Science.gov

Sample records for proton form factor

  1. Proton form factor effects in hydrogenic atoms

    SciTech Connect

    Daza, F. Garcia; Kelkar, N. G.; Nowakowski, M.

    2011-10-21

    The proton structure corrections to the hyperfine splittings in electronic and muonic hydrogen are evaluated using the Breit potential with electromagnetic form factors. In contrast to other methods, the Breit equation with q{sup 2} dependent form factors is just an extension of the standard Breit equation which gives the hyperfine splitting Hamiltonian. Precise QED corrections are comparable to the structure corrections which therefore need to be evaluated ab initio.

  2. Proton Form Factor Measurements at Jefferson Lab

    SciTech Connect

    Charles Perdrisat; Vina Punjabi

    2004-09-27

    In two experiments at Jefferson Lab in Hall A, the first one in 1998 and the second in 2000, the ratio of the electromagnetic form factors of the proton was obtained by measuring P{sub t} and P{sub ell}, the transverse and longitudinal recoil proton polarization components, respectively, in {rvec e}p {yields} e{rvec p}; the ratio G{sub E{sub p}}/G{sub M{sub p}} is proportional to P{sub t}/P{sub {ell}}. Simultaneous measurement of P{sub t} and P{sub {ell}} provides good control of the systematic uncertainty. The first measurement of G{sub E{sub p}}/G{sub M{sub p}} ratio was made to Q{sup 2} = 3.5 GeV{sup 2} and the second measurement to Q{sup 2} = 5.6 GeV{sup 2}. The results from these two experiments indicate that the ratio scales like 1/Q{sup 2}, in stark contrast with cross section data analyzed by the Rosenbluth separation method which gives a constant value for this ratio. The incompatibility of the recoil polarization results with most of the Rosenbluth separation results appears now well established above Q{sup 2} of about 3 GeV{sup 2}. The consensus at the present time is that the interference of the two-photon exchange with the Born term, which had been deemed negligible until recently, might explain the discrepancy between the results of the two techniques; the possibility that the discrepancy is due to incomplete radiative correction has also been recently discussed.

  3. The Proton Form Factor Ratio Measurements at Jefferson Lab

    SciTech Connect

    Punjabi, Vina A.; Perdrisat, Charles F.

    2014-03-01

    The ratio of the proton form factors, G{sub Ep}/G{sub Mp}, has been measured from Q{sup 2} of 0.5 GeV{sup 2} to 8.5 GeV{sup 2}, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The discovery that the proton form factor ratio measured in these experiments decreases approximately linearly with four-momentum transfer, Q{sup 2}, for values above ~1 GeV{sup 2}, is one of the most significant results to come out of JLab. These results have had a large impact on progress in hadronic physics; and have required a significant rethinking of nucleon structure. The increasingly common use of the double-polarization technique to measure the nucleon form factors, in the last 15 years, has resulted in a dramatic improvement of the quality of all four nucleon electromagnetic form factors, G{sub Ep}, G{sub Mp}, G{sub En} and G{sub Mn}. There is an approved experiment at JLab, GEP(V), to continue the ratio measurements to 12 GeV{sup 2}. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. It will be equipped with a focal plane polarimeter to measure the polarization of the recoil protons. The scattered electrons will be detected in an electromagnetic calorimeter. In this presentation, I will review the status of the proton elastic electromagnetic form factors and discuss a number of theoretical approaches to describe nucleon form factors.

  4. The proton form factor ratio results from Jefferson Lab

    SciTech Connect

    Vina Punjabi

    2012-09-01

    The ratio of the proton form factors, GE p/GMp, has been measured extensively, from Q2 of 0.5 GeV2 to 8.5 GeV2, at the Jefferson Laboratory, using the polarization transfer method. This ratio is extracted directly from the measured ratio of the transverse and longitudinal polarization components of the recoiling proton in elastic electron-proton scattering. The polarization transfer results are of unprecedented high precision and accuracy, due in large part to the small systematic uncertainties associated with the experimental technique. There is an approved experiment at JLab, GEP(5), to continue the ratio measurements to 12 GeV2. A dedicated experimental setup, the Super Bigbite Spectrometer (SBS), will be built for this purpose. It will be equipped with a focal plane polarimeter to measure the polarization of the recoil protons. The scattered electrons will be detected in an electromagnetic calorimeter. In this presentation, I will review the status of the proton elastic electromagnetic form factors and discuss a number of theoretical approaches to describe nucleon form factors.

  5. Reanalysis of Rosenbluth measurements of the proton form factors

    NASA Astrophysics Data System (ADS)

    Gramolin, A. V.; Nikolenko, D. M.

    2016-05-01

    We present a reanalysis of the data from Stanford Linear Accelerator Center (SLAC) experiments E140 [R. C. Walker et al., Phys. Rev. D 49, 5671 (1994), 10.1103/PhysRevD.49.5671] and NE11 [L. Andivahis et al., Phys. Rev. D 50, 5491 (1994), 10.1103/PhysRevD.50.5491] on elastic electron-proton scattering. This work is motivated by recent progress in calculating the corresponding radiative corrections and by the apparent discrepancy between the Rosenbluth and polarization transfer measurements of the proton electromagnetic form factors. New, corrected values for the scattering cross sections are presented, as well as a new form factor fit in the Q2 range from 1 to 8.83 GeV2. We also provide a complete set of revised formulas to account for radiative corrections in single-arm measurements of unpolarized elastic electron-proton scattering.

  6. Proton Form Factors Measurements in the Time-Like Region

    SciTech Connect

    Anulli, F.; /Frascati

    2007-10-22

    I present an overview of the measurement of the proton form factors in the time-like region. BABAR has recently measured with great accuracy the e{sup +}e{sup -} {yields} p{bar p} reaction from production threshold up to an energy of {approx} 4.5 GeV, finding evidence for a ratio of the electric to magnetic form factor greater than unity, contrary to expectation. In agreement with previous measurements, BABAR confirmed the steep rise of the magnetic form factor close to the p{bar p} mass threshold, suggesting the possible presence of an under-threshold N{bar N} vector state. These and other open questions related to the nucleon form factors both in the time-like and space-like region, wait for more data with different experimental techniques to be possibly solved.

  7. Helicity non-conserving form factor of the proton

    SciTech Connect

    Voutier, E.; Furget, C.; Knox, S.

    1994-04-01

    The study of the hadron structure in the high Q{sup 2} range contributes to the understanding of the mechanisms responsible for the confinement of quarks and gluons. Among the numerous experimental candidates sensitive to these mechanisms, the helicity non-conserving form factor of the proton is a privileged observable since it is controlled by non-perturbative effects. The authors investigate here the feasibility of high Q{sup 2} measurements of this form factor by means of the recoil polarization method in the context of the CEBAF 8 GeV facility. For that purpose, they discuss the development of a high energy proton polarimeter, based on the H({rvec p},pp) elastic scattering, to be placed at the focal plane of a new hadron spectrometer. It is shown that this experimental method significantly improves the knowledge of the helicity non-conserving form factor of the proton up to 10 GeV{sup 2}/c{sup 2}.

  8. The Mainz high-precision proton form factor measurement

    NASA Astrophysics Data System (ADS)

    Bernauer, Jan

    2011-04-01

    Form factors offer a direct approach to fundamental properties of the nucleons like the radius and charge distribution. Renewed interest was stirred up by the 5 sigma discrepancy between a recent determination of the proton radius from the Lamb shift in muonic hydrogen and preceding electron scattering results. The low-q shape of the form factors might also contain a direct signal of a pion cloud around the nucleus and is a strong test of hadron models. In my talk, I will discuss the electron scattering experiment performed with the 3-spectrometer-facility of the A1 collaboration at MAMI in Mainz, Germany. The data set covers the Q2-range from 0.004 to 1 (GeV / c) 2 and includes about 1400 separate cross section measurements, spanning the range of scattering angles from below 20° to above 120° at six beam energies between 180 and 855 MeV, with statistical uncertainties below 0.4%. The 3-spectrometer-setup allowed for a simultaneous monitoring of the luminosity and overlapping and redundant measurements of the cross section to achieve stringent control over systematic uncertainties. Beam stabilization systems and redundant current measurements further limit systematic effects. The measured cross sections were analyzed with the standard Rosenbluth separation technique and by employing direct fits of a large set of form factor models. The high redundancy of the data set allowed us to extract the form factors up to 0.6 (GeV / c) 2 with very small uncertainties and to give a new, precise value for the proton radius from electron scattering. From the form factors, the charge distribution and Zemach moments were calculated. The latter constitute important input for the theoretical corrections of the muonic Lamb shift experiment. However, the revised values can not explain the discrepancy. Further possible explanations include higher order QED-corrections, vacuum effects or even physics beyond the standard model.

  9. Proton Form Factor Measurements Using Polarization Method: Beyond Born Approximation

    SciTech Connect

    Pentchev, Lubomir

    2008-10-13

    Significant theoretical and experimental efforts have been made over the past 7 years aiming to explain the discrepancy between the proton form factor ratio data obtained at JLab using the polarization method and the previous Rosenbluth measurements. Preliminary results from the first high precision polarization experiment dedicated to study effects beyond Born approximation will be presented. The ratio of the transferred polarization components and, separately, the longitudinal polarization in ep elastic scattering have been measured at a fixed Q{sup 2} of 2.5 GeV{sup 2} over a wide kinematic range. The two quantities impose constraints on the real part of the ep elastic amplitudes.

  10. Electric and magnetic form factors of the proton

    NASA Astrophysics Data System (ADS)

    Bernauer, J. Â. C.; Distler, M. Â. O.; Friedrich, J.; Walcher, Th.; Achenbach, P.; Ayerbe Gayoso, C.; Böhm, R.; Bosnar, D.; Debenjak, L.; Doria, L.; Esser, A.; Fonvieille, H.; Gómez Rodríguez de la Paz, M.; Friedrich, J. Â. M.; Makek, M.; Merkel, H.; Middleton, D. Â. G.; Müller, U.; Nungesser, L.; Pochodzalla, J.; Potokar, M.; Sánchez Majos, S.; Schlimme, B. Â. S.; Širca, S.; Weinriefer, M.; A1 Collaboration

    2014-07-01

    This paper describes a precise measurement of electron scattering off the proton at momentum transfers of 0.003≲Q2≲1 GeV2. The average point-to-point error of the cross sections in this experiment is ˜0.37%. These data are used for a coherent new analysis together with all world data of unpolarized and polarized electron scattering from the very smallest to the highest momentum transfers so far measured. The extracted electric and magnetic form factors provide new insight into their exact shape, deviating from the classical dipole form, and of structure on top of this gross shape. The data reaching very low Q2 values are used for a new determination of the electric and magnetic radii. An empirical determination of the two-photon-exchange correction is presented. The implications of this correction on the radii and the question of a directly visible signal of the pion cloud are addressed.

  11. Resolving the Proton Form Factor Problem with Positron-Proton Scattering

    NASA Astrophysics Data System (ADS)

    Weinstein, Lawrence

    2012-10-01

    The proton electromagnetic form factors are essential pieces of our knowledge of nucleon structure. However, Rosenbluth separation measurements of the proton electric form factor, GE(Q^2), differ from polarization transfer measurements by a factor of three at Q^2 = 5.6 (GeV/c)^2. This discrepancy must be resolved. One possible resolution is to include the contribution of hard two-photon exchange (TPE) contributions. These contributions are very difficult to calculate. However, we can directly determine the TPE effect by measuring the ratio of the positron-proton to electron-proton elastic scattering cross sections, R=σ(e^+p)/σ(e^-p), because the TPE amplitude has the same sign as the e^+p born amplitude and the opposite sign as the e^-p born amplitude. We have measured R over a wide range of momentum transfer, 0.2 <=Q^2 <=2 GeV^2, and virtual photon polarization, 0.1 <=ɛ<=0.9, using a mixed identical beam of electrons and positrons in Hall B at Jefferson Lab. This talk will describe the experimental techniques used to produce this beam, the analysis techniques to identify elastic scattering events, and some preliminary results.

  12. Measurement of the neutral weak form factors of the proton

    SciTech Connect

    Aniol, K.A.; Epstein, M.B.; Margaziotis, D.J.; Deur, A.; Spradlin, M.; Wilson, R.; Garibaldi, F.; Chen, J.; Chudakov, E.; de Jager, C.W.; Deur, A.; Gomez, J.; Hansen, O.; Kuss, M.; LeRose, J.; Michaels, R.; Price, J.S.; Rutt, P.M.; Saha, A.; Wojtsekhowski, B.; Madey, R.; Petratos, G.G.; Prout, D.; Suleiman, R.; Dale, D.; Glamazdin, A.; Gorbenko, V.; Pomatsalyuk, R.; Kim, D.H.; Kim, M.S.; Ewell, L.; Fissum, K.; Gao, J.; Liyanage, N.; Calarco, J.; Hersman, F.; Holtrop, M.; Leuschner, M.; Punjabi, V.; Vlahovic, B.; Jutier, C.; McCormick, K.; Todor, L.; Ulmer, P.E.; Cates, G.D.; Humensky, B.; Kumar, K.S.; Mastromarino, P.; Miller, G.W.; Spradlin, M.; Fleck, A.; Gilman, R.; McIntyre, J.; and others

    1999-02-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The kinematic point [{l_angle}{theta}{sub lab }{r_angle}=12.3{degree} and {l_angle}Q{sup 2}{r_angle}=0.48 (GeV /c){sup 2} ] is chosen to provide sensitivity, at a level that is of theoretical interest, to the strange electric form factor G{sup s}{sub E} . The result, A={minus}14.5{plus_minus}2.2 ppm , is consistent with the electroweak standard model and no additional contributions from strange quarks. In particular, the measurement implies G{sup s}{sub E}+0.39G{sup s}{sub M}=0.023 {plus_minus}0.034(stat){plus_minus}0.022( syst){plus_minus}0.026({delta}G{sup n}{sub E}) , where the last uncertainty arises from the estimated uncertainty in the neutron electric form factor. {copyright} {ital 1999} {ital The American Physical Society}

  13. Measurement of the Neutral Weak Form Factors of the Proton

    SciTech Connect

    Deur, Alexandre; Fleck, Andre; Saha, Arunava; Gasparian, Ashot; Frois, Bernard; Wojtsekhowski, Bogdan; Vlahovic, Branislav; Perdrisat, Charles; Cavata, Christian; Jutier, Christophe; De Jager, Cornelis; Neyret, Damien; Dale, Daniel; Armstrong, David; Lhuillier, David; Prout, David; Margaziotis, Demetrius; Kim, Donghee; Burtin, Etienne; Chudakov, Eugene; Hersman, F.; Garibaldi, Franco; Marie, Frederic; Miller, Greg; Rutledge, Gary; Gerstner, George; Petratos, Gerassimos; Quemener, Gilles; Cates, Gordon; Thompson, J.; Martino, Jacques; Gomez, Javier; Jorda, Jean-Paul; Hansen, Jens-Ole; Chen, Jian-Ping; Jardillier, Johann; Calarco, John; LeRose, John; Price, John; Gao, Juncai; McIntyre, Justin; McCormick, Kathy; Fissum, Kevin; Kramer, Kevin; Aniol, Konrad; Kumar, Krishna; Wijesooriya, Krishni; Ewell, Lars; Todor, Luminita; Spradlin, Marcus; Jones, Mark; Leuschner, Mark; Epstein, Martin; Baylac, Maud; Holtrop, Maurik; Finn, Michael; Kuss, Michael; Kim, Min; Falletto, Nicolas; Liyanage, Nilanga; Glamazdin, Oleksandr; Rutt, Paul; Souder, Paul; Ulmer, Paul; Mastromarino, Peter; Djawotho, Pibero; Wilson, Richard; Suleiman, Riad; Holmes, Richard; Madey, Richard; Lourie, Robert; Michaels, Robert; Pomatsalyuk, Roman; Gilman, Ronald; Incerti, Sebastien; Escoffier, Stephanie; Pussieux, Thierry; Humensky, Thomas; Gorbenko, Viktor; Punjabi, Vina; Kahl, William; Meziani, Zein-Eddine

    1999-02-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The kinematic point [(Thetalab) = 12.3r and (Q2) = 0.48 (GeV/c)2] is chosen to provide sensitivity, at a level that is of theoretical interest, to the strange electric form factor GsE. The result, A = - 14.5 + or - 2.2 ppm, is consistent with the electroweak standard model and no additional contributions from strange quarks. In particular, the measurement implies GsE + 0.39GsM = 0.023 + or - 0.034(stat) + or - 0.022(syst) + or - 0.026(delta-GnE), where the last uncertainty arises from the estimated uncertainty in the neutron electric form factor.

  14. Proton form factors and two-photon exchange in elastic electron-proton scattering

    SciTech Connect

    Nikolenko, D. M.; Arrington, J.; Barkov, L. M.; Vries, H. de; Gauzshtein, V. V.; Golovin, R. A.; Gramolin, A. V.; Dmitriev, V. F.; Zhilich, V. N.; Zevakov, S. A.; Kaminsky, V. V.; Lazarenko, B. A.; Mishnev, S. I.; Muchnoi, N. Yu.; Neufeld, V. V.; Rachek, I. A.; Sadykov, R. Sh.; Stibunov, V. N.; Toporkov, D. K.; Holt, R. J.; and others

    2015-05-15

    Proton electromagnetic form factors are among the most important sources of information about the internal structure of the proton. Two different methods for measuring these form factors, the method proposed by Rosenbluth and the polarization-transfer method, yield contradictory results. It is assumed that this contradiction can be removed upon taking into account the hard part of the contribution of two-photon exchange to the cross section for elastic electron-proton scattering. This contribution can measured experimentally via a precision comparison of the cross sections for the elastic scattering of positrons and electrons on protons. Such a measurement, performed at the VEPP-3 storage ring in Novosibirsk at the beam energies of 1.6 and 1.0 GeV for positron (electron) scattering angles in the ranges of θ{sub e} = 15°–25° and 55°–75° in the first case and in the range of θ{sub e} = 65°–105° in the second case is described in the present article. Preliminary results of this experiment and their comparison with theoretical predictions are described.

  15. New results on strange form factors of the proton

    SciTech Connect

    Richard Holmes

    2000-12-12

    At the Thomas Jefferson National Accelerator Facility, we have studied the elastic scattering of polarized electrons from hydrogen. The resulting parity-violating electroweak asymmetry is sensitive to the contributions of strange quarks to the nucleon form factors at a level that is of theoretical interest. Using events at a laboratory scattering angle of 12.3{sup o} and (Q{sup 2})=0.477 GeV/c, we measure the linear combination of strange form factors (G{sup n}{sub E}) + 0.39G{sup E}{sub M}/(G{sup py}{sub M}/mu{sub p}) = 0.091+/-0.054+/-0.039, where the first error is the quadratic sum of our systematic and statistical errors and the second error is due to uncertainty in nucleon form factors.

  16. Theoretical and Experimental Review on Proton Form Factors

    NASA Astrophysics Data System (ADS)

    Baldini Ferroli, Rinaldo; Pacetti, Simone

    2014-12-01

    During the last three lustra nucleon form factors experiments have lived a golden age, full of interesting results, that likely will continue and culminate when new data will come from BESIII, SND, CMD3 and PANDA, in the time-like region and, Jefferson Lab and A1 in the space-like region. On the other hand, from theoretical point of view, mainly concerning the possibility of descriptions in all kinematical regions, no great breakthrough has been made.

  17. Recoil polarization measurements of the proton electromagnetic form factor ratio at high momentum transfer

    SciTech Connect

    Andrew Puckett

    2009-12-01

    Electromagnetic form factors are fundamental properties of the nucleon that describe the effect of its internal quark structure on the cross section and spin observables in elastic lepton-nucleon scattering. Double-polarization experiments have become the preferred technique to measure the proton and neutron electric form factors at high momentum transfers. The recently completed GEp-III experiment at the Thomas Jefferson National Accelerator Facility used the recoil polarization method to extend the knowledge of the proton electromagnetic form factor ratio GpE/GpM to Q2 = 8.5 GeV2. In this paper we present the preliminary results of the experiment.

  18. Proton electromagnetic form factors: present status and future perspectives at PANDA

    NASA Astrophysics Data System (ADS)

    Tomasi-Gustafsson, E.

    2015-05-01

    Data and models on electromagnetic proton form factors are reviewed, highlighting the contribution foreseen by the PANDA collaboration. Electromagnetic hadron form factors contain essential information on the internal structure of hadrons. Precise and surprising data have been obtained at electron accelerators, applying the polarization method in electron-proton elastic scattering. At electron-positron colliders, using initial state radiation, BABAR measured proton time-like form factors in a wide time-like kinematical region and the BESIII collaboration will measure very precisely proton and neutron form factors in the threshold region. In the next future an antiproton beam with momentum up to 15 GeV/c will be available at FAIR (Darmstadt). Measurements of the reaction p̅ + p → e+ + e- by the PANDA collaboration will contribute to the individual determination of electric and magnetic form factors in the time-like region of momentum transfer squared, as well as to their first determination in the unphysical region (below the kinematical threshold), through the reaction p̅ + p → e+ + e- + π0. From the discussion on feasibility studies at PANDA, we focus on the consequences of such measurements in view of an unified description of form factors in the full kinematical region. We present models which have the necessary analytical requirements and apply to the data in the whole kinematical region.

  19. Pion and proton form factors in the regge description of electroproduction p( e, e' π +) n

    NASA Astrophysics Data System (ADS)

    Choi, Tae Keun; Kong, Kook Jin; Yu, Byung Geel

    2015-10-01

    Electroproduction of π + above the resonance region is analyzed in the Regge model for π + ρ exchanges. The importance of the roles of the pion and the proton form factors in the process is discussed in comparison with the existing models of Kaskulov and Mosel and of Vrancx and Ryckebusch. The present model with a proton form factor of a simple dipole-type is shown to yield a better description of DESY and JLab data over those models for the high Q 2 and - t region up to 5 GeV2.

  20. New Precision Limit on the Strange Vector Form Factors of the Proton

    NASA Astrophysics Data System (ADS)

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; Canan, M.; Camsonne, A.; Cates, G. D.; Chen, J.-P.; Chudakov, E.; Cisbani, E.; Dalton, M. M.; de Jager, C. W.; de Leo, R.; Deconinck, W.; Decowski, P.; Deng, X.; Deur, A.; Dutta, C.; Franklin, G. B.; Friend, M.; Frullani, S.; Garibaldi, F.; Giusa, A.; Glamazdin, A.; Golge, S.; Grimm, K.; Hansen, O.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Huang, J.; Huang, M.; Hyde, C. E.; Jen, C. M.; Jin, G.; Jones, D.; Kang, H.; King, P.; Kowalski, S.; Kumar, K. S.; Lee, J. H.; Lerose, J. J.; Liyanage, N.; Long, E.; McNulty, D.; Margaziotis, D.; Meddi, F.; Meekins, D. G.; Mercado, L.; Meziani, Z.-E.; Michaels, R.; Muñoz-Camacho, C.; Mihovilovic, M.; Muangma, N.; Myers, K. E.; Nanda, S.; Narayan, A.; Nelyubin, V.; Nuruzzaman; Oh, Y.; Pan, K.; Parno, D.; Paschke, K. D.; Phillips, S. K.; Qian, X.; Qiang, Y.; Quinn, B.; Rakhman, A.; Reimer, P. E.; Rider, K.; Riordan, S.; Roche, J.; Rubin, J.; Russo, G.; Saenboonruang, K.; Saha, A.; Sawatzky, B.; Silwal, R.; Sirca, S.; Souder, P. A.; Sperduto, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Sutera, C. M.; Tobias, W. A.; Urciuoli, G. M.; Waidyawansa, B.; Wang, D.; Wexler, J.; Wilson, R.; Wojtsekhowski, B.; Zhan, X.; Yan, X.; Yao, H.; Ye, L.; Zhao, B.; Zheng, X.

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2=0.624GeV2 and beam energy Eb=3.48GeV to be APV=-23.80±0.78(stat)±0.36(syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs+0.517GMs=0.003±0.010(stat)±0.004(syst)±0.009(ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.

  1. The Proton Coulomb Form Factor from Polarized Inclusive e-p Scattering

    SciTech Connect

    Chris Harris

    2001-08-01

    The proton form factors provide information on the fundamental properties of the proton and provide a test for models based on QCD. In 1998 at Jefferson Lab (JLAB) in Newport News, VA, experiment E93026 measured the inclusive e-p scattering cross section from a polarized ammonia (15NH3) target at a four momentum transfer squared of Q2 = 0.5 (GeV/c)2. Longitudinally polarized electrons were scattered from the polarized target and the scattered electron was detected. Data has been analyzed to obtain the asymmetry from elastically scattered electrons from hydrogen in 15NH3. The asymmetry, Ap, has been used to determine the proton elastic form factor GEp. The result is consistent with the dipole model and data from previous experiments. However, due to the choice of kinematics, the uncertainty in the measurement is large.

  2. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Xiaohui Zhan

    2009-12-01

    A high precision measurement of the proton elastic form factor ratio µpGEp/GMp in the range Q2 = 0.3–0.7 GeV2/c2 was performed using recoil polarimetry in Jefferson Lab Hall A. In this low Q2 range, previous data from LEDEX [5] along with many fits and calculations [2, 3, 4] indicate substantial deviations of the ratio from unity. In this new measurement, with 80% polarized electron beam for 24 days, we are able to achieve <1% statistical uncertainty. Preliminary results are a few percent lower than expected from previous world data and fits, indicating a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the improved form factor measurements also have implications for DVCS, determinations of the proton Zemach radius and strangeness form factors through parity violation experiments.

  3. High-precision determination of the electric and magnetic form factors of the proton.

    PubMed

    Bernauer, J C; Achenbach, P; Ayerbe Gayoso, C; Böhm, R; Bosnar, D; Debenjak, L; Distler, M O; Doria, L; Esser, A; Fonvieille, H; Friedrich, J M; Friedrich, J; Gómez Rodríguez de la Paz, M; Makek, M; Merkel, H; Middleton, D G; Müller, U; Nungesser, L; Pochodzalla, J; Potokar, M; Sánchez Majos, S; Schlimme, B S; Sirca, S; Walcher, Th; Weinriefer, M

    2010-12-10

    New precise results of a measurement of the elastic electron-proton scattering cross section performed at the Mainz Microtron MAMI are presented. About 1400 cross sections were measured with negative four-momentum transfers squared up to Q² = 1 (GeV/c)² with statistical errors below 0.2%. The electric and magnetic form factors of the proton were extracted by fits of a large variety of form factor models directly to the cross sections. The form factors show some features at the scale of the pion cloud. The charge and magnetic radii are determined to be ½ = 0.879(5)stat(4)syst(2)model(4)group fm and ½ = 0.777(13)stat(9)syst(5)model(2)group fm. PMID:21231520

  4. High-Precision Determination of the Electric and Magnetic Form Factors of the Proton

    SciTech Connect

    Bernauer, J. C.; Achenbach, P.; Ayerbe Gayoso, C.; Boehm, R.; Distler, M. O.; Doria, L.; Esser, A.; Friedrich, J.; Gomez Rodriguez de la Paz, M.; Merkel, H.; Middleton, D. G.; Mueller, U.; Nungesser, L.; Pochodzalla, J.; Sanchez Majos, S.; Schlimme, B. S.; Walcher, Th.; Weinriefer, M.; Bosnar, D.; Makek, M.

    2010-12-10

    New precise results of a measurement of the elastic electron-proton scattering cross section performed at the Mainz Microtron MAMI are presented. About 1400 cross sections were measured with negative four-momentum transfers squared up to Q{sup 2}=1 (GeV/c){sup 2} with statistical errors below 0.2%. The electric and magnetic form factors of the proton were extracted by fits of a large variety of form factor models directly to the cross sections. The form factors show some features at the scale of the pion cloud. The charge and magnetic radii are determined to be {sup 1/2}=0.879(5){sub stat}(4){sub syst}(2){sub model}(4){sub group} fm and {sup 1/2}=0.777(13){sub stat}(9){sub syst}(5){sub model}(2){sub group} fm.

  5. Global analysis of proton elastic form factor data with two-photon exchange corrections

    SciTech Connect

    J. Arrington; W. Melnitchouk; J. A. Tjon

    2007-09-01

    We use the world's data on elastic electron-proton scattering and calculations of two-photon exchange effects to extract corrected values of the proton's electric and magnetic form factors over the full Q^2 range of the existing data. Our analysis combines the corrected Rosenbluth cross section and polarization transfer data, and is the first extraction of G_Ep and G_Mp including explicit two-photon exchange corrections and their associated uncertainties. In addition, we examine the angular dependence of the corrected cross sections, and discuss the possible nonlinearities of the cross section as a function of epsilon.

  6. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    NASA Astrophysics Data System (ADS)

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R. P.; Arrington, J.; Brooks, W. K.; Adhikari, K. P.; Afanasev, A. V.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A. S.; Bono, J.; Boiarinov, S.; Briscoe, W. J.; Burkert, V. D.; Carman, D. S.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G. E.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J. A.; Fradi, A.; Garillon, B.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Jenkins, D.; Jiang, H.; Jo, H. S.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Koirala, S.; Kubarovsky, V.; Kuhn, S. E.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moody, C. I.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Peña, C.; Pisano, S.; Pogorelko, O.; Price, J. W.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A. J. R.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seder, E.; Sharabian, Y. G.; Simonyan, A.; Skorodumina, I.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2015-02-01

    There is a significant discrepancy between the values of the proton electric form factor, GEp, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GEp from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ɛ ) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ɛ at Q2=1.45 GeV2 . This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2 - 3 GeV2 .

  7. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R. P.; Arrington, J.; Brooks, W. K.; Adhikari, K. P.; Afanasev, A. V.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Hafidi, K.; Moody, C. I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p). from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing epsilon at Q(2) = 1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q(2) approximate to 1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  8. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    SciTech Connect

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; Amaryan, M.; Anderson, M.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Battaglieri, M.; Bedlinskiy, I.; Biselli, A.; Bono, J.; Boiarinov, S.; Briscoe, W.; Burkert, V.; Carman, D.; Careccia, S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dodge, G.; Dupre, R.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Elouadrhiri, L.; Eugenio, P.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J.; Fradi, A.; Garillon, B.; Gilfoyle, G.; Giovanetti, K.; Girod, F.; Goetz, J.; Gohn, W.; Golovatch, E.; Gothe, R.; Griffioen, K.; Guegan, B.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Holtrop, M.; Hughes, S.; Hyde, C. E.; Ilieva, Y.; Ireland, D.; Ishkhanov, B.; Jenkins, D.; Jiang, H.; Jo, H.; Joo, K.; Joosten, S.; Kalantarians, N.; Keller, D.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F.; Koirala, S.; Kubarovsky, V.; Kuhn, S.; Livingston, K.; Lu, H.; MacGregor, I.; Markov, N.; Mattione, P.; Mayer, M.; McKinnon, B.; Mestayer, M.; Meyer, C.; Mirazita, M.; Mokeev, V.; Montgomery, R.; Moody, C.; Moutarde, H.; Movsisyan, A.; Camacho, C. Munoz; Nadel-Turonski, P.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A.; Park, K.; Pasyuk, E.; Pisano, S.; Pogorelko, O.; Price, J.; Procureur, S.; Prok, Y.; Protopopescu, D.; Puckett, A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabati, F.; Salgado, C.; Schott, D.; Schumacher, R.; Seder, E.; Sharabian, Y.; Simonyan, A.; Skorodumina, I.; Smith, E.; Smith, G.; Sober, D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strauch, S.; Sytnik, V.; Taiuti, M.; Tian, Ye; Trivedi, A.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N.; Watts, D.; Wei, X.; Wood, M.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z.; Zonta, I.

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentum transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.

  9. Towards a Resolution of the Proton Form Factor Problem: New Electron and Positron Scattering Data

    DOE PAGESBeta

    Adikaram, D.; Rimal, D.; Weinstein, L. B.; Raue, B.; Khetarpal, P.; Bennett, R.; Arrington, J.; Brooks, W.; Adhikari, K.; Afanasev, A.; et al

    2015-02-10

    There is a significant discrepancy between the values of the proton electric form factor, GpE, extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of GpE from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (epsilon) and momentummore » transfer (Q2) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ε at Q2=1.45 GeV2. This measurement is consistent with the size of the form factor discrepancy at Q2≈1.75 GeV2 and with hadronic calculations including nucleon and Delta intermediate states, which have been shown to resolve the discrepancy up to 2-3 GeV2.« less

  10. Towards a resolution of the proton form factor problem: new electron and positron scattering data.

    PubMed

    Adikaram, D; Rimal, D; Weinstein, L B; Raue, B; Khetarpal, P; Bennett, R P; Arrington, J; Brooks, W K; Adhikari, K P; Afanasev, A V; Amaryan, M J; Anderson, M D; Anefalos Pereira, S; Avakian, H; Ball, J; Battaglieri, M; Bedlinskiy, I; Biselli, A S; Bono, J; Boiarinov, S; Briscoe, W J; Burkert, V D; Carman, D S; Careccia, S; Celentano, A; Chandavar, S; Charles, G; Colaneri, L; Cole, P L; Contalbrigo, M; Crede, V; D'Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Dodge, G E; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Filippi, A; Fleming, J A; Fradi, A; Garillon, B; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Goetz, J T; Gohn, W; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guidal, M; Guo, L; Hafidi, K; Hakobyan, H; Hanretty, C; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Hughes, S M; Hyde, C E; Ilieva, Y; Ireland, D G; Ishkhanov, B S; Jenkins, D; Jiang, H; Jo, H S; Joo, K; Joosten, S; Kalantarians, N; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kubarovsky, V; Kuhn, S E; Livingston, K; Lu, H Y; MacGregor, I J D; Markov, N; Mattione, P; Mayer, M; McKinnon, B; Mestayer, M D; Meyer, C A; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Camacho, C Munoz; Nadel-Turonski, P; Niccolai, S; Niculescu, G; Osipenko, M; Ostrovidov, A I; Park, K; Pasyuk, E; Peña, C; Pisano, S; Pogorelko, O; Price, J W; Procureur, S; Prok, Y; Protopopescu, D; Puckett, A J R; Ripani, M; Rizzo, A; Rosner, G; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Sharabian, Y G; Simonyan, A; Skorodumina, I; Smith, E S; Smith, G D; Sober, D I; Sokhan, D; Sparveris, N; Stepanyan, S; Stoler, P; Strauch, S; Sytnik, V; Taiuti, M; Tian, Ye; Trivedi, A; Ungaro, M; Voskanyan, H; Voutier, E; Walford, N K; Watts, D P; Wei, X; Wood, M H; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I

    2015-02-13

    There is a significant discrepancy between the values of the proton electric form factor, G(E)(p), extracted using unpolarized and polarized electron scattering. Calculations predict that small two-photon exchange (TPE) contributions can significantly affect the extraction of G(E)(p) from the unpolarized electron-proton cross sections. We determined the TPE contribution by measuring the ratio of positron-proton to electron-proton elastic scattering cross sections using a simultaneous, tertiary electron-positron beam incident on a liquid hydrogen target and detecting the scattered particles in the Jefferson Lab CLAS detector. This novel technique allowed us to cover a wide range in virtual photon polarization (ϵ) and momentum transfer (Q(2)) simultaneously, as well as to cancel luminosity-related systematic errors. The cross section ratio increases with decreasing ϵ at Q(2)=1.45  GeV(2). This measurement is consistent with the size of the form factor discrepancy at Q(2)≈1.75  GeV(2) and with hadronic calculations including nucleon and Δ intermediate states, which have been shown to resolve the discrepancy up to 2-3  GeV(2). PMID:25723209

  11. New Precision Limit on the Strange Vector Form Factors of the Proton

    SciTech Connect

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; Canan, M.; Camsonne, A.; Cates, G. D.; Chen, J. -P.; Chudakov, E.; Cisbani, E.; Dalton, M. M.; de Jager, C. W.; De Leo, R.; Deconinck, W.; Decowski, P.; Deng, X.; Deur, A.; Dutta, C.; Franklin, G. B.; Friend, M.; Frullani, S.; Garibaldi, F.; Giusa, A.; Glamazdin, A.; Golge, S.; Grimm, K.; Hansen, O.; Higinbotham, D. W.; Holmes, R.; Holmstrom, T.; Huang, J.; Huang, M.; Hyde, C. E.; Jen, C. M.; Jin, G.; Jones, D.; Kang, H.; King, P.; Kowalski, S.; Kumar, K. S.; Lee, J. H.; LeRose, J. J.; Liyanage, N.; Long, E.; McNulty, D.; Margaziotis, D.; Meddi, F.; Meekins, D. G.; Mercado, L.; Meziani, Z. -E.; Michaels, R.; Muñoz-Camacho, C.; Mihovilovic, M.; Muangma, N.; Myers, K. E.; Nanda, S.; Narayan, A.; Nelyubin, V.; Nuruzzaman, None; Oh, Y.; Pan, K.; Parno, D.; Paschke, K. D.; Phillips, S. K.; Qian, X.; Qiang, Y.; Quinn, B.; Rakhman, A.; Reimer, P. E.; Rider, K.; Riordan, S.; Roche, J.; Rubin, J.; Russo, G.; Saenboonruang, K.; Saha, A.; Sawatzky, B.; Silwal, R.; Sirca, S.; Souder, P. A.; Sperduto, M.; Subedi, R.; Suleiman, R.; Sulkosky, V.; Sutera, C. M.; Tobias, W. A.; Urciuoli, G. M.; Waidyawansa, B.; Wang, D.; Wexler, J.; Wilson, R.; Wojtsekhowski, B.; Zhan, X.; Yan, X.; Yao, H.; Ye, L.; Zhao, B.; Zheng, X.

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.

  12. New precision limit on the strange vector form factors of the proton.

    PubMed

    Ahmed, Z; Allada, K; Aniol, K A; Armstrong, D S; Arrington, J; Baturin, P; Bellini, V; Benesch, J; Beminiwattha, R; Benmokhtar, F; Canan, M; Camsonne, A; Cates, G D; Chen, J-P; Chudakov, E; Cisbani, E; Dalton, M M; de Jager, C W; De Leo, R; Deconinck, W; Decowski, P; Deng, X; Deur, A; Dutta, C; Franklin, G B; Friend, M; Frullani, S; Garibaldi, F; Giusa, A; Glamazdin, A; Golge, S; Grimm, K; Hansen, O; Higinbotham, D W; Holmes, R; Holmstrom, T; Huang, J; Huang, M; Hyde, C E; Jen, C M; Jin, G; Jones, D; Kang, H; King, P; Kowalski, S; Kumar, K S; Lee, J H; LeRose, J J; Liyanage, N; Long, E; McNulty, D; Margaziotis, D; Meddi, F; Meekins, D G; Mercado, L; Meziani, Z-E; Michaels, R; Muñoz-Camacho, C; Mihovilovic, M; Muangma, N; Myers, K E; Nanda, S; Narayan, A; Nelyubin, V; Nuruzzaman; Oh, Y; Pan, K; Parno, D; Paschke, K D; Phillips, S K; Qian, X; Qiang, Y; Quinn, B; Rakhman, A; Reimer, P E; Rider, K; Riordan, S; Roche, J; Rubin, J; Russo, G; Saenboonruang, K; Saha, A; Sawatzky, B; Silwal, R; Sirca, S; Souder, P A; Sperduto, M; Subedi, R; Suleiman, R; Sulkosky, V; Sutera, C M; Tobias, W A; Urciuoli, G M; Waidyawansa, B; Wang, D; Wexler, J; Wilson, R; Wojtsekhowski, B; Zhan, X; Yan, X; Yao, H; Ye, L; Zhao, B; Zheng, X

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624  GeV2 and beam energy E(b) = 3.48  GeV to be A(PV) = -23.80 ± 0.78(stat) ± 0.36(syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors G(E)(s) + 0.517G(M)(s) = 0.003 ± 0.010(stat) ± 0.004(syst) ± 0.009(ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections. With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors. PMID:22468841

  13. New Precision Limit on the Strange Vector Form Factors of the Proton

    DOE PAGESBeta

    Ahmed, Z.; Allada, K.; Aniol, K. A.; Armstrong, D. S.; Arrington, J.; Baturin, P.; Bellini, V.; Benesch, J.; Beminiwattha, R.; Benmokhtar, F.; et al

    2012-03-01

    The parity-violating cross-section asymmetry in the elastic scattering of polarized electrons from unpolarized protons has been measured at a four-momentum transfer squared Q2 = 0.624 GeV2 and beam energy Eb = 3.48 GeV to be APV = -23.80 ± 0.78 (stat) ± 0.36 (syst) parts per million. This result is consistent with zero contribution of strange quarks to the combination of electric and magnetic form factors GEs + 0.517 GMs = 0.003 ± 0.010 (stat) ± 0.004 (syst) ± 0.009 (ff), where the third error is due to the limits of precision on the electromagnetic form factors and radiative corrections.more » With this measurement, the world data on strange contributions to nucleon form factors are seen to be consistent with zero and not more than a few percent of the proton form factors.« less

  14. Feasibility studies on time-like proton electromagnetic form factors at PANDA-FAIR

    NASA Astrophysics Data System (ADS)

    Zimmermann, Iris; Dbeyssi, Alaa; Khaneft, Dmitry

    2016-05-01

    This contribution reports on the latest status of the feasibility studies for the measurement of time-like proton electromagnetic form factors (FF's) at the PANDA experiment [1] at FAIR (Germany). Electromagnetic FF's are fundamental quantities parameterizing the electric and magnetic structure of hadrons. In the time-like region proton FF's can be accessed experimentally through the annihilation processes p ¯p → l+l- (l = e, μ), assuming that the interaction takes place through the exchange of one virtual photon. Due to the low luminosity available at colliders in the past, an individual determination of the time-like electric and magnetic proton FF's was not feasible. The statistical precision, at which the proton FF's will be determined at PANDA, is estimated for both signal processes p ¯p → l+l- (l = e, μ) using the PandaRoot software, which encompasses full detector simulation and event reconstruction. The signal identification and suppression of the main background process (p ¯p → π+π-) is studied. Different methods have been used to generate and analyze the processes of interest. The results from the different analyses show that time-like electromagnetic FF's can be measured at PANDA with unprecedented statistical accuracy.

  15. Phenomenological analysis of near-threshold periodic modulations of the proton timelike form factor

    NASA Astrophysics Data System (ADS)

    Bianconi, A.; Tomasi-Gustafsson, E.

    2016-03-01

    We have recently highlighted the presence of a periodically oscillating 10% modulation in the BABAR Collaboration data on the proton timelike form factors, expressing the deviations from the pointlike behavior of the proton-antiproton electromagnetic current in the reaction e++e-→p ¯+p . Here we deepen our previous data analysis and confirm that in the case of several standard parametrizations it is possible to write the form factor in the form F0+Fosc , where F0 is a parametrization expressing the long-range trend of the form factor (for q2 ranging from the p ¯p threshold to 36 GeV2), and Fosc is a function of the form exp(-B p )cos(C p ) , where p is the relative momentum of the final p ¯p pair. Error bars allow for a clean identification of the main features of this modulation for q2<10 GeV2 . Assuming this oscillatory modulation to be an effect of final-state interactions between the forming proton and the antiproton, we propose a phenomenological model based on a double-layer imaginary optical potential. This potential is flux absorbing when the distance between the proton and antiproton centers of mass is ≳1.7 - 1.8 fm and flux generating when it is ≲1.7 - 1.8 fm. The main features of the oscillations may be reproduced with some freedom in the potential parameters, but the transition between the two layers must be sudden (0-0.2 fm) to get the correct oscillation period. The flux-absorbing part of the p ¯p interaction is well known in the phenomenology of small-energy antiproton interactions and is due to the annihilation of p ¯p pairs into multimeson states. We interpret the flux-creating part of the potential as due to the creation of a 1 /q -ranged state when the virtual photon decays into a set of current quarks and antiquarks. This short-lived compact state may be expressed as a sum of several hadronic states including the ones with large mass Qn≫q , that may exist for a time t ˜1 /(Qn-q ) . The decay of these large-mass states leads to an

  16. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely

  17. Measurements of the electromagnetic form factor of the Proton at Jlab

    SciTech Connect

    Vina Punjabi; Charles Perdrisat

    2003-04-01

    The ratio of the proton's elastic electromagnetic form factors G{sub E{sub p}}/G{sub M{sub p}} was obtained by measuring P{sub t} and P{sub {ell}}, the transverse and longitudinal recoil proton polarization, respectively. For the elastic reaction {rvec e}p {yields} e{rvec p}, G{sub E{sub p}}/G{sub M{sub p}} is proportional to P{sub t}/P{sub {ell}}. The simultaneous measurement of P{sub t} and P{sub {ell}} in a polarimeter reduces systematic uncertainties. The results for the ratio G{sub E{sub p}}/G{sub M{sub p}} measured in Hall A so far show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. Together these experiments cover the Q{sub 2}- range of 0.5 to 5.6 GeV{sup 2}. A new experiment is currently being prepared, to extend the Q{sup 2}-range to 9 GeV{sup 2} in Hall C.

  18. Proton Magnetic Form Factor from Existing Elastic e-p Cross Section Data

    NASA Astrophysics Data System (ADS)

    Ou, Longwu; Christy, Eric; Gilad, Shalev; Keppel, Cynthia; Schmookler, Barak; Wojtsekhowski, Bogdan

    2015-04-01

    The proton magnetic form factor GMp, in addition to being an important benchmark for all cross section measurements in hadron physics, provides critical information on proton structure. Extraction of GMp from e-p cross section data is complicated by two-photon exchange (TPE) effects, where available calculations still have large theoretical uncertainties. Studies of TPE contributions to e-p scattering have observed no nonlinear effects in Rosenbluth separations. Recent theoretical investigations show that the TPE correction goes to 0 when ɛ approaches 1, where ɛ is the virtual photon polarization parameter. In this talk, existing e-p elastic cross section data are reanalyzed by extrapolating the reduced cross section for ɛ approaching 1. Existing polarization transfer data, which is supposed to be relatively immune to TPE effects, are used to produce a ratio of electric and magnetic form factors. The extrapolated reduced cross section and polarization transfer ratio are then used to calculate GEp and GMp at different Q2 values.

  19. Low Q^2 measurements of the proton form factor ratio $mu_p G_E / G_M$

    SciTech Connect

    Ron, G; Zhan, X; Lee, B; Allada, K; Armstrong, W; Arrington, J; Beck, A; Benmokhtar, F; Berman, B L; Boeglin, W; Brash, E; Camsonne, A; Calarco, J; Chen, J P; Choi, S; Chudakov, E; Coman, L; Craver, B; Cusanno, F; Dumas, J; Dutta, C; Feuerbach, R; Freyberger, A; Frullani, S; Garibaldi, F; Gilman, R; Hansen, O; Higinbotham, D W; Holmstrom, T; Hyde, C E; Ibrahim, H; Ilieva, Y; de Jager, C W; Jiang, X; Jones, M; Kelleher, A; Khrosinkova, E; Kuchina, E; Kumbartzki, G; LeRose, J J; Lindgren, R; Markowitz, P; May-Tal Beck, S; McCullough, E; Meziane, M; Meziani, Z -E; Michaels, R; Moffit, B; Norum, B E; Oh, Y; Olson, M; Paolone, M; Paschke, K; Perdrisat, C F; Piasetzky, E; Potokar, M; Pomatsalyuk, R; Pomerantz, I; Puckett, A; Punjabi, V; Qian, X; Qiang, Y; Ransome, R; Reyhan, M

    2011-11-01

    We present an updated extraction of the proton electromagnetic form factor ratio, {mu}{sub p}G{sub E}/G{sub M}, at low Q{sup 2}. The form factors are sensitive to the spatial distribution of the proton, and precise measurements can be used to constrain models of the proton. An improved selection of the elastic events and reduced background contributions yielded a small systematic reduction in the ratio {mu}{sub p}G{sub E}/G{sub M} compared to the original analysis.

  20. Strange magnetic form factor of the proton at $Q^2 = 0.23$ GeV$^2$

    SciTech Connect

    Wang, Ping; Leinweber, Derek; Thomas, Anthony; Young, Ross

    2009-06-01

    We determine the $u$ and $d$ quark contributions to the proton magnetic form factor at finite momentum transfer by applying chiral corrections to quenched lattice data. Heavy baryon chiral perturbation theory is applied at next to leading order in the quenched, and full QCD cases for the valence sector using finite range regularization. Under the assumption of charge symmetry these values can be combined with the experimental values of the proton and neutron magnetic form factors to deduce a relatively accurate value for the strange magnetic form factor at $Q^2=0.23$ GeV$^2$, namely $G_M^s=-0.034 \\pm 0.021$ $\\mu_N$.

  1. Recoil Polarization Measurements of the Proton Electromagnetic Form Factor Ratio to Q^2 = 8.5 GeV^2

    SciTech Connect

    Puckett, A J.R.; Jones, M K; Luo, W; Meziane, M; Pentchev, L; Perdrisat, C F; Punjabi, V; Wesselmann, F R; Ahmidouch, A; Albayrak, I; Aniol, K A; Arrington, J; Asaturyan, A; Baghdasaryan, H; Benmokhtar, F; Bertozzi, W; Bimbot, L; Bosted, P; Boeglin, W; Butuceanu, C; Carter, P; Chernenko, S; Christy, E; Commisso, M; Cornejo, J C; Covrig, S; Danagoulian, S; Daniel, A; Davidenko, A; Day, D; Dhamija, S; Dutta, D; Ent, R; Frullani, S; Fenker, H; Frlez, E; Garibaldi, F; Gaskell, D; Gilad, S; Gilman, R; Goncharenko, Y; Hafidi, K; Hamilton, D; Higinbotham, D W; Hinton, W; Horn, T; Hu, B; Huang, J; Huber, G M; Jensen, E; Keppel, C; Khandaker, M; King, P; Kirillov, D; Kohl, M; Kravtsov, V; Kumbartzki, G; Li, Y; Mamyan, V; Margaziotis, D J; Marsh, A; Matulenko, Y; Maxwell, J; Mbianda, G; Meekins, D; Melnik, Y; Miller, J; Mkrtchyan, A; Mkrtchyan, H; Moffit, B; Moreno, O; Mulholland, J; Narayan, A; Nedev, S; Nuruzzaman,; Piasetzky, E; Pierce, W; Piskunov, N M; Prok, Y; Ransome, R D; Razin, D S; Reimer, P; Reinhold, J; Rondon, O; Shabestari, M; Shahinyan, A; Shestermanov, K; Sirca, S; Sitnik, I; Smykov, L; Smith, G; Solovyev, L; Solvingnon, P; Subedi, R; Tomasi-Gustafsson, E; Vasiliev, A; Veilleux, M; Wojtsekhowski, B B; Wood, S; Ye, Z; Zanevsky, Y; Zhang, X; Zhang, Y; Zheng, X; Zhu, L

    2010-06-01

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon’s quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q2=5.2, 6.7, and 8.5  GeV2. By extending the range of Q2 for which GEp is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime.

  2. The Proton Elastic Form Factor Ratio mu(p) G**p(E)/G**p(M) at Low Momentum Transfer

    SciTech Connect

    G. Ron; J. Glister; B. Lee; K. Allada; W. Armstrong; J. Arrington; A. Beck; F. Benmokhtar; B.L. Berman; W. Boeglin; E. Brash; A. Camsonne; J. Calarco; J. P. Chen; Seonho Choi; E. Chudakov; L. Coman; B. Craver; F. Cusanno; J. Dumas; C. Dutta; R. Feuerbach; A. Freyberger; S. Frullani; F. Garibaldi; R. Gilman; O. Hansen; D. W. Higinbotham; T. Holmstrom; C.E. Hyde; H. Ibrahim; Y. Ilieva; C. W. de Jager; X. Jiang; M. K. Jones; A. Kelleher; E. Khrosinkova; E. Kuchina; G. Kumbartzki; J. J. LeRose; R. Lindgren; P. Markowitz; S. May-Tal Beck; E. McCullough; D. Meekins; M. Meziane; Z.-E. Meziani; R. Michaels; B. Moffit; B.E. Norum; Y. Oh; M. Olson; M. Paolone; K. Paschke; C. F. Perdrisat; E. Piasetzky; M. Potokar; R. Pomatsalyuk; I. Pomerantz; A. Puckett; V. Punjabi; X. Qian; Y. Qiang; R. Ransome; M. Reyhan; J. Roche; Y. Rousseau; A. Saha; A.J. Sarty; B. Sawatzky; E. Schulte; M. Shabestari; A. Shahinyan; R. Shneor; S. ˇ Sirca; K. Slifer; P. Solvignon; J. Song; R. Sparks; R. Subedi; S. Strauch; G. M. Urciuoli; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; X. Zhan; X. Zhu

    2007-11-01

    High precision measurements of the proton elastic form factor ratio have been made at four-momentum transfers, Q^2, between 0.2 and 0.5 GeV^2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q^2 range the deviation from unity is primarily due to GEp being smaller than the dipole parameterization.

  3. High Precision Measurement of the Proton Elastic Form Factor Ratio at Low Q2

    SciTech Connect

    Zhan, Xiaohui

    2010-01-01

    Experiment E08-007 measured the proton elastic form factor ratio μpGE/GM in the range of Q2 = 0.3-0.7(GeV/c)2 by recoil polarimetry. Data were taken in 2008 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 1.2 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The recoil proton was detected in the left HRS in coincidence with the elasticly scattered electrons tagged by the BigBite spectrometer. The proton polarization was measured by the focal plane polarimeter (FPP). In this low Q2 region, previous measurement from Jefferson Lab Hall A (LEDEX) along with various fits and calculations indicate substantial deviations of the ratio from unity. For this new measurement, the proposed statistical uncertainty (< 1%) was achieved. These new results are a few percent lower than expected from previous world data and fits, which indicate a smaller GEp at this region. Beyond the intrinsic interest in nucleon structure, the new results also have implications in determining the proton Zemach radius and the strangeness form factors from parity violation experiments.

  4. High-precision measurement of the proton elastic form factor ratio μpGE/GM at low Q2

    DOE PAGESBeta

    Zhan, X.; Allada, K.; Armstrong, D. S.; Arrington, J.; Bertozzi, W.; Boeglin, W.; Chen, J. -P.; Chirapatpimol, K.; Choi, S.; Chudakov, E.; et al

    2011-10-06

    Here, we report a new high precision measurement of the proton elastic form factor ratio μpGE/GM for the four-momentum transfer squared Q2 = 0.3-0.7 (GeV/c)2. The measurement was performed at Jefferson Lab (JLab) in Hall A using recoil polarimetry. With the achieved ~1% total uncertainty, the new data clearly show that the deviation of the ratio μpGE/GM from unity observed in previous polarization measurements at high Q2 continues down to the lowest Q2 value of this measurement. The updated global fit that includes the new results yields in this Q2 range an electric (magnetic) form factor ~2% smaller (~1% larger)more » than the previous global fit. We obtain new extractions of the proton electric and magnetic radii, which are (rE2)1/2 = 0.875 ± 0.010 fm and (rM2)1/2 = 0.867 ± 0.020 fm. Moreover, the charge radius is consistent with other recent extractions based on the electron-proton interaction, including the atomic hydrogen Lamb shift measruements, which suggests a missing correction in the comparison of measurements of the proton charge radius using electron probes and the recent extraction from the muonic hydrogen Lamb shift.« less

  5. New Measurement of Parity Violation in Elastic Electron-Proton Scattering and Implications for Strange Form Factors

    SciTech Connect

    Konrad Aniol; David Armstrong; Todd Averett; Maud Baylac; Etienne Burtin; John Calarco; Gordon Cates; Christian Cavata; Zhengwei Chai; C. Chang; Jian-Ping Chen; Eugene Chudakov; Evaristo Cisbani; Marius Coman; Daniel Dale; Alexandre Deur; Pibero Djawotho; Martin Epstein; Stephanie Escoffier; Lars Ewell; Nicolas Falletto; John Finn; A. Fleck; Bernard Frois; Salvatore Frullani; Juncai Gao; Franco Garibaldi; Ashot Gasparian; G. M. Gerstner; Ronald Gilman; Oleksandr Glamazdin; Javier Gomez; Viktor Gorbenko; Jens-ole Hansen; F. Hersman; Douglas Higinbotham; Richard Holmes; Maurik Holtrop; Thomas Humensky; Sebastien Incerti; Mauro Iodice; Cornelis De Jager; Johann Jardillier; Xiaodong Jiang; Mark Jones; J. Jorda; Christophe Jutier; W. Kahl; James Kelly; Donghee Kim; M. -J. Kim; Minsuk Kim; Ioannis Kominis; Edgar Kooijman; Kevin Kramer; Krishna Kumar; Michael Kuss; John LeRose; Raffaele De Leo; M. Leuschner; David Lhuillier; Meihua Liang; Nilanga Liyanage; R. Lourie; Richard Madey; Sergey Malov; Demetrius Margaziotis; Frederic Marie; Pete Markowitz; Jacques Martino; Peter Mastromarino; Kathy McCormick; Justin McIntyre; Zein-Eddine Meziani; Robert Michaels; Brian Milbrath; Gerald Miller; Joseph Mitchell; Ludyvine Morand; Damien Neyret; Gerassimos Petratos; Roman Pomatsalyuk; John Price; David Prout; Thierry Pussieux; Gilles Quemener; Ronald Ransome; David Relyea; Yves Roblin; Julie Roche; Gary Rutledge; Paul Rutt; Marat Rvachev; Franck Sabatie; Arunava Saha; Paul Souder; Marcus Spradlin; Steffen Strauch; Riad Suleiman; Jeffrey Templon; T. Teresawa; James Thompson; Raphael Tieulent; Luminita Todor; Baris Tonguc; Paul Ulmer; Guido Urciuoli; Branislav Vlahovic; Krishni Wijesooriya; R. Wilson; Bogdan Wojtsekhowski; Rhett Woo; Wang Xu; Imran Younus; C. Zhang

    2001-06-01

    We have measured the parity-violating electroweak asymmetry in the elastic scattering of polarized electrons from the proton. The result is A = -15.05 +- 0.98(stat) {+-} 0.56(syst) ppm at the kinematic point theta{sub lab} = 12.3 degrees and Q{sup 2} = 0.477 (GeV/c){sup 2}. The measurement implies that the value for the strange form factor (G{sub E}{sup s} + 0.392 G{sub M}{sup s})/(G{sub M}{sup p} {mu}{sub p}) = 0.069 +- 0.056 +- 0.039, where the first error is experimental and the second arises from the uncertainties in electromagnetic form factors. This measurement is the first fixed-target parity violation experiment that used either a ''strained'' GaAs photocathode to produce highly polarized electrons or a Compton polarimeter to continuously monitor the electron beam polarization.

  6. Two-photon exchange contribution to proton form factors in the time-like region

    SciTech Connect

    Chen, D. Y.; Dong, Y. B.; Zhou, H. Q.

    2008-10-15

    We estimate the two-photon exchange contribution to the process e{sup +}+e{sup -}{yields}p+p . The two-photon exchange corrections to double spin polarization observables and form factors in the time-like region are calculated. The corrections are found to be small in magnitude but with a strong angular dependence at fixed momentum transfer. These two features are the same as those in the space-like region. In future experiments, the double spin polarization observable P{sub z} deserves to be considered.

  7. Parity-Violating Electron Deuteron Scattering and the Proton's Neutral Weak Axial Vector Form Factor

    SciTech Connect

    Ito, Takeyasu; Averett, Todd; Barkhuff, David; Batigne, Guillaume; Beck, Douglas; Beise, Elizabeth; Blake, A.; Breuer, Herbert; Carr, Robert; Clasie, Benjamin; Covrig, Silviu; Danagoulian, Areg; Dodson, George; Dow, Karen; Dutta, Dipangkar; Farkhondeh, Manouchehr; Filippone, Bradley; FRANKLIN, W.; Furget, Christophe; Gao, Haiyan; Gao, Juncai; Gustafsson, Kenneth; Hannelius, Lars; Hasty, R.; Allen, Alice; Herda, M.C.; Jones, CE; King, Paul; Korsch, Wolfgang; Kowalski, Stanley; Kox, Serge; Kramer, Kevin; Lee, P.; Liu, Jinghua; Martin, Jeffery; McKeown, Robert; Mueller, B.; Pitt, Mark; Plaster, Bradley; Quemener, Gilles; Real, Jean-Sebastien; Ritter, J.; Roche, Julie; Savu, V.; Schiavilla, Rocco; Seely, Charles; Spayde, Damon; Suleiman, Riad; Taylor, S.; Tieulent, Raphael; Tipton, Bryan; Tsentalovich, E.; Wells, Steven; Yang, Bin; Yuan, Jing; Yun, Junho; Zwart, Townsend

    2004-03-01

    We report on a new measurement of the parity-violating asymmetry in quasielastic electron scattering from the deuteron at backward angles at Q2 = 0.038 (GeV/c)2. This quantity provides a determination of the neutral weak axial vector form factor of the nucleon, which can potentially receive large electroweak corrections. The measured asymmetry A = z3.51±0.57 (stat)±0.58 (syst) ppm is consistent with theoretical predictions. We also report on updated results of the previous experiment at Q2 = 0.091 (GeV/c)2, which are also consistent with theoretical predictions.

  8. Meson exchange effects in elastic ep scattering at loop level and the electromagnetic form factors of the proton

    NASA Astrophysics Data System (ADS)

    Chen, Hong-Yu; Zhou, Hai-Qing

    2014-10-01

    A new form of two-photon exchange (TPE) effect is studied to explain the discrepancy between unpolarized and polarized experimental data in elastic ep scattering. The mechanism is based on a simple idea that apart from the usual TPE effects from box and crossed-box diagrams, the mesons may also be exchanged in elastic ep scattering by two-photon coupling at loop level. The detailed study shows such contributions to reduced unpolarized cross section (σun) and polarized observables (Pt,Pl) at fixed Q2 are only dependent on proton's electromagnetic form factors GE ,M and a new unknown universal parameter g. After combining this contribution with the usual TPE contributions from box and crossed-box diagrams, the ratio μpGE/GM extracted from the recent precise unpolarized and polarized experimental data can be described consistently.

  9. -Measurement of the proton's electric to magnetic form factor ratio from 1H(over -->)(e(over -->),e'p).

    PubMed

    Crawford, C B; Sindile, A; Akdogan, T; Alarcon, R; Bertozzi, W; Booth, E; Botto, T; Calarco, J; Clasie, B; Degrush, A; Donnelly, T W; Dow, K; Dutta, D; Farkhondeh, M; Fatemi, R; Filoti, O; Franklin, W; Gao, H; Geis, E; Gilad, S; Haeberli, W; Hasell, D; Hersman, W; Holtrop, M; Karpius, P; Kohl, M; Kolster, H; Lee, T; Maschinot, A; Matthews, J; McIlhany, K; Meitanis, N; Milner, R G; Redwine, R P; Seely, J; Shinozaki, A; Sirca, S; Six, E; Smith, T; Tonguc, B; Tschalaer, C; Tsentalovich, E; Turchinetz, W; van den Brand, J F J; van der Laan, J; Wang, F; Wise, T; Xiao, Y; Xu, W; Zhang, C; Zhou, Z; Ziskin, V; Zwart, T

    2007-02-01

    We report the first precision measurement of the proton electric to magnetic form factor ratio from spin-dependent elastic scattering of longitudinally polarized electrons from a polarized hydrogen internal gas target. The measurement was performed at the MIT-Bates South Hall Ring over a range of four-momentum transfer squared Q2 from 0.15 to 0.65 (GeV/c)(2). Significantly improved results on the proton electric and magnetic form factors are obtained in combination with existing cross-section data on elastic electron-proton scattering in the same Q2 region. PMID:17358849

  10. Recoil polarization measurements of the proton electromagnetic form factor ratio to Q2 = 8.5  GeV2.

    PubMed

    Puckett, A J R; Brash, E J; Jones, M K; Luo, W; Meziane, M; Pentchev, L; Perdrisat, C F; Punjabi, V; Wesselmann, F R; Ahmidouch, A; Albayrak, I; Aniol, K A; Arrington, J; Asaturyan, A; Baghdasaryan, H; Benmokhtar, F; Bertozzi, W; Bimbot, L; Bosted, P; Boeglin, W; Butuceanu, C; Carter, P; Chernenko, S; Christy, E; Commisso, M; Cornejo, J C; Covrig, S; Danagoulian, S; Daniel, A; Davidenko, A; Day, D; Dhamija, S; Dutta, D; Ent, R; Frullani, S; Fenker, H; Frlez, E; Garibaldi, F; Gaskell, D; Gilad, S; Gilman, R; Goncharenko, Y; Hafidi, K; Hamilton, D; Higinbotham, D W; Hinton, W; Horn, T; Hu, B; Huang, J; Huber, G M; Jensen, E; Keppel, C; Khandaker, M; King, P; Kirillov, D; Kohl, M; Kravtsov, V; Kumbartzki, G; Li, Y; Mamyan, V; Margaziotis, D J; Marsh, A; Matulenko, Y; Maxwell, J; Mbianda, G; Meekins, D; Melnik, Y; Miller, J; Mkrtchyan, A; Mkrtchyan, H; Moffit, B; Moreno, O; Mulholland, J; Narayan, A; Nedev, S; Nuruzzaman; Piasetzky, E; Pierce, W; Piskunov, N M; Prok, Y; Ransome, R D; Razin, D S; Reimer, P; Reinhold, J; Rondon, O; Shabestari, M; Shahinyan, A; Shestermanov, K; Sirca, S; Sitnik, I; Smykov, L; Smith, G; Solovyev, L; Solvignon, P; Subedi, R; Tomasi-Gustafsson, E; Vasiliev, A; Veilleux, M; Wojtsekhowski, B B; Wood, S; Ye, Z; Zanevsky, Y; Zhang, X; Zhang, Y; Zheng, X; Zhu, L

    2010-06-18

    Among the most fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon's quark constituents; indeed, recent proton data have attracted intense theoretical interest. In this Letter, we report new measurements of the proton electromagnetic form factor ratio using the recoil polarization method, at momentum transfers Q2=5.2, 6.7, and 8.5  GeV2. By extending the range of Q2 for which G(E)(p) is accurately determined by more than 50%, these measurements will provide significant constraints on models of nucleon structure in the nonperturbative regime. PMID:20873943

  11. Measurements of the proton elastic-form-factor ratio mu pG p E/G p M at low momentum transfer.

    PubMed

    Ron, G; Glister, J; Lee, B; Allada, K; Armstrong, W; Arrington, J; Beck, A; Benmokhtar, F; Berman, B L; Boeglin, W; Brash, E; Camsonne, A; Calarco, J; Chen, J P; Choi, Seonho; Chudakov, E; Coman, L; Craver, B; Cusanno, F; Dumas, J; Dutta, C; Feuerbach, R; Freyberger, A; Frullani, S; Garibaldi, F; Gilman, R; Hansen, O; Higinbotham, D W; Holmstrom, T; Hyde, C E; Ibrahim, H; Ilieva, Y; de Jager, C W; Jiang, X; Jones, M K; Kang, H; Kelleher, A; Khrosinkova, E; Kuchina, E; Kumbartzki, G; LeRose, J J; Lindgren, R; Markowitz, P; May-Tal Beck, S; McCullough, E; Meekins, D; Meziane, M; Meziani, Z-E; Michaels, R; Moffit, B; Norum, B E; Oh, Y; Olson, M; Paolone, M; Paschke, K; Perdrisat, C F; Piasetzky, E; Potokar, M; Pomatsalyuk, R; Pomerantz, I; Puckett, A; Punjabi, V; Qian, X; Qiang, Y; Ransome, R; Reyhan, M; Roche, J; Rousseau, Y; Saha, A; Sarty, A J; Sawatzky, B; Schulte, E; Shabestari, M; Shahinyan, A; Shneor, R; Sirca, S; Slifer, K; Solvignon, P; Song, J; Sparks, R; Subedi, R; Strauch, S; Urciuoli, G M; Wang, K; Wojtsekhowski, B; Yan, X; Yao, H; Zhan, X; Zhu, X

    2007-11-16

    High-precision measurements of the proton elastic form-factor ratio, mu pG p E/G p M, have been made at four-momentum transfer, Q2, values between 0.2 and 0.5 GeV2. The new data, while consistent with previous results, clearly show a ratio less than unity and significant differences from the central values of several recent phenomenological fits. By combining the new form-factor ratio data with an existing cross-section measurement, one finds that in this Q2 range the deviation from unity is primarily due to G p E being smaller than expected. PMID:18233135

  12. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Kees de Jager

    2004-08-01

    Although nucleons account for nearly all the visible mass in the universe, they have a complicated structure that is still incompletely understood. The first indication that nucleons have an internal structure, was the measurement of the proton magnetic moment by Frisch and Stern (1933) which revealed a large deviation from the value expected for a point-like Dirac particle. The investigation of the spatial structure of the nucleon, resulting in the first quantitative measurement of the proton charge radius, was initiated by the HEPL (Stanford) experiments in the 1950s, for which Hofstadter was awarded the 1961 Nobel prize. The first indication of a non-zero neutron charge distribution was obtained by scattering thermal neutrons off atomic electrons. The recent revival of its experimental study through the operational implementation of novel instrumentation has instigated a strong theoretical interest. Nucleon electro-magnetic form factors (EMFFs) are optimally studied through the exchange of a virtual photon, in elastic electron-nucleon scattering. The momentum transferred to the nucleon by the virtual photon can be selected to probe different scales of the nucleon, from integral properties such as the charge radius to scaling properties of its internal constituents. Polarization instrumentation, polarized beams and targets, and the measurement of the polarization of the recoiling nucleon have been essential in the accurate separation of the charge and magnetic form factors and in studies of the elusive neutron charge form factor.

  13. Nucleon Electromagnetic Form Factors

    SciTech Connect

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  14. A Precision Measurement of the Proton Strange-Quark Form Factors at Q2 = 0.624 GeV2

    NASA Astrophysics Data System (ADS)

    Friend, Megan Lynn

    The parity-violating asymmetry of the elastic scattering of highly polarized 3.84 GeV electrons from unpolarized protons at Q2 = 0.624 GeV2 has been measured to high precision. The measurement was carried out by the HAPPEX collaboration in Hall A of Jefferson Lab's Continuous Electron Beam Accelerator Facility. This precision measurement required careful control of any potential systematic effects, as well as a very precise determination of the absolute electron-beam polarization. In order to obtain the required precision on the electron-beam polarization measurement, an upgrade of the Hall A Compton polarimeter, and, in particular, the polarimeter's photon-arm detector and data acquisition system, was completed. A parity-violating asymmetry of APV = --23.80 +/- 0.78(stat) +/- 0.36(syst) ppm was measured. The predicted parity-violating asymmetry in the absence of strange quarks is ANS = --24.062 +/- 0.734 ppm. This allows for the extraction of the linear combination of proton strange-quark form factors GsE + 0.517 GsM = 0.003 +/- 0.010(stat) +/- 0.004(syst) +/- 0.009( ANS), where the third error is due to uncertainties in the nucleon electromagnetic form factors and radiative corrections. This measurement is consistent with zero strange contribution to the proton form factors at Q2 = 0.624 GeV2.

  15. Anomalous tensor magnetic moments and form factors of the proton in the self-consistent chiral quark-soliton model

    NASA Astrophysics Data System (ADS)

    Ledwig, Tim; Silva, Antonio; Kim, Hyun-Chul

    2010-09-01

    We investigate the form factors of the chiral-odd nucleon matrix element of the tensor current. In particular, we aim at the anomalous tensor magnetic form factors of the nucleon within the framework of the SU(3) and SU(2) chiral quark-soliton model. We consider 1/Nc rotational corrections and linear effects of SU(3) symmetry breaking with the symmetry-conserving quantization employed. We first obtain the results of the anomalous tensor magnetic moments for the up and down quarks: κTu=3.56 and κTd=1.83, respectively. The strange anomalous tensor magnetic moment is yielded to be κTs=0.2˜-0.2, that is compatible with zero. We also calculate the corresponding form factors κTq(Q2) up to a momentum transfer Q2≤1GeV2 at a renormalization scale of 0.36GeV2.

  16. Precision Measurement of the proton neutral weak form factors at Q{sup 2} ~ 0.1 GeV{sup 2}

    SciTech Connect

    Kaufman, Lisa

    2007-02-01

    This thesis reports the HAPPEX measurement of the parity-violating asymmetry for longitudinally polarized electrons elastically scattered from protons in a liquid hydrogen target. The measurement was carried out in Hall A at Thomas Jefferson National Accelerator Facility using a beam energy E = 3 GeV and scattering angle <θ{sub lab}> = 6°. The asymmetry is sensitive to the weak neutral form factors from which we extract the strange quark electric and magnetic form factors (G{sup s}{sub E} and G{sup s}{sub M}) of the proton. The measurement was conducted during two data-taking periods in 2004 and 2005. This thesis describes the methods for controlling the helicity-correlated beam asymmetries and the analysis of the raw asymmetry. The parity-violating asymmetry has been measured to be A{sub PV} = -1.14± 0.24 (stat)±0.06 (syst) ppm at = 0.099 GeV{sup 2} (2004), and A{sub PV} = -1.58±0.12 (stat)±0.04 (syst) ppm at = 0.109 GeV{sup 2} (2005). The strange quark form factors extracted from the asymmetry are G{sup s}{sub E} + 0.080G{sup s}{sub M} = 0.030 ± 0.025 (stat) ± 0.006 (syst) ± 0.012 (FF) (2004) and G{sup s}{sub E} +0.088G{sup s}{sub M} = 0.007±0.011 (stat)±0.004 (syst)±0.005 (FF) (2005). These results place the most precise constraints on the strange quark form factors and indicate little strange dynamics in the proton.

  17. Measurement of the axial and the strangeness magnetic form factor of the proton with a P2 backward angle setup

    SciTech Connect

    Baunack, S.; Becker, D.; Gerz, K.; Kumar, K.; Maas, F. E.

    2013-11-07

    The P2 experiment at the future accelerator facility MESA in Mainz aims for a precise determination of the weak charge of the proton at low momentum transfer. The experimental method is a measurement of the parity violating asymmetry in elastic electron-proton scattering at forward angle. This asymmetry is dominated by the weak charge, but also the proton structure plays a role. Here we consider a back angle measurement, which is more sensitive to the proton structure, and present its possible implications on the main P2 measurement.

  18. Proton elastic form factor ratios to Q{sup 2}=3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    Punjabi, V.; Perdrisat, C.F.; Gerstner, G.; Pentchev, L.; Rutledge, G.; Strauch, S.; Wijesooriya, K.; Aniol, K.A.; Epstein, M.B.; Margaziotis, D.J.; Baker, F.T.; Templon, J.A.; Berthot, J.; Bertin, P.Y.; Besson, A.; Fonvieille, H.; Jaminion, S.; Laveissiere, G.

    2005-05-01

    The ratio of the proton elastic electromagnetic form factors, G{sub Ep}/G{sub Mp}, was obtained by measuring P{sub t} and P{sub l}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic e{sup {yields}}p{yields}ep{sup {yields}}reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, G{sub Ep}/G{sub Mp} is directly proportional to P{sub t}/P{sub l}. The simultaneous measurement of P{sub t} and P{sub l} in a polarimeter reduces systematic uncertainties. The results for G{sub Ep}/G{sub Mp} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been reanalyzed and their systematic uncertainties have become significantly smaller than those reported previously.

  19. Proton elastic form factor ratios to Q{sup 2} = 3.5 GeV{sup 2} by polarization transfer

    SciTech Connect

    V. Punjabi; C.F. Perdrisat; et al

    2005-01-01

    The ratio of the proton elastic electromagnetic form factors, G{sub E{sub p}}/G{sub M{sub p}}, was obtained by measuring P{sub t} and P{sub {ell}}, the transverse and longitudinal recoil proton polarization components, respectively, for the elastic {rvec e}p {yields} e{rvec p} reaction in the four-momentum transfer squared range of 0.5 to 3.5 GeV{sup 2}. In the single-photon exchange approximation, the ratio G{sub E{sub p}}/G{sub M{sub p}} is directly proportional to the ratio P{sub t}/P{sub {ell}}. The simultaneous measurement of P{sub t} and P{sub {ell}} in a polarimeter reduces systematic uncertainties. The results for the ratio G{sub E{sub p}}/G{sub M{sub p}} show a systematic decrease with increasing Q{sup 2}, indicating for the first time a definite difference in the distribution of charge and magnetization in the proton. The data have been re-analyzed and systematic uncertainties have become significantly smaller than previously published results.

  20. Proton form factor ratio, μpGEP/GMP from double spin asymmetry

    SciTech Connect

    Habarakada Liyanage, Anusha Pushpakumari

    2013-08-01

    The form factors are fundamental properties of the nucleon representing the effect of its structure on its response to electromagnetic probes such as electrons. They are functions of the four-momentum transfer squared Q2 between the electron and the proton. This thesis reports the results of a new measurement of the ratio of the electric and magnetic form factors of the proton up to Q2 = 5.66 (GeV/c)2 using the double spin asymmetry with a polarized beam and target. Experiment E07-003 (SANE, Spin Asymmetries of the Nucleon Experiment) was carried out in Hall C at Jefferson Lab in 2009 to study the proton spin structure functions with a dynamically polarized ammonia target and longitudinally polarized electron beam. By detecting elastically scattered protons in the High-Momentum Spectrometer (HMS) in coincidence with the electrons in the Big Electron Telescope Array (BETA), elastic measurements were carried out in parallel. The elastic double spin asymmetry allows one to extract the proton electric to magnetic form factor ratio GpE/GpM at high-momentum transfer, Q2= 5.66 (GeV/c)2. In addition to the coincidence data, inclusively scattered electrons from the polarized ammonia target were detected by HMS, which allows to measure the beam-target asymmetry in the elastic region with the target spin nearly perpendicular to the momentum transfer, and to extract GpE/GpM at low Q2= 2.06 (GeV/c)2. This alternative measurement of GpE/GpM has verified and confirmed the dramatic discrepancy at high Q2 between the Rosenbluth and the recoil-polarization-transfer iv method with a different measurement technique and systematic uncertainties uncorrelated to those of the recoil-polarization measurements. The measurement of the form factor ratio at Q2 = 2

  1. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    DOE PAGESBeta

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; et al

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elasticmore » events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.« less

  2. Mesonic Form Factors

    SciTech Connect

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  3. Nucleon Form Factors Using Spin Degrees of Freedom

    SciTech Connect

    Mark Jones

    2002-04-01

    An overview of recent measurements of the neutron and proton electromagnetic form factors from double polarization experiments. Spin observables are sensitive to the product of nucleon form factor which allows access to the small nucleon electric form factors.

  4. The Form Factors of the Nucleons

    SciTech Connect

    Perdrisat, Charles F.

    2013-11-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double-polarization experiments, in comparison with with pre-vious unpolarized cross section data. Here we will review the experimental data base in view of the new results for the proton and the neutron, obtained at MIT-Bates, JLab and MAMI. The rapid evolution of phenomenological models triggered by these high- precision experiments will be discussed. In particular, the possibility that the proton is non-spherical in its ground state, and that the transverse charge density are model in- dependently defined in the infinite momentum frame. Likewise, flavor decomposition of the nucleon form factors into dressed u and d quark form factors, may give information about the quark-diquark structure of the nucleon. The current proton radius "crisis" will also be discussed.

  5. Electromagnetic nucleon form factors

    SciTech Connect

    Bender, A.; Roberts, C.D.; Frank, M.R.

    1995-08-01

    The Dyson-Schwinger equation framework is employed to obtain expressions for the electromagnetic nucleon form factor. In generalized impulse approximation the form factor depends on the dressed quark propagator, the dressed quark-photon vertex, which is crucial to ensuring current conservation, and the nucleon Faddeev amplitude. The approach manifestly incorporates the large space-like-q{sup 2} renormalization group properties of QCD and allows a realistic extrapolation to small space-like-q{sup 2}. This extrapolation allows one to relate experimental data to the form of the quark-quark interaction at small space-like-q{sup 2}, which is presently unknown. The approach provides a means of unifying, within a single framework, the treatment of the perturbative and nonperturbative regimes of QCD. The wealth of experimental nucleon form factor data, over a large range of q{sup 2}, ensures that this application will provide an excellent environment to test, improve and extend our approach.

  6. Nucleon Form Factors from Generalized Parton Distributions

    SciTech Connect

    M. Guidal; Maxim Polyakov; Anatoly Radyushkin; Marc Vanderhaeghen

    2004-10-01

    We discuss the links between Generalized Parton Distributions (GPDs) and elastic nucleon form factors. These links, in the form of sum rules, represent powerful constraints on parametrizations of GPDs. A Regge parametrization for GPDs at small momentum transfer, is extended to the large momentum transfer region and it is found to describe the basic features of proton and neutron electromagnetic form factor data. This parametrization is used to estimate the quark contribution to the nucleon spin.

  7. Inelastic Scattering Form Factors

    Energy Science and Technology Software Center (ESTSC)

    1992-01-01

    ATHENA-IV computes form factors for inelastic scattering calculations, using single-particle wave functions that are eigenstates of motion in either a Woods-Saxon potential well or a harmonic oscillator well. Two-body forces of Gauss, Coulomb, Yukawa, and a sum of cut-off Yukawa radial dependences are available.

  8. Nucleon Form Factors - A Jefferson Lab Perspective

    SciTech Connect

    John Arrington, Kees de Jager, Charles F. Perdrisat

    2011-06-01

    The charge and magnetization distributions of the proton and neutron are encoded in their elastic electromagnetic form factors, which can be measured in elastic electron--nucleon scattering. By measuring the form factors, we probe the spatial distribution of the proton charge and magnetization, providing the most direct connection to the spatial distribution of quarks inside the proton. For decades, the form factors were probed through measurements of unpolarized elastic electron scattering, but by the 1980s, progress slowed dramatically due to the intrinsic limitations of the unpolarized measurements. Early measurements at several laboratories demonstrated the feasibility and power of measurements using polarization degrees of freedom to probe the spatial structure of the nucleon. A program of polarization measurements at Jefferson Lab led to a renaissance in the field of study, and significant new insight into the structure of matter.

  9. Measurement of the proton form factors ratio G{sub E}/G{sub M} to Q{sup 2} = 5.6 GeV{sup 2} by recoil polarimetry

    SciTech Connect

    Olivier Gayou

    2002-04-01

    In this thesis, we present the results of the experiment E99-007, which measured the ratio of the electric to magnetic form factors of the proton to the four momentum transfer square Q{sup 2} = 5.6 GeV{sup 2}, by recoil polarimetry. Data were taken in 2000 at the Thomas Jefferson National Accelerator Facility in Virginia, USA. A 4.6 GeV polarized electron beam was scattered off a cryogenic hydrogen target. The polarization of the recoil proton was measured in the Focal Plane Polarimeter, located after one of the two High Resolution Spectrometers in the hall. The ratio of the transverse to longitudinal components of the recoil proton polarization is proportional to the ratio of the form factors. Elastic events were selected by detecting the scattered electron in a large acceptance lead-glass calorimeter. The main result of this experiment is the linear decrease of the form factor ratio with increasing Q{sup 2}, corresponding to different spatial distributions of the electric charge and the magnetization. Numerous theoretical calculations show that relativistic effects, such as mixing of spin states due to Lorentz boosts, are important to account for the observed data in this critical intermediate kinematic region.

  10. Electromagnetic pion form factor

    SciTech Connect

    Roberts, C.D.

    1995-08-01

    A phenomenological Dyson-Schwinger/Bethe-Salpeter equation approach to QCD, formalized in terms of a QCD-based model field theory, the Global Color-symmetry Model (GCM), was used to calculate the generalized impulse approximation contribution to the electromagnetic pion form factor at space-like q{sup 2} on the domain [0,10] GeV{sup 2}. In effective field theories this form factor is sometimes understood as simply being due to Vector Meson Dominance (VMD) but this does not allow for a simple connection with QCD where the VMD contribution is of higher order than that of the quark core. In the GCM the pion is treated as a composite bound state of a confined quark and antiquark interacting via the exchange of colored vector-bosons. A direct study of the quark core contribution is made, using a quark propagator that manifests the large space-like-q{sup 2} properties of QCD, parameterizes the infrared behavior and incorporates confinement. It is shown that the few parameters which characterize the infrared form of the quark propagator may be chosen so as to yield excellent agreement with the available data. In doing this one directly relates experimental observables to properties of QCD at small space-like-q{sup 2}. The incorporation of confinement eliminates endpoint and pinch singularities in the calculation of F{sub {pi}}(q{sup 2}). With asymptotic freedom manifest in the dressed quark propagator the calculation yields q{sup 4}F{sub {pi}}(q{sup 2}) = constant, up to [q{sup 2}]- corrections, for space-like-q{sup 2} {approx_gt} 35 GeV{sup 2}, which indicates that soft, nonperturbative contributions dominate the form factor at presently accessible q{sup 2}. This means that the often-used factorization Ansatz fails in this exclusive process. A paper describing this work was submitted for publication. In addition, these results formed the basis for an invited presentation at a workshop on chiral dynamics and will be published in the proceedings.

  11. Nucleon elastic form factors

    SciTech Connect

    D. Day

    2007-03-01

    The nucleon form factors are still the subject of active investigation even after an experimental effort spanning 50 years. This is because they are of critical importance to our understanding of the electromagnetic properties of nuclei and provide a unique testing ground for QCD motivated models of nucleon structure. Progress in polarized beams, polarized targets and recoil polarimetry have allowed an important and precise set of data to be collected over the last decade. I will review the experimental status of elastic electron scattering from the nucleon along with an outlook for future progress.

  12. Pion form factor

    SciTech Connect

    Ryong Ji, C.; Pang, A.; Szczepaniak, A.

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  13. Precision Rosenbluth Measurement of the Proton Elastic Electromagnetic Form Factors and Their Ratio at Q^2=2.64, 3.20, and 4.10 GeV^2

    SciTech Connect

    Issam A. Qattan

    2005-12-01

    Due to the inconsistency in the results of the mupGEp/GMp ratio of the proton, as extracted from the Rosenbluth and recoil polarization techniques, high precision measurements of the e-p elastic scattering cross sections were made at Q{sup 2} = 2.64, 3.20, and 4.10 GeV{sup 2}. Protons were detected, in contrast to previous measurements where the scattered electrons were detected, which dramatically decreased-dependent systematic uncertainties and corrections. A single spectrometer measured the scattered protons of interest while simultaneous measurements at Q{sup 2} = 0.5 GeV{sup 2} were carried out using another spectrometer which served as a luminosity monitor in order to remove any uncertainties due to beam charge and target density fluctuations. The absolute uncertainty in the measured cross sections is {approx}3% for both spectrometers and with relative uncertainties, random and slope, below 1% for the higher Q{sup 2} protons, and below 1% random and 6% slope for the monitor spectrometer. The extracted electric and magnetic form factors were determined to 4%-7% for GEp and 1.5% for GMp. The ratio mupGEp/GMp was determined to 4%-7% and showed mupGEp/GMp {approx} 1.0. The results of this work are in agreement with the previous Rosenbluth data and inconsistent with high-Q{sup 2} recoil polarization results, implying a systematic difference between the two techniques.

  14. Survey of nucleon electromagnetic form factors

    SciTech Connect

    Perdrisat, Charles F.; Punjabi, Vina A.

    2011-09-20

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has been greatly improved by performing double polarization experiments, in compar- ison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at MIT-Bates, MAMI, and JLab. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed.

  15. Nucleon form factor studies at Jlab

    SciTech Connect

    Giusa, A; Mammoliti, F; Russo, G; Sperduto, M L; Sutera, C M; Cisbani, E; Garibaldi, F; Urciuoli, G M; Capogni, M; Cates, G D; de Jager, K; Wojtsekhowski, B

    2011-08-01

    The ratio of the electromagnetic proton elastic form factors, GpE/GpM, has been measured at Jefferson Lab up to View the MathML source, by using the CEBAF 6 GeV electron beam, and revealing an unexpected and challenging physical behaviour. The 2014 scheduled 12 GeV upgrade will allow the measurement of GpE/GpM up to View the MathML source, by taking advantage of the new large-acceptance forward spectrometer Super BigBite (SBS) in Hall A. Measurements of neutron form factors in the region around 10 (GeV/c)2, where quark confinement plays an important role, are expected to show the behaviour already observed in the proton case.

  16. Elastic form factors at higher CEBAF energies

    SciTech Connect

    Petratos, G.G.

    1994-04-01

    The prospects for elastic scattering from few body systems with higher beam energies at CEBAF is presented. The deuteron and{sup 3}He elastic structure functions A(Q{sup 2}) can be measured at sufficiently high momentum transfers to study the transition between the conventional meson-nucleon and the constituent quark-gluon descriptions. Possible improvements in the proton magnetic form factor data are also presented.

  17. Hadronic form factors in kaon photoproduction

    SciTech Connect

    Syukurilla, L. Mart, T.

    2014-09-25

    We have revisited the effect of hadronic form factors in kaon photoproduction process by utilizing an isobaric model developed for kaon photoproduction off the proton. The model is able to reproduce the available experimental data nicely as well as to reveal the origin of the second peak in the total cross section, which was the main source of confusion for decades. Different from our previous study, in the present work we explore the possibility of using different hadronic form factors in each of the KΛN vertices. The use of different hadronic form factors, e.g. dipole, Gaussian, and generalized dipole, has been found to produce a more flexible isobar model, which can provide a significant improvement in the model.

  18. Final analysis of proton form factor ratio data at Q2 = 4.0, 4.8, and 5.6 GeV2

    SciTech Connect

    Puckett, A. J. R.; Brash, E. J.; Gayou, O.; Jones, M. K.; Pentchev, L.; Perdrisat, C. F.; Punjabi, V.; Aniol, K. A.; Averett, T.; Benmokhtar, F.; Bertozzi, W.; Bimbot, L.; Calarco, J. R.; Cavata, C.; Chai, Z.; Chang, C. -C.; Chang, T.; Chen, J. P.; Chudakov, E.; De Leo, R.; Dieterich, S.; Endres, R.; Epstein, M. B.; Escoffier, S.; Fissum, K. G.; Fonvieille, H.; Frullani, S.; Gao, J.; Garibaldi, F.; Gilad, S.; Gilman, R.; Glamazdin, A.; Glashausser, C.; Gomez, J.; Hansen, J. -O.; Higinbotham, D.; Huber, G. M.; Iodice, M.; de Jager, C. W.; Jiang, X.; Khandaker, M.; Kozlov, S.; Kramer, K. M.; Kumbartzki, G.; LeRose, J. J.; Lhuillier, D.; Lindgren, R. A.; Liyanage, N.; Lolos, G. J.; Margaziotis, D. J.; Marie, F.; Markowitz, P.; McCormick, K.; Michaels, R.; Milbrath, B. D.; Nanda, S. K.; Neyret, D.; Piskunov, N. M.; Ransome, R. D.; Raue, B. A.; Roché, R.; Rvachev, M.; Salgado, C.; Sirca, S.; Sitnik, I.; Strauch, S.; Todor, L.; Tomasi-Gustafsson, E.; Urciuoli, G. M.; Voskanyan, H.; Wijesooriya, K.; Wojtsekhowski, B. B.; Zheng, X.; Zhu, L.

    2012-04-11

    Recently published measurements of the proton electromagnetic form factor ratio R = μp GEp/GMp at momentum transfers Q2 up to 8.5 GeV2 in Jefferson Lab Hall C deviate from the linear trend of previous measurements in Jefferson Lab Hall A, favoring a slower rate of decrease of R with Q2. While statistically compatible in the region of overlap with Hall A, the Hall C data hint at a systematic difference between the two experiments. This possibility was investigated in a reanalysis of the Hall A data. We find that the original analysis underestimated the background in the selection of elastic events. The application of an additional cut to further suppress the background increases the results for R, improving the consistency between Halls A and C.

  19. The Dirac form factor predicts the Pauli form factor in the Endpoint Model

    NASA Astrophysics Data System (ADS)

    Dagaonkar, Sumeet K.; Jain, Pankaj; Ralston, John P.

    2016-07-01

    We compute the momentum-transfer dependence of the proton Pauli form factor F2 in the Endpoint overlap Model. We find the model correctly reproduces the scaling of the ratio of F2 with the Dirac form factor F1 observed at the Jefferson Laboratory. The calculation uses the leading-power, leading-twist Dirac structure of the quark light-cone wave function and the same endpoint dependence previously determined from the Dirac form factor F1. There are no parameters and no adjustable functions in the Endpoint Model's prediction for the scaling behavior of F2. The model's predicted momentum dependence of the ratio F2(Q2)/F1(Q2) is quite insensitive to the endpoint wave function, which explains why the observed ratio scales like 1 / Q down to rather low momentum transfers. We also fit the magnitude of this ratio by adjusting the parameters of the wave function. The Endpoint Model appears to be the only comprehensive model consistent with all form factor information as well as reproducing fixed-angle proton-proton scattering at large momentum transfer. Any one of the processes is capable of predicting the others.

  20. The structure of the nucleon: Elastic electromagnetic form factors

    SciTech Connect

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discuss the outlook for the future.

  1. Protonated Forms of Monoclinic Zirconia: A Theoretical Study

    SciTech Connect

    Mantz, Yves A.; Gemmen, Randall S.

    2010-05-06

    In various materials applications of zirconia, protonated forms of monoclinic zirconia may be formed, motivating their study within the framework of density-functional theory. Using the HCTH/120 exchange-correlation functional, the equations of state of yttria and of the three low-pressure zirconia polymorphs are computed, to verify our approach. Next, the favored charge state of a hydrogen atom in monoclinic zirconia is shown to be positive for all Fermilevel energies in the band gap, by the computation of defect formation energies.This result is consistent with a single previous theoretical prediction at midgap as well as muonium spectroscopy experiments. For the formally positively (+1e) charged system of a proton in monoclinic zirconia (with a homogeneous neutralizing background charge densityimplicitly included), modeled using up to a 3 x 3 x 3 arrangement of unit cells, different stable and metastable structures are identified. They are similar to those structures previously proposed for the neutral system of hydrogen-doedmonoclinic zirconia, at a similar level of theory. As predicted using the HCTH/120 functional, the lowest energy structure of the proton bonded to one of the two available oxygen atom types, O1, is favored by 0.39 eV compared to that of the proton bonded to O2. The rate of proton transfer between O1 ions is slower than that for hydrogen-dopedmonoclinic zirconia, whose transition-state structures may be lowered in energy by the extra electron.

  2. Probing non polar interstellar molecules through their protonated form: Detection of protonated cyanogen (NCCNH+)★

    PubMed Central

    Agúndez, M.; Cernicharo, J.; de Vicente, P.; Marcelino, N.; Roueff, E.; Fuente, A.; Gerin, M.; Guélin, M.; Albo, C.; Barcia, A.; Barbas, L.; Bolaño, R.; Colomer, F.; Diez, M. C.; Gallego, J. D.; Gómez-González, J.; López-Fernández, I.; López-Fernández, J. A.; López-Pérez, J. A.; Malo, I.; Serna, J. M.; Tercero, F.

    2015-01-01

    Cyanogen (NCCN) is the simplest member of the series of dicyanopolyynes. It has been hypothesized that this family of molecules can be important constituents of interstellar and circumstellar media, although the lack of a permanent electric dipole moment prevents its detection through radioastronomical techniques. Here we present the first solid evidence of the presence of cyanogen in interstellar clouds through the detection of its protonated form toward the cold dark clouds TMC-1 and L483. Protonated cyanogen (NCCNH+) has been identified through the J = 5 – 4 and J = 10 – 9 rotational transitions using the 40m radiotelescope of Yebes and the IRAM 30m telescope. We derive beam averaged column densities for NCCNH+ of (8.6 ± 4.4) × 1010 cm−2 in TMC-1 and (3.9 ± 1.8) × 1010 cm−2 in L483, which translate to fairly low fractional abundances relative to H2, in the range (1-10) × 10−12. The chemistry of protonated molecules in dark clouds is discussed, and it is found that, in general terms, the abundance ratio between the protonated and non protonated forms of a molecule increases with increasing proton affinity. Our chemical model predicts an abundance ratio NCCNH+/NCCN of ~ 10−4, which implies that the abundance of cyanogen in dark clouds could be as high as (1-10) × 10−8 relative to H2, i.e., comparable to that of other abundant nitriles such as HCN, HNC, and HC3N. PMID:26543239

  3. Nucleon and Elastic and Transition Form Factors

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge; Cloët, Ian C.; Roberts, Craig D.; Schmidt, Sebastian M.

    2014-12-01

    We present a unified study of nucleon and elastic and transition form factors, and compare predictions made using a framework built upon a Faddeev equation kernel and interaction vertices that possess QCD-like momentum dependence with results obtained using a symmetry-preserving treatment of a vector vector contact-interaction. The comparison emphasises that experiments are sensitive to the momentum dependence of the running couplings and masses in the strong interaction sector of the Standard Model and highlights that the key to describing hadron properties is a veracious expression of dynamical chiral symmetry breaking in the bound-state problem. Amongst the results we describe, the following are of particular interest: possesses a zero at Q 2 = 9.5 GeV2; any change in the interaction which shifts a zero in the proton ratio to larger Q 2 relocates a zero in to smaller Q 2; there is likely a value of momentum transfer above which ; and the presence of strong diquark correlations within the nucleon is sufficient to understand empirical extractions of the flavour-separated form factors. Regarding the -baryon, we find that, inter alia: the electric monopole form factor exhibits a zero; the electric quadrupole form factor is negative, large in magnitude, and sensitive to the nature and strength of correlations in the Faddeev amplitude; and the magnetic octupole form factor is negative so long as rest-frame P- and D-wave correlations are included. In connection with the transition, the momentum-dependence of the magnetic transition form factor, , matches that of once the momentum transfer is high enough to pierce the meson-cloud; and the electric quadrupole ratio is a keen measure of diquark and orbital angular momentum correlations, the zero in which is obscured by meson-cloud effects on the domain currently accessible to experiment. Importantly, within each framework, identical propagators and vertices are sufficient to describe all properties discussed herein. Our

  4. Protonated thiophene-based oligomers as formed within zeolites: understanding their electron delocalization and aromaticity.

    PubMed

    Valencia, Diego; Whiting, Gareth T; Bulo, Rosa E; Weckhuysen, Bert M

    2016-01-21

    In an earlier work, protonated thiophene-based oligomers were identified inside ZSM-5 zeolites. The novel compounds exhibited π-π* absorption wavelengths deep within the visible region, earmarking them for possible use as chromophores in a variety of applications. In this computational study, we determine the factors that cause such low-energy transitions, and describe the electronic structure of these remarkable compounds. DFT calculations of conjugated thiophene-based oligomers with up to five monomer units reveal that the main absorption band of each protonated oligomer is strongly red-shifted compared to the unprotonated form. This effect is counterintuitive, since protonation is expected to diminish aromaticity, and thereby increase the HOMO-LUMO gap. We find that upon protonation the π-electrons remain delocalized over the entire π-conjugated molecule, but the positive charge is localized predominantly on the protonated side of the molecule. A possible explanation for this ground-state charge localization is the participation of the C-H bond in the π-system of the protonated ring, locally providing aromatic stabilization for the positive charge. The addition of the proton stabilizes all electronic orbitals, but due to the ground state π-electron distribution away from the added nucleus, the HOMO is stabilized less than the LUMO. The main absorption peak upon protonation corresponds to the charge transfer excitation involving the frontier orbitals, and the small band gap explains the observed red shift. Analogue calculations on thiophene within a ZSM-5 zeolite cluster model confirm the same trends upon protonation as observed in the non-interacting compounds. Understanding the electronic structure of these compounds is very relevant to correlate UV-Vis bands with acidic strength and possibly environment in zeolites and to improve their performance in catalytic and energy related applications. PMID:26685895

  5. Flavor decomposition of the nucleon electromagnetic form factors at low Q2

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.; Alsaad, A.

    2015-06-01

    Background: The spatial distribution of charge and magnetization within the proton is encoded in the elastic form factors. These have been precisely measured in elastic electron scattering, and the combination of proton and neutron form factors allows for the separation of the up- and down-quark contributions. Purpose: In this work, we extract the proton and neutron form factors from worldwide data with an emphasis on precise new data covering the low-momentum region, which is sensitive to the large-scale structure of the nucleon. From these, we separate the up- and down-quark contributions to the proton form factors. Method: We combine cross section and polarization measurements of elastic electron-proton scattering to separate the proton form factors and two-photon exchange (TPE) contributions. We combine the proton form factors with parametrization of the neutron form factor data and uncertainties to separate the up- and down-quark contributions to the proton's charge and magnetic form factors. Results: The extracted TPE corrections are compared to previous phenomenological extractions, TPE calculations, and direct measurements from the comparison of electron and positron scattering. The flavor-separated form factors are extracted and compared to models of the nucleon structure. Conclusions: With the inclusion of the precise new data, the extracted TPE contributions show a clear change of sign at low Q2, which is necessary to explain the high-Q2 form factor discrepancy while being consistent with the known Q2→0 limit. We find that the new Mainz data yield a significantly different result for the proton magnetic form factor and its flavor-separated contributions. We also observe that the rms radius of both the up- and down-quark distributions are smaller than the rms charge radius of the proton.

  6. Form factors from lattice QCD

    SciTech Connect

    Dru Renner

    2012-04-01

    Precision computation of hadronic physics with lattice QCD is becoming feasible. The last decade has seen precent-level calculations of many simple properties of mesons, and the last few years have seen calculations of baryon masses, including the nucleon mass, accurate to a few percent. As computational power increases and algorithms advance, the precise calculation of a variety of more demanding hadronic properties will become realistic. With this in mind, I discuss the current lattice QCD calculations of generalized parton distributions with an emphasis on the prospects for well-controlled calculations for these observables as well. I will do this by way of several examples: the pion and nucleon form factors and moments of the nucleon parton and generalized-parton distributions.

  7. Electric Form Factor of the Neutron

    SciTech Connect

    Feuerbach, Robert

    2007-10-13

    Recent polarization-based precision measurements of the nucleons' elastic electric form factors have led to surprising results. The measurement of the ratio of the proton's electromagnetic form factors, $\\mu_p G_E^p/G_M^p$, was found to drop nearly linearly with $Q^2$ out to at least $5 \\mathrm{GeV}^2$, inconsistent with the older Rosenbluth-type experiments. A recent measurement of $G_E^n$, the neutron's electric form-factor saw $G_E^n$ does not fall off as quickly as commonly expected up to $Q^2 \\approx 1.5 \\mathrm{GeV}^2$. Extending this study, a precision measurement of $G_E^n$ up to $Q^2=3.5 \\mathrm{GeV}^2$ was completed in Hall A at Jefferson Lab. The ratio $G_E^n/G_M^n$ was measured through the beam-target asymmetry $A_\\perp$ of electrons quasi-elastically scattered off polarized neutrons in the reaction ${}^{3}\\overrightarrow{He}(\\overrightarrow{e},e' n)$. The experiment took full advantage of the electron beam, recent target developments, as well as two detectors new to Jefferson Lab. The measurement used the accelerator's 100\\% duty-cycle high-polarization (typically 84\\%) electron beam and a new, hybrid optically-pumped polarized ${}^{3}\\overrightarrow{He}$ target which achieved in-beam polarizations in excess of 50\\%. A medium acceptance (80msr) open-geometry magnetic spectrometer (BigBite) detected the scattered electron, while a geometrically matched neutron detector observed the struck neutron. Preliminary results from this measurement will be discussed and compared to modern calculations of $G_E^n$.

  8. The structure of the nucleon: Elastic electromagnetic form factors

    DOE PAGESBeta

    Punjabi, V.; Perdrisat, C. F.; Jones, M. K.; Brash, E. J.; Carlson, C. E.

    2015-07-10

    Precise proton and neutron form factor measurements at Jefferson Lab, using spin observables, have recently made a significant contribution to the unraveling of the internal structure of the nucleon. Accurate experimental measurements of the nucleon form factors are a test-bed for understanding how the nucleon's static properties and dynamical behavior emerge from QCD, the theory of the strong interactions between quarks. There has been enormous theoretical progress, since the publication of the Jefferson Lab proton form factor ratio data, aiming at reevaluating the picture of the nucleon. We will review the experimental and theoretical developments in this field and discussmore » the outlook for the future.« less

  9. Measuring Form Factors and Structure Functions with CLAS

    SciTech Connect

    G.P. Gilfoyle

    2007-09-10

    The physics program at the Thomas Jefferson National Accelerator Facility includes a strong effort to measure form factors and structure functions to probe the structure of hadronic matter, reveal the nature of confinement, and develop an understanding of atomic nuclei using quark-gluon degrees of freedom. The CLAS detector is a large acceptance device occupying one of the end stations. We discuss here two programs that use CLAS; measuring the magnetic form factor of the neutron and the virtual photon asymmetry of the proton. The form factor has been measured with unprecedented kinematic coverage and precision up to Q2=4.7 GeV2 and is consistent within 5%-10% of the dipole parameterization. The proton virtual photon asymmetry has been measured across a wide range in Bjorken x. The data exceed the SU(6)-symmetric quark prediction and show evidence of a smooth approach to the scaling limit prescribed by perturbative QCD.

  10. Transition Form Factor from CLAS

    SciTech Connect

    Park, Kijun

    2009-01-01

    The excitation of nucleon resonances in electromagnetic interaction has long been studied. The study of resonances helps us to understand the long- and short- range structures of the nucleon and its excited states in terms of quark confinement. While the existing data of the low-lying resonances are consistent with the well-studied SU(6) circle times operator O(3) constituent quark model classification, many open questions still remain. Exclusive electro-production is one of the best ways to investigate nucleon resonances. The exclusive electro-production process View the MathML source was measured in the photon virtuality range Q2 = 1.7 â 4.5 GeV2 and the invariant mass range for the n?+ system of W = 1.15 â 1.7 GeV using the CEBAF Large Acceptance Spectrometer. For the first time, these kinematics are probed in exclusive ?+ production from protons with nearly full coverage in the azimuthal and polar angles of the n?+ center-of-mass system. The n?+ channel has particular sensitivity t

  11. Analytic parametrization for nuclear form factors

    SciTech Connect

    Atkin, G.; Dumbrajs, O.

    1982-08-01

    A new analytic parametrization of the nuclear form factor is developed using a factorization theorem. We show that the nuclear form factor can be represented in terms of its real zeros and its asymptotic behavior. The parametrization is applied to nuclear form factor data of /sup 3/He and /sup 4/He. Our results suggest that further diffraction minima can be expected at higher momentum transfer where experiments have not yet been made.

  12. Charge density distributions and charge form factors of the N=82 and N=126 isotonic nuclei

    SciTech Connect

    Wang Zaijun; Fan Ying; Ren Zhongzhou

    2006-01-15

    Charge form factors for N=82 and N=126 isotonic nuclei are calculated with the relativistic eikonal approximation, in which the charge density distributions are from the relativistic mean-field theory. The variations of charge form factors with proton number are discussed in detail. It is found that the most sensitive parts of the charge form factors are those around the minimums and maximums. For an increasing proton number, the charge form factors near the extrema have an upward shift. As the protons increase and occupy a new shell, the minimums and maximums of the charge form factors could also have a significant inward shift. The results can be useful for the study of behaviors of valence-proton wave functions for such nuclei as can be considered as a core plus proton(s), and thus the proton-halo phenomenon. In addition, the results can also be useful for future electron-unstable nucleus scattering experiments and provide tests of the reliability of the relativistic mean-field theory for the unstable nuclei.

  13. Measurements of the Proton Electromagnetic Form Factor Ratio From Elastic e + p -> e + p Scattering at Momentum Transfer Q2 = 2.5, 5.2, 6.7 and 8.5 (GeV/c)2

    SciTech Connect

    Mkrtchyan, Arthur

    2012-05-31

    Among the fundamental observables of nucleon structure, electromagnetic form factors are a crucial benchmark for modern calculations describing the strong interaction dynamics of the nucleon's quark constituents. Electromagnetic probes are traditionally preferered to the hadronic beams. The electromagnetic interaction is a powerful tool for investigating the nucleon structure since it is well understood and it reveals observables that can be directly interpreted in terms of the current carried by the quarks. Elastic scattering leads to the form factors that describe the spatial charge and current distributions inside the nucleon. The reaction mechanism is assumed to be one photon exchange, the electromagnetic interaction is exactly calculable in QED, and one can safely extract the information on the hadronic vertex. The most important feature of early measurements of proton form factor ratio GEp/GMp with recoil polarization technique at Q2 up to 5.6 (GeV/c)2 is the sharp decline of the ratio with Q2 increases, indicating that GEp falls much faster than GMp. This contradicts to data obtained by Rosenbluth separation method. An intriguing question was whether GEp will continue to decrease or become constant when Q2 increases. New set of measurements of proton form factor ratio GEp/GMp at Q2 = 2.5, 5.2, 6.7 and 8.5 (GeV/c)2 have been conducted at JLab Hall C using ~85% longitudinally polarized electron elastic scattering from unpolarized hydrogen target. Recoil protons were detected in the HMS magnetic spectrometer with the standard detector package, combined with newly installed trigger scintillators and Focal Plane Polarimeter. The BigCal electromagnetic calorimeter (1744 channel) have been used for electron detection. Data obtained in this

  14. On form factors of boundary changing operators

    NASA Astrophysics Data System (ADS)

    Bajnok, Z.; Hollo, L.

    2016-04-01

    We develop a form factor bootstrap program to determine the matrix elements of local, boundary condition changing operators. We propose axioms for these form factors and determine their solutions in the free boson and Lee-Yang models. The sudden change in the boundary condition, caused by an operator insertion, can be interpreted as a local quench and the form factors provide the overlap of any state before the quench with any outgoing state after the quench.

  15. Flavor Decomposition of the Elastic Nucleon Electromagnetic Form Factors

    NASA Astrophysics Data System (ADS)

    Cates, G. D.; de Jager, C. W.; Riordan, S.; Wojtsekhowski, B.

    2011-06-01

    The u- and d-quark contributions to the elastic nucleon electromagnetic form factors have been determined by using experimental data on GEn, GMn, GEp, and GMp. Such a flavor separation of the form factors became possible up to negative four-momentum transfer squared Q2=3.4GeV2 with recent data on GEn from Hall A at Jefferson Lab. For Q2 above 1GeV2, for both the u and the d quark, the ratio of the Pauli and Dirac form factors, F2/F1, was found to be almost constant in sharp contrast to the behavior of F2/F1 for the proton as a whole. Also, again for Q2>1GeV2, both F2d and F1d are roughly proportional to 1/Q4, whereas the dropoff of F2u and F1u is more gradual.

  16. Physical and biological factors determining the effective proton range

    SciTech Connect

    Grün, Rebecca; Friedrich, Thomas; Krämer, Michael; Scholz, Michael; Zink, Klemens; Durante, Marco; Engenhart-Cabillic, Rita

    2013-11-15

    Purpose: Proton radiotherapy is rapidly becoming a standard treatment option for cancer. However, even though experimental data show an increase of the relative biological effectiveness (RBE) with depth, particularly at the distal end of the treatment field, a generic RBE of 1.1 is currently used in proton radiotherapy. This discrepancy might affect the effective penetration depth of the proton beam and thus the dose to the surrounding tissue and organs at risk. The purpose of this study was thus to analyze the impact of a tissue and dose dependent RBE of protons on the effective range of the proton beam in comparison to the range based on a generic RBE of 1.1.Methods: Factors influencing the biologically effective proton range were systematically analyzed by means of treatment planning studies using the Local Effect Model (LEM IV) and the treatment planning software TRiP98. Special emphasis was put on the comparison of passive and active range modulation techniques.Results: Beam energy, tissue type, and dose level significantly affected the biological extension of the treatment field at the distal edge. Up to 4 mm increased penetration depth as compared to the depth based on a constant RBE of 1.1. The extension of the biologically effective range strongly depends on the initial proton energy used for the most distal layer of the field and correlates with the width of the distal penumbra. Thus, the range extension, in general, was more pronounced for passive as compared to active range modulation systems, whereas the maximum RBE was higher for active systems.Conclusions: The analysis showed that the physical characteristics of the proton beam in terms of the width of the distal penumbra have a great impact on the RBE gradient and thus also the biologically effective penetration depth of the beam.

  17. Isomers and conformational barriers of gas phase nicotine, nornicotine and their protonated forms

    SciTech Connect

    Yoshida, Tomoki; Farone, William A.; Xantheas, Sotiris S.

    2014-07-17

    We report extensive conformational searches of the neutral nicotine, nornicotine and their protonated analogs that are based on ab-initio second order Møller-Plesset perturbation (MP2) electronic structure calculations. Initial searches were performed with the 6-31G(d,p) and the energetics of the most important structures were further refined from geometry optimizations with the aug-cc-pVTZ basis set. Based on the calculated free energies at T=298 K for the gas phase molecules, neutral nicotine has two dominant trans conformers, whereas neutral nornicotine is a mixture of several conformers. For nicotine, the protonation on both the pyridine and the pyrrolidine sites is energetically competitive, whereas nornicotine prefers protonation on the pyridine nitrogen. The protonated form of nicotine is mainly a mixture of two pyridine-protonated trans conformers and two pyrrolidine-protonated trans conformers, whereas the protonated form of nornicotine is a mixture of four pyridine-protonated trans conformers. Nornicotine is conformationally more flexible than nicotine, however it is less protonated at the biologically important pyrrolidine nitrogen site. The lowest energy isomers for each case were found to interconvert via low (< 6 kcal/mol) rotational barriers around the pyridine-pyrrolidine bond.

  18. Form factor and boundary contribution of amplitude

    NASA Astrophysics Data System (ADS)

    Huang, Rijun; Jin, Qingjun; Feng, Bo

    2016-06-01

    The boundary contribution of an amplitude in the BCFW recursion relation can be considered as a form factor involving boundary operator and unshifted particles. At the tree-level, we show that by suitable construction of Lagrangian, one can relate the leading order term of boundary operators to some composite operators of mathcal{N} = 4 superYang-Mills theory, then the computation of form factors is translated to the computation of amplitudes. We compute the form factors of these composite operators through the computation of corresponding double trace amplitudes.

  19. Measurements of the elastic electromagnetic form factor ratio {mu}pGEp/GMp via polarization transfer

    SciTech Connect

    Olivier Gayou; Oleksandr Glamazdin; Andrei Afanasev; Arunava Saha; Brendan Fox; Bogdan Wojtsekhowski; C. Chang; Cathleen Jones; Charles Glashausser; Charles Perdrisat; D. Crovelli; Daniel Simon; David Meekins; Demetrius Margaziotis; Dipangkar Dutta; Edgar Kooijman; Elaine Schulte; Edward Brash; Edward Kinney; Eugene Chudakov; Feng Xiong; Franco Garibaldi; Garth Huber; Gerfried Kumbartzki; Guido Urciuoli; Haiyan Gao; Jordan Hovdebo; James Kelly; Javier Gomez; Jens-Ole Hansen; Jian-Ping Chen; John Calarco; John LeRose; Joseph Mitchell; Juncai Gao; Konrad Aniol; Kamal Benslama; Kathy McCormick; Cornelis De Jager; Cornelis de Jager; Kevin Fissum; Krishni Wijesooriya; Louis Bimbot; Ludyvine Morand; Luminita Todor; Moskov Amarian; Marat Rvachev; Mark Jones; Martin Epstein; Meihua Liang; Michael Kuss; Nilanga Liyanage; Adam Sarty; Paul Ulmer; Pete Markowitz; Peter Bosted; R. Holt; Riad Suleiman; Richard Lindgren; Rikki Roche; Robert Michaels; Roman Pomatsalyuk; Ronald Gilman; Ronald Ransome; Stephen Becher; Scott Dumalski; Salvatore Frullani; Seonho Choi; Sergey Malov; Sonja Dieterich; Steffen Strauch; Steve Churchwell; Ting Chang; Viktor Gorbenko; Vina Punjabi; Wang Xu; Xiangdong Ji; Zein-Eddine Meziani; Zhengwei Chai

    2001-09-01

    We present measurements of the ratio of the proton elastic electromagnetic form factors, {mu}pGEp/GMp. The Jefferson Lab Hall A Focal Plane Polarimeter was used to determine the longitudinal and transverse components of the recoil proton polarization in ep elastic scattering; the ratio of these polarization components is proportional to the ratio of the two form factors. These data reproduce the observation of Jones et al. [Phys. Rev. Lett. 84, 1398 (2000)], that the form factor ratio decreases significantly from unity above Q2 = 1 GeV2.

  20. Processes forming and sustaining Saturn's proton radiation belts

    NASA Astrophysics Data System (ADS)

    Kollmann, P.; Roussos, E.; Paranicas, C.; Krupp, N.; Haggerty, D. K.

    2013-01-01

    Saturn's proton radiation belts extend over the orbits of several moons that split this region of intense radiation into several distinct belts. Understanding their distribution requires to understand how their particles are created and evolve. High-energy protons are thought to be dominantly produced by cosmic ray albedo neutron decay (CRAND). The source of the lower energies and the role of other effects such as charge exchange with the gas originating from Enceladus is still an open question. There is also no certainty so far if the belts exist independently from each other and the rest of the magnetosphere or if and how particles are exchanged between these regions. We approach these problems by using measurements acquired by the MIMI/LEMMS instrument onboard the Cassini spacecraft. Protons in the range from 500 keV to 40 MeV are considered. Their intensities are averaged over 7 years of the mission and converted to phase space densities at constant first and second adiabatic invariant. We reproduce the resulting radial profiles with a numerical model that includes radial diffusion, losses from moons and interactions with gas, and a phenomenological source. Our results show that the dominating effects away from the moon sweeping corridors are diffusion and the source, while interactions with gas are secondary. Based on a GEANT4 simulation of the interaction of cosmic rays with Saturn's rings, we conclude that secondary particles produced within the rings can only account for the high-energy part of the source. A comparison with the equivalent processes within Earth's atmosphere shows that Saturn's atmosphere can contribute to the production of the lower energies and might be even dominating at the higher energies. Other possibilities to supply the belts and exchange particles between them, as diffusion and injections from outside the belts, or stripping of ENAs, can be excluded.

  1. Nucleon and Δ electromagnetic form factors

    NASA Astrophysics Data System (ADS)

    Bartoš, Erik; Dubnička, Stanislav; Dubničková, Anna-Zuzana

    2015-11-01

    The unitary and analytic model for nucleons works very well. The model for spin 1 2+ baryons can predict static parameters for Λ, Σ+, Σ0, Σ-, Ξ, Ξ-. We prepared the scheme how to construct the model also for Δ nucleon resonance. It was used to describe transition form factor GM∗ and the experimentally measured ratio RSM with the help of relations for magnetic dipole transition and charge quadrupole form factors.

  2. Proton imaging of an electrostatic field structure formed in laser-produced counter-streaming plasmas

    NASA Astrophysics Data System (ADS)

    Morita, T.; Kugland, N. L.; Wan, W.; Crowston, R.; Drake, R. P.; Fiuza, F.; Gregori, G.; Huntington, C.; Ishikawa, T.; Koenig, M.; Kuranz, C.; Levy, M. C.; Martinez, D.; Meinecke, J.; Miniati, F.; Murphy, C. D.; Pelka, A.; Plechaty, C.; Presura, R.; Quirós, N.; Remington, B. A.; Reville, B.; Ross, J. S.; Ryutov, D. D.; Sakawa, Y.; Steele, L.; Takabe, H.; Yamaura, Y.; Woolsey, N.; Park, H.-S.

    2016-03-01

    We report the measurements of electrostatic field structures associated with an electrostatic shock formed in laser-produced counter-streaming plasmas with proton imaging. The thickness of the electrostatic structure is estimated from proton images with different proton kinetic energies from 4.7 MeV to 10.7 MeV. The width of the transition region is characterized by electron scale length in the laser-produced plasma, suggesting that the field structure is formed due to a collisionless electrostatic shock.

  3. Electromagnetic Form Factors of Hadrons in Quantum Field Theories

    SciTech Connect

    Dominguez, C. A.

    2008-10-13

    In this talk, recent results are presented of calculations of electromagnetic form factors of hadrons in the framework of two quantum field theories (QFT), (a) Dual-Large N{sub c} QCD (Dual-QCD{sub {infinity}}) for the pion, proton, and {delta}(1236), and (b) the Kroll-Lee-Zumino (KLZ) fully renormalizable Abelian QFT for the pion form factor. Both theories provide a QFT platform to improve on naive (tree-level) Vector Meson Dominance (VMD). Dual-QCD{sub {infinity}} provides a tree-level improvement by incorporating an infinite number of zero-width resonances, which can be subsequently shifted from the real axis to account for the time-like behaviour of the form factors. The renormalizable KLZ model provides a QFT improvement of VMD in the framework of perturbation theory. Due to the relative mildness of the {rho}{pi}{pi} coupling, and the size of loop suppression factors, the perturbative expansion is well defined in spite of this being a strong coupling theory. Both approaches lead to considerable improvements of VMD predictions for electromagnetic form factors, in excellent agreement with data.

  4. Magnetic form factors of the trinucleons

    SciTech Connect

    Schiavilla, R; Pandharipande, V R; Riska, Dan-Olof

    1989-11-01

    The magnetic form factors of 3H and 3He are calculated with the Monte Carlo method from variational ground-state wave functions obtained for the Argonne and Urbana two- and three-nucleon interactions. The electromagnetic current operator contains one- and two-body terms that are constructed so as to satisfy the continuity equation with the two-nucleon potential in the Hamiltonian. The results obtained with the Argonne two-nucleon interaction are in overall agreement with the empirical values. It appears that the remaining theoretical uncertainty, in the calculation of these form factors from a given interaction model, is dominated by that in the electromagnetic form factors of the nucleon. It is found that the isovector magnetic form factors are rather sensitive to the details of the isospin-dependent tensor force, and they are much better reproduced with the Argonne than the Urbana potential. The isoscalar magnetic form factors appear to be sensitive to the spin-orbit interactions, and are better reproduced with the Urbana potential. The Argonne potential has a stronger τ1∙τ2 tensor force, while the Urbana one has a shorter-range spin-orbit interaction.

  5. Electroweak form factors of the Δ (1232 ) resonance

    NASA Astrophysics Data System (ADS)

    Graczyk, Krzysztof M.; Żmuda, Jakub; Sobczyk, Jan T.

    2014-11-01

    Nucleon →Δ (1232 ) transition electroweak form factors are discussed in a single pion production model with nonresonant background terms originating from a chiral perturbation theory. Fits to electron-proton scattering F2 as well as neutrino scattering bubble chamber experimental data are performed. Both ν -proton and ν -neutron channel data are discussed in a unified statistical model. A new parametrization of the N →Δ (1232 ) vector form factors is proposed. In the case of model with deuteron nuclear effects fit to neutrino scattering data gives the axial mass MA Δ=0.85-0.08+0.09 GeV and C5A(0 )=1.10-0.14+0.15 in accordance with the Goldberger-Treiman relation. However, the consistency is spoiled when the deuteron effects are omitted; i.e., in this case the fit gives the axial mass MA Δ=0.8 1-0.09+0.09 GeV and C5A(0 )=0.9 3-0.13+0.13 .

  6. Charm form factors in hadronic interactions

    SciTech Connect

    Bracco, M. E.; Navarra, F. S.; Nielsen, M.; Chiapparini, M.

    2010-12-28

    We calculate the form factors and the coupling constants in vertices with charm mesons, such as {rho}D*D*, in the framework of QCD sum rules. We first discuss the applications of these form factors in heavy ion collisions and in B decays. We then present an introduction to the method of QCD sum rules and describe how to work with the three-point function. We give special attention to the procedure employed to extrapolate results obtained in the deep euclidean region to the poles of the particles, located in the time-like region. Finally we present a table of ready-to-use parametrizations of all the form factors, which are relevant for the processes mentioned in the introduction. We also give the coupling constants.

  7. Precision comparison of the g-factor of the proton and anti-proton

    NASA Astrophysics Data System (ADS)

    Disciacca, Jack

    2013-05-01

    We report the first measurement of the antiproton magnetic moment using a single antiproton. The magnetic moment in nuclear magnetons is μp /μN = - 2 . 792845 +/- 0 . 000012 , a 4.4 parts per million (ppm) measurement. This represents a factor of 680 improvement in precision over previous work using exotic atom spectroscopy, which has achieved a 3000 ppm precision and remained essentially unchanged in the past 20 years., Our measurement allows for an improved comparison of the proton and antiproton magnetic moments, yielding a result consistent with the prediction of charge, parity and time reversal symmetry. Following a proof of principle, 2.5 ppm measurement of the proton magnetic moment, the experiment was moved to CERN for the antiproton experiment. Initial work focused on catching, cooling and trapping a single antiproton from the 5 MeV beam at CERN's Antiproton Decelerator. Following this work, we undertook a magnetic moment measurement. The spin and cyclotron frequency are measured to determine the g-factor, g / 2 =fs /fc . Prospects for further improvement should be possible with single spin flip detection, similar to what was used to measure the electron magnetic moment - currently the most precisely measured property of a fundamental particle. The new antiproton magnetic moment measurement is likely a first step towards improved precision by an additional factor of 103 or 104 improvement, with a precision at the part per billion level.,, A. Kreissl, et al., Z. Phys. C: Part. Fields 37, 557 (1988).

  8. Meson-photon transition form factors

    SciTech Connect

    Balakireva, Irina; Lucha, Wolfgang; Melikhov, Dmitri

    2012-10-23

    We present the results of our recent analysis of the meson-photon transition form factors F{sub P{gamma}}(Q{sup 2}) for the pseudoscalar mesons P {pi}{sup 0},{eta},{eta} Prime ,{eta}{sub c}, using the local-duality version of QCD sum rules.

  9. Form Factors and Radii of Light Nuclei

    SciTech Connect

    Sick, Ingo

    2015-09-15

    We discuss the determination of electromagnetic form factors from the world data on electron–nucleus scattering for nuclei Z ≤ 3, with particular emphasis on the derivation of the moments required for comparison with measurements from electronic/muonic atoms and isotope shifts.

  10. Electromagnetic charged and neutral kaon form factors

    SciTech Connect

    Roberts, C.D.; Burden, C.J.; Thomson, M.J.

    1995-08-01

    The electromagnetic form factor of the charged and neutral kaon is calculated using the approach applied in the successful study of the pion form factor, described above. The charged kaon form factor will be measured in forthcoming experiments at CEBAF. Our calculation involves the dressed strange quark propagator, to which F{sub {pi}}(q{sup 2}) is not sensitive, and hence it provides us with constraints on the strange-quark sector of QCD. Our preliminary results are encouraging. We find that the strange and up/down quark propagators are not too different, once the change in the current-quark-mass is accounted for. However, the difference that remains is important since it allows {l_angle}{bar s}s{r_angle}<{l_angle}{bar u}u{r_angle}. This calculation is the first to yield a value of f{sub K}/f{sub {pi}} that is in good agreement with experiment and also yields r{sub K+}/r{sub {pi}} in good agreement with experiment. Our calculated charged kaon form factor provides a prediction that will be tested in the forthcoming CEBAF experiments. Our studies also show that K{sup 0} has a negative charge radius, as is to be expected. Our calculated value will be compared with that measured in K{sub s}{sup 0} regeneration from electrons.

  11. Form Factors and Radii of Light Nuclei

    NASA Astrophysics Data System (ADS)

    Sick, Ingo

    2015-09-01

    We discuss the determination of electromagnetic form factors from the world data on electron-nucleus scattering for nuclei Z ≤ 3, with particular emphasis on the derivation of the moments required for comparison with measurements from electronic/muonic atoms and isotope shifts.

  12. Form factor effects in the direct detection of isospin-violating dark matter

    SciTech Connect

    Zheng, Hao; Zhang, Zhen; Chen, Lie-Wen E-mail: malkuth@sjtu.edu.cn

    2014-08-01

    Isospin-violating dark matter (IVDM) provides a possible mechanism to ameliorate the tension among recent direct detection experiments. For IVDM, we demonstrate that the results of direct detection experiments based on neutron-rich target nuclei may depend strongly on the density dependence of the symmetry energy which is presently largely unknown and controls the neutron skin thickness that reflects the relative difference of neutron and proton form factors in the neutron-rich nuclei. In particular, using the neutron and proton form factors obtained from Skyrme-Hartree-Fock calculations by varying the symmetry energy within the uncertainty region set by the latest model-independent measurement of the neutron skin thickness of {sup 208}Pb from PREX experiment at JLab, we find that, for IVDM with neutron-to-proton coupling ratio fixed to f{sub n}/f{sub p}=-0.7, the form factor effect may enhance the sensitivity of Xe-based detectors (e.g., XENON100 and LUX) to the DM-proton cross section by a factor of 3 in the DM mass region constrained by CMDS-II(Si) and even by more than an order of magnitude for heavy DM with mass larger than 80 GeV, compared with the results using the empirical Helm form factor. Our results further indicate that the form factor effect can significantly modify the recoil spectrum of Xe-based detectors for heavy IVDM with f{sub n}/f{sub p}=-0.7.

  13. Energy-dependent dipole form factor in a QCD-inspired model

    NASA Astrophysics Data System (ADS)

    Bahia, C. A. S.; Broilo, M.; Luna, E. G. S.

    2016-04-01

    We consider the effect of an energy-dependent dipole form factor in the high-energy behavior of the forward amplitude. The connection between the semihard parton-level dynamics and the hadron-hadron scattering is established by an eikonal QCD-based model. Our results for the proton-proton (pp) and antiproton-proton (¯pp) total cross sections, σpp,\\bar{pp}tot(s), obtained using the CTEQ6L1 parton distribution function, are consistent with the recent data from the TOTEM experiment.

  14. Experimental validation of beam quality correction factors for proton beams

    NASA Astrophysics Data System (ADS)

    Gomà, Carles; Hofstetter-Boillat, Bénédicte; Safai, Sairos; Vörös, Sándor

    2015-04-01

    This paper presents a method to experimentally validate the beam quality correction factors (kQ) tabulated in IAEA TRS-398 for proton beams and to determine the kQ of non-tabulated ionization chambers (based on the already tabulated values). The method is based exclusively on ionometry and it consists in comparing the reading of two ionization chambers under the same reference conditions in a proton beam quality Q and a reference beam quality 60Co. This allows one to experimentally determine the ratio between the kQ of the two ionization chambers. In this work, 7 different ionization chamber models were irradiated under the IAEA TRS-398 reference conditions for 60Co beams and proton beams. For the latter, the reference conditions for both modulated beams (spread-out Bragg peak field) and monoenergetic beams (pseudo-monoenergetic field) were studied. For monoenergetic beams, it was found that the experimental kQ values obtained for plane-parallel chambers are consistent with the values tabulated in IAEA TRS-398; whereas the kQ values obtained for cylindrical chambers are not consistent—being higher than the tabulated values. These results support the suggestion (of previous publications) that the IAEA TRS-398 reference conditions for monoenergetic proton beams should be revised so that the effective point of measurement of cylindrical ionization chambers is taken into account when positioning the reference point of the chamber at the reference depth. For modulated proton beams, the tabulated kQ values of all the ionization chambers studied in this work were found to be consistent with each other—except for the IBA FC65-G, whose experimental kQ value was found to be 0.6% lower than the tabulated one. The kQ of the PTW Advanced Markus chamber, which is not tabulated in IAEA TRS-398, was found to be 0.997 ± 0.042 (k = 2), based on the tabulated value of the PTW Markus chamber.

  15. Unified description of kaon electroweak form factors

    SciTech Connect

    A. Afanasev; W. Buck

    1996-06-01

    A calculation of the semileptonic decays of the kaon (K{sub l3}) is presented. The results are direct predictions of a covariant model of the pion and kaon introduced earlier by Ito, Buck, Gross. The weak form factors for K{sub l3} are predicted with absolutely no parameter adjustments of the model. The authors obtained for the form factor parameters: f{sub {minus}}(q{sup 2}=m{sub l}{sup 2})/f{sub +}(q{sup 2}=m{sub l}{sup 2})={minus}0.28 and {lambda}{sub +}= 0.028, both within experimental error bars. Connections of this approach to heavy quark symmetry will also be discussed.

  16. Systematic Structural Elucidation for the Protonated Form of Rare Earth Bis(porphyrinato) Double-Decker Complexes: Direct Structural Evidence of the Location of the Attached Proton.

    PubMed

    Yamashita, Ken-Ichi; Sakata, Naoya; Ogawa, Takuji

    2016-09-01

    Direct structural evidence of the presence and location of the attached proton in the protonated form of rare earth bis(porphyrinato) double-decker complexes is obtained from an X-ray diffraction study of single crystals for a series of protonated forms of bis(tetraphenylporphyrinato) complexes [M(III)(tpp)(tppH)] (M = Tb, Y, Sm, Nd, and La). When CHCl3 is used as a solvent for crystallization of the complexes, their nondisordered molecular structures are obtained and the attached proton is identified on one of the eight nitrogen atoms. Use of other solvents affords another type of crystal, in which the position of the proton is disordered and thus the molecular structure is averaged. La complex also affords the disordered average structure even when CHCl3 is used for crystallization. A variable-temperature diffraction study for the Tb complex reveals that the dynamics of the proton in the nondisordered crystal is restricted. PMID:27541189

  17. Heavy to light baryon transition form factors

    SciTech Connect

    Guo, X. |; Huang, T. |; Li, Z.

    1996-05-01

    Recently, Stech found form factor relations for heavy to light transitions based on two simple dynamical assumptions for a spectator particle. In this paper we generalize his approach to the case of baryons and find that for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} ({ital Q}={ital b} or {ital c}) only one independent form factor remains in the limit {ital m}{sub {ital Q}}{r_arrow}{infinity}. Furthermore, combining with the model of Guo and Kroll we determine both of the two form factors for {Lambda}{sub {ital Q}}{r_arrow}{Lambda} in the heavy quark limit. The results are applied to {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} which is not clarified both theoretically and experimentally. It is found that the branching ratio of {Lambda}{sub {ital b}}{r_arrow}{Lambda}+{ital J}/{psi} is of order 10{sup {minus}5}. {copyright} {ital 1996 The American Physical Society.}

  18. Longitudinal electron scattering form factors for 54,56Fe

    NASA Astrophysics Data System (ADS)

    Salman, A. D.; Kadhim, D. R.

    2014-09-01

    In this paper, inelastic longitudinal electron scattering form factors for C2 transition have been studied in 54Fe and 56Fe with the aid of shell model calculations. The GX1 effective interaction for the fp-shell is used with the nucleon-nucleon realistic interaction Michigan three-range Yukawa and Modified surface delta interaction as a two-body interactions. The core polarization effects is taken into account through the first-order perturbation theory with the effective charge, which is taken to the proton and the neutron. The effective charge along with the core effects up to 6 ℏw enhanced the calculation very well and improving good agreement with the experimental data.

  19. Pion form factor from a contact interaction

    SciTech Connect

    Gutierrez-Guerrero, L. X.; Bashir, A.; Cloeet, I. C.; Roberts, C. D.

    2010-06-15

    In a Poincare-covariant vector-boson-exchange theory, the pion possesses components of pseudovector origin, which materially influence its observable properties. For a range of such quantities, we explore the consequences of a momentum-independent interaction, regularized in a symmetry-preserving manner. The contact interaction, while capable of describing pion static properties, produces a form factor whose evolution for Q{sup 2}>0.17 GeV{sup 2} disagrees markedly with experiment and whose asymptotic power-law behavior conflicts strongly with perturbative QCD.

  20. Pion form factor from a contact interaction.

    SciTech Connect

    Gutierrez-Guerrero, L. X.; Bashir, A.; Cloet, I. C.; Roberts, C. D.

    2010-01-01

    In a Poincare-covariant vector-boson-exchange theory, the pion possesses components of pseudovector origin, which materially influence its observable properties. For a range of such quantities, we explore the consequences of a momentum-independent interaction, regularized in a symmetry-preserving manner. The contact interaction, while capable of describing pion static properties, produces a form factor whose evolution for Q{sup 2} > 0.17 GeV{sup 2} disagrees markedly with experiment and whose asymptotic power-law behavior conflicts strongly with perturbative QCD.

  1. Electromagnetic Transition Form Factors of Nucleon Resonances

    SciTech Connect

    Burkert, Volker D.

    2008-10-13

    Recent measurements of nucleon resonance transition form factors with CLAS at Jefferson Lab are discussed. The new data resolve a long-standing puzzle of the nature of the Roper resonance, and confirm the assertion of the symmetric constituent quark model of the Roper as the first radial excitation of the nucleon. The data on high Q{sup 2} n{pi}{sup +} production confirm the slow fall off of the S{sub 11}(1535) transition form factor with Q{sup 2}, and better constrain the branching ratios {beta}{sub N{pi}} = 0.50 and {beta}{sub N{eta}} = 0.45. For the first time, the longitudinal transition amplitude to the S{sub 11}(1535) was extracted from the n{pi}{sup +} data. Also, new results on the transition amplitudes for the D{sub 13}(1520) resonance are presented showing a rapid transition from helicity 3/2 dominance seen at the real photon point to helicty 1/2 dominance at higher Q{sup 2}.

  2. Helium Compton Form Factor Measurements at CLAS

    SciTech Connect

    Voutier, Eric J.-M.

    2013-07-01

    The distribution of the parton content of nuclei, as encoded via the generalized parton distributions (GPDs), can be accessed via the deeply virtual Compton scattering (DVCS) process contributing to the cross section for leptoproduction of real photons. Similarly to the scattering of light by a material, DVCS provides information about the dynamics and the spatial structure of hadrons. The sensitivity of this process to the lepton beam polarization allows to single-out the DVCS amplitude in terms of Compton form factors that contain GPDs information. The beam spin asymmetry of the $^4$He($\\vec {\\mathrm e}$,e$' \\gamma ^4$He) process was measured in the experimental Hall B of the Jefferson Laboratory to extract the real and imaginary parts of the twist-2 Compton form factor of the $^4$He nucleus. The experimental results reported here demonstrate the relevance of this method for such a goal, and suggest the dominance of the Bethe-Heitler amplitude to the unpolarized process in the kinematic range explored by the experiment.

  3. Proton Therapy

    MedlinePlus

    ... nucleus is surrounded by electrons. In proton therapy, beams of fast-moving protons are used to destroy ... atoms to release proton, neutron, and helium ion beams. In this highly specialized form of radiosurgery , proton ...

  4. Is the proton electromagnetic form factor modified in nuclei?

    SciTech Connect

    Morgenstern, J; Meziani, Zein-eddine

    2003-06-01

    Guided by the recent experimental confirmation of the validity of the Effective Momentum Approximation (EMA) in quasi-elastic scattering off nuclei, we have re-examined the extraction of the Longitudinal and Transverse Response Functions in medium-weight and heavy nuclei. In the EMA we have performed a Rosenbluth separation of the available world data on 40Ca, 48Ca, 56Fe and 208Pb. We find that the Longitudinal Response Function for these nuclei is quenched and that the Coulomb sum is not saturated, at odds with recent claims in the literature.

  5. Chiral corrections to hyperon vector form factors

    NASA Astrophysics Data System (ADS)

    Anderson, Jeffrey; Luty, Markus A.

    1993-06-01

    We show that the leading chiral corrections to the ΔS=1 f1 vector form factors of hyperons are O(ms) and O(m3/2s), and are expected to be ~20-30 % by dimensional analysis. This is consistent with the Ademollo-Gatto theorem. We compute the O(ms) corrections and a subset of the O(m3/2s) corrections using an effective Lagrangian in which the baryons are treated as heavy particles. All of these corrections are surprisingly small, ~5% combining them, we obtain ~5-10 % corrections. The pattern of corrections is very different from that predicted by quark models.

  6. Elastic and Transition Form Factors in DSEs

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge

    2016-06-01

    A symmetry preserving framework for the study of continuum quantum chromodynamics (QCD) is obtained from a truncated solution of the QCD equations of motion or QCD's Dyson-Schwinger equations (DSEs). A nonperturbative solution of the DSEs enables the study of, e.g., hadrons as composites of dressed-quarks and dressed-gluons, the phenomena of confinement and dynamical chiral symmetry breaking, and therefrom an articulation of any connection between them. It is within this context that we present a unified study of Nucleon, Delta and Roper elastic and transition form factors, and compare predictions made using a framework built upon a Faddeev equation kernel and interaction vertices that possess QCD-like momentum dependence with results obtained using a symmetry-preserving treatment of a vector ⊗ vector contact-interaction.

  7. Nucleon Transition Form Factors and New Perspectives

    SciTech Connect

    Gothe, R W

    2007-10-01

    The status of the electro-excitation program to study baryon resonances at Jefferson Lab will be exemplified by the most recent results on resonance parameters and transition form factors in single and double-pion production. These results demonstrate that the separation of resonance and background contributions and therefore the extraction of the electro-coupling amplitudes of resonances become easier and cleaner at higher four-momentum transfers (Q2). Furthermore, the double-pion in comparison to the single-pion channel shows a higher sensitivity to higher excited resonances and a distinctly different Q2 dependence of the background amplitudes. The combined analysis of the single- and double-pion data reduces model dependent uncertainties significantly, which allows us to extract the resonant electrocoupling amplitudes with an unprecedented quality.

  8. Role of diquark correlations and the pion cloud in nucleon elastic form factors

    NASA Astrophysics Data System (ADS)

    Cloët, Ian C.; Bentz, Wolfgang; Thomas, Anthony W.

    2014-10-01

    Electromagnetic form factors of the nucleon in the spacelike region are investigated within the framework of a covariant and confining Nambu-Jona-Lasinio model. The bound-state amplitude of the nucleon is obtained as the solution of a relativistic Faddeev equation, where diquark correlations appear naturally as a consequence of the strong coupling in the color 3¯ qq channel. Pion degrees of freedom are included as a perturbation to the "quark-core" contribution obtained using the Poincaré covariant Faddeev amplitude. While no model parameters are fit to form-factor data, excellent agreement is obtained with the empirical nucleon form factors (including the magnetic moments and radii) where pion loop corrections play a critical role for Q2≲1GeV2. Using charge symmetry, the nucleon form factors can be expressed as proton quark sector form factors. The latter are studied in detail, leading, for example, to the conclusion that the d-quark sector of the Dirac form factor is much softer than the u-quark sector, a consequence of the dominance of scalar diquark correlations in the proton wave function. On the other hand, for the proton quark sector Pauli form factors we find that the effect of the pion cloud and axial-vector diquark correlations overcomes the effect of scalar diquark dominance, leading to a larger d-quark anomalous magnetic moment and a form factor in the u-quark sector that is slightly softer than in the d-quark sector.

  9. Alpha-helical hydrophobic polypeptides form proton-selective channels in lipid bilayers

    NASA Technical Reports Server (NTRS)

    Oliver, A. E.; Deamer, D. W.

    1994-01-01

    Proton translocation is important in membrane-mediated processes such as ATP-dependent proton pumps, ATP synthesis, bacteriorhodopsin, and cytochrome oxidase function. The fundamental mechanism, however, is poorly understood. To test the theoretical possibility that bundles of hydrophobic alpha-helices could provide a low energy pathway for ion translocation through the lipid bilayer, polyamino acids were incorporated into extruded liposomes and planar lipid membranes, and proton translocation was measured. Liposomes with incorporated long-chain poly-L-alanine or poly-L-leucine were found to have proton permeability coefficients 5 to 7 times greater than control liposomes, whereas short-chain polyamino acids had relatively little effect. Potassium permeability was not increased markedly by any of the polyamino acids tested. Analytical thin layer chromatography measurements of lipid content and a fluorescamine assay for amino acids showed that there were approximately 135 polyleucine or 65 polyalanine molecules associated with each liposome. Fourier transform infrared spectroscopy indicated that a major fraction of the long-chain hydrophobic peptides existed in an alpha-helical conformation. Single-channel recording in both 0.1 N HCl and 0.1 M KCl was also used to determine whether proton-conducting channels formed in planar lipid membranes (phosphatidylcholine/phosphatidylethanolamine, 1:1). Poly-L-leucine and poly-L-alanine in HCl caused a 10- to 30-fold increase in frequency of conductive events compared to that seen in KCl or by the other polyamino acids in either solution. This finding correlates well with the liposome observations in which these two polyamino acids caused the largest increase in membrane proton permeability but had little effect on potassium permeability. Poly-L-leucine was considerably more conductive than poly-L-alanine due primarily to larger event amplitudes and, to a lesser extent, a higher event frequency. Poly-L-leucine caused two

  10. Baryon Transition Form Factors at JLab: Status and Outlook

    SciTech Connect

    Ralf Gothe

    2009-12-01

    The measurements of exclusive single-meson and double-pion electro-production cross sections off the proton to study nucleon resonances will be extended to higher momentum transfers with the CLAS12 detector and the energy upgraded CEBAF beam. Based on new theoretical developments to extract and interpret the electromagnetic transition form factors and on the experience gained from the most recent results, the newly formed collaboration of experimentalists and theorists shall enable us to provide unprecedented high-precision data, high-quality analyses, and state-of-the-art model and QCD based calculations in a Q domain up to 10 GeV{sup 2}. For the first time nucleon resonance structures will be studied at still unexplored distance scales, where the dressed quark contributions are the dominating degrees of freedom and their strong interaction is responsible for the ground and excited nucleon state formation. These studies also open up a promising opportunity to understand the origin of more than 98% of the nucleon mass that is created by strong fields predominantly at these distance scales by dressing the current quarks.

  11. Nucleon Structure and hyperon form factors from lattice QCD

    SciTech Connect

    Lin, Huey-Wen

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point to be 1.23(5), consistant with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(26), consistent with the Adelaide-JLab Collaboration's result. The hyperon Sigma and Xi axial coupling constants are also performed for the first time in a lattice calculation, g_SigmaSigma = 0.441(14) and g_XiXi = -0.277(11).

  12. Nucleon Structure and Hyperon Form Factors from Lattice QCD.

    SciTech Connect

    Lin,H.W.

    2007-06-11

    In this work, I report the latest lattice QCD calculations of nucleon and hyperon structure from chiral fermions in 2+1-flavor dynamical simulations. All calculations are done with a chirally symmetric fermion action, domain-wall fermions, for valence quarks. I begin with the latest lattice results on the nucleon structure, focusing on results from RBC/UKQCD using 2+1-flavor chiral fermion actions. We find the chiral-extrapolated axial coupling constant at physical pion mass point. to be 1.23(5), consistent with experimental value. The renormalization constants for the structure functions are obtained from RI/MOM-scheme non-perturbative renormalization. We find first moments of the polarized and unpolarized nucleon structure functions at zero transfer momentum to be 0.133(13) and 0.203(23) respectively, using continuum chiral extrapolation. These are consistent with the experimental values, unlike previous calculations which have been 50% larger. We also have a prediction for the transversity, which we find to be 0.56(4). The twist-3 matrix element is consistent with zero which agrees with the prediction of the Wandzura-Wilczek relation. In the second half of this work, I report an indirect dynamical estimation of the strangeness proton magnetic moments using mixed actions. With the analysis of hyperon form factors and using charge symmetry, the strangeness of proton is found to be -0.066(2G), consistent with the Adelaide-JLab Collaboration's result. The hyperon {Sigma} and {Xi} axial coupling constants are also performed for the first time in a lattice calculation, g{sub {Sigma}{Sigma}} = 0.441(14) and g{sub {Xi}{Xi}} = -0.277(11).

  13. Optimized perturbation theory: the pion form factor

    SciTech Connect

    Gupta, R.

    1981-10-01

    The order ..cap alpha../sup 2//sub s/(Q/sup 2/) corrections to the pion form-factor F/sub ..pi../(Q/sup 2/) are calculated using perturbative QCD and dimensional regularization. The result is compared in the MS and MOM subtraction schemes and plotted as a function of Q/sup 2//Q/sup 2/ where Q is the subtraction point. There is a large dependence on the scheme, the definition of the running coupling constant ..cap alpha../sub s/(Q/sup 2/) and the subtraction point Q. We find it best to invert the ..beta..-function equation for the definition of ..cap alpha../sub s/ rather than make an expansion in powers of log(Q/sup 2//..lambda../sup 2/). We study two methods to optimize the result with respect to Q: Stevenson's prescription and putting the 0(..cap alpha../sup 2//sub s/) term to zero. Both methods give almost the same value for Q/sup 2/F/sub ..pi../ and this value is scheme independent.

  14. Fluorescence characteristics of protonated form of 6-hydroxyquinoline in Nafion® film

    NASA Astrophysics Data System (ADS)

    Mehata, M. S.; Joshi, H. C.; Tripathi, H. B.

    2003-02-01

    Fluorescence characteristics of 6-hydroxyquinoline (6-HQ) have been studied at room temperature in Nafion® film by steady state and nano-second time-resolved fluorescence spectroscopy. The fluorescence spectrum exhibits single emission band corresponding to the protonated form of 6-HQ in this matrix. However, the decay fits with two or three exponential functions depending on the emission wavelength monitored. At blue edge of the emission, the decay fits to three-exponential function, whereas at longer wavelengths, the decay fits to bi-exponential function. Two tentative mechanisms have been proposed to explain the experimental data, viz. a closely lying charge transfer state (CT) or an excited state proton transfer (ESPT) process. The photophysical parameters appear to be sensitive to the change in microstructure due to swelling of the membrane by the solvents.

  15. Neutron-Proton Asymmetry Dependence of Spectroscopic Factors in Ar Isotopes

    NASA Astrophysics Data System (ADS)

    Lee, Jenny; Tsang, M. B.; Bazin, D.; Coupland, D.; Henzl, V.; Henzlova, D.; Kilburn, M.; Lynch, W. G.; Rogers, A. M.; Sanetullaev, A.; Signoracci, A.; Sun, Z. Y.; Youngs, M.; Chae, K. Y.; Charity, R. J.; Cheung, H. K.; Famiano, M.; Hudan, S.; O'Malley, P.; Peters, W. A.; Schmitt, K.; Shapira, D.; Sobotka, L. G.

    2010-03-01

    Spectroscopic factors have been extracted for proton-rich Ar34 and neutron-rich Ar46 using the (p, d) neutron transfer reaction. The experimental results show little reduction of the ground state neutron spectroscopic factor of the proton-rich nucleus Ar34 compared to that of Ar46. The results suggest that correlations, which generally reduce such spectroscopic factors, do not depend strongly on the neutron-proton asymmetry of the nucleus in this isotopic region as was reported in knockout reactions. The present results are consistent with results from systematic studies of transfer reactions but inconsistent with the trends observed in knockout reaction measurements.

  16. Neutron-Proton Asymmetry Dependence of Spectroscopic Factors in Ar Isotopes

    SciTech Connect

    Lee, Jenny; Tsang, Betty; Shapira, Dan

    2010-01-01

    Spectroscopic factors have been extracted for proton-rich 34Ar and neutron-rich 46Ar using the (p, d) neutron transfer reaction. The experimental results show little reduction of the ground state neutron spectroscopic factor of the proton-rich nucleus 34Ar compared to that of 46Ar. The results suggest that correlations, which generally reduce such spectroscopic factors, do not depend strongly on the neutron-proton asymmetry of the nucleus in this isotopic region as was reported in knockout reactions. The present results are consistent with results from systematic studies of transfer reactions but inconsistent with the trends observed in knockout reaction measurements.

  17. Calculation of neutral weak nucleon form factors with the AdS/QCD correspondence

    NASA Astrophysics Data System (ADS)

    Lohmann, Mark

    The AdS/QCD (Anti-de Sitter/Quantum Chromodynamics) is a mathematical formalism applied to a theory based on the original AdS/CFT (Anti-de Sitter/ Conformal Field Theory) correspondence. The aim is to describe properties of the strong force in an essentially non-perturbative way. AdS/QCD theories break the conformal symmetry of the AdS metric (a sacrifice) to arrive at a boundary theory which is QCD-like (a payoff). This correspondence has been used to calculate well-known quantities in nucleon spectra and structure like Regge trajectories, form factors, and many others within an error of less than 20% from experiment. This is impressive considering that ordinary perturbation theory in QCD applied to the strongly interacting domain usually obtains an error of about 30%. In this thesis, the AdS/QCD correspondence method of light-front holography established by Brodsky and de Teramond is used in an attempt to calculate the Dirac and Pauli neutral weak form factors, FZ1 (Q2) and FZ2 (Q 2) respectively, for both the proton and the neutron. With this approach, we were able to determine the neutral weak Dirac form factor for both nucleons and the Pauli form factor for the proton, while the method did not succeed at determining the neutral weak Pauli form factor for the neutron. With these we were also able to extract the proton's strange electric and magnetic form factor, which addresses important questions in nucleon sub-structure that are currently being investigated through experiments at the Thomas Jefferson National Accelerator Facility.

  18. Nucleon form factors to next-to-leading order with light-cone sum rules

    SciTech Connect

    Passek-Kumericki, K.; Peters, G.

    2008-08-01

    We have calculated the leading-twist next-to-leading order (NLO), i.e., O({alpha}{sub s}), correction to the light-cone sum rules prediction for the electromagnetic form factors of the nucleon. We have used the Ioffe nucleon interpolation current and worked in M{sub N}=0 approximation, with M{sub N} being the mass of the nucleon. In this approximation, only the Pauli form factor F{sub 2} receives a correction and the calculated correction is quite sizable (ca. 60%). The numerical results for the proton form factors show the improved agreement with the experimental data. We also discuss the problems encountered when going away from M{sub N}=0 approximation at NLO, as well as gauge invariance of the perturbative results. This work presents the first step towards the NLO accuracy in the light-cone sum rules for baryon form factors.

  19. Proton tissue dose for the blood forming organ in human geometry: Isotropic radiation

    NASA Technical Reports Server (NTRS)

    Khandelwal, G. S.; Wilson, J. W.

    1974-01-01

    A computer program is described which calculates doses averaged within five major segments of the blood forming organ in the human body taking into account selfshielding of the detailed body geometry and nuclear star effects for proton radiation of arbitrary energy spectrum (energy less than 1 GeV) and isotropic angular distribution. The dose calculation includes the first term of an asymptotic series expansion of transport theory which is known to converge rapidly for most points in the human body. The result is always a conservative estimate of dose and is given as physical dose (rad) and dose equivalent (rem).

  20. Structure of olefin-imidacloprid and gas-phase fragmentation chemistry of its protonated form.

    PubMed

    Fusetto, Roberto; White, Jonathan M; Hutton, Craig A; O'Hair, Richard A J

    2016-02-01

    One of the major insect metabolites of the widely used neonicotinoid insecticide imidacloprid, 1 (1-[(6-chloro-3-pyridinyl)methyl]-N-nitro-1H-imidazol-2-amine), is the olefin 2. To better understand how the structure of olefin 2 relates to the gas-phase fragmentation of its protonated form, 2H(+), X-ray crystallography, tandem mass spectrometry experiments and DFT calculations were carried out. Olefin 2 was found to be in a tautomeric form where the proton is on the N(1) position of the imidazole ring and forms a hydrogen bond to one of the oxygen atoms of the coplanar nitroamine group. Under conditions of low-energy collision-induced dissociation (CID) in a linear ion trap, 2H(+), formed via electrospray ionization (ESI), fragments via a major loss of water, together with minor competing losses of HNO2 and NO2•.This contrasts with 1H+, which mainly undergoes bond homolysis via NO2• loss. Thus, installation of the double bond in 2 plays a key role in facilitating the loss of water. DFT calculations, carried out using the B3LYP/6-311G++(d,p) level of theory, revealed that loss of water was energetically more favourable compared to HNO2 and NO2• loss. Three multistep, energetically accessible mechanisms were identified for loss of water from 2H(+), and these have the following barriers: (I) direct proton transfer from N(5) of the pyridine to O(1) on the NO2 group (119 kJ mol(-1)); (II) rotation of the N(2)-N(4) bond (117 kJ mol(-1)); (III) 1,3-intramolecular proton transfer between the two oxygen atoms of the NO2 group (145 kJ mol(-1)). Given that the lowest barrier for the losses of HNO2 and NO2• is 156 kJ mol(-1), it is likely that all three water loss mechanisms occur concurrently. PMID:26726997

  1. DFT study of sulfur derivatives of cumulenes and their protonated forms of interstellar interest and calculations of dissociation energies of protonated forms (SC(CH)C(n-2)S)(+) (n = 3-8).

    PubMed

    Benmensour, Mohamed Ali; Djennane-Bousmaha, Sema; Boucekkine, Abdou

    2014-07-01

    A theoretical study of the sulfur cumulenes SCnS (n = 3-8), CnS ( n = 1-8) and of their protonated forms (SCnS)H(+) and (CnS)H(+) that might exist in the interstellar environment, has been carried out by means of the standard B3LYP/6-311G** method. The geometries and relative energies of singlet and triplet states according to the number of carbons have been computed. Like neutral species, we have found that the ground state of the most stable protonated forms (SC(CH)Cn-2S)(+) and ((HC)Cn-1S)(+), alternates between a triplet state for the even series and a singlet state for the odd series. We provided the data needed to simulate infrared and microwave spectra (vibration frequencies, dipole moments, and rotational constants) for each protonated species (SCnS)H(+) and (CnS)H(+) and for each neutral CnS species. The computing of dissociation energies of the most stable protonated forms (SC(CH)Cn-2S)(+) (n = 3-8) has shown that the lowest values are obtained for the dissociation of compounds with an even number of carbons, in their triplet state, which produce the observed fragments CS and C3S. The dissociation of even protonated forms requires less energy than for the odd protonated forms. PMID:24935110

  2. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE

    NASA Astrophysics Data System (ADS)

    Schneider, Uwe; Hälg, Roger A.; Baiocco, Giorgio; Lomax, Tony

    2016-08-01

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  3. Neutrons in proton pencil beam scanning: parameterization of energy, quality factors and RBE.

    PubMed

    Schneider, Uwe; Hälg, Roger A; Baiocco, Giorgio; Lomax, Tony

    2016-08-21

    The biological effectiveness of neutrons produced during proton therapy in inducing cancer is unknown, but potentially large. In particular, since neutron biological effectiveness is energy dependent, it is necessary to estimate, besides the dose, also the energy spectra, in order to obtain quantities which could be a measure of the biological effectiveness and test current models and new approaches against epidemiological studies on cancer induction after proton therapy. For patients treated with proton pencil beam scanning, this work aims to predict the spatially localized neutron energies, the effective quality factor, the weighting factor according to ICRP, and two RBE values, the first obtained from the saturation corrected dose mean lineal energy and the second from DSB cluster induction. A proton pencil beam was Monte Carlo simulated using GEANT. Based on the simulated neutron spectra for three different proton beam energies a parameterization of energy, quality factors and RBE was calculated. The pencil beam algorithm used for treatment planning at PSI has been extended using the developed parameterizations in order to calculate the spatially localized neutron energy, quality factors and RBE for each treated patient. The parameterization represents the simple quantification of neutron energy in two energy bins and the quality factors and RBE with a satisfying precision up to 85 cm away from the proton pencil beam when compared to the results based on 3D Monte Carlo simulations. The root mean square error of the energy estimate between Monte Carlo simulation based results and the parameterization is 3.9%. For the quality factors and RBE estimates it is smaller than 0.9%. The model was successfully integrated into the PSI treatment planning system. It was found that the parameterizations for neutron energy, quality factors and RBE were independent of proton energy in the investigated energy range of interest for proton therapy. The pencil beam algorithm has

  4. Virtuality Distributions and Pion Transition Form Factor

    DOE PAGESBeta

    Radyushkin, Anatoly V.

    2015-03-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+=0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k_perp), and write it in terms of VDA Φ(x,σ). We propose models for softmore » VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.« less

  5. Virtuality Distributions and Pion Transition Form Factor

    NASA Astrophysics Data System (ADS)

    Radyushkin, A. V.

    2015-02-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal 𝒪(0, z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+ = 0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k⊥), and write it in terms of VDA Φ(x, σ). We propose models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.

  6. Molecular mobility of imidazoles in molten state as a key factor to enhance proton conductivity

    NASA Astrophysics Data System (ADS)

    Jarumaneeroj, Chatchai; Tashiro, Kohji; Chirachanchai, Suwabun

    2014-03-01

    A systematic study on alkyl urocanates related to the proton conductivity performances to clarify the role of molecular mobility and hydrogen bond in proton transfer is carried out. Depending on the methylene units, the melting (Tm) and degradation temperatures (Td) change remarkably. When methylene unit is four, C4U shows the lowest melting point (as low as 46 °C) and this suggests the favorable molecular mobility in the molten state. The short hydrogen bond distance and the short T1 relaxation time lead to a scheme of proton conductivity of C4U to be under a regular imidazole arrangement with highly active alkyl chain molecular motion. When C4U is in molten state, the proton transfer is under vehicle mechanism clarified by Volgel-Tammann-Fulcher (VTF) equation. By applying C4U as a proton conductive additive in a sulfonated poly(ether ether ketone) (SPEEK) membrane without any acid dopants, the proton conductivity in the heating process up to 170 °C continuously increases to be ∼104 times higher than that of the neat SPEEK. The present work not only demonstrates the thermal mobility as a key factor to govern the proton conductivity but also proposes the effective proton transfer of heterocyclic compounds based on the molten state.

  7. Virtuality Distributions and Pion Transition Form Factor

    SciTech Connect

    Radyushkin, Anatoly V.

    2015-03-01

    Using the example of hard exclusive transition process γ*γ → π0 at the handbag level, we outline basics of a new approach to transverse momentum dependence in hard processes. In coordinate representation, matrix elements of operators (in the simplest case, bilocal O(0,z)) describing a hadron with momentum p, are functions of (pz) and z2 parametrized through virtuality distribution amplitudes (VDA) Φ(x, σ), with x being Fourier-conjugate to (pz) and σ Laplace-conjugate to z2. For intervals with z+=0, we introduce the transverse momentum distribution amplitude (TMDA) Ψ(x, k_perp), and write it in terms of VDA Φ(x,σ). We propose models for soft VDAs/TMDAs, and use them for comparison of handbag results with experimental (BaBar and BELLE) data. We also discuss the generation of hard tails of TMDAs from initially soft forms.

  8. Factor Structure of the Personality Research Form-E: A Maximum Likelihood Analysis.

    ERIC Educational Resources Information Center

    Fowler, Patrick C.

    1985-01-01

    Presents a five-factor, structural model of the Personality Research Form-E for 140 university undergraduates. All factors demonstrated an excellent level of similarity to those previously reported for other forms of the PRF, as well as to the conceptual scheme developed by Jackson (1974). (Author/JAC)

  9. Studies of Nucleon Form Factors with 12 GeV CEBAF and SuperBigBite

    SciTech Connect

    Hansen, Jens-Ole

    2012-04-01

    The elastic electromagnetic form factors are among the most fundamental quantities that describe the ground-state structure of the proton and neutron. Precision data of the form factors over a wide kinematical range provide a powerful test of current theories of hadron structure. A number of experiments aiming to measure the electric and magnetic elastic form factors of the neutron, G{sub E}{sup n} and G{sub M}{sup n}, and proton, G{sub E}{sup p}, at very high momentum transfer, up to the range of Q{sup 2} = 10-14 (GeV/c){sup 2}, are planned to be carried out with the future 11 GeV electron beam of the upgraded CEBAF at Jefferson Lab. These experiments will determine the nucleon form factors with unprecedented precision to Q{sup 2}-values up to three times higher than those of existing data. We review the approved proposals and the conceptual design of a new spectrometer, SuperBigBite, that will be used in these and other future experiments at Jefferson Lab.

  10. Conformal symmetry and pion form factor: Space- and timelike region

    SciTech Connect

    Choi, Ho-Meoyng; Ji, Chueng-Ryong

    2008-06-01

    We extend a recent analysis of the pion electromagnetic form factor constrained by the conformal symmetry to explore the timelike region. We show explicitly that the timelike form factor obtained by the analytic continuation of the spacelike form factor correctly satisfies the dispersion relation. Our results indicate that the quark spin and dynamical mass effects are crucial to yield the realistic features of the vector meson dominance phenomena.

  11. HERMES impact for the access of Compton form factors

    NASA Astrophysics Data System (ADS)

    Kumerički, K.; Müller, D.; Murray, M.

    2014-07-01

    We utilize the DVCS asymmetry measurements of the HERMES collaboration for access to Compton form factors in the deeply virtual regime and to generalized parton distributions. In particular, the (almost) complete measurement of DVCS observables allows us to map various asymmetries into the space of Compton form factors, where we still rely in this analysis on dominance of twist-two associated Compton form factors. We compare this one-to-one map with local Compton form factor fits and a model dependent global fit.

  12. Analytical evaluation of atomic form factors: Application to Rayleigh scattering

    SciTech Connect

    Safari, L.; Santos, J. P.; Amaro, P.; Jänkälä, K.; Fratini, F.

    2015-05-15

    Atomic form factors are widely used for the characterization of targets and specimens, from crystallography to biology. By using recent mathematical results, here we derive an analytical expression for the atomic form factor within the independent particle model constructed from nonrelativistic screened hydrogenic wave functions. The range of validity of this analytical expression is checked by comparing the analytically obtained form factors with the ones obtained within the Hartee-Fock method. As an example, we apply our analytical expression for the atomic form factor to evaluate the differential cross section for Rayleigh scattering off neutral atoms.

  13. On the maximum charge state and proton transfer reactivity of peptide and protein ions formed by electrospray ionization.

    PubMed

    Schnier, P D; Gross, D S; Williams, E R

    1995-11-01

    A relatively simple model for calculation of the energetics of gas-phase proton transfer reactions and the maximum charge state of multiply protonated ions formed by electrospray ionization is presented. This model is based on estimates of the intrinsic proton transfer reactivity of sites of protonation and point charge Coulomb interactions. From this model, apparent gas-phase basicities (GB(app)) of multiply protonated ions are calculated. Comparison of this value to the gas-phase basicity of the solvent from which an ion is formed enables a maximum charge state to be calculated. For 13 commonly electrosprayed proteins, our calculated maximum charge states are within an average of 6% of the experimental values reported in the literature. This indicates that the maximum charge state for proteins is determined by their gas-phase reactivity. Similar results are observed for peptides with many basic residues. For peptides with few basic residues, we find that the maximum charge state is better correlated to the charge state in solution. For low charge state ions, we find that the most basic sites Arg, Lys, and His are preferentially protonated. A significant fraction of the less basic residues Pro, Trp, and Gln are protonated in high charge state ions. The calculated GB(app) of individual protonation sites varies dramatically in the high charge state ions. From these values, we calculate a reduced cross section for proton transfer reactivity that is significantly lower than the Langevin collision frequency when the GB(app) of the ion is approximately equal to the GB of the neutral base. PMID:24214055

  14. X-Ray Form Factor, Attenuation and Scattering Tables

    National Institute of Standards and Technology Data Gateway

    SRD 66 X-Ray Form Factor, Attenuation and Scattering Tables (Web, free access)   This database collects tables and graphs of the form factors, the photoabsorption cross section, and the total attenuation coefficient for any element (Z <= 92).

  15. Factors Influencing Students' Achievement in Form 5 Islamic Studies Subject

    ERIC Educational Resources Information Center

    bin Che Noh, Mohd Aderi; Omar, Noraini binti; bin Kasan, Hasnan

    2013-01-01

    This study is aimed at analyzing the factors influencing the achievements of students in the subject of Islamic Studies for Form 5 SPM (KBSM) in schools in the area of Samarahan, Sarawak. The factors analysed is attitude and interest. This is a survey based study and data was compiled from the survey forms which had the topic "Factors…

  16. Orthopositronium decay form factors and two-photon correlations

    SciTech Connect

    Adkins, Gregory S.; Droz, Daniel R.; Rastawicki, Dominik; Fell, Richard N.

    2010-04-15

    We give results for the orthopositronium decay form factors through one-loop order. We use the form factors to calculate momentum correlations of the final-state photons and , including one-loop corrections, for ensembles of initial orthopositronium atoms having arbitrary polarization.

  17. Nucleon Form Factors experiments with 12 GeV CEBAF

    SciTech Connect

    Wojtsekhowski, B.

    2008-10-13

    A number of precision form factor experiments at high momentum transfer will be performed with the 11 GeV electron beam of CEBAF. We review the approved proposals and the conceptual schemes of several new suggestions. Form factor data will serve as a major input for the construction of a tomographic image of the nucleon.

  18. Form factors in SU(3)-invariant integrable models

    NASA Astrophysics Data System (ADS)

    Belliard, S.; Pakuliak, S.; Ragoucy, E.; Slavnov, N. A.

    2013-04-01

    We study SU(3)-invariant integrable models solvable by a nested algebraic Bethe ansatz. We obtain determinant representations for form factors of diagonal entries of the monodromy matrix. This representation can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  19. Relativistic quark model for the Omega- electromagnetic form factors

    SciTech Connect

    G. Ramalho, K. Tsushima, Franz Gross

    2009-08-01

    We compute the Omega- electromagnetic form factors and the decuplet baryon magnetic moments using a quark model application of the Covariant Spectator Theory. Our predictions for the Omega- electromagnetic form factors can be tested in the future by lattice QCD simulations at the physical strange quark mass.

  20. The energy spectra of solar energetic protons in the large energy range: their functional form and parameters.

    NASA Astrophysics Data System (ADS)

    Nymmik, Rikho; Pervaia, Taisia

    2016-07-01

    Experimental data on the fluxes of protons of solar energetic particles (SEP) are analyzed. It is known that above energies of 2-45 MeV (averaging 27-30 MeV), the proton spectra are a power-law function of the energy (at relativistic energies - from the momentum) of the particles. At lower energies, the spectra become harder, with the high-energy part of the spectra forming the "knee". This report is devoted to the determination of the parameters of the SEP spectra, having the form of a "double power-law shape", to ascertain the reliability of the parameters of the approximations of the experimental data.

  1. In-flight calibration of NOAA POES proton detectors—Derivation of the MEPED correction factors

    NASA Astrophysics Data System (ADS)

    Sandanger, Marit Irene; Ødegaard, Linn-Kristine Glesnes; Nesse Tyssøy, Hilde; Stadsnes, Johan; Søraas, Finn; Oksavik, Kjellmar; Aarsnes, Kjell

    2015-11-01

    The MEPED instruments on board the NOAA POES and MetOp satellites have been continuously measuring energetic particles in the magnetosphere since 1978. However, degradation of the proton detectors over time leads to an increase in the energy thresholds of the instrument and imposes great challenges to studies of long-term variability in the near-Earth space environment as well as a general quantification of the proton fluxes. By comparing monthly mean accumulated integral flux from a new and an old satellite at the same magnetic local time (MLT) and time period, we estimate the change in energy thresholds. The first 12 monthly energy spectra of the new satellite are used as a reference, and the derived monthly correction factors over a year for an old satellite show a small spread, indicating a robust calibration procedure. The method enables us to determine for the first time the correction factors also for the highest-energy channels of the proton detector. In addition, we make use of the newest satellite in orbit (MetOp-01) to find correction factors for 2013 for the NOAA 17 and MetOp-02 satellites. Without taking into account the level of degradation, the proton data from one satellite cannot be used quantitatively for more than 2 to 3 years after launch. As the electron detectors are vulnerable to contamination from energetic protons, the corrected proton measurements will be of value for electron flux measurements too. Thus, the correction factors ensure the correctness of both the proton and electron measurements.

  2. Proton beam shaped by "particle lens" formed by laser-driven hot electrons

    NASA Astrophysics Data System (ADS)

    Zhai, S. H.; Shen, B. F.; Wang, W. P.; Zhang, H.; He, S. K.; Lu, F.; Zhang, F. Q.; Deng, Z. G.; Dong, K. G.; Wang, S. Y.; Zhou, K. N.; Xie, N.; Wang, X. D.; Zhang, L. G.; Huang, S.; Liu, H. J.; Zhao, Z. Q.; Gu, Y. Q.; Zhang, B. H.; Xu, Z. Z.

    2016-05-01

    Two-dimensional tailoring of a proton beam is realized by a "particle lens" in our experiment. A large quantity of electrons, generated by an intense femtosecond laser irradiating a polymer target, produces an electric field strong enough to change the trajectory and distribution of energetic protons flying through the electron area. The experiment shows that a strip pattern of the proton beam appears when hot electrons initially converge inside the plastic plate. Then the shape of the proton beam changes to a "fountain-like" pattern when these hot electrons diffuse after propagating a distance.

  3. Relationship Domain of Form Six Teachers Thinking in Teaching with External Factors of Form Six Teachers

    ERIC Educational Resources Information Center

    bin Pet, Mokhtar; Sihes, Ahmad Johari Hj

    2015-01-01

    This study aims to examine the external factors of form six teachers who can influence thinking domain form six teachers in their teaching. This study was conducted using a quantitative approach using questionnaires. A total of 300 form six teacher schools in Johor were chosen as respondents. The findings were obtained as student background…

  4. Low-energy expansion of meson form factors

    NASA Astrophysics Data System (ADS)

    Gasser, J.; Leutwyler, H.

    We calculate the corrections to various low-energy theorems concerning the behaviour of the pseudoscalar meson form factors near t=0. In particular we discuss (i) the Ademollo-Gatto theorem, (ii) Sirlin's relation between the Kl3 form factor ƒ +Kπ (t) and the electromagnetic form factors, (iii) the Callan-Treiman relation, and (iv) the Dashen-Weinstein relation, which connects the slope λ0 of ƒ 0Kπ (t) with the ratio FK/ Fπ. Furthermore, we point out a remarkable isospin breaking effect which is clearly visible in the experimental rates of the decays K +→ π0e +ν, K 0→ π-e +ν.

  5. Roaming form factors for the tricritical to critical Ising flow

    NASA Astrophysics Data System (ADS)

    Horváth, D. X.; Dorey, P. E.; Takács, G.

    2016-07-01

    We study the massless flows described by the staircase model introduced by Al.B. Zamolodchikov through the analytic continuation of the sinh-Gordon S-matrix, focusing on the renormalisation group flow from the tricritical to the critical Ising model. We show that the properly defined roaming limits of certain sinh-Gordon form factors are identical to the form factors of the order and disorder operators for the massless flow. As a by-product, we also construct form factors for a semi-local field in the sinh-Gordon model, which can be associated with the twist field in the ultraviolet limiting free massless bosonic theory.

  6. Longitudinal vector form factors in weak decays of nuclei

    SciTech Connect

    Šimkovic, F.; Kovalenko, S.; Krivoruchenko, M. I.

    2015-10-28

    The longitudinal form factors of the weak vector current of particles with spin J = 1/2 and isospin I = 1/2 are determined by the mass difference and the charge radii of members of the isotopic doublets. The most promising reactions to measure these form factors are the reactions with large momentum transfers involving the spin-1/2 isotopic doublets with a maximum mass splitting. Numerical estimates of longitudinal form factors are given for nucleons and eight nuclear spin-1/2 isotopic doublets.

  7. Normalization Of Thermal-Radiation Form-Factor Matrix

    NASA Technical Reports Server (NTRS)

    Tsuyuki, Glenn T.

    1994-01-01

    Report describes algorithm that adjusts form-factor matrix in TRASYS computer program, which calculates intraspacecraft radiative interchange among various surfaces and environmental heat loading from sources such as sun.

  8. Hadronic Form Factors in Asymptotically Free Field Theories

    DOE R&D Accomplishments Database

    Gross, D. J.; Treiman, S. B.

    1974-01-01

    The breakdown of Bjorken scaling in asymptotically free gauge theories of the strong interactions is explored for its implications on the large q{sup 2} behavior of nucleon form factors. Duality arguments of Bloom and Gilman suggest a connection between the form factors and the threshold properties of the deep inelastic structure functions. The latter are addressed directly in an analysis of asymptotically free theories; and through the duality connection we are then led to statements about the form factors. For very large q{sup 2} the form factors are predicted to fall faster than any inverse power of q{sup 2}. For the more modest range of q{sup 2} reached in existing experiments the agreement with data is fairly good, though this may well be fortuitous. Extrapolations beyond this range are presented.

  9. Exploring strange nucleon form factors on the lattice

    NASA Astrophysics Data System (ADS)

    Babich, Ronald; Brower, Richard C.; Clark, Michael A.; Fleming, George T.; Osborn, James C.; Rebbi, Claudio; Schaich, David

    2012-03-01

    We discuss techniques for evaluating sea quark contributions to hadronic form factors on the lattice and apply these to an exploratory calculation of the strange electromagnetic, axial, and scalar form factors of the nucleon. We employ the Wilson gauge and fermion actions on an anisotropic 243×64 lattice, probing a range of momentum transfer with Q2<1GeV2. The strange electric and magnetic form factors, GEs(Q2) and GMs(Q2), are found to be small and consistent with zero within the statistics of our calculation. The lattice data favor a small negative value for the strange axial form factor GAs(Q2) and exhibit a strong signal for the bare strange scalar matrix element ⟨N|s¯s|N⟩0. We discuss the unique systematic uncertainties affecting the latter quantity relative to the continuum, as well as prospects for improving future determinations with Wilson-like fermions.

  10. Personality Research Form: Factor Structure and Response Style Involvement

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    1974-01-01

    Explores factor structure of the Personality Research Form (PRF) and examines the inventory's relations with response styles. In general, the PRF content scales correlate moderately with each other and with measures of acquiescence, social desirability, and defensiveness response biases. (Author)

  11. From quarks and gluons to baryon form factors

    PubMed Central

    Eichmann, Gernot

    2012-01-01

    I briefly summarize recent results for nucleon and Δ(1232) electromagnetic, axial and transition form factors in the Dyson–Schwinger approach. The calculation of the current diagrams from the quark–gluon level enables a transparent discussion of common features such as: the implications of dynamical chiral symmetry breaking and quark orbital angular momentum, the timelike structure of the form factors, and their interpretation in terms of missing pion-cloud effects. PMID:26766879

  12. Vector Meson Form Factors and Wave Functions from Holographic QCD

    SciTech Connect

    Hovhannes Grigoryan; Anatoly Radyushkin

    2007-10-10

    Based on the holographic dual model of QCD, we study 2- and 3-point functions of vector currents and derive form factors as well as wave functions for the vector mesons. As a result, generalized vector-meson dominance representation for form factors is obtained with a very specific VMD pattern. The calculated electric radius of the rho-meson is shown to be in a good agreement with predictions from lattice QCD.

  13. Deuteron form factor measurements at low momentum transfers

    NASA Astrophysics Data System (ADS)

    Schlimme, B. S.; Achenbach, P.; Beričič, J.; Böhm, R.; Bosnar, D.; Correa, L.; Distler, M. O.; Esser, A.; Fonvieille, H.; Friščić, I.; Griffioen, K. A.; Huan, Y.; Kegel, S.; Kohl, Y.; Merkel, H.; Mihovilovič, M.; Müller, J.; Müller, U.; Pochodzalla, J.; Schoth, M.; Schulz, F.; Sfienti, C.; Širca, S.; Štajner, S.; Thiel, M.; Weber, A.

    2016-03-01

    A precise measurement of the elastic electron-deuteron scattering cross section at four-momentum transfers of 0.24 fm-1 ≤ Q ≤ 2.7 fm-1 has been performed at the Mainz Microtron. In this paper we describe the utilized experimental setup and the necessary analysis procedure to precisely determine the deuteron charge form factor from these data. Finally, the deuteron charge radius rd can be extracted from an extrapolation of that form factor to Q2 = 0.

  14. On Gravitational Form Factors and Transverse Spin Sum Rule

    NASA Astrophysics Data System (ADS)

    Chakrabarti, D.; Mondal, C.; Mukherjee, A.

    2016-06-01

    Using the light front wave functions of the scalar quark-diquark model for nucleon predicted by the soft-wall AdS/QCD, we calculate the flavor dependent gravitational form factors. We evaluate the matrix element of Pauli-Lubanski operator in this model and show that the intrinsic spin sum rule involves the higher twist form factor {bar{C}}. The longitudinal momentum densities in the transverse impact parameter space are also discussed for both unpolarized and transversely polarized nucleons.

  15. Breather boundary form factors in sine-Gordon theory

    NASA Astrophysics Data System (ADS)

    Lencsés, M.; Takács, G.

    2011-11-01

    A previously conjectured set of exact form factors of boundary exponential operators in the sinh-Gordon model is tested against numerical results from boundary truncated conformal space approach in boundary sine-Gordon theory, related by analytic continuation to sinh-Gordon model. We find that the numerical data strongly support the validity of the form factors themselves; however, we also report a discrepancy in the case of diagonal matrix elements, which remains unresolved for the time being.

  16. In-medium modified energy-momentum tensor form factors

    NASA Astrophysics Data System (ADS)

    Jung, Ju-Hyun; Yakhshiev, Ulugbek; Kim, Hyun-Chul

    2014-04-01

    In this talk, we report a recent investigation on the energy-momentum tensor form factors of the nucleon in nuclear medium, based on the framework of the in-medium modified chiral soliton model. The model was constructed by taking into account the influence of the surrounding environment to the mesonic sector (π-, ρ- and ω-meson properties). We briefly discuss the results of the energy-momentum tensor form factors.

  17. Charm and bottom hadronic form factors with QCD sum rules

    SciTech Connect

    Bracco, M. E.; Rodrigues, B. O.; Cerqueira, A. Jr.

    2013-03-25

    We present a brief review of some calculations of form factors and coupling constants in vertices with charm and bottom mesons in the framework of QCD sum rules. We first discuss the motivation for this work, describing possible applications of these form factors to charm and bottom decays processes. We first make a summarize of the QCD sum rules method. We give special attention to the uncertainties of the method introducing by the intrinsic variation of the parameters. Finally we conclude.

  18. Online Soil Science Lesson 3: Soil Forming Factors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This lesson explores the five major factors of soil formation, namely: 1) climate; 2) organisms; 3) time; 4) topography; and 5) parent material and their influence in forming soil. The distinction between active and passive factors, moisture and temperature regimes, organism and topographic influen...

  19. The roles of STOP1-like transcription factors in aluminum and proton tolerance.

    PubMed

    Fan, Wei; Lou, He Qiang; Yang, Jian Li; Zheng, Shao Jian

    2016-02-01

    Aluminum (Al) and proton (H(+)) are 2 coexisting rhizotoxicities limiting plant growth in acid soils. Sensitive to Proton Rhizotoxicity (STOP) 1-like zinc finger transcription factors play important roles in regulating expression of downstream genes involved in tolerance mechanism of either stress. In this mini-review, we summarized recent advances in characterizing STOP1-like proteins with respect to plant Al and H(+) tolerance. The possible involvement of structure-function of STOP1-like proteins in differential regulation of Al and H(+) tolerance are discussed. In addition, we also direct research in this area to protein phosphorylation. PMID:26689896

  20. The roles of STOP1-like transcription factors in aluminum and proton tolerance

    PubMed Central

    Fan, Wei; Lou, He Qiang; Yang, Jian Li; Zheng, Shao Jian

    2016-01-01

    ABSTRACT Aluminum (Al) and proton (H+) are 2 coexisting rhizotoxicities limiting plant growth in acid soils. Sensitive to Proton Rhizotoxicity (STOP) 1-like zinc finger transcription factors play important roles in regulating expression of downstream genes involved in tolerance mechanism of either stress. In this mini-review, we summarized recent advances in characterizing STOP1-like proteins with respect to plant Al and H+ tolerance. The possible involvement of structure-function of STOP1-like proteins in differential regulation of Al and H+ tolerance are discussed. In addition, we also direct research in this area to protein phosphorylation. PMID:26689896

  1. Electroweak single pion production and form factors of the Δ(1232) resonance

    NASA Astrophysics Data System (ADS)

    Żmuda, Jakub; Graczyk, Krzysztof M.

    2015-10-01

    We extend and review our analysis of the nucleon → Δ(1232) transition electroweak form factors from Ref. [1]. New fit of the Δ(1232) vector form factors to electron-proton scattering F2 structure function is introduced as well, leading to results different from the popular parametrization of Ref. [2]. A clear model dependence of the extracted parameters emerges. Fit to neutrino scattering data is performed in all available isospin channels. The resulting axial mass is MA Δ=0.85-0.08+0.09(GeV) and C5A(0 )=1.10-0.14+0.15 . The latter value is in accordance with Goldberger-Treiman relation as long as the deuteron effects are included.

  2. High-precision calculation of the strange nucleon electromagnetic form factors

    SciTech Connect

    Green, Jeremy; Meinel, Stefan; Engelhardt, Michael G.; Krieg, Stefan; Laeuchli, Jesse; Negele, John W.; Orginos, Kostas; Pochinsky, Andrew; Syritsyn, Sergey

    2015-08-26

    We report a direct lattice QCD calculation of the strange nucleon electromagnetic form factors GsE and GsM in the kinematic range 0 ≤ Q2 ≤ 1.2GeV2. For the first time, both GsE and GsM are shown to be nonzero with high significance. This work uses closer-to-physical lattice parameters than previous calculations, and achieves an unprecented statistical precision by implementing a recently proposed variance reduction technique called hierarchical probing. We perform model-independent fits of the form factor shapes using the z-expansion and determine the strange electric and magnetic radii and magnetic moment. As a result, we compare our results to parity-violating electron-proton scattering data and to other theoretical studies.

  3. Electromagnetic structure of the proton within the CP-violation hypothesis

    SciTech Connect

    Krutov, A. F. Kudinov, M. Yu.

    2013-11-15

    The so-called non-Rosenbluth behavior of the proton electromagnetic form factors can be explained within the hypothesis of CP violation in electromagnetic processes involving composite systems of strongly interacting particles. It is shown that this hypothesis leads to the appearance of an additional, anapole, form factor of the proton. The proton electromagnetic form factors, including the anapole form factor, are estimated on the basis of experimental data on elastic electron-proton scattering.

  4. Nickel phlorin intermediate formed by proton-coupled electron transfer in hydrogen evolution mechanism

    PubMed Central

    Solis, Brian H.; Maher, Andrew G.; Dogutan, Dilek K.; Nocera, Daniel G.; Hammes-Schiffer, Sharon

    2016-01-01

    The development of more effective energy conversion processes is critical for global energy sustainability. The design of molecular electrocatalysts for the hydrogen evolution reaction is an important component of these efforts. Proton-coupled electron transfer (PCET) reactions, in which electron transfer is coupled to proton transfer, play an important role in these processes and can be enhanced by incorporating proton relays into the molecular electrocatalysts. Herein nickel porphyrin electrocatalysts with and without an internal proton relay are investigated to elucidate the hydrogen evolution mechanisms and thereby enable the design of more effective catalysts. Density functional theory calculations indicate that electrochemical reduction leads to dearomatization of the porphyrin conjugated system, thereby favoring protonation at the meso carbon of the porphyrin ring to produce a phlorin intermediate. A key step in the proposed mechanisms is a thermodynamically favorable PCET reaction composed of intramolecular electron transfer from the nickel to the porphyrin and proton transfer from a carboxylic acid hanging group or an external acid to the meso carbon of the porphyrin. The C–H bond of the active phlorin acts similarly to the more traditional metal-hydride by reacting with acid to produce H2. Support for the theoretically predicted mechanism is provided by the agreement between simulated and experimental cyclic voltammograms in weak and strong acid and by the detection of a phlorin intermediate through spectroelectrochemical measurements. These results suggest that phlorin species have the potential to perform unique chemistry that could prove useful in designing more effective electrocatalysts. PMID:26655344

  5. Nucleon to delta electromagnetic transition form factors in lattice QCD

    SciTech Connect

    Alexandrou, C.; Koutsou, G.; Neff, H.; Negele, J. W.; Schroers, W.; Tsapalis, A.

    2008-04-15

    The electromagnetic nucleon to {delta} transition form factors are evaluated using two degenerate flavors of dynamical Wilson fermions and using dynamical sea staggered fermions with domain-wall valence quarks. The two subdominant quadrupole form factors are evaluated for the first time in full QCD to sufficient accuracy to exclude a zero value, which is taken as a signal for deformation in the nucleon-{delta} system. For the Coulomb quadrupole form factor the unquenched results begin to deviate from the quenched results at low q{sup 2} indicating that dynamical lattice results are closer to experiment. This can be taken as a first confirmation of the expected importance of pion cloud contributions on this quantity.

  6. Measurements of the Helium Form Factors at JLab

    SciTech Connect

    Khrosinkova, Elena

    2007-10-26

    An experiment to measure elastic electron scattering off {sup 3}He and {sup 4}He at large momentum transfers is presented. The experiment was carried out in the Hall A Facility of Jefferson Lab. Elastic electron scattering off {sup 3}He was measured at forward and backward electron scattering angles to extract the isotope's charge and magnetic form factors. The charge form factor of {sup 4}He will be extracted from forward-angle electron scattering angle measurements. The data are expected to significantly extend and improve the existing measurements of the three- and four-body form factors. The results will be crucial for the establishment of a canonical standard model for the few-body nuclear systems and for testing predictions of quark dimensional scaling and hybrid nucleon-quark models.

  7. Master integrals for the four-loop Sudakov form factor

    NASA Astrophysics Data System (ADS)

    Boels, Rutger H.; Kniehl, Bernd A.; Yang, Gang

    2016-01-01

    The light-like cusp anomalous dimension is a universal function in the analysis of infrared divergences. In maximally (N = 4) supersymmetric Yang-Mills theory (SYM) in the planar limit, it is known, in principle, to all loop orders. The non-planar corrections are not known in any theory, with the first appearing at the four-loop order. The simplest quantity which contains this correction is the four-loop two-point form factor of the stress tensor multiplet. This form factor was largely obtained in integrand form in a previous work for N = 4 SYM, up to a free parameter. In this work, a reduction of the appearing integrals obtained by solving integration-by-parts (IBP) identities using a modified version of Reduze is reported. The form factor is shown to be independent of the remaining parameter at integrand level due to an intricate pattern of cancellations after IBP reduction. Moreover, two of the integral topologies vanish after reduction. The appearing master integrals are cross-checked using independent algebraic-geometry techniques explored in the Mint package. The latter results provide the basis of master integrals applicable to generic form factors, including those in Quantum Chromodynamics. Discrepancies between explicitly solving the IBP relations and the MINT approach are highlighted. Remaining bottlenecks to completing the computation of the four-loop non-planar cusp anomalous dimension in N = 4 SYM and beyond are identified.

  8. Electromagnetic form factors of the Δ with D-waves

    SciTech Connect

    Ramalho, Gilberto T.F.; Pena, Maria Teresa; Gross, Franz L.

    2010-06-01

    The electromagnetic form factors of the Δ baryon are evaluated within the framework of a covariant spectator quark model, where S and D-states are included in the Δ wave function. We predict all the four Δ multipole form factors: the electric charge GE0, the magnetic dipole GM1, the electric quadrupole GE2 and the magnetic octupole GM3. We compare our predictions with other theoretical calculations. Our results are compatible with the available experimental data and recent lattice QCD data.

  9. The B → K* form factors on the lattice

    NASA Astrophysics Data System (ADS)

    Agadjanov, Andria; Bernard, Véronique; Meißner, Ulf-G.; Rusetsky, Akaki

    2016-09-01

    The extraction of the B →K* transition form factors from lattice data is studied, applying non-relativistic effective field theory in a finite volume. The possible mixing of πK and ηK states is taken into account. The two-channel analogue of the Lellouch-Lüscher formula is reproduced. Due to the resonance nature of the K*, an equation is derived, which allows to determine the form factors at the pole position in a process-independent manner. The infinitely-narrow width approximation of the results is discussed.

  10. Form factor of pNIPAM microgels in overpacked states

    SciTech Connect

    Gasser, U.; Hyatt, J. S.; Lietor-Santos, J.-J.; Fernandez-Nieves, A.; Herman, E. S.; Lyon, L. A.

    2014-07-21

    We study the form factor of thermoresponsive microgels based on poly(N-isopropylacrylamide) at high generalized volume fractions, ζ, where the particles must shrink or interpenetrate to fit into the available space. Small-angle neutron scattering with contrast matching techniques is used to determine the particle form factor. We find that the particle size is constant up to a volume fraction roughly between random close packing and space filling. Beyond this point, the particle size decreases with increasing particle concentration; this decrease is found to occur with little interpenetration. Noteworthily, the suspensions remain liquid-like for ζ larger than 1, emphasizing the importance of particle softness in determining suspension behavior.

  11. Pion electromagnetic form factor in the Covariant Spectator Theory

    SciTech Connect

    Biernat, Elmar P.; Gross, Franz L.; Pena, Teresa; Stadler, Alfred

    2014-01-01

    The pion electromagnetic form factor at spacelike momentum transfer is calculated in relativistic impulse approximation using the Covariant Spectator Theory. The same dressed quark mass function and the equation for the pion bound-state vertex function as discussed in the companion paper are used for the calculation, together with a dressed quark current that satisfies the Ward-Takahashi identity. The results obtained for the pion form factor are in agreement with experimental data, they exhibit the typical monopole behavior at high momentum transfer and they satisfy some remarkable scaling relations.

  12. Pseudo-scalar form factors at three loops in QCD

    NASA Astrophysics Data System (ADS)

    Ahmed, Taushif; Gehrmann, Thomas; Mathews, Prakash; Rana, Narayan; Ravindran, V.

    2015-11-01

    The coupling of a pseudo-scalar Higgs boson to gluons is mediated through a heavy quark loop. In the limit of large quark mass, it is described by an effective Lagrangian that only admits light degrees of freedom. In this effective theory, we compute the three-loop massless QCD corrections to the form factor that describes the coupling of a pseudo-scalar Higgs boson to gluons. Due to the axial anomaly, the pseudo-scalar operator for the gluonic field strength mixes with the divergence of the axial vector current. Working in dimensional regularization and using the 't Hooft-Veltman prescription for the axial vector current, we compute the three-loop pseudo-scalar form factors for massless quarks and gluons. Using the universal infrared factorization properties, we independently derive the three-loop operator mixing and finite operator renormalisation from the renormalisation group equation for the form factors, thereby confirming recent results in the operator product expansion. The finite part of the three-loop form factor is an important ingredient to the precise prediction of the pseudo-scalar Higgs boson production cross section at hadron colliders. We discuss potential applications and derive the hard matching coefficient in soft-collinear effective theory.

  13. Pion Electromagnetic Form Factor in Virtuality Distribution Formalism

    SciTech Connect

    Radyushkin, Anatoly V.

    2016-01-01

    We discuss two applications of the {\\it Virtuality Distribution Amplitudes} (VDA) formalism developed in our recent papers. We start with an overview of the main properties of the pion distribution amplitude emphasizing the quantitative measures of its width, and possibility to access them through the pion transition form factor studies. We formulate the basic concepts of the VDA approach and introduce the pion {\\it transverse momentum distribution amplitude} (TMDA) which plays, in a covariant Lagrangian formulation, a role similar to that of the pion wave function in the 3-dimensional Hamiltonian light-front approach. We propose simple factorized models for soft TMDAs, and use them to describe existing data on the pion transition form factor, thus fixing the scale determining the size of the transverse-momentum effects. Finally, we apply the VDA approach to the one-gluon exchange contribution for the pion electromagnetic form factor. We observe a very late $Q^2 \\gtrsim 20$ GeV$^2$ onset of transition to the asymptotic pQCD predictions and show that in the $Q^2 \\lesssim 10$ GeV$^2$ region there is essentially no sensitivity to the shape of the pion distribution amplitude. Furthermore, the magnitude of the one-gluon exchange contribution in this region is estimated to be an order of magnitude below the Jefferson Lab data, thus leaving the Feynman mechanism as the only one relevant to the pion electromagnetic form factor behavior for accessible $Q^2$.

  14. Ab initio study of the molecular structure and vibrational spectrum of nitric acid and its protonated forms

    NASA Technical Reports Server (NTRS)

    Lee, Timothy J.; Rice, Julia E.

    1992-01-01

    The equilibrium structures, harmonic vibrational frequencies, IR intensities, and relative energetics of HNO3 and its protonated form H2NO3+ were investigated using double-zeta plus polarization and triple-zeta plus polarization basis sets in conjunction with high-level ab initio methods. The latter include second-order Moller-Plesset perturbation theory, the single and double excitation coupled cluster (CCSD) methods, a perturbational estimate of the effects of connected triple excitations (CCSD(T)), and the self-consistent field. To determine accurate energy differences CCSD(T) energies were computed using large atomic natural orbital basis sets. Four different isomers of H2NO3+ were considered. The lowest energy form of protonated nitric acid was found to correspond to a complex between H2O and NO2+, which is consistent with earlier theoretical and experimental studies.

  15. Dirac and Pauli form factors based on consideration of the gluon effect in light-cone wave functions

    NASA Astrophysics Data System (ADS)

    Shojaei, Mohammad Reza; Nikkhoo, Negin Sattary

    2015-11-01

    We discuss Dirac and Pauli form factors based on a generalized parton distribution framework in the range of high momentum transfers of t < 30 GeV2 and calculate the electromagnetic form factors, GE and GM, for the proton. In previous work, Gaussian parameterization has been used in wave functions for calculating electromagnetic form factors at intermediate-high momentum transfers of 1 GeV2 < t < 10 GeV2; in this paper, by considering an improved Gaussian ansatz, we not only calculate the electromagnetic form factors at moderately high momentum transfers t but also can calculate these quantities at high momentum transfers, achieving reasonable agreement with experimental data and other previous work.

  16. SU-E-T-577: Obliquity Factor and Surface Dose in Proton Beam Therapy

    SciTech Connect

    Das, I; Andersen, A; Coutinho, L

    2015-06-15

    Purpose: The advantage of lower skin dose in proton beam may be diminished creating radiation related sequalae usually seen with photon and electron beams. This study evaluates the surface dose as a complex function of beam parameters but more importantly the effect of beam angle. Methods: Surface dose in proton beam depends on the beam energy, source to surface distance, the air gap between snout and surface, field size, material thickness in front of surface, atomic number of the medium, beam angle and type of nozzle (ie double scattering, (DS), uniform scanning (US) or pencil beam scanning (PBS). Obliquity factor (OF) is defined as ratio of surface dose in 0° to beam angle Θ. Measurements were made in water phantom at various beam angles using very small microdiamond that has shown favorable beam characteristics for high, medium and low proton energy. Depth dose measurements were performed in the central axis of the beam in each respective gantry angle. Results: It is observed that surface dose is energy dependent but more predominantly on the SOBP. It is found that as SSD increases, surface dose decreases. In general, SSD, and air gap has limited impact in clinical proton range. High energy has higher surface dose and so the beam angle. The OF rises with beam angle. Compared to OF of 1.0 at 0° beam angle, the value is 1.5, 1.6, 1,7 for small, medium and large range respectively for 60 degree angle. Conclusion: It is advised that just like range and SOBP, surface dose should be clearly understood and a method to reduce the surface dose should be employed. Obliquity factor is a critical parameter that should be accounted in proton beam therapy and a perpendicular beam should be used to reduce surface dose.

  17. The Super Bigbite Project: A Study of Nucleon Form Factors

    SciTech Connect

    Jager, Kees de

    2010-06-01

    A proposed set of instrumentation, collectively referred to as the Super Bigbite project, is presented. Used in three different con figurations it will allow measurements of three nucleon electromagnetic form factors GEn, GEp, and GMn with unprecedented precision to Q2-values up to three times higher than existing data.

  18. Delta-Isobar magnetic form factor in QCD

    SciTech Connect

    Belyaev, Vladimir

    1993-01-01

    We consider the QCD sum rules approach for Delta-isobar magnetic form factor in the infra-red region $0

  19. Measurement of the pion form factor at higher energies

    SciTech Connect

    Mack, D.J.

    1994-04-01

    One of the strongest arguments for increasing the nominal CEBAF beam energy to equal or exceed 6 GeV is that one would be able to make quality high Q{sup 2} measurements of the charged pion form factor.

  20. JLAB Measurements of the Deuteron Electric and Magnetic Form Factors

    SciTech Connect

    Gerassimos G. Petratos

    2000-12-12

    Large-momentum transfer JLab measurements of the deuteron electric and magnetic form factors are reported. The data are compared to theoretical models based on the relativistic impulse approximation with the inclusion of meson-exchange currents, and to predictions of quark-dimensional scaling and perturbative QCD.

  1. Personality Research Form: Factor Structure and Response Style Involvement.

    ERIC Educational Resources Information Center

    Stricker, Lawrence J.

    The aims of this study were (1) to explore the factor structure of the Personality Research Form (PRF) and (2) to examine the inventory's relations with response styles. In general the PRF content scales correlated moderately with each other and with measures of acquiesence, social desirability, and defensiveness response Biases. Six oblique…

  2. Nucleon form factors program with SBS at JLAB

    SciTech Connect

    Wojtsekhowski, Bogdan B.

    2014-12-01

    The physics of the nucleon form factors is the basic part of the Jefferson Laboratory program. We review the achievements of the 6-GeV era and the program with the 12- GeV beam with the SBS spectrometer in Hall A, with a focus on the nucleon ground state properties.

  3. The Modern description of semileptonic meson form factors

    SciTech Connect

    Hill, Richard J.

    2006-06-01

    I describe recent advances in our understanding of the hadronic form factors governing semileptonic meson transitions. The resulting framework provides a systematic approach to the experimental data, as a means of extracting precision observables, testing nonperturbative field theory methods, and probing a poorly understood limit of QCD.

  4. Factor Content of the Hill Interaction Matrix--Form B

    ERIC Educational Resources Information Center

    Drummond, Robert J.; McIntire, Walter G.

    1976-01-01

    Investigates the construct validity of the Hill Interaction Matrix--Form B, a 64-item instrument designed to assess preferred modes of interaction in group settings. A factor analysis was performed by using 134 subjects. Results indicate that the items and the conceptual format are appropriate. (Author)

  5. High Q{sup 2} behavior of the electromagnetic form factors in the relativistic hypercentral constituent quark model

    SciTech Connect

    Santopinto, E.; Vassallo, A.; Giannini, M. M.; De Sanctis, M.

    2010-12-15

    The ratio R{sub p} between the electric and magnetic proton form factors has been recently measured at Jefferson Lab up to Q{sup 2}=8.5 GeV{sup 2}. We have extended the calculation of the nucleon form factors with the hypercentral constituent quark model and compared them with the data on R{sub p} and on the Q{sup 2} behavior of the ratio Q{sup 2}F{sub 2}/F{sub 1}. In both cases, the theoretical curves agree with the experimental points.

  6. Study of structure-activity relationship of enantiomeric, protonated and deprotonated forms of warfarin via vibrational spectroscopy and DFT calculations

    NASA Astrophysics Data System (ADS)

    Mishra, Alok; Srivastava, Sunil Kumar; Swati, D.

    2013-09-01

    The structure-activity relationship of the anticoagulant drug warfarin were studied by studying two enantiomeric forms (S-form and R-form) of warfarin and its protonated as well as deprotonated structures in aqueous media using density functional theory (DFT). Theoretically computed Raman and IR spectra of all the computed structures were compared and their specific vibrational spectroscopic signatures were discussed. The percentage contributions of individual normal modes of warfarin, which provides direct evidence of the different molecular activity due to change in relative atomic position of atoms in molecule, were investigated through potential energy distribution (PED). The optimized energy and molecular electrostatic potential (MEP) maps show that the S-form of the drug molecules warfarin is energetically more stable than R-form and provides higher docking opportunity for the molecular binding with the receptors in the bio-systems.

  7. SU-E-T-595: Output Factor Calculation for a Uniform Scanning Proton Therapy System

    SciTech Connect

    Hecksel, D; Stauffer, N; DeFillippo, G; Edwards, J; Pankuch, M

    2015-06-15

    Purpose: To develop an analytical model that predicts dose output factors for patient treatment fields in a uniform scanning proton therapy system. Methods: A model to predict output factors for patient specific treatment fields was produced based on the methods developed by Kooy et al. (2003). The Kooy model predicts the output factor based on the ratio of the entrance dose under calibration conditions to that for a given range and modulation corrected for the inverse square effect. Field specific output factors were plotted as a function of a single parameter r, where r = (Range-Modulation)/Modulation. The model targeted user range 1 sub-span 3 through user range 2 sup-span 2 of the IBA uniform scanning proton therapy system. The data set included points measured using the 10 cm and 18 cm snout sizes to eliminate stem effects on the monitor unit chambers. The data was fit using equation 15 from Kooy et al. (2003), and the resulting model was tested against measurements that were not included in the original data set. Results: For the range and sub span investigated, 120 data points were tested against the model prediction. The model predicted the output factor within 2% for 96% of the points tested and within 2.5% for 99% of the points tested. All points were within 3% of the predicted values. Conclusion: Monitor units for patient treatment fields with proton ranges that fall within the tested interval can be predicted using a model based on the methods developed at MGH. With further evaluation, it will be possible to model all user ranges and sub-spans of the IBA system. Further testing is also needed to predict output factors using a 25 cm snout which introduces variable scanning pattern sizes and stem effects on the monitor unit chambers.

  8. Electromagnetic form factors and charge densities from hadrons to nuclei

    SciTech Connect

    Miller, Gerald A.

    2009-10-15

    A simple exact covariant model in which a scalar particle {psi} is modeled as a bound state of two different particles is used to elucidate relativistic aspects of electromagnetic form factors F(Q{sup 2}). The model form factor is computed using an exact covariant calculation of the lowest order triangle diagram. The light-front technique of integrating over the minus component of the virtual momentum gives the same result and is the same as the one obtained originally by Gunion et al. [Phys. Rev. D 8, 287 (1973)] by using time-ordered perturbation theory in the infinite-momentum frame. The meaning of the transverse density {rho}(b) is explained by providing a general derivation, using three spatial coordinates, of its relationship with the form factor. This allows us to identify a mean-square transverse size ={integral}d{sup 2}b b{sup 2}{rho}(b)=-4(dF/dQ{sup 2})(Q{sup 2}=0). The quantity is a true measure of hadronic size because of its direct relationship with the transverse density. We show that the rest-frame charge distribution is generally not observable by studying the explicit failure to uphold current conservation. Neutral systems of two charged constituents are shown to obey the conventional lore that the heavier one is generally closer to the transverse origin than the lighter one. It is argued that the negative central charge density of the neutron arises, in pion-cloud models, from pions of high longitudinal momentum that reside at the center. The nonrelativistic limit is defined precisely, and the ratio of the binding energy B to the mass M of the lightest constituent is shown to govern the influence of relativistic effects. It is shown that the exact relativistic formula for F(Q{sup 2}) is the same as the familiar one of the three-dimensional Fourier transform of a square of a wave function for very small values of B/M, but this only occurs for values of B/M less than about 0.001. For masses that mimic the quark-diquark model of

  9. Octet Baryon Electromagnetic Form Factors in a Relativistic Quark Model

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2011-09-01

    We study the octet baryon electromagnetic properties by applying the covariant spectator quark model, and provide covariant parametrization that can be used to study baryon electromagnetic reactions. While we use the lattice QCD data in the large pion mass regime (small pion cloud effects) to determine the parameters of the model in the valence quark sector, we use the nucleon physical and octet baryon magnetic moment data to parameterize the pion cloud contributions. The valence quark contributions for the octet baryon electromagnetic form factors are estimated by extrapolating the lattice parametrization in the large pion mass regime to the physical regime. As for the pion cloud contributions, we parameterize them in a covariant, phenomenological manner, combined with SU(3) symmetry. We also discuss the impact of the pion cloud effects on the octet baryon electromagnetic form factors and their radii.

  10. Dirac and Pauli form factors from lattice QCD

    SciTech Connect

    Collins, S.; Goeckeler, M.; Nobile, A.; Schaefer, A.; Haegler, Ph.; Horsley, R.; Winter, F.; Zanotti, J. M.; Nakamura, Y.; Pleiter, D.; Rakow, P. E. L.; Schierholz, G.; Schroers, W.; Stueben, H.

    2011-10-01

    We present a comprehensive analysis of the electromagnetic form factors of the nucleon from a lattice simulation with two flavors of dynamical O(a)-improved Wilson fermions. A key feature of our calculation is that we make use of an extensive ensemble of lattice gauge field configurations with four different lattice spacings, multiple volumes, and pion masses down to m{sub {pi}{approx}1}80 MeV. We find that by employing Kelly-inspired parametrizations for the Q{sup 2} dependence of the form factors, we are able to obtain stable fits over our complete ensemble. Dirac and Pauli radii and the anomalous magnetic moments of the nucleon are extracted and results at light quark masses provide evidence for chiral nonanalytic behavior in these fundamental observables.

  11. Measurement of the gamma gamma* -> pi0 transition form factor

    SciTech Connect

    Aubert, B.

    2009-06-02

    We study the reaction e{sup +}e{sup -} {yields} e{sup +}e{sup -}{pi}{sup 0} in the single tag mode and measure the differential cross section d{sigma}/dQ{sup 2} and the {gamma}{gamma}* {yields} {pi}{sup 0} transition form factor in the mometum transfer range from 4 to 40 GeV{sup 2}. At Q{sup 2} > 10 GeV{sup 2} the measured form factor exceeds the asymptotic limit predicted by perturbative QCD. The analysis is based on 442 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  12. Bs→Kℓν form factors from lattice QCD

    NASA Astrophysics Data System (ADS)

    Bouchard, C. M.; Lepage, G. Peter; Monahan, Christopher; Na, Heechang; Shigemitsu, Junko

    2014-09-01

    We report the first lattice QCD calculation of the form factors for the standard model tree-level decay Bs→K ℓν. In combination with future measurement, this calculation will provide an alternative exclusive semileptonic determination of |Vub|. We compare our results with previous model calculations, make predictions for differential decay rates and branching fractions, and predict the ratio of differential branching fractions between Bs→Kτν and Bs→Kμν. We also present standard model predictions for differential decay rate forward-backward asymmetries and polarization fractions and calculate potentially useful ratios of Bs→K form factors with those of the fictitious Bs→ηs decay. Our lattice simulations utilize nonrelativistic QCD b and highly improved staggered light quarks on a subset of the MILC Collaboration 2+1 asqtad gauge configurations, including two lattice spacings and a range of light quark masses.

  13. Small form factor full parallax tiled light field display

    NASA Astrophysics Data System (ADS)

    Alpaslan, Zahir Y.; El-Ghoroury, Hussein S.

    2015-03-01

    With the recent introduction of Ostendo's Quantum Photonic Imager (QPI) display technology, a very small pixel pitch, emissive display with high brightness and low power consumption became available. We used QPI's to create a high performance light field display tiles with a very small form factor. Using 8 of these QPI light field displays tiled in a 4x2 array we created a tiled full parallax light field display. Each individual light field display tile combines custom designed micro lens array layers with monochrome green QPIs. Each of the light field display tiles can address 1000 x 800 pixels placed under an array of 20 x 16 lenslets with 500 μm diameters. The light field display tiles are placed with small gaps to create a tiled display of approximately 46 mm (W) x 17 mm (H) x 2 mm (D) in mechanical dimensions. The prototype tiled full parallax light field display demonstrates small form factor, high resolution and focus cues.

  14. Axial form factor of the nucleon at large momentum transfers

    NASA Astrophysics Data System (ADS)

    Anikin, I. V.; Braun, V. M.; Offen, N.

    2016-08-01

    Motivated by the emerging possibilities to study threshold pion electroproduction at large momentum transfers at Jefferson Laboratory following the 12 GeV upgrade, we provide a short theory summary and an estimate of the nucleon axial form factor for large virtualities in the Q2=1 - 10 GeV2 range using next-to-leading-order light-cone sum rules.

  15. Stackable Form-Factor Peripheral Component Interconnect Device and Assembly

    NASA Technical Reports Server (NTRS)

    Somervill, Kevin M. (Inventor); Ng, Tak-kwong (Inventor); Torres-Pomales, Wilfredo (Inventor); Malekpour, Mahyar R. (Inventor)

    2013-01-01

    A stackable form-factor Peripheral Component Interconnect (PCI) device can be configured as a host controller or a master/target for use on a PCI assembly. PCI device may comprise a multiple-input switch coupled to a PCI bus, a multiplexor coupled to the switch, and a reconfigurable device coupled to one of the switch and multiplexor. The PCI device is configured to support functionality from power-up, and either control function or add-in card function.

  16. Nonlocal form factors for curved-space antisymmetric fields

    NASA Astrophysics Data System (ADS)

    Netto, Tibério de Paula; Shapiro, Ilya L.

    2016-07-01

    In a recent paper, Buchbinder, Kirillova, and Pletnev presented formal arguments concerning the quantum equivalence of free massive antisymmetric tensor fields of the second and third rank to the free Proca theory and massive scalar field with minimal coupling to gravity, respectively. We confirm this result using explicit covariant calculations of nonlocal form factors based on the heart-kernel technique and discuss the discontinuity of quantum contributions in the massless limit.

  17. Two-photon exchange corrections to the pion form factor

    DOE PAGESBeta

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  18. The structure of light-front wavefunctions and constraints on hadronic form factors

    SciTech Connect

    S. J. Brodsky; J. R. Hiller; D. S. Hwang; V. A. Karmanov

    2003-11-17

    We study the analytic structure of light-front wave functions (LFWFs) and its consequences for hadron form factors using an explicitly Lorentz-invariant formulation of the front form. The normal to the light front is specified by a general null vector {omega}{sup {mu}}. The LFWFs with definite total angular momentum are eigenstates of a kinematic angular momentum operator and satisfy all Lorentz symmetries. They are analytic functions of the invariant mass squared of the constituents M{sub 0}{sup 2} = ({Sigma} k{sup {mu}}){sup 2} and the light-cone momentum fractions x{sub i} = k{sub i} {center_dot} {omega}/p {center_dot} {omega} multiplied by invariants constructed from the spin matrices, polarization vectors, and {omega}{sup {mu}}. These properties are illustrated using known nonperturbative eigensolutions of the Wick-Cutkosky model. We analyze the LFWFs introduced by Chung and Coester to describe static and low momentum properties of the nucleons. They correspond to the spin-locking of a quark with the spin of its parent nucleon, tog ether with a positive-energy projection constraint. These extra constraints lead to anomalous dependence of form factors on Q rather than Q{sup 2}. In contrast, the dependence of LFWFs on M{sub 0}{sup 2} implies that hadron form factors are analytic functions of Q{sup 2} in agreement with dispersion theory and perturbative QCD. We show that a model incorporating the leading-twist perturbative QCD prediction is consistent with recent data for the ratio of proton Pauli and Dirac form factors.

  19. Pion transverse charge density from timelike form factor data

    SciTech Connect

    Gerald Miller, Mark Strikman, Christian Weiss

    2011-01-01

    The transverse charge density in the pion can be represented as a dispersion integral of the imaginary part of the pion form factor in the timelike region. This formulation incorporates information from e+e- annihilation experiments and allows one to reconstruct the transverse density much more accurately than from the spacelike pion form factor data alone. We calculate the transverse density using an empirical parametrization of the timelike pion form factor and estimate that it is determined to an accuracy of ~10% at a distance b ~ 0.1 fm, and significantly better at larger distances. The density is found to be close to that obtained from a zero-width rho meson pole over a wide range and shows a pronounced rise at small distances. The resulting two-dimensional image of the fast-moving pion can be interpreted in terms of its partonic structure in QCD. We argue that the singular behavior of the charge density at the center requires a substantial presence of pointlike configurations in the pion's partonic wave function, which can be probed in other high-momentum transfer processes.

  20. Strange vector form factors from parity-violating electron scattering

    SciTech Connect

    Kent Paschke, Anthony Thomas, Robert Michaels, David Armstrong

    2011-06-01

    The simplest models might describe the nucleon as 3 light quarks, but this description would be incomplete without inclusion of the sea of glue and qbar q pairs which binds it. Early indications of a particularly large contribution from strange quarks in this sea to the spin and mass of the nucleon motivated an experimental program examining the role of these strange quarks in the nucleon vector form factors. The strangeness form factors can be extracted from the well-studied electromagnetic structure of the nucleon using parity-violation in electron-nuclear scattering to isolate the effect of the weak interaction. With high luminosity and polarization, and a very stable beam due to its superconducting RF cavities, CEBAF at Jefferson Lab is a precision instrument uniquely well suited to the challenge of measurements of the small parity-violating asymmetries. The techniques and results of the two major Jefferson Lab experimental efforts in parity-violation studies, HAPPEX and G0, as well as efforts to describe the strange form factors in QCD, will be reviewed.

  1. Meson Transition Form Factors in Light-Front Holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao, Fu-Guang; de Teramond, Guy F.; /Costa Rica U.

    2011-06-22

    We study the photon-to-meson transition form factors (TFFs) F{sub M{gamma}}(Q{sup 2}) for {gamma}{gamma}* {yields} M using light-front holographic methods. The Chern-Simons action, which is a natural form in 5-dimensional anti-de Sitter (AdS) space, leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the q{bar q} component of the pion wavefunction, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0} {yields} {gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the q{bar q} component of the pion wavefunction P{sub q{bar q}} = 0.5 is required; thus giving indication that the contributions from higher Fock states in the pion light-front wavefunction need to be included in the analysis. The probability for the Fock state containing four quarks (anti-quarks) which follows from analyzing the hadron matrix elements, P{sub q{bar q}q{bar q}} {approx} 10%, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wavefunction. The results for the TFFs for the {eta} and {eta}{prime} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{prime} TFFs.

  2. Kinetics and Mechanism of Deoxygenation Reactions over Proton-Form and Molybdenum-Modified Zeolite Catalysts

    NASA Astrophysics Data System (ADS)

    Bedard, Jeremy William

    The depletion of fossil fuel resources and the environmental consequences of their use have dictated the development of new sources of energy that are both sustainable and economical. Biomass has emerged as a renewable carbon feedstock that can be used to produce chemicals and fuels traditionally obtained from petroleum. The oxygen content of biomass prohibits its use without modification because oxygenated hydrocarbons are non-volatile and have lower energy content. Chemical processes that eliminate oxygen and keep the carbon backbone intact are required for the development of biomass as a viable chemical feedstock. This dissertation reports on the kinetic and mechanistic studies conducted on high and low temperature catalytic processes for deoxygenation of biomass precursors to produce high-value chemicals and fuels. Low temperature, steady state reaction studies of acetic acid and ethanol were used to identify co-adsorbed acetic acid/ethanol dimers as surface intermediates within specific elementary steps involved in the esterification of acetic acid with ethanol on zeolites. A reaction mechanism involving two dominating surface species, an inactive ethanol dimeric species adsorbed on Bronsted sites inhibiting ester formation and a co-adsorbed complex of acetic acid and ethanol on the active site reacting to produce ethyl acetate, is shown to describe the reaction rate as a function of temperature (323 -- 383 K), acetic acid (0.5 -- 6.0 kPa), and ethanol (5.0 -- 13.0 kPa) partial pressure on proton-form BEA, FER, MFI, and MOR zeolites. Measured differences in rates as a function of zeolite structure and the rigorous interpretation of these differences in terms of esterification rate and equilibrium constants is presented to show that the intrinsic rate constant for the activation of the co-adsorbed complex increases in the order FER < MOR < MFI < BEA. High temperature co-processing of acetic acid, formic acid, or carbon dioxide with methane (CH3COOH/CH4 = 0

  3. Neutron charge radius and the neutron electric form factor

    SciTech Connect

    Gentile, T. R.; Crawford, C. B.

    2011-05-15

    For nearly forty years, the Galster parametrization has been employed to fit existing data for the neutron electric form factor, G{sub E}{sup n}, vs the square of the four-momentum transfer, Q{sup 2}. Typically this parametrization is constrained to be consistent with experimental data for the neutron charge radius. However, we find that the Galster form does not have sufficient freedom to accommodate reasonable values of the radius without constraining or compromising the fit. In addition, the G{sub E}{sup n} data are now at sufficient precision to motivate a two-parameter fit (or three parameters if we include thermal neutron data). Here we present a modified form of a two-dipole parametrization that allows this freedom and fits both G{sub E}{sup n} (including recent data at both low and high four-momentum transfer) and the charge radius well with simple, well-defined parameters. Analysis reveals that the Galster form is essentially a two-parameter approximation to the two-dipole form but becomes degenerate if we try to extend it naturally to three parameters.

  4. Are protons nonidentical fermions?

    SciTech Connect

    Mart, T.

    2014-09-25

    We briefly review the progress of our investigation on the electric (charge) radius of the proton. In order to explain the recently measured proton radius, which is significantly smaller than the standard CODATA value, we assume that the real protons radii are not identical, they are randomly distributed in a certain range. To obtain the measured radius we average the radii and fit both the mean radius and the range. By using an averaged dipole form factor we obtain the charge radius r{sub E} = 0.8333 fm, in accordance with the recent measurement of the Lamb shift in muonic hydrogen.

  5. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement.

    PubMed

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-21

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the currently

  6. Quantitative investigation of physical factors contributing to gold nanoparticle-mediated proton dose enhancement

    NASA Astrophysics Data System (ADS)

    Cho, Jongmin; Gonzalez-Lepera, Carlos; Manohar, Nivedh; Kerr, Matthew; Krishnan, Sunil; Cho, Sang Hyun

    2016-03-01

    Some investigators have shown tumor cell killing enhancement in vitro and tumor regression in mice associated with the loading of gold nanoparticles (GNPs) before proton treatments. Several Monte Carlo (MC) investigations have also demonstrated GNP-mediated proton dose enhancement. However, further studies need to be done to quantify the individual physical factors that contribute to the dose enhancement or cell-kill enhancement (or radiosensitization). Thus, the current study investigated the contributions of particle-induced x-ray emission (PIXE), particle-induced gamma-ray emission (PIGE), Auger and secondary electrons, and activation products towards the total dose enhancement. Specifically, GNP-mediated dose enhancement was measured using strips of radiochromic film that were inserted into vials of cylindrical GNPs, i.e. gold nanorods (GNRs), dispersed in a saline solution (0.3 mg of GNRs/g or 0.03% of GNRs by weight), as well as vials containing water only, before proton irradiation. MC simulations were also performed with the tool for particle simulation code using the film measurement setup. Additionally, a high-purity germanium detector system was used to measure the photon spectrum originating from activation products created from the interaction of protons and spherical GNPs present in a saline solution (20 mg of GNPs/g or 2% of GNPs by weight). The dose enhancement due to PIXE/PIGE recorded on the films in the GNR-loaded saline solution was less than the experimental uncertainty of the film dosimetry (<2%). MC simulations showed highly localized dose enhancement (up to a factor 17) in the immediate vicinity (<100 nm) of GNRs, compared with hypothetical water nanorods (WNRs), mostly due to GNR-originated Auger/secondary electrons; however, the average dose enhancement over the entire GNR-loaded vial was found to be minimal (0.1%). The dose enhancement due to the activation products from GNPs was minimal (<0.1%) as well. In conclusion, under the

  7. Three-Loop Slope of the Dirac Form Factor and the 1S Lamb Shift in Hydrogen

    SciTech Connect

    Melnikov, Kirill; Ritbergen, Timo van

    2000-02-21

    The last unknown contribution to hydrogen energy levels at order m{alpha}{sup 7} , due to the slope of the Dirac form factor at three loops, is evaluated in a closed analytical form. The resulting shift of the hydrogen nS energy level is found to be 3.016/n{sup 3} kHz . Using the QED calculations of the 1S Lamb shift, we extract a precise value of the proton charge radius r{sub p}=0.883{+-}0.014 fm . (c) 2000 The American Physical Society.

  8. Scattering form factors for self-assembled network junctions

    NASA Astrophysics Data System (ADS)

    Foster, T.; Safran, S. A.; Sottmann, T.; Strey, R.

    2007-11-01

    The equilibrium microstructures in microemulsions and other self-assembled systems show complex, connected shapes such as symmetric bicontinuous spongelike structures and asymmetric bicontinuous networks formed by cylinders interconnected at junctions. In microemulsions, these cylinder network microstructures may mediate the structural transition from a spherical or globular phase to the bicontinuous microstructure. To understand the structural and statistical properties of such cylinder network microstructures as measured by scattering experiments, models are needed to extract the real-space structure from the scattering data. In this paper, we calculate the scattering functions appropriate for cylinder network microstructures. We focus on such networks that contain a high density of network junctions that connect the cylindrical elements. In this limit, the network microstructure can be regarded as an assembly of randomly oriented, closed packed network junctions (i.e., the cylinder scattering contributions are neglected). Accordingly, the scattering spectrum of the network microstructure can be calculated as the product of the junction number density, the junction form factor, which describes the scattering from the surface of a single junction, and a structure factor, which describes the local correlations of different junctions due to junction interactions (including their excluded volume). This approach is applied to analyze the scattering data from a bicontinuous microemulsion with equal volumes of water and oil. In a second approach, we included the cylinder scattering contribution in the junction form factor by calculating the scattering intensity of Y junctions to which three rods with spherical cross section are attached. The respective theoretical predictions are compared with results of neutron scattering measurements on a water-in-oil microemulsion with a connected microstructure.

  9. CEBAF at higher energies and the kaon electromagnetic form factor

    SciTech Connect

    Baker, O.K.

    1994-04-01

    The electromagnetic production of strangeness, the physics of exciting systems having strangeness degrees of freedom (production of hadrons with one or more strange constituent quarks) using electromagnetic probes (real or virtual photons), is one of the frontier areas of research which will be investigated at the Continuous Electron Beam Accelerator Facility (CEBAF) when it becomes operational. CEBAF is expected to have an important impact upon this field of research using its specialized set of detection instruments and high quality electron beam. This paper focusses upon one aspect of the associated production of strangeness - the determination of the kaon electromagnetic form factor at high squared momentum transfers.

  10. Baryon octet electromagnetic form factors in a confining NJL model

    NASA Astrophysics Data System (ADS)

    Carrillo-Serrano, Manuel E.; Bentz, Wolfgang; Cloët, Ian C.; Thomas, Anthony W.

    2016-08-01

    Electromagnetic form factors of the baryon octet are studied using a Nambu-Jona-Lasinio model which utilizes the proper-time regularization scheme to simulate aspects of colour confinement. In addition, the model also incorporates corrections to the dressed quarks from vector meson correlations in the t-channel and the pion cloud. Comparison with recent chiral extrapolations of lattice QCD results shows a remarkable level of consistency. For the charge radii we find the surprising result that rEp < rEΣ+ and | rEn | < | rEΞ0 |, whereas the magnetic radii have a pattern largely consistent with a naive expectation based on the dressed quark masses.

  11. gamma* p ---> Delta form-factors in QCD

    SciTech Connect

    V. M. Belyaev; A. V. Radyushkin

    1995-05-01

    We use local quark-hadron duality to estimate the purely nonperturbative soft contribution to the {gamma}*p {yields} {Delta} form factors. Our results are in agreement with existing experimental data. We predict that the ratio G*{sub E}(Q{sup 2})/G*{sub M}(Q{sup 2}) is small for all accessible Q{sup 2}, in contrast to the perturbative QCD expectations that G*{sub E}(Q{sup 2}) {yields} -G*{sub M}(Q{sup 2}).

  12. Nucleon strangeness form factors and moments of PDF

    SciTech Connect

    Doi, Takumi; Deka, Mridupawan; Dong, Shao-Jing; Draper, Terrence; Liu, Keh-Fei; Mankame, Devdatta; Mathur, Nilmani; Streuer, Thomas

    2011-10-24

    The calculation of the nucleon strangeness form factors from N{sub f} = 2+1 clover fermion lattice QCD is presented. Disconnected insertions are evaluated using the Z(4) stochastic method, along with unbiased subtractions from the hopping parameter expansion. We find that increasing the number of nucleon sources for each configuration improves the signal significantly. We obtain G{sub M}{sup s}(0) = -0.017(25)(07), which is consistent with experimental values, and has an order of magnitude smaller error. Preliminary results for the strangeness contribution to the second moment of the parton distribution function are also presented.

  13. Two-photon exchange corrections to the pion form factor

    SciTech Connect

    Peter G. Blunden; Melnitchouk, Wally; Tjon, John A.

    2010-01-06

    Here, we compute two-photon exchange corrections to the electromagnetic form factor of the pion, taking into account the finite size of the pion. Compared to the soft-photon approximation for the infrared divergent contribution which neglects hadron structure effects, the corrections are found to be ≲ 1% for small Q2 (Q2 < 0.1 GeV2), but increase to several percent for Q2 ≳ 1 GeV2 at extreme backward angles.

  14. Minimal form factor digital-image sensor for endoscopic applications

    NASA Astrophysics Data System (ADS)

    Wäny, Martin; Voltz, Stephan; Gaspar, Fabio; Chen, Lei

    2009-02-01

    This paper presents a digital image sensor SOC featuring a total chip area (including dicing tolerances) of 0.34mm2 for endoscopic applications. Due to this extremely small form factor the sensor enables integration in endoscopes, guide wires and locater devices of less than 1mm outer diameter. The sensor embeds a pixel matrix of 10'000 pixels with a pitch of 3um x 3um covered with RGB filters in Bayer pattern. The sensor operates fully autonomous, controlled by an on chip ring oscillator and readout state machine, which controls integration AD conversion and data transmission, thus the sensor only requires 4 pin's for power supply and data communication. The sensor provides a frame rate of 40Frames per second over a LVDS serial data link. The endoscopic application requires that the sensor must work without any local power decoupling capacitances at the end of up to 2m cabling and be able to sustain data communication over the same wire length without deteriorating image quality. This has been achieved by implementation of a current mode successive approximation ADC and current steering LVDS data transmission. An band gap circuit with -40dB PSRR at the data frequency was implemented as on chip reference to improve robustness against power supply ringing due to the high series inductance of the long cables. The B&W versions of the sensor provides a conversion gain of 30DN/nJ/cm2 at 550nm with a read noise in dark of 1.2DN when operated at 2m cable. Using the photon transfer method according to EMVA1288 standard the full well capacity was determined to be 18ke-. According to our knowledge the presented work is the currently world smallest fully digital image sensor. The chip was designed along with a aspheric single surface lens to assemble on the chip without increasing the form factor. The extremely small form factor of the resulting camera permit's to provide visualization with much higher than state of the art spatial resolution in sub 1mm endoscopic

  15. Proton Conductive Nanosheets Formed by Alignment of Metallo-Supramolecular Polymers.

    PubMed

    Pandey, Rakesh K; Rana, Utpal; Chakraborty, Chanchal; Moriyama, Satoshi; Higuchi, Masayoshi

    2016-06-01

    Linear Fe(II)-based metallo-supramolecular polymer chains were precisely aligned by the simple replacement of the counteranion with an N,N'-bis(4-benzosulfonic acid)perylene-3,4,9,10-tetracarboxylbisimide (PSA) dianion, which linked the polymer chains strongly. A parallel alignment of the polymer chains promoted by the PSA dianions yielded nanosheets formation. The nanosheets' structure was analyzed with FESEM, HRTEM, UV-vis, and XRD in detail. The nanosheets showed more than 5 times higher proton conductivity than the original polymer due to the smooth ionic conduction through the aligned polymer chains. The complex impedance plot with two semicircles also suggested the presence of grain boundaries in the polymer nanosheets. PMID:27164027

  16. ρ γ*→π (ρ ) transition form factors in the perturbative QCD factorization approach

    NASA Astrophysics Data System (ADS)

    Zhang, Ya-Lan; Cheng, Shan; Hua, Jun; Xiao, Zhen-Jun

    2015-11-01

    In this paper, we studied the ρ γ*→π and ρ γ*→ρ transition processes and made the calculations for the ρ π transition form factor Q4Fρ π(Q2) and the ρ -meson electromagnetic form factors, FLL ,LT ,TT(Q2) and F1 ,2 ,3(Q2), by employing the perturbative QCD (PQCD) factorization approach. For the ρ γ*→π transition, we found that the contribution to form factor Q4Fρ π(Q2) from the term proportional to the distribution amplitude combination ϕρT(x1)ϕπP(x2) is absolutely dominant, and the PQCD predictions for both the size and the Q2-dependence of this form factor Q4Fρ π(Q2) agree well with those from the extended anti-de Sitter/QCD models or the light-cone QCD sum rule. For the ρ γ*→ρ transition and in the region of Q2≥3 GeV2 , furthermore, we found that the PQCD predictions for the magnitude and their Q2-dependence of the F1(Q2) and F2(Q2) form factors agree well with those from the QCD sum rule, while the PQCD prediction for F3(Q2) is much larger than the one from the QCD sum rule.

  17. Meson transition form factors in light-front holographic QCD

    SciTech Connect

    Brodsky, Stanley J.; Cao Fuguang; de Teramond, Guy F.

    2011-10-01

    We study the photon-to-meson transition form factors (TFFs) F{sub M}{gamma}(Q{sup 2}) for {gamma}{gamma}{sup *}{yields}M using light-front holographic methods. The Chern-Simons action, which is a natural form in five-dimensional anti-de Sitter (AdS) space, is required to describe the anomalous coupling of mesons to photons using holographic methods and leads directly to an expression for the photon-to-pion TFF for a class of confining models. Remarkably, the predicted pion TFF is identical to the leading order QCD result where the distribution amplitude has asymptotic form. The Chern-Simons form is local in AdS space and is thus somewhat limited in its predictability. It only retains the qq component of the pion wave function, and further, it projects out only the asymptotic form of the meson distribution amplitude. It is found that in order to describe simultaneously the decay process {pi}{sup 0}{yields}{gamma}{gamma} and the pion TFF at the asymptotic limit, a probability for the qq component of the pion wave function P{sub qq}=0.5 is required, thus giving indication that the contributions from higher Fock states in the pion light-front wave function need to be included in the analysis. The probability for the Fock state containing four quarks P{sub qqqq}{approx}10%, which follows from analyzing the hadron matrix elements for a dressed current model, agrees with the analysis of the pion elastic form factor using light-front holography including higher Fock components in the pion wave function. The results for the TFFs for the {eta} and {eta}{sup '} mesons are also presented. The rapid growth of the pion TFF exhibited by the BABAR data at high Q{sup 2} is not compatible with the models discussed in this article, whereas the theoretical calculations are in agreement with the experimental data for the {eta} and {eta}{sup '} TFFs.

  18. Small form factor optical fiber connector evaluation for harsh environments

    NASA Astrophysics Data System (ADS)

    Ott, Melanie N.; Thomes, W. Joe, Jr.; Chuska, Richard F.; Switzer, Robert; Blair, Diana E.

    2011-09-01

    For the past decade NASA programs have utilized the Diamond AVIM connector for optical fiber assemblies on space flight instrumentation. These connectors have been used in communications, sensing and LIDAR systems where repeatability and high performance are required. Recently Diamond has released a smaller form factor optical fiber connector called the "Mini-AVIM" which although more compact still includes the tight tolerances and the ratcheting feature of the heritage AVIM. NASA Goddard Space Flight Center Photonics Group in the Parts, Packaging and Assembly Technologies Office has been performing evaluations of this connector to determine how it compares to the performance of the AVIM connector and to assess its feasibility for harsh environmental applications. Vibration and thermal testing were performed on the Mini-AVIM with both multi-mode and single-mode optical fiber using insitu optical transmission monitoring. Random vibration testing was performed using typical launch condition profiles for most NASA missions but extended to 35 Grms, which is much higher than most requirements. Thermal testing was performed incrementally up to a range of -55°C to +125°C. The test results include both unjacketed fiber and cabled assembly evaluations. The data presented here indicate that the Mini-AVIM provides a viable option for small form factor applications that require a high performance optical fiber connector.

  19. Nucleon electromagnetic form factors in two-flavor QCD

    NASA Astrophysics Data System (ADS)

    Capitani, S.; Della Morte, M.; Djukanovic, D.; von Hippel, G.; Hua, J.; Jäger, B.; Knippschild, B.; Meyer, H. B.; Rae, T. D.; Wittig, H.

    2015-09-01

    We present results for the nucleon electromagnetic form factors, including the momentum transfer dependence and derived quantities (charge radii and magnetic moment). The analysis is performed using O (a ) improved Wilson fermions in Nf=2 QCD measured on the Coordinated Lattice Simulations ensembles. Particular focus is placed on a systematic evaluation of the influence of excited states in three-point correlation functions, which lead to a biased evaluation, if not accounted for correctly. We argue that the use of summed operator insertions and fit Ansätze including excited states allow us to suppress and control this effect. We employ a novel method to perform joint chiral and continuum extrapolations, by fitting the form factors directly to the expressions of covariant baryonic chiral effective field theory. The final results for the charge radii and magnetic moment from our lattice calculations include, for the first time, a full error budget. We find that our estimates are compatible with experimental results within their overall uncertainties.

  20. Improved semileptonic form factor calculations in lattice QCD

    SciTech Connect

    Evans, Richard; Bali, Gunnar; Collins, Sara

    2010-11-01

    We investigate the computational efficiency of two stochastic based alternatives to the sequential propagator method used in lattice QCD calculations of heavy-light semileptonic form factors. In the first method, we replace the sequential propagator, which couples the calculation of two of the three propagators required for the calculation, with a stochastic propagator so that the calculations of all three propagators are independent. This method is more flexible than the sequential propagator method but introduces stochastic noise. We study the noise to determine when this method becomes competitive with the sequential propagator method, and find that for any practical calculation it is competitive with or superior to the sequential propagator method. We also examine a second stochastic method, the so-called 'one-end trick', concluding it is relatively inefficient in this context. The investigation is carried out on two gauge field ensembles, using the nonperturbatively improved Wilson-Sheikholeslami-Wohlert action with N{sub f}=2 mass-degenerate sea quarks. The two ensembles have similar lattice spacings but different sea-quark masses. We use the first stochastic method to extract O(a)-improved, matched lattice results for the semileptonic form factors on the ensemble with lighter sea quarks, extracting f{sub +}(0).

  1. Astrophysical S factors for radiative proton capture by {sup 3}H and {sup 7}Li nuclei

    SciTech Connect

    Dubovichenko, S. B.

    2011-03-15

    Within the potential cluster model where orbital states are classified according to Young diagrams and isospin, astrophysical S factors are considered for radiative proton capture by {sup 3}H and {sup 7}Li nuclei at energies of up to 1 and 10 keV, respectively. It is shown that the approach used, which takes into account only the E1 transition for the p{sup 3}H capture process, makes it possible to describe well the most recent experimental data at c.m. energies in the range from 50 keV to 5MeV. In the case of proton capture by {sup 7}Li nuclei, an M1 processwas taken into account in addition to the E1 transition, and a general behavior and the magnitude of the experimental S factor could be correctly reproduced owing to this at astrophysical energies, including the region around the resonance at 0.441 MeV (in the laboratory frame).

  2. The Location of the Protonated and Unprotonated Forms of Arbidol in the Membrane: A Molecular Dynamics Study.

    PubMed

    Galiano, Vicente; Villalaín, José

    2016-06-01

    Arbidol is a potent broad-spectrum antiviral molecule for the treatment and prophylaxis of many viral infections. Viruses that can be inhibited by arbidol include enveloped and non-enveloped viruses, RNA and DNA viruses, as well as pH-independent and pH-dependent ones. These differences in viral types highlight the broad spectrum of Arb antiviral activity and, therefore, it must affect a common viral critical step. Arbidol incorporates rapidly into biological membranes, and some of its antiviral effects might be related to its capacity to interact with and locate into the membrane. However, no information is available of the molecular basis of its antiviral mechanism/s. We have aimed to locate the protonated (Arp) and unprotonated (Arb) forms of arbidol in a model membrane system. Both Arb and Arp locate in between the hydrocarbon acyl chains of the phospholipids but its specific location and molecular interactions differ from each other. Whereas both Arb and Arp average location in the membrane palisade is a similar one, Arb tends to be perpendicular to the membrane surface, whereas Arp tends to be parallel to it. Furthermore, Arp, in contrast to Arb, seems to interact stronger with POPG than with POPC, implying the existence of a specific interaction between Arp, the protonated from, with negatively charged phospholipids. This data would suggest that the active molecule of arbidol in the membrane is the protonated one, i.e., the positively charged molecule. The broad antiviral activity of arbidol would be defined by the perturbation it exerts on membrane structure and therefore membrane functioning. PMID:26843065

  3. Deuteron Electromagnetic Form Factors in AdS/QCD

    NASA Astrophysics Data System (ADS)

    Lyubovitskij, Valery E.; Gutsche, Thomas; Schmidt, Ivan; Vega, Alfredo

    2016-03-01

    We extend a soft-wall AdS/QCD approach to a description of deuteron properties. Our framework is based an effective action formulated in terms of AdS fields, which are holographically equivalent to the deuteron and photon fields. This action produces the equation of motion for the deuteron wave function and the Q^2 -dependent electromagnetic current, which are then used to calculate the deuteron electromagnetic form factors and structure functions in the Euclidean region. We show that the predicted deuteron quantities are expressed through a universal function, which is defined by a single scale parameter κ and which has the correct 1/Q^{10} power scaling at large Q^2.

  4. Chiral corrections to the hyperon vector form factors

    NASA Astrophysics Data System (ADS)

    Villadoro, Giovanni

    2006-07-01

    We present a complete calculation of the SU(3)-breaking corrections to the hyperon vector form factors up to O(p4) in heavy baryon chiral perturbation theory. Because of the Ademollo-Gatto theorem, at this order the results do not depend on unknown low energy constants and allow to test the convergence of the chiral expansion. We complete and correct previous calculations and find that O(p3) and O(1/M0) corrections are important. We also study the inclusion of the decuplet degrees of freedom, showing that in this case the perturbative expansion is jeopardized. These results raise doubts on the reliability of the chiral expansion for hyperons.

  5. Thin and small form factor cells : simulated behavior.

    SciTech Connect

    Clews, Peggy Jane; Pluym, Tammy; Grubbs, Robert K.; Cruz-Campa, Jose Luis; Zubia, David; Young, Ralph Watson; Okandan, Murat; Gupta, Vipin P.; Nielson, Gregory N.; Resnick, Paul James

    2010-07-01

    Thin and small form factor cells have been researched lately by several research groups around the world due to possible lower assembly costs and reduced material consumption with higher efficiencies. Given the popularity of these devices, it is important to have detailed information about the behavior of these devices. Simulation of fabrication processes and device performance reveals some of the advantages and behavior of solar cells that are thin and small. Three main effects were studied: the effect of surface recombination on the optimum thickness, efficiency, and current density, the effect of contact distance on the efficiency for thin cells, and lastly the effect of surface recombination on the grams per Watt-peak. Results show that high efficiency can be obtained in thin devices if they are well-passivated and the distance between contacts is short. Furthermore, the ratio of grams per Watt-peak is greatly reduced as the device is thinned.

  6. The Pion Charge Form Factor Through Pion Electroproduction

    SciTech Connect

    Horn, Tanja

    2006-04-01

    The goal of Jefferson Lab experiment E01-004 (F?-2) was the measurement of the longitudinal and transverse cross sections via pion electroproduction from hydrogen and deuterium for the purpose of extracting the charged pion form factor using pole dominance. The data were taken at two values of Q2 (1.60 and 2.45 GeV/c)2. In order to attain full coverage in R?, charged pions were detected in parallel kinematics (along the direction of momentum transfer, q), and at ±3 degrees off the direction of momentum transfer. For each Q2 data were taken for two values of the virtual photon polarization, ?, respectively. All data were taken at a fixed center of mass energy, W=2.22 GeV. The longitudinal and transverse pieces of the cross section were separated using the Rosenbluth separation method.

  7. Deuteron Electromagnetic Form Factors in AdS/QCD

    NASA Astrophysics Data System (ADS)

    Lyubovitskij, Valery E.; Gutsche, Thomas; Schmidt, Ivan; Vega, Alfredo

    2016-07-01

    We extend a soft-wall AdS/QCD approach to a description of deuteron properties. Our framework is based an effective action formulated in terms of AdS fields, which are holographically equivalent to the deuteron and photon fields. This action produces the equation of motion for the deuteron wave function and the Q^2-dependent electromagnetic current, which are then used to calculate the deuteron electromagnetic form factors and structure functions in the Euclidean region. We show that the predicted deuteron quantities are expressed through a universal function, which is defined by a single scale parameter κ and which has the correct 1/Q^{10} power scaling at large Q^2.

  8. Finite-lattice form factors in free-fermion models

    NASA Astrophysics Data System (ADS)

    Iorgov, N.; Lisovyy, O.

    2011-04-01

    We consider the general {Z}_2 -symmetric free-fermion model on the finite periodic lattice, which includes as special cases the Ising model on the square and triangular lattices and the {Z}_n -symmetric BBS τ(2)-model with n = 2. Translating Kaufman's fermionic approach to diagonalization of Ising-like transfer matrices into the language of Grassmann integrals, we determine the transfer matrix eigenvectors and observe that they coincide with the eigenvectors of a square lattice Ising transfer matrix. This allows us to find exact finite-lattice form factors of spin operators for the statistical model and the associated finite-length quantum chains, of which the most general is equivalent to the XY chain in a transverse field.

  9. Lattice calculation of composite dark matter form factors

    NASA Astrophysics Data System (ADS)

    Appelquist, T.; Brower, R. C.; Buchoff, M. I.; Cheng, M.; Cohen, S. D.; Fleming, G. T.; Kiskis, J.; Lin, M. F.; Neil, E. T.; Osborn, J. C.; Rebbi, C.; Schaich, D.; Schroeder, C.; Syritsyn, S.; Voronov, G.; Vranas, P.; Wasem, J.

    2013-07-01

    Composite dark matter candidates, which can arise from new strongly-coupled sectors, are well-motivated and phenomenologically interesting, particularly in the context of asymmetric generation of the relic density. In this work, we employ lattice calculations to study the electromagnetic form factors of electroweak-neutral dark-matter baryons for a three-color, QCD-like theory with Nf=2 and 6 degenerate fermions in the fundamental representation. We calculate the (connected) charge radius and anomalous magnetic moment, both of which can play a significant role for direct detection of composite dark matter. We find minimal Nf dependence in these quantities. We generate mass-dependent cross sections for dark matter-nucleon interactions and use them in conjunction with experimental results from XENON100, excluding dark matter candidates of this type with masses below 10 TeV.

  10. Bunch coalescing in the main ring to form intense proton and antiproton bunches without RF counterphasing

    SciTech Connect

    Griffin, J.E.; MacLachlan, J.A.; Nicholls, G.N.; Qian, Z.B.

    1984-08-09

    Both the proton and antiproton bunches which will collide in the Tevatron have longitudinal emittance greater than can be accelerated by the main ring from 8 GeV without large loss and emittance growth. We have previously described the technique of combining several smaller bunches at the Tevatron injection energy with little increase in the total emittance and negligible loss. This technique requires adiabatic debunching of several adjacent 53 MHz bunches by smooth reduction of the RF voltage from approx. 1 MV to approx. 100 V. The very low voltage is extremely difficult to attain with a high-Q system designed for megavolt accelerating potential. The counterphasing technique of voltage reduction which we have used in main ring experiments and proposed for the TeV I project is to divide the accelerating cavities into two closely matched groups and to smoothly shift the relative phase of the drive to the two groups by 180 degrees. When the net voltage has been reduced by this means to the lowest practical level, about 10 kV, the final voltage reduction may be performed by turning off the high-Q system and using a low-Q cavity. The voltage induced on the undriven gaps of the high-Q system is low enough not to be a major problem because the total intensity is low. However, the effects are not negligible, and dynamic beam loading compensation is required. This memo proposes that the process described above be simplified somewhat by replacing the counterphasing voltage reduction with a zero-voltage spreading of the bunches for several milliseconds followed by a few hundred microseconds of rotation to minimum energy spread in buckets produced at high voltage.

  11. Comparative proton nuclear magnetic resonance studies of amantadine complexes formed in aqueous solutions with three major cyclodextrins.

    PubMed

    Lis-Cieplak, Agnieszka; Sitkowski, Jerzy; Kolodziejski, Waclaw

    2014-01-01

    Host-guest complexes of alpha-, beta-, and gamma-cyclodextrins (α-CD, β-CD, and γ-CD, respectively) with amantadine (1-aminoadamantane, AMA; an antiviral agent) were characterized in aqueous solutions using proton nuclear magnetic resonance (NMR) spectroscopy. Host-guest molecular interactions were manifested by changes in the chemical shifts of AMA protons. NMR Job's plots showed that the stoichiometry of all the studied complexes was 1:1. Two-dimensional T-ROESY experiments demonstrated that the complexes were formed by different degrees of incorporation of the adamantyl group of AMA into the CD cavity. The mode of AMA binding was proposed. The AMA molecule came into the α-CD cavity (the smallest size) or β-CD cavity (the intermediate size) through its wide entrance to become shallowly or deeply accommodated, respectively. In the complex of AMA with γ-CD (the largest cavity size), the adamantyl group was also quite deeply inserted into the CD cavity, but it arrived there through the narrow cavity entrance. It was found that the adamantyl group of AMA was best accommodated by the β-CD cavity. The binding constants Kaa of the studied complexes (in M(-1) ), determined from DOSY NMR, were fairly high; their values in an ascending order were: α-CD (183) < γ-CD (306) ≪ β-CD (5150). PMID:24282085

  12. Factors Governing Surface Form Accuracy In Diamond Machined Components

    NASA Astrophysics Data System (ADS)

    Myler, J. K.; Page, D. A.

    1988-10-01

    simple spheres. It is important however to realise that a diamond turning process will possess a new set of criteria which limit the accuracy of the surface profile created corresponding to a completely new set of specifications. The most important factors are:- tool centring accuracy, surface waviness, conical form error, and other rotationally symmetric non spherical errors. The fixturing of the workpiece is very different from that of a conventional lap, since in many cases the diamond machine resembles a conventional lathe geometry where the workpiece rotates at a few thousand R.P.M. Substrates must be held rigidly for rotation at such speeds as compared with more delicate mounting methods for conventional laps. Consequently the workpiece may suffer from other forms of deformation which are non-rotationally symmetric due to mounting stresses (static deformation) and stresses induced at the speed of rotation (dynamic deformation). The magnitude of each of these contributions to overall form error will be a function of the type of machine, the material, substrate, and testing design. The following sections describe each of these effects in more detail based on experience obtained on a Pneumo Precision MSG325 XY CNC machine. Certain in-process measurement techniques have been devised to minimise and quantify each contribution.

  13. Coupling factor B is a component of the Fo proton channel of mitochondrial H+-ATPase

    SciTech Connect

    Huang, Y.; Kantham, L.; Sanadi, D.R.

    1987-03-05

    Repeated extraction of bovine heart submitochondrial particles with ammonia and EDTA (AE) yields a preparation that is highly deficient in coupling factor B (FB). The activity of the thrice extracted particle (AE-P3) in ATP-driven NAD+ reduction by succinate and the /sup 32/Pi-ATP exchange activity were substantially stimulated, 8-fold and 5-fold, respectively, by purified FB. To decrease the basal activity of the particle further, the residual FB in AE-P3 was inactivated by treatment with the -SH reagent, 4-vinylpyridine. The resulting particle was depleted of F1 by treatment with 3.5 M NaBr. This particle was incorporated into asolectin liposomes alone and in the presence of added FB. Passive proton conduction in the FB-deficient proteoliposomes was negligible and restored in the presence of FB. The H+ conductance was inhibited extensively by oligomycin and partially by F1-ATPase. The results show absolute dependence on FB for functioning of the FO proton channel.

  14. Astrophysical S-factor of the radiative proton capture on 14C at low energies

    NASA Astrophysics Data System (ADS)

    Dubovichenko, Sergey; Burtebaev, Nasurlla; Dzhazairov-Kakhramanov, Albert; Alimov, Dilshod

    2014-07-01

    The phase shift analysis for position location of the 2S1/2 resonance at 1.5 MeV was carried out on the basis of the known experimental measurements of the excitation functions of the p14C elastic scattering at four angles from 90° to 165° and more than 100 energy values in the range from 600-800 keV to 2200-2400 keV. Also, the possibility to describe the available experimental data on the astrophysical S-factor for the proton capture reaction on 14C to the ground state (GS) of 15N at astrophysical energies was considered in the frame of modified potential cluster model (MPCM).

  15. Delirium in the geriatric unit: proton-pump inhibitors and other risk factors

    PubMed Central

    Otremba, Iwona; Wilczyński, Krzysztof; Szewieczek, Jan

    2016-01-01

    Background Delirium remains a major nosocomial complication of hospitalized elderly. Predictive models for delirium may be useful for identification of high-risk patients for implementation of preventive strategies. Objective Evaluate specific factors for development of delirium in a geriatric ward setting. Methods Prospective cross-sectional study comprised 675 consecutive patients aged 79.2±7.7 years (66% women and 34% men), admitted to the subacute geriatric ward of a multiprofile university hospital after exclusion of 113 patients treated with antipsychotic medication because of behavioral disorders before admission. Comprehensive geriatric assessments including a structured interview, physical examination, geriatric functional assessment, blood sampling, ECG, abdominal ultrasound, chest X-ray, Confusion Assessment Method for diagnosis of delirium, Delirium-O-Meter to assess delirium severity, Richmond Agitation-Sedation Scale to assess sedation or agitation, visual analog scale and Doloplus-2 scale to assess pain level were performed. Results Multivariate logistic regression analysis revealed five independent factors associated with development of delirium in geriatric inpatients: transfer between hospital wards (odds ratio [OR] =2.78; confidence interval [CI] =1.54–5.01; P=0.001), preexisting dementia (OR =2.29; CI =1.44–3.65; P<0.001), previous delirium incidents (OR =2.23; CI =1.47–3.38; P<0.001), previous fall incidents (OR =1.76; CI =1.17–2.64; P=0.006), and use of proton-pump inhibitors (OR =1.67; CI =1.11–2.53; P=0.014). Conclusion Transfer between hospital wards, preexisting dementia, previous delirium incidents, previous fall incidents, and use of proton-pump inhibitors are predictive of development of delirium in the geriatric inpatient setting. PMID:27103793

  16. The Proton Radius Puzzle

    NASA Astrophysics Data System (ADS)

    Downie, E. J.

    2016-03-01

    The proton radius puzzle is the difference between the proton radius as measured with electron scattering and in the excitation spectrum of atomic hydrogen, and that measured with muonic hydrogen spectroscopy. Since the inception of the proton radius puzzle in 2010 by the measurement of Pohl et al.[1], many possible resolutions to the puzzle have been postulated, but, to date, none has been generally accepted. New data are therefore necessary to resolve the issue. We briefly review the puzzle, the proposed solutions, and the new electron scattering and spectroscopy experiments planned and underway. We then introduce the MUSE experiment, which seeks to resolve the puzzle by simultaneously measuring elastic electron and muon scattering on the proton, in both charge states, thereby providing new information to the puzzle. MUSE addresses issues of two-photon effects, lepton universality and, possibly, new physics, while providing simultaneous form factor, and therefore radius, measurements with both muons and electrons.

  17. Nucleon form factors and hidden symmetry in holographic QCD

    SciTech Connect

    Hong, Deog Ki; Rho, Mannque; Yee, Ho-Ung; Yi, Piljin

    2008-01-01

    The vector dominance of the electromagnetic form factors both for mesons and baryons arises naturally in holographic QCD, where both the number of colors and the 't Hooft coupling are taken to be very large, offering a bona-fide derivation of the notion of vector dominance. The crucial ingredient for this is the infinite tower of vector mesons in the approximations made which share features that are characteristic of the quenched approximation in lattice QCD. We approximate the infinite sum by contributions from the lowest four vector mesons of the tower which turn out to saturate the charge and magnetic moment sum rules within a few percent and compute them totally free of unknown parameters for momentum transfers Q{sup 2} < or approx. 1 GeV{sup 2}. We identify certain observables that can be reliably computed within the approximations and others that are not, and discuss how the improvement of the latter can enable one to bring holographic QCD closer to QCD proper.

  18. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation.

    PubMed

    Sanzari, Jenine K; Krigsfeld, Gabriel S; Shuman, Anne L; Diener, Antonia K; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R

    2015-04-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for loss of white blood cells (WBCs), which are the body's main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved WBC loss, specifically neutrophils, in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated, irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well as internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses. PMID:25909052

  19. Proton Gradients as a Key Physical Factor in the Evolution of the Forced Transport Mechanism Across the Lipid Membrane

    NASA Astrophysics Data System (ADS)

    Strbak, Oliver; Kanuchova, Zuzana; Krafcik, Andrej

    2016-04-01

    A critical phase in the transition from prebiotic chemistry to biological evolution was apparently an asymmetric ion flow across the lipid membrane. Due to imbalance in the ion flow, the early lipid vesicles could selectively take the necessary molecules from the environment, and release the side-products from the vesicle. Natural proton gradients played a definitively crucial role in this process, since they remain the basis of energy transfer in the present-day cells. On the basis of this supposition, and the premise of the early vesicle membrane's impermeability to protons, we have shown that the emergence of the proton gradient in the lipid vesicle could be a key physical factor in the evolution of the forced transport mechanism (pore formation and active transport) across the lipid bilayer. This driven flow of protons across the membrane is the result of the electrochemical proton gradient and osmotic pressures on the integrity of the lipid vesicle. At a critical number of new lipid molecules incorporated into the vesicle, the energies associated with the creation of the proton gradient exceed the bending stiffness of the lipid membrane, and overlap the free energy of the lipid bilayer pore formation.

  20. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    NASA Astrophysics Data System (ADS)

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-04-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for loss of white blood cells (WBCs), which are the body's main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved WBC loss, specifically neutrophils, in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated, irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well as internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses.

  1. Effects of a granulocyte colony stimulating factor, Neulasta, in mini pigs exposed to total body proton irradiation

    PubMed Central

    Sanzari, Jenine K.; Krigsfeld, Gabriel S.; Shuman, Anne L.; Diener, Antonia K.; Lin, Liyong; Mai, Wilfried; Kennedy, Ann R.

    2015-01-01

    Astronauts could be exposed to solar particle event (SPE) radiation, which is comprised mostly of proton radiation. Proton radiation is also a treatment option for certain cancers. Both astronauts and clinical patients exposed to ionizing radiation are at risk for white blood cell (WBC) loss, which are the body’s main defense against infection. In this report, the effect of Neulasta treatment, a granulocyte colony stimulating factor, after proton radiation exposure is discussed. Mini pigs exposed to total body proton irradiation at a dose of 2 Gy received 4 treatments of either Neulasta or saline injections. Peripheral blood cell counts and thromboelastography parameters were recorded up to 30 days post-irradiation. Neulasta significantly improved white blood cell (WBC), specifically neutrophil, loss in irradiated animals by approximately 60% three days after the first injection, compared to the saline treated irradiated animals. Blood cell counts quickly decreased after the last Neulasta injection, suggesting a transient effect on WBC stimulation. Statistically significant changes in hemostasis parameters were observed after proton radiation exposure in both the saline and Neulasta treated irradiated groups, as well internal organ complications such as pulmonary changes. In conclusion, Neulasta treatment temporarily alleviates proton radiation-induced WBC loss, but has no effect on altered hemostatic responses. PMID:25909052

  2. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    DOE PAGESBeta

    Park, K.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; et al

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measuredmore » using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.« less

  3. Measurement of the generalized form factors near threshold via γ*p→nπ+ at high Q2

    NASA Astrophysics Data System (ADS)

    Park, K.; Gothe, R. W.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Eugenio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Kalantarians, N.; Khandaker, M.; Khetarpal, P.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Pereira, S. Anefalos; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-01

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum-rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  4. Structural, thermal, morphological and biological studies of proton-transfer complexes formed from 4-aminoantipyrine with quinol and picric acid

    NASA Astrophysics Data System (ADS)

    Adam, Abdel Majid A.

    2013-03-01

    4-Aminoantipyrine (4AAP) is widely used in the pharmaceutical industry, biochemical experiments and environmental monitoring. However, residual amounts of 4AAP in the environment may pose a threat to human health. To provide basic data that can be used to extract or eliminate 4AAP from the environment, the proton-transfer complexes of 4AAP with quinol (QL) and picric acid (PA) were synthesized and spectroscopically investigated. The interactions afforded two new proton-transfer salts named 1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-aminium-4-hydroxyphenolate and 1,5-dimethyl-3-oxo-2-phenyl-2,3-dihydro-1H-pyrazol-4-aminium-2,4,6-trinitrophenolate for QL and PA, respectively, via a 1:1 stoichiometry. Elemental analysis (CHN), electronic absorption, spectrophotometric titration, IR, Raman, 1H NMR and X-ray diffraction were used to characterize the new products. The thermal stability of the synthesized CT complexes was investigated using thermogravimetric (TG) analyses, and the morphology and particle size of these complexes were obtained from scanning electron microscopy (SEM). It was found that PA and 4AAP immediately formed a yellow precipitate with a remarkable sponge-like morphology and good thermal stability up to 180 °C. Finally, the biological activities of the newly synthesized CT complexes were tested for their antibacterial and antifungal activities. The results indicated that the [(4AAP)(QL)] complex exhibited strong antimicrobial activities against various bacterial and fungal strains compared with standard drugs.

  5. A human factors approach to waste form design

    SciTech Connect

    Rodriguez, M.A.

    1994-04-01

    The current study consist of two experiments and an example of a revised waste form to demonstrate the necessity of careful form design and provide guidance in obtaining accurate information through written solicitation of any kind. In Experiment 1, two differently designed forms were used to solicit the same list of specific information. The data suggest that the more clearly designed form significantly produced more of the specific information required than the form that just listed the questions. Experiment 2, which is to be conducted during the spring semester 1994, is designed to address three specific aspects of form design. The results of this Experiment 2 will be interpreted and presented at the 1994 International High-Level Radioactive Waste Management Conference, May 22--26. Guidelines and examples of form design are given.

  6. Nucleon Form Factors above 6 GeV

    DOE R&D Accomplishments Database

    Taylor, R. E.

    1967-09-01

    This report describes the results from a preliminary analysis of an elastic electron-proton scattering experiment... . We have measured cross sections for e-p scattering in the range of q{sup 2} from 0.7 to 25.0 (GeV/c){sup 2}, providing a large region of overlap with previous measurements. In this experiment we measure the cross section by observing electrons scattered from a beam passing through a liquid hydrogen target. The scattered particles are momentum analyzed by a magnetic spectrometer and identified as electrons in a total absorption shower counter. Data have been obtained with primary electron energies from 4.0 to 17.9 GeV and at scattering angles from 12.5 to 35.0 degrees. In general, only one measurement of a cross section has been made at each momentum transfer.

  7. An experiment for the direct determination of the g-factor of a single proton in a Penning trap

    NASA Astrophysics Data System (ADS)

    Rodegheri, C. C.; Blaum, K.; Kracke, H.; Kreim, S.; Mooser, A.; Quint, W.; Ulmer, S.; Walz, J.

    2012-06-01

    A new apparatus has been designed that aims at a direct precision measurement of the g-factor of a single isolated proton or antiproton in a Penning trap. We present a thorough discussion on the trap design and a method for the experimental trap optimization using a single stored proton. A first attempt at the g-factor determination has been made in a section of the trap with a magnetic bottle. The Larmor frequency of the proton has been measured with a relative uncertainty of 1.8 × 10-6 and the magnetic moment has been determined with a relative uncertainty of 8.9 × 10-6. A g-factor of 5.585 696(50) has been obtained, which is in excellent agreement with previous measurements and predictions. Future experiments shall drive the spin-flip transition in a section of the trap with a homogeneous magnetic field. This has the potential to improve the precision of the measured g-factor of the proton and the antiproton by several orders of magnitude.

  8. Next-to-leading-order correction to pion form factor in k{sub T} factorization

    SciTech Connect

    Li Hsiangnan; Shen Yuelong; Wang Yuming; Zou Hao

    2011-03-01

    We calculate the next-to-leading-order (NLO) correction to the pion electromagnetic form factor at leading twist in the k{sub T} factorization theorem. Partons off-shell by k{sub T}{sup 2} are considered in both quark diagrams and effective diagrams for the transverse-momentum-dependent pion wave function. The light-cone singularities in the transverse-momentum-dependent pion wave function are regularized by rotating the Wilson lines away from the light cone. The soft divergences from gluon exchanges among initial- and fal-state partons cancel exactly. We derive the infrared-finite k{sub T}-dependent NLO hard kernel for the pion electromagnetic form factor by taking the difference of the above two sets of diagrams. Varying the renormalization and factorization scales, we find that the NLO correction is smaller, when both the scales are set to the invariant masses of internal particles: it becomes lower than 40% of the leading-order contribution for momentum transfer squared Q{sup 2}>7 GeV{sup 2}. It is observed that the NLO leading-twist correction does not play an essential role in explaining the experimental data, but the leading-order higher-twist contribution does.

  9. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    DOE PAGESBeta

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; et al

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW(more » $$\\bar{q}$$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $$\\bar{q}$$ = 0.475 fm-1. We find FW($$\\bar{q}$$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($$\\bar{q}$$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.« less

  10. The static properties and form factors of the deuteron using the different forms of the Wood-Saxon potential

    NASA Astrophysics Data System (ADS)

    Rezaei, B.; Dashtimoghadam, A.

    2014-09-01

    The basic properties and form factors of the deuteron system are investigated for the different forms of the Wood-Saxon potential. We have used the Nikiforov-Uvarov (NU) method for analytical solution of the radial Schrodinger equation. A comparison of the calculated values with experimental results are given. It is shown that the obtained results for the modified form of the Wood-Saxon potential are very close to the experimental results in comparison with other forms of the potential.

  11. Pion form factor using domain wall valence quarks and asqtad sea quarks

    SciTech Connect

    George Fleming; Frederic Bonnet; Robert Edwards; Randal Lewis; David Richards

    2004-09-01

    We compute the pion electromagnetic form factor in a hybrid calculation with domain wall valence quarks and improved staggered (asqtad) sea quarks. This method can easily be extended to rho-to-gamma-pi transition form factors.

  12. Overview of nucleon form factor experiments with 12 GeV at Jefferson Lab

    NASA Astrophysics Data System (ADS)

    Cisbani, Evaristo

    2014-06-01

    Since the R. Hofstadter pioneering experiments in the '50s, the measurements of the electromagnetic space-like nucleon form factors (FF's) have been a precious source of information for the understanding of the internal structure of the nucleons. In the last 15 years, the polarization transfer experiments at the Thomas Jefferson National Accelerator Facility (JLab) have undermined our view of the mechanism of the electron scattering and renewed critical interest in the FF measurements. In the coming years, JLab, with its upgraded 12 GeV polarized, high intensity, electron beam combined to new targets and readout equipments, will offer unprecedented opportunities to extend the current proton and neutron FF's measurements to higher momentum transfer Q2 and to improve statistical and uncertainties at lower Q2, where the nucleon size can be accurately investigated. The measurements at high Q2 will provide also new insights on the elusive quark orbital angular momenta, will contribute to constraint two of the nucleon Generalized Parton Distributions that are expected to describe more consistently the nucleon structure, and in general will test the validity of quite a few fundamental nucleon models in a region of transition between perturbative and non perturbative regimes. A selection of the relevant properties of the FF's, and the main results of JLab are shortly reviewed; the new proposed and approved experiments on FF's at JLab are presented addressing some key details, the expected experimental achievements and the new equipment designed for them.

  13. Perturbative QCD analysis of pion and kaon form factors and pair production in photon-photon collisions using a frozen coupling constant

    SciTech Connect

    Ji Chuengryong ); Amiri, F. )

    1990-12-01

    Within the framework of leading-order perturbative QCD and using a frozen coupling constant, we calculate the pion and kaon form factors and the cross section of pion and kaon pair production in two-photon collisions. We use the same frozen coupling constant as taken in the nucleon Dirac-form-factor analysis and find that the results for the {pi} and {ital K} form factors, the reactions {gamma}{gamma}{r arrow}{pi}{sup +}{pi}{sup {minus}},{ital K}{sup +}{ital K}{sup {minus}}, and the proton Dirac form factor are in fair agreement with the available experimental data. The cutoff value of the frozen coupling constant used in our analysis is consistent with the theoretical estimation presented by Cornwall.

  14. Iso-vector form factors of the delta and nucleon in QCD sum rules

    SciTech Connect

    Ozpineci, A.

    2012-10-23

    Form factors are important non-perturbative properties of hadrons. They give information about the internal structure of the hadrons. In this work, iso-vector axial-vector and iso-vector tensor form factors of the nucleon and the iso-vector axial-vector {Delta}{yields}N transition form factor calculations in QCD Sum Rules are presented.

  15. Box products in nilpotent normal form theory: The factoring method

    NASA Astrophysics Data System (ADS)

    Murdock, James

    2016-01-01

    Let N be a nilpotent matrix and consider vector fields x ˙ = Nx + v (x) in normal form. Then v is equivariant under the flow eN*t for the inner product normal form or eMt for the sl2 normal form. These vector equivariants can be found by finding the scalar invariants for the Jordan blocks in N* or M; taking the box product of these to obtain the invariants for N* or M itself; and then boosting the invariants to equivariants by another box product. These methods, developed by Murdock and Sanders in 2007, are here given a self-contained exposition with new foundations and new algorithms yielding improved (simpler) Stanley decompositions for the invariants and equivariants. Ideas used include transvectants (from classical invariant theory), Stanley decompositions (from commutative algebra), and integer cones (from integer programming). This approach can be extended to covariants of sl2k for k > 1, known as SLOCC in quantum computing.

  16. Reversible inhibition of proton release activity and the anesthetic-induced acid-base equilibrium between the 480 and 570 nm forms of bacteriorhodopsin.

    PubMed Central

    Boucher, F; Taneva, S G; Elouatik, S; Déry, M; Messaoudi, S; Harvey-Girard, E; Beaudoin, N

    1996-01-01

    In purple membrane added with general anesthetics, there exists an acid-base equilibrium between two spectral forms of the pigment: bR570 and bR480 (apparent pKa = 7.3). As the purple 570 nm bacteriorhodopsin is reversibly transformed into its red 480 nm form, the proton pumping capability of the pigment reversibly decreases, as indicated by transient proton release measurements and proton translocation action spectra of mixture of both spectral forms. It happens in spite of a complete photochemical activity in bR480 that is mostly characterized by fast deprotonation and slow reprotonation steps and which, under continuous illumination, bleaches with a yield comparable to that of bR570. This modified photochemical activity has a correlated specific photoelectrical counterpart: a faster proton extrusion current and a slower reprotonation current. The relative areas of all photocurrent phases are reduced in bR480, most likely because its photochemistry is accompanied by charge movements for shorter distances than in the native pigment, reflecting a reversible inhibition of the pumping activity. PMID:8789112

  17. Bound Nucleon Form Factors, Quark-Hadron Duality, and the Nuclear EMC Effect

    SciTech Connect

    K. Tsushima; D.H. Lu; W. Melnitchouk; K. Saito; A.W. Thomas

    2002-09-13

    We discuss the electromagnetic form factors, axial form factors, and structure functions of a nucleon bound in the quark-meson coupling (QMC) model. Free space nucleon form factors are calculated using the improved cloudy bag model (ICBM). After describing finite nuclei and nuclear matter in the quark-based (EMC) model, the in-medium modification of the bound nucleon form factors is calculated in the same model. Finally, the bound nucleon structure function, F2, is extracted using the calculated in-medium electromagnetic form factors and Bloom-Gilman (quark-hadron) duality.

  18. Energy transport mechanism in the form of proton soliton in a one-dimensional hydrogen-bonded polypeptide chain.

    PubMed

    Kavitha, L; Priya, R; Ayyappan, N; Gopi, D; Jayanthi, S

    2016-01-01

    The dynamics of protons in a one-dimensional hydrogen-bonded (HB) polypeptide chain (PC) is investigated theoretically. A new Hamiltonian is formulated with the inclusion of higher-order molecular interactions between peptide groups (PGs). The wave function of the excitation state of a single particle is replaced by a new wave function of a two-quanta quasi-coherent state. The dynamics is governed by a higher-order nonlinear Schrödinger equation and the energy transport is performed by the proton soliton. A nonlinear multiple-scale perturbation analysis has been performed and the evolution of soliton parameters such as velocity and amplitude is explored numerically. The proton soliton is thermally stable and very robust against these perturbations. The energy transport by the proton soliton is more appropriate to understand the mechanism of energy transfer in biological processes such as muscle contraction, DNA replication, and neuro-electric pulse transfer on biomembranes. PMID:26198375

  19. Calculation of the positron distribution from 15O nuclei formed in nuclear reactions in human tissue during proton therapy.

    PubMed

    Tuckwell, W; Bezak, E

    2007-05-01

    To measure and verify the dose distribution within a patient during proton therapy, indirect methods must be used. One such method is to use positron emission tomography (PET), which takes advantage of the nuclear reactions that take place between protons and nuclei in the tissue. The dominant nuclear reaction in human muscle tissue involves oxygen nuclei and produces radioactive oxygen-15. Oxygen-15 decays through positron emission, and it is these positrons that go on to annihilate that produce the signal used in the PET technique. Finding the distribution of annihilation points, however, is not analogous to finding the proton dose distribution. The oxygen-15 and positrons travel finite distances within the tissue, blurring the detected PET distribution from the desired proton distribution. Through Monte Carlo modelling, an analysis of the differences between the positron, oxygen-15 and proton distributions has been made. The program SRIM 2003 was used to find the correlation between the three distributions within simulated muscle tissue. Results show that the distal edge of the proton Bragg peak correlates with the detectable positron distribution, which is a section of the dose distribution of interest due to the steep dose gradient and position of adjacent critical structures. PMID:17440247

  20. Assignment of selected hyperfine proton NMR resonances in the met forms of Glycera dibranchiata monomer hemoglobins and comparisons with sperm whale metmyoglobin

    SciTech Connect

    Constantinidis, I.; Satterlee, J.D.; Pandey, R.K.; Leung, H.K.; Smith, K.M.

    1988-04-19

    This work indicates a high degree of purity for our preparations of all three of the primary Glycera dibranchiata monomer hemoglobins and details assignments of the heme methyl and vinyl protons in the hyperfine shift region of the ferric (aquo.) protein forms. The assignments were carried out by reconstituting the apoproteins of each component with selectively deuteriated hemes. The results indicate that even though the individual component preparations consist of essentially a single protein, the proton NMR spectra indicate spectroscopic heterogeneity. Evidence is presented for identification and classification of major and minor protein forms that are present in solutions of each component. Finally, in contrast to previous results, a detailed analysis of the proton hyperfine shift patterns of the major and minor forms of each component, in comparison to the major and minor forms of metmyoglobin, leads to the conclusions that the corresponding forms of the proteins from each species have strikingly similar heme-globin contacts and display nearly identical heme electronic structures and coordination numbers.

  1. Structural transitions of polyadenylic acid due to protonation: the influence of the length of single strands on the polarographic behaviour of the double-helical form

    PubMed Central

    Paleček, Emil; Vetterl, Vladimír; Šponar, Jaroslav

    1974-01-01

    Transition of single-stranded poly(A) into its double-helical protonated form was followed by means of derivative pulse polarography, spectrophotometry, and other methods. It was found that properties of protonated poly(A) depended on the length of single strands from which the protonated double helix was formed. In contrary to longer poly(A) transition of short single-stranded molecules (s20,w lower than about 3) caused practically no decrease in the pulse-polarographic current. It was concluded that the formation of the protonated double helix of poly(A) did not result in the inaccesibility of the reduction sites (located in the vicinity of the surface of the molecule) for the electrode process, as it was in DNA-like double-helical polynucleotides. The current changes observed in the course of transition of longer poly(A) were explained as due to slower transport of long double-stranded molecules to the electrode. PMID:10793676

  2. Chiral perturbation theory and off-shell electromagnetic form factors

    SciTech Connect

    Rudy, T.E.; Fearing, H.W.; Scherer, S.

    1995-05-10

    The off-shell electromagnetic vertex of pions and kaons is calculated to {ital O}({ital p}{sup 4}) in the momentum expansion within the framework of chiral perturbation theory to one loop. The formalism of Gasser and Leutwyler is extended to accommodate the most general form for off-shell Green`s functions in the pseudoscalar meson sector. To that end we identify the structures at {ital O}({ital p}{sup 4}) which were initially removed by using the equation of motion of the lowest-order lagrangian. {copyright} {ital 1995} {ital American} {ital Institute} {ital of} {ital Physics}.

  3. Factors for converting dose measured in polystyrene phantoms to dose reported in water phantoms for incident proton beams

    SciTech Connect

    Moyers, M. F.; Vatnitsky, A. S.; Vatnitsky, S. M.

    2011-10-15

    Purpose: Previous dosimetry protocols allowed calibrations of proton beamline dose monitors to be performed in plastic phantoms. Nevertheless, dose determinations were referenced to absorbed dose-to-muscle or absorbed dose-to-water. The IAEA Code of Practice TRS 398 recommended that dose calibrations be performed with ionization chambers only in water phantoms because plastic-to-water dose conversion factors were not available with sufficient accuracy at the time of its writing. These factors are necessary, however, to evaluate the difference in doses delivered to patients if switching from calibration in plastic to a protocol that only allows calibration in water. Methods: This work measured polystyrene-to-water dose conversion factors for this purpose. Uncertainties in the results due to temperature, geometry, and chamber effects were minimized by using special experimental set-up procedures. The measurements were validated by Monte Carlo simulations. Results: At the peak of non-range-modulated beams, measured polystyrene-to-water factors ranged from 1.015 to 1.024 for beams with ranges from 36 to 315 mm. For beams with the same ranges and medium sized modulations, the factors ranged from 1.005 to 1.019. The measured results were used to generate tables of polystyrene-to-water dose conversion factors. Conclusions: The dose conversion factors can be used at clinical proton facilities to support beamline and patient specific dose per monitor unit calibrations performed in polystyrene phantoms.

  4. Nucleon tensor form factors induced by isovector and isoscalar currents in QCD

    SciTech Connect

    Aliev, T. M.; Savci, M.; Azizi, K.

    2011-10-01

    Using the most general form of the nucleon interpolating current, we calculate the tensor form factors of the nucleon within light cone QCD sum rules. A comparison of our results on tensor form factors with those of the chiral-soliton model and lattice QCD is given.

  5. TH-C-19A-07: Output Factor Dependence On Range and Modulation for a New Proton Therapy System

    SciTech Connect

    Sun, B; Zhao, T; Grantham, K; Goddu, S; Santanam, L; Klein, E

    2014-06-15

    Purpose: Proton treatment planning systems are not able to accurately predict output factors and do not calculate monitor units (MU) for proton fields. Output factors (cGy/MU) for patient-specific fields are usually measured in phantoms or modeled empirically. The purpose of this study is to predict the output factors (OFs) for a given proton (R90) and modulation width (Mod) for the first Mevion S250 proton therapy system. Methods: Using water phantoms and a calibrated ionization chamber-electrometer, over 100 OFs were measured for various R90 and Mod combinations for 24 different options. OFs were measured at the center of the Mod, which coincided with the isocenter. The measured OFs were fitted using an analytic model developed by Kooy (Phys.Med.Biol. 50, 2005) for each option and a derived universal empirical-based polynomial as a function of R90 and Mod for all options. Options are devised for ranges of R90 and Mod. The predicted OFs from both models were compared to measurements. Results: Using the empirical-based model, the values could be predicted to within 3% for at least 90% of measurements and within 5% for 98% of the measurements. Using the analytic model to fit each option with the same effective source position, the prediction is much more accurate. The maximal uncertainty between measured and predicted is within 2% and the averaged root-mean-square is 1.5%. Conclusion: Although the measured data was not exhaustive, both models predicted OFs within acceptable uncertainty. Both models are currently used for a sanity check of our continual patient field OF measurements. As we acquire more patient-field OFs, the model will be refined with an ultimate goal of eliminating the time-consuming patient-specific OF measurements.

  6. Resource Form Factor and Installation of GFA Controllers

    SciTech Connect

    DeSteese, John G.; Hammerstrom, Donald J.

    2009-11-15

    The focus of this task is to optimize the form and placement of a controller comprising the Grid Friendly™ appliance (GFA) controller, power supply and power relay (and/or a solid-state power electronic switch) that would command a domestic water heater to shed its load in response to stress on the electric power grid. The GFA controller would disconnect the water heater from its supply circuit whenever it senses a low voltage signal or other indicators of system stress communicated via the electric power distribution system. Power would be reconnected to the appliance when the GFA controller senses the absence of these signals. This project has also considered more frequent cycling of this controller’s relay switch to perform demand-side frequency regulation. The principal criteria considered in this optimization are reliability, cost and life expectancy of the GFA components. The alternative embodiments of the GFA equipment under consideration are: Option 1- installation inside the insulation space of the water heater between the tank and jacket Option 2 containment in a separate nearby electrical enclosure Option 3 - as a modification or adjunct to the distribution panel housing and/or the breaker that protects the water heater supply circuit.

  7. Mechanisms for Two-Step Proton Transfer Reactions in the Outward-Facing Form of MATE Transporter.

    PubMed

    Nishima, Wataru; Mizukami, Wataru; Tanaka, Yoshiki; Ishitani, Ryuichiro; Nureki, Osamu; Sugita, Yuji

    2016-03-29

    Bacterial pathogens or cancer cells can acquire multidrug resistance, which causes serious clinical problems. In cells with multidrug resistance, various drugs or antibiotics are extruded across the cell membrane by multidrug transporters. The multidrug and toxic compound extrusion (MATE) transporter is one of the five families of multidrug transporters. MATE from Pyrococcus furiosus uses H(+) to transport a substrate from the cytoplasm to the outside of a cell. Crystal structures of MATE from P. furiosus provide essential information on the relevant H(+)-binding sites (D41 and D184). Hybrid quantum mechanical/molecular mechanical simulations and continuum electrostatic calculations on the crystal structures predict that D41 is protonated in one structure (Straight) and, both D41 and D184 protonated in another (Bent). All-atom molecular dynamics simulations suggest a dynamic equilibrium between the protonation states of the two aspartic acids and that the protonation state affects hydration in the substrate binding cavity and lipid intrusion in the cleft between the N- and C-lobes. This hypothesis is examined in more detail by quantum mechanical/molecular mechanical calculations on snapshots taken from the molecular dynamics trajectories. We find the possibility of two proton transfer (PT) reactions in Straight: the 1st PT takes place between side-chains D41 and D184 through a transient formation of low-barrier hydrogen bonds and the 2nd through another H(+) from the headgroup of a lipid that intrudes into the cleft resulting in a doubly protonated (both D41 and D184) state. The 1st PT affects the local hydrogen bond network and hydration in the N-lobe cavity, which would impinge on the substrate-binding affinity. The 2nd PT would drive the conformational change from Straight to Bent. This model may be applicable to several prokaryotic H(+)-coupled MATE multidrug transporters with the relevant aspartic acids. PMID:27028644

  8. Proton Transport

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrew; DeVincenzi, Donald L. (Technical Monitor)

    2001-01-01

    The transport of protons across membranes is an essential process for both bioenergetics of modern cells and the origins of cellular life. All living systems make use of proton gradients across cell walls to convert environmental energy into a high-energy chemical compound, adenosine triphosphate (ATP), synthesized from adenosine diphosphate. ATP, in turn, is used as a source of energy to drive many cellular reactions. The ubiquity of this process in biology suggests that even the earliest cellular systems were relying on proton gradient for harvesting environmental energy needed to support their survival and growth. In contemporary cells, proton transfer is assisted by large, complex proteins embedded in membranes. The issue addressed in this Study was: how the same process can be accomplished with the aid of similar but much simpler molecules that could have existed in the protobiological milieu? The model system used in the study contained a bilayer membrane made of phospholipid, dimyristoylphosphatidylcholine (DMPC) which is a good model of the biological membranes forming cellular boundaries. Both sides of the bilayer were surrounded by water which simulated the environment inside and outside the cell. Embedded in the membrane was a fragment of the Influenza-A M$_2$ protein and enough sodium counterions to maintain system neutrality. This protein has been shown to exhibit remarkably high rates of proton transport and, therefore, is an excellent model to study the formation of proton gradients across membranes. The Influenza M$_2$ protein is 97 amino acids in length, but a fragment 25 amino acids long. which contains a transmembrane domain of 19 amino acids flanked by three amino acids on each side. is sufficient to transport protons. Four identical protein fragments, each folded into a helix, aggregate to form small channels spanning the membrane. Protons are conducted through a narrow pore in the middle of the channel in response to applied voltage. This

  9. Highly Efficient Small Form Factor LED Retrofit Lamp

    SciTech Connect

    Steven Allen; Fred Palmer; Ming Li

    2011-09-11

    This report summarizes work to develop a high efficiency LED-based MR16 lamp downlight at OSRAM SYLVANIA under US Department of Energy contract DE-EE0000611. A new multichip LED package, electronic driver, and reflector optic were developed for these lamps. At steady-state, the lamp luminous flux was 409 lumens (lm), luminous efficacy of 87 lumens per watt (LPW), CRI (Ra) of 87, and R9 of 85 at a correlated color temperature (CCT) of 3285K. The LED alone achieved 120 lumens per watt efficacy and 600 lumen flux output at 25 C. The driver had 90% electrical conversion efficiency while maintaining excellent power quality with power factor >0.90 at a power of only 5 watts. Compared to similar existing MR16 lamps using LED sources, these lamps had much higher efficacy and color quality. The objective of this work was to demonstrate a LED-based MR16 retrofit lamp for replacement of 35W halogen MR16 lamps having (1) luminous flux of 500 lumens, (2) luminous efficacy of 100 lumens per watt, (3) beam angle less than 40{sup o} and center beam candlepower of at least 1000 candelas, and (4) excellent color quality.

  10. Semi-analytical model for output factor calculations in proton beam therapy with consideration for the collimator aperture edge

    NASA Astrophysics Data System (ADS)

    Kase, Yuki; Yamashita, Haruo; Sakama, Makoto; Mizota, Manabu; Maeda, Yoshikazu; Tameshige, Yuji; Murayama, Shigeyuki

    2015-08-01

    In the development of an external radiotherapy treatment planning system, the output factor (OPF) is an important value for the monitor unit calculations. We developed a proton OPF calculation model with consideration for the collimator aperture edge to account for the dependence of the OPF on the collimator aperture and distance in proton beam therapy. Five parameters in the model were obtained by fitting with OPFs measured by a pinpoint chamber with the circular radiation fields of various field radii and collimator distances. The OPF model calculation using the fitted model parameters could explain the measurement results to within 1.6% error in typical proton treatment beams with 6- and 12 cm SOBP widths through a range shifter and a circular aperture more than 10.6 mm in radius. The calibration depth dependences of the model parameters were approximated by linear or quadratic functions. The semi-analytical OPF model calculation was tested with various MLC aperture shapes that included circles of various sizes as well as a rectangle, parallelogram, and L-shape for an intermediate proton treatment beam condition. The pre-calculated OPFs agreed well with the measured values, to within 2.7% error up to 620 mm in the collimator distance, though the maximum difference was 5.1% in the case of the largest collimator distance of 740 mm. The OPF calculation model would allow more accurate monitor unit calculations for therapeutic proton beams within the expected range of collimator conditions in clinical use.

  11. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... of Transportation Cost Factors. 247.372 Section 247.372 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT TRANSPORTATION Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors....

  12. Up- and Down-Quark Contributions to the Nucleon Form Factors

    NASA Astrophysics Data System (ADS)

    Qattan, I. A.; Arrington, J.

    2014-03-01

    Recent measurements of the neutron s electric to magnetic form factors ratio, Rn = µnGnE/GnM, up to 3.4 (GeV/c)2 combined with existing Rp = µpGpE/GpM measurements in the same Q2 range allowed, for the first time, a separation of the up- and downquark contributions to the form factors at high Q2, as presented by Cates, et al.. Our analysis expands on the original work by including additional form factor data, applying two-photon exchange (TPE) corrections, and accounting for the uncertainties associated with all of the form factor measurements.

  13. On soft theorems and form factors in N=4 SYM theory

    NASA Astrophysics Data System (ADS)

    Bork, L. V.; Onishchenko, A. I.

    2015-12-01

    Soft theorems for the form factors of 1/2-BPS and Konishi operator super-multiplets are derived at tree level in N=4 SYM theory. They have a form identical to the one in the amplitude case. For MHV sectors of stress tensor and Konishi operator supermultiplets loop corrections to soft theorems are considered at one loop level. They also appear to have universal form in the soft limit. Possible generalization of the on-shell diagrams to the form factors based on leading soft behavior is suggested. Finally, we give some comments on inverse soft limit and integrability of form factors in the limit q 2 → 0.

  14. Factor Structure and Construct Validity of the Counselor Skills Personal Development Rating Form.

    ERIC Educational Resources Information Center

    Torres-Rivera, Edil; Wilbur, Michael P.; Maddux, Cleborne D.; Smaby, Marlowe H.; Phan, Loan T.; Roberts-Wilbur, Janice

    2002-01-01

    Presents an exploratory factor analysis of the scores of 248 counselors-in-training on the Counselor Skills Personal Development Rating Form (CSPD-RF). Authors of the test hypothesized that the CPSD-RF measured 2 factors, personal development and skills development. Factor analysis revealed 4 factors accounting for 58.4% of the total variance,…

  15. Factors influencing the accuracy of beam range estimation in proton therapy using prompt gamma emission

    NASA Astrophysics Data System (ADS)

    Janssen, FMFC; Landry, G.; Cambraia Lopes, P.; Dedes, G.; Smeets, J.; Schaart, D. R.; Parodi, K.; Verhaegen, F.

    2014-08-01

    In-vivo imaging is a strategy to monitor the range of protons inside the patient during radiation treatment. A possible method of in-vivo imaging is detection of secondary ‘prompt’ gamma (PG) photons outside the body, which are produced by inelastic proton-nuclear interactions inside the patient. In this paper, important parameters influencing the relationship between the PG profile and percentage depth dose (PDD) in a uniform cylindrical phantom are explored. Monte Carlo simulations are performed with the new Geant4 based code TOPAS for mono-energetic proton pencil beams (range: 100-250 MeV) and an idealized PG detector. PG depth profiles are evaluated using the inflection point on a sigmoid fit in the fall-off region of the profile. A strong correlation between the inflection point and the proton range determined from the PDD is found for all conditions. Variations between 1.5 mm and 2.7 mm in the distance between the proton range and the inflection point are found when either the mass density, phantom diameter, or detector acceptance angle is changed. A change in cut-off energy of the detector could induce a range difference of maximum 4 mm. Applying time-of-flight discrimination during detection, changing the primary energy of the beam or changing the elemental composition of the tissue affects the accuracy of the range prediction by less than 1 mm. The results indicate that the PG signal is rather robust to many parameter variations, but millimetre accurate range monitoring requires all medium and detector properties to be carefully taken into account.

  16. Factors influencing the accuracy of beam range estimation in proton therapy using prompt gamma emission.

    PubMed

    Janssen, F M F C; Landry, G; Cambraia Lopes, P; Dedes, G; Smeets, J; Schaart, D R; Parodi, K; Verhaegen, F

    2014-08-01

    In-vivo imaging is a strategy to monitor the range of protons inside the patient during radiation treatment. A possible method of in-vivo imaging is detection of secondary 'prompt' gamma (PG) photons outside the body, which are produced by inelastic proton-nuclear interactions inside the patient. In this paper, important parameters influencing the relationship between the PG profile and percentage depth dose (PDD) in a uniform cylindrical phantom are explored. Monte Carlo simulations are performed with the new Geant4 based code TOPAS for mono-energetic proton pencil beams (range: 100-250 MeV) and an idealized PG detector. PG depth profiles are evaluated using the inflection point on a sigmoid fit in the fall-off region of the profile. A strong correlation between the inflection point and the proton range determined from the PDD is found for all conditions. Variations between 1.5 mm and 2.7 mm in the distance between the proton range and the inflection point are found when either the mass density, phantom diameter, or detector acceptance angle is changed. A change in cut-off energy of the detector could induce a range difference of maximum 4 mm. Applying time-of-flight discrimination during detection, changing the primary energy of the beam or changing the elemental composition of the tissue affects the accuracy of the range prediction by less than 1 mm. The results indicate that the PG signal is rather robust to many parameter variations, but millimetre accurate range monitoring requires all medium and detector properties to be carefully taken into account. PMID:25049223

  17. Strange quark contribution to the vector and axial form factors of the nucleon: Combined analysis of data from the G0, HAPPEx, and Brookhaven E734 experiments

    SciTech Connect

    Pate, Stephen F.; McKee, David W.; Papavassiliou, Vassili

    2008-07-15

    The strange quark contribution to the vector and axial form factors of the nucleon has been determined for momentum transfers in the range 0.45form factors G{sub E}{sup s} and G{sub M}{sup s}, with little sensitivity to the strange axial form factor G{sub A}{sup s}. However, elastic neutrino scattering at low Q{sup 2} is dominated by the axial form factor, with some significant sensitivity to the vector form factors as well. Combination of the two data sets allows the simultaneous extraction of G{sub E}{sup s},G{sub M}{sup s}, and G{sub A}{sup s} over a significant range of Q{sup 2} for the very first time. The Q{sup 2} dependence of the strange axial form factor suggests that the strange quark contribution to the proton spin, {delta}s, is negative.

  18. SU-E-T-491: Importance of Energy Dependent Protons Per MU Calibration Factors in IMPT Dose Calculations Using Monte Carlo Technique

    SciTech Connect

    Randeniya, S; Mirkovic, D; Titt, U; Guan, F; Mohan, R

    2014-06-01

    Purpose: In intensity modulated proton therapy (IMPT), energy dependent, protons per monitor unit (MU) calibration factors are important parameters that determine absolute dose values from energy deposition data obtained from Monte Carlo (MC) simulations. Purpose of this study was to assess the sensitivity of MC-computed absolute dose distributions to the protons/MU calibration factors in IMPT. Methods: A “verification plan” (i.e., treatment beams applied individually to water phantom) of a head and neck patient plan was calculated using MC technique. The patient plan had three beams; one posterior-anterior (PA); two anterior oblique. Dose prescription was 66 Gy in 30 fractions. Of the total MUs, 58% was delivered in PA beam, 25% and 17% in other two. Energy deposition data obtained from the MC simulation were converted to Gy using energy dependent protons/MU calibrations factors obtained from two methods. First method is based on experimental measurements and MC simulations. Second is based on hand calculations, based on how many ion pairs were produced per proton in the dose monitor and how many ion pairs is equal to 1 MU (vendor recommended method). Dose distributions obtained from method one was compared with those from method two. Results: Average difference of 8% in protons/MU calibration factors between method one and two converted into 27 % difference in absolute dose values for PA beam; although dose distributions preserved the shape of 3D dose distribution qualitatively, they were different quantitatively. For two oblique beams, significant difference in absolute dose was not observed. Conclusion: Results demonstrate that protons/MU calibration factors can have a significant impact on absolute dose values in IMPT depending on the fraction of MUs delivered. When number of MUs increases the effect due to the calibration factors amplify. In determining protons/MU calibration factors, experimental method should be preferred in MC dose calculations

  19. Skyrme model πNN form factor and the sea quark distribution of the nucleon

    NASA Astrophysics Data System (ADS)

    Fries, R. J.; Schäfer, A.

    1998-06-01

    We calculate the sea quark distribution of the nucleon in a meson cloud model. The novel feature of our calculation is the implementation of a special πNN form factor recently obtained by Holzwarth and Machleidt. This form factor is hard for small and soft for large momentum transfers. We show that this feature leads to a substantial improvement.

  20. Form factors in quantum integrable models with GL(3)-invariant R-matrix

    NASA Astrophysics Data System (ADS)

    Pakuliak, S.; Ragoucy, E.; Slavnov, N. A.

    2014-04-01

    We study integrable models solvable by the nested algebraic Bethe ansatz and possessing GL(3)-invariant R-matrix. We obtain determinant representations for form factors of off-diagonal entries of the monodromy matrix. These representations can be used for the calculation of form factors and correlation functions of the XXX SU(3)-invariant Heisenberg chain.

  1. Nucleon form factors from high statistics mixed-action calculations with 2+1 flavors

    SciTech Connect

    Schroers, Wolfram; Edwards, Robert G; Engelhardt, Michael; Fleming, George Taminga; Hagler, Philipp; Lin, Huey-Wen; Lin, Mei-Feng; Meyer, Harvey B; Musch, Bernhard; Negele, John W; Orginos, Kostas; Pochinsky, Andrew V; Procura, Massimiliano; Renner, Dru B; Richards, David G; Syritsyn, Sergey N; Walker-Loud, Andre P

    2009-12-01

    We present new high-statistics results for nucleon form factors at pion masses of approximately 290, 350, 500, and 600 MeV using a mixed action of domain wall valence quarks on an improved staggered sea. We perform chiral fits to both vector and axial form factors and compare our results to experiment.

  2. Ratio of aerosol and gases of radioactive chlorine and particle size distribution of aerosol formed by high-energy proton irradiation.

    PubMed

    Yokoyama, S; Sato, K; Manabe, K; Noguchi, H; Kaneko, H; Oki, Y; Iida, T; Tanaka, Su

    2007-01-01

    To estimate internal doses due to the inhalation of radionuclides produced by the nuclear spallation of the air nuclei in high-energy proton accelerator facilities, the physicochemical properties of radionuclides are very important. Thus, the ratio of aerosol and gases of 38Cl and 39Cl formed by irradiating argon gas-added air with a 48 MeV proton beam has been measured. Radionuclides of 38Cl and 39Cl exist as aerosol, acid gas and non-acid gas. The percentages of activity of 38Cl and 39Cl aerosols are about 80%. The number size distributions of non-radioactive aerosol were characterised by two peaks with diameters of 10-20 nm and larger than 20 nm. As a result predicted by a simple surface model, it was found that the activity size distribution of 38Cl aerosols can be regarded as that having a single peak at 120 nm. PMID:18033760

  3. Two-Photon Exchange in Elastic Electron-Proton Scattering: A QCD Factorization Approach

    SciTech Connect

    Kivel, Nikolai; Vanderhaeghen, Marc

    2009-08-28

    We estimate the two-photon exchange contribution to elastic electron-proton scattering at large momentum transfer Q{sup 2}. It is shown that the leading two-photon exchange amplitude behaves as 1/Q{sup 4}, and can be expressed in a model independent way in terms of the leading twist nucleon distribution amplitudes. Using several models for the nucleon distribution amplitudes, we provide estimates for existing data and for ongoing experiments.

  4. Simultaneous Precipitation of Solar Protons and Relativistic Electrons as a New Factor Affecting the Earth's Atmosphere

    NASA Astrophysics Data System (ADS)

    Shirochkov, A. V.; Sokolov, S. N.

    In the field of solar - terrestrial physics during the last decade there has been renewed interest in the effects produced in the Earth atmosphere and ionosphere by fluxes of precipitated highly relativistic electrons. A series of investigation on the subject (preferably by means of satellite measurements) was performed recently, which discussed different aspects of these phenomena called HRE events. More careful study of the HRE events revealed previously unnoticed geophysical phenomenon: a great majority of the solar proton events (SPE) were accompanied by simultaneous precipitation of relativistic electron fluxes. The studies of previous SPE events attributed their atmospheric and ionospheric effects entirely to the solar proton fluxes. It turned out that such an assumption is wrong. Therefore we have actually a new class of geophysical phenomena when the Earth's atmosphere and ionosphere experience combined impact of simultaneously precipitating fluxes of solar protons and relativistic electrons. If one takes into accounts effect of enhanced density of the solar wind during the SPEs (i.e. its dynamic pressure) the real situation during these combined events became more complicated. In this paper the effects during the storm of May 1992 are analyzed as an example of such unusual combination. The methods of separation of the effects produced by different precipitation particles are presented. Other similar events are considered to demonstrate that such complex events are not unique geophysical phenomena.

  5. Axial form factors of the octet baryons in a covariant quark model

    NASA Astrophysics Data System (ADS)

    Ramalho, G.; Tsushima, K.

    2016-07-01

    We study the weak interaction axial form factors of the octet baryons, within the covariant spectator quark model, focusing on the dependence of four-momentum transfer squared, Q2. In our model the axial form factors GA(Q2) (axial-vector form factor) and GP(Q2) (induced pseudoscalar form factor) are calculated based on the constituent quark axial form factors and the octet baryon wave functions. The quark axial current is parametrized by the two constituent quark form factors, the axial-vector form factor gAq(Q2), and the induced pseudoscalar form factor gPq(Q2). The baryon wave functions are composed of a dominant S -state and a P -state mixture for the relative angular momentum of the quarks. First, we study in detail the nucleon case. We assume that the quark axial-vector form factor gAq(Q2) has the same function form as that of the quark electromagnetic isovector form factor. The remaining parameters of the model, the P -state mixture and the Q2 dependence of gPq(Q2), are determined by a fit to the nucleon axial form factor data obtained by lattice QCD simulations with large pion masses. In this lattice QCD regime the meson cloud effects are small, and the physics associated with the valence quarks can be better calibrated. Once the valence quark model is calibrated, we extend the model to the physical regime and use the low Q2 experimental data to estimate the meson cloud contributions for GA(Q2) and GP(Q2). Using the calibrated quark axial form factors and the generalization of the nucleon wave function for the other octet baryon members, we make predictions for all the possible weak interaction axial form factors GA(Q2) and GP(Q2) of the octet baryons. The results are compared with the corresponding experimental data for GA(0 ) and with the estimates of baryon-meson models based on S U (6 ) symmetry.

  6. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 3 2013-10-01 2013-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  7. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 3 2012-10-01 2012-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  8. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 3 2011-10-01 2011-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  9. 48 CFR 247.372 - DD Form 1654, Evaluation of Transportation Cost Factors.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 3 2014-10-01 2014-10-01 false DD Form 1654, Evaluation... Transportation in Supply Contracts 247.372 DD Form 1654, Evaluation of Transportation Cost Factors. Contracting personnel may use the DD Form 1654 to furnish information to the transportation office for development...

  10. Off-shell electromagnetic form factors of pions and kaons in chiral perturbation theory

    SciTech Connect

    Rudy, T.E.; Fearing, H.W.; Scherer, S. )

    1994-07-01

    The off-shell electromagnetic vertex of a (pseudo)scalar particle contains, in general, two form factors [ital F] and [ital G] which depend, in addition to the squared momentum transfer, on the invariant masses associated with the initial and final legs of the vertex. Chiral perturbation theory to one loop is used to calculate the off-shell form factors of pions and kaons. The formalism of Gasser and Leutwyler, which was previously used to calculate the on-shell limit of the form factor [ital F], is extended to accommodate the most general form for off-shell Green's functions in the pseudoscalar meson sector. We find that chiral symmetry predicts that the form factors [ital F] of the charged pions and kaons go off-shell in the same way, i.e., the off-shell slope at the real photon point is given by the same new phenomenological constant [beta][sub 1]. Furthermore, it is shown that at order [ital p][sup 4] the form factor [ital F] of the [ital K][sup 0] does not show any off-shell dependence. The form factors [ital G] are all related to the form factors [ital F] in the correct fashion as required by the Ward-Takahashi identity. Numerical results for different off-shell kinematics are presented.

  11. A Factor Analytic Study of the Coopersmith Self-Esteem Inventory Adult Short Form.

    ERIC Educational Resources Information Center

    Haines, Janet; Wilson, George V.

    1988-01-01

    A factor analysis was conducted on the Coopersmith Self-Esteem Inventory-Adult Short Form using 237 college students and 43 female office workers in Australia. Factors were found corresponding with three of the four subscales: general self, social self-peers, and home-parents (family). No factor related to the school-academic (work) subscale. (SLD)

  12. An Investigation of the Factor Structure and Convergent and Discriminant Validity of the Five-Factor Model Rating Form

    ERIC Educational Resources Information Center

    Samuel, Douglas B.; Mullins-Sweatt, Stephanie N.; Widiger, Thomas A.

    2013-01-01

    The Five-Factor Model Rating Form (FFMRF) is a one-page measure designed to provide an efficient assessment of the higher order domains of the Five Factor Model (FFM) as well as the more specific, lower order facets proposed by McCrae and Costa. Although previous research has suggested that the FFMRF's assessment of the lower order facets converge…

  13. The neutron electric form factor to Q² = 1.45 (GeV/c)²

    SciTech Connect

    Bradley Plaster

    2004-02-01

    The nucleon elastic electromagnetic form factors are fundamental quantities needed for an understanding of nucleon and nuclear electromagnetic structure. The evolution of the Sachs electric and magnetic form factors with Q2, the square of the four-momentum transfer, is related to the distribution of charge and magnetization within the nucleon. High precision measurements of the nucleon form factors are essential for stringent tests of our current theoretical understanding of confinement within the nucleon. Measurements of the neutron form factors, in particular, those of the neutron electric form factor, have been notoriously difficult due to the lack of a free neutron target and the vanishing integral charge of the neutron. Indeed, a precise measurement of the neutron electric form factor has eluded experimentalists for decades; however, with the advent of high duty-factor polarized electron beam facilities, experiments employing polarization degrees of freedom have finally yielded the first precise measurements of this fundamental quantity. Following a general overview of the experimental and theoretical status of the nucleon form factors, a detailed description of an experiment designed to extract the neutron electric form factor from measurements of the neutron's recoil polarization in quasielastic 2H(e, e')1H scattering is presented. The experiment described here employed the Thomas Jefferson National Accelerator Facility's longitudinally polarized electron beam, a magnetic spectrometer for detection of the scattered electron, and a neutron polarimeter designed specifically for this experiment. Measurements were conducted at three Q2 values of 0.45, 1.13, and 1.45 (GeV/c)2, and the final results extracted from an analysis of the data acquired in this experiment are reported and compared with recent theoretical predictions for the nucleon form factors.

  14. Monte Carlo simulations of neutron spectral fluence, radiation weighting factor and ambient dose equivalent for a passively scattered proton therapy unit

    NASA Astrophysics Data System (ADS)

    Zheng, Yuanshui; Fontenot, Jonas; Taddei, Phil; Mirkovic, Dragan; Newhauser, Wayne

    2008-01-01

    Stray neutron exposures pose a potential risk for the development of secondary cancer in patients receiving proton therapy. However, the behavior of the ambient dose equivalent is not fully understood, including dependences on neutron spectral fluence, radiation weighting factor and proton treatment beam characteristics. The objective of this work, therefore, was to estimate neutron exposures resulting from the use of a passively scattered proton treatment unit. In particular, we studied the characteristics of the neutron spectral fluence, radiation weighting factor and ambient dose equivalent with Monte Carlo simulations. The neutron spectral fluence contained two pronounced peaks, one a low-energy peak with a mode around 1 MeV and one a high-energy peak that ranged from about 10 MeV up to the proton energy. The mean radiation weighting factors varied only slightly, from 8.8 to 10.3, with proton energy and location for a closed-aperture configuration. For unmodulated proton beams stopped in a closed aperture, the ambient dose equivalent from neutrons per therapeutic absorbed dose (H*(10)/D) calculated free-in-air ranged from about 0.3 mSv/Gy for a small scattered field of 100 MeV proton energy to 19 mSv/Gy for a large scattered field of 250 MeV proton energy, revealing strong dependences on proton energy and field size. Comparisons of in-air calculations with in-phantom calculations indicated that the in-air method yielded a conservative estimation of stray neutron radiation exposure for a prostate cancer patient.

  15. Concerted O atom-proton transfer in the O—O bond forming step in water oxidation

    SciTech Connect

    Chen, Zuofeng; Concepcion, Javier C.; Hu, Xiangqian; Yang, Weitao; Hoertz, Paul G.; Meyer, Thomas J

    2010-04-20

    As the terminal step in photosystem II, and a potential half-reaction for artificial photosynthesis, water oxidation (2H2O → O2 + 4e- + 4H+) is key, but it imposes a significant mechanistic challenge with requirements for both 4e-/4H- loss and O—O bond formation. Significant progress in water oxidation catalysis has been achieved recently by use of single-site Ru metal complex catalysts such as [Ru(Mebimpy)(bpy)(OH2)]2+ [Mebimpy = 2,6-bis(1-methylbenzimidazol-2-yl)pyridine; bpy = 2,2'-bipyridine]. When oxidized from RuII-OH22+ to RuV = O3+, these complexes undergo O—O bond formation by O-atom attack on a H2O molecule, which is often the rate-limiting step. Microscopic details of O—O bond formation have been explored by quantum mechanical/molecular mechanical (QM/MM) simulations the results of which provide detailed insight into mechanism and a strategy for enhancing catalytic rates. It utilizes added bases as proton acceptors and concerted atom–proton transfer (APT) with O-atom transfer to the O atom of a water molecule in concert with proton transfer to the base (B). Base catalyzed APT reactivity in water oxidation is observed both in solution and on the surfaces of oxide electrodes derivatized by attached phosphonated metal complex catalysts. These results have important implications for catalytic, electrocatalytic, and photoelectrocatalytic water oxidation.

  16. On-shell diagrams, Graßmannians and integrability for form factors

    NASA Astrophysics Data System (ADS)

    Frassek, Rouven; Meidinger, David; Nandan, Dhritiman; Wilhelm, Matthias

    2016-01-01

    We apply on-shell and integrability methods that have been developed in the context of scattering amplitudes in {N}=4 SYM theory to tree-level form factors of this theory. Focussing on the colour-ordered super form factors of the chiral part of the stress-tensor multiplet as an example, we show how to systematically construct on-shell diagrams for these form factors with the minimal form factor as further building block in addition to the three-point amplitudes. Moreover, we obtain analytic representations in terms of Graßmannian integrals in spinor helicity, twistor and momentum twistor variables. While Yangian invariance is broken by the operator insertion, we find that the form factors are eigenstates of the integrable spin-chain transfer matrix built from the monodromy matrix that yields the Yangian generators. Constructing them via the method of R operators allows to introduce deformations that preserve the integrable structure. We finally show that the integrable properties extend to minimal tree-level form factors of generic composite operators as well as certain leading singularities of their n-point loop-level form factors.

  17. An experimental survey of the factors that affect leaching from low-level radioactive waste forms

    SciTech Connect

    Dougherty, D.R.; Pietrzak, R.F.; Fuhrmann, M.; Colombo, P.

    1988-09-01

    This report represents the results of an experimental survey of the factors that affect leaching from several types of solidified low-level radioactive waste forms. The goal of these investigations was to determine those factors that accelerate leaching without changing its mechanism(s). Typically, although not in every case,the accelerating factors include: increased temperature, increased waste loading (i.e., increased waste to binder ratio), and decreased size (i.e., decreased waste form volume to surface area ratio). Additional factors that were studied were: increased leachant volume to waste form surface area ratio, pH, leachant composition (groundwaters, natural and synthetic chelating agents), leachant flow rate or replacement frequency and waste form porosity and surface condition. Other potential factors, including the radiation environment and pressure, were omitted based on a survey of the literature. 82 refs., 236 figs., 13 tabs.

  18. Can Nonrelativistic QCD Explain the γ γ*→ηc Transition Form Factor Data?

    NASA Astrophysics Data System (ADS)

    Feng, Feng; Jia, Yu; Sang, Wen-Long

    2015-11-01

    Unlike the bewildering situation in the γ γ*→π form factor, a widespread view is that perturbative QCD can decently account for the recent BABAR measurement of the γ γ*→ηc transition form factor. The next-to-next-to-leading-order perturbative correction to the γ γ*→ηc ,b form factor, is investigated in the nonrelativistic QCD (NRQCD) factorization framework for the first time. As a byproduct, we obtain, by far, the most precise order-αs2 NRQCD matching coefficient for the ηc ,b→γ γ process. After including the substantial negative order-αs2 correction, the good agreement between NRQCD prediction and the measured γ γ*→ηc form factor is completely ruined over a wide range of momentum transfer squared. This eminent discrepancy casts some doubts on the applicability of the NRQCD approach to hard exclusive reactions involving charmonium.

  19. The effects of density-dependent form factors for (e, e'p) reaction in quasi-elastic region

    NASA Astrophysics Data System (ADS)

    Kim, K. S.; Cheoun, Myung-Ki; Kim, Hungchong; So, W. Y.

    2016-04-01

    Within the framework of a relativistic single particle model, the effects of density-dependent electromagnetic form factors on the exclusive (e,e'p) reaction are investigated in the quasi-elastic region. The density-dependent electromagnetic form factors are generated from a quark-meson coupling model and used to calculate the cross sections in two different densities, either at the normal density of ρ_0 ˜ 0.15 fm^-3 or at the lower density, 0.5ρ_0 . Then these cross sections are analyzed in the two different kinematics: One is that the momentum of the outgoing nucleon is along the momentum transfer. The other is that the angle between the momentum of the outgoing nucleon and the momentum transfer is varied at fixed magnitude of the momentum of the outgoing nucleon. Our theoretical differential reduced cross sections are compared with the NIKHEF data for the 208 Pb( e, e'p) reaction, which is related to the probability that a bound nucleon from a given orbit can be knocked-out of the nucleus. The effects of the density-dependent form factors increase the differential cross sections for both knocked-out proton and neutron by an amount of a few percent. Moreover they are shown to be almost the same within only a few percent, i.e., nearly independent of the shell location of knockout nucleons. These results are quite consistent with the characteristics of double magic nuclei which have relatively sharp smearing in the density distribution.

  20. Two-photon exchange and elastic electron-proton scattering

    SciTech Connect

    Peter Blunden; Wally Melnitchouk; John Tjon

    2003-06-01

    Two-photon exchange contributions to elastic electron-proton scattering cross sections are evaluated in a simple hadronic model including the finite size of the proton. The corrections are found to be small, but with a strong angular dependence at fixed Q{sup 2}. This is significant for the Rosenbluth technique for determining the ratio of electric and magnetic form factors of the proton, and partly reconciles the apparent discrepancy with the results of the polarization transfer technique.

  1. Interaction between droplets in a ternary microemulsion evaluated by the relative form factor method

    SciTech Connect

    Nagao, Michihiro; Seto, Hideki; Yamada, Norifumi L.

    2007-06-15

    This paper describes the concentration dependence of the interaction between water droplets coated by a surfactant monolayer using the contrast variation small-angle neutron scattering technique. In the first part, we explain the idea of how to extract a relatively model free structure factor from the scattering data, which is called the relative form factor method. In the second part, the experimental results for the shape of the droplets (form factor) are described. In the third part the relatively model free structure factor is shown, and finally the concentration dependence of the interaction potential between droplets is discussed. The result indicates the validity of the relative form factor method, and the importance of the estimation of the model free structure factor to discuss the nature of structure formation in microemulsion systems.

  2. Delta and Omega electromagnetic form factors in a Dyson-Schwinger/Bethe-Salpeter approach

    SciTech Connect

    Diana Nicmorus, Gernot Eichmann, Reinhard Alkofer

    2010-12-01

    We investigate the electromagnetic form factors of the Delta and the Omega baryons within the Poincare-covariant framework of Dyson-Schwinger and Bethe-Salpeter equations. The three-quark core contributions of the form factors are evaluated by employing a quark-diquark approximation. We use a consistent setup for the quark-gluon dressing, the quark-quark bound-state kernel and the quark-photon interaction. Our predictions for the multipole form factors are compatible with available experimental data and quark-model estimates. The current-quark mass evolution of the static electromagnetic properties agrees with results provided by lattice calculations.

  3. Parity-Violating Electron Scattering and the Electric and Magnetic Strange Form Factors of the Nucleon

    SciTech Connect

    Armstrong, David S.; McKeown, Robert

    2012-11-01

    Measurement of the neutral weak vector form factors of the nucleon provides unique access to the strange quark content of the nucleon. These form factors can be studied using parity-violating electron scattering. A comprehensive program of experiments has been performed at three accelerator laboratories to determine the role of strange quarks in the electromagnetic form factors of the nucleon. This article reviews the remarkable technical progress associated with this program, describes the various methods used in the different experiments, and summarizes the physics results along with recent theoretical calculations.

  4. Modification of generalized vector form factors and transverse charge densities of the nucleon in nuclear matter

    NASA Astrophysics Data System (ADS)

    Jung, Ju-Hyun; Yakhshiev, Ulugbek; Kim, Hyun-Chul

    2016-03-01

    We investigate the medium modification of the generalized vector form factors of the nucleon, which include the electromagnetic and energy-momentum tensor form factors, based on an in-medium modified π -ρ -ω soliton model. We find that the vector form factors of the nucleon in nuclear matter fall off faster than those in free space, which implies that the charge radii of the nucleon become larger in nuclear medium than in free space. We also compute the corresponding transverse charge densities of the nucleon in nuclear matter, which clearly reveal the increasing of the nucleon size in nuclear medium.

  5. Pion Form Factor in Chiral Limit of Hard-Wall AdS/QCD Model

    SciTech Connect

    Anatoly Radyushkin; Hovhannes Grigoryan

    2007-12-01

    We develop a formalism to calculate form factor and charge density distribution of pion in the chiral limit using the holographic dual model of QCD with hard-wall cutoff. We introduce two conjugate pion wave functions and present analytic expressions for these functions and for the pion form factor. They allow to relate such observables as the pion decay constant and the pion charge electric radius to the values of chiral condensate and hard-wall cutoff scale. The evolution of the pion form factor to large values of the momentum transfer is discussed, and results are compared to existing experimental data.

  6. A Semi-Empirical Method to Estimate the Response Factors for VOCs in Proton-Transfer Reaction Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Li, S.; Leithead, A.; De Gouw, J. A.; Warneke, C.; Graus, M.; Veres, P. R.; Murphy, S. M.

    2013-12-01

    Volatile organic compounds are essential in sustaining atmospheric chemical processes which lie at the heart of most atmospheric environmental issues. Recent advances in VOC measurement technologies have allowed rapid detection of the primary VOCs and their oxidation products. Proton-Transfer-Reaction Mass Spectrometry (PTRMS) has been widely used to determine air concentrations of many hydrocarbons and oxygenated hydrocarbons rapidly. The recent advance in PTRMS with time-of-flight mass (TOF) detection, allows hundreds of VOC compounds to be detected simultaneously and rapidly. Converting these detected signals into air concentrations is a challenge. This is usually accomplished with calibrations using a limited number of target compounds at known concentrations. However, for the hundreds of masses in the PTR mass spectrum particularly from TOF detectors, conversion to air concentration is not always practical nor possible if their compound identities are not known. Here, we have developed a new method to estimate the response factors for VOCs to convert the measured ion signals into air concentrations. This method is based on semi-empirical calculations of the rate constants for the proton transfer reactions between the hydronium ion and target hydrocarbons using polarizabilities and permanent dipole moments, and extrapolation to unknown hydrocarbons. The method is further validated with calibration results for selected hydrocarbons. Using these response factors, conversion to air concentrations for many signals in a PTR MS of unknown chemical structures can be accomplished.

  7. Double protonation of 1,5-bis(triarylaminoethynyl)anthraquinone to form a paramagnetic pentacyclic dipyrylium salt.

    PubMed

    Rao, Koya Prabhakara; Kusamoto, Tetsuro; Toshimitsu, Fumiyuki; Inayoshi, Kiyotaka; Kume, Shoko; Sakamoto, Ryota; Nishihara, Hiroshi

    2010-09-01

    Protonation-induced intramolecular cyclization reactions of new donor (D)-acceptor (A) and D-A-D conjugated molecules 1-triarylaminoethynylanthraquinone (1-AmAq) and 1,5-bis(triarylaminoethynyl)anthraquinone (1,5-Am(2)Aq), respectively, were achieved. The former undergoes monoprotonation with bis(trifluoromethanesulfone)imide acid (TFSIH) to give pyrylium salt [1-AmPyl]TFSI, whereas the latter undergoes a novel double proton cyclization reaction to yield 1,5-bis(triarylamino)dipyrylium salt [1,5-Am(2)Pyl(2)](TFSI)(2) with a new pentacyclic backbone. This divalent cationic salt can be reduced to give the neutral species 2,8-bis(triarylamino)benzo[de]isochromeno[1,8-gh]chromene ([1,5-Am(2)Pyl(2)](0)), which maintains the planar pentacyclic backbone. The obtained condensed-ring compounds show unique optical, electrochemical, and magnetic properties due to the extremely narrow HOMO-LUMO gap. In particular, the dication [1,5-Am(2)Pyl(2)](2+) shows paramagnetic behavior with two spins centered on two triarylamine moieties through valence tautomerization with the pentacyclic backbone. PMID:20718415

  8. Electrochemical studies of protonated and deprotonated forms of heteroleptic and homoleptic europium{sup (III)} and dysprosium{sup (III)} porphyrin double-deckers

    SciTech Connect

    Spyroulias, G.A.; Coutsolelos, A.G.; Montauzon, D. de; Poilblanc, R.

    1996-12-31

    Lanthanide {open_quotes}sandwich{close_quotes}-type porphyrins are those with double-decker or triple-decker structures of the form M(por){sub 2} or M{sub 2}(por){sub 3} where (por) is the dianion of the porphyrin ring. The cyclic voltammetric oxidation, of heteroleptic and homoleptic lanthanide porphyrin double-deckers demonstrates the presence of equilibrium protonated/deprotonated species present in CH{sub 2}Cl{sub 2}, DMF, and THF. 20 refs., 3 figs., 2 tabs.

  9. SU-E-T-464: On the Equivalence of the Quality Correction Factor for Pencil Beam Scanning Proton Therapy

    SciTech Connect

    Sorriaux, J; Paganetti, H; Testa, M; Giantsoudi, D; Schuemann, J; Bertrand, D; Orban de Xivry, J.; Lee, J; Palmans, H; Vynckier, S; Sterpin, E

    2014-06-01

    Purpose: In current practice, most proton therapy centers apply IAEA TRS-398 reference dosimetry protocol. Quality correction factors (kQ) take into account in the dose determination process the differences in beam qualities used for calibration unit and for treatment unit. These quality correction factors are valid for specific reference conditions. TRS-398 reference conditions should be achievable in both scattered proton beams (i.e. DS) and scanned proton beams (i.e. PBS). However, it is not a priori clear if TRS-398 kQ data, which are based on Monte Carlo (MC) calculations in scattered beams, can be used for scanned beams. Using TOPAS-Geant4 MC simulations, the study aims to determine whether broad beam quality correction factors calculated in TRS-398 can be directly applied to PBS delivery modality. Methods: As reference conditions, we consider a 10×10×10 cm{sup 3} homogeneous dose distribution delivered by PBS system in a water phantom (32/10 cm range/modulation) and an air cavity placed at the center of the spread-out-Bragg-peak. In order to isolate beam differences, a hypothetical broad beam is simulated. This hypothetical beam reproduces exactly the same range modulation, and uses the same energy layers than the PBS field. Ion chamber responses are computed for the PBS and hypothetical beams and then compared. Results: For an air cavity of 2×2×0.2 cm{sup 3}, the ratio of ion chamber responses for the PBS and hypothetical beam qualities is 0.9991 ± 0.0016. Conclusion: Quality correction factors are insensitive to the delivery pattern of the beam (broad beam or PBS), as long as similar dose distributions are achieved. This investigation, for an air cavity, suggests that broad beam quality correction factors published in TRS-398 can be applied for scanned beams. J. Sorriaux is financially supported by a public-private partnership involving the company Ion Beam Applications (IBA)

  10. Exotic Protonated Species Produced by UV-Induced Photofragmentation of a Protonated Dimer: Metastable Protonated Cinchonidine.

    PubMed

    Alata, Ivan; Scuderi, Debora; Lepere, Valeria; Steinmetz, Vincent; Gobert, Fabrice; Thiao-Layel, Loïc; Le Barbu-Debus, Katia; Zehnacker-Rentien, Anne

    2015-10-01

    A metastable protonated cinchona alkaloid was produced in the gas phase by UV-induced photodissociation (UVPD) of its protonated dimer in a Paul ion trap. The infrared multiple photon dissociation (IRMPD) spectrum of the molecular ion formed by UVPD was obtained and compared to DFT calculations to characterize its structure. The protonation site obtained thereby is not accessible by classical protonation ways. The protonated monomer directly formed in the ESI source or by collision-induced dissociation (CID) of the dimer undergoes protonation at the most basic alkaloid nitrogen. In contrast, protonation occurs at the quinoline aromatic ring nitrogen in the UVPD-formed monomer. PMID:26347997

  11. Nucleon electromagnetic form factors on the lattice and in chiral effective field theory

    SciTech Connect

    Goeckeler, M.; Hemmert, T.R.; Horsley, R.; Pleiter, D.; Rakow, P.E.L.; Schaefer, A.; Schierholz, G.

    2005-02-01

    We compute the electromagnetic form factors of the nucleon in quenched lattice QCD, using nonperturbatively improved Wilson fermions, and compare the results with phenomenology and chiral effective field theory.

  12. Form factors in the Bullough-Dodd-related models: The Ising model in a magnetic field

    NASA Astrophysics Data System (ADS)

    Alekseev, O. V.

    2012-11-01

    We consider a certain modification of the free-field representation of the form factors in the Bullough-Dodd model. The two-particle minimal form factors are eliminated from the construction. We consequently obtain a convenient representation for the multiparticle form factors, establish recurrence relations between them, and study their properties. We use the proposed construction to obtain the free-field representation of form factors for the lightest particles in the Φ 1,2 -perturbed minimal models. As an important example, we consider the Ising model in a magnetic field. We verify that the results obtained in the framework of the proposed free-field representation agree with the corresponding results obtained by solving the bootstrap equations.

  13. Form factors in the Bullough-Dodd related models: The Ising model in a magnetic field

    NASA Astrophysics Data System (ADS)

    Alekseev, O. V.

    2012-04-01

    A particular modification of the free-field representation of the form factors in the Bullough-Dodd model is considered. The two-particles minimal form factors are excluded from the construction. As a consequence, a convenient representation for the multiparticle form factors has been obtained, recurrence relations between them have been established, and their properties have been studied. The proposed construction is used to obtain the free-field representation of the lightest particles form factors in the Φ1, 2 perturbed minimal models. The Ising model in a magnetic field is considered as a significant example. The results obtained in the framework of the proposed free-field representation are in agreement with the corresponding results obtained by solving the bootstrap equations.

  14. Comments on world-sheet form factors in AdS/CFT

    NASA Astrophysics Data System (ADS)

    Klose, Thomas; McLoughlin, Tristan

    2014-02-01

    We study form factors in the light-cone gauge world-sheet theory for strings in AdS5 ×S5. We perturbatively calculate the two-particle form factor in a closed \\mathfrak {su}(2) sector to one-loop in the near-plane-wave limit and to two-loops in the Maldacena-Swanson limit. We also perturbatively solve the functional equation which follows from the form factor axioms for the world-sheet theory and show that the ‘minimal’ solution correctly reproduces the discontinuities of the perturbative calculations. Finally we propose a prescription, valid for polynomial orders of the inverse world-sheet length, for extracting the finite-volume world-sheet matrix element from the form factors and show that the two-excitation matrix element matches with the thermodynamic limit of the spin-chain description of certain tree-level N=4 SYM structure constants.

  15. Nucleon-to-{delta} axial transition form factors in relativistic baryon chiral perturbation theory

    SciTech Connect

    Geng, L. S.; Camalich, J. Martin; Alvarez-Ruso, L.; Vacas, M. J. Vicente

    2008-07-01

    We report a theoretical study of the axial nucleon-to-delta (1232) (N{yields}{delta}) transition form factors up to one-loop order in relativistic baryon chiral perturbation theory. We adopt a formalism in which the {delta} couplings obey the spin-3/2 gauge symmetry and, therefore, decouple the unphysical spin-1/2 fields. We compare the results with phenomenological form factors obtained from neutrino bubble-chamber data and in quark models.

  16. Isospin-symmetry breaking effects on the strange electric and magnetic form factors of the nucleon

    SciTech Connect

    Xia Zhengtong; Zuo Wei

    2008-07-15

    We examine the electric and magnetic strange form factors of the nucleon in the pseudoscalar-vector SU(3) Skyrme model, with special emphasis on the effects of isospin symmetry breaking (ISB). It is found that ISB has a nontrivial effect on the strange vector form factors of the nucleon and its contribution to the nucleon strangeness is significantly larger than one might naively expect. Our calculations and discussions may be of some significance for the experimental extraction of the authentic strangeness.

  17. Interpreting the neutron's electric form factor: Rest frame charge distribution or foldy term?

    SciTech Connect

    Nathan Isgur

    1998-12-01

    The neutron's electric form factor contains vital information on nucleon structure, but its interpretation within many models has been obscured by relativistic effects. The author demonstrates that, to leading order in the relativistic expansion of a constituent quark model, the Foldy term cancels exactly against a contribution to the Dirac form factor F{sub 1} to leave intact the naive interpretation of G{sup n}{sub E} as arising from the neutron's rest frame charge distribution.

  18. $$B\\to Kl^+l^-$$ decay form factors from three-flavor lattice QCD

    DOE PAGESBeta

    Bailey, Jon A.

    2016-01-27

    We compute the form factors for the B → Kl+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2+1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensivemore » examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. Lastly, we use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.« less

  19. Effects of core deformations and collective rotational currents on electron-nucleus magnetic form factors

    SciTech Connect

    Lin, C.K.

    1983-01-01

    The collective model H/sub int/ + H/sub coll/ is used to study the magnetic form factors. For the intrinsic Hamiltonian, we use the Nilsson model to generate the intrinsic state. For the collective Hamiltonian, two models are considered, the rigid body model and the liquid soap model. We use the particle-rotor model to derive the collective operators and their reduced matrix elements, and then apply this model to the elastic M1 form factor of /sup 13/C. One sees clearly the interplay of the intrinsic form factor and the collective form factor. Since the form factor is essentially a Fourier transform of the current density operator, one also sees the effects of the collective current density distribution due to all the particles in addition to that of the intrinsic current due to the unpaired nucleons. The effects of core deformation are explored. This includes discussions on the difference between the variation before projection and the variation after projection. Analytic results are obtained in the case of weak deformations. The collective model focuses on the effects of the quadrupole deformation on the M1 form factor of /sup 13/C, whereas the calculation involving core polarization stresses the monopole effects. By introducing a quenching of the isovector g/sub s/, the fits by the collective models are very comparable to the fit by the core polarization, although the justification for this procedure in light nuclei is questionable.

  20. B →K l+l- decay form factors from three-flavor lattice QCD

    NASA Astrophysics Data System (ADS)

    Bailey, Jon A.; Bazavov, A.; Bernard, C.; Bouchard, C. M.; DeTar, C.; Du, Daping; El-Khadra, A. X.; Foley, J.; Freeland, E. D.; Gámiz, E.; Gottlieb, Steven; Heller, U. M.; Jain, R. D.; Komijani, J.; Kronfeld, A. S.; Laiho, J.; Levkova, L.; Liu, Yuzhi; Mackenzie, P. B.; Meurice, Y.; Neil, E. T.; Qiu, Si-Wei; Simone, J. N.; Sugar, R.; Toussaint, D.; Van de Water, R. S.; Zhou, Ran; Fermilab Lattice; MILC Collaborations

    2016-01-01

    We compute the form factors for the B →K l+l- semileptonic decay process in lattice QCD using gauge-field ensembles with 2 +1 flavors of sea quark, generated by the MILC Collaboration. The ensembles span lattice spacings from 0.12 to 0.045 fm and have multiple sea-quark masses to help control the chiral extrapolation. The asqtad improved staggered action is used for the light valence and sea quarks, and the clover action with the Fermilab interpretation is used for the heavy b quark. We present results for the form factors f+(q2), f0(q2), and fT(q2), where q2 is the momentum transfer, together with a comprehensive examination of systematic errors. Lattice QCD determines the form factors for a limited range of q2, and we use the model-independent z expansion to cover the whole kinematically allowed range. We present our final form-factor results as coefficients of the z expansion and the correlations between them, where the errors on the coefficients include statistical and all systematic uncertainties. We use this complete description of the form factors to test QCD predictions of the form factors at high and low q2.

  1. Charged pion form factor between $Q^2$=0.60 and 2.45 GeV$^2$. II. Determination of, and results for, the pion form factor

    SciTech Connect

    Huber, Garth; Blok, Henk; Horn, Tanja; Beise, Elizabeth; Gaskell, David; Mack, David; Tadevosyan, Vardan; Volmer, Jochen; Abbott, David; Aniol, Konrad; Anklin, Heinz; Armstrong, Christopher; Arrington, John; Assamagan, Ketevi; Avery, Steven; Baker, O.; Barrett, Robert; Bochna, Christopher; Boeglin, Werner; Brash, Edward; Breuer, Herbert; Chang, C.; Chang, C.C.; Chant, Nicholas; Christy, Michael; Dunne, James; Eden, Thomas; Ent, Rolf; Fenker, Benjamin; Gibson, Edward; Gilman, Ronald; Gustafsson, Kenneth; Hinton, Wendy; Holt, Roy; Jackson, Harold; uk Jin, Seong; Jones, Mark; Keppel, Cynthia; Kim, pyunghun; Kim, Wooyoung; King, Paul; Klein, Andreas; Koltenuk, Douglas; Kovaltchouk, Vitali; Liang, Meihua; Liu, Jinghua; Lolos, George; Lung, Allison; Margaziotis, Demetrius; Markowitz, Pete; Matsumura, Akihiko; McKee, David; Meekins, David; Mitchell, Joseph; Miyoshi, Toshinobu; Mkrtchyan, Hamlet; Mueller, Robert; Niculescu, Gabriel; Niculescu, Maria-Ioana; Okayasu, Yuichi; Pentchev, Lubomir; Perdrisat, Charles; Pitz, David; Potterveld, David; Punjabi, Vina; Qin, Liming; Reimer, Paul; Reinhold, Joerg; Roche, Julie; Roos, Philip; Sarty, Adam; Shin, Ilkyoung; Smith, Gregory; Stepanyan, Stepan; Tang, Liguang; Tvaskis, Vladas; van der Meer, Rob; Vansyoc, Kelley; Van Westrum, Derek; Vidakovic, Sandra; Vulcan, William; Warren, Glen; Wood, Stephen; Xu, Chen; Yan, Chen; Zhao, Wenxia; Zheng, Xiaochao; Zihlmann, Benedikt

    2008-10-01

    DOI: http://dx.doi.org/10.1103/PhysRevC.78.045203
    The charged pion form factor, Fpi(Q2), is an important quantity that can be used to advance our knowledge of hadronic structure. However, the extraction of Fpi from data requires a model of the 1H(e,e'pi+)n reaction and thus is inherently model dependent. Therefore, a detailed description of the extraction of the charged pion form factor from electroproduction data obtained recently at Jefferson Lab is presented, with particular focus given to the dominant uncertainties in this procedure. Results for Fpi are presented for Q2=0.60-2.45 GeV2. Above Q2=1.5 GeV2, the Fpi values are systematically below the monopole parametrization that describes the low Q2 data used to determine the pion charge radius. The pion form factor can be calculated in a wide variety of theoretical approaches, and the experimental results are compared to a number of calculations. This comparison is helpful in understanding the role of soft versus hard c

  2. Factor Structure and Psychometric Properties of the Young Schema Questionnaire (Short Form) in Chinese Undergraduate Students

    ERIC Educational Resources Information Center

    Cui, Lixia; Lin, Wenwen; Oei, Tian P. S.

    2011-01-01

    This study investigated cross-cultural differences in the factor structure and psychometric properties of the Young Schema Questionnaire (short form; YSQ-SF). The participants were 712 Chinese undergraduate students. The total sample was randomly divided into two sub-samples. Exploratory Factor Analysis (EFA) was conducted on questionnaire results…

  3. Forms, Factors and Consequences of Cheating in University Examinations: Insight from Open and Distance Learning Students

    ERIC Educational Resources Information Center

    Mokula, Lebeloane Lazarus Donald; Lovemore, Nyaumwe

    2014-01-01

    The present study narrated the forms, factors and consequences of cheating in university examinations by UNISA Open and Distance learning students from anecdotal data. The results showed that the perpetrators mostly used crib materials on paper, ruler and calculator cover. The factors that influenced examination cheating were gender, age range and…

  4. Form factors of the transitions {gamma}{sup *}{pi}{sup 0} {r_arrow} {gamma} and {gamma}{sup *}{eta}{r_arrow}{gamma}

    SciTech Connect

    Afanasev, A.

    1994-04-01

    The author discusses possibilities to study {gamma}*{pi}{sup 0} and {gamma}*{eta} {r_arrow} {gamma} transition form factors at CEBAF energies. The author shows that for 4 GeV electron beam, these form factors can be measured at CEBAF for the 4-momentum transfers Q{sup 2} {le} 2.5 (GeV/c){sup 2} using virtual Compton scattering on the proton and nuclear target in the kinematic regime of low momentum transfers to the target. These measurements can be extended to Q{sup 2} {le} 4.0 (GeV/c){sup 2} using the electron beam with the energy 6 GeV.

  5. One-pion exchange current effects on magnetic form factor in the relativistic formalism

    NASA Astrophysics Data System (ADS)

    Zhang, Cun; Liu, Jian; Ren, Zhongzhou

    2016-08-01

    One-pion exchange current effects on the magnetic form factors of some odd nuclei are studied in the relativistic formalism. The Dirac wave functions of nucleons are calculated from the relativistic mean-field theory. After fitting to experimental data by quenching factors, it is found that taking the one-pion exchange currents into account gives a better description of the magnetic form factor. The root-mean-square radii of the valance nucleon orbits are also calculated in RMF model, which coincide with experimental radii extracted with meson exchange current corrections.

  6. B to tensor meson form factors in the perturbative QCD approach

    SciTech Connect

    Wang Wei

    2011-01-01

    We calculate the B{sub u,d,s}{yields}T form factors within the framework of the perturbative QCD approach, where T denotes a light tensor meson with J{sup P}=2{sup +}. Because of the similarities between the wave functions of a vector and a tensor meson, the factorization formulas of B{yields}T form factors can be obtained from the B{yields}V transition through a replacement rule. As a consequence, we find that these two sets of form factors have the same signs and correlated q{sup 2}-dependence behaviors. At q{sup 2}=0 point, the B{yields}T form factors are smaller than the B{yields}V ones, in accordance with the experimental data of radiative B decays. In addition, we use our results for the form factors to explore semilteptonic B{yields}Tl{nu}{sub l} decays and the branching fractions can reach the order 10{sup -4}.

  7. Regularization of multi-soliton form factors in sine-Gordon model

    NASA Astrophysics Data System (ADS)

    Pálmai, T.

    2012-08-01

    A general and systematic regularization is developed for the exact solitonic form factors of exponential operators in the (1+1)-dimensional sine-Gordon model by analytical continuation of their integral representations. The procedure is implemented in Mathematica. Test results are shown for four- and six-soliton form factors. Catalogue identifier: AEMG_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEMG_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 1462 No. of bytes in distributed program, including test data, etc.: 15 488 Distribution format: tar.gz Programming language: Mathematica [1] Computer: PC Operating system: Cross-platform Classification: 7.7, 11.1, 23 Nature of problem: The multi-soliton form factors of the sine-Gordon model (relevant in two-dimensional physics) were given only by highly non-trivial integral representation with a limited domain of convergence. Practical applications of the form factors, e.g. calculation of correlation functions in two-dimensional condensed matter systems, were not possible in general. Solution method: Using analytic continuation techniques an efficient algorithm is found and implemented in Mathematica, which provides a general and systematic way to calculate multi-soliton form factors in the sine-Gordon model. The package contains routines to compute the two-, four- and six-soliton form factors. Running time: Strongly dependent on the desired accuracy and the number of solitons. For physical rapidities after an initialization of about 30 s, the calculation of the two-, four- and six-soliton form factors at a single point takes approximately 0.5 s, 2.5 s and 8 s, respectively. Wolfram Research, Inc., Mathematica Edition: Version 7.0, Wolfram Research, Inc., Champaign, Illinois, 2008.

  8. Proton transfer dynamics at the membrane/water interface: dependence on the fixed and mobile pH buffers, on the size and form of membrane particles, and on the interfacial potential barrier.

    PubMed

    Cherepanov, Dmitry A; Junge, Wolfgang; Mulkidjanian, Armen Y

    2004-02-01

    Crossing the membrane/water interface is an indispensable step in the transmembrane proton transfer. Elsewhere we have shown that the low dielectric permittivity of the surface water gives rise to a potential barrier for ions, so that the surface pH can deviate from that in the bulk water at steady operation of proton pumps. Here we addressed the retardation in the pulsed proton transfer across the interface as observed when light-triggered membrane proton pumps ejected or captured protons. By solving the system of diffusion equations we analyzed how the proton relaxation depends on the concentration of mobile pH buffers, on the surface buffer capacity, on the form and size of membrane particles, and on the height of the potential barrier. The fit of experimental data on proton relaxation in chromatophore vesicles from phototropic bacteria and in bacteriorhodopsin-containing membranes yielded estimates for the interfacial potential barrier for H(+)/OH(-) ions of approximately 120 meV. We analyzed published data on the acceleration of proton equilibration by anionic pH buffers and found that the height of the interfacial barrier correlated with their electric charge ranging from 90 to 120 meV for the singly charged species to >360 meV for the tetra-charged pyranine. PMID:14747306

  9. Anti-sense DNA d(GGCCCC)n expansions in C9ORF72 form i-motifs and protonated hairpins.

    PubMed

    Kovanda, Anja; Zalar, Matja; Šket, Primož; Plavec, Janez; Rogelj, Boris

    2015-01-01

    The G4C2 hexanucleotide repeat expansion mutation (HREM) in C9ORF72, represents the most common mutation associated with amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). Three main disease mechanisms have been proposed to date: C9ORF72 haploinsufficiency, RNA toxicity, and accumulation of dipeptide repeat proteins. Pure GC content of the HREM potentially enables the formation of various non-B DNA structures such as G-quadruplexes and i-motifs. These structures are proposed to act as promoters and regulatory elements affecting replication, transcription and translation of the surrounding region. G-quadruplexes have already been shown on the G-rich sense DNA and RNA strands (G4C2)n, the structure of the anti-sense (G2C4)n strand remains unresolved. Similar C-rich sequences may, under acidic conditions, form i-motifs consisting of two parallel duplexes in a head to tail orientation held together by hemi-protonated C(+)-C pairs. We show that d(G2C4)n repeats do form i-motif and protonated hairpins even under near-physiological conditions. Rather than forming a DNA duplex, i-motifs persist even in the presence of the sense strand. This preferential formation of G-quadruplex and i-motif/hairpin structures over duplex DNA, may explain HREM replicational and transcriptional instability. Furthermore, i-motifs/hairpins can represent a novel pharmacological target for C9ORF72 associated ALS and FTLD. PMID:26632347

  10. Anti-sense DNA d(GGCCCC)n expansions in C9ORF72 form i-motifs and protonated hairpins

    PubMed Central

    Kovanda, Anja; Zalar, Matja; Šket, Primož; Plavec, Janez; Rogelj, Boris

    2015-01-01

    The G4C2 hexanucleotide repeat expansion mutation (HREM) in C9ORF72, represents the most common mutation associated with amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). Three main disease mechanisms have been proposed to date: C9ORF72 haploinsufficiency, RNA toxicity, and accumulation of dipeptide repeat proteins. Pure GC content of the HREM potentially enables the formation of various non-B DNA structures such as G-quadruplexes and i-motifs. These structures are proposed to act as promoters and regulatory elements affecting replication, transcription and translation of the surrounding region. G-quadruplexes have already been shown on the G-rich sense DNA and RNA strands (G4C2)n, the structure of the anti-sense (G2C4)n strand remains unresolved. Similar C-rich sequences may, under acidic conditions, form i-motifs consisting of two parallel duplexes in a head to tail orientation held together by hemi-protonated C+-C pairs. We show that d(G2C4)n repeats do form i-motif and protonated hairpins even under near-physiological conditions. Rather than forming a DNA duplex, i-motifs persist even in the presence of the sense strand. This preferential formation of G-quadruplex and i-motif/hairpin structures over duplex DNA, may explain HREM replicational and transcriptional instability. Furthermore, i-motifs/hairpins can represent a novel pharmacological target for C9ORF72 associated ALS and FTLD. PMID:26632347

  11. Factor structure of the Minnesota Satisfaction Questionnaire short form for restaurant employees.

    PubMed

    Hancer, Mura; George, R Thomas

    2004-02-01

    The factor structure of the Minnesota Satisfaction Questionnaire short form for nonsupervisory restaurant employees was explored in questions among 2000 employees of three full-service restaurant chains operating in midwestern United States. A total of 2000 surveys were distributed to hourly employees of the three chains. From the mailing, 924 surveys were returned and found useable, a 46.2% response rate. Principal factors analysis identified a four-factor structure for the employees, in contrast to the original two-factor structure, but as in other studies the structure was multifactorial. PMID:15077790

  12. Weak charge form factor and radius of 208Pb through parity violation in electron scattering

    SciTech Connect

    Horowitz, C. J.; Ahmed, Z.; Jen, C. -M.; Rakhman, A.; Souder, P. A.; Dalton, M. M.; Liyanage, N.; Paschke, K. D.; Saenboonruang, K.; Silwal, R.; Franklin, G. B.; Friend, M.; Quinn, B.; Kumar, K. S.; McNulty, D.; Mercado, L.; Riordan, S.; Wexler, J.; Michaels, R. W.; Urciuoli, G. M.

    2012-03-26

    We use distorted wave electron scattering calculations to extract the weak charge form factor FW($\\bar{q}$), the weak charge radius RW, and the point neutron radius Rn, of 208Pb from the PREX parity violating asymmetry measurement. The form factor is the Fourier transform of the weak charge density at the average momentum transfer $\\bar{q}$ = 0.475 fm-1. We find FW($\\bar{q}$) = 0.204 ± 0.028(exp) ± 0.001(model). We use the Helm model to infer the weak radius from FW($\\bar{q}$). We find RW = 5.826 ± 0.181(exp) ± 0.027(model) fm. Here the exp error includes PREX statistical and systematic errors, while the model error describes the uncertainty in RW from uncertainties in the surface thickness σ of the weak charge density. The weak radius is larger than the charge radius, implying a 'weak charge skin' where the surface region is relatively enriched in weak charges compared to (electromagnetic) charges. We extract the point neutron radius Rn = 5.751 ± 0.175 (exp) ± 0.026(model) ± 0.005(strange) fm, from RW. Here there is only a very small error (strange) from possible strange quark contributions. We find Rn to be slightly smaller than RW because of the nucleon's size. As a result, we find a neutron skin thickness of Rn-Rp = 0.302 ± 0.175 (exp) ± 0.026 (model) ± 0.005 (strange) fm, where Rp is the point proton radius.

  13. Proton Therapy - Accelerating Protons to Save Lives

    SciTech Connect

    Keppel, Cynthia

    2011-10-25

    In 1946, physicist Robert Wilson first suggested that protons could be used as a form of radiation therapy in the treatment of cancer because of the sharp drop-off that occurs on the distal edge of the radiation dose. Research soon confirmed that high-energy protons were particularly suitable for treating tumors near critical structures, such as the heart and spinal column. The precision with which protons can be delivered means that more radiation can be deposited into the tumor while the surrounding healthy tissue receives substantially less or, in some cases, no radiation. Since these times, particle accelerators have continuously been used in cancer therapy and today new facilities specifically designed for proton therapy are being built in many countries. Proton therapy has been hailed as a revolutionary cancer treatment, with higher cure rates and fewer side effects than traditional X-ray photon radiation therapy. Proton therapy is the modality of choice for treating certain small tumors of the eye, head or neck. Because it exposes less of the tissue surrounding a tumor to the dosage, proton therapy lowers the risk of secondary cancers later in life - especially important for young children. To date, over 80,000 patients worldwide have been treated with protons. Currently, there are nine proton radiation therapy facilities operating in the United States, one at the Hampton University Proton Therapy Institute. An overview of the treatment technology and this new center will be presented.

  14. Measurement of strange-quark contributions to the nucleon's form factors at Q(2) = 0.230 (GeV/c)(2).

    PubMed

    Maas, F E; Achenbach, P; Aulenbacher, K; Baunack, S; Capozza, L; Diefenbach, J; Grimm, K; Imai, Y; Hammel, T; von Harrach, D; Kabuss, E M; Kothe, R; Lee, J H; Lorente, A; Lopes Ginja, A; Nungesser, L; Schilling, E; Stephan, G; Weinrich, C; Altarev, I; Arvieux, J; Collin, B; Frascaria, R; Guidal, M; Kunne, R; Marchand, D; Morlet, M; Ong, S; van de Wiele, J; Kowalski, S; Plaster, B; Suleiman, R; Taylor, S

    2004-07-01

    We report on a measurement of the parity-violating asymmetry in the scattering of longitudinally polarized electrons on unpolarized protons at a Q2 of 0.230 (GeV/c)(2) and a scattering angle of theta (e) = 30 degrees - 40 degrees. Using a large acceptance fast PbF2 calorimeter with a solid angle of delta omega = 0.62 sr, the A4 experiment is the first parity violation experiment to count individual scattering events. The measured asymmetry is A(phys)=(-5.44+/-0.54(stat)+/-0.26(sys))x10(-6). The standard model expectation assuming no strangeness contributions to the vector form factors is A(0) = (-6.30+/-0.43) x 10(-6). The difference is a direct measurement of the strangeness contribution to the vector form factors of the proton. The extracted value is G(s)(E) + 0.225G(s)(M) = 0.039+/-0.034 or F(s)(1) + 0.130F(s)(2) = 0.032+/-0.028. PMID:15323904

  15. Flux line lattice form factor and paramagnetic effects in type II superconductors

    NASA Astrophysics Data System (ADS)

    Ichioka, Masanori; Machida, Kazushige

    2009-03-01

    Based on the quasiclassical Eilenberger theory, we investigate the vortex structure in type II superconductors with strong Pauli-paramagnetic contributions due to the Zeeman effect. We quantitatively study how the paramagnetic effect suppresses the superconductivity, and evaluate the flux line lattice (FLL) form factor from the calculated internal field distribution both in the s-wave and d-wave pairings. When the paramagnetic effects are strong, the intensity of the FLL form factor increases toward Hc2 as a function of an applied field, instead of exponential decay. This anomalous field dependence is due to the induced paramagnetic moments around the vortex core. We discuss the anomalous field-dependence of the FLL form factor observed by the small angle neutron scattering in CeCoIn5.

  16. Kaon semileptonic decay (Kl3) form factors from the instanton vacuum

    NASA Astrophysics Data System (ADS)

    Nam, Seung-Il; Kim, Hyun-Chul

    2007-05-01

    We investigate the kaon semileptonic decay (Kl3) form factors within the framework of the nonlocal chiral quark model (χQM) from the instanton vacuum, taking into account the effects of flavor SU(3) symmetry breaking. We also consider the problem of gauge invariance arising from the momentum-dependent quark mass in the present work. All theoretical calculations are carried out without any adjustable parameter, the average instanton size (ρ˜1/3fm) and the interinstanton distance (R˜1fm) having been fixed. We also show that the present results satisfy the Callan-Treiman low-energy theorem as well as the Ademollo-Gatto theorem. Using the Kl3 form factors, we evaluate relevant physical quantities. It turns out that the effects of flavor SU(3) symmetry breaking are essential in reproducing the kaon semileptonic form factors. The present results are in good agreement with experiments, and are compatible with other model calculations.

  17. Electromagnetic form factors of the {Omega}{sup -} in lattice QCD

    SciTech Connect

    Alexandrou, C.; Korzec, T.; Koutsou, G.; Negele, J. W.; Proestos, Y.

    2010-08-01

    We present results on the omega baryon ({Omega}{sup -}) electromagnetic form factors using N{sub f}=2+1 domain-wall fermion configurations for three pion masses in the range of about 350 to 300 MeV. We compare results obtained using domain-wall fermions with those of a mixed-action (hybrid) approach, which combines domain-wall valence quarks on staggered sea quarks, for a pion mass of about 350 MeV. We pay particular attention in the evaluation of the subdominant electric quadrupole form factor to sufficient accuracy to exclude a zero value, by constructing a sequential source that isolates it from the dominant form factors. The {Omega}{sup -} magnetic moment, {mu}{sub {Omega}}{sup -}, and the electric charge and magnetic radius, , are extracted for these pion masses. The electric quadrupole moment is determined for the first time using dynamical quarks.

  18. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    PubMed

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  19. The Neutron Magnetic Form Factor at High Q{sup 2}: Experimental Status, Future Measurements

    SciTech Connect

    Will Brooks

    2002-05-01

    Recent progress in improving our knowledge of the four nucleon form factors G{sup p}{sub M}, G{sup p}{sub E}, G{sup n}{sub M}, G{sup n}{sub E} at high momentum transfer is stimulating a new wave of theoretical efforts to describe these fundamental quantities. Both model calculations and lattice QCD can predict the elastic form factors; a definitive, stringent test of these efforts is to predict all of them simultaneously. However, the limited range and quality of the data for the neutron magnetic form factor G{sup n}{sub M} presently reduce the discriminating power of such a test. The present status of our knowledge of G{sup n}{sub M} is discussed, and prospects for future improvements are presented.

  20. $D$ semileptonic form factors and $|V_{cs(d)}|$ from 2+1 flavor lattice QCD

    SciTech Connect

    Bailey, Jon A.; Bazavov, A.; El-Khadra, A.X.; Gottlieb, Steven; Jain, R.D.; Kronfeld, A.S.; Van de Water, R.S.; Zhou, R.

    2011-11-01

    The measured partial widths of the semileptonic decays D {yields} K{ell}{nu} and D {yields} {pi}{ell}{nu} can be combined with the form factors calculated on the lattice to extract the CKM matrix elements |V{sub cs}| and |V{sub cd}|. The lattice calculations can be checked by comparing the form factor shapes from the lattice and experiment. We have generated a sizable data set by using heavy clover quarks with the Fermilab interpretation for charm and asqtad staggered light quarks on 2+1 flavor MILC ensembles with lattice spacings of approximately 0.12, 0.09, 0.06, and 0.045 fm. Preliminary fits to staggered chiral perturbation theory suggest that we can reduce the uncertainties in the form factors at q{sup 2} = 0 to below 5%.

  1. Nuclear physics in soft-wall AdS/QCD: Deuteron electromagnetic form factors

    NASA Astrophysics Data System (ADS)

    Gutsche, Thomas; Lyubovitskij, Valery E.; Schmidt, Ivan; Vega, Alfredo

    2015-06-01

    We present a high-quality description of the deuteron electromagnetic form factors in a soft-wall anti-de Sitter/quantum chromodynamics approach. We first propose an effective action describing the dynamics of the deuteron in the presence of an external vector field. Based on this action the deuteron electromagnetic form factors are calculated, displaying the correct 1 /Q10 power scaling for large Q2 values. This finding is consistent with quark counting rules and the earlier observation that this result holds in confining gauge/gravity duals. The Q2 dependence of the deuteron form factors is defined by a single and universal scale parameter κ , which is fixed from data.

  2. Consistency of electron scattering data with a small proton radius

    NASA Astrophysics Data System (ADS)

    Griffioen, Keith; Carlson, Carl; Maddox, Sarah

    2016-06-01

    We determine the charge radius of the proton by analyzing the published low momentum transfer electron-proton scattering data from Mainz. We note that polynomial expansions of the form factor converge for momentum transfers squared below 4 mπ2 , where mπ is the pion mass. Expansions with enough terms to fit the data, but few enough not to overfit, yield proton radii smaller than the CODATA or Mainz values and in accord with the muonic atom results. We also comment on analyses using a wider range of data, and overall obtain a proton radius RE=0.840 (16 ) fm.

  3. Research on design method of the full form ship with minimum thrust deduction factor

    NASA Astrophysics Data System (ADS)

    Zhang, Bao-ji; Miao, Ai-qin; Zhang, Zhu-xin

    2015-04-01

    In the preliminary design stage of the full form ships, in order to obtain a hull form with low resistance and maximum propulsion efficiency, an optimization design program for a full form ship with the minimum thrust deduction factor has been developed, which combined the potential flow theory and boundary layer theory with the optimization technique. In the optimization process, the Sequential Unconstrained Minimization Technique (SUMT) interior point method of Nonlinear Programming (NLP) was proposed with the minimum thrust deduction factor as the objective function. An appropriate displacement is a basic constraint condition, and the boundary layer separation is an additional one. The parameters of the hull form modification function are used as design variables. At last, the numerical optimization example for lines of after-body of 50000 DWT product oil tanker was provided, which indicated that the propulsion efficiency was improved distinctly by this optimal design method.

  4. Constraints on the ωπ form factor from analyticity and unitarity

    NASA Astrophysics Data System (ADS)

    Ananthanarayan, B.; Caprini, Irinel; Kubis, Bastian

    2016-05-01

    Form factors are important low-energy quantities and an accurate knowledge of these sheds light on the strong interactions. A variety of methods based on general principles have been developed to use information known in different energy regimes to constrain them in regions where experimental information needs to be tested precisely. Here we review our recent work on the electromagnetic ωπ form factor in a model-independent framework known as the method of unitarity bounds, partly motivated by the discrepancies noted recently between the theoretical calculations of the form factor based on dispersion relations and certain experimental data measured from the decay ω → π0γ∗. We have applied a modified dispersive formalism, which uses as input the discontinuity of the ωπ form factor calculated by unitarity below the ωπ threshold and an integral constraint on the square of its modulus above this threshold. The latter constraint was obtained by exploiting unitarity and the positivity of the spectral function of a QCD correlator, computed on the spacelike axis by operator product expansion and perturbative QCD. An alternative constraint is obtained by using data available at higher energies for evaluating an integral of the modulus squared with a suitable weight function. From these conditions we derived upper and lower bounds on the modulus of the ωπ form factor in the region below the ωπ threshold. The results confirm the existence of a disagreement between dispersion theory and experimental data on the ωπ form factor around 0.6 GeV, including those from NA60 published in 2016.

  5. A form-factor method for determining the structure of distorted stars

    NASA Technical Reports Server (NTRS)

    Wolfe, R. H., Jr.; Kern, J. W.

    1979-01-01

    The equilibrium equations of a uniformly rotating and tidally distorted star are reduced to the same form as for a spherical star except for the inclusion of two form factors. One factor, expressing the buoyancy effects of centrifugal force, is determined directly from the integrated structure variables. The other factor, expressing the deviation from spherical shape, is shown to be relatively insensitive to errors in the assumed shape, so that accurate solutions are obtained in spite of the use of an a priori shape. The method is employed by adding computations for the factors to an existing spherical model program. Upper Main Sequence models determined by this method compare closely with results from the double approximation method even for critical rotation and tidal distortion.

  6. Tests of the triple Higgs boson form factor in μ-μ+→H H

    NASA Astrophysics Data System (ADS)

    Gounaris, G. J.; Renard, F. M.

    2016-05-01

    We study the sensitivity of the process μ-μ+→H H to the q2 dependence of the H H H form factor, which can reflect the Higgs boson structure, especially in the case of compositeness. We compute the Born and one-loop SM contribution to this process. We then show how the μ-μ+→H H polarized and unpolarized cross sections are modified by the presence of various types of anomalous contributions to the H H H form factor, in particular Higgs constituents in the case of compositeness.

  7. Microscopic model of the timelike electromagnetic form factor of the nucleon

    SciTech Connect

    Doenges, H.C.; Schaefer, M.; Mosel, U. )

    1995-02-01

    A microscopic model of the electromagnetic form factor of the nucleon is developed in a hadronic framework, including pions, nucleons and the [Delta]-resonance explicitly. The spacelike on-shell form factors are reproduced and predictions for the half off-shell dependence are made. The impact of this off-shell dependence in the time like sector ([ital q][sup 2][lt]1 GeV[sup 2], thus including the region of vector meson dominance) is of main interest in this investigation.

  8. Form factors and generalized parton distributions in basis light-front quantization

    NASA Astrophysics Data System (ADS)

    Adhikari, Lekha; Li, Yang; Zhao, Xingbo; Maris, Pieter; Vary, James P.; El-Hady, Alaa Abd

    2016-05-01

    We calculate the elastic form factors and the generalized parton distributions (GPDs) for four low-lying bound states of a demonstration fermion-antifermion system, strong-coupling positronium (e e ¯ ), using basis light-front quantization (BLFQ). By using this approach, we also calculate the impact-parameter-dependent GPDs q (x ,b⃗⊥) to visualize the fermion density in the transverse plane (b⃗⊥). We compare selected results with corresponding quantities in the nonrelativistic limit to reveal relativistic effects. Our results establish the foundation within BLFQ for investigating the form factors and the GPDs for hadronic systems.

  9. JLab Measurement of the He4 Charge Form Factor at Large Momentum Transfers

    NASA Astrophysics Data System (ADS)

    Camsonne, A.; Katramatou, A. T.; Olson, M.; Sparveris, N.; Acha, A.; Allada, K.; Anderson, B. D.; Arrington, J.; Baldwin, A.; Chen, J.-P.; Choi, S.; Chudakov, E.; Cisbani, E.; Craver, B.; Decowski, P.; Dutta, C.; Folts, E.; Frullani, S.; Garibaldi, F.; Gilman, R.; Gomez, J.; Hahn, B.; Hansen, J.-O.; Higinbotham, D. W.; Holmstrom, T.; Huang, J.; Iodice, M.; Jiang, X.; Kelleher, A.; Khrosinkova, E.; Kievsky, A.; Kuchina, E.; Kumbartzki, G.; Lee, B.; LeRose, J. J.; Lindgren, R. A.; Lott, G.; Lu, H.; Marcucci, L. E.; Margaziotis, D. J.; Markowitz, P.; Marrone, S.; Meekins, D.; Meziani, Z.-E.; Michaels, R.; Moffit, B.; Norum, B.; Petratos, G. G.; Puckett, A.; Qian, X.; Rondon, O.; Saha, A.; Sawatzky, B.; Segal, J.; Shabestari, M.; Shahinyan, A.; Solvignon, P.; Subedi, R. R.; Suleiman, R.; Sulkosky, V.; Urciuoli, G. M.; Viviani, M.; Wang, Y.; Wojtsekhowski, B. B.; Yan, X.; Yao, H.; Zhang, W.-M.; Zheng, X.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2014-04-01

    The charge form factor of He4 has been extracted in the range 29 fm-2≤Q2≤77 fm-2 from elastic electron scattering, detecting He4 recoil nuclei and electrons in coincidence with the high resolution spectrometers of the Hall A Facility of Jefferson Lab. The measurements have uncovered a second diffraction minimum for the form factor, which was predicted in the Q2 range of this experiment. The data are in qualitative agreement with theoretical calculations based on realistic interactions and accurate methods to solve the few-body problem.

  10. Computation of form factors in massless QCD with finite master integrals

    NASA Astrophysics Data System (ADS)

    von Manteuffel, Andreas; Panzer, Erik; Schabinger, Robert M.

    2016-06-01

    We present the bare one-, two-, and three-loop form factors in massless quantum chromodynamics as linear combinations of finite master integrals. Using symbolic integration, we compute their ɛ expansions and thereby reproduce all known results with an independent method. Remarkably, in our finite basis, only integrals with a less-than-maximal number of propagators contribute to the cusp anomalous dimensions. We report on indications of this phenomenon at four loops, including the result for a finite, irreducible, twelve-propagator form factor integral. Together with this article, we provide our automated software setup for the computation of finite master integrals.

  11. X-ray coherent scattering form factors of tissues, water and plastics using energy dispersion

    NASA Astrophysics Data System (ADS)

    King, B. W.; Landheer, K. A.; Johns, P. C.

    2011-07-01

    A key requirement for the development of the field of medical x-ray scatter imaging is accurate characterization of the differential scattering cross sections of tissues and phantom materials. The coherent x-ray scattering form factors of five tissues (fat, muscle, liver, kidney, and bone) obtained from butcher shops, four plastics (polyethylene, polystyrene, lexan (polycarbonate), nylon), and water have been measured using an energy-dispersive technique. The energy-dispersive technique has several improvements over traditional diffractometer measurements. Most notably, the form factor is measured on an absolute scale with no need for scaling factors. Form factors are reported in terms of the quantity x = λ-1sin (θ/2) over the range 0.363-9.25 nm-1. The coherent form factors of muscle, liver, and kidney resemble those of water, while fat has a narrower peak at lower x, and bone is more structured. The linear attenuation coefficients of the ten materials have also been measured over the range 30-110 keV and parameterized using the dual-material approach with the basis functions being the linear attenuation coefficients of polymethylmethacrylate and aluminum.

  12. Evidence for a Proton Transfer Network and a Required Persulfide-Bond-Forming Cysteine Residue in Ni-Containing Carbon Monoxide Dehydrogenases

    SciTech Connect

    Eun Jin Kim; Jian Feng; Matthew R. Bramlett; Paul A. Lindahl

    2004-05-18

    OAK-B135 Carbon monoxide dehydrogenase from Moorella thermoacetica catalyzes the reversible oxidation of CO to CO2 at a nickel-iron-sulfur active-site called the C-cluster. Mutants of a proposed proton transfer pathway and of a cysteine residue recently found to form a persulfide bond with the C-cluster were characterized. Four semi-conserved histidine residues were individually mutated to alanine. His116 and His122 were essential to catalysis, while His113 and His119 attenuated catalysis but were not essential. Significant activity was ''rescued'' by a double mutant where His116 was replaced by Ala and His was also introduced at position 115. Activity was also rescued in double mutants where His122 was replaced by Ala and His was simultaneously introduced at either position 121 or 123. Activity was also ''rescued'' by replacing His with Cys at position 116. Mutation of conserved Lys587 near the C-cluster attenuated activity but did not eliminate it. Activity was virtually abolished in a double mutant where Lys587 and His113 were both changed to Ala. Mutations of conserved Asn284 also attenuated activity. These effects suggest the presence of a network of amino acid residues responsible for proton transfer rather than a single linear pathway. The Ser mutant of the persulfide-forming Cys316 was essentially inactive and displayed no EPR signals originating from the C-cluster. Electronic absorption and metal analysis suggests that the C-cluster is absent in this mutant. The persulfide bond appears to be essential for either the assembly or stability of the C-cluster, and/or for eliciting the redox chemistry of the C-cluster required for catalytic activity.

  13. Extensive Molecular Dynamics Simulations Show That Canonical G8 and Protonated A38H+ Forms Are Most Consistent with Crystal Structures of Hairpin Ribozyme

    PubMed Central

    Mlýnský, Vojtěch; Banáš, Pavel; Hollas, Daniel; Réblová, Kamila; Walter, Nils G.; Šponer, Jiří; Otyepka, Michal

    2010-01-01

    The hairpin ribozyme is a prominent member of the group of small catalytic RNAs (RNA enzymes or ribozymes) because it does not require metal ions to achieve catalysis. Biochemical and structural data have implicated guanine 8 (G8) and adenine 38 (A38) as catalytic participants in cleavage and ligation catalyzed by the hairpin ribozyme, yet their exact role in catalysis remains disputed. To gain insight into dynamics in the active site of a minimal self-cleaving hairpin ribozyme, we have performed extensive classical, explicit-solvent molecular dynamics (MD) simulations on timescales of 50-150 ns. Starting from the available X-ray crystal structures, we investigated the structural impact of the protonation states of G8 and A38, and the inactivating A−1(2′-methoxy) substitution employed in crystallography. Our simulations reveal that a canonical G8 agrees well with the crystal structures while a deprotonated G8 profoundly distorts the active site. Thus MD simulations do not support a straightforward participation of the deprotonated G8 in catalysis. By comparison, the G8 enol tautomer is structurally well tolerated, causing only local rearrangements in the active site. Furthermore, a protonated A38H+ is more consistent with the crystallography data than a canonical A38. The simulations thus support the notion that A38H+ is the dominant form in the crystals, grown at pH 6. In most simulations, the canonical A38 departs from the scissile phosphate and substantially perturbs the structures of active site and S-turn. Yet, we occasionally also observe formation of a stable A−1(2′-OH)…A38(N1) hydrogen bond, which documents the ability of the ribozyme to form this hydrogen bond, consistent with a potential role of A38 as general base catalyst. The presence of this hydrogen bond is, however, incompatible with the expected in-line attack angle necessary for self-cleavage, requiring a rapid transition of the deprotonated 2′-oxyanion to a position more favorable for

  14. SU-E-T-586: Field Size Dependence of Output Factor for Uniform Scanning Proton Beams: A Comparison of TPS Calculation, Measurement and Monte Carlo Simulation

    SciTech Connect

    Zheng, Y; Singh, H; Islam, M

    2014-06-01

    Purpose: Output dependence on field size for uniform scanning beams, and the accuracy of treatment planning system (TPS) calculation are not well studied. The purpose of this work is to investigate the dependence of output on field size for uniform scanning beams and compare it among TPS calculation, measurements and Monte Carlo simulations. Methods: Field size dependence was studied using various field sizes between 2.5 cm diameter to 10 cm diameter. The field size factor was studied for a number of proton range and modulation combinations based on output at the center of spread out Bragg peak normalized to a 10 cm diameter field. Three methods were used and compared in this study: 1) TPS calculation, 2) ionization chamber measurement, and 3) Monte Carlos simulation. The XiO TPS (Electa, St. Louis) was used to calculate the output factor using a pencil beam algorithm; a pinpoint ionization chamber was used for measurements; and the Fluka code was used for Monte Carlo simulations. Results: The field size factor varied with proton beam parameters, such as range, modulation, and calibration depth, and could decrease over 10% from a 10 cm to 3 cm diameter field for a large range proton beam. The XiO TPS predicted the field size factor relatively well at large field size, but could differ from measurements by 5% or more for small field and large range beams. Monte Carlo simulations predicted the field size factor within 1.5% of measurements. Conclusion: Output factor can vary largely with field size, and needs to be accounted for accurate proton beam delivery. This is especially important for small field beams such as in stereotactic proton therapy, where the field size dependence is large and TPS calculation is inaccurate. Measurements or Monte Carlo simulations are recommended for output determination for such cases.

  15. Nucleon form factors with 2+1 flavor dynamical domain-wall fermions

    SciTech Connect

    Takeshi Yamazaki; Aoki, Yasumichi; Blum, Tom; Lin, Huey-Wen; Ohta, Shigemi; Sasaki, Shoichi; Tweedie, Robert; Zanotti, James

    2009-06-01

    We report our numerical lattice QCD calculations of the isovector nucleon form factors for the vector and axialvector currents: the vector, induced tensor, axialvector, and induced pseudoscalar form factors. The calculation is carried out with the gauge configurations generated with N{sub f} = 2+1 dynamical domain wall fermions and Iwasaki gauge actions at {beta} = 2.13, corresponding to a cutoff a{sup -1} = 1.73 GeV, and a spatial volume of (2.7 fm){sup 3}. The up and down quark masses are varied so the pion mass lies between 0.33 and 0.67 GeV while the strange quark mass is about 12% heavier than the physical one. We calculate the form factors in the range of momentum transfers, 0.2 < q{sup 2} < 0.75 GeV{sup 2}. The vector and induced tensor form factors are well described by the conventional dipole forms and result in significant underestimation of the Dirac and Pauli mean-squared radii and the anomalous magnetic moment compared to the respective experimental values. We show that the axial-vector form factor is significantly affected by the finite spatial volume of the lattice. In particular in the axial charge, g{sub A}/g{sub V}, the finite volume effect scales with a single dimensionless quantity, m{sub {pi}}L, the product of the calculated pion mass and the spatial lattice extent. Our results indicate that for this quantity, m{sub {pi}} L > 6 is required to ensure that finite volume effects are below 1%.

  16. Positron-proton to electron-proton elastic cross section ratios from CLAS

    NASA Astrophysics Data System (ADS)

    Adikaram, Dasuni; Rimal, Dipak; Weinstein, Larry; Raue, Brian

    2014-03-01

    There is a significant discrepancy between the ratio of the electromagnetic form factors of the proton measured by the Rosenbluth and the polarization transfer technique. The most likely explanation of this discrepancy is the inclusion of two-photon exchange (TPE) amplitude contributions to the elastic electron-proton cross section. The CLAS TPE experiment measured the TPE contribution in the wide range of Q2 and ɛ range using a comparison of positron-proton to electron-proton elastic cross sections (R = σ (e+ p) / σ (e- p)). Preliminary results will be presented, along with the estimations of systematic uncertainties. A detailed comparison of new results with previous R measurements and theoretical calculations will be presented. Implications of the CLAS TPE measurements on the elastic electron-proton cross section will be also discussed.

  17. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    SciTech Connect

    Waller, Zoë A.E. Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  18. Constraints on the form factors for K ---> pi l nu and implications for |V(us)|

    SciTech Connect

    Hill, Richard J.; /Fermilab

    2006-07-01

    Rigorous bounds are established for the expansion coefficients governing the shape of semileptonic K {yields} {pi} form factors. The constraints enforced by experimental data from {tau} {yields} K{pi}{nu} eliminate uncertainties associated with model parameterizations in the determination of |V{sub us}|. The results support the validity of a powerful expansion that can be applied to other semileptonic transitions.

  19. Measuring the axial form factor of {sup 3}He using weak capture of polarized electrons

    SciTech Connect

    Dutta, D.

    2013-11-07

    A low energy, high intensity polarized electron beam could enable the extraction of the A=3 weak axial form factors F{sub A} using the reaction →e+{sup 3}He→{sup 3}H+ν. These form factors have never been measured before. We discuss the feasibility of such an experiment using a small toroidal magnet and a radial low energy recoil detector to tag the recoil tritons. A moderately high intensity polarized electron beam (>500 μA) with beam energies between 50 - 150 MeV is necessary for the cross section measurement and to provides a free clean measurement of the background. Moreover, in addition to the cross section, by measuring the electron spin and recoil triton correlation coefficient it may be possible to search for second class currents and to extract the ratio of the axial to the vector form factor of the nucleon. Such novel electron scattering based measurements would have a completely different set of systematic uncertainties compared to polarized neutron beta decay, neutrino scattering and muon capture experiments which are typically used to extract the weak form-factors.

  20. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    NASA Astrophysics Data System (ADS)

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-01

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm3, which was designed for a target frequency of as low as 100 Hz.

  1. Calculation of inelastic electron-nucleus scattering form factors of 29Si

    NASA Astrophysics Data System (ADS)

    Salman, A. D.; Al-Dahan, N.; Sharrad, F. I.; Hossain, I.

    2014-08-01

    Inelastic electron scattering form factors for 29Si nucleus with total angular momentum and positive parity (Jπ) and excited energy (3/2+, 1.273 MeV; 5/2+, 2.028 MeV; 3/2+, 2.425 MeV and 7/2+, 4.079 MeV) have been calculated using higher energy configurations outside the sd-shell. The calculations of inelastic form factors up to the first- and second-order with and without core-polarization (CP) effects were compared with the available experimental data. The calculations of inelastic electron scattering form factors up to the first-order with CP effects are in agreement with the experimental data, excepted for states 3/2+(1.273 MeV) and 5/2+(2.028 MeV) and without this effect are failed for all states. Furthermore, the calculations of inelastic electron scattering form factors up to the second-order with CP effects are in agreement with the experimental data for 3/2+(1.273 MeV) and 5/2+(2.028 MeV).

  2. Lattice QCD results for the B --> D(*) l nu form factors: F(1) and G(1)

    SciTech Connect

    Van de Water, R.S.; /Fermilab

    2007-01-01

    I review the current status of lattice QCD calculations of the B {yields} D and B {yields} D* form factors and discuss prospects for their improvement. Successful calculations within the quenched approximation demonstrate the power of lattice methods for calculating F(1) and G(1), and the unquenched calculations in progress should soon allow for a 2-3% exclusive determination of |Vcb|.

  3. Form factor dispersion at La M5,4 edges and average density of resonant atoms.

    PubMed

    Smadici, S; Lee, J C T; Logvenov, G; Bozovic, I; Abbamonte, P

    2014-01-15

    Resonant soft x-ray scattering on complex oxide superlattices shows very large variations in the superlattice reflection position and intensity near La M5,4 edges. Resonant dispersion of the La x-ray form factor describes the observations well. We determine the average density of resonant La atoms and the thickness of superlattice layers. PMID:24318961

  4. The charge form factor of pseudoscalar mesons in a relativistic constituent quark model

    SciTech Connect

    Cardarelli, F.; Pace, E.; Grach, I.L.

    1994-04-01

    The charge form factor of pseudoscalar mesons has been investigated in the light-cone formalism, up to Q{sup 2} relevant to CEBAF energies. The consequences of adopting the meson wave functions generated through the Godfrey-Isgur q{bar q} potential, which reproduces the mass spectra, are discussed.

  5. Precision measurement of the neutron magnetic form factor from {sup 3}He(e, e')

    SciTech Connect

    Dipangkar Dutta

    2000-12-12

    A precision measurement of the inclusive quasielastic transverse asymmetry A{sub T'} from {sup 3}He(e, e') was completed recently at Hall A at Jefferson Lab (E95-001). The preliminary results on the neutron magnetic form factor at low Q{sup 2} are presented here.

  6. A small-form-factor piezoelectric vibration energy harvester using a resonant frequency-down conversion

    SciTech Connect

    Sun, Kyung Ho; Kim, Young-Cheol; Kim, Jae Eun

    2014-10-15

    While environmental vibrations are usually in the range of a few hundred Hertz, small-form-factor piezoelectric vibration energy harvesters will have higher resonant frequencies due to the structural size effect. To address this issue, we propose a resonant frequency-down conversion based on the theory of dynamic vibration absorber for the design of a small-form-factor piezoelectric vibration energy harvester. The proposed energy harvester consists of two frequency-tuned elastic components for lowering the first resonant frequency of an integrated system but is so configured that an energy harvesting beam component is inverted with respect to the other supporting beam component for a small form factor. Furthermore, in order to change the unwanted modal characteristic of small separation of resonant frequencies, as is the case with an inverted configuration, a proof mass on the supporting beam component is slightly shifted toward a second proof mass on the tip of the energy harvesting beam component. The proposed small-form-factor design capability was experimentally verified using a fabricated prototype with an occupation volume of 20 × 39 × 6.9 mm{sup 3}, which was designed for a target frequency of as low as 100 Hz.

  7. Light-Front Quark Model Analysis of Meson-Photon Transition Form Factor

    NASA Astrophysics Data System (ADS)

    Choi, Ho-Meoyng; Ji, Chueng-Ryong

    2016-07-01

    We discuss {(π0, η, η') to γ^{*}γ} transition form factors using the light-front quark model. Our discussion includes the analysis of the mixing angles for {η-η'}. Our results for {Q2 F_{(π^0,η,η')toγ^*γ}(Q^2)} show scaling behavior for high Q 2 consistent with pQCD predictions.

  8. Energy-momentum tensor form factors of the nucleon in nuclear matter

    NASA Astrophysics Data System (ADS)

    Kim, Hyun-Chul; Schweitzer, Peter; Yakhshiev, Ulugbek

    2012-12-01

    The nucleon form factors of the energy-momentum tensor are studied in nuclear medium in the framework of the in-medium modified Skyrme model. We obtain a negative D-term, in agreement with results from other approaches, and find that medium effects make the value of d1 more negative.

  9. Structure of the neutral pion and its electromagnetic transition form factor

    NASA Astrophysics Data System (ADS)

    Raya, Khépani; Chang, Lei; Bashir, Adnan; Cobos-Martinez, J. Javier; Gutiérrez-Guerrero, L. Xiomara; Roberts, Craig D.; Tandy, Peter C.

    2016-04-01

    The γ*γ →π0 transition form factor, G (Q2), is computed on the entire domain of spacelike momenta using a continuum approach to the two valence body bound-state problem in relativistic quantum field theory: the result agrees with data obtained by the CELLO, CLEO, and Belle Collaborations. The analysis unifies this prediction with that of the pion's valence-quark parton distribution amplitude (PDA) and elastic electromagnetic form factor and demonstrates, too, that a fully self-consistent treatment can readily connect a pion PDA that is a broad, concave function at the hadronic scale with the perturbative QCD prediction for the transition form factor in the hard photon limit. The normalization of that limit is set by the scale of dynamical chiral symmetry breaking, which is a crucial feature of the Standard Model. Understanding of the latter will thus remain incomplete until definitive transition form factor data are available on Q2>10 GeV2 .

  10. QCD corrections to B → π form factors from light-cone sum rules

    NASA Astrophysics Data System (ADS)

    Wang, Yu-Ming; Shen, Yue-Long

    2015-09-01

    We compute perturbative corrections to B → π form factors from QCD light-cone sum rules with B-meson distribution amplitudes. Applying the method of regions we demonstrate factorization of the vacuum-to-B-meson correlation function defined with an interpolating current for pion, at one-loop level, explicitly in the heavy quark limit. The short-distance functions in the factorization formulae of the correlation function involves both hard and hard-collinear scales; and these functions can be further factorized into hard coefficients by integrating out the hard fluctuations and jet functions encoding the hard-collinear information. Resummation of large logarithms in the short-distance functions is then achieved via the standard renormalization-group approach. We further show that structures of the factorization formulae for fBπ+ (q2) and fBπ0 (q2) at large hadronic recoil from QCD light-cone sum rules match that derived in QCD factorization. In particular, we perform an exploratory phenomenological analysis of B → π form factors, paying attention to various sources of perturbative and systematic uncertainties, and extract |Vub | = (3.05-0.38+0.54|th. ± 0.09|exp.) ×10-3 with the inverse moment of the B-meson distribution amplitude ϕB+ (ω) determined by reproducing fBπ+ (q2 = 0) obtained from the light-cone sum rules with π distribution amplitudes. Furthermore, we present the invariant-mass distributions of the lepton pair for B → πℓνℓ (ℓ = μ, τ) in the whole kinematic region. Finally, we discuss non-valence Fock state contributions to the B → π form factors fBπ+ (q2) and fBπ0 (q2) in brief.

  11. Minocycline inhibits the production of the precursor form of nerve growth factor by retinal microglial cells☆

    PubMed Central

    Yang, Xiaochun; Duan, Xuanchu

    2013-01-01

    A rat model of acute ocular hypertension was established by enhancing the perfusion of balanced salt solution in the anterior chamber of the right eye. Minocycline (90 mg/kg) was administered intraperitoneally into rats immediately after the operation for 3 consecutive days. Immunofluorescence, western blot assay and PCR detection revealed that the expression of the precursor form of nerve growth factor, nerve growth factor and the p75 neurotrophin receptor, and the mRNA expression of nerve growth factor and the p75 neurotrophin receptor, increased after acute ocular hypertension. The number of double-labeled CD11B- and precursor form of nerve growth factor-positive cells, glial fibrillary acidic protein- and p75 neurotrophin receptor-positive cells, glial fibrillary acidic protein- and caspase-3-positive cells in the retina markedly increased after acute ocular hypertension. The above-described expression decreased after minocycline treatment. These results suggested that minocycline inhibited the increased expression of the precursor form of nerve growth factor in microglia, the p75 neurotrophin receptor in astroglia, and protected cells from apoptosis. PMID:25206672

  12. Measurement of the Electric Form Factor of the Neutron at High Momentum Transfer

    SciTech Connect

    Jonathan Miller

    2009-06-01

    The E02-013 collaboration's precision measurement of the electric form factor of the neutron at high momentum took place in Hall A of Jefferson Laboratory [1]. Four kinematic points spread in Q2 from 1.2 to 3.5 (GeV/c)2 reach the region of momentum transfer where there is little ambiguity that the form factors are dominated by the valence quarks. The electric form factor provides important constraints on the generalized parton distributions (GPDs) of the nucleon and therefore to understand the currently unknown quark angular orbital moments. The talk presented newly obtained results for GnE including at Q2 of 2.5 (GeV/c)2. These measurements provide access to twice the range of momentum transfer for complete iso-spin decomposition of the nucleon form factors. The form factors of the u and d quarks were also presented. The measurement used a double polarization asymmetry method [2][3] with He polarized up to 55% (provided by a novel hybrid alkali optical pumping scheme utilizing a Rb & K mixture) and the highly polarized (85%) electron beam at CEBAF. A specially constructed detector package consisting of an electron spectrometer, named Big-Bite, with a solid angle of 95 msr and a large neutron detector were used to detect the particles in the reaction {sup 3}H{rvec e}({rvec e},e',h). The experimental apparatus provided more than 100 times better Figure-of-Merit than other GnE experiments utilizing polarized targets; for more information see [4].

  13. A chloride capturing system via proton-induced structure transformation between opened- and closed-forms of dodecavanadates.

    PubMed

    Inoue, Yoshitaka; Kikukawa, Yuji; Kuwajima, Sho; Hayashi, Yoshihito

    2016-05-01

    Chloride-incorporated dodecavanadates show two distinct structures of the monoprotonated-form [HV12O32(Cl)](4-) (closed-V12) with a spherical closed-structure and the opened-form [V12O32(Cl)](5-) (opened-V12). The reaction of closed-V12 with a stoichiometric amount of ethylenediamine drives the structure transformation reaction to opened-V12, quantitatively. From time dependent observations of (51)V NMR, a tube-type intermediate [V12O32(Cl)](5-) (tube-V12) was observed in the transformation process. Isolation of the intermediate was achieved by the deprotonation reaction of closed-V12 with diethylamine, and the structure transformation was confirmed by using the isolated intermediate. The reverse transformation from opened-V12 to closed-V12 was also achieved by addition of trifluoroacetic acid. The geometrical difference between closed-V12 and opened-V12 is reflected in the reactivity difference to the external reagents, and this was demonstrated by examining the chloride removal reaction by using a silver cation. The incorporated chloride was preserved in the closed-V12 cage even in the presence of a silver cation. In contrast, the chloride in opened-V12 was removed as AgCl by the silver cation. In addition, by the reaction of chloride-free opened-V12 with a quantitative amount of {Et4N}Cl retrieved opened-V12, showing the capability of opened-V12 to recapture a guest chloride in the cavity. This transformation between two isomeric dodecavanadate structures is regarded as the movement of a molecular mitt to catch a ball and secure it. PMID:27112216

  14. Induced drag ideal efficiency factor of arbitrary lateral-vertical wing forms

    NASA Technical Reports Server (NTRS)

    Deyoung, J.

    1980-01-01

    A relatively simple equation is presented for estimating the induced drag ideal efficiency factor e for arbitrary cross sectional wing forms. This equation is based on eight basic but varied wing configurations which have exact solutions. The e function which relates the basic wings is developed statistically and is a continuous function of configuration geometry. The basic wing configurations include boxwings shaped as a rectangle, ellipse, and diamond; the V-wing; end-plate wing; 90 degree cruciform; circle dumbbell; and biplane. Example applications of the e equations are made to many wing forms such as wings with struts which form partial span rectangle dumbbell wings; bowtie, cruciform, winglet, and fan wings; and multiwings. Derivations are presented in the appendices of exact closed form solutions found of e for the V-wing and 90 degree cruciform wing and for an asymptotic solution for multiwings.

  15. Exploratory and confirmatory factor analysis of a short-form of the EMBU among Chinese adolescents.

    PubMed

    Li, Zhongquan; Wang, Li; Zhang, Lisong

    2012-02-01

    The present study used a sample of Chinese adolescents and validated a short-form of the Egna Minnen Beträffande Uppfostran: One's Memories of Upbringing (s-EMBU) assessing perceived parental rearing styles. A Chinese revision of the s-EMBU by the authors was administered to a total of 779 high school students, ages 11 to 19 years. Exploratory factor analysis with half of the sample yielded a three-factor solution of Rejection, Emotional Warmth, and Overprotection, accounting for 47.1% of the total variance onthe father form and 48.8% of the total variance on the mother form. Then, confirmatory factor analysis indicated a good fit of the three-factor model to the data in the other half of the sample. The three subscales consisted of 6, 6, and 7 items, respectively. Scores on these subscales had Cronbach alphas ranging from .71 to .81, indicating adequate internal consistency. These psychometric properties suggest its applicability for research with Chinese adolescents. PMID:22489392

  16. Development of a Short Form of the Five-Factor Narcissism Inventory: the FFNI-SF.

    PubMed

    Sherman, Emily D; Miller, Joshua D; Few, Lauren R; Campbell, W Keith; Widiger, Thomas A; Crego, Cristina; Lynam, Donald R

    2015-09-01

    The Five-Factor Narcissism Inventory (FFNI; Glover, Miller, Lynam, Crego, & Widiger, 2012) is a 148-item self-report inventory of 15 traits designed to assess the basic elements of narcissism from the perspective of a 5-factor model. The FFNI assesses both vulnerable (i.e., cynicism/distrust, need for admiration, reactive anger, and shame) and grandiose (i.e., acclaim seeking, arrogance, authoritativeness, entitlement, exhibitionism, exploitativeness, grandiose fantasies, indifference, lack of empathy, manipulativeness, and thrill seeking) variants of narcissism. The present study reports the development of a short-form version of the FFNI in 4 diverse samples (i.e., 2 undergraduate samples, a sample recruited from MTurk, and a clinical community sample) using item response theory. The validity of the resultant 60-item short form was compared against the validity of the full scale in the 4 samples at both the subscale level and the level of the grandiose and vulnerable composites. Results indicated that the 15 subscales remain relatively reliable, possess a factor structure identical to the structure of the long-form scales, and manifest correlational profiles highly similar to those of the long-form scales in relation to a variety of criterion measures, including basic personality dimensions, other measures of grandiose and vulnerable narcissism, and indicators of externalizing and internalizing psychopathology. Grandiose and vulnerable composites also behave almost identically across the short- and long-form versions. It is concluded that the FFNI-Short Form (FFNI-SF) offers a well-articulated assessment of the basic traits comprising grandiose and vulnerable narcissism, particularly when assessment time is limited. PMID:25774640

  17. Measurement of the form factor ratios in semileptonic decays of charm mesons

    SciTech Connect

    R. Zaliznyak

    1999-01-26

    I have measured the form factor ratios r{sub 2} = A{sub 2} (0)/A{sub 1} (0) and r{sub V} = V (0)/A{sub 1} (0) in the semileptonic charm meson decay D{sup +} {yields} {anti K}{sup *0} e{sup +}{nu}{sub e} from data collected by the Fermilab E791 collaboration. Form factors are introduced in the calculation of the hadronic current in semileptonic decays of strange, charm, or bottom mesons, such as D{sup +} {yields} {anti K}{sup *0} e{sup +} {nu}{sub e} . Semileptonic decays provide insight into quark coupling to the W boson since the leptonic and hadronic amplitudes in the Feynman diagram for the decay are completely separate. There are no strong interactions between the final state leptons and quarks. A number of theoretical models predict the values of the form factors for D{sup +} {yields} {anti K}{sup *0} e{sup +} {nu}{sub e} , though there is a large range of predictions. E791 is a hadroproduction experiment that recorded over 20 billion interactions with a 500 GeV {pi}{sup -} beam incident on five thin targets during the 1991-92 Fermilab fixed-target run. Approximately 3000 D{sup +} {yields} {anti K}{sup *0} e{sup +} {nu}{sub e} decays are fully reconstructed. In order to extract the form factor ratios from the data, I implement a multidimensional unbinned maximum likelihood fit with a large sample of simulated (Monte Carlo) D{sup +} {yields} {anti K}{sup *0} e{sup +}{nu}{sub e} events. The large E791 data sample provides the most precise measurement of the form factor ratios to date. The measured values for the form factor ratios are r{sub 2} = 0.71 {+-} 0.08 {+-} 0.09 and r{sub V} = 1.84 {+-} 0.11 {+-} 0.08. These results are in good agreement with some Lattice Gauge calculations. However the agreement with quark model predictions is not as good.

  18. Factor structure and differential item functioning of the BASC-2 BESS Spanish Language Parent Form.

    PubMed

    Dever, Bridget V; Raines, Tara C; Dowdy, Erin

    2016-06-01

    Given the steady increase of students from diverse backgrounds in the U.S. educational system, in particular immigrant and Latino students, it is important to consider how to best support all students within our schools. The present study focuses on the Behavior Assessment System for Children-Second Edition (BASC-2) Behavioral and Emotional Screening System (BESS) Parent Spanish form, which is a promising assessment tool for those who are interested in screening for behavioral and emotional risk among Spanish-speaking populations. The present study included 725 students of Latino descent in Grades K-6 in an urban school district and their parents or legal guardians, who served as the informants. All parents completed the BESS language form (English or Spanish) of their choice. A confirmatory factor analysis (CFA) supported a 4-factor structure (Externalizing, Internalizing, Inattention, and Adaptive Skills) similar to that of the BESS Parent English form: χ2(77) = 248.06, p < .001; CFI = 0.903; TLI = 0.940. However, differential item functioning (DIF) analyses revealed 5 items (16.7%) demonstrated significant levels of DIF, with 4 of the 5 being easier to endorse in English. This study provides preliminary evidence of partial invariance of the BESS Parent across language forms. Although some evidence of invariance across language forms at the structural and item levels exists, more research is necessary to determine whether the DIF found in the present study results in any perceptible test bias. (PsycINFO Database Record PMID:27243244

  19. Measurement of the isovector axial form factor at Q{sup 2} = 0.23 (GeV/c){sup 2}

    SciTech Connect

    Ríos, D. Balaguer; Baunack, S.; Glaser, B.; Maas, F.; Imai, Y.

    2013-11-07

    We present the preliminary value of the measurement of the parity violating asymmetry in the cross section of quasi-elastic scattering of longitudinally polarized electrons on deuteron at backward angles at Q{sup 2} = 0.23. The preliminary asymmetry is A{sub PV}{sup d}(Q{sup 2} = 0.23) = (−20.77±0.84{sub stat}±1.23{sub syst})10{sup −6}. From this value a preliminary linear combination of the G{sub M}{sup s} and the isovector axial form factor G{sub A} can be extracted G{sub A}{sup T = 1}+0.59G{sub M}{sup s} = −0.53±0.37±0.02. Combining this preliminary linear combination with that extracted from the measurement of the parity violating asymmetry on proton, already publish, it is possible to disentagle the form factors and thus we can obtain a preliminary experimental determination of the isovector axial form factor G{sub A}{sup T = 1} = −0.43±0.46.

  20. Threshold pion production from proton-proton collisions

    SciTech Connect

    Lee, T.S.H.

    1995-08-01

    We showed that the threshold production of {pi}{sup 0}pp, {pi}{sup +}np, and {pi}{sup +}d from proton-proton collisions can be consistently described by a model consisting of pion s-wave rescattering and N{bar N} pair-terms of heavy-meson exchanges. The large difference between {sigma}{sup tot}(pp {yields} {pi}{sup +}d) and {sigma}{sup tot}(pp {yields} {pi}{sup +}np) is understood from the orthogonality of the deuteron and the np scattering wave functions. In a calculation using the Paris potential, we find that the data can be reproduced best by using a soft {pi}NN form factor with {Delta} = 650 MeV for a monopole form. This is consistent with our earlier studies of pion production in the A-excitation region. A paper describing this result was submitted for publication.

  1. High-throughput spectrometer designs in a compact form-factor: principles and applications

    NASA Astrophysics Data System (ADS)

    Norton, S. M.

    2013-05-01

    Many compact, portable Raman spectrometers have entered the market in the past few years with applications in narcotics and hazardous material identification, as well as verification applications in pharmaceuticals and security screening. Often, the required compact form-factor has forced designers to sacrifice throughput and sensitivity for portability and low-cost. We will show that a volume phase holographic (VPH)-based spectrometer design can achieve superior throughput and thus sensitivity over conventional Czerny-Turner reflective designs. We will look in depth at the factors influencing throughput and sensitivity and illustrate specific VPH-based spectrometer examples that highlight these design principles.

  2. OPE for all helicity amplitudes II. Form factors and data analysis

    NASA Astrophysics Data System (ADS)

    Basso, Benjamin; Caetano, João; Córdova, Lucía; Sever, Amit; Vieira, Pedro

    2015-12-01

    We present the general flux tube integrand for MHV and non-MHV amplitudes, in planar N=4 SYM theory, up to a group theoretical rational factor. We find that the MHV and non-MHV cases only differ by simple form factors which we derive. This information allows us to run the operator product expansion program for all sorts of non-MHV amplitudes and to test the recently proposed map with the so called charged pentagons transitions. Perfect agreement is found, on a large sample of non-MHV amplitudes, with the perturbative data available in the literature.

  3. An investigation of the factor structure and convergent and discriminant validity of the five-factor model rating form.

    PubMed

    Samuel, Douglas B; Mullins-Sweatt, Stephanie N; Widiger, Thomas A

    2013-02-01

    The Five-Factor Model Rating Form (FFMRF) is a one-page measure designed to provide an efficient assessment of the higher order domains of the Five Factor Model (FFM) as well as the more specific, lower order facets proposed by McCrae and Costa. Although previous research has suggested that the FFMRF's assessment of the lower order facets converge reasonably with other FFM measures, the structural validity of the domain-level assessment has not yet been evaluated. The current study employed an exploratory structural equation modeling framework to investigate the fit of a five-factor solution within a combined sample of 757 participants. This was a novel analysis using a combined sample drawn from three previously published studies and was composed primarily of undergraduates but also included a smaller clinical subsample. Results indicated that the FFMRF is well accommodated within a five-factor solution. Furthermore, the FFMRF domain scores evinced large correlations with domain scores from the NEO Personality Inventory-Revised. The results suggest that the FFMRF might hold promise as a choice for those seeking a brief measure that provides a valid assessment of both the broad and specific traits of the FFM. PMID:22871990

  4. Charge form factor and sum rules of electromagnetic response functions in $^{12}$C

    SciTech Connect

    Lovato, Alessandro; Gandolfi, Stefano; Carlson, Joseph A.; Butler, Ralph; Lusk, Ewing; Pieper, Steven C.; Schiavilla, Rocco

    2013-08-01

    An {\\it ab initio} calculation of the $^{12}$C elastic form factor, and sum rules of longitudinal and transverse response functions measured in inclusive (e,e') scattering, is reported, based on realistic nuclear potentials and electromagnetic currents. The longitudinal elastic form factor and sum rule are found to be in satisfactory agreement with available experimental data. A direct comparison between theory and experiment is difficult for the transverse sum rule. However, it is shown that the calculated one has large contributions from two-body currents, indicating that these mechanisms lead to a significant enhancement of the quasi-elastic transverse response. This fact may have implications for the anomaly observed in recent neutrino quasi-elastic charge-changing scattering data off $^{12}$C.

  5. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sérgio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as "Z-graphs," but omits other two and three-body currents. Finally, we compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  6. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Alexandre Pinto, SÂ ergio; Stadler, Alfred; Gross, Franz

    2009-01-01

    We present the first calculations of the electromagnetic form factors of 3He and 3H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a non-relativistic framework, such as ?Z-graphs?, but omits other two and three-body currents. We compare our results to non-relativistic calculations augmented by relativistic corrections of O(v/c)2.

  7. Covariant spectator theory for the electromagnetic three-nucleon form factors: Complete impulse approximation

    SciTech Connect

    Pinto, Sergio Alexandre; Stadler, Alfred; Gross, Franz

    2009-05-15

    We present the first calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H within the framework of the Covariant Spectator Theory (CST). This first exploratory study concentrates on the sensitivity of the form factors to the strength of the scalar meson-nucleon off-shell coupling, known from previous studies to have a strong influence on the three-body binding energy. Results presented here were obtained using the complete impulse approximation (CIA), which includes contributions of relativistic origin that appear as two-body corrections in a nonrelativistic framework, such as 'Z-graphs', but omits other two and three-body currents. We compare our results to nonrelativistic calculations augmented by relativistic corrections of O(v/c){sup 2}.

  8. $$B\\to\\pi\\ell\\ell$$ Form Factors for New-Physics Searches from Lattice QCD

    DOE PAGESBeta

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+ℓ- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agreesmore » with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].« less

  9. CFD-based method of determining form factor k for different ship types and different drafts

    NASA Astrophysics Data System (ADS)

    Wang, Jinbao; Yu, Hai; Zhang, Yuefeng; Xiong, Xiaoqing

    2016-07-01

    The value of form factor k at different drafts is important in predicting full-scale total resistance and speed for different types of ships. In the ITTC community, most organizations predict form factor k using a low-speed model test. However, this method is problematic for ships with bulbous bows and transom. In this article, a Computational Fluid Dynamics (CFD)-based method is introduced to obtain k for different type of ships at different drafts, and a comparison is made between the CFD method and the model test. The results show that the CFD method produces reasonable k values. A grid generating method and turbulence model are briefly discussed in the context of obtaining a consistent k using CFD.

  10. Form factors of descendant operators: resonance identities in the sinh-Gordon model

    NASA Astrophysics Data System (ADS)

    Lashkevich, Michael; Pugai, Yaroslav

    2014-12-01

    We study the space of local operators in the sinh-Gordon model in the framework of the bootstrap form factor approach. Our final goal is to identify the operators obtained by solving bootstrap equations with those defined in terms of the Lagrangian field. Here we try to identify operators at some very particular points, where the phenomenon of operator resonance takes place. The operator resonance phenomenon being perturbative, nevertheless, results in exact identities between some local operators. By applying an algebraic approach developed earlier for form factors we derive an infinite set of identities between particular descendant and exponential operators in the sinh-Gordon theory, which generalize the quantum equation of motion. We identify the corresponding descendant operators by comparing them with the result of perturbation theory.

  11. B→πll Form Factors for New Physics Searches from Lattice QCD.

    PubMed

    Bailey, Jon A; Bazavov, A; Bernard, C; Bouchard, C M; DeTar, C; Du, Daping; El-Khadra, A X; Freeland, E D; Gámiz, E; Gottlieb, Steven; Heller, U M; Kronfeld, A S; Laiho, J; Levkova, L; Liu, Yuzhi; Lunghi, E; Mackenzie, P B; Meurice, Y; Neil, E; Qiu, Si-Wei; Simone, J N; Sugar, R; Toussaint, D; Van de Water, R S; Zhou, Ran

    2015-10-01

    The rare decay B→πℓ^{+}ℓ^{-} arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor f_{T}. Together with the vector and scalar form factors f_{+} and f_{0} from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B^{+}→π^{+}μ^{+}μ^{-})=20.4(2.1)×10^{-9} in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125]. PMID:26550717

  12. Isospin mixing in the nucleon and He-4 and the nucleon strange electric form-factor

    SciTech Connect

    M. Viviani; R. Schiavilla; B. Kubis; R. Lewis; L. Girlanda; A. Kievsky; L.E. Marcucci; S. Rosati

    2007-09-01

    In order to isolate the contribution of the nucleon strange electric form factor to the parity-violating asymmetry measured in 4He(\\vec e,e')4He experiments, it is crucial to have a reliable estimate of the magnitude of isospin-symmetry-breaking (ISB) corrections in both the nucleon and 4He. We examine this issue in the present letter. Isospin admixtures in the nucleon are determined in chiral perturbation theory, while those in 4He are derived from nuclear interactions, including explicit ISB terms. A careful analysis of the model dependence in the resulting predictions for the nucleon and nuclear ISB contributions to the asymmetry is carried out. We conclude that, at the low momentum transfers of interest in recent measurements reported by the HAPPEX collaboration at Jefferson Lab, these contributions are of comparable magnitude to those associated with strangeness components in the nucleon electric form factor.

  13. Electron-scattering form factors for 6Li in the ab initio symmetry-guided framework

    NASA Astrophysics Data System (ADS)

    Dytrych, T.; Hayes, A. C.; Launey, K. D.; Draayer, J. P.; Maris, P.; Vary, J. P.; Langr, D.; Oberhuber, T.

    2015-02-01

    We present an ab initio symmetry-adapted no-core shell-model description for 6Li. We study the structure of the ground state of 6Li and the impact of the symmetry-guided space selection on the charge density components for this state in momentum space, including the effect of higher shells. We accomplish this by investigating the electron scattering charge form factor for momentum transfers up to q ˜4 fm-1 . We demonstrate that this symmetry-adapted framework can achieve significantly reduced dimensions for equivalent large shell-model spaces while retaining the accuracy of the form factor for any momentum transfer. These new results confirm the previous outcomes for selected spectroscopy observables in light nuclei, such as binding energies, excitation energies, electromagnetic moments, E 2 and M 1 reduced transition probabilities, as well as point-nucleon matter rms radii.

  14. Nucleon electromagnetic form factors from lattice QCD using a nearly physical pion mass

    NASA Astrophysics Data System (ADS)

    Green, J. R.; Negele, J. W.; Pochinsky, A. V.; Syritsyn, S. N.; Engelhardt, M.; Krieg, S.

    2014-10-01

    We present lattice QCD calculations of nucleon electromagnetic form factors using pion masses mπ=149, 202, and 254 MeV and an action with clover-improved Wilson quarks coupled to smeared gauge fields, as used by the Budapest-Marseille-Wuppertal Collaboration. Particular attention is given to the removal of the effects of excited-state contamination by calculations at three source-sink separations and the use of the summation and generalized pencil-of-function methods. The combination of a calculation at the nearly physical mass mπ=149 MeV in a large spatial volume (mπLs=4.2) and the removal of excited-state effects yields agreement with experiment for the electric and magnetic form factors GE(Q2) and GM(Q2) up to Q2=0.5 GeV2.

  15. A study of the N to Delta transition form factors in full QCD

    SciTech Connect

    Constantia Alexandrou; Robert Edwards; Giannis Koutsou; Theodoros Leontiou; Hartmut Neff; John W. Negele; Wolfram Schroers; Antonios Tsapalis

    2005-07-01

    The N to Delta transition form factors GM1, GE2 and GC2 are evaluated using dynamical MILC configurations and valence domain wall fermions at three values of quark mass corresponding to pion mass 606 MeV, 502 MeV and 364 MeV on lattices of spatial size 20{sup 3} and 28{sup 3}. The unquenched results are compared to those obtained at similar pion mass in the quenched theory.

  16. Measurement of the neutron electric form factor GEn in quasielastic scattering

    SciTech Connect

    Donal Day

    2003-07-15

    We have measured the electric form factor of the neutron, GEn, at two momentum transfers (Q2= 0.5 and Q2= 1.0 GeV/c2) through quasielastic scattering in Jefferson Lab's Hall C. Longitudinally polarized electrons scattered from polarized deuterated ammonia and GEn was extracted from the beam-target asymmetry AVed which, in quasielastic kinematics, is particularly sensitive to GEn and insensitive to MEC and FSI.

  17. Extraction and interpretation of gammaN-->Delta form factors within a dynamical model

    SciTech Connect

    B. Juliá-Díaz, T.-S. H. Lee, T. Sato, and L. C. Smith

    2007-01-01

    Within the dynamical model of Refs. [Phys. Rev. C54, 2660 (1996); C63, 055201 (2001)], we perform an analysis of recent data of pion electroproduction reactions at energies near the {Delta}(1232) resonance. We discuss possible interpretations of the extracted bare and dressed {gamma} N {yields} {Delta} form factors in terms of relativistic constituent quark models and Lattice QCD calculations. Possible future developments are discussed.

  18. K →π semileptonic form factors with Nf=2 +1 +1 twisted mass fermions

    NASA Astrophysics Data System (ADS)

    Carrasco, N.; Lami, P.; Lubicz, V.; Riggio, L.; Simula, S.; Tarantino, C.; ETM Collaboration

    2016-06-01

    We present a lattice QCD determination of the vector and scalar form factors of the semileptonic K →π ℓν decay which are relevant for the extraction of the Cabibbo-Kobayashi-Maskawa matrix element |Vu s| from experimental data. Our results are based on the gauge configurations produced by the European Twisted Mass Collaboration with Nf=2 +1 +1 dynamical fermions, which include in the sea, besides two light mass degenerate quarks, also the strange and the charm quarks. We use data simulated at three different values of the lattice spacing and with pion masses as small as 210 MeV. Our final result for the vector form factor at zero momentum transfer is f+(0 )=0.9709 (46 ) , where the uncertainty is both statistical and systematic combined in quadrature. Using the latest experimental value of f+(0 )|Vu s| from Kℓ3 decays, we obtain |Vu s|=0.2230 (11 ) , which allows us to test the unitarity constraint of the Standard Model below the permille level once the determination of |Vu d| from superallowed nuclear β decays is adopted. A slight tension with unitarity at the level of ˜2 standard deviations is observed. Moreover, we present our results for the semileptonic scalar f0(q2) and vector f+(q2) form factors in the whole range of values of the squared four-momentum transfer q2 measured in Kℓ3 decays, obtaining a very good agreement with the momentum dependence of the experimental data. We provide a set of synthetic data points representing our results for the vector and scalar form factors at the physical point for several selected values of q2.

  19. Measurement of the Hadronic Form Factors in Ds to phi e nu Decays

    SciTech Connect

    Serrano, J

    2006-09-26

    Based on the measured four-dimensional rate for D{sub s}{sup +} {yields} {phi}e{sup +}{nu}{sub e} decays, they have determined the ratios of the three hadronic form factors, {tau}{sub V} = V(0)/A{sub 1}(0) = 1.636 {+-} 0.067 {+-} 0.038 and {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.705 {+-} 0.056 {+-} 0.029, using a simple pole ansatz for the q{sup 2} dependence, with fixed values of the pole masses for both the vector and axial form factors. By a separate fit to the same data, they have also extracted the pole mass for the axial form factors, m{sub A}: {tau}{sub V} = V(0)/A{sub 1}(0) = 1.633 {+-} 0.081 {+-} 0.068, {tau}{sub 2} = A{sub 2}(0)/A{sub 1}(0) = 0.711 {+-} 0.111 {+-} 0.096 and m{sub A} = (2.53{sub -0.35}{sup +0.54} {+-} 0.54)GeV/c{sup 2}.

  20. Λb→pl⁻ν¯l form factors from lattice QCD with static b quarks

    DOE PAGESBeta

    Detmold, William; Lin, C.-J. David; Meinel, Stefan; Wingate, Matthew

    2013-07-23

    We present a lattice QCD calculation of form factors for the decay Λb→pμ⁻ν¯μ, which is a promising channel for determining the Cabibbo-Kobayashi-Maskawa matrix element |Vub| at the Large Hadron Collider. In this initial study we work in the limit of static b quarks, where the number of independent form factors reduces to two. We use dynamical domain-wall fermions for the light quarks, and perform the calculation at two different lattice spacings and at multiple values of the light-quark masses in a single large volume. Using our form factor results, we calculate the Λb→pμ⁻ν¯μ differential decay rate in the range 14more » GeV²≤q²≤q²max, and obtain the integral ∫q²max 14 GeV²[dΓ/dq²]dq²/|Vub|²=15.3±4.2 ps⁻¹. Combined with future experimental data, this will give a novel determination of |Vub| with about 15% theoretical uncertainty. The uncertainty is dominated by the use of the static approximation for the b quark, and can be reduced further by performing the lattice calculation with a more sophisticated heavy-quark action.« less

  1. Light meson electromagnetic form factors from three-flavor lattice QCD with exact chiral symmetry

    NASA Astrophysics Data System (ADS)

    Aoki, S.; Cossu, G.; Feng, X.; Hashimoto, S.; Kaneko, T.; Noaki, J.; Onogi, T.

    2016-02-01

    We study the chiral behavior of the electromagnetic (EM) form factors of pions and kaons in three-flavor lattice QCD. In order to make a direct comparison of the lattice data with chiral perturbation theory (ChPT), we employ the overlap quark action that has exact chiral symmetry. Gauge ensembles are generated at a lattice spacing of 0.11 fm with four pion masses ranging between Mπ≃290 MeV and 540 MeV and with a strange quark mass ms close to its physical value. We utilize the all-to-all quark propagator technique to calculate the EM form factors with high precision. Their dependence on ms and on the momentum transfer is studied by using the reweighting technique and the twisted boundary conditions for the quark fields, respectively. A detailed comparison with SU(2) and SU(3) ChPT reveals that the next-to-next-to-leading order terms in the chiral expansion are important to describe the chiral behavior of the form factors in the pion mass range studied in this work. We estimate the relevant low-energy constants and the charge radii, and find reasonable agreement with phenomenological and experimental results.

  2. Roles of Different Forms of Scale Factor in Non-linear Electrodynamics for Accelerating Universe

    NASA Astrophysics Data System (ADS)

    Maity, Sayani; Debnath, Ujjal

    2013-07-01

    In this work, we have assumed the modified Lagrangian of non-linear electrodynamics for accelerated universe. The energy density and pressure for non-linear electromagnetic theory have been considered in terms of both electric and magnetic fields. The Einstein's filed equations have been considered in FRW universe for Hořava-Lifshitz gravity. Since we are considering the non-linear form of Lagrangian for accelerating universe, so four forms of scale factors like logamediate, intermediate, emergent and power law forms are chosen in our investigation. For every expansion, the natures of electric field and magnetic field have been shown through graphical representation. The electric and magnetic fields increase for logamediate, intermediate and emergent expansion and decrease in power law expansion.

  3. SU-E-T-72: Commissioning of a Standardized SRS Cone Set: Determination of the Bolus Gap Factors in a Passively Scattered Proton Beam

    SciTech Connect

    Simpson, R; Gordon, I; Ghebremedhin, A; Wroe, A; Schulte, R; Bush, D; Slater, J; Patyal, B

    2014-06-01

    Purpose: To determine the proton output factors for an SRS cone set using standardized apertures and varied range compensators (bolus blanks); specifically, to determine the best method for modeling the bolus gap factor (BGF) and eliminate the need for patient specific calibrations. Methods: A Standard Imaging A-16 chamber was placed in a Plastic Water phantom to measure the change in dose/MU with different treatment combinations for a proton SRS cone, using standardized apertures and range compensators. Measurements were made with all apertures in the SRS cone set, with four different range compensator thicknesses and five different air gaps between the end of the SRS cone and the surface of the phantom. The chamber was located at iso-center and maintained at a constant depth at the center of modulation for all measurements. Each aperture was placed in the cone to measure the change in MU needed to maintain constant dose at the chamber, as the air gap was increased with different thicknesses of bolus. Results: The dose/MU varied significantly with decreasing aperture size, increasing bolus thickness, or increasing air gap. The measured data was fitted with the lowest order polynomials that accurately described the data, to create a model for determining the change in output for any potential combination of devices used to treat a patient. For a given standardized aperture, the BGF could be described by its constituent factors: the bolus thickness factor (BTF) and the nozzle extension factor (NEF). Conclusion: The methods used to model the dose at the calibration point could be used to accurately predict the change in output for SRS proton beams due to the BGF, eliminating the need for patient specific calibrations. This method for modeling SRS treatments could also be applied to model other treatments using passively scattered proton beams.

  4. The effect of intramolecular H-bonds on the aqueous solution continuum description of the N-protonated form of dopamine

    NASA Astrophysics Data System (ADS)

    Alagona, Giuliano; Ghio, Caterina

    1996-04-01

    The conformational properties in vacuo and in solution of N-protonated dopamine have been studied making use of ab initio SCF calculations in vacuo and free energy calculations in aqueous solution, in the framework of the polarizable continuum model (PCM), on the STO-3G, 4-31G and 6-31G ∗ optimized geometries obtained in vacuo. The in vacuo energy profiles along a few sections of the potential energy surface turn out to be very close for the extended basis sets, while the STO-3G eresults are slightly dispalced. The largest difference between the minimal and the extended basis sets is found for the perpendicular arrangement, which is however the lowest energy profile with low barriers to the CCCN rotation both invacuo and in solution. The solvent stabilizes the trans over the gauche rotamers. Teh conformers without intramolecular H-bond between the -OH side chains are favored by the solvent, which makes the planar i, anti conformers as stable as the corresponding conformers with an intramolecular H-bond in aqueous solution. The solvation free energy is considerably less basis set dependent than the potential energy in vacuo. The ab initio PCM results slightly favor the planar 1 form over the planar 2 form whereas the semiempirical AMSOL results of Urban, Cramer and Famini (J. Am. Chem. Soc. 114 (1992) 8226) do the opposite. The cavitation free energy is nearly independent of the basis set. The almost constant (about 4.4 kcal/mol) cavitation and dispersion-repulsion corrections do not affect the differential quantities.

  5. Clean measurements of the nucleon axial-vector and free-neutron magnetic form factors

    SciTech Connect

    Deur, Alexandre P.

    2013-11-01

    We discuss the feasibility of a weak charged current experiment using a low energy electron beam. A first goal is to measure the Q^2 dependence of the axial-vector form factor g_a(Q^2). It can be measured model-independently and as robustly as for electromagnetic form factors from typical electron scattering experiments, in contrast to the methods used so far to measure g_a(Q^2). If g_a(Q^2) follows a dipole form, the axial mass can be extracted with a better accuracy than the world data altogether. The most important detection equipment would be a segmented neutron detector with good momentum and angular resolution that is symmetric about the beam direction, and covers a moderate angular range. A high intensity beam (100 uA) is necessary. Beam polarization is highly desirable as it provides a clean measurement of the backgrounds. Beam energies between 70 and 110 MeV are ideal. This range would provide a Q^2 mapping of g_a between 0.01

  6. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms

    PubMed Central

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-01-01

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains’ nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity. PMID:27539267

  7. Nematicidal spore-forming Bacilli share similar virulence factors and mechanisms.

    PubMed

    Zheng, Ziqiang; Zheng, Jinshui; Zhang, Zhengming; Peng, Donghai; Sun, Ming

    2016-01-01

    In the soil environment, Bacilli can affect nematode development, fecundity and survival. However, although many Bacillus species can kill nematodes, the virulence mechanisms Bacilli utilize remain unknown. In this study, we collected 120 strains comprising 30 species across the Bacillaceae and Paenibacillaceae families of the Bacillales order and measured their nematicidal activities in vitro. Comparison of these strains' nematicidal capacities revealed that nine species, including Bacillus thuringiensis, B. cereus, B. subtilis, B. pumilus, B. firmus, B. toyonensis, Lysinibacillus sphaericus, Brevibacillus laterosporus and B. brevis, were highly nematicidal, the first of which showed the highest activity. Genome sequencing and analysis identified many potential virulence factors, which grouped into five types. At least four possible mechanisms were deduced on the basis of the combination of these factors and the bacterial nematicidal activity, including a pore-forming mechanism of crystal proteins, an inhibition-like mechanism of thuringiensin and a degradation mechanism of proteases and/or chitinases. Our results demonstrate that 120 spore-forming Bacilli across different families share virulence factors that may contribute to their nematicidal capacity. PMID:27539267

  8. The Use of Soil Forming Factors in the Development of Soil Taxonomy

    NASA Astrophysics Data System (ADS)

    Bockheim, JG; Gennadiyev, AN; Hartemink, Alfred E.; Brevik, Eric C.

    2014-05-01

    The past and present roles of the five soil-forming factors in creating categories in USDA Soil Taxonomy have been analyzed. The factorial and genetic approach is clearly present in Soil Taxonomy, but was not so evident in the 7th Approximation of 1960. Soil climate is the most important factor in Soil Taxonomy. Climate is used at the highest level to define two of the 12 soil orders: Aridisols, the soils of the dry regions, and Gelisols, the permafrost-affected soils and is also used to differentiate suborders in eight of the remaining orders. Parent material is used to fully define two orders: Histosols and Andisols, and partially to define the suborders in the Entisol order (Fluvents, Psamments). Only one group of organisms, the worms (Verm-), is used at the great-group and subgroup levels in several orders. Relief and time are not used in defining taxa in Soil Taxonomy. Three of the eight epipedons are defined on the basis of parent material (folistic, histic, melanic), two on the basis of human activities (anthropic and plaggen), and two from the interaction of climate and vegetation (mollic and umbric). Of the 19 subsurface horizons, 11 originate from the interaction of climate and parent material. This analysis reveals there is an imbalance in the utilization of the soil-forming factors in Soil Taxonomy, with an emphasis on climate and parent material.

  9. Cluster form factor calculation in the ab initio no-core shell model

    SciTech Connect

    Navratil, Petr

    2004-11-01

    We derive expressions for cluster overlap integrals or channel cluster form factors for ab initio no-core shell model (NCSM) wave functions. These are used to obtain the spectroscopic factors and can serve as a starting point for the description of low-energy nuclear reactions. We consider the composite system and the target nucleus to be described in the Slater determinant (SD) harmonic oscillator (HO) basis while the projectile eigenstate to be expanded in the Jacobi coordinate HO basis. This is the most practical case. The spurious center of mass components present in the SD bases are removed exactly. The calculated cluster overlap integrals are translationally invariant. As an illustration, we present results of cluster form factor calculations for <{sup 5}He vertical bar{sup 4}He+n>, <{sup 5}He vertical bar{sup 3}H+d>, <{sup 6}Li vertical bar{sup 4}He+d>, <{sup 6}Be vertical bar{sup 3}He+{sup 3}He>, <{sup 7}Li vertical bar{sup 4}He+{sup 3}H>, <{sup 7}Li vertical bar{sup 6}Li+n>, <{sup 8}Be vertical bar{sup 6}Li+d>, <{sup 8}Be vertical bar{sup 7}Li+p>, <{sup 9}Li vertical bar{sup 8}Li+n>, and <{sup 13}C vertical bar{sup 12}C+n>, with all the nuclei described by multi-({Dirac_h}/2{pi}){omega} NCSM wave functions.

  10. Alcohol Dimer is Requisite to Form an Alkyl Oxonium Ion in the Proton Transfer of a Strong (Photo)Acid to Alcohol.

    PubMed

    Park, Sun-Young; Lee, Young Min; Kwac, Kijeong; Jung, Yousung; Kwon, Oh-Hoon

    2016-03-18

    Alcohols, the simplest amphiprotic organic compounds, can exhibit either acidic or basic behavior by donating or accepting a proton. In this study, proton dissociation of a model photoacid in solution is explored by using time-resolved spectroscopy, revealing quantitatively for the first time that alcohol acts as a Brønsted base because of H-bonded cluster formation to enhance the reactivity. The protonated alcohol cluster, the alkyl oxonium ion, can be regarded as a key reaction intermediate in the well-established alcohol dehydration reaction. This finding signifies, as in water, the cooperativity of protic solvent molecules to facilitate nonaqueous acid-base reactions. PMID:26757097

  11. TWO-PHOTON EXCHANGE IN ELECTRON-PROTON ELASTIC SCATTERING: THEORY UPDATE

    SciTech Connect

    Andrei Afanasev

    2007-05-21

    Recent theoretical developments in the studies of two-photon exchange effects in elastic electron-proton scattering are reviewed. Two-photon exchange mechanism is considered a likely source of discrepancy between polarized and unpolarized experimental measurements of the proton electric form factor at momentum transfers of several GeV$^2$. This mechanism predicts measurable effects that are currently studied experimentally.

  12. Analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section

    SciTech Connect

    Gerasimov, R. E. Fadin, V. S.

    2015-01-15

    An analysis of approximations used in calculations of radiative corrections to electron-proton scattering cross section is presented. We investigate the difference between the relatively recent Maximon and Tjon result and the Mo and Tsai result, which was used in the analysis of experimental data. We also discuss the proton form factors ratio dependence on the way we take into account radiative corrections.

  13. Form factor expansions in the 2D Ising model and Painlevé VI

    NASA Astrophysics Data System (ADS)

    Mangazeev, Vladimir V.; Guttmann, Anthony J.

    2010-10-01

    We derive a Toda-type recurrence relation, in both high- and low-temperature regimes, for the λ-extended diagonal correlation functions C(N,N;λ) of the two-dimensional Ising model, using an earlier connection between diagonal form factor expansions and tau-functions within Painlevé VI (PVI) theory, originally discovered by Jimbo and Miwa. This greatly simplifies the calculation of the diagonal correlation functions, particularly their λ-extended counterparts. We also conjecture a closed form expression for the simplest off-diagonal case C(0,1;λ) where a connection to PVI theory is not known. Combined with the results for diagonal correlations these give all the initial conditions required for the λ-extended version of quadratic difference equations for the correlation functions discovered by McCoy, Perk and Wu. The results obtained here should provide a further potential algorithmic improvement in the λ-extended case, and facilitate other developments.

  14. Valence quark contributions for the gamma N -> P11(1440) form factors

    SciTech Connect

    Gilberto Ramalho, Kazuo Tsushima

    2010-04-01

    Using a covariant spectator quark model we estimate valence quark contributions to the F_1*(Q2) and F2*(Q2) transition form factors for the gamma N -> P11(1440) reaction. The Roper resonance, P11(1440), is assumed to be the first radial excitation of the nucleon. The present model requires no extra parameters except for those already fixed by the previous studies for the nucleon. Our results are consistent with the experimental data in the high Q2 region, and those from lattice QCD. We also estimate the meson cloud contributions, focusing on the low Q2 region, where they are expected to be dominant.

  15. Extraction of the Compton Form Factor H from DVCS measurements at Jefferson Lab

    SciTech Connect

    Moutarde, H

    2009-05-01

    In the framework of Generalised Parton Distributions, we study the helicity-dependent and independent cross sections measured in Hall A and the beam spin asymmetries measured in Hall B at Jefferson Laboratory. We perform a global fit of these data and fits on each kinematical bin. We extract the real and imaginary parts of the Compton Form Factor $\\mathcal{H}$ under the main hypothesis of dominance of the Generalised Parton Distribution $H$ and twist 2 accuracy. We discuss our results and compare to previous extractions as well as to the VGG model. We pay extra attention to the estimation of errors on the extraction of $\\mathcal{H}$.

  16. K(13) FORM FACTOR WITH TWO FLAVORS OF DYNAMICAL DOMAIN WALL QUARKS.

    SciTech Connect

    SONI, A.; DAWSON, T.; IZUBUCHI, T.; KANEKO, T.; SASAKI, S.

    2005-07-25

    We report on our calculation of K {yields} {pi} vector form factor by numerical simulations of two-flavor QCD on a 16{sup 3} x 32 x 12 lattice at a {approx_equal} 0.12 fm using domain-wall quarks and DBW2 glue. Our preliminary result at a single sea quark mass corresponding to m{sub PS}/m{sub V} {approx_equal} 0.53 shows a good agreement with previous estimate in quenched QCD and that from a phenomenological model.

  17. Trinucleon Electromagnetic Form Factors and the Light-Front Hamiltonian Dynamics

    SciTech Connect

    Baroncini, F.; Kievsky, A.; Pace, E.; Salme, G.

    2008-10-13

    This contribution briefly illustrates preliminary calculations of the electromagnetic form factors of {sup 3}He and {sup 3}H, obtained within the Light-front Relativistic Hamiltonian Dynamics, adopting i) a Poincare covariant current operator, without dynamical two-body currents, and ii) realistic nuclear bound states with S, P and D waves. The kinematical region of few (GeV/c){sup 2}, relevant for forthcoming TJLAB experiments, has been investigated, obtaining possible signatures of relativistic effects for Q{sup 2}>2.5(GeV/c){sup 2}.

  18. Precise Determination of the Neutron Magnetic Form Factor to Higher Q{sup 2}

    SciTech Connect

    William K. Brooks; Jeffery D. Lachniet

    2004-10-01

    The neutron elastic magnetic form factor G{sub M}{sup n} has been extracted from quasielastic scattering from deuterium in the CEBAF Large Acceptance Spectrometer, CLAS. The kinematic coverage of the measurement is continuous over a broad range, extending from below 1 GeV{sup 2} to nearly 5 GeV{sup 2} in four-momentum transfer squared. High precision is achieved by employing a ratio technique in which most uncertainties cancel, and by a simultaneous in-situ calibration of the neutron detection efficiency, the largest correction to the data. Preliminary results are shown with statistical errors only.

  19. Extraction of the Compton Form Factor H from DVCS Measurements in the Quark Sector

    SciTech Connect

    H. Moutarde

    2011-10-01

    Working at twist 2 accuracy and assuming the dominance of the Generalized Parton Distribution H we study the helicity-dependent and independent cross sections measured in Hall A, the beam spin asymmetries measured in Hall B at Jefferson Laboratory and beam charge, beam spin and target spin asymmetries measured by Hermes. We extract the real and imaginary parts of the Compton Form Factor H, the latter being obtained with a 20-50% uncertainty. We pay extra attention to the estimation of systematic errors on the extraction of H. We discuss our results and compare to other extractions as well as to the popular VGG model.

  20. Extraction of the Compton Form Factor H from DVCS Measurements in the Quark Sector

    SciTech Connect

    Moutarde, H.

    2011-10-24

    Working at twist 2 accuracy and assuming the dominance of the Generalized Parton Distribution H we study the helicity-dependent and independent cross sections measured in Hall A, the beam spin asymmetries measured in Hall B at Jefferson Laboratory and beam charge, beam spin and target spin asymmetries measured by Hermes. We extract the real and imaginary parts of the Compton Form Factor H, the latter being obtained with a 20-50 % uncertainty. We pay extra attention to the estimation of systematic errors on the extraction of H. We discuss our results and compare to other extractions as well as to the popular VGG model.

  1. Measurement of the Form-Factor Ratios for D+ --> K¯*0e+νe

    NASA Astrophysics Data System (ADS)

    Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G.; Gagnon, G. P.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K.; Santoro, A. F.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yi, D.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1998-02-01

    We present a measurement of the form-factor ratios rV = V\\(0\\)/A1\\(0\\) and r2 = A2\\(0\\)/A1\\(0\\) for the decay D+-->K¯ *0e+νe. The measurement is based on a signal of approximately 3000 D+-->K¯ *0e+νe, K¯ *0-->K-π+ decays reconstructed in data from charm hadroproduction experiment E791 at Fermilab. The results are rV = 1.84+/-0.11+/-0.08 and r2 = 0.71+/-0.08+/-0.09.

  2. Measurement of the form-factor ratios for D+s-- >φl+νl

    NASA Astrophysics Data System (ADS)

    E791 Collaboration; Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G. F.; Gagnon, P.; Gobel, C.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R. T.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K. S.; Santoro, A. F. S.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stefanski, R. J.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yang, S. M.; Yi, D.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1999-03-01

    We have measured the form factor ratios rV=V(0)/A1(0) and r2=A2(0)/A1(0) for the decay Ds+-->φ l+ νl, φ-->K+ K-, using data from charm hadroproduction experiment E791 at Fermilab. Results are based on 144 signal and 22 background events in the electron channel and 127 signal and 34 background events in the muon channel. We combine the measurements from both lepton channels to obtain rV=2.27+/-0.35+/-0.22 and r2=1.57+/-0.25+/-0.19.

  3. All tree-level MHV form factors in N = 4 SYM from twistor space

    NASA Astrophysics Data System (ADS)

    Koster, Laura; Mitev, Vladimir; Staudacher, Matthias; Wilhelm, Matthias

    2016-06-01

    We incorporate all gauge-invariant local composite operators into the twistor-space formulation of N = 4 SYM theory, detailing and expanding on ideas we presented recently in [1]. The vertices for these operators contain infinitely many terms and we show how they can be constructed by taking suitable derivatives of a light-like Wilson loop in twistor space and shrinking it down to a point. In particular, these vertices directly yield the tree-level MHV super form factors of all composite operators in N = 4 SYM theory.

  4. Measurement of the gamma gamma* --> eta and gamma gamma* --> eta' transition form factors

    SciTech Connect

    del Amo Sanchez et al, P.

    2011-02-07

    We study the reactions e{sup +}e{sup -} {yields} e{sup +}e{sup -} {eta}{sup (/)} in the single-tag mode and measure the {gamma}{gamma}* {yields} {eta}{sup (/)} transition form factors in the momentum transfer range from 4 to 40 GeV{sup 2}. The analysis is based on 469 fb{sup -1} of integrated luminosity collected at PEP-II with the BABAR detector at e{sup +}e{sup -} center-of-mass energies near 10.6 GeV.

  5. The Form Factors of the Gauge-Invariant Three-Gluon Vertex

    SciTech Connect

    Binger, Michael; Brodsky, Stanley J.

    2006-02-24

    The gauge-invariant three-gluon vertex obtained from the pinch technique is characterized by thirteen nonzero form factors, which are given in complete generality for unbroken gauge theory at one loop. The results are given in d dimensions using both dimensional regularization and dimensional reduction, including the effects of massless gluons and arbitrary representations of massive gauge bosons, fermions, and scalars. We find interesting relations between the functional forms of the contributions from gluons, quarks, and scalars. These relations hold only for the gauge-invariant pinch technique vertex and are d-dimensional incarnations of supersymmetric nonrenormalization theorems which include finite terms. The form factors are shown to simplify for N = 1, 2, and 4 supersymmetry in various dimensions. In four-dimensional non-supersymmetric theories, eight of the form factors have the same functional form for massless gluons, quarks, and scalars, when written in a physically motivated tensor basis. For QCD, these include the tree-level tensor structure which has prefactor {beta}{sub 0} = (11N{sub c}-2N{sub f})/3, another tensor with prefactor 4N{sub c} - N{sub f}, and six tensors with N{sub c} - N{sub f}. In perturbative calculations our results lead naturally to an effective coupling for the three-gluon vertex, {tilde {alpha}}(k{sub 1}{sup 2}, k{sub 2}{sup 2}, k{sub 3}{sup 2}), which depends on three momenta and gives rise to an effective scale Q{sub eff}{sup 2} (k{sub 1}{sup 2}, k{sub 2}{sup 2}, k{sub 3}{sup 2}) which governs the behavior of the vertex. The effects of nonzero internal masses M are important and have a complicated threshold and pseudo-threshold structure. A three-scale effective number of flavors N{sub F}(k{sub 1}{sup 2}/M{sup 2}, k{sub 2}{sup 2}/M{sup 2}, k{sub 3}{sup 2}/M{sup 2}) is defined. The results of this paper are an important part of a gauge-invariant dressed skeleton expansion and a related multi-scale analytic renormalization scheme

  6. Palmitoleate is a mitogen, formed upon stimulation with growth factors, and converted to palmitoleoyl-phosphatidylinositol.

    PubMed

    Koeberle, Andreas; Shindou, Hideo; Harayama, Takeshi; Shimizu, Takao

    2012-08-01

    Controversial correlations between biological activity and concentration of the novel lipokine palmitoleate (9Z-hexadecenoate, 16:1) might depend on the formation of an active 16:1 metabolite. For its identification, we analyzed the glycerophospholipid composition of mouse Swiss 3T3 fibroblasts in response to 16:1 using LC-MS/MS. 16:1 was either supplemented to the cell culture medium or endogenously formed when cells were stimulated with insulin or growth factors as suggested by the enhanced mRNA expression of 16:1-biosynthetic enzymes. The proportion of 1-acyl-2-16:1-sn-phosphatidylinositol (16:1-PI) was time-dependently and specifically increased relative to other glycerophospholipids under both conditions and correlated with the proliferation of fatty acid (16:1, palmitate, oleate, or arachidonate)-supplemented cells. Accordingly, cell proliferation was impaired by blocking 16:1 biosynthesis using the selective stearoyl-CoA desaturase-1 inhibitor CAY10566 and restored by supplementation of 16:1. The accumulation of 16:1-PI occurred throughout cellular compartments and within diverse mouse cell lines (Swiss 3T3, NIH-3T3, and 3T3-L1 cells). To elucidate further whether 16:1-PI is formed through the de novo or remodeling pathway of PI biosynthesis, phosphatidate levels and lyso-PI-acyltransferase activities were analyzed as respective markers. The proportion of 16:1-phosphatidate was significantly increased by insulin and growth factors, whereas lyso-PI-acyltransferases showed negligible activity for 16:1-coenzyme A. The relevance of the de novo pathway for 16:1-PI biosynthesis is supported further by the comparable incorporation rate of deuterium-labeled 16:1 and tritium-labeled inositol into PI for growth factor-stimulated cells. In conclusion, we identified 16:1 or 16:1-PI as mitogen whose biosynthesis is induced by growth factors. PMID:22700983

  7. Factorial invariance of the Five-Factor Model Rating Form across gender.

    PubMed

    Samuel, Douglas B; South, Susan C; Griffin, Sarah A

    2015-02-01

    The Five-Factor Model Rating Form (FFMRF) provides a brief, one-page assessment of the Five-Factor Model. An important and unique aspect of the FFMRF is that it is the only brief measure that includes scales for the 30 facets proposed by Costa and McCrae. The current study builds on existing validity support for the FFMRF by evaluating its factorial invariance across gender within a sample of 699 undergraduate students. Consistent with other measures of the Five-Factor Model, men scored lower than women on the domains of neuroticism, extraversion, agreeableness, and conscientiousness but slightly higher on openness. The novel contribution of the current study is the use of exploratory structural equation modeling to determine that the FFMRF displayed a five-factor structure that demonstrated strong measurement invariance across gender. This factorial invariance adds important support for the validity of the FFMRF as a self-report measure as it indicates that the scores assess the same latent constructs in men and women. Although future work is needed to clarify some facet-level findings and evaluate for potential predictive biases, the present results add to the increasing body of research supporting the validity of the FFMRF as a self-report measure of personality. PMID:24891427

  8. Accurate measurement of the x-ray coherent scattering form factors of tissues

    NASA Astrophysics Data System (ADS)

    King, Brian W.

    The material dependent x-ray scattering properties of tissues are determined by their scattering form factors, measured as a function of the momentum transfer argument, x. Incoherent scattering form factors, Finc, are calculable for all values of x while coherent scattering form factors, Fcoh, cannot be calculated except at large C because of their dependence on long range order. As a result, measuring Fcoh is very important to the developing field of x-ray scatter imaging. Previous measurements of Fcoh, based on crystallographic techniques, have shown significant variability, as these methods are not optimal for amorphous materials. Two methods of measuring F coh, designed with amorphous materials in mind, are developed in this thesis. An angle-dispersive technique is developed that uses a polychromatic x-ray beam and a large area, energy-insensitive detector. It is shown that Fcoh can be measured in this system if the incident x-ray spectrum is known. The problem is ill-conditioned for typical x-ray spectra and two numerical methods of dealing with the poor conditioning are explored. It is shown that these techniques work best with K-edge filters to limit the spectral width and that the accuracy degrades for strongly ordered materials. Measurements of width Fcoh for water samples are made using 50, 70 and 92 kVp spectra. The average absolute relative difference in Fcoh between our results and the literature for water is approximately 10-15%. Similar measurements for fat samples were made and found to be qualitatively similar to results in the literature, although there is very large variation between the literature values in this case. The angle-dispersive measurement is limited to low resolution measurements of the coherent scattering form factor although it is more accessible than traditional measurements because of the relatively commonplace equipment requirements. An energy-dispersive technique is also developed that uses a polychromatic x-ray beam and an

  9. Pion Cloud Contributions to the Proton Sea

    NASA Astrophysics Data System (ADS)

    Furukawa, Kayla; Aldahlawi, Feras; Merfeld, Kara

    2012-10-01

    A proton may split into a meson and a baryon as allowed by the Heisenberg uncertainty principle. This process and the possible meson-baryon combinations have been studied by several theoretical models. In this study, we investigate the proton and its constituents through the pion cloud model. The pion cloud model depends on the splitting function, fπB(y), which represents the probability of a proton splitting into a pion and a baryon, and the pion parton distribution function, qπ(z). The goal of our research is to examine the way the proton antiquark distributions depend on qπ(z) and the form factors and cutoffs of fπB(y). We have studied functional forms for the dbar and ubar quarks given by the Durham HepData Project, compared their difference and ratio to the E866 experimental data from FermiLab and have studied a simplified pion cloud model. For Henley and Miller's fπN(y) we show how different qπ(z) affect the proton antiquark distribution. We consider the pion parton distribution function of Sutton et al., as well as Aicher et al., and other forms of qπ(z).

  10. Proton transfer in organic scaffolds

    NASA Astrophysics Data System (ADS)

    Basak, Dipankar

    This dissertation focuses on the fundamental understanding of the proton transfer process and translating the knowledge into design/development of new organic materials for efficient non-aqueous proton transport. For example, what controls the shuttling of a proton between two basic sites? a) Distance between two groups? or b) the basicity? c) What is the impact of protonation on molecular conformation when the basic sites are attached to rigid scaffolds? For this purpose, we developed several tunable proton sponges and studied proton transfer in these scaffolds theoretically as well as experimentally. Next we moved our attention to understand long-range proton conduction or proton transport. We introduced liquid crystalline (LC) proton conductor based on triphenylene molecule and established that activation energy barrier for proton transport is lower in the LC phase compared to the crystalline phase. Furthermore, we investigated the impact of several critical factors: the choice of the proton transferring groups, mobility of the charge carriers, intrinsic vs. extrinsic charge carrier concentrations and the molecular architectures on long-range proton transport. The outcome of this research will lead to a deeper understanding of non-aqueous proton transfer process and aid the design of next generation proton exchange membrane (PEM) for fuel cell.

  11. Development of a Short Form of the Five-Factor Borderline Inventory.

    PubMed

    DeShong, Hilary L; Mullins-Sweatt, Stephanie N; Miller, Joshua D; Widiger, Thomas A; Lynam, Donald R

    2016-06-01

    The Five-Factor Borderline Inventory (FFBI) is a 120-item dimensional measure of borderline personality disorder (BPD) that was developed from the description of BPD from the perspective of the Five-Factor Model. The FFBI includes 12 subscales and 1 total score. The current study created a short form of the FFBI (FFBI-SF) using item response theory analyses based on an undergraduate student sample that completed the FFBI. Based on the results, the final FFBI-SF included 48 items, with 4 items per subscale. The construct validity of the short form was compared with the original FFBI in five additional samples. The FFBI-SF showed strong convergence with other BPD scales and comparable convergent and discriminant validity with the FFM compared with the FFBI. The correlational profiles generated by the total score and subscales were highly convergent. Results of the current study suggest that the FFBI-SF may be an accessible and useful assessment tool of BPD. PMID:25882163

  12. Extraction of Electromagnetic Transition Form Factors for Nucleon Resonances within a Dynamical Coupled-Channels Model

    SciTech Connect

    N. Suzuki, T. Sato, T.-S. H. Lee

    2010-10-01

    We explain the application of a recently developed analytic continuation method to extract the electromagnetic transition form factors for the nucleon resonances ($N^*$) within a dynamical coupled-channel model of meson-baryon reactions.Illustrative results of the obtained $N^*\\rightarrow \\gamma N$ transition form factors, defined at the resonance pole positions on the complex energy plane, for the well isolated $P_{33}$ and $D_{13}$, and the complicated $P_{11}$ resonances are presented. A formula has been developed to give an unified representation of the effects due to the first two $P_{11}$ poles, which are near the $\\pi\\Delta$ threshold, but are on different Riemann sheets. We also find that a simple formula, with its parameters determined in the Laurent expansions of $\\pi N \\rightarrow \\pi N$ and $\\gamma N \\rightarrow\\pi N$ amplitudes, can reproduce to a very large extent the exact solutions of the considered model at energies near the real parts of the extracted resonance positions. We indicate the differences between our results and those extracted from the approaches using the Breit-Wigner parametrization of resonant amplitudes to fit the data.

  13. $B\\to\\pi\\ell\\ell$ Form Factors for New-Physics Searches from Lattice QCD

    SciTech Connect

    Bailey, Jon A.

    2015-10-07

    The rare decay B→πℓ+- arises from b→d flavor-changing neutral currents and could be sensitive to physics beyond the standard model. Here, we present the first ab initio QCD calculation of the B→π tensor form factor fT. Together with the vector and scalar form factors f+ and f0 from our companion work [J. A. Bailey et al., Phys. Rev. D 92, 014024 (2015)], these parametrize the hadronic contribution to B→π semileptonic decays in any extension of the standard model. We obtain the total branching ratio BR(B+→π+μ+μ-)=20.4(2.1)×10-9 in the standard model, which is the most precise theoretical determination to date, and agrees with the recent measurement from the LHCb experiment [R. Aaij et al., J. High Energy Phys. 12 (2012) 125].

  14. Mutant forms of growth factor-binding protein-2 reverse BCR-ABL-induced transformation.

    PubMed Central

    Gishizky, M L; Cortez, D; Pendergast, A M

    1995-01-01

    Growth factor-binding protein 2 (Grb2) is an adaptor protein that links tyrosine kinases to Ras. BCR-ABL is a tyrosine kinase oncoprotein that is implicated in the pathogenesis of Philadelphia chromosome (Ph1)-positive leukemias. Grb2 forms a complex with BCR-ABL and the nucleotide exchange factor Sos that leads to the activation of the Ras protooncogene. In this report we demonstrate that Grb2 mutant proteins lacking amino- or carboxyl-terminal src homology SH3 domains suppress BCR-ABL-induced Ras activation and reverse the oncogenic phenotype. The Grb2 SH3-deletion mutant proteins bind to BCR-ABL and do not impair tyrosine kinase activity. Expression of the Grb2 SH3-deletion mutant proteins in BCR-ABL-transformed Rat-1 fibroblasts and in the human Ph1-positive leukemic cell line K562 inhibits their ability to grow as foci in soft agar and form tumors in nude mice. Furthermore, expression of the Grb2 SH3-deletion mutants in K562 cells induced their differentiation. Because Ras plays an important role in signaling by receptor and nonreceptor tyrosine kinases, the use of interfering mutant Grb2 proteins may be applied to block the proliferation of other cancers that depend in part on activated tyrosine kinases for growth. Images Fig. 1 Fig. 2 Fig. 3 PMID:7479904

  15. Measurement of the form-factor ratios for D+-->K¯*0l +νl

    NASA Astrophysics Data System (ADS)

    Fermilab E791 Collaboration; Aitala, E. M.; Amato, S.; Anjos, J. C.; Appel, J. A.; Ashery, D.; Banerjee, S.; Bediaga, I.; Blaylock, G.; Bracker, S. B.; Burchat, P. R.; Burnstein, R. A.; Carter, T.; Carvalho, H. S.; Copty, N. K.; Cremaldi, L. M.; Darling, C.; Denisenko, K.; Fernandez, A.; Fox, G. F.; Gagnon, P.; Gobel, C.; Gounder, K.; Halling, A. M.; Herrera, G.; Hurvits, G.; James, C.; Kasper, P. A.; Kwan, S.; Langs, D. C.; Leslie, J.; Lundberg, B.; Maytal-Beck, S.; Meadows, B.; de Mello Neto, J. R. T.; Mihalcea, D.; Milburn, R. H.; de Miranda, J. M.; Napier, A.; Nguyen, A.; D'Oliveira, A. B.; O'Shaughnessy, K.; Peng, K. C.; Perera, L. P.; Purohit, M. V.; Quinn, B.; Radeztsky, S.; Rafatian, A.; Reay, N. W.; Reidy, J. J.; Dos Reis, A. C.; Rubin, H. A.; Sanders, D. A.; Santha, A. K. S.; Santoro, A. F. S.; Schwartz, A. J.; Sheaff, M.; Sidwell, R. A.; Slaughter, A. J.; Sokoloff, M. D.; Solano, J.; Stanton, N. R.; Stefanski, R. J.; Stenson, K.; Summers, D. J.; Takach, S.; Thorne, K.; Tripathi, A. K.; Watanabe, S.; Weiss-Babai, R.; Wiener, J.; Witchey, N.; Wolin, E.; Yi, D.; Yang, S. M.; Yoshida, S.; Zaliznyak, R.; Zhang, C.

    1998-11-01

    The form factor ratios rV=V(0)/A1(0), r2=A2(0)/A1(0) and r3=A3(0)/A1(0) in the decay D+-->K¯*0l +νl, K¯*0-->K-π+ have been measured using data from charm hadroproduction experiment E791 at Fermilab. From 3034 (595) signal (background) events in the muon channel, we obtain rV=1.84+/-0.11+/-0.09, r2=0.75+/-0.08+/-0.09 and, as a first measurement of r3, we find 0.04+/-0.33+/-0.29. The values of the form factor ratios rV and r2 measured for the muon channel are combined with the values of rV and r2 that we have measured in the electron channel. The combined E791 results for the muon and electron channels are rV=1.87+/-0.08+/-0.07 and r2=0.73+/-0.06+/-0.08.

  16. Measurement of the Hadronic Form factor in D0 to K- e+ nu_e Decays

    SciTech Connect

    Aubert, B.; Bona, M.; Boutigny, D.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prudent, X.; Tisserand, V.; Zghiche, A.; Garra Tico, J.; Grauges, E.; Lopez, L.; Palano, A.; Eigen, G.; Stugu, B.; Sun, L.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Button-Shafer, J.; Cahn, R.N.; /Energy Sci. Network /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Leipzig, Tech. Hochsch. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /Frascati /Genoa U. /Harvard U. /Heidelberg U. /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /Milan U. /Mississippi U. /Concordia U., Montreal /Mt. Holyoke Coll. /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /Paris U., VI-VII /Pennsylvania U. /Perugia U. /Pisa U. /Prairie View A-M /Princeton U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison /Yale U.

    2007-04-09

    The shape of the hadronic form factor f{sub +} (q{sup 2}) in the decay D{sup 0} {yields} K{sup -} e{sup +}{nu}{sub e} has been measured in a model independent analysis and compared with theoretical calculations. They use 75 fb{sup -1} of data recorded by the BABAR detector at the PEPII electron-positron collider. The corresponding decay branching fraction, relative to the decay D{sup 0} {yields} K{sup -} {pi}{sup +}, has also been measured to be R{sub D} = BR(D{sup 0} {yields} K{sup -}e{sup +}{nu}{sub e})/BR(D{sup 0} {yields} K{sup -}{pi}{sup +}) = 0.927 {+-} 0.007 {+-} 0.012. From these results, and using the present world average value for BR(D{sup 0} {yields} K{sup -}{pi}{sup +}), the normalization of the form factor at q{sup 2} = 0 is determined to be f{sub +}(0) = 0.727 {+-} 0.007 {+-} 0.005 {+-} 0.007 where the uncertainties are statistical, systematic, and from external inputs, respectively.

  17. Nucleon to {Delta} transition form factors with N{sub F}=2+1 domain wall fermions

    SciTech Connect

    Alexandrou, C.; Koutsou, G.; Proestos, Y.; Tsapalis, A.

    2011-01-01

    We calculate the electromagnetic, axial, and pseudoscalar form factors of the nucleon to {Delta}(1232) transition using two dynamical light degenerate quarks and a dynamical strange quark simulated with the domain wall fermion action. Results are obtained at lattice spacings a=0.114 fm and a=0.084 fm, with corresponding pion masses of 330 MeV and 297 MeV, respectively. High statistics measurements are achieved by utilizing the coherent sink technique. The dominant electromagnetic dipole form factor, the axial form factors and the pseudoscalar coupling are extracted to a good accuracy. This allows the investigation of the nondiagonal Goldberger-Treiman relation. Particular emphasis is given on the extraction of the subdominant electromagnetic quadrupole form factors and their ratio to the dominant dipole form factor, R{sub EM} and R{sub SM}, measured in experiment.

  18. Direct CP Violation, Branching Ratios and Form Factors B --> pi, B --> K in B decays

    SciTech Connect

    O. Leitner; X.-H. Guo; A.W. Thomas

    2004-11-01

    The B {yields} {pi} and B {yields} K transitions involved in hadronic B decays are investigated in a phenomenological way through the framework of QCD factorization. By comparing our results with experimental branching ratios from the BELLE, BABAR and CLEO collaborations for all the B decays including either a pion or a kaon, we propose boundaries for the transition form factors B {yields} {pi} and B {yields} K depending on the CKM matrix element parameters {rho} and {eta}. From this analysis, the form factors required to reproduce the experimental data for branching ratios are F{sup B {yields} {pi}} = 0.31 {+-} 0.12 and F{sup B {yields} K} = 0.37 {+-} 0.13. We calculate the direct CP violating asymmetry parameter, a{sub CP}, for B {yields} {pi}{sup +}{pi}{sup -}{pi} and B {yields} {pi}{sup +}{pi}{sup -} K decays, in the case where {rho} - {omega} mixing effects are taken into account. Based on these results, we find that the direct CP asymmetry for B{sup -} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup -}, {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup 0}, B{sup -} {yields} {pi}{sup +}{pi}{sup -}K{sup -}, and {bar B}{sup 0} {yields} {pi}{sup +}{pi}{sup -} {bar K}{sup 0}, reaches its maximum when the invariant mass {pi}{sup +}{pi}{sup -} is in the vicinity of the {omega} meson mass. The inclusion of {rho} - {omega} mixing provides an opportunity to erase, without ambiguity, the phase uncertainty mod{pi} in the determination of th CKM angles {alpha} in case of b {yields} u and {gamma} in case of b {yields} s.

  19. Proton Radius, Darwin-Foldy Term and Radiative Corrections

    NASA Astrophysics Data System (ADS)

    Jentschura, Ulrich

    2013-04-01

    It is not an easy task to define the proton charge radius. Namely, by definition, the proton radius is the slope of the GESachs form factor of the proton at zero momentum transfer, provided one has subtracted from the scattering cross sections, all effects due to QED. That means that radiative corrections must be subtracted; these otherwise ``mask'' the proton structure from the surroundings. On the other hand, the self-energy of the proton (not of the electron or of the muon) also influence the spectrum of atomic hydrogen, or muonic hydrogen, respectively. In the talk, we shall review the difficulties faced by a consistent definition, offer a way to resolve them, and review the current status of Lamb shift predictions in muonic hydrogen, with a special reference to the current experimental-theoretical discrepancy, as reported by the CREMA collaboration.

  20. Dose-rate effects of protons on in vivo activation of nuclear factor-kappa B and cytokines in mouse bone marrow cells

    SciTech Connect

    Rithidech, K.N.; Rusek, A.; Reungpatthanaphong, P.; Honikel, L.; Simon, S.R.

    2010-05-28

    The objective of this study was to determine the kinetics of nuclear factor-kappa B (NF-{kappa}B) activation and cytokine expression in bone marrow (BM) cells of exposed mice as a function of the dose rate of protons. The cytokines included in this study are pro-inflammatory [i.e., tumor necrosis factor-alpha (TNF-{alpha}), interleukin-1beta (IL-1{beta}), and IL-6] and anti-inflammatory cytokines (i.e., IL-4 and IL-10). We gave male BALB/cJ mice a whole-body exposure to 0 (sham-controls) or 1.0 Gy of 100 MeV protons, delivered at 5 or 10 mGy min{sup -1}, the dose and dose rates found during solar particle events in space. As a reference radiation, groups of mice were exposed to 0 (sham-controls) or 1 Gy of {sup 137}Cs {gamma} rays (10 mGy min{sup -1}). After irradiation, BM cells were collected at 1.5, 3, 24 h, and 1 month for analyses (five mice per treatment group per harvest time). The results indicated that the in vivo time course of effects induced by a single dose of 1 Gy of 100 MeV protons or {sup 137}Cs {gamma} rays, delivered at 10 mGy min{sup -1}, was similar. Although statistically significant levels of NF-{kappa}B activation and pro-inflammatory cytokines in BM cells of exposed mice when compared to those in the corresponding sham controls (Student's t-test, p < 0.05 or < 0.01) were induced by either dose rate, these levels varied over time for each protein. Further, only a dose rate of 5 mGy min{sup -1} induced significant levels of anti-inflammatory cytokines. The results indicate dose-rate effects of protons.

  1. Measurement of the generalized form factors near threshold via γ*p → nπ+ at high Q2

    SciTech Connect

    Park, K.; Adhikari, K. P.; Adikaram, D.; Anghinolfi, M.; Baghdasaryan, H.; Ball, J.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bookwalter, C.; Boiarinov, S.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Daniel, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; El Alaoui, A.; El Fassi, L.; Euginio, P.; Fedotov, G.; Fradi, A.; Gabrielyan, M. Y.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Graham, L.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Heddle, D.; Hicks, K.; Holtrop, M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jo, H. S.; Joo, K.; Khandaker, M.; Khertarpal, P.; Kim, A.; Kim, W.; Klein, F. J.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Kvaltine, N. D.; Livingston, K.; Lu, H. Y.; MacGregor, J. D.; Markov, N.; Mayer, M.; McKinnon, B.; Mestayer, M. D.; Meyer, C. A.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Moutarde, H.; Munevar, E.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I; Paolone, M.; Pappalardo, L.; Paremuzyan, R.; Park, S.; Anefalos Pereira, S.; Phelps, E.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Prok, Y.; Ricco, G.; Rimal, D.; Ripani, M.; Ritchie, B. G.; Rosner, G.; Rossi, P.; Sabati ee, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S. S.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tang, W.; Taylor, C. E.; Tian, Y.; Tkachenko, S.; Trivedi, A.; Ungaro, M.; Vernarsky, B.; Vlassov, A. V.; Voutier, E.; Watts, D. P.; Weygand, D. P.; Wood, M. H.; Zachariou, N.; Zhao, B.; Zhao, Z. W.

    2012-03-26

    We report the first extraction of the pion-nucleon multipoles near the production threshold for the nπ+ channel at relatively high momentum transfer (Q2 up to 4.2 GeV2). The dominance of the s-wave transverse multipole (E0+), expected in this region, allowed us to access the generalized form factor G1 within the light-cone sum rule (LCSR) framework as well as the axial form factor GA. The data analyzed in this work were collected by the nearly 4π CEBAF Large Acceptance Spectrometer (CLAS) using a 5.754-GeV electron beam on a proton target. The differential cross section and the π-N multipole E0+/GD were measured using two different methods, the LCSR and a direct multipole fit. The results from the two methods are found to be consistent and almost Q2 independent.

  2. Enantioselective Protonation

    PubMed Central

    Mohr, Justin T.; Hong, Allen Y.; Stoltz, Brian M.

    2010-01-01

    Enantioselective protonation is a common process in biosynthetic sequences. The decarboxylase and esterase enzymes that effect this valuable transformation are able to control both the steric environment around the proton acceptor (typically an enolate) and the proton donor (typically a thiol). Recently, several chemical methods to achieve enantioselective protonation have been developed by exploiting various means of enantiocontrol in different mechanisms. These laboratory transformations have proven useful for the preparation of a number of valuable organic compounds. PMID:20428461

  3. {nu} induced threshold production of two pions and N*(1440) electroweak form factors

    SciTech Connect

    Hernandez, E.; Nieves, J.; Valverde, M.; Singh, S. K.; Vacas, M. J. Vicente

    2008-03-01

    We study the threshold production of two pions induced by neutrinos in nucleon targets. The contribution of nucleon, pion, and contact terms are calculated using a chiral Lagrangian. The contribution of the Roper resonance, neglected in earlier studies, has also been taken into account. The numerical results for the cross sections are presented and compared with the available experimental data. It has been found that in the two-pion channels with {pi}{sup +}{pi}{sup -} and {pi}{sup 0}{pi}{sup 0} in the final state, the contribution of the N*(1440) is quite important and could be used to determine the N*(1440) electroweak transition form factors if experimental data with better statistics become available in the future.

  4. JLab Measurement of the 4He Charge Form Factor at Large Momentum Transfers

    SciTech Connect

    Camsonne, Alexandre; Katramatou, A. T.; Olson, M.; Sparveris, Nikolaos; Acha, Armando; Allada, Kalyan; Anderson, Bryon; Arrington, John; Baldwin, Alan; Chen, Jian-Ping; Choi, Seonho; Chudakov, Eugene; Cisbani, Evaristo; Craver, Brandon; Decowski, Piotr; Dutta, Chiranjib; Folts, Edward; Frullani, Salvatore; Garibaldi, Franco; Gilman, Ronald; Gomez, Javier; Hahn, Brian; Hansen, Jens-Ole; Higinbotham, Douglas; Holmstrom, Timothy; Huang, Jian; Iodice, Mauro; Kelleher, Aidan; Khrosinkova, Elena; Kievsky, A.; Kuchina, Elena; Kumbartzki, Gerfried; Lee, Byungwuek; LeRose, John; Lindgren, Richard; Lott, Gordon; Lu, H.; Marcucci, Laura; Margaziotis, Demetrius; Markowitz, Pete; Marrone, Stefano; Meekins, David; Meziani, Zein-Eddine; Michaels, Robert; Moffit, Bryan; Norum, Blaine; Petratos, Gerassimos; Puckett, Andrew; Qian, Xin; Rondon-Aramayo, Oscar; Saha, Arunava; Sawatzky, Bradley; Segal, John; Hashemi, Mitra; Shahinyan, Albert; Solvignon-Slifer, Patricia; Subedi, Ramesh; Suleiman, Riad; Sulkosky, Vincent; Urciuoli, Guido; Viviani, Michele; Wang, Y.; Wojtsekhowski, Bogdan; Yan, X.; Yao, H.; Zhang, W. -M.; Zheng, X.; Zhu, L.

    2014-04-01

    The charge form factor of 4He has been extracted in the range 29 fm-2 <= Q2 <= 77 fm-2 from elastic electron scattering, detecting 4He nuclei and electrons in coincidence with the High Resolution Spectrometers of the Hall A Facility of Jefferson Lab. The results are in qualitative agreement with realistic meson-nucleon theoretical calculations. The data have uncovered a second diffraction minimum, which was predicted in the Q2 range of this experiment, and rule out conclusively long-standing predictions of dimensional scaling of high-energy amplitudes using quark counting.

  5. Scattering from phase-separated vesicles. I. An analytical form factor for multiple static domains

    SciTech Connect

    Heberle, Frederick A.; Anghel, Vinicius N. P.; Katsaras, John

    2015-08-18

    This is the first in a series of studies considering elastic scattering from laterally heterogeneous lipid vesicles containing multiple domains. Unique among biophysical tools, small-angle neutron scattering can in principle give detailed information about the size, shape and spatial arrangement of domains. A general theory for scattering from laterally heterogeneous vesicles is presented, and the analytical form factor for static domains with arbitrary spatial configuration is derived, including a simplification for uniformly sized round domains. The validity of the model, including series truncation effects, is assessed by comparison with simulated data obtained from a Monte Carlo method. Several aspects of the analytical solution for scattering intensity are discussed in the context of small-angle neutron scattering data, including the effect of varying domain size and number, as well as solvent contrast. Finally, the analysis indicates that effects of domain formation are most pronounced when the vesicle's average scattering length density matches that of the surrounding solvent.

  6. Form factors and complete spectrum of XXX antiperiodic higher spin chains by quantum separation of variables

    SciTech Connect

    Niccoli, G.

    2013-05-15

    The antiperiodic transfer matrices associated to higher spin representations of the rational 6-vertex Yang-Baxter algebra are analyzed by generalizing the approach introduced recently in the framework of Sklyanin's quantum separation of variables (SOV) for cyclic representations, spin-1/2 highest weight representations, and also for spin-1/2 representations of the 6-vertex reflection algebra. Such SOV approach allow us to derive exactly results which represent complicate tasks for more traditional methods based on Bethe ansatz and Baxter Q-operator. In particular, we both prove the completeness of the SOV characterization of the transfer matrix spectrum and its simplicity. Then, the derived characterization of local operators by Sklyanin's quantum separate variables and the expression of the scalar products of separate states by determinant formulae allow us to compute the form factors of the local spin operators by one determinant formulae similar to those of the scalar products.

  7. Small form factor (SFF) optical data storage devices for mobile applications

    NASA Astrophysics Data System (ADS)

    Park, Young-Pil; Park, No-Cheol; Kim, Chul-Jin

    2005-09-01

    There are two basic requirements in the field of optical storage data devices. The first is the demand for the improvement of memory capacity to manage the increased data capacity in personal and official purposes. The second is the demand for small sized optical storage devices for mobile multimedia digital electronics, including digital camera, PDA and mobile phones. To summarize, for the sake of mobile applications, it is necessary to develop optical data storage devices which have simultaneously a large capacity and a small size. Small form factor optical disk drive (SFF ODD) is expected to become a good match for mobile applications due its advantages over other devices in cost and removability. Nowadays, many companies and research institutes including universities cooperate together in the research on SFF ODD and other related optical storage devices. Due such active researches, it is expected that SFF ODD will be widely used in mobile applications in the very near future.

  8. A polarized target measurement of the electric form factor of the neutron at Jlab

    SciTech Connect

    N. Savvinov

    2004-09-01

    The experiment E93-026 at the Thomas Jefferson National Accelerator Facility (JLab) determined the electric form factor of the neutron G{sub E}{sup n} through quasielastic {rvec d}({rvec e},e'n)p scattering using a longitudinally polarized electron beam and a frozen polarized {sup 15}N D{sub 3} target. The knocked out neutrons were detected in a segmented plastic scintillator detector in coincidence with the scattered electrons. The G{sub E}{sup n} was extracted by comparing the experimental beam-target asymmetry with full theoretical calculations based on different values of G{sub E}{sup n}. Preliminary results of the Fall 2001 run are reported.

  9. The Spectroscopy and Form Factors of Nucleon Resonances from Superconformal Quantum Mechanics and Holographic QCD

    NASA Astrophysics Data System (ADS)

    de Téramond, Guy F.

    2016-06-01

    The superconformal algebraic approach to hadronic physics is used to construct a semiclassical effective theory for nucleons which incorporates essential nonperturbative dynamical features, such as the emergence of a confining scale and the Regge resonance spectrum. Relativistic bound-state equations for nucleons follow from the extension of superconformal quantum mechanics to the light front and its holographic embedding in a higher dimensional gravity theory. Superconformal algebra has been used elsewhere to describe the connections between the light mesons and baryons, but in the present context it relates the fermion positive and negative chirality states and uniquely determines the confinement potential of nucleons. The holographic mapping of multi-quark bound states also leads to a light-front cluster decomposition of form factors for an arbitrary number of constituents. The remarkable analytical structure which follows incorporates the correct scaling behavior at high photon virtualities and also vector dominance at low energies.

  10. Periodic orbits analysis of the form factor: from ballistic to diffusive systems

    NASA Astrophysics Data System (ADS)

    Agam, Oded; Fishman, Shmuel

    1996-05-01

    The energy level correlator K(s) and the form factor 0305-4470/29/9/016/img1 are calculated for a hypercubic billiard with small hyperspheres placed at random in its interior. Various regimes, characterized by the elastic mean free path l, resulting from the scattering on impurities, are identified. The analysis extends from the ballistic regime, where l is much larger than the size of the system, via intermediate regimes, to the diffusive regime, where l is much smaller than its size. Semiclassical expressions for the density of states of chaotic and integrable systems in terms of classical periodic orbits are used. The diagonal approximation for 0305-4470/29/9/016/img1 is made for short times, while non-perturbative methods are used for long times. The analysis makes use of analytic properties of classical dynamical zeta function associated with the Perron - Frobenius operator. The general features are relevant for mesoscopic systems.

  11. Form factors and complete spectrum of XXX antiperiodic higher spin chains by quantum separation of variables

    NASA Astrophysics Data System (ADS)

    Niccoli, G.

    2013-05-01

    The antiperiodic transfer matrices associated to higher spin representations of the rational 6-vertex Yang-Baxter algebra are analyzed by generalizing the approach introduced recently in the framework of Sklyanin's quantum separation of variables (SOV) for cyclic representations, spin-1/2 highest weight representations, and also for spin-1/2 representations of the 6-vertex reflection algebra. Such SOV approach allow us to derive exactly results which represent complicate tasks for more traditional methods based on Bethe ansatz and Baxter Q-operator. In particular, we both prove the completeness of the SOV characterization of the transfer matrix spectrum and its simplicity. Then, the derived characterization of local operators by Sklyanin's quantum separate variables and the expression of the scalar products of separate states by determinant formulae allow us to compute the form factors of the local spin operators by one determinant formulae similar to those of the scalar products.

  12. An important factor powerfully influencing the Al Ni-based alloys' glass-forming ability

    NASA Astrophysics Data System (ADS)

    Bo, Zhang; Xiufang, Bian; Chunxia, Fu; Na, Han; Jiankun, Zhou; Weimin, Wang

    2005-12-01

    In order to get better glass-forming abilities (GFAs), Ni atoms are partially replaced by Cu and Co atoms in Al84Ni12Zr4 alloys. Thermal analysis shows that the reduced crystallization temperature Trx has no direct correlation with the GFA of the alloys. However, it is notable that prepeaks have been found in the total structure factors of the amorphous Al84Ni(12-x)Zr4Cux and Al84Ni(12-x)Zr4Cox alloys. In addition, the results prove that the intensity of the prepeaks influences the GFA powerfully. The amorphous alloys with larger intensity of the prepeak show better GFA. The influence of prepeaks on the GFA can be explained by the atomic configuration difference among the liquid, crystal and glass states.

  13. B →D l ν form factors at nonzero recoil and extraction of |Vc b|

    NASA Astrophysics Data System (ADS)

    Na, Heechang; Bouchard, Chris M.; Lepage, G. Peter; Monahan, Chris; Shigemitsu, Junko; Hpqcd Collaboration

    2015-09-01

    We present a lattice QCD calculation of the B →D l ν semileptonic decay form factors f+(q2) and f0(q2) for the entire physical q2 range. Nonrelativistic QCD bottom quarks and highly improved staggered quark charm and light quarks are employed together with Nf=2 +1 MILC gauge configurations. A joint fit to our lattice and BABAR experimental data allows an extraction of the Cabibbo-Kobayashi-Maskawa matrix element |Vc b| . We also determine the phenomenologically interesting ratio R (D )=B (B →D τ ντ)/B (B →D l νl) (l =e ,μ ). We find |Vc b|exclB →D=0.0402 (17 )(13 ) , where the first error consists of the lattice simulation errors and the experimental statistical error and the second error is the experimental systematic error. For the branching fraction ratio we find R (D )=0.300 (8 ) .

  14. Scaling study of the pion electroproduction cross sections and the pion form factor

    SciTech Connect

    Tanja Horn; Xin Qian; John Arrington; Razmik Asaturyan; Fatiha Benmokthar; Werner Boeglin; Peter Bosted; Antje Bruell; Eric Christy; Eugene Chudakov; Ben Clasie; Mark Dalton; AJI Daniel; Donal Day; Dipangkar Dutta; Lamiaa El Fassi; Rolf Ent; Howard Fenker; J. Ferrer; Nadia Fomin; H. Gao; K Garrow; Dave Gaskell; C Gray; G. Huber; M. Jones; N Kalantarians; C. Keppel; K Kramer; Y Li; Y Liang; A. Lung; S Malace; P. Markowitz; A. Matsumura; D. Meekins; T Mertens; T Miyoshi; H. Mykrtchyan; R. Monson; T. Navasardyan; G. Niculescu; I. Niculescu; Y. Okayasu; A. Opper; C Perdrisat; V. Punjabi; A. Rauf; V. Rodriguez; D. Rohe; J Seely; E Segbefia; G. Smith; M. Sumihama; V. Tadevoyan; L Tang; V. Tvaskis; A. Villano; W. Vulcan; F. Wesselmann; S. Wood; L. Yuan; X. Zheng

    2007-07-12

    The $^{1}$H($e,e^\\prime \\pi^+$)n cross section was measured for a range of four-momentum transfer up to $Q^2$=3.91 GeV$^2$ at values of the invariant mass, $W$, above the resonance region. The $Q^2$-dependence of the longitudinal component is consistent with the $Q^2$-scaling prediction for hard exclusive processes. This suggests that perturbative QCD concepts are applicable at rather low values of $Q^2$. Pion form factor results, while consistent with the $Q^2$-scaling prediction, are inconsistent in magnitude with perturbative QCD calculations. The extraction of Generalized Parton Distributions from hard exclusive processes assumes the dominance of the longitudinal term. However, transverse contributions to the cross section are still significant at $Q^2$=3.91 GeV$^2$.

  15. Persistent activation of nuclear factor-kappa B and expression of pro-inflammatory cytokines in bone marrow cells after exposure of mice to protons

    NASA Astrophysics Data System (ADS)

    Rithidech, Kanokporn; Reungpatthanaphong, Paiboon; Honikel, Louise; Whorton, Elbert

    Protons are the most abundant component of solar particle events (SPEs) in space. Information is limited on early-and late-occurring in vivo biological effects of exposure to protons at doses and dose rates that are similar to what astronauts encounter in space. We conducted a study series to fill this knowledge gap. We focused on the biological effects of 100 MeV/n protons, which are one of the most abundant types of protons induced during SPEs. We gave BALB/cJ mice a whole-body exposure to 0.5 or 1.0 Gy of 100 MeV/n protons, delivered at 0.5 or 1.0 cGy/min. These doses and dose rates of protons were selected because they are comparable to those of SPEs taking place in space. For each dose and dose rate of 100 MeV/n protons, mice exposed to 0 Gy of protons served as sham controls. Mice included in this study were also part of a study series conducted to examine the extent and the mechanisms involved in in vivo induction of genomic instability (expressed as late-occurring chromosome instability) by 100 MeV/n protons. Bone marrow (BM) cells were collected from groups of mice for analyses at different times post-exposure, i.e. early time-points (1.5, 3, and 24 hr) and late time-points (1 and 6 months). At each harvest time, there were five mice per treatment group. Several endpoints were used to investigate the biological effects of 100 MeV/n protons in BM cells from irradiated and sham control mice. The scope of this study was to determine the dose-rate effects of 0.5 Gy of 100 MeV/n protons in BM cells on the kinetics of nuclear factor-kappa B (NF-kappa B) activation and the expression of selected NF-kappa B target proteins known to be involved in inflammatory response, i.e. pro-inflammatory cytokines (TNF-alpha, IL-1 beta, and IL-6). Significantly high levels (p values ranging from p¡0.01 and p¡0.05) of activated NF-kappa B were observed in BM cells collected from irradiated mice, relative to those obtained from the corresponding sham controls, at all time

  16. ISR Hadron Production in e+e- Annihilations and Meson-Photon Transition Form Factors

    SciTech Connect

    Muller, David; /SLAC

    2012-05-22

    We present several recent results from the BaBar collaboration in the areas of initial state radiation physics and transition form factors. An updated study of the processes e{sup +}e{sup -} {yields} K{sup +}K{sup -}{pi}{sup +}{pi}{sup -} and e{sup +}e{sup -} {yields} K{sup +}K{sup -}{pi}{sup 0}{pi}{sup 0} provides an improved understanding of the Y (2175) meson. A very precise study of the process e{sup +}e{sup -} {yields} {pi}{sup +}{pi}{sup -} improves the precision on the calculated anomalous magnetic moment of the muon and provides by far the best information on excited {rho} states. Our previous measurements of the timelike transition form factors (TFF) of the {eta} and {eta}' mesons at Q{sup 2} = 112 GeV{sup 2}, combined with new measurements of the their spacelike TFFs and those of the {pi}{sup 0} and {eta}{sub c} mesons, provide powerful tests of QCD and models of the distribution amplitudes of quarks inside these mesons. The {eta}{sub c} TFF shows the expected behavior over the Q{sup 2} range 1-50 GeV{sup 2}, and we are sensitive to next-to-leading-order QCD corrections. The {eta} and {eta}' TFFs are consistent with expected behavior, but those for the {pi}{sup 0} are not. Extracting the strange and nonstrange components of the {eta} and {eta}' TFFs, we find the nonstrange component to be consistent with theoretical expectations and inconsistent with the measured {pi}{sup 0} TFF.

  17. Transition Form Factors: A Unique Opportunity to Connect Non-Perturbative Strong Interactions to QCD

    SciTech Connect

    Gothe, Ralf W.

    2014-01-01

    Meson-photoproduction measurements and their reaction-amplitude analyses can establish more sensitively, and in some cases in an almost model-independent way, nucleon excitations and non-resonant reaction amplitudes. However, to investigate the strong interaction from explored — where meson-cloud degrees of freedom contribute substantially to the baryon structure — to still unexplored distance scales — where quark degrees of freedom dominate and the transition from dressed to current quarks occurs — we depend on experiments that allow us to measure observables that are probing this evolving non-perturbative QCD regime over its full range. Elastic and transition form factors are uniquely suited to trace this evolution by measuring elastic electron scattering and exclusive single-meson and double-pion electroproduction cross sections off the nucleon. These exclusive measurements will be extended to higher momentum transfers with the energy-upgraded CEBAF beam at JLab to study the quark degrees of freedom, where their strong interaction is responsible for the ground and excited nucleon state formations. After establishing unprecedented high-precision data, the imminent next challenge is a high-quality analysis to extract these relevant electrocoupling parameters for various resonances that then can be compared to state-of-the-art models and QCD-based calculations. Recent results will demonstrate the status of the analysis and of their theoretical descriptions, and an experimental and theoretical outlook will highlight what shall and may be achieved in the new era of the 12-GeV upgraded transition form factor program.

  18. Universal behavior of the γ⁎γ→(π0,η,η′) transition form factors

    PubMed Central

    Melikhov, Dmitri; Stech, Berthold

    2012-01-01

    The photon transition form factors of π, η and η′ are discussed in view of recent measurements. It is shown that the exact axial anomaly sum rule allows a precise comparison of all three form factors at high-Q2 independent of the different structures and distribution amplitudes of the participating pseudoscalar mesons. We conclude: (i) The πγ form factor reported by Belle is in excellent agreement with the nonstrange I=0 component of the η and η′ form factors obtained from the BaBar measurements. (ii) Within errors, the πγ form factor from Belle is compatible with the asymptotic pQCD behavior, similar to the η and η′ form factors from BaBar. Still, the best fits to the data sets of πγ, ηγ, and η′γ form factors favor a universal small logarithmic rise Q2FPγ(Q2)∼log(Q2). PMID:23226917

  19. Unraveling the mechanism of proton translocation in the extracellular half-channel of bacteriorhodopsin.

    PubMed

    Ge, Xiaoxia; Gunner, M R

    2016-05-01

    Bacteriorhodopsin, a light activated protein that creates a proton gradient in halobacteria, has long served as a simple model of proton pumps. Within bacteriorhodopsin, several key sites undergo protonation changes during the photocycle, moving protons from the higher pH cytoplasm to the lower pH extracellular side. The mechanism underlying the long-range proton translocation between the central (the retinal Schiff base SB216, D85, and D212) and exit clusters (E194 and E204) remains elusive. To obtain a dynamic view of the key factors controlling proton translocation, a systematic study using molecular dynamics simulation was performed for eight bacteriorhodopsin models varying in retinal isomer and protonation states of the SB216, D85, D212, and E204. The side-chain orientation of R82 is determined primarily by the protonation states of the residues in the EC. The side-chain reorientation of R82 modulates the hydrogen-bond network and consequently possible pathways of proton transfer. Quantum mechanical intrinsic reaction coordinate calculations of proton-transfer in the methyl guanidinium-hydronium-hydroxide model system show that proton transfer via a guanidinium group requires an initial geometry permitting proton donation and acceptance by the same amine. In all the bacteriorhodopsin models, R82 can form proton wires with both the CC and the EC connected by the same amine. Alternatively, rare proton wires for proton transfer from the CC to the EC without involving R82 were found in an O' state where the proton on D85 is transferred to D212. Proteins 2016; 84:639-654. © 2016 Wiley Periodicals, Inc. PMID:26868676

  20. Sulphur abundance determinations in star-forming regions - I. Ionization correction factor

    NASA Astrophysics Data System (ADS)

    Dors, O. L.; Pérez-Montero, E.; Hägele, G. F.; Cardaci, M. V.; Krabbe, A. C.

    2016-03-01

    In this work, we used a grid of photoionization models combined with stellar population synthesis models to derive reliable ionization correction factors (ICFs) for the sulphur in star-forming regions. These models cover a large range of nebular parameters and yielding ionic abundances in consonance with those derived through optical and infrared observational data of star-forming regions. From our theoretical ICFs, we suggested an α value of 3.27 ± 0.01 in the classical Stasińska formulae. We compared the total sulphur abundance in the gas phase of a large sample of objects by using our theoretical ICF and other approaches. In average, the differences between the determinations via the use of the different ICFs considered are similar to the uncertainties in the S/H estimations. Nevertheless, we noted that for some objects it could reach up to about 0.3 dex for the low-metallicity regime. Despite of the large scatter of the points, we found a trend of S/O ratio to decrease with the metallicity, independently of the ICF used to compute the sulphur total abundance.

  1. Characterization of pH titration shifts for all the nonlabile proton resonances in a protein by two-dimensional NMR: The case of mouse epidermal growth factor

    SciTech Connect

    Kohda, Daisuke; Sawada, Toshie; Inagaki, Fuyuhiko )

    1991-05-21

    The pH titration shifts for all the nonlabile proton resonances in a 53-residue protein (mouse epidermal growth factor) were measured in the p{sup 2}H range 1.5-9 with two-dimensional (2D) {sup 1}H NMR. The 2D NMR pH titration experiment made it possible to determine the pK values for all the ionizable group which were titrated in the pH range 1.5-9 in the protein. The pK values of the nine ionizable groups ({alpha}-amino group, four Asp, two Glu, one His, and {alpha}-carboxyl group) were found to be near their normal values. The 2D titration experiment also provided a detailed description of the pH-dependent behavior of the proton chemical shifts and enabled us to characterize the pH-dependent changes of protein conformation. Analysis of the pH-dependent shifts of ca. 200 proton resonances offered evidence of conformational changes in slightly basic pH solution: The deprotonation of the N-terminal {alpha}-amino group induced a widespread conformational change over the {beta}-sheet structure in the protein, while the effects of deprotonation of the His22 imidazole group were relatively localized. The authors found that the 2D NMR pH titration experiment is a powerful tool for investigating the structural and dynamic properties of proteins.

  2. Characterization of pH titration shifts for all the nonlabile proton resonances a protein by two-dimensional NMR: the case of mouse epidermal growth factor.

    PubMed

    Kohda, D; Sawada, T; Inagaki, F

    1991-05-21

    The pH titration shifts for all the nonlabile proton resonances in a 53-residue protein (mouse epidermal growth factor) were measured in the p2H range 1.5-9 with two-dimensional (2D) 1H NMR. The 2D NMR pH titration experiment made it possible to determine the pK values for all the ionizable groups which were titrated in the pH range 1.5-9 in the protein. The pK values of the nine ionizable groups (alpha-amino group, four Asp, two Glu, one His, and alpha-carboxyl group) were found to be near their normal values. The 2D titration experiment also provided a detailed description of the pH-dependent behavior of the proton chemical shifts and enabled us to characterize the pH-dependent changes of protein conformation. Analysis of the pH-dependent shifts of ca. 200 proton resonances offered evidence of conformational changes in slightly basic pH solution: The deprotonation of the N-terminal alpha-amino group induced a widespread conformational change over the beta-sheet structure in the protein, while the effects of deprotonation of the His22 imidazole group were relatively localized. We found that the 2D NMR pH titration experiment is a powerful tool for investigating the structural and dynamic properties of proteins. PMID:2036358

  3. Fitting of NWM Ray-traced Slant Factors to Closed-form Tropospheric Mapping Functions

    NASA Astrophysics Data System (ADS)

    Urquhart, L.; Nievinski, F. G.; Santos, M. C.

    2009-05-01

    Ray-tracing in numerical weather models (NWM) is a promising solution for describing the elevation angle- and azimuth-dependence of tropospheric delay, especially at very low elevation angles, in an attempt to de- correlate vertical position and zenith tropospheric delay during GPS estimation. On the other hand, mapping functions expressed in closed form remain imperative, demanded by the need for (i) fast processing and (ii) convenient distribution to end-users, who employ a variety of third-party GPS processing packages. We investigate the fitting of ray-tracing results to closed-form expressions. We neglect the variation of the tropospheric delay with latitude, longitude, and height, offering a mapping function valid for a specific station site (similarly as done for VMF1-Site [Boehm et al., 1996]). We focus on the variation of the delay with time, elevation angle, and azimuth. For the time-dependence, we choose to work with slant factors instead of slant delays, because the former are more stable in time than the latter; that is a consequence of the normalization by zenith delays which removes the bulk of the variation with time. For the elevation angle-dependence we compare the continued form fraction of Yan and Ping [1995] with that of Marini [1972] (normalized to yield unity at zenith, as given by Herring [1992]). The latter is more commonly used, but the former is expected to provide a better fit at elevation angles below five degrees. Since the ray-tracing results do not necessarily assume azimuthal symmetry, we have to account for the azimuth-dependence. For that we compare the single-direction model of Davis et al. [1993] with the inclusion of secondary directions [Seko et al., 2004] and arbitrary spherical harmonics [Böhm and Schuh, 2001]). We also assess whether physically-oblivious models (i.e., not derived from analytical idealized atmospheric models), such spline or polynomials, as suggested by Rocken et al. [2001], are adequate.

  4. Crystal Structure of a Translation Termination Complex Formed With Release Factor RF2

    SciTech Connect

    Korostelev, A.; Asahara, H.; Lancaster, L.; Laurberg, M.; Hirschi, A.; Zhu, J.; Trakhanov, S.; Scott, W.G.; Noller, H.F.

    2009-05-20

    We report the crystal structure of a translation termination complex formed by the Thermus thermophilus 70S ribosome bound with release factor RF2, in response to a UAA stop codon, solved at 3 {angstrom} resolution. The backbone of helix -5 and the side chain of serine of the conserved SPF motif of RF2 recognize U1 and A2 of the stop codon, respectively. A3 is unstacked from the first 2 bases, contacting Thr-216 and Val-203 of RF2 and stacking on G530 of 16S rRNA. The structure of the RF2 complex supports our previous proposal that conformational changes in the ribosome in response to recognition of the stop codon stabilize rearrangement of the switch loop of the release factor, resulting in docking of the universally conserved GGQ motif in the PTC of the 50S subunit. As seen for the RF1 complex, the main-chain amide nitrogen of glutamine in the GGQ motif is positioned to contribute directly to catalysis of peptidyl-tRNA hydrolysis, consistent with mutational studies, which show that most side-chain substitutions of the conserved glutamine have little effect. We show that when the H-bonding capability of the main-chain N-H of the conserved glutamine is eliminated by substitution with proline, peptidyl-tRNA esterase activity is abolished, consistent with its proposed role in catalysis.

  5. Characterization of the clotting activities of structurally different forms of activated factor IX. Enzymatic properties of normal human factor IXa alpha, factor IXa beta, and activated factor IX Chapel Hill.

    PubMed Central

    Griffith, M J; Breitkreutz, L; Trapp, H; Briet, E; Noyes, C M; Lundblad, R L; Roberts, H R

    1985-01-01

    Two structurally different forms of activated human Factor IX (Factor IXa alpha and IXa beta) have been previously reported to have essentially identical clotting activity in vitro. Although it has been shown that activated Factor IX Chapel Hill, an abnormal Factor IX isolated from the plasma of a patient with mild hemophilia B, and normal Factor IXa alpha are structurally very similar, the clotting activity of activated Factor IX Chapel Hill is much lower (approximately fivefold) than that of normal Factor IXa beta. In the present study we have prepared activated Factor IX by incubating human Factor IX with calcium and Russell's viper venom covalently bound to agarose. Fractionation of the activated Factor IX by high-performance liquid chromatography demonstrated the presence of both Factors IXa alpha and IXa beta. On the basis of active site concentration, determined by titration with antithrombin III, the clotting activities of activated Factor IX Chapel Hill and IXa alpha were similar, but both activities were less than 20% of the clotting activity of Factor IXa beta. Activated Factor IX activity was also measured in the absence of calcium, phospholipid, and Factor VIII, by determination of the rate of Factor X activation in the presence of polylysine. In the presence of polylysine, the rates of Factor X activation by activated Factor IX Chapel Hill, Factor IXa alpha, and Factor IXa beta were essentially identical. We conclude that the clotting activity of activated Factor IX Chapel Hill is reduced when compared with that of Factor IXa beta but essentially normal when compared with that of Factor IXa alpha. PMID:3871202

  6. Biochemical and proton NMR characterization of the isolated functional beta-subunit of coupling factor one from spinach chloroplasts

    SciTech Connect

    Roux-Fromy, M.; Neumann, J.M.; Andre, F.; Berger, G.; Girault, G.; Galmiche, J.M.; Remy, R.

    1987-04-29

    Beta subunits have been dissociated from CF1 of spinach chloroplasts, purified by HPLC and characterized by two-dimensional electrophoresis and fluorescence emission. The solutions of isolated beta subunits are able to hydrolyze MgATP; this ATPase activity is an intrinsic property of the beta molecule. From proton NMR at 300 and 500 MHz, it is shown that the preparations are fully reproducible and that beta subunits remain monomeric with 75% aliphatic protons associated with rigid parts of the molecule. The other 25% give rise to separate resonances and belong to mobile side-chains and/or to flexible regions. The measurement of the transverse relaxation times T2 has permitted a detailed characterization of the molecular dynamics of the isolated beta subunits.

  7. A Non-parametric approach to the D+ ---> anti-K*0 mu+ nu form-factors

    SciTech Connect

    Link, J.M.; Yager, P.M.; Anjos, J.C.; Bediaga, I.; Castromonte, C.; Machado, A.A.; Magnin, J.; Massafferri, A.; de Miranda, J.M.; Pepe, I.M.; Polycarpo, E.; dos Reis, A.C.; Carrillo, S.; Casimiro, E.; Cuautle, E.; Sanchez-Hernandez, A.; Uribe, C.; Vazquez, F.; Agostino, L.; Cinquini, L.; Cumalat, J.P.; /Colorado U. /Fermilab /Frascati /Guanajuato U. /Illinois U., Urbana /Indiana U. /Korea U. /Kyungpook Natl. U. /INFN, Milan /Milan U. /North Carolina U. /Pavia U. /INFN, Pavia /Rio de Janeiro, Pont. U. Catol. /Puerto Rico U., Mayaguez /South Carolina U. /Tennessee U. /Vanderbilt U. /Wisconsin U., Madison

    2005-09-01

    Using a large sample of D{sup +} {yields} K{sup -} {pi}{sup +} {mu}{sup +}{nu} decays collected by the FOCUS photo-production experiment at Fermilab, we present the first measurements of the helicity basis form factors free from the assumption of spectroscopic pole dominance. We also present the first information on the form factor that controls the s-wave interference discussed in a previous paper by the FOCUS collaboration. We find reasonable agreement with the usual assumption of spectroscopic pole dominance and measured form factor ratios.

  8. First principles calculations of nucleon and pion form factors: understanding the building blocks of nuclear matter from lattice QCD

    SciTech Connect

    Constantia Alexandrou; Bojan Bistrovic; Robert Edwards; P de Forcrand; George Fleming; Philipp Haegler; John Negele; Konstantinos Orginos; Andrew Pochinsky; Dru Renner; David Richards; Wolfram Schroers; Antonios Tsapalis

    2005-10-01

    Lattice QCD is an essential complement to the current and anticipated DOE-supported experimental program in hadronic physics. In this poster we address several key questions central to our understanding of the building blocks of nuclear matter, nucleons and pions. Firstly, we describe progress at computing the electromagnetic form factors of the nucleon, describing the distribution of charge and current, before considering the role played by the strange quarks. We then describe the study of transition form factors to the Delta resonance. Finally, we present recent work to determine the pion form factor, complementary to the current JLab experimental determination and providing insight into the approach to asymptotic freedom.

  9. Radiative corrections to polarization observables in electron-proton scattering

    NASA Astrophysics Data System (ADS)

    Borisyuk, Dmitry; Kobushkin, Alexander

    2014-08-01

    We consider radiative corrections to polarization observables in elastic electron-proton scattering, in particular, for the polarization transfer measurements of the proton form factor ratio μGE/GM. The corrections are of two types: two-photon exchange (TPE) and bremsstrahlung (BS); in the present work we pay special attention to the latter. Assuming small missing energy or missing mass cutoff, the correction can be represented in a model-independent form, with both electron and proton radiation taken into account. Numerical calculations show that the contribution of the proton radiation is not negligible. Overall, at high Q2 and energies, the total correction to μGE/GM grows, but is dominated by TPE. At low energies both TPE and BS may be significant; the latter amounts to ˜0.01 for some reasonable cut-off choices.

  10. Exclusive muon-pair production in ultrarelativistic heavy-ion collisions: Realistic nucleus charge form factor and differential distributions

    SciTech Connect

    Klusek-Gawenda, M.; Szczurek, A.

    2010-07-15

    The cross sections for exclusive muon-pair production in nucleus-nucleus collisions are calculated and several differential distributions are shown. Realistic (Fourier transform of charge density) charge form factors of nuclei are used and the corresponding results are compared with the cross sections calculated with monopole form factor often used in the literature and discussed recently in the context of higher-order QED corrections. Absorption effects are discussed and quantified. The cross sections obtained with realistic form factors are significantly smaller than those obtained with the monopole form factor. The effect is bigger for large muon rapidities and/or large muon transverse momenta. The predictions for the STAR and PHENIX collaboration measurements at RHIC as well as the ALICE and CMS collaborations at LHC are presented.

  11. Aspects of Precision Calculations of Nucleon Generalized Form Factors with Domain Wall Fermions on an Asqtad Sea

    SciTech Connect

    Bratt, Jonathan; Edwards, Robert; Engelhardt, Michael; Fleming, George; Hagler, Ph.; Lin, Meifeng; Meyer, Harvey; Musch, Bernhard; Negele, John; Orginos, Konstantinos; Pochinsky, Andrew; Procura, M.; Renner, Dru; Richards, David; Schroers, Wolfram; Syritsyn, Sergey

    2008-12-01

    In order to advance lattice calculations of moments of unpolarized, helicity, and transversity distributions, electromagnetic form factors, and generalized form factors of the nucleon to a new level of precision, this work investigates several key aspects of precision lattice calculations. We calculate the number of configurations required for constant statistical errors as a function of pion mass, describe the coherent sink method to help achieve these statistics, examine the statistical correlations between separate measurements, study correlations in the behavior of form factors at different momentum transfer, examine volume dependence, and compare mixed action results with those using comparable dynamical domain wall configurations. We also show selected form factor results and comment on the QCD evolution of our calculations of the flavor non-singlet nucleon angular momentum.

  12. Strong diquark correlations inside the proton

    NASA Astrophysics Data System (ADS)

    Segovia, Jorge

    2016-03-01

    Quantum Chromodynamics is thought to be the relativistic quantum field theory that describes the strong interaction of the Standard Model. This interaction produces mesons but it is also able to generate quark-quark (diquark) correlations inside baryons. In this work, we employ a continuum approach to QCD based on Dyson-Schwinger equations to calculate the electromagnetic form factors of the proton and analyze in a deeper way the consequences of having strong diquark correlations. Comparison with the experimental data reveals that the presence of strong diquark correlations within the proton is sufficient to understand empirical extractions of the flavour-separated form factors. The explained reduction of the ratios F1d/F1u and F2d/F2u at high Q2 in the quark-diquark picture are responsible of the precocious scaling of the F2p/F1p observed experimentally.

  13. Mechanism and Influencing Factors of Iron Nuggets Forming in Rotary Hearth Furnace Process at Lower Temperature

    NASA Astrophysics Data System (ADS)

    Han, Hongliang; Duan, Dongping; Chen, Siming; Yuan, Peng

    2015-10-01

    In order to improve the efficiency of slag and iron separation, a new idea of "the separation of slag (solid state) and iron (molten state) in rotary hearth furnace process at lower temperature" is put forward. In this paper, the forming process of iron nuggets has been investigated. Based on those results, the forming mechanisms and influencing factors of iron nugget at low temperature are discussed experimentally using an electric resistance furnace simulating a rotary hearth furnace process. Results show that the reduction of iron ore, carburization of reduced iron, and the composition and quantity of slag are very important for producing iron nuggets at lower temperature. Reduction reaction of carbon-containing pellets is mainly at 1273 K and 1473 K (1000 °C and 1200 °C). When the temperature is above 1473 K (1200 °C), the metallization rate of carbon-containing pellets exceeds 93 pct, and the reduction reaction is substantially complete. Direct carburization is the main method for carburization of reduced iron. This reaction occurs above 1273 K (1000 °C), with carburization degree increasing greatly at 1473 K and 1573 K (1200 °C and 1300 °C) after particular holding times. Besides, to achieve the "slag (solid state) and iron (molten state) separation," the melting point of the slag phase should be increased. Slag (solid state) and iron (molten state) separation can be achieved below 1573 K (1300 °C), and when the holding time is 20 minutes, C/O is 0.7, basicity is less than 0.5 and a Na2CO3 level of 3 pct, the recovery rate of iron can reach 90 pct, with a proportion of iron nuggets more than 3.15 mm of nearly 90 pct. This study can provide theoretical and technical basis for iron nugget production.

  14. Continuum limit of the leading-order HQET form factor in Bs → Kℓν decays

    NASA Astrophysics Data System (ADS)

    Bahr, Felix; Banerjee, Debasish; Bernardoni, Fabio; Joseph, Anosh; Koren, Mateusz; Simma, Hubert; Sommer, Rainer

    2016-06-01

    We discuss the computation of form factors for semi-leptonic decays of B-, Bs-mesons in lattice QCD. Considering in particular the example of the static Bs form factors we demonstrate that after non-perturbative renormalization the continuum limit can be taken with confidence. The resulting precision is of interest for extractions of Vub. The size of the corrections of order 1 /mb is just estimated at present but it is expected that their inclusion does not pose significant difficulties.

  15. Energy-Momentum Tensor Form Factors of the Nucleon in Nuclear Matter in the Chiral Soliton Model

    NASA Astrophysics Data System (ADS)

    Yakhshiev, Ulugbek; Kim, Hyun-Chul; Schweitzer, Peter

    2013-08-01

    In the present talk, we report a recent investigation on the nucleon form factors of the energy-momentum tensor in nuclear matter, based on the in-medium modified chiral soliton model. The results in free space are in agreement with those from other approaches. We have discussed the changes of the energy-momentum tensor form factors in nuclear matter and the modification of the soliton structure due to the surrounding nuclear environment.

  16. Exploring universality of transversity in proton-proton collisions

    NASA Astrophysics Data System (ADS)

    Radici, Marco; Ricci, Alessandro M.; Bacchetta, Alessandro; Mukherjee, Asmita

    2016-08-01

    We consider the azimuthal correlations of charged hadron pairs with large total transverse momentum and small relative momentum, produced in proton-proton collisions with one transversely polarized proton. One of these correlations directly probes the chiral-odd transversity parton distribution in connection with a chiral-odd interference fragmentation function. We present predictions for this observable based on previous extractions of transversity (from charged pion pair production in semi-inclusive deep-inelastic scattering) and of the interference fragmentation function (from the production of back-to-back charged pion pairs in electron-positron annihilations). All analyses are performed in the framework of collinear factorization. We compare our predictions to the recent data on proton-proton collisions released by the STAR Collaboration at RHIC, and we find them reasonably compatible. This comparison confirms for the first time the predicted role of transversity in proton-proton collisions, and it allows us to test its universality.

  17. Measurements of the Electric Form Factor of the Neutron at Q^2=0.45 and 1.13 (GeV/c)^2

    SciTech Connect

    Shigeyuki Tajima

    2003-12-31

    .45 (GeV/c)2 are more precise than prior measurements at lower Q2. In this dissertation, the data analyses and our results for g and Gn E at Q2=0.45 (GeV/c)2 and Q2=1.13 (GeV/c)2 are given. Our high-accuracy data are included with the ?world? data for Gn E to form an improved data set that was fit with an empirical function to give a simple parameterization of Gn E as a function of Q2. In addition, the data for the ratio Gn E/Gn M are compared to theoretical models of the nucleon. We found that no theoretical model predicts both proton and neutron form factor data.

  18. Global Developmental Gene Programing Involves a Nuclear Form of Fibroblast Growth Factor Receptor-1 (FGFR1).

    PubMed

    Terranova, Christopher; Narla, Sridhar T; Lee, Yu-Wei; Bard, Jonathan; Parikh, Abhirath; Stachowiak, Ewa K; Tzanakakis, Emmanuel S; Buck, Michael J; Birkaya, Barbara; Stachowiak, Michal K

    2015-01-01

    Genetic studies have placed the Fgfr1 gene at the top of major ontogenic pathways that enable gastrulation, tissue development and organogenesis. Using genome-wide sequencing and loss and gain of function experiments the present investigation reveals a mechanism that underlies global and direct gene regulation by the nuclear form of FGFR1, ensuring that pluripotent Embryonic Stem Cells differentiate into Neuronal Cells in response to Retinoic Acid. Nuclear FGFR1, both alone and with its partner nuclear receptors RXR and Nur77, targets thousands of active genes and controls the expression of pluripotency, homeobox, neuronal and mesodermal genes. Nuclear FGFR1 targets genes in developmental pathways represented by Wnt/β-catenin, CREB, BMP, the cell cycle and cancer-related TP53 pathway, neuroectodermal and mesodermal programing networks, axonal growth and synaptic plasticity pathways. Nuclear FGFR1 targets the consensus sequences of transcription factors known to engage CREB-binding protein, a common coregulator of transcription and established binding partner of nuclear FGFR1. This investigation reveals the role of nuclear FGFR1 as a global genomic programmer of cell, neural and muscle development. PMID:25923916

  19. Measurement of the g{sub piNN} Form Factor

    SciTech Connect

    Kelley Vansyoc

    2001-08-01

    Cross sections were measured for the reaction 1H(e, e' {pi}+ )n at the energy W = 1.95 GeV and momentum transfer Q 2 = 0.6 (GeV/c) 2 . At this W and Q 2 , the longitudinal cross section is dominated by t-channel production, giving a unique opportunity to examine the strong coupling form factor g {pi}NN (t). The measured cross sections were separated using a method similar to a Rosenbluth separation. For the extraction of g {pi}NN (t), the Actor and Korner model [42] and a parameterization of the MAID2000 model [3] were employed to fit the longitudinal cross section. Three parameterizations g {pi}NN (t) were used in both models. These fits resulted in a strong coupling constant g {pi}NN (m 2 / {pi} ) that is consistent with theoretical predictions. However, this coupling constant leads to a cutoff parameter that is less than 1 GeV.

  20. Small Form Factor Information Storage Devices for Mobile Applications in Korea

    NASA Astrophysics Data System (ADS)

    Park, Young-Pil; Park, No-Cheol; Kim, Chul-Jin

    Recently, the ubiquitous environment in which anybody can reach a lot of information data without any limitations on the place and time has become an important social issue. There are two basic requirements in the field of information storage devices which have to be satisfied; the first is the demand for the improvement of memory capacity to manage the increased data capacity in personal and official purposes. The second is the demand for new development of information storage devices small enough to be applied to mobile multimedia digital electronics, including digital camera, PDA and mobile phones. To summarize, for the sake of mobile applications, it is necessary to develop information storage devices which have simultaneously a large capacity and a small size. Korea possesses the necessary infrastructure for developing such small sized information storage devices. It has a good digital market, major digital companies, and various research institutes. Nowadays, many companies and research institutes including university cooperate together in the research on small sized information storage devices. Thus, it is expected that small form factor optical disk drives will be commercialized in the very near future in Korea.