0.6 wt% Na2O). TS26 and 93 lack Wark-Lovering rim layers; ABC is a CAI fragment missing the outermost part. The peripheral portions of TS26 and ABC are enriched in SiO2 and depleted in TiO2 and Al2O3 compared to their cores and contain relict ferromagnesian chondrule fragments composed of forsteritic olivine (Fa6-8) and low-Ca pyroxene/pigeonite (Fs1Wo1-9). The relict grains are corroded by Al-Ti-diopside of the host CAIs and surrounded by haloes of augite (Fs0.5Wo30-42). The outer portion of CAI 93 enriched in spinel is overgrown by coarse-grained pigeonite (Fs0.5-2Wo5-17), augite (Fs0.5Wo38-42), and anorthitic plagioclase (An84). Relict olivine and low-Ca pyroxene/pigeonite in ABC and TS26, and the pigeonite-augite rim around 93 are 16O-poor (Δ17O ˜ -1‰ to -8‰). Spinel and Al-Ti-diopside in cores of CAIs ABC, TS26, and 93 are 16O-enriched (Δ17O down to -20‰), whereas Al-Ti-diopside in the outer zones, as well as melilite and anorthite, are 16O-depleted to various degrees (Δ17O = -11‰ to 2‰). In contrast to typical Allende CAIs that have the canonical initial 26Al/27Al ratio of ˜5 × 10-5 ABC, 93, and TS26 are 26Al-poor with (26Al/27Al)0 ratios of (4.7 ± 1.4) × 10-6 (1.5 ± 1.8) × 10-6 <1.2 × 10-6 respectively. We conclude that ABC, TS26, and 93 experienced remelting with addition of ferromagnesian chondrule silicates and incomplete oxygen isotopic exchange in an 16O-poor gaseous reservoir, probably in the chondrule-forming region. This melting episode could

  1. The formation of ornithine from proline in animal tissues

    PubMed Central

    Smith, A. D.; Benziman, M.; Strecker, H. J.

    1967-01-01

    1. Homogenates of liver or kidney from rat, mouse, dog and guinea pig formed ornithine from proline but not from glutamate. Rat kidney was most active in this reaction and was used for further studies. 2. The overall reaction was found to be catalysed by proline oxidase to yield glutamic γ-semialdehyde, followed by transamination of this product with glutamate as catalysed by ornithine–keto acid aminotransferase. 3. The unfavourable equilibrium of the ornithine–keto acid aminotransferase reaction was overcome chiefly by glutamate dehydrogenase in the tissue, which removed the α-oxoglutarate produced, by reduction with endogenous ammonia and NADH. 4. Aspartate aminotransferase in these preparations also aided in the removal of α-oxoglutarate. In this case the overall reaction was driven also by the rapid decarboxylation of oxaloacetate. 5. No evidence could be found for a pathway of ornithine synthesis involving acylated intermediates as has been observed in some micro-organisms. 6. The rate of ornithine synthesis in homogenates of several rat tissues paralleled the activity of ornithine–keto acid aminotransferase in these tissues, indicating that this enzyme was rate-determining for the synthesis. 7. The possible influence of these reactions on urea synthesis is discussed. PMID:6048797

  2. Proline Metabolism Increases katG Expression and Oxidative Stress Resistance in Escherichia coli

    PubMed Central

    Zhang, Lu; Alfano, James R.

    2014-01-01

    The oxidation of l-proline to glutamate in Gram-negative bacteria is catalyzed by the proline utilization A (PutA) flavoenzyme, which contains proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate (P5C) dehydrogenase domains in a single polypeptide. Previous studies have suggested that aside from providing energy, proline metabolism influences oxidative stress resistance in different organisms. To explore this potential role and the mechanism, we characterized the oxidative stress resistance of wild-type and putA mutant strains of Escherichia coli. Initial stress assays revealed that the putA mutant strain was significantly more sensitive to oxidative stress than the parental wild-type strain. Expression of PutA in the putA mutant strain restored oxidative stress resistance, confirming that depletion of PutA was responsible for the oxidative stress phenotype. Treatment of wild-type cells with proline significantly increased hydroperoxidase I (encoded by katG) expression and activity. Furthermore, the ΔkatG strain failed to respond to proline, indicating a critical role for hydroperoxidase I in the mechanism of proline protection. The global regulator OxyR activates the expression of katG along with several other genes involved in oxidative stress defense. In addition to katG, proline increased the expression of grxA (glutaredoxin 1) and trxC (thioredoxin 2) of the OxyR regulon, implicating OxyR in proline protection. Proline oxidative metabolism was shown to generate hydrogen peroxide, indicating that proline increases oxidative stress tolerance in E. coli via a preadaptive effect involving endogenous hydrogen peroxide production and enhanced catalase-peroxidase activity. PMID:25384482

  3. T-box-mediated control of the anabolic proline biosynthetic genes of Bacillus subtilis.

    PubMed

    Brill, Jeanette; Hoffmann, Tamara; Putzer, Harald; Bremer, Erhard

    2011-04-01

    Bacillus subtilis possesses interlinked routes for the synthesis of proline. The ProJ-ProA-ProH route is responsible for the production of proline as an osmoprotectant, and the ProB-ProA-ProI route provides proline for protein synthesis. We show here that the transcription of the anabolic proBA and proI genes is controlled in response to proline limitation via a T-box-mediated termination/antitermination regulatory mechanism, a tRNA-responsive riboswitch. Primer extension analysis revealed mRNA leader transcripts of 270 and 269 nt for the proBA and proI genes, respectively, both of which are synthesized from SigA-type promoters. These leader transcripts are predicted to fold into two mutually exclusive secondary mRNA structures, forming either a terminator or an antiterminator configuration. Northern blot analysis allowed the detection of both the leader and the full-length proBA and proI transcripts. Assessment of the level of the proBA transcripts revealed that the amount of the full-length mRNA species strongly increased in proline-starved cultures. Genetic studies with a proB-treA operon fusion reporter strain demonstrated that proBA transcription is sensitively tied to proline availability and is derepressed as soon as cellular starvation for proline sets in. Both the proBA and the proI leader sequences contain a CCU proline-specific specifier codon prone to interact with the corresponding uncharged proline-specific tRNA. By replacing the CCU proline specifier codon in the proBA T-box leader with UUC, a codon recognized by a Phe-specific tRNA, we were able to synthetically re-engineer the proline-specific control of proBA transcription to a control that was responsive to starvation for phenylalanine. PMID:21233158

  4. A Histidine-rich Linker Region in Peptidylglycine α-Amidating Monooxygenase Has the Properties of a pH Sensor*

    PubMed Central

    Vishwanatha, Kurutihalli; Bäck, Nils; Mains, Richard E.; Eipper, Betty A.

    2014-01-01

    Decreasing luminal pH is thought to play a role in the entry of newly synthesized and endocytosed membrane proteins into secretory granules. The two catalytic domains of peptidylglycine α-amidating monooxygenase (PAM), a type I integral membrane protein, catalyze the sequential reactions that convert peptidyl-Gly substrates into amidated products. We explored the hypothesis that a conserved His-rich cluster (His-Gly-His-His) in the linker region connecting its two catalytic domains senses pH and affects PAM trafficking by mutating these His residues to Ala (Ala-Gly-Ala-Ala; H3A). Purified recombinant wild-type and H3A linker peptides were examined using circular dichroism and tryptophan fluorescence; mutation of the His cluster largely eliminated its pH sensitivity. An enzymatically active PAM protein with the same mutations (PAM-1/H3A) was expressed in HEK293 cells and AtT-20 corticotrope tumor cells. Metabolic labeling followed by immunoprecipitation revealed more rapid loss of newly synthesized PAM-1/H3A than PAM-1; although release of newly synthesized monofunctional PHM/H3A was increased, release of soluble bifunctional PAM/H3A, a product of the endocytic pathway, was decreased. Surface biotinylation revealed rapid loss of PAM-1/H3A, with no detectable return of the mutant protein to secretory granules. Consistent with its altered endocytic trafficking, little PAM-1/H3A was subjected to regulated intramembrane proteolysis followed by release of a small nuclear-targeted cytosolic fragment. AtT-20 cells expressing PAM-1/H3A adopted the morphology of wild-type AtT-20 cells; secretory products no longer accumulated in the trans-Golgi network and secretory granule exocytosis was more responsive to secretagogue. PMID:24627494

  5. A Conserved Active Site Tyrosine Residue of Proline Dehydrogenase Helps Enforce the Preference for Proline over Hydroxyproline as the Substrate†,‡

    PubMed Central

    Ostrander, Elizabeth L.; Larson, John D.; Schuermann, Jonathan P.; Tanner, John J.

    2009-01-01

    Proline dehydrogenase (PRODH) catalyzes the oxidation of L-proline to Delta-1-pyrroline-5-carboxylate. PRODHs exhibit a pronounced preference for proline over hydroxyproline (trans-4-hydroxy-L-proline) as the substrate, but the basis for specificity is unknown. The goal of this study, therefore, is to gain insights into the structural determinants of substrate specificity of this class of enzyme, with a focus on understanding how PRODHs discriminate between the two closely related molecules, proline and hydroxyproline. Two site-directed mutants of the PRODH domain of Escherichia coli PutA were created: Y540A and Y540S. Kinetics measurements were performed with both mutants. Crystal structures of Y540S complexed with hydroxyproline, proline, and the proline analog L-tetrahydro-2-furoic acid were determined at resolutions of 1.75 Å, 1.90 Å and 1.85 Å. Mutation of Tyr540 increases the catalytic efficiency for hydroxyproline three-fold and decreases the specificity for proline by factors of twenty (Y540S) and fifty (Y540A). The structures show that removal of the large phenol side chain increases the volume of the substrate-binding pocket, allowing sufficient room for the 4-hydroxyl of hydroxyproline. Furthermore, the introduced serine residue participates in recognition of hydroxyproline by forming a hydrogen bond with the 4-hydroxyl. This result has implications for understanding substrate specificity of the related enzyme human hydroxyproline dehydrogenase, which has serine in place of tyrosine at this key active site position. The kinetic and structural results suggest that Tyr540 is an important determinant of specificity. Structurally, it serves as a negative filter for hydroxyproline by clashing with the 4-hydroxyl group of this potential substrate. PMID:19140736

  6. Proline biosynthesis augments tumor cell growth and aerobic glycolysis: involvement of pyridine nucleotides

    PubMed Central

    Liu, Wei; Hancock, Chad N.; Fischer, Joseph W.; Harman, Meredith; Phang, James M.

    2015-01-01

    The metabolism of the nonessential amino acid proline contributes to tumor metabolic reprogramming. Previously we showed that MYC increases proline biosynthesis (PB) from glutamine. Here we show MYC increases the expression of the enzymes in PB at both protein and mRNA levels. Blockade of PB decreases tumor cell growth and energy production. Addition of Δ1-pyrroline-5-carboxylate (P5C) or proline reverses the effects of P5C synthase knockdown but not P5C reductases knockdown. Importantly, the reversal effect of proline was blocked by concomitant proline dehydrogenase/oxidase (PRODH/POX) knockdown. These findings suggest that the important regulatory contribution of PB to tumor growth derives from metabolic cycling between proline and P5C rather than product proline or intermediate P5C. We further document the critical role of PB in maintaining pyridine nucleotide levels by connecting the proline cycle to glycolysis and to the oxidative arm of the pentose phosphate pathway. These findings establish a novel function of PB in tumorigenesis, linking the reprogramming of glucose, glutamine and pyridine nucleotides, and may provide a novel target for antitumor therapy. PMID:26598224

  7. Environmental and developmental signals modulate proline homeostasis: evidence for a negative transcriptional regulator.

    PubMed Central

    Verbruggen, N; Hua, X J; May, M; Van Montagu, M

    1996-01-01

    In many plants, osmotic stress induces a rapid accumulation of proline through de novo synthesis from glutamate. This response is thought to play a pivotal role in osmotic stress tolerance [Kishor, P. B. K., Hong, Z., Miao, G.-H., Hu, C.-A. A. and Verma, D. P. S. (1995) Plant Physiol. 108, 1387-1394]. During recovery from osmotic stress, accumulated proline is rapidly oxidized to glutamate and the first step of this process is catalyzed by proline oxidase. We have isolated a full-length cDNA from Arabidopsis thaliana, At-POX, which maps to a single locus on chromosome 3 and that encodes a predicted polypeptide of 499 amino acids showing significant similarity with proline oxidase sequences from Drosophila and Saccharomyces cerevisiae (55.5% and 45.1%, respectively). The predicted location of the encoded polypeptide is the inner mitochondrial membrane. RNA gel blot analysis revealed that At-POX mRNA levels declined rapidly upon osmotic stress and this decline preceded proline accumulation. On the other hand, At-POX mRNA levels rapidly increased during recovery. Free proline, exogenously added to plants, was found to be an effective inducer of At-POX expression; indeed, At-POX was highly expressed in flowers and mature seeds where the proline level is higher relative to other organs of Arabidopsis. Our results indicate that stress- and developmentally derived signals interact to determine proline homeostasis in Arabidopsis. Images Fig. 3 Fig. 4 PMID:8710950

  8. A proline-derived transannular N-cap for nucleation of short α-helical peptides.

    PubMed

    Tian, Yuan; Wang, Dongyuan; Li, Jingxu; Shi, Chuan; Zhao, Hui; Niu, Xiaogang; Li, Zigang

    2016-07-28

    We report herein a proline-derived transannular N-cap as a helix nucleating template in diverse bio-related peptide sequences via macrolactamization on resin. This approach takes advantage of synergistic stabilization effects of both N-capping properties of proline and substitution of a main chain hydrogen bond with a covalent bond. PMID:27357119

  9. Localization of two post-proline cleaving peptidases in the midgut of Tenebrio molitor larvae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Two soluble post-proline cleaving peptidase activities, PPCP1 and PPCP2, were demonstrated in the midgut of Tenebrio molitor larvae with the substrate benzyloxycarbonyl-L-alanyl-L-proline p-nitroanilide. Both activities were serine peptidases. PPCP1 was active in acidic buffers, with maximum activit...

  10. Structural Basis of Transcriptional Regulation of the Proline Utilization Regulon by Multifunctional PutA

    PubMed Central

    Zhou, Yuzhen; Larson, John D.; Bottoms, Christopher A.; Arturo, Emilia C.; Henzl, Michael T.; Jenkins, Jermaine L.; Nix, Jay C.; Becker, Donald F.; Tanner, John J.

    2009-01-01

    Summary The multifunctional Escherichia coli PutA flavoprotein functions as both a membrane-associated proline catabolic enzyme and transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52) complexed with DNA and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5′-GTTGCA-3′, were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25 Å resolution crystal structure of PutA52 bound to one of the operators (operator 2, 21-bp) shows that the protein contacts a 9-bp fragment, corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic with an enthalpy of −1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and 15-fold lower affinity, which shows that base pairs outside of the consensus motif impact binding. The structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators. PMID:18586269

  11. Effect of exogenous proline, betaine, and carnitine on growth of Listeria monocytogenes in a minimal medium.

    PubMed

    Beumer, R R; Te Giffel, M C; Cox, L J; Rombouts, F M; Abee, T

    1994-04-01

    Three Listeria monocytogenes strains isolated from food or food-processing environments were used to assess the response of this species to salinity in a chemically defined minimal medium. Growth in a minimal medium containing five essential amino acids and glucose as a carbon and energy source was comparable to growth in a rich medium (brain heart infusion broth). In the absence and presence of 3% NaCl the final cell numbers reached in minimal medium were 10(9) and 10(7) CFU/ml, respectively. Growth under the latter conditions could not be detected by spectrophotometry by measuring A660. Apparently, this technique was not suitable for these experiments since the detection level was > 10(7) CFU/ml. Exogenously added proline (10 mM), trimethylglycine (betaine) (1 mM), and beta-hydroxy-gamma-N-trimethyl aminobutyrate (carnitine) (1 mM) significantly stimulated growth under osmotic stress conditions in minimal medium at both 37 and 10 degrees C. Betaine and carnitine are present in foods derived from plants and animals, respectively. Therefore, these compounds can contribute significantly to growth of L. monocytogenes in various foods at high osmolarities. PMID:8017923

  12. Protective effects of proline against cadmium toxicity in micropropagated hyperaccumulator, Solanum nigrum L.

    PubMed

    Xu, Jin; Yin, HengXia; Li, Xia

    2009-02-01

    Solanum nigrum is a newly discovered Cd-hyperaccumulator. In the present study, the protective effects of proline against cadmium toxicity of callus and regenerated shoots of S. nigrum are investigated based on a high frequency in vitro shoot regeneration system. Proline pretreatment reduces the reactive oxygen species levels and protects the plasma membrane integrity of callus under cadmium stress, and therefore improves the cadmium tolerance in S. nigrum. Inductively coupled plasma mass spectroscopy analysis shows that exogenous proline increases the cadmium accumulation in callus and regenerated shoots of S. nigrum. Further analysis indicates that the improvement of cadmium tolerance caused by proline pretreatment is correlated with an increase of superoxide dismutase and catalase activity and intracellular total glutathione content. The interaction between proline and enzymic or non-enzymic antioxidants is discussed. PMID:19043719

  13. Solvent and conformation dependence of amide I vibrations in peptides and proteins containing proline

    NASA Astrophysics Data System (ADS)

    Roy, Santanu; Lessing, Joshua; Meisl, Georg; Ganim, Ziad; Tokmakoff, Andrei; Knoester, Jasper; Jansen, Thomas L. C.

    2011-12-01

    We present a mixed quantum-classical model for studying the amide I vibrational dynamics (predominantly CO stretching) in peptides and proteins containing proline. There are existing models developed for determining frequencies of and couplings between the secondary amide units. However, these are not applicable to proline because this amino acid has a tertiary amide unit. Therefore, a new parametrization is required for infrared-spectroscopic studies of proteins that contain proline, such as collagen, the most abundant protein in humans and animals. Here, we construct the electrostatic and dihedral maps accounting for solvent and conformation effects on frequency and coupling for the proline unit. We examine the quality and the applicability of these maps by carrying out spectral simulations of a number of peptides with proline in D2O and compare with experimental observations.

  14. Prediction and Biochemical Demonstration of a Catabolic Pathway for the Osmoprotectant Proline Betaine

    PubMed Central

    Kumar, Ritesh; Zhao, Suwen; Vetting, Matthew W.; Wood, B. McKay; Sakai, Ayano; Cho, Kyuil; Solbiati, José; Almo, Steven C.; Sweedler, Jonathan V.; Jacobson, Matthew P.; Gerlt, John A.; Cronan, John E.

    2014-01-01

    ABSTRACT Through the use of genetic, enzymatic, metabolomic, and structural analyses, we have discovered the catabolic pathway for proline betaine, an osmoprotectant, in Paracoccus denitrificans and Rhodobacter sphaeroides. Genetic and enzymatic analyses showed that several of the key enzymes of the hydroxyproline betaine degradation pathway also function in proline betaine degradation. Metabolomic analyses detected each of the metabolic intermediates of the pathway. The proline betaine catabolic pathway was repressed by osmotic stress and cold stress, and a regulatory transcription factor was identified. We also report crystal structure complexes of the P. denitrificans HpbD hydroxyproline betaine epimerase/proline betaine racemase with l-proline betaine and cis-hydroxyproline betaine. PMID:24520058

  15. Effect of l-Proline on Sake Brewing and Ethanol Stress in Saccharomyces cerevisiae

    PubMed Central

    Takagi, Hiroshi; Takaoka, Miki; Kawaguchi, Akari; Kubo, Yoshito

    2005-01-01

    During the fermentation of sake, cells of Saccharomyces cerevisiae are exposed to high concentrations of ethanol, thereby damaging the cell membrane and functional proteins. l-Proline protects yeast cells from damage caused by freezing or oxidative stress. In this study, we evaluated the role of intracellular l-proline in cells of S. cerevisiae grown under ethanol stress. An l-proline-accumulating laboratory strain carries a mutant allele of PRO1, pro1D154N, which encodes the Asp154Asn mutant γ-glutamyl kinase. This mutation increases the activity of γ-glutamyl kinase and γ-glutamyl phosphate reductase, which catalyze the first two steps of l-proline synthesis and which together may form a complex in vivo. When cultured in liquid medium in the presence of 9% and 18% ethanol under static conditions, the cell viability of the l-proline-accumulating laboratory strain is greater than the cell viability of the parent strain. This result suggests that intracellular accumulation of l-proline may confer tolerance to ethanol stress. We constructed a novel sake yeast strain by disrupting the PUT1 gene, which is required for l-proline utilization, and replacing the wild-type PRO1 allele with the pro1D154N allele. The resultant strain accumulated l-proline and was more tolerant to ethanol stress than was the control strain. We used the strain that could accumulate l-proline to brew sake containing five times more l-proline than what is found in sake brewed with the control strain, without affecting the fermentation profiles. PMID:16332860

  16. Synthesis, Release, and Recapture of Compatible Solute Proline by Osmotically Stressed Bacillus subtilis Cells

    PubMed Central

    Hoffmann, Tamara; von Blohn, Carsten; Stanek, Agnieszka; Moses, Susanne; Barzantny, Helena

    2012-01-01

    Bacillus subtilis synthesizes large amounts of the compatible solute proline as a cellular defense against high osmolarity to ensure a physiologically appropriate level of hydration of the cytoplasm and turgor. It also imports proline for this purpose via the osmotically inducible OpuE transport system. Unexpectedly, an opuE mutant was at a strong growth disadvantage in high-salinity minimal media lacking proline. Appreciable amounts of proline were detected in the culture supernatant of the opuE mutant strain, and they rose concomitantly with increases in the external salinity. We found that the intracellular proline pool of severely salinity-stressed cells of the opuE mutant was considerably lower than that of its opuE+ parent strain. This loss of proline into the medium and the resulting decrease in the intracellular proline content provide a rational explanation for the observed salt-sensitive growth phenotype of cells lacking OpuE. None of the known MscL- and MscS-type mechanosensitive channels of B. subtilis participated in the release of proline under permanently imposed high-salinity growth conditions. The data reported here show that the OpuE transporter not only possesses the previously reported role for the scavenging of exogenously provided proline as an osmoprotectant but also functions as a physiologically highly important recapturing device for proline that is synthesized de novo and subsequently released by salt-stressed B. subtilis cells. The wider implications of our findings for the retention of compatible solutes by osmotically challenged microorganisms and the roles of uptake systems for compatible solutes are considered. PMID:22685134

  17. Growth of plutons by incremental emplacement of sheets in crystal-rich host: Evidence from Miocene intrusions of the Colorado River region, Nevada, USA

    USGS Publications Warehouse

    Miller, C.F.; Furbish, D.J.; Walker, B.A.; Claiborne, L.L.; Koteas, G.C.; Bleick, H.A.; Miller, J.S.

    2011-01-01

    Growing evidence supports the notion that plutons are constructed incrementally, commonly over long periods of time, yet field evidence for the multiple injections that seem to be required is commonly sparse or absent. Timescales of up to several million years, among other arguments, indicate that the dominant volume does not remain largely molten, yet if growing plutons are constructed from rapidly solidifying increments it is unlikely that intrusive contacts would escape notice. A model wherein magma increments are emplaced into melt-bearing but crystal-rich host, rather than either solid or crystal-poor material, provides a plausible explanation for this apparent conundrum. A partially solidified intrusion undoubtedly comprises zones with contrasting melt fraction and therefore strength. Depending on whether these zones behave elastically or ductilely in response to dike emplacement, intruding magma may spread to form sheets by either of two mechanisms. If the melt-bearing host is elastic on the relevant timescale, magma spreads rather than continuing to propagate upward, where it encounters a zone of higher rigidity (higher crystal fraction). Similarly, if the dike at first ascends through rigid, melt-poor material and then encounters a zone that is weak enough (poor enough in crystals) to respond ductilely, the ascending material will also spread because the dike tip ceases to propagate as in rigid material. We propose that ascending magma is thus in essence trapped, by either mechanism, within relatively crystal-poor zones. Contacts will commonly be obscure from the start because the contrast between intruding material (crystal-poorer magma) and host (crystal-richer material) is subtle, and they may be obscured even further by subsequent destabilization of the crystal-melt framework. Field evidence and zircon zoning stratigraphy in plutons of the Colorado River region of southern Nevada support the hypothesis that emplacement of magma replenishments into a

  18. Ehrlichia chaffeensis Proliferation Begins with NtrY/NtrX and PutA/GlnA Upregulation and CtrA Degradation Induced by Proline and Glutamine Uptake

    PubMed Central

    Cheng, Zhihui; Lin, Mingqun

    2014-01-01

    ABSTRACT How the obligatory intracellular bacterium Ehrlichia chaffeensis begins to replicate upon entry into human monocytes is poorly understood. Here, we examined the potential role of amino acids in initiating intracellular replication. PutA converts proline to glutamate, and GlnA converts glutamate to glutamine. E. chaffeensis PutA and GlnA complemented Escherichia coli putA and glnA mutants. Methionine sulfoximine, a glutamine synthetase inhibitor, inhibited E. chaffeensis GlnA activity and E. chaffeensis infection of human cells. Incubation of E. chaffeensis with human cells rapidly induced putA and glnA expression that peaked at 24 h postincubation. E. chaffeensis took up proline and glutamine but not glutamate. Pretreatment of E. chaffeensis with a proline transporter inhibitor (protamine), a glutamine transporter inhibitor (histidine), or proline analogs inhibited E. chaffeensis infection, whereas pretreatment with proline or glutamine enhanced infection and upregulated putA and glnA faster than no treatment or glutamate pretreatment. The temporal response of putA and glnA expression was similar to that of NtrY and NtrX, a two-component system, and electrophoretic mobility shift assays showed specific binding of recombinant E. chaffeensis NtrX (rNtrX) to the promoter regions of E. chaffeensis putA and glnA. Furthermore, rNtrX transactivated E. chaffeensis putA and glnA promoter-lacZ fusions in E. coli. Growth-promoting activities of proline and glutamine were also accompanied by rapid degradation of the DNA-binding protein CtrA. Our results suggest that proline and glutamine uptake regulates putA and glnA expression through NtrY/NtrX and facilitates degradation of CtrA to initiate a new cycle of E. chaffeensis growth. PMID:25425236

  19. Use of Cis-[18F]Fluoro-Proline for Assessment of Exercise-Related Collagen Synthesis in Musculoskeletal Connective Tissue

    PubMed Central

    Skovgaard, Dorthe; Kjaer, Andreas; Heinemeier, Katja Maria; Brandt-Larsen, Malene; Madsen, Jacob; Kjaer, Michael

    2011-01-01

    Protein turnover in collagen rich tissue is influenced by exercise, but can only with difficulty be studied in vivo due to use of invasive procedure. The present study was done to investigate the possibility of applying the PET-tracer, cis-[18F]fluoro-proline (cis-Fpro), for non-invasive assessment of collagen synthesis in rat musculoskeletal tissues at rest and following short-term (3 days) treadmill running. Musculoskeletal collagen synthesis was studied in rats at rest and 24 h post-exercise. At each session, rats were PET scanned at two time points following injection of cis-FPro: (60 and 240 min p.i). SUV were calculated for Achilles tendon, calf muscle and tibial bone. The PET-derived results were compared to mRNA expression of collagen type I and III. Tibial bone had the highest SUV that increased significantly (p<0.001) from the early (60 min) to the late (240 min) PET scan, while SUV in tendon and muscle decreased (p<0.001). Exercise had no influence on SUV, which was contradicted by an increased gene expression of collagen type I and III in muscle and tendon. The clearly, visible uptake of cis-Fpro in the collagen-rich musculoskeletal tissues is promising for multi-tissue studies in vivo. The tissue-specific differences with the highest basal uptake in bone are in accordance with earlier studies relying on tissue incorporation of isotopic-labelled proline. A possible explanation of the failure to demonstrate enhanced collagen synthesis following exercise, despite augmented collagen type I and III transcription, is that SUV calculations are not sensitive enough to detect minor changes in collagen synthesis. Further studies including kinetic compartment modeling must be performed to establish whether cis-Fpro can be used for non-invasive in-vivo assessment of exercise-induced changes in musculoskeletal collagen synthesis. PMID:21347251

  20. The central leucine-rich repeat region of chicken TLR16 dictates unique ligand specificity and species-specific interaction with TLR2.

    PubMed

    Keestra, A Marijke; de Zoete, Marcel R; van Aubel, Rémon A M H; van Putten, Jos P M

    2007-06-01

    The ligand specificity of human TLR (hTLR) 2 is determined through the formation of functional heterodimers with either hTLR1 or hTLR6. The chicken carries two TLR (chTLR) 2 isoforms, type 1 and type 2 (chTLR2t1 and chTLR2t2), and one putative TLR1/6/10 homologue (chTLR16) of unknown function. In this study, we report that transfection of HeLa cells with the various chicken receptors yields potent NF-kappaB activation for the receptor combination of chTLR2t2 and chTLR16 only. The sensitivity of this complex was strongly enhanced by human CD14. The functional chTLR16/chTLR2t2 complex responded toward both the hTLR2/6-specific diacylated peptide S-(2,3-bispalmitoyloxypropyl)-Cys-Gly-Asp-Pro-Lys-His-Pro-Lys-Ser-Phe (FSL-1) and the hTLR2/1 specific triacylated peptide tripalmitoyl-S-(bis(palmitoyloxy)propyl)-Cys-Ser-(Lys)(3)-Lys (Pam(3)CSK(4)), indicating that chTLR16 covers the functions of both mammalian TLR1 and TLR6. Dissection of the species specificity of TLR2 and its coreceptors showed functional chTLR16 complex formation with chTLR2t2 but not hTLR2. Conversely, chTLR2t2 did not function in combination with hTLR1 or hTLR6. The use of constructed chimeric receptors in which the defined domains of chTLR16 and hTLR1 or hTLR6 had been exchanged revealed that the transfer of leucine-rich repeats (LRR) 6-16 of chTLR16 into hTLR6 was sufficient to confer dual ligand specificity to the human receptor and to establish species-specific interaction with chTLR2t2. Collectively, our data indicate that diversification of the central LRR region of the TLR2 coreceptors during evolution has put constraints on both their ligand specificity and their ability to form functional complexes with TLR2. PMID:17513760

  1. Proline transport and osmotic stress response in Escherichia coli K-12.

    PubMed Central

    Grothe, S; Krogsrud, R L; McClellan, D J; Milner, J L; Wood, J M

    1986-01-01

    Proline is accumulated in Escherichia coli via two active transport systems, proline porter I (PPI) and PPII. In our experiments, PPI was insensitive to catabolite repression and was reduced in activity twofold when bacteria were subjected to amino acid-limited growth. PPII, which has a lower affinity for proline than PPI, was induced by tryptophan-limited growth. PPII activity was elevated in bacteria that were subjected to osmotic stress during growth or the transport measurement. Neither PPI nor uptake of serine or glutamine was affected by osmotic stress. Mutation proU205, which was similar in genetic map location and phenotype to other proU mutations isolated in E. coli and Salmonella typhimurium, influenced the sensitivity of the bacteria to the toxic proline analogs azetidine-2-carboxylate and 3,4-dehydroproline, the proline requirements of auxotrophs, and the osmoprotective effect of proline. This mutation did not influence proline uptake via PPI or PPII. A very low uptake activity (6% of the PPII activity) observed in osmotically stressed bacteria lacking PPI and PPII was not observed when the proU205 lesion was introduced. PMID:3514577

  2. Functional reconstitution of a purified proline permease from Candida albicans: interaction with the antifungal cispentacin.

    PubMed

    Jethwaney, D; Höfer, M; Khaware, R K; Prasad, R

    1997-02-01

    We have purified proline permease to homogeneity from Candida albicans using an L-proline-linked agarose matrix as an affinity column. The eluted protein produced two bands of 64 and 67 kDa by SDS-PAGE, whereas it produced a single band of 67 kDa by native PAGE and Western blotting. The apparent Km for L-proline binding to the purified protein was 153 microM. The purified permease was reconstituted into proteoliposomes and its functionality was tested by imposing a valinomycin-induced membrane potential. The main features of L-proline transport in reconstituted systems, viz. specificity and sensitivity to N-ethylmaleimide, were very similar to those of intact cells, The antifungal cispentacin, which enters C. albicans cells via an inducible proline permease, competitively inhibited the L-proline binding and translocation in reconstituted proteoliposomes. However, the uptake of L-proline in proteoliposomes reconstituted with the purified protein displayed monophasic kinetics with an apparent Km of 40 microM. PMID:9043117

  3. Plant-derived compatible solutes proline betaine and betonicine confer enhanced osmotic and temperature stress tolerance to Bacillus subtilis.

    PubMed

    Bashir, Abdallah; Hoffmann, Tamara; Kempf, Bettina; Xie, Xiulan; Smits, Sander H J; Bremer, Erhard

    2014-10-01

    L-Proline is a widely used compatible solute and is employed by Bacillus subtilis, through both synthesis and uptake, as an osmostress protectant. Here, we assessed the stress-protective potential of the plant-derived L-proline derivatives N-methyl-L-proline, L-proline betaine (stachydrine), trans-4-L-hydroxproline and trans-4-hydroxy-L-proline betaine (betonicine) for cells challenged by high salinity or extremes in growth temperature. l-Proline betaine and betonicine conferred salt stress protection, but trans-4-L-hydroxyproline and N-methyl-L-proline was unable to do so. Except for L-proline, none of these compounds served as a nutrient for B. subtilis. L-Proline betaine was a considerably better osmostress protectant than betonicine, and its import strongly reduced the l-proline pool produced by B. subtilis under osmotic stress conditions, whereas a supply of betonicine affected the L-proline pool only modestly. Both compounds downregulated the transcription of the osmotically inducible opuA operon, albeit to different extents. Mutant studies revealed that L-proline betaine was taken up via the ATP-binding cassette transporters OpuA and OpuC, and the betaine-choline-carnitine-transporter-type carrier OpuD; betonicine was imported only through OpuA and OpuC. L-Proline betaine and betonicine also served as temperature stress protectants. A striking difference between these chemically closely related compounds was observed: L-proline betaine was an excellent cold stress protectant, but did not provide heat stress protection, whereas the reverse was true for betonicine. Both compounds were primarily imported in temperature-challenged cells via the high-capacity OpuA transporter. We developed an in silico model for the OpuAC-betonicine complex based on the crystal structure of the OpuAC solute receptor complexed with L-proline betaine. PMID:25012968

  4. Energy coupling in the active transport of proline and glutamate by the photosynthetic halophile Ectothiorhodospira halophila.

    PubMed Central

    Rinehart, C A; Hubbard, J S

    1976-01-01

    When illuminated, washed cell suspensions of Ectothiorhodospira halophila carry out a concentrative uptake of glutamate or proline. Dark-exposed cells accumulate glutamate but not proline. Proline transport was strongly inhibited by carbonylcyanide-m-chlorophenylhydrazone (CCCP), a proton permeant that uncouples photophosphorylation, and by 2-heptyl-4-hydroxyquinoline-n-oxide (HQNO), an inhibitor of photosynthetic electron transport. A stimulation of proline uptake was effected by N,N'-dicyclohexylcarbodiimide (DCCD), an inhibitor of membrane adenosine triphosphatase (ATPase) which catalyzes the phosphorylation. These findings suggest that the driving force for proline transport is the proton-motive force established during photosynthetic electron transport. Glutamate uptake in the light was inhibited by CCCP and HQNO, but to a lesser extent than was the proline system. DCCD caused a mild inhibition of glutamate uptake in the light, but strongly inhibited the uptake by dark-exposed cells. CCCP strongly inhibited glutamate uptake in the dark. The light-dependent transport of glutamate is apparently driven by the proton-motive force established during photosynthetic electron transport. Hydrolysis of adenosine triphosphate (ATP) by membrane ATPase apparently establishes the proton-motive force to drive the light-independent transport. These conclusions were supported by demonstrating that light- or dark-exposed cells accumulate [3H]triphenylmethylphosphonium, a lipid-soluble cation. Several lines of indirect evidence indicated that the proline system required higher levels of energy than did the glutamate system(s). This could explain why ATP hydrolysis does not drive proline transport in the dark. Membrane vesicles were prepared by the sonic treatment of E. halophila spheroplasts. The vesicles contained active systems for the uptake of proline and glutamate. PMID:956126

  5. Involvement of Phosphatidylinositol 3-kinase in the regulation of proline catabolism in Arabidopsis thaliana.

    PubMed

    Leprince, Anne-Sophie; Magalhaes, Nelly; De Vos, Delphine; Bordenave, Marianne; Crilat, Emilie; Clément, Gilles; Meyer, Christian; Munnik, Teun; Savouré, Arnould

    2014-01-01

    Plant adaptation to abiotic stresses such as drought and salinity involves complex regulatory processes. Deciphering the signaling components that are involved in stress signal transduction and cellular responses is of importance to understand how plants cope with salt stress. Accumulation of osmolytes such as proline is considered to participate in the osmotic adjustment of plant cells to salinity. Proline accumulation results from a tight regulation between its biosynthesis and catabolism. Lipid signal components such as phospholipases C and D have previously been shown to be involved in the regulation of proline metabolism in Arabidopsis thaliana. In this study, we demonstrate that proline metabolism is also regulated by class-III Phosphatidylinositol 3-kinase (PI3K), VPS34, which catalyses the formation of phosphatidylinositol 3-phosphate (PI3P) from phosphatidylinositol. Using pharmacological and biochemical approaches, we show that the PI3K inhibitor, LY294002, affects PI3P levels in vivo and that it triggers a decrease in proline accumulation in response to salt treatment of A. thaliana seedlings. The lower proline accumulation is correlated with a lower transcript level of Pyrroline-5-carboxylate synthetase 1 (P5CS1) biosynthetic enzyme and higher transcript and protein levels of Proline dehydrogenase 1 (ProDH1), a key-enzyme in proline catabolism. We also found that the ProDH1 expression is induced in a pi3k-hemizygous mutant, further demonstrating that PI3K is involved in the regulation of proline catabolism through transcriptional regulation of ProDH1. A broader metabolomic analysis indicates that LY294002 also reduced other metabolites, such as hydrophobic and aromatic amino acids and sugars like raffinose. PMID:25628629

  6. Involvement of Phosphatidylinositol 3-kinase in the regulation of proline catabolism in Arabidopsis thaliana

    PubMed Central

    Leprince, Anne-Sophie; Magalhaes, Nelly; De Vos, Delphine; Bordenave, Marianne; Crilat, Emilie; Clément, Gilles; Meyer, Christian; Munnik, Teun; Savouré, Arnould

    2015-01-01

    Plant adaptation to abiotic stresses such as drought and salinity involves complex regulatory processes. Deciphering the signaling components that are involved in stress signal transduction and cellular responses is of importance to understand how plants cope with salt stress. Accumulation of osmolytes such as proline is considered to participate in the osmotic adjustment of plant cells to salinity. Proline accumulation results from a tight regulation between its biosynthesis and catabolism. Lipid signal components such as phospholipases C and D have previously been shown to be involved in the regulation of proline metabolism in Arabidopsis thaliana. In this study, we demonstrate that proline metabolism is also regulated by class-III Phosphatidylinositol 3-kinase (PI3K), VPS34, which catalyses the formation of phosphatidylinositol 3-phosphate (PI3P) from phosphatidylinositol. Using pharmacological and biochemical approaches, we show that the PI3K inhibitor, LY294002, affects PI3P levels in vivo and that it triggers a decrease in proline accumulation in response to salt treatment of A. thaliana seedlings. The lower proline accumulation is correlated with a lower transcript level of Pyrroline-5-carboxylate synthetase 1 (P5CS1) biosynthetic enzyme and higher transcript and protein levels of Proline dehydrogenase 1 (ProDH1), a key-enzyme in proline catabolism. We also found that the ProDH1 expression is induced in a pi3k-hemizygous mutant, further demonstrating that PI3K is involved in the regulation of proline catabolism through transcriptional regulation of ProDH1. A broader metabolomic analysis indicates that LY294002 also reduced other metabolites, such as hydrophobic and aromatic amino acids and sugars like raffinose. PMID:25628629

  7. Proline Dehydrogenase Regulates Redox State and Respiratory Metabolism in Trypanosoma cruzi

    PubMed Central

    Paes, Lisvane Silva; Suárez Mantilla, Brian; Zimbres, Flávia Menezes; Pral, Elisabeth Mieko Furusho; Diogo de Melo, Patrícia; Tahara, Erich B.; Kowaltowski, Alicia J.; Elias, Maria Carolina; Silber, Ariel Mariano

    2013-01-01

    Over the past three decades, L-proline has become recognized as an important metabolite for trypanosomatids. It is involved in a number of key processes, including energy metabolism, resistance to oxidative and nutritional stress and osmoregulation. In addition, this amino acid supports critical parasite life cycle processes by acting as an energy source, thus enabling host-cell invasion by the parasite and subsequent parasite differentiation. In this paper, we demonstrate that L-proline is oxidized to Δ1-pyrroline-5-carboxylate (P5C) by the enzyme proline dehydrogenase (TcPRODH, E.C. 1.5.99.8) localized in Trypanosoma cruzi mitochondria. When expressed in its active form in Escherichia coli, TcPRODH exhibits a Km of 16.58±1.69 µM and a Vmax of 66±2 nmol/min mg. Furthermore, we demonstrate that TcPRODH is a FAD-dependent dimeric state protein. TcPRODH mRNA and protein expression are strongly upregulated in the intracellular epimastigote, a stage which requires an external supply of proline. In addition, when Saccharomyces cerevisiae null mutants for this gene (PUT1) were complemented with the TcPRODH gene, diminished free intracellular proline levels and an enhanced sensitivity to oxidative stress in comparison to the null mutant were observed, supporting the hypothesis that free proline accumulation constitutes a defense against oxidative imbalance. Finally, we show that proline oxidation increases cytochrome c oxidase activity in mitochondrial vesicles. Overall, these results demonstrate that TcPRODH is involved in proline-dependant cytoprotection during periods of oxidative imbalance and also shed light on the participation of proline in energy metabolism, which drives critical processes of the T. cruzi life cycle. PMID:23894476

  8. Identification of a PutP proline permease gene homolog from Staphylococcus aureus by expression cloning of the high-affinity proline transport system in Escherichia coli.

    PubMed Central

    Wengender, P A; Miller, K J

    1995-01-01

    The important food-borne pathogen Staphylococcus aureus is distinguished by its ability to grow at low water activity values. Previous work in our laboratory and by others has revealed that proline accumulation via transport is an important osmoregulatory strategy employed by this bacterium. Furthermore, proline uptake by this bacterium has been shown to be mediated by two distinct transport systems: a high-affinity system and a low-affinity system (J.-H. Bae, and K. J. Miller, Appl. Environ. Microbiol. 58:471-475, 1992; D. E. Townsend and B. J. Wilkinson, J. Bacteriol. 174:2702-2710, 1992). In the present study, we report the cloning of the high-affinity proline transport system of S. aureus by functional expression in an Escherichia coli host. The sequence of the staphylococcal proline permease gene was predicted to encode a protein of 497 amino acids which shares 49% identity with the PutP high-affinity proline permease of E. coli. Analysis of hydropathy also indicated a common overall structure for these proteins. PMID:7887605

  9. Proline-based Phosphoramidite Reagents for the Reductive Ligation of S-Nitrosothiols

    PubMed Central

    Xian, Ming

    2015-01-01

    S-Nitrosothiols have many biological implications but are rarely used in organic synthesis. In this work we report the development of proline-based phosphoramidite substrates that can effectively convert S-nitrosothiols to proline-based sulfenamides through a reductive ligation process. A unique property of this method is that the phosphine oxide moiety on the ligation products can be readily removed under acidic conditions. In conjugation with the facile preparation of S-nitrosothiols (RSNO) from the corresponding thiols (RSH), this method provides a new way to prepare proline-based sulfenamides from simple thiol starting materials. PMID:26758493

  10. Mercury'S Radar Bright Region C: Mg-rich Orthopyroxene And Olivine, K-spar, Iron-free Tio2, Ca- And Mg-garnet Indicate Possible Deep Crust Or Mantle Rock Exposures

    NASA Astrophysics Data System (ADS)

    Kozlowski, Richard W.; Donaldson Hanna, K. L.; Sprague, A. L.; Helbert, J.; Maturilli, A.

    2008-09-01

    We identify mineral phases and approximate abundances on Mercury's surface for a large (600 by 600 km) region at and around radar bright region C (Harmon, 1997, Adv. Space Res.). Our results are obtained by fitting spectra obtained with the Mid-Infrared Spectrometer and Imager (MIRSI) at the Infrared Telescope Facility (IRTF) using an established spectral deconvolution algorithm (Ramsey 1996, Ph.D. Dissertation, ASU; Ramsey and Christiansen 1998, JGR). We have assembled several laboratory mineral spectral libraries (JHU, Salisbury et al. 1987, Open-File Report 87-263, USGS; JPL, http://speclib.jpl.nasa.gov; RELAB, http://www.planetary.brown.edu/relab; ASU, Christensen et al. 2000, JGR; BED, Helbert et al. 2007, Adv. Space Res.; USGS, Clark et al. 2007, USGS digital spectral library) with a wide range of known mineral compositions with grain sizes ranging from the finest separates, 0 - 45 µm, incrementally increasing to 250 - 400 µm. For the region 110° to 130° E longitude and 0° to 20° N latitude we find enstatite and Mg-rich hypersthene, K-spar (either sanidine or orthoclase), intermediate plagioclase compositions, Mg-rich olivine, an iron-free opaque phase of either (TiO2) or perovskite (CaTiO3). Small abundances of Mg- and Ca- rich garnet are also apparently present. These minerals are indicative of possible excavated upper mantle material that may be causing the high radar backscatter at this location. This work was funded by NSF AST0406796.

  11. Differential regulation of a hydroxyproline-rich glycoprotein gene family in wounded and infected plants.

    PubMed Central

    Corbin, D R; Sauer, N; Lamb, C J

    1987-01-01

    We have characterized three different transcripts induced by fungal elicitor, wounding, or infection which encode apoproteins of cell wall hydroxyproline-rich glycoproteins involved in plant defense against infection. The proteins encoded by two of these transcripts contain a proline-rich domain involving tandem repetition of the 16-amino-acid unit Tyr3-Lys-Ser-Pro4-Ser-Pro-Ser-Pro4. The third transcript encodes a protein with a proline-rich domain involving a variant of this 16-mer canonical repeat: Tyr3-His-Ser-Pro4-Lys-His-Ser-Pro4. Each transcript is encoded by a separate gene present at single or low copy number in the haploid genome. These transcripts exhibit markedly different patterns of accumulation in different stress conditions, indicating the operation of several distinct intercellular stress signal systems in higher plants. Images PMID:3437892

  12. Structure of the Proline Utilization A Proline Dehydrogenase Domain Inactivated by N-propargylglycine Provides Insight into Conformational Changes Induced by Substrate Binding and Flavin Reduction†,‡

    PubMed Central

    Srivastava, Dhiraj; Zhu, Weidong; Johnson, William H.; Whitman, Christian P.; Becker, Donald F.; Tanner, John J.

    2013-01-01

    Proline utilization A (PutA) from Escherichia coli is a flavoprotein that has mutually exclusive roles as a transcriptional repressor of the put regulon and a membrane-associated enzyme that catalyzes the oxidation of proline to glutamate. Previous studies have shown that the binding of proline in the proline dehydrogenase (PRODH) active site and subsequent reduction of the FAD trigger global conformational changes that enhance PutA-membrane affinity. These events cause PutA to switch from its repressor to enzymatic role, but the mechanism by which this signal is propagated from the active site to the distal membrane-binding domain is largely unknown. Here, it is shown that N-propargylglycine irreversibly inactivates PutA by covalently linking the flavin N(5) atom to the ε-amino of Lys329. Furthermore, inactivation locks PutA into a conformation that may mimic the proline reduced, membrane-associated form. The 2.15 Å resolution structure of the inactivated PRODH domain suggests that the initial events involved in broadcasting the reduced flavin state to the distal membrane binding domain include major reorganization of the flavin ribityl chain, severe (35 degree) butterfly bending of the isoalloxazine ring, and disruption of an electrostatic network involving the flavin N(5), Arg431, and Asp370. The structure also provides information about conformational changes associated with substrate binding. This analysis suggests that the active site is incompletely assembled in the absence of the substrate, and the binding of proline draws together conserved residues in helix 8 and the β1-αl loop to complete the active site. PMID:19994913

  13. On Spontaneously Pulsating Proline-Phenylalanine Peptide Microfibers.

    PubMed

    Godziek, Agnieszka; Maciejowska, Anna; Talik, Ewa; Wrzalik, Roman; Sajewicz, Mieczysław; Kowalska, Teresa

    2016-01-01

    Earlier, we have collected an experimental evidence showing that low molecular weight chiral carboxylic acids (amino acids included) can spontaneously undergo an oscillatory chiral conversion and an oscillatory condensation in abiotic aqueous and non-aqueous liquid systems, stored for certain amount of time under mild external conditions. These earlier findings are summarized in the introductory part of this study. In the second part, a preliminary report is given on spontaneous pulsation of peptide microfibers in the aged proline-phenylalanine (Pro-Phe) solution in 70% aqueous acetonitrile. The experimental evidence originates from a number of advanced analytical techniques. In view of our earlier and present findings, a presumption is made that the mechanism of spontaneous pulsation (formation and decay) of Pro-Phe microfibers is directly related to the oscillatory chiral conversion and oscillatory peptidization. The entity of the discussed results pointing out to spontaneous and uncontrolled instability of peptide structures might be a bad prognostic for employing such structures in nanobiotechnology. PMID:26521956

  14. Identification of highly deformed even-even nuclei in the neutron- and proton-rich regions of the nuclear chart from the B(E2)↑ and E2 predictions in the generalized differential equation model

    NASA Astrophysics Data System (ADS)

    Nayak, R. C.; Pattnaik, S.

    2015-11-01

    We identify here the possible occurrence of large deformations in the neutron- and proton-rich (n-rich and p-rich) regions of the nuclear chart from extensive predictions of the values of the reduced quadrupole transition probability B(E2)↑ for the transition from the ground state to the first 2+ state and the corresponding excitation energy E2 of even-even nuclei in the recently developed generalized differential equation (GDE) model exclusively meant for these physical quantities. This is made possible from our analysis of the predicted values of these two physical quantities and the corresponding deformation parameters derived from them such as the quadrupole deformation β2, the ratio of β2 to the Weisskopf single-particle β2(sp) and the intrinsic electric quadrupole moment Q0, calculated for a large number of both known as well as hitherto unknown even-even isotopes of oxygen to fermium (0 to FM; Z = 8-100). Our critical analysis of the resulting data convincingly support possible existence of large collectivity for the nuclides 30,32Ne,34Mg, 60Ti, 42,62,64Cr,50,68Fe, 52,72Ni, 72,70,96Kr,74,76Sr,78,80,106,108Zr, 82,84,110,112Mo, 140Te,144Xe, 148Ba,122Ce, 128,156Nd,130,132,158,160Sm and 138,162,164,166Gd, whose values of β2 are found to exceed 0.3 and even 0.4 in some cases. Our findings of large deformations in the exotic n-rich regions support the existence of another “island of inversion” in the heavy-mass region possibly caused by breaking of the N = 70 subshell closure.

  15. Crystal structures of coordination polymers from CaI2 and proline

    PubMed Central

    Lamberts, Kevin; Englert, Ulli

    2015-01-01

    Completing our reports concerning the reaction products from calcium halides and the amino acid proline, two different solids were found for the reaction of l- and dl-proline with CaI2. The enanti­opure amino acid yields the one-dimensional coordination polymer catena-poly[[aqua-μ3-l-proline-tetra-μ2-l-proline-dicalcium] tetra­iodide 1.7-hydrate], {[Ca2(C5H9NO2)5(H2O)]I4·1.7H2O}n, (1), with two independent Ca2+ cations in characteristic seven- and eightfold coordination. Five symmetry-independent zwitterionic l-proline mol­ecules bridge the metal sites into a cationic polymer. Racemic proline forms with Ca2+ cations heterochiral chains of the one-dimensional polymer catena-poly[[di­aquadi-μ2-dl-proline-calcium] diiodide], {[Ca(C5H9NO2)2(H2O)2]I2}n, (2). The centrosymmetric structure is built by one Ca2+ cation that is bridged towards its symmetry equivalents by two zwitterionic proline mol­ecules. In both structures, the iodide ions remain non-coordinating and hydrogen bonds are formed between these counter-anions, the amino groups, coordinating and co-crystallized water mol­ecules. While the overall composition of (1) and (2) is in line with other structures from calcium halides and amino acids, the diversity of the carboxyl­ate coordination geometry is quite surprising. PMID:26090148

  16. Proline transport by brush-border membrane vesicles of lobster antennal glands

    SciTech Connect

    Behnke, R.D.; Wong, R.K.; Huse, S.M.; Reshkin, S.J.; Ahearn, G.A. )

    1990-02-01

    Purified brush-border membrane vesicles (BBMV) of lobster antennal gland labyrinth and bladder were separately formed by a magnesium precipitation technique. L-(3H)proline uptake was stimulated by a transmembrane NaCl gradient (outside (o) greater than inside (i)) to a greater extent in BBMV from labyrinth than those from the bladder. Detailed study of the labyrinth proline-transport processes revealed a specific dependence on NaCl, with negligible stimulatory effects by NaSCN, Na-gluconate, or KCl. A transmembrane proton gradient (o greater than i) was without stimulatory effect on proline transport. A transmembrane potential difference alone, in the presence of equilibrated NaCl and L-(3H)proline, led to net influx of the labeled amino acid, suggesting that the uptake process was electrogenic and capable of bringing about the net transfer of positive charge to the vesicle interior. Although a transmembrane Na gradient alone, in the presence of equilibrated Cl and L-(3H)proline, was able to bring about the net influx of the amino acid, a transmembrane Cl gradient alone under Na- and L-(3H)proline-equilibrated conditions was not, suggesting that only the Na gradient could energize the carrier process through cotransport, while the anion served an essential activating role. Proline influx by these vesicles occurred by the combination of at least one saturable Michaelis-Menten carrier system (apparent Kt = 0.37 mM; apparent JM = 1.19 nmol.mg protein-1.10 s-1) and apparent diffusion (P = 0.33 nmol.mg protein-1.10 s-1.mM-1). Static head analysis of the transport process suggested a cotransport stoichiometry of 2 Na:1 proline with essential activation by Cl ion.

  17. Responses of reactive oxygen scavenging enzymes, proline and malondialdehyde to water deficits among six secondary successional seral species in Loess Plateau.

    PubMed

    Du, Feng; Shi, Huijun; Zhang, Xingchang; Xu, Xuexuan

    2014-01-01

    Drought can impact local vegetation dynamics in a long term. In order to predict the possible successional pathway of local community under drought, the responses of some drought resistance indices of six successional seral species in the semi-arid Loss Hilly Region of China were illustrated and compared on three levels of soil water deficits along three growing months (7, 8 and 9). The results showed that: 1) the six species had significant differences in SOD, POD activities and MDA content. The rank correlations between SOD, POD activities and the successional niche positions of the six species were positive, and the correlation between MDA content and the niche positions was negative; 2) activities of SOD, CAT and POD, and content of proline and MDA had significant differences among the three months; 3) there existed significant interactions of SOD, CAT, POD activities and MDA content between months and species. With an exception, no interaction of proline was found. Proline in leaves had a general decline in reproductive month; 4) SOD, CAT, POD activities and proline content had negative correlations with MDA content. Among which, the correlation between SOD activity and MDA content was significant. The results implied that, in arid or semiarid region, the species at later successional stage tend to have strong drought resistance than those at early stage. Anti-drought indices can partially interpret the pathway of community succession in the drought impacted area. SOD activity is more distinct and important on the scope of protecting membrane damage through the scavenging of ROS on exposure to drought. PMID:24914928

  18. Proline-15 creates an amphipathic wedge in maculatin 1.1 peptides that drives lipid membrane disruption.

    PubMed

    Sani, Marc-Antoine; Lee, Tzong-Hsien; Aguilar, Marie-Isabel; Separovic, Frances

    2015-10-01

    The membrane interaction of peptides derived from maculatin 1.1 and caerin 1.1, with the sequence motif of N and C termini of maculatin 1.1, was compared in order to understand the role of these common sequence motifs, which encompass critical proline residues, on peptide secondary structure and on membrane binding and disruption in zwitterionic and anionic membranes. The peptides incorporated a single substitution with lysine or deletion of the central region to mimic the length of the antimicrobial peptides, citropin 1.1 and aurein 1.2. The impact of these changes in the sequence, length and physicochemical properties, on lytic activity and structure was assessed by dye-release from lipid vesicles and the change in the bilayer order as a function of membrane-bound peptide mass. All peptides adopted similar degrees of helical structure in both membrane systems. In addition, all peptide analogues were less active than either maculatin 1.1 or caerin 1.1 in dye release assays. The membrane binding was analyzed by dual polarization interferometry and the results showed that membrane binding was significantly affected by changes in the hydrophobic environment of Pro-15. Moreover, changes in the relative distribution of charge and hydrophobicity flanking Pro-15 also caused significant changes to the membrane order. Overall, the proline residue plays an important role in inducing a peptide structure that enhances the activity of these antimicrobial peptides. PMID:26079051

  19. Quest for Cells Responsible for Age-related Increase of Salivary Glycine and Proline.

    PubMed

    Hino, Shunsuke; Nishiyama, Akira; Matsuta, Tomohiko; Horie, Norio; Shimoyama, Tetsuo; Tanaka, Shoji; Sakagami, Hiroshi

    2016-01-01

    We have previously reported that salivary glycine and proline levels are increased to nearly butanoate level in elderly people. In order to identify the source of glycine and proline, we performed high-performance liquid chromatography analysis of amino acid production to a total of seven oral cells before and after stimulation with inflammation inducers. We found that production of amino acids (per a given number of cells) by normal oral mesenchymal cells (gingival fibroblast, pulp cell, periodontal ligament fibroblast) was approximately three-fold that of oral squamous cell carcinoma cell lines (HSC-2, HSC-3, HSC-4, Ca9-22), and that production of glycine and especially proline by all these seven cells was much lower than that of glutamine and glutamic acid. Treatment of three oral mesenchymal cells with interleukin (IL)-1β or lipopoly-saccharide (LPS) reproducibly increased the production of glutamic acid and glutamine, but not that of glycine and proline. Glycine and proline only marginally stimulated the IL-8 production by IL-1β-stimulated gingival fibroblast, whereas glycine dose-dependently inhibited the nitric oxide production by lipopolysaccharide-stimulated mouse macrophage-like RAW264.7 cells. These data demonstrated that normal oral mesenchymal cells are not the major source of glycine and proline that accumulates in the saliva of aged people, suggesting the involvement of the deregulation of collagen metabolism during aging. PMID:26912818

  20. Normal Myeloid Development Requires Both the Glutamine-Rich Transactivation Domain and the PEST Region of Transcription Factor PU.1 but Not the Potent Acidic Transactivation Domain

    PubMed Central

    Fisher, Robert C.; Olson, Marilyn C.; Pongubala, Jagan M. R.; Perkel, Jeffrey M.; Atchison, Michael L.; Scott, Edward W.; Simon, M. Celeste

    1998-01-01

    Gene targeting of transcription factor PU.1 results in an early block to fetal hematopoiesis, with no detectable lymphoid or myeloid cells produced in mouse embryos. Furthermore, PU.1−/− embryonic stem (ES) cells fail to differentiate into Mac-1+ and F4/80+ macrophages in vitro. We have previously shown that a PU.1 transgene under the control of its own promoter restores the ability of PU.1−/− ES cells to differentiate into macrophages. In this study, we take advantage of our PU.1−/− ES cell rescue system to genetically test which previously identified PU.1 functional domains are necessary for the development of mature macrophages. PU.1 functional domains include multiple N-terminal acidic and glutamine-rich transactivation domains, a PEST domain, several serine phosphorylation sites, and a C-terminal Ets DNA binding domain, all delineated and characterized by using standard biochemical and transactivational assays. By using the production of mature macrophages as a functional readout in our assay system, we have established that the glutamine-rich transactivation domain, a portion of the PEST domain, and the DNA binding domain are required for myelopoiesis. Deletion of three acidic domains, which exhibit potent transactivation potential in vitro, had no effect on the ability of PU.1 to promote macrophage development. Furthermore, mutagenesis of four independent sites of serine phosphorylation also had no effect on myelopoiesis. Collectively, our results indicate that PU.1 interacts with important regulatory proteins during macrophage development via the glutamine-rich and PEST domains. The PU.1−/− ES cell rescue system represents a powerful, in vitro strategy to functionally map domains of PU.1 essential for normal hematopoiesis and the generation of mature macrophages. PMID:9632818

  1. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  2. Study of the tensor correlation in a neutron-rich sd-shell region with mean-field and beyond-mean-field methods

    SciTech Connect

    Sugimoto, Satoru; Toki, Hiroshi; Ikeda, Kiyomi

    2008-04-29

    We study the effect of the tensor force on nuclear structure with mean-field and beyond-mean-field methods. An important correlation induced by the tensor force is a two-particle-two-hole (2p2h) correlation, which cannot be treated with a standard mean-field method. To treat the 2p2h tensor correlation, we develop a new framework [charge- and parity-projected Hartree-Fock (CPPHF) method], which is a beyond-mean-field method. In the CPPHF method, we introduce single-particle states with parity and charge mixing. The parity and charge projections are performed on a total wave function before variation. We apply the CPPHF method to oxygen isotopes including neutron-rich ones. The potential energy from the tensor force has the same order of magnitude as that from the LS force and becomes smaller with neutron number, which indicates that excess neutrons do not contribute to the 2p2h tensor correlation significantly. We also study the effect of the tensor force on spin-orbit-splitting (ls-splitting) in a neutron-rich fluorine isotope {sup 23}F. The tensor force reduces the ls-splitting for the proton d-orbits by about 3 MeV. This effect is important to reproduce the experimental value.

  3. Study of the tensor correlation in a neutron-rich sd-shell region with the charge- and parity-projected Hartree-Fock method

    SciTech Connect

    Sugimoto, Satoru; Toki, Hiroshi; Ikeda, Kiyomi

    2008-05-12

    We study the effect of the tensor force on nuclear structure with mean-field and beyond-mean-field methods. An important correlation induced by the tensor force is two-particle-two-hole (2p2h) correlation, which cannot be treated with a usual mean-filed method. To treat the 2p2h tensor correlation, we develop a new framework (charge- and parity-projected Hartree-Fock (CPPHF) method), which is a beyond-mean-field method. In the CPPHF method, we introduce single-particle states with parity and charge mixing. The parity and charge projections are performed on a total wave function before variation. We apply the CPPHF method to oxygen isotopes including neutron-rich ones. The potential energy from the tensor force has the same order of magnitude with that from the LS force and becomes smaller with neutron number, which indicates that excess neutrons do not contribute to the 2p2h tensor correlation significantly. We also study the effect of the tensor force on spin-orbit-splitting (ls-splitting) in a neutron-rich fluorine isotope {sup 23}F. The tensor force reduces the ls-splitting for the proton d-orbits by about 3 MeV. This effect is important to reproduce the experimental value. We also find that the 2p2h tensor correlation does not affect the ls-splitting in {sup 23}F.

  4. Boron-rich mud volcanoes of the Black Sea region: modern analogues to ancient sea-floor tourmalinites associated with Sullivan-type Pb-Zn deposits?

    USGS Publications Warehouse

    Slack, J.F.; Turner, R.J.W.; Ware, P.L.G.

    1998-01-01

    Large submarine mud volcanoes in the abyssal part of the Black Sea south of the Crimean Peninsula are similar in many respects to synsedimentary mud volcanoes in the Mesoproterozoic Belt-Purcell basin. One of the Belt-Purcell mud volcanoes directly underlies the giant Sullivan Pb-Zn-Ag deposit in southeastern British Columbia. Footwall rocks to the Sullivan deposit comprise variably tourmalinized siltstone, conglomerate, and related fragmental rock; local thin pyrrhotite-rich and spessartine-quartz beds are interpreted as Fe and Fe-Mn exhalites, respectively. Analogous Fe- and Mn-rich sediments occur near the abyssal Black Sea mud volcanoes. Massive pyrite crusts and associated carbonate chimneys discovered in relatively shallow waters (~200 m depth) west of the Crimean Peninsula indicate an active sea-floor-hydrothermal system. Subaerial mud volcanoes on the Kerch and Taman Peninsulas (~100 km north of the abyssal mud volcanoes) contain saline thermal waters that locally have very high B contents (to 915 mg/L). These data suggest that tourmalinites might be forming in or near submarine Black Sea mud volcanoes, where potential may also exist for Sullivan-type Pb-Zn mineralization.

  5. The study of neutron-rich nuclei production in the region of the closed shell N=126 in the multi-nucleon transfer reaction 136Xe+208Pb

    NASA Astrophysics Data System (ADS)

    Novikov, K.; Harca, I. M.; Kozulin, E. M.; Dmitriev, S.; Itkis, J.; Knyazheva, G.; Loktev, T.; Corradi, L.; Valiente-Dobon, J.; Fioretto, E.; Montanari, D.; Stefanini, A. M.; Vardaci, E.; Quero, D.; Montagnoli, G.; Scarlassara, F.; Strano, E.; Pollarolo, G.; Piot, J.; Mijatović, T.; Szilner, S.; Ackermann, D.; Chubarian, G.; Trzaska, W. H.

    2016-04-01

    The unexplored area of heavy neutron rich nuclei is extremely important for nuclear astrophysics investigations and, in particular, for the understanding of the r-process of astrophysical nucleogenesis. For the production of heavy neutron rich nuclei located along the neutron closed shell N=126 (probably the last "waiting point" in the r-process of nucleosynthesis) the low-energy multi-nucleon transfer reaction 136Xe+208Pb at Elab=870MeV was explored. Due to the stabilizing effect of the closed neutron shells in both nuclei, N=82 and N=126, and the rather favorable proton transfer from lead to xenon, the light fragments formed in this process are well bound and the Q-value of the reaction is nearly zero. Measurements were performed with the PRISMA spectrometer in coincidence with an additional time-of-flight (ToF) arm on the +20 beam line of the PIAVE-ALPI accelerator in Legnaro, Italy. The PRISMA spectrometer allows identification of the A, Z and velocity of the projectile-like fragments (PLF), while the second arm gives access to the target-like fragments (TLF). Details on the experimental setup and preliminary results are reported.

  6. Boron-rich mud volcanoes of the Black Sea region: Modern analogues to ancient sea-floor tourmalinites associated with Sullivan-type Pb-Zn deposits?

    NASA Astrophysics Data System (ADS)

    Slack, John F.; Turner, Robert J. W.; Ware, Paul L. G.

    1998-05-01

    Large submarine mud volcanoes in the abyssal part of the Black Sea south of the Crimean Peninsula are similar in many respects to synsedimentary mud volcanoes in the Mesoproterozoic Belt-Purcell basin. One of the Belt-Purcell mud volcanoes directly underlies the giant Sullivan Pb-Zn-Ag deposit in southeastern British Columbia. Footwall rocks to the Sullivan deposit comprise variably tourmalinized siltstone, conglomerate, and related fragmental rock; local thin pyrrhotite-rich and spessartine-quartz beds are interpreted as Fe and Fe-Mn exhalites, respectively. Analogous Fe- and Mn-rich sediments occur near the abyssal Black Sea mud volcanoes. Massive pyrite crusts and associated carbonate chimneys discovered in relatively shallow waters (˜200 m depth) west of the Crimean Peninsula indicate an active sea-floor hydrothermal system. Subaerial mud volcanoes on the Kerch and Taman Peninsulas (˜100 km north of the abyssal mud volcanoes) contain saline thermal waters that locally have very high B contents (to 915 mg/L). These data suggest that tourmalinites might be forming in or near submarine Black Sea mud volcanoes, where potential may also exist for Sullivan-type Pb-Zn mineralization.

  7. Crystal structure of histidine-rich glycoprotein N2 domain reveals redox activity at an interdomain disulfide bridge: implications for angiogenic regulation

    PubMed Central

    Kassaar, Omar; McMahon, Stephen A.; Thompson, Rory; Botting, Catherine H.; Naismith, James H.

    2014-01-01

    Histidine-rich glycoprotein (HRG) is a plasma protein consisting of 6 distinct functional domains and is an important regulator of key cardiovascular processes, including angiogenesis and coagulation. The protein is composed of 2 N-terminal domains (N1 and N2), 2 proline-rich regions (PRR1 and PRR2) that flank a histidine-rich region (HRR), and a C-terminal domain. To date, structural information of HRG has largely come from sequence analysis and spectroscopic studies. It is thought that an HRG fragment containing the HRR, released via plasmin-mediated cleavage, acts as a negative regulator of angiogenesis in vivo. However, its release also requires cleavage of a disulphide bond suggesting that its activity is mediated by a redox process. Here, we present a 1.93 Å resolution crystal structure of the N2 domain of serum-purified rabbit HRG. The structure confirms that the N2 domain, which along with the N1 domain, forms an important molecular interaction site on HRG, possesses a cystatin-like fold composed of a 5-stranded antiparallel β-sheet wrapped around a 5-turn α-helix. A native N-linked glycosylation site was identified at Asn184. Moreover, the structure reveals the presence of an S-glutathionyl adduct at Cys185, which has implications for the redox-mediated release of the antiangiogenic cleavage product from HRG. PMID:24501222

  8. Insertion proQ220::Tn5 alters regulation of proline porter II, a transporter of proline and glycine betaine in Escherichia coli.

    PubMed Central

    Milner, J L; Wood, J M

    1989-01-01

    Mutation pro-220::Tn5, which increases the resistance of Escherichia coli to 3,4-dehydroproline (M. E. Stalmach, S. Grothe, and J. M. Wood, J. Bacteriol. 156:481-486, 1983), is not linked to putP, proP, or proU. It was located at 40.4 min on the E. coli chromosomal linkage map, by conjugational and transductional mapping, and is now denoted proQ220::Tn5. Proline porter II was not detectable when proQ220::Tn5 proP+ bacteria were cultivated under optimal conditions or with nutritional stress (amino acid limitation). Toxic proline analog sensitivity and proline porter II activity were partially restored to proQ220::Tn5 proP+ bacteria, but not to a proQ220::Tn5 proP219 strain, by a hyperosmotic shift and by growth under osmotic stress. Elevated expression of a proP::lacZ gene fusion, for bacteria grown under osmotic stress, was not influenced by the proQ220::Tn5 insertion. We propose that the proQ locus encodes a positive regulatory element which elevates proline porter II activity. PMID:2536686

  9. Perturbation of Critical Prolines in Gloeobacter violaceus Ligand-gated Ion Channel (GLIC) Supports Conserved Gating Motions among Cys-loop Receptors*

    PubMed Central

    Rienzo, Matthew; Rocchi, Angela R.; Threatt, Stephanie D.; Dougherty, Dennis A.; Lummis, Sarah C. R.

    2016-01-01

    Gloeobacter violaceus ligand-gated ion channel (GLIC) has served as a valuable structural and functional model for the eukaryotic Cys-loop receptor superfamily. In Cys-loop and other receptors, we have previously demonstrated the crucial roles played by several conserved prolines. Here we explore the role of prolines in the gating transitions of GLIC. As conventional substitutions at some positions resulted in nonfunctional proteins, we used in vivo non-canonical amino acid mutagenesis to determine the specific structural requirements at these sites. Receptors were expressed heterologously in Xenopus laevis oocytes, and whole-cell electrophysiology was used to monitor channel activity. Pro-119 in the Cys-loop, Pro-198 and Pro-203 in the M1 helix, and Pro-299 in the M4 helix were sensitive to substitution, and distinct roles in receptor activity were revealed for each. In the context of the available structural data for GLIC, the behaviors of Pro-119, Pro-203, and Pro-299 mutants are consistent with earlier proline mutagenesis work. However, the Pro-198 site displays a unique phenotype that gives evidence of the importance of the region surrounding this residue for the correct functioning of GLIC. PMID:26668320

  10. Reconstitution and spectroscopic analysis of caveolin-1 residues 62-178 reveals that proline 110 governs its structure and solvent exposure.

    PubMed

    Root, Kyle T; Glover, Kerney Jebrell

    2016-04-01

    Caveolin-1 is a membrane protein that possesses an unusual topology where both N- and C-termini are cytoplasmic as a result of a membrane-embedded turn. In particular, proline 110 has been postulated to be the linchpin of this unusual motif. Using a caveolin-1 construct (residues 62-178) reconstituted into dodecylphosphocholine micelles with and without a cholesterol mimic, the changes that occurred upon P110A mutation were probed. Using far UV circular dichroism spectroscopy it was shown that cholesterol attenuated the helicity of caveolin-1, and that mutation of P110 to alanine caused a significant increase in the α-helicity of the protein. Near UV circular dichroism spectroscopy showed significant changes in structure and/or environment upon mutation that again were modulated by the presence of cholesterol. Stern-Volmer quenching and λ(max) analysis of tryptophan residues showed that the proline mutation caused W85 to become more exposed, W98 and W115 to become less exposed, and W128 showed no change. This finding provided evidence that regions proximal and far away from the proline are buried differentially upon its mutation and therefore this residue is strongly tied to maintaining the hydrophobic coverage along the caveolin-1 sequence. In the presence of cholesterol, the accessibilities of the two tryptophan residues that proceeded position 110 were altered much more significantly upon P110A mutation than the two tryptophans aft P110. Overall, this work provides strong evidence that proline 110 is critical for maintaining both the structure and hydrophobic coverage of caveolin-1 and that cholesterol also plays a significant role in modulating these parameters. PMID:26775739

  11. Diversification of the plant-specific hybrid glycine-rich protein (HyGRP) genes in cereals.

    PubMed

    Fujino, Kenji; Obara, Mari; Sato, Koji

    2014-01-01

    Plant-specific hybrid proline- or glycine-rich proteins (HyP/GRPs) are involved in diverse gene functions including plant development and responses to biotic and abiotic stresses. The quantitative trait locus, qLTG3-1, enhances seed germination in rice under low-temperature conditions and encodes a member with a glycine-rich motif of the HyP/GRP family. The function of this gene may be related to the weakening of tissue covering the embryo during seed germination. In the present study, the diversification of the HyP/GRP gene family was elucidated in rice based on phylogenetic relationships and gene expression levels. At least 21 members of the HyP/GRP family have been identified in the rice genome and clustered in five regions on four chromosomes by tandem and chromosomal duplications. Of these, OsHyPRP05 (qLTG3-1) and its paralogous gene, OsHyPRP21, had a glycine-rich motif. Furthermore, orthologous genes with a glycine-rich motif and the HyP/GRP gene family were detected in four genome-sequenced monocots: 12 in barley, 10 in Brachypodium, 20 in maize, and 28 in sorghum, using a BLAST search of qLTG3-1 as the query. All members of the HyP/GRP family in these five species were classified into seven main groups, which were clustered together in these species. These results suggested that the HyP/GRP gene family was formed in the ancestral genome before the divergence of these species. The collinearity of chromosomal regions around qLTG3-1 and its orthologous genes were conserved among rice, Brachypodium, sorghum, and maize, indicating that qLTG3-1 and orthologous genes conserve gene function during seed germination. PMID:25309566

  12. Diversification of the plant-specific hybrid glycine-rich protein (HyGRP) genes in cereals

    PubMed Central

    Fujino, Kenji; Obara, Mari; Sato, Koji

    2014-01-01

    Plant-specific hybrid proline- or glycine-rich proteins (HyP/GRPs) are involved in diverse gene functions including plant development and responses to biotic and abiotic stresses. The quantitative trait locus, qLTG3-1, enhances seed germination in rice under low-temperature conditions and encodes a member with a glycine-rich motif of the HyP/GRP family. The function of this gene may be related to the weakening of tissue covering the embryo during seed germination. In the present study, the diversification of the HyP/GRP gene family was elucidated in rice based on phylogenetic relationships and gene expression levels. At least 21 members of the HyP/GRP family have been identified in the rice genome and clustered in five regions on four chromosomes by tandem and chromosomal duplications. Of these, OsHyPRP05 (qLTG3-1) and its paralogous gene, OsHyPRP21, had a glycine-rich motif. Furthermore, orthologous genes with a glycine-rich motif and the HyP/GRP gene family were detected in four genome-sequenced monocots: 12 in barley, 10 in Brachypodium, 20 in maize, and 28 in sorghum, using a BLAST search of qLTG3-1 as the query. All members of the HyP/GRP family in these five species were classified into seven main groups, which were clustered together in these species. These results suggested that the HyP/GRP gene family was formed in the ancestral genome before the divergence of these species. The collinearity of chromosomal regions around qLTG3-1 and its orthologous genes were conserved among rice, Brachypodium, sorghum, and maize, indicating that qLTG3-1 and orthologous genes conserve gene function during seed germination. PMID:25309566

  13. Evidence for Hysteretic Substrate Channeling in the Proline Dehydrogenase and Δ1-Pyrroline-5-carboxylate Dehydrogenase Coupled Reaction of Proline Utilization A (PutA)*

    PubMed Central

    Moxley, Michael A.; Sanyal, Nikhilesh; Krishnan, Navasona; Tanner, John J.; Becker, Donald F.

    2014-01-01

    PutA (proline utilization A) is a large bifunctional flavoenzyme with proline dehydrogenase (PRODH) and Δ1-pyrroline-5-carboxylate dehydrogenase (P5CDH) domains that catalyze the oxidation of l-proline to l-glutamate in two successive reactions. In the PRODH active site, proline undergoes a two-electron oxidation to Δ1-pyrroline-5-carboxlylate, and the FAD cofactor is reduced. In the P5CDH active site, l-glutamate-γ-semialdehyde (the hydrolyzed form of Δ1-pyrroline-5-carboxylate) undergoes a two-electron oxidation in which a hydride is transferred to NAD+-producing NADH and glutamate. Here we report the first kinetic model for the overall PRODH-P5CDH reaction of a PutA enzyme. Global analysis of steady-state and transient kinetic data for the PRODH, P5CDH, and coupled PRODH-P5CDH reactions was used to test various models describing the conversion of proline to glutamate by Escherichia coli PutA. The coupled PRODH-P5CDH activity of PutA is best described by a mechanism in which the intermediate is not released into the bulk medium, i.e., substrate channeling. Unexpectedly, single-turnover kinetic experiments of the coupled PRODH-P5CDH reaction revealed that the rate of NADH formation is 20-fold slower than the steady-state turnover number for the overall reaction, implying that catalytic cycling speeds up throughput. We show that the limiting rate constant observed for NADH formation in the first turnover increases by almost 40-fold after multiple turnovers, achieving half of the steady-state value after 15 turnovers. These results suggest that EcPutA achieves an activated channeling state during the approach to steady state and is thus a new example of a hysteretic enzyme. Potential underlying causes of activation of channeling are discussed. PMID:24352662

  14. Increased expression of phosphorylated forms of heat-shock protein-27 and p38MAPK in macrophage-rich regions of fibro-fatty atherosclerotic lesions in the rabbit.

    PubMed

    Shafi, Shahida; Codrington, Rosalind; Gidden, Lewis Michael; Ferns, Gordon Ashley Anthony

    2016-02-01

    We aimed to assess the expression and distribution of Hsp27, pHsp27 (Ser82), p38MAPK and p-p38MAPK in fibro-fatty atherosclerotic lesions and the myocardium of hypercholesterolaemic rabbits. Male New Zealand white rabbits were fed a high-cholesterol diet for 18 weeks, maintaining serum cholesterol at approximately 20 mmol/l over this period. Aortic arch and myocardial tissues were analysed by Western blot, immunohistochemistry and double immunofluorescence. Plasma Hsp27 levels were measured by ELISA. There was a significant increase in the expression of monomeric and dimeric forms of Hsp27, together with pHsp27 (Ser82), p38MAPK and p-p38MAPK in the fibro-fatty atherosclerotic lesions (P < 0.01; P < 0.05; P < 0.001; and P < 0.001, respectively) and the myocardial tissues (P < 0.001) from the cholesterol-fed rabbits compared with equivalent tissues from controls when the plasma concentration was low. Immunohistochemical analysis of the fibro-fatty lesions showed marked increases in Hsp27 and pHsp27 (Ser82) immunoreactivity. Double immunostaining showed intense expression of pHsp27 and p-p38MAPK in regions that were rich in macrophages, suggesting a close association with these inflammatory cells, whereas, in regions rich in smooth muscle cells, only p-p38MAPK was found to be strongly expressed. An increased expression of pHsp27 (Ser82) was spatially associated with increased p-p38MAPK within fibro-fatty atherosclerotic lesions and was colocalized to regions rich in macrophages. The initial increase in plasma Hsp27 levels may reflect the increase in systemic inflammation and oxidative stress in the early phases of disease. The falling concentrations subsequently may be coincident with the development of the advanced atherosclerotic lesions. PMID:26853073

  15. A spectral line list for water isotopologues in the 1100-4100 cm-1 region for application to CO2-rich planetary atmospheres

    NASA Astrophysics Data System (ADS)

    Gamache, Robert R.; Farese, Michaella; Renaud, Candice L.

    2016-08-01

    A line list of transitions for seven isotopologues of water vapor in the 1100-4100 wavenumber range has been constructed for application to atmospheres rich in CO2. The quantum transitions for H216O, H218O, H217O, HD16O, HD18O, and HD17O are from the 2012 HITRAN database (Rothman et al., 2013) and those for D216O are from the ab initio line list of Shirin et al. (2008). The database was constructed using the best available measured parameters and augmented with theoretical calculations. The half-width, γ, its temperature dependence, n, and the line shift, δ, are for CO2 as the colliding partner or self-collisions and are determined using the Modified Complex Robert-Bonamy (MCRB) theory. The resulting line list contains 282 557 transitions and is available, in the HITRAN 2012 format, from the corresponding author or from the supplemental information of the journal.

  16. Systematic study of the isovector pairing effect on the moment of inertia of proton-rich nuclei in the region 30 <= Z <= 40

    NASA Astrophysics Data System (ADS)

    Ami, I.; Fellah, M.; Benhamouda, N.; Allal, N. H.

    2013-02-01

    A systematic study of the isovector neutron-proton (np) pairing effect on the moment of inertia is performed at zero temperature. This study is based on a recently established expression obtained using the framework of the quantum perturbation theory and the Inglis cranking method, at the limit when the temperature is nil. We considered even-even proton-rich nuclei such as 30 <= Z <= 40 and N - Z = 0, 2, 4 using the single-particle energies and eigen-states of a deformed Woods-Saxon mean-field. The obtained results are compared to their homologues of the conventional BCS theory (i. e. when only the pairing between like-particles is considered).

  17. Application of Pb isotopes to the absolute timing of regional exposure events in carbonate rocks: An example from U-rich dolostones from the Wahoo Formation (Pennsylvanian), Prudhoe Bay, Alaska

    SciTech Connect

    Hoff, J.A.; Hanson, G.N.; Jameson, J.

    1995-01-02

    Pb isotope data from U-rich dolostones from the Wahoo Formation (Pennsylvanian) from the subsurface at Prudhoe Bay, alaska, demonstrate that the U-Th-Pb system can be a powerful geochemical and geochronological tool in understanding carbonate diagenesis. These U-rich dolostones are developed beneath a major, Late Permian to Early Triassic truncational unconformity. U enrichment is uniquely associated with the mineral dolomite, but anomalously high concentrations of U are not present within the dolomite crystal lattice. Major mineral or fluid phases can be ruled out as U hosts. SEM analyses indicate that U anomalies are present in an unknown mineral phase associated with authigenic clays and are commonly concentrated along stylolites. Geologic, petrographic, and geochemical data indicate that the bulk of dolomitization occurred during the Permo-Triassic, following development of a regional unconformity (Jameson 1989a, 1989b, 1990a, 1990b, 1994). In this study, the Pb isotopic composition of these U-rich dolostones is used to establish the absolute timing of U enrichment and its relationship to dolomitization and to the burial history of the Wahoo Formation.

  18. Optimization of the catalytic asymmetric addition of nitroalkanes to cyclic enones with trans-4,5-methano-L-proline.

    PubMed

    Hanessian, Stephen; Shao, Zhihui; Warrier, Jayakumar S

    2006-10-12

    [reaction: see text] The conjugate addition of symmetrical 2-nitroalkanes to 2-cycloalkenones catalyzed by trans-4,5-methano-l-proline proceeds with >99% ee and excellent chemical yields. 1-Nitroalkanes afford diastereomeric syn/anti products that can be separated with good individual enantioselectivities. Proline hydroxamic acid and its trans-4,5-methano -l-proline hydroxamic acid are also effective organocatalysts in the addition of 2-nitropropane to 2-cyclohexenone (75% and 81% ee, respectively). PMID:17020303

  19. Proline accumulation protects Saccharomyces cerevisiae cells in stationary phase from ethanol stress by reducing reactive oxygen species levels.

    PubMed

    Takagi, Hiroshi; Taguchi, Junpei; Kaino, Tomohiro

    2016-08-01

    During fermentation processes, Saccharomyces cerevisiae cells are exposed to multiple stresses, including a high concentration of ethanol that represents toxicity through intracellular reactive oxygen species (ROS) generation. We previously reported that proline protected yeast cells from damage caused by various stresses, such as freezing and ethanol. As an anti-oxidant, proline is suggested to scavenge intracellular ROS. In this study, we examined the role of intracellular proline during ethanol treatment in S. cerevisiae strains that accumulate different concentrations of proline. When cultured in YPD medium, there was a significant accumulation of proline in the put1 mutant strain, which is deficient in proline oxidase, in the stationary phase. Expression of the mutant PRO1 gene, which encodes the γ-glutamyl kinase variant (Asp154Asn or Ile150Thr) with desensitization to feedback inhibition by proline in the put1 mutant strain, showed a prominent increase in proline content as compared with that of the wild-type strain. The oxidation level was clearly increased in wild-type cells after exposure to ethanol, indicating that the generation of ROS occurred. Interestingly, proline accumulation significantly reduces the ROS level and increases the survival rate of yeast cells in the stationary phase under ethanol stress conditions. However, there was not a clear correlation between proline content and survival rate in yeast cells. An appropriate level of intracellular proline in yeast might be important for its stress-protective effect. Hence, the engineering of proline metabolism could be promising for breeding stress-tolerant industrial yeast strains. Copyright © 2016 John Wiley & Sons, Ltd. PMID:26833688

  20. Exclusive Use of trans-Editing Domains Prevents Proline Mistranslation*

    PubMed Central

    Vargas-Rodriguez, Oscar; Musier-Forsyth, Karin

    2013-01-01

    Aminoacyl-tRNA synthetases (ARSs) catalyze the attachment of specific amino acids to cognate tRNAs. Although the accuracy of this process is critical for overall translational fidelity, similar sizes of many amino acids provide a challenge to ARSs. For example, prolyl-tRNA synthetases (ProRSs) mischarge alanine and cysteine onto tRNAPro. Many bacterial ProRSs possess an alanine-specific proofreading domain (INS) but lack the capability to edit Cys-tRNAPro. Instead, Cys-tRNAPro is cleared by a single-domain homolog of INS, the trans-editing YbaK protein. A global bioinformatics analysis revealed that there are six types of “INS-like” proteins. In addition to INS and YbaK, four additional single-domain homologs are widely distributed throughout bacteria: ProXp-ala (formerly named PrdX), ProXp-x (annotated as ProX), ProXp-y (annotated as YeaK), and ProXp-z (annotated as PA2301). The last three are domains of unknown function. Whereas many bacteria encode a ProRS containing an INS domain in addition to YbaK, many other combinations of INS-like proteins exist throughout the bacterial kingdom. Here, we focus on Caulobacter crescentus, which encodes a ProRS with a truncated INS domain that lacks catalytic activity, as well as YbaK and ProXp-ala. We show that C. crescentus ProRS can readily form Cys- and Ala-tRNAPro, and deacylation studies confirmed that these species are cleared by C. crescentus YbaK and ProXp-ala, respectively. Substrate specificity of C. crescentus ProXp-ala is determined, in part, by elements in the acceptor stem of tRNAPro and further ensured through collaboration with elongation factor Tu. These results highlight the diversity of approaches used to prevent proline mistranslation and reveal a novel triple-sieve mechanism of editing that relies exclusively on trans-editing factors. PMID:23564458

  1. Target Site Specificity of the Tos17 Retrotransposon Shows a Preference for Insertion within Genes and against Insertion in Retrotransposon-Rich Regions of the Genome

    PubMed Central

    Miyao, Akio; Tanaka, Katsuyuki; Murata, Kazumasa; Sawaki, Hiromichi; Takeda, Shin; Abe, Kiyomi; Shinozuka, Yoriko; Onosato, Katsura; Hirochika, Hirohiko

    2003-01-01

    Because retrotransposons are the major component of plant genomes, analysis of the target site selection of retrotransposons is important for understanding the structure and evolution of plant genomes. Here, we examined the target site specificity of the rice retrotransposon Tos17, which can be activated by tissue culture. We have produced 47,196 Tos17-induced insertion mutants of rice. This mutant population carries ∼500,000 insertions. We analyzed >42,000 flanking sequences of newly transposed Tos17 copies from 4316 mutant lines. More than 20,000 unique loci were assigned on the rice genomic sequence. Analysis of these sequences showed that insertion events are three times more frequent in genic regions than in intergenic regions. Consistent with this result, Tos17 was shown to prefer gene-dense regions over centromeric heterochromatin regions. Analysis of insertion target sequences revealed a palindromic consensus sequence, ANGTT-TSD-AACNT, flanking the 5-bp target site duplication. Although insertion targets are distributed throughout the chromosomes, they tend to cluster, and 76% of the clusters are located in genic regions. The mechanisms of target site selection by Tos17, the utility of the mutant lines, and the knockout gene database are discussed. PMID:12897251

  2. Is foliar spray of proline sufficient for mitigation of salt stress in Brassica juncea cultivars?

    PubMed

    Wani, A S; Ahmad, A; Hayat, S; Tahir, I

    2016-07-01

    The effects of foliar application of proline (20 mM) on growth, physio-biochemical, and yield parameters were assessed in two Brassica juncea (L.) Czern & Coss cultivars, namely, Varuna and RH-30, at different levels (2.8, 4.2, or 5.6 dsm(-1)) of NaCl in soil. At 29 days after sowing (DAS), plants were sprayed with either 20 mM proline or water in the presence or absence of NaCl stress. The NaCl negatively affected parameters related to growth, photosynthesis, and yield in both varieties but more in RH-30 than in Varuna. Exogenous application of proline counteracted the effects of salt stress in Varuna only, by increasing the antioxidative capacity of the plants. Moreover, proline was not effective in alleviating the detrimental effects of higher salt concentrations on the studied parameters. Proline application to unstressed plants increased growth, photosynthesis, and yield parameters in both varieties; however, the effects were more prominent in Varuna than in RH-30. PMID:27026543

  3. Use of prolines for improving growth and other properties of plants and algae

    DOEpatents

    Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

    2004-12-14

    Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

  4. Use of prolines for improving growth and other properties of plants and algae

    DOEpatents

    Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

    2003-04-29

    Increasing the concentration of prolines such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that overexpress glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramnate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

  5. Use of prolines for improving growth and other properties of plants and algae

    DOEpatents

    Unkefer, Pat J.; Knight, Thomas J.; Martinez, Rodolfo A.

    2003-07-15

    Increasing the concentration of prolines, such as 2-hydroxy-5-oxoproline, in the foliar portions of plants has been shown to cause an increase in carbon dioxide fixation, growth rate, dry weight, nutritional value (amino acids), nodulation and nitrogen fixation, photosynthetically derived chemical energy, and resistance to insect pests over the same properties for wild type plants. This can be accomplished in four ways: (1) the application of a solution of the proline directly to the foliar portions of the plant by spraying these portions; (2) applying a solution of the proline to the plant roots; (3) genetically engineering the plant and screening to produce lines that over-express glutamine synthetase in the leaves which gives rise to increased concentration of the metabolite, 2-hydroxy-5-oxoproline (this proline is also known as 2-oxoglutaramate); and (4) impairing the glutamine synthetase activity in the plant roots which causes increased glutamine synthetase activity in the leaves which gives rise to increased concentration of 2-hydroxy-5-oxoproline. Prolines have also been found to induce similar effects in algae.

  6. Structural and thermodynamic basis of proline-induced transmembrane complex stabilization

    PubMed Central

    Schmidt, Thomas; Situ, Alan J.; Ulmer, Tobias S.

    2016-01-01

    In membrane proteins, proline-mediated helix kinks are indispensable for the tight packing of transmembrane (TM) helices. However, kinks invariably affect numerous interhelical interactions, questioning the acceptance of proline substitutions and evolutionary origin of kinks. Here, we present the structural and thermodynamic basis of proline-induced integrin αIIbβ3 TM complex stabilization to understand the introduction of proline kinks in membrane proteins. In phospholipid bicelles, the A711P substitution in the center of the β3 TM helix changes the direction of adjacent helix segments to form a 35 ± 2° angle and predominantly repacks the segment in the inner membrane leaflet due to a swivel movement. This swivel repacks hydrophobic and electrostatic interhelical contacts within intracellular lipids, resulting in an overall TM complex stabilization of −0.82 ± 0.01 kcal/mol. Thus, proline substitutions can directly stabilize membrane proteins and such substitutions are proposed to follow the structural template of integrin αIIbβ3(A711P). PMID:27436065

  7. A unique cis-3-hydroxy-l-proline dehydratase in the enolase superfamily.

    PubMed

    Zhang, Xinshuai; Kumar, Ritesh; Vetting, Matthew W; Zhao, Suwen; Jacobson, Matthew P; Almo, Steven C; Gerlt, John A

    2015-02-01

    The genome of Labrenzia aggregata IAM 12614 encodes an uncharacterized member of the muconate lactonizing enzyme (MLE) subgroup of the enolase superfamily (UniProt ID A0NXQ8 ). The gene encoding A0NXQ8 is located between genes that encode members of the proline racemase superfamily, 4R-hydroxyproline 2-epimerase (UniProt ID A0NXQ7 ; 4HypE) and trans-3-hydroxy-l-proline dehydratase (UniProt ID A0NXQ9 ; t3LHypD). A0NXQ8 was screened with a library of proline analogues; two reactions were observed with cis-3-hydroxy-l-proline (c3LHyp), competing 2-epimerization to trans-3-hydroxy-d-proline (1,1-proton transfer) and dehydration to Δ(1)-pyrroline-2-carboxylate (β-elimination; c3LHyp dehydratase), with eventual total dehydration. The genome context encoding A0NXQ8 both (1) confirms its novel c3LHyp dehydratase function and (2) provides evidence for metabolic pathways that allow L. aggregata to utilize several isomeric 3- and 4-hydroxyprolines as sole carbon sources. PMID:25608448

  8. Direct linking of metabolism and gene expression in the proline utilization A protein from Escherichia coli

    PubMed Central

    Zhou, Yuzhen; Zhu, Weidong; Bellur, Padmanetra S.; Rewinkel, Dustin; Becker, Donald F.

    2009-01-01

    Summary The control of gene expression by enzymes provides a direct pathway for cells to respond to fluctuations in metabolites and nutrients. One example is the proline utilization A (PutA) protein from Escherichia coli. PutA is a membrane-associated enzyme that catalyzes the oxidation of L-proline to glutamate using a flavin containing proline dehydrogenase domain and a NAD+ dependent Δ1-pyrroline-5-carboxylate dehydrogenase domain. In some Gram-negative bacteria such as E. coli, PutA is also endowed with a ribbon-helix-helix DNA-binding domain and acts as a transcriptional repressor of the proline utilization genes. PutA switches between transcriptional repressor and enzymatic functions in response to proline availability. Molecular insights into the redox based mechanism of PutA functional switching from recent studies are reviewed. In addition, new results from cell-based transcription assays are presented which correlate PutA membrane localization with put gene expression levels. General membrane localization of PutA, however, is not sufficient to activate the put genes. PMID:18324349

  9. Structural Basis for the Inactivation of Thermus thermophilus Proline Dehydrogenase by N-Propargylglycine†‡

    PubMed Central

    White, Tommi A.; Johnson, William H.; Whitman, Christian P.; Tanner, John J.

    2009-01-01

    The flavoenzyme proline dehydrogenase catalyzes the first step of proline catabolism, the oxidation of proline to pyrroline-5-carboxylate. Here we report the first crystal structure of an irreversibly inactivated proline dehydrogenase. The 1.9 Å resolution structure of Thermus thermophilus proline dehydrogenase inactivated by the mechanism-based inhibitor N-propargylglycine shows that N5 of the flavin cofactor is covalently connected to the ε-amino group of Lys99 via a 3-carbon linkage, consistent with the mass spectral analysis of the inactivated enzyme. The isoalloxazine ring has a butterfly angle of 25°, which suggests that the flavin cofactor is reduced. Two mechanisms can account for these observations. In both, N-propargylglycine is oxidized to N-propargyliminoglycine. In one mechanism, this α,β-unsaturated iminium compound is attacked by the N5 atom of the now reduced flavin to produce a 1,4-addition product. Schiff base formation between Lys99 and the imine of the 1,4-addition product releases glycine and links the enzyme to the modified flavin. In the second mechanism, hydrolysis of N-propargyliminoglycine yields propynal and glycine. A 1,4-addition reaction with propynal coupled with Schiff base formation between Lys99 and the carbonyl group tethers the enzyme to the flavin via a 3-carbon chain. The presumed non-enzymatic hydrolysis of N-propargyliminoglycine and the subsequent rebinding of propynal to the enzyme make the latter mechanism less likely. PMID:18426222

  10. UV Photodissociation of Proline-containing Peptide Ions: Insights from Molecular Dynamics

    NASA Astrophysics Data System (ADS)

    Girod, Marion; Sanader, Zeljka; Vojkovic, Marin; Antoine, Rodolphe; MacAleese, Luke; Lemoine, Jérôme; Bonacic-Koutecky, Vlasta; Dugourd, Philippe

    2015-03-01

    UV photodissociation of proline-containing peptide ions leads to unusual product ions. In this paper, we report laser-induced dissociation of a series of proline-containing peptides at 213 nm. We observe specific fragmentation pathways corresponding to the formation of (y-2), (a + 2) and (b + 2) fragment ions. This was not observed at 266 nm or for peptides which do not contain proline residues. In order to obtain insights into the fragmentation dynamics at 213 nm, a small peptide (RPK for arginine-proline-lysine) was studied both theoretically and experimentally. Calculations of absorption spectra and non-adiabatic molecular dynamics (MD) were made. Second and third excited singlet states, S2 and S3, lie close to 213 nm. Non-adiabatic MD simulation starting from S2 and S3 shows that these transitions are followed by C-C and C-N bond activation close to the proline residue. After this first relaxation step, consecutive rearrangements and proton transfers are required to produce unusual (y-2), (a + 2) and (b + 2) fragment ions. These fragmentation mechanisms were confirmed by H/D exchange experiments.

  11. Paneth Cell-Rich Regions Separated by a Cluster of Lgr5+ Cells Initiate Crypt Fission in the Intestinal Stem Cell Niche.

    PubMed

    Langlands, Alistair J; Almet, Axel A; Appleton, Paul L; Newton, Ian P; Osborne, James M; Näthke, Inke S

    2016-06-01

    The crypts of the intestinal epithelium house the stem cells that ensure the continual renewal of the epithelial cells that line the intestinal tract. Crypt number increases by a process called crypt fission, the division of a single crypt into two daughter crypts. Fission drives normal tissue growth and maintenance. Correspondingly, it becomes less frequent in adulthood. Importantly, fission is reactivated to drive adenoma growth. The mechanisms governing fission are poorly understood. However, only by knowing how normal fission operates can cancer-associated changes be elucidated. We studied normal fission in tissue in three dimensions using high-resolution imaging and used intestinal organoids to identify underlying mechanisms. We discovered that both the number and relative position of Paneth cells and Lgr5+ cells are important for fission. Furthermore, the higher stiffness and increased adhesion of Paneth cells are involved in determining the site of fission. Formation of a cluster of Lgr5+ cells between at least two Paneth-cell-rich domains establishes the site for the upward invagination that initiates fission. PMID:27348469

  12. Paneth Cell-Rich Regions Separated by a Cluster of Lgr5+ Cells Initiate Crypt Fission in the Intestinal Stem Cell Niche

    PubMed Central

    Langlands, Alistair J.; Almet, Axel A.; Appleton, Paul L.; Newton, Ian P.; Osborne, James M.; Näthke, Inke S.

    2016-01-01

    The crypts of the intestinal epithelium house the stem cells that ensure the continual renewal of the epithelial cells that line the intestinal tract. Crypt number increases by a process called crypt fission, the division of a single crypt into two daughter crypts. Fission drives normal tissue growth and maintenance. Correspondingly, it becomes less frequent in adulthood. Importantly, fission is reactivated to drive adenoma growth. The mechanisms governing fission are poorly understood. However, only by knowing how normal fission operates can cancer-associated changes be elucidated. We studied normal fission in tissue in three dimensions using high-resolution imaging and used intestinal organoids to identify underlying mechanisms. We discovered that both the number and relative position of Paneth cells and Lgr5+ cells are important for fission. Furthermore, the higher stiffness and increased adhesion of Paneth cells are involved in determining the site of fission. Formation of a cluster of Lgr5+ cells between at least two Paneth-cell-rich domains establishes the site for the upward invagination that initiates fission. PMID:27348469

  13. The Protein Zfand5 Binds and Stabilizes mRNAs with AU-rich Elements in Their 3′-Untranslated Regions*

    PubMed Central

    He, Guoan; Sun, Dongxu; Ou, Zhiying; Ding, Aihao

    2012-01-01

    AU-rich elements (AREs) in the 3′-UTR of unstable transcripts play a vital role in the regulation of many inflammatory mediators. To identify novel ARE-dependent gene regulators, we screened a human leukocyte cDNA library for candidates that enhanced the activity of a luciferase reporter bearing the ARE sequence from TNF (ARETNF). Among 171 hits, we focused on Zfand5 (zinc finger, AN1-type domain 5), a 23-kDa protein containing two zinc finger domains. Zfand5 expression was induced in macrophages in response to IFNγ and Toll-like receptor ligands. Knockdown of Zfand5 in macrophages decreased expression of ARE class II transcripts TNF and COX2, whereas overexpression stabilized TNF mRNA by suppressing deadenylation. Zfand5 specifically bound to ARETNF mRNA and competed with tristetraprolin, a protein known to bind and destabilize class II ARE-containing RNAs. Truncation studies indicated that both zinc fingers of Zfand5 contributed to its mRNA-stabilizing function. These findings add Zfand5 to the growing list of RNA-binding proteins and suggest that Zfand5 can enhance ARE-containing mRNA stability by competing with tristetraprolin for mRNA binding. PMID:22665488

  14. Two subsites in the binding domain of the acetylcholine receptor: an aromatic subsite and a proline subsite.

    PubMed

    Kachalsky, S G; Jensen, B S; Barchan, D; Fuchs, S

    1995-11-01

    The ligand binding site of the nicotinic acetylcholine receptor (AcChoR) is localized in the alpha-subunit within a domain containing the tandem Cys-192 and -193. By analyzing the binding-site region of AcChoR from animal species that are resistant to alpha-neurotoxins, we have previously shown that four residues in this region, at positions 187, 189, 194, and 197, differ between animals sensitive (e.g., mouse) and resistant (e.g., mongoose and snake) to alpha-bungarotoxin (alpha-BTX). In the present study, we performed site-directed mutagenesis on a fragment of the mongoose AcChoR alpha-subunit (residues 122-205) and exchanged residues 187, 189, 194, and 197, either alone or in combination, with those present in the mouse alpha-subunit sequence. Only the mongoose fragment in which all four residues were mutated to the mouse ones exhibited alpha-BTX binding similar to that of the mouse fragment. The mongoose double mutation in which Leu-194 and His-197 were replaced with proline residues, which are present at these positions in the mouse AcChoR and in all other toxin binders, bound alpha-BTX to approximately 60% of the level of binding exhibited by the mouse fragment. In addition, replacement of either Pro-194 or -197 in the mouse fragment with serine and histidine, respectively, markedly decreased alpha-BTX binding. All other mutations resulted in no or just a small increase in alpha-BTX binding. These results have led us to propose two subsites in the binding domain for alpha-BTX: the proline subsite, which includes Pro-194 and -197 and is critical for alpha-BTX binding, and the aromatic subsite, which includes amino acid residues 187 and 189 and determines the extent of alpha-BTX binding. PMID:7479887

  15. Two subsites in the binding domain of the acetylcholine receptor: an aromatic subsite and a proline subsite.

    PubMed Central

    Kachalsky, S G; Jensen, B S; Barchan, D; Fuchs, S

    1995-01-01

    The ligand binding site of the nicotinic acetylcholine receptor (AcChoR) is localized in the alpha-subunit within a domain containing the tandem Cys-192 and -193. By analyzing the binding-site region of AcChoR from animal species that are resistant to alpha-neurotoxins, we have previously shown that four residues in this region, at positions 187, 189, 194, and 197, differ between animals sensitive (e.g., mouse) and resistant (e.g., mongoose and snake) to alpha-bungarotoxin (alpha-BTX). In the present study, we performed site-directed mutagenesis on a fragment of the mongoose AcChoR alpha-subunit (residues 122-205) and exchanged residues 187, 189, 194, and 197, either alone or in combination, with those present in the mouse alpha-subunit sequence. Only the mongoose fragment in which all four residues were mutated to the mouse ones exhibited alpha-BTX binding similar to that of the mouse fragment. The mongoose double mutation in which Leu-194 and His-197 were replaced with proline residues, which are present at these positions in the mouse AcChoR and in all other toxin binders, bound alpha-BTX to approximately 60% of the level of binding exhibited by the mouse fragment. In addition, replacement of either Pro-194 or -197 in the mouse fragment with serine and histidine, respectively, markedly decreased alpha-BTX binding. All other mutations resulted in no or just a small increase in alpha-BTX binding. These results have led us to propose two subsites in the binding domain for alpha-BTX: the proline subsite, which includes Pro-194 and -197 and is critical for alpha-BTX binding, and the aromatic subsite, which includes amino acid residues 187 and 189 and determines the extent of alpha-BTX binding. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7479887

  16. Distribution of /sup 3/H-proline in alveolar bone of the mouse as seen by radioautography

    SciTech Connect

    Johnson, R.B.

    1986-11-01

    Previous studies of the turnover of alveolar bone collagenous proteins have devoted little attention to the variable patterns in this process caused by bone remodeling. The present study seeks to document changes resulting from physiologic tooth movements in the incorporation and removal of the /sup 3/H-proline label within the interdental septum of alveolar bone. One week following /sup 3/H-proline injection, three zones could be distinguished: the appositional band, new bone, and old bone. Radioautography demonstrated that formation of new bone on the distal wall of the septum entrapped fibers of the periodontal ligament to create Sharpey's fibers. At the alveolar crest, new bone entrapped transseptal fibers to form transalveolar Sharpey's fibers. Grain counts were made within each area and over the total septum and were compared statistically. The data strongly suggested regional variations in protein remodeling. Counts from old and new bone were significantly different from the total septum or the appositional band (P less than .001). Regression lines were drawn to represent incorporation and removal of the isotope; slopes were calculated and compared statistically. The rate of incorporation and removal was significantly greater in the appositional band and in the total septum in comparison to old bone (P less than .001). The rates of incorporation and removal in the appositional band, old bone, and total septum were significantly different (P less than .001). Half-life of the labeled protein of old bone was 16.78 weeks; in the appositional band, 7.66 weeks; and in the total septum, 7.64 weeks. These data suggest that regional variations in collagen remodeling must be considered in a study of interdental bone and that the total septal grain counts are not indicative of the remodeling in the component zones.

  17. Proline Editing: A General and Practical Approach to the Synthesis of Functionally and Structurally Diverse Peptides. Analysis of Steric versus Stereoelectronic Effects of 4-Substituted Prolines on Conformation within Peptides

    PubMed Central

    Pandey, Anil K.; Naduthambi, Devan; Thomas, Krista M.; Zondlo, Neal J.

    2013-01-01

    Functionalized proline residues have diverse applications. Herein we describe a practical approach, proline editing, for the synthesis of peptides with stereospecifically modified proline residues. Peptides are synthesized by standard solid-phase-peptide-synthesis to incorporate Fmoc-Hydroxyproline (4R-Hyp). In an automated manner, the Hyp hydroxyl is protected and the remainder of the peptide synthesized. After peptide synthesis, the Hyp protecting group is orthogonally removed and Hyp selectively modified to generate substituted proline amino acids, with the peptide main chain functioning to “protect” the proline amino and carboxyl groups. In a model tetrapeptide (Ac-TYPN-NH2), 4R-Hyp was stereospecifically converted to 122 different 4-substituted prolyl amino acids, with 4R or 4S stereochemistry, via Mitsunobu, oxidation, reduction, acylation, and substitution reactions. 4-Substituted prolines synthesized via proline editing include incorporated structured amino acid mimetics (Cys, Asp/Glu, Phe, Lys, Arg, pSer/pThr), recognition motifs (biotin, RGD), electron-withdrawing groups to induce stereoelectronic effects (fluoro, nitrobenzoate), handles for heteronuclear NMR (19F:fluoro; pentafluorophenyl or perfluoro-tert-butyl ether; 4,4-difluoro; 77SePh) and other spectroscopies (fluorescence, IR: cyanophenyl ether), leaving groups (sulfonate, halide, NHS, bromoacetate), and other reactive handles (amine, thiol, thioester, ketone, hydroxylamine, maleimide, acrylate, azide, alkene, alkyne, aryl halide, tetrazine, 1,2-aminothiol). Proline editing provides access to these proline derivatives with no solution phase synthesis. All peptides were analyzed by NMR to identify stereoelectronic and steric effects on conformation. Proline derivatives were synthesized to permit bioorthogonal conjugation reactions, including azide-alkyne, tetrazinetrans-cyclooctene, oxime, reductive amination, native chemical ligation, Suzuki, Sonogashira, cross-metathesis, and Diels

  18. Comparative analysis of the mitochondrial genomes of Callitettixini Spittlebugs (Hemiptera: Cercopidae) confirms the overall high evolutionary speed of the AT-rich region but reveals the presence of short conservative elements at the tribal level.

    PubMed

    Liu, Jie; Bu, Cuiping; Wipfler, Benjamin; Liang, Aiping

    2014-01-01

    The present study compares the mitochondrial genomes of five species of the spittlebug tribe Callitettixini (Hemiptera: Cercopoidea: Cercopidae) from eastern Asia. All genomes of the five species sequenced are circular double-stranded DNA molecules and range from 15,222 to 15,637 bp in length. They contain 22 tRNA genes, 13 protein coding genes (PCGs) and 2 rRNA genes and share the putative ancestral gene arrangement of insects. The PCGs show an extreme bias of nucleotide and amino acid composition. Significant differences of the substitution rates among the different genes as well as the different codon position of each PCG are revealed by the comparative evolutionary analyses. The substitution speeds of the first and second codon position of different PCGs are negatively correlated with their GC content. Among the five species, the AT-rich region features great differences in length and pattern and generally shows a 2-5 times higher substitution rate than the fastest PCG in the mitochondrial genome, atp8. Despite the significant variability in length, short conservative segments were identified in the AT-rich region within Callitettixini, although absent from the other groups of the spittlebug superfamily Cercopoidea. PMID:25285442