Science.gov

Sample records for pulse stretcher amps

  1. Pulse stretcher

    DOEpatents

    Horton, J.A.

    1994-05-03

    Apparatus for increasing the length of a laser pulse to reduce its peak power without substantial loss in the average power of the pulse is disclosed. The apparatus uses a White cell having a plurality of optical delay paths of successively increasing number of passes between the field mirror and the objective mirrors. A pulse from a laser travels through a multi-leg reflective path between a beam splitter and a totally reflective mirror to the laser output. The laser pulse is also simultaneously injected through the beam splitter to the input mirrors of the optical delay paths. The pulses from the output mirrors of the optical delay paths go simultaneously to the laser output and to the input mirrors of the longer optical delay paths. The beam splitter is 50% reflective and 50% transmissive to provide equal attenuation of all of the pulses at the laser output. 6 figures.

  2. Pulse stretcher

    DOEpatents

    Horton, James A.

    1994-01-01

    Apparatus (20) for increasing the length of a laser pulse to reduce its peak power without substantial loss in the average power of the pulse. The apparatus (20) uses a White cell (10) having a plurality of optical delay paths (18a-18d) of successively increasing number of passes between the field mirror (13) and the objective mirrors (11 and 12). A pulse (26) from a laser (27) travels through a multi-leg reflective path (28) between a beam splitter (21) and a totally reflective mirror (24) to the laser output (37). The laser pulse (26) is also simultaneously injected through the beam splitter (21) to the input mirrors (14a-14d) of the optical delay paths (18a-18d). The pulses from the output mirrors (16a-16d) of the optical delay paths (18a-18d) go simultaneously to the laser output (37) and to the input mirrors ( 14b-14d) of the longer optical delay paths. The beam splitter (21) is 50% reflective and 50% transmissive to provide equal attenuation of all of the pulses at the laser output (37).

  3. Predicted performance of a multi-section VUV FEL with the Amsterdam pulse stretcher and storage ring AmPS

    SciTech Connect

    Bazylev, V.A.; Pitatelev, M.I.; Tulupov, A.V.

    1995-12-31

    A design is proposed to realize a VUV FEL with the Amsterdam Pulse Stretcher and Storage Ring (AmPS). The FEL is based on 4 identical undulator sections and 3 dispersive sections. The total magnetic system has a length of 12 m. 3 D simulations with the actual electron beam parameters of AmPS have been done with a version of TDA code modified for multi-sectional FELs. The spectral range between 50 and 100 nm has been considered. The simulations show that an amplification as large as 1*E5 - 1*E7 can be achieved. The amplification can be enhanced by a further optimisation procedure.

  4. SHORT PULSE STRETCHER

    DOEpatents

    Branum, D.R.; Cummins, W.F.

    1962-12-01

    >A short pulse stretching circuit capable of stretching a short puise to enable it to be displayed on a relatively slow sweeping oscilloscope is described. Moreover, the duration of the pulse is increased by charging a capacitor through a diode and thereafter discharging the capacitor at such time as is desired. In the circuit the trigger pulse alone passes through a delay line, whereas the main signal passes through the diode only, and results in over-all circuit losses which are proportional to the low losses of the diode only. (AEC)

  5. Feedback oscillator functions as low-level pulse stretcher

    NASA Technical Reports Server (NTRS)

    1965-01-01

    Low trigger pulses of the pulse stretcher circuit are obtained by forward biasing the transistor oscillator. The loop gain is kept below unity and prevents free-running oscillation. Two parallel feedback loops improve the stretching capabilities.

  6. Aberration-free, all-reflective laser pulse stretcher

    DOEpatents

    Perry, Michael D.; Banks, Paul S.; Stuart, Brent C.; Fochs, Scott N.

    1999-09-28

    An all-reflective pulse stretcher for laser systems employing chirped-pulse amplification enables on-axis use of the focusing mirror which results in ease of use, significantly decreased sensitivity to alignment and near aberration-free performance. By using a new type of diffraction grating which contains a mirror incorporated into the grating, the stretcher contains only three elements: 1) the grating, 2) a spherical or parabolic focusing mirror, and 3) a flat mirror. Addition of a fourth component, a retro-reflector, enables multiple passes of the same stretcher resulting in stretching ratios beyond the current state of the art in a simple and compact design. The pulse stretcher has been used to stretch pulses from 20 fsec to over 600 psec (a stretching ratio in excess of 30,000).

  7. Polarization-controlled optical ring cavity (PORC) tunable pulse stretcher

    NASA Astrophysics Data System (ADS)

    Williamson, Andrew P.; Kiefer, Johannes

    2016-08-01

    A new concept and a theoretical approach for modeling a tunable polarization-controlled optical ring cavity pulse stretcher is demonstrated. The technique discussed herein permits highly simplified and flexible tuning of the temporal shape of nanosecond duration pulses. Using half-wave plates positioned extra- and intracavity, transmission to reflection ratios across both input faces of a polarization beam splitter can easily be controlled. The resulting models indicate a further reduction in peak intensity of 30%, with respect to conventional dielectric beam splitting optical ring cavities, when configured under equivalent and optimized cavity settings.

  8. Laser pulse stretcher method and apparatus

    DOEpatents

    Hawkins, Jon K.; Williams, William A.

    1990-01-01

    The output of an oscillator stage of a laser system is monitored by a photocell which is coupled to a feedback section to control a Pockels Cell and change the light output of the oscillator stage. A synchronizing pulse is generated in timed relation to the initiation of operation of the oscillator stage and is applied to a forward feed section which cooperates with the feedback section to maintain the light output constant for an extended time interval.

  9. New stretcher scheme for a parametric amplifier of chirped pulses with frequency conversion

    SciTech Connect

    Freidman, Gennadii I; Yakovlev, I V

    2007-02-28

    The properties of hybrid prism-grating dispersion systems are studied. The scheme of a prism-grating stretcher matched to a standard compressor in the phase dispersion up to the fourth order inclusive is developed for a petawatt laser complex based on the optical parametric chirped-pulse amplification. The stretcher was used to obtain the {approx}200-TW peak power of laser radiation. (control of laser radiation parameters)

  10. Short pulse laser stretcher-compressor using a single common reflective grating

    DOEpatents

    Erbert, Gaylen V.; Biswal, Subrat; Bartolick, Joseph M.; Stuart, Brent C.; Telford, Steve

    2004-05-25

    The present invention provides an easily aligned, all-reflective, aberration-free pulse stretcher-compressor in a compact geometry. The stretcher-compressor device is a reflective multi-layer dielectric that can be utilized for high power chirped-pulse amplification material processing applications. A reflective grating element of the device is constructed: 1) to receive a beam for stretching of laser pulses in a beam stretcher beam path and 2) to also receive stretched amplified pulses to be compressed in a compressor beam path through the same (i.e., common) reflective multilayer dielectric diffraction grating. The stretched and compressed pulses are interleaved about the grating element to provide the desired number of passes in each respective beam path in order to achieve the desired results.

  11. A Large-Bandwidth, Cylindrical Offner Pulse Stretcher for a High-Average-Power, 15 Femtosecond Laser

    SciTech Connect

    Molander, W A; Bayramian, A J; Campbell, R; Cross, R R; Huete, G; Schenkel, N; Ebbers, C; Caird, J; Barty, C J; Siders, C W

    2008-09-24

    We have designed and built an all-reflective pulse stretcher based on an Offner telescope. It uses cylindrical optics to simplify alignment and reduce aberrations. The stretch is {approx}1x10{sup 5} with a bandwidth of 200 nm. The stretcher is to be part of a 10 Hz repetition rate, high-average-power, femtosecond laser. This new design compensates for dispersion in the laser by using gratings of different groove spacing in the stretcher and compressor and a spectral phase corrector plate, made by magneto-rheological finishing, within the stretcher.

  12. Integrated pulse stretchers for high-energy CPA and OPCPA systems

    NASA Astrophysics Data System (ADS)

    Shah, Lawrence; Bodnar, Nathan; Roumayah, Patrick; Webb, Benjamin; Bradford, Joshua; Richardson, Martin

    2016-03-01

    Pulse stretchers are critical components in chirped pulse amplification (CPA) and optical parametric CPA (OPCPA) laser systems. In CPA systems, pulse stretching and compression is typical accomplished using bulk diffraction gratings; however integrated devices such volume or fiber Bragg gratings can provide similar optical performance with significantly smaller footprint and simplified alignment. In this work, we discuss the use of such integrated devices to stretch a 100 fs pulse to 400 ps with customized third order dispersion for use in a multi-TW Ti:Sapphire system as well as integrated optics to control the pulse duration in pump lasers for OPCPA systems.

  13. Literature search on kickers and septa for the Amsterdam Pulse Stretcher (APS)

    NASA Astrophysics Data System (ADS)

    Kuijt, J.; Linden, A. V. D.

    A study of the literature was performed with a view to the design of kickers and septa for the injection and extraction line of the Amsterdam Pulse Stretcher Ring (APS) in the UPDATE project. The UPDATE kickers were given the following specifications: deflection angle 2 mrad, pulse width 2 micrometer, fall time 70 ans, available length 2 m. A comparison of the characteristic parameters (kick strength, pulse characteristics, required peak power) with the existing system shows correspondence with two ferrite kicker designs (CERN-CPS and ELSA), the Los Alamos TEM-kicker, and the Saskatoon electrostatic kicker. On account of the relative simplicity of construction and the pulse forming network, the Saskatoon kicker was chosen as the starting point for a design study. Septum magnets and electrostatic wire septa are overviewed.

  14. Grism compressor for carrier-envelope phase-stable millijoule-energy chirped pulse amplifier lasers featuring bulk material stretcher.

    PubMed

    Ricci, A; Jullien, A; Forget, N; Crozatier, V; Tournois, P; Lopez-Martens, R

    2012-04-01

    We demonstrate compression of amplified carrier-envelope phase (CEP)-stable laser pulses using paired transmission gratings and high-index prisms, or grisms, with chromatic dispersion matching that of a bulk material pulse stretcher. Grisms enable the use of larger bulk stretching factors and thereby higher energy pulses with lower B-integral in a compact amplifier design suitable for long-term CEP control. PMID:22466193

  15. Single-grating-mirror intracavity stretcher design for chirped pulse regenerative amplification.

    PubMed

    Caracciolo, E; Kemnitzer, M; Rumpel, M; Guandalini, A; Pirzio, F; Kienle, F; Graf, T; Abdou Ahmed, M; Aus der Au, J; Agnesi, A

    2015-04-01

    We report for the first time, to the best of our knowledge, an innovative design concept for intracavity pulse stretching in a regenerative amplifier, employing a single "grating-mirror" based on a leaky-mode grating-waveguide design. The very compact and flexible layout allows for femtosecond pulses to be in principle easily stretched up to nanosecond durations. The design has been tested in a diode-pumped Yb:CALGO regenerative amplifier followed by a standard transmission grating compressor. Sub-200-fs pulses (stretched pulses ≈110  ps) with 205-μJ energy at 20-kHz repetition rate have been demonstrated. In order to prove the robustness and potential for energy scaling of leaky-mode grating-waveguide intracavity stretcher, we generated stretched pulses with energies of up to ≈700  μJ (400-ps long) at a lower repetition rate of 10 kHz. A simple model is proposed for the study of the cavity in presence of induced spatial chirp. PMID:25831377

  16. Investigation of a grating-based stretcher/compressor for carrier-envelope phase stabilized fs pulses.

    PubMed

    Thomann, Isabell; Gagnon, Etienne; Jones, R; Sandhu, Arvinder; Lytle, Amy; Anderson, Ryan; Ye, Jun; Murnane, Margaret; Kapteyn, Henry

    2004-07-26

    In this work, we experimentally investigate the effect of a grating based pulse stretcher/compressor on the carrier-envelope phase stability of femtosecond pulses. Grating based stretcher-compressor (SC) setups have been avoided in past demonstrations of chirped pulse amplification (CPA) of carrier envelope phase (CEP) stabilized femtosecond pulses, because they were expected to introduce significantly stronger CEP fluctuations than material-based SC systems. Using a microstructure fiber-based detection setup, we measure CEP fluctuations of PhiCE,SC = 340 milliradians rms for a frequency range from 63 mHz to 102 kHz for pulses propagating through the SC setup. When bypassing the beam path through the SC, we find CEP fluctuations of PhiCE,bypass = 250 milliradians rms. These values contain significant contributions from amplitude-to-phase conversion in our microstructure fiber-based detection setup for PhiCE. Hence, we do not unambiguously measure any added CEP noise intrinsic to the SC setup. To distinguish between intrinsic SC effects and amplitude-to-phase conversion, we introduce controlled beam pointing fluctuations alpha and again compare the phase noise introduced when passing through / bypassing the SC. Our measurements do not reveal any intrinsic effects of the SC system, but allow us to place an upper limit on the sensitivity of our SC system of PhiCEintrinsic,SC / alpha < 13000 rad/rad. Our results demonstrate experimentally that there is not a strong coupling mechanism between CEP and beam pointing through a stretcher/compressor , as well as measuring significantly smaller CEP fluctuations than experimental results reported previously. PMID:19483877

  17. Transform-limited 100 microJ, 340 MW pulses from a nonlinear-fiber chirped-pulse amplifier using a mismatched grating stretcher-compressor.

    PubMed

    Zaouter, Y; Boullet, J; Mottay, E; Cormier, E

    2008-07-01

    We report on a compact double-stage ytterbium-doped-fiber chirped-pulse amplifier system delivering high temporal quality 270 fs pulses of 100 microJ energy at a repetition rate of 300 kHz resulting in a peak power of 340 MW. The recompression down to 1.1 times the Fourier limit is based on the exploitation of nonlinear phase shifts associated with mismatched stretcher-compressor units. A 1-m-long ytterbium-doped 80 mum core diameter photonic crystal fiber is implemented as the power amplifier and allows the production of 143 microJ pulses before compression with an accumulated B integral of 17 rad throughout the amplification stages. PMID:18594687

  18. High-fidelity, 160 fs, 5 μJ pulses from an integrated Yb-fiber laser system with a fiber stretcher matching a simple grating compressor.

    PubMed

    Fernández, A; Jespersen, K; Zhu, L; Grüner-Nielsen, L; Baltuška, A; Galvanauskas, A; Verhoef, A J

    2012-03-01

    Although femtosecond microjoule Yb-fiber systems are attractive because of a straightforward power scalability, they inherently suffer from a lowered pulse fidelity as a result of complex dispersion and nonlinearity management. Here, we present an integrated Yb-fiber system delivering high-fidelity microjoule pulses compressible down to 160 fs. The system uses a dispersion compensating fiber stretcher that is specially designed to match the dispersion of a 1480 lines/mm grating compressor. Performance analysis suggests the further possibility of scaling the pulse energy to tens of microjoules without pulse quality deterioration using this dispersion management scheme. PMID:22378441

  19. Beam optics of the AmPS extraction line

    NASA Astrophysics Data System (ADS)

    Hoekstra, R.

    1991-01-01

    The beam optics of the AmPS (Amsterdam Pulse Stretcher) are described. Definitions are outlined, and the beam elements and parameters are given. Developments relating to the electrostatic septum, chicane, beam transformer and bending through 90 degrees are described. The performance of the AmPS and beam diagnostics are discussed.

  20. Chirped-pulse amplification system based on chirp reversal and near-field spatial reversal with common tiled grating pair as stretcher and compressor.

    PubMed

    Wang, Xiao; Wei, Xiaofeng; Hu, Yao; Zeng, Xiaoming; Zuo, Yanlei; Hao, Xin; Zhou, Kainan; Xie, Na; Zhang, Ying

    2012-08-10

    Chirped-pulse amplification system based on chirp reversal in optical parametric chirped-pulse amplification is proposed and experimentally demonstrated. The operation of this system can be described as negative stretching-temporal chirp reversal-energy amplification-negative compression, in which the pulse is stretched and compressed with the same gratings. Stand-alone stretcher adopting lenses or concave mirrors with large aperture can be omitted. Simulations showed that this work mode can also increase the cut-off band-pass of the whole system and increase the output energy by 15-17%. In addition, the stability of a tiled-grating compressor can be improved with this work mode. PMID:22885574

  1. Grism based stretcher/compressor system for amplified, femtosecond kilohertz lasers

    NASA Astrophysics Data System (ADS)

    Gaudiosi, David M.; Gibson, Emily A.; Kane, Steve; Huff, Rachael; Murnane, Margaret; Kaptyen, Henry C.; Durfee, Charles G.; Squier, Jeff; Jimenez, Ralph

    We demonstrate a simple and efficient grism based stretcher/compression system. 36 fs, ˜300 µJ pulses are generated at 5-15 kHz by using this unique grism stretcher/material compressor in a Ti:sapphire amplifier system based on downchirped pulse amplification.

  2. Towards a turn-key femtosecond laser: Elimination of grating-pair stretchers from chirped-pulse amplification systems

    SciTech Connect

    Kane, S.; Squier, J.

    1995-11-01

    The authors have demonstrated for the first time a method for compensating second and third-order dispersion in the normal dispersion regime. They show that a pair of gratings written on to dielectric slabs can produce third-order dispersion which is opposite in sign to that of a traditional grating pair. Their calculations indicate that this grating pair can compensate for very large amounts of material dispersion in a compact geometry, making possible the expansion, amplification, and compression of sub-100-fs pulses in simple and robust systems. In addition, this grating pair can be used as a compact intracavity dispersion compensator, significantly reducing the size and complexity of femtosecond sources.

  3. Control and readout of the extraction septum of AmPS

    NASA Astrophysics Data System (ADS)

    Vanes, J. T.; Luigjes, G.; Vantrigt, J. H.

    The electronics used for the septum translation-rotation control system and for the control of the 100 kV power supply of the electrostatic septum of the storage ring AmPS (Amsterdam Pulse Stretcher) are described. The translation and rotation of the septum are performed by stepping motors controlled by LVDT's (Linear Variable Differential Transformers), which are controlled by a bitbus module which also controls the high voltage power supply.

  4. Monochromators as Light Stretchers.

    ERIC Educational Resources Information Center

    Rubin, B.; Herman, R. M.

    1981-01-01

    A known but often overlooked property of optical monochromators is discussed in view of its current applications. It is shown that grating and prism monochromators hold on to light for time durations proportional to resolving power and that the dispersing ability of monochromators extends to pulses of arbitrarily short duration. (SK)

  5. Experimental and theoretical investigation of timing jitter inside a stretcher-compressor setup.

    PubMed

    Klingebiel, Sandro; Ahmad, Izhar; Wandt, Christoph; Skrobol, Christoph; Trushin, Sergei A; Major, Zsuzsanna; Krausz, Ferenc; Karsch, Stefan

    2012-02-13

    In an optically synchronized short-pulse optical-parametric chirped-pulse amplification (OPCPA) system, we observe a few-100 fs-scale timing jitter. With an active timing stabilization system slow fluctuations are removed and the timing jitter can be reduced to 100 fs standard deviation (Std). As the main source for the timing fluctuations we could identify air turbulence in the stretcher-compressor setup inside the chirped pulse amplification (CPA) pump chain. This observation is supported by theoretical investigation of group delay changes for angular deviations occurring between the parallel gratings of a compressor or stretcher, as they can be introduced by air turbulence. PMID:22418103

  6. The 80 kV electrostatic wire septum for AmPS

    NASA Astrophysics Data System (ADS)

    Vanderlinden, A.; Bijleveld, J. H. M.; Rookhuizen, H. Boer; Bruinsma, P. J. T.; Heine, E.; Lassing, P.; Prins, E.

    The characteristics of the wire septum for the Amsterdam Pulse Stretcher (AmPS) are summarized. In the extraction process of the AmPS the extracted beam is intercepted from the circulating beam by the 1 m long electrostatic wire septum. For a bending angle of 4.4 mrad, the maximum anode voltage is 80 kV. The system developed consists of a wire spacing of 0.65 mm between tungsten wires of 50 micrometers diameter. Stainless steel spring wires, bent in a half cylindrical carrier, stretch the septum wires two by two. Prototype tests were successful up to an anode voltage of 120 kV.

  7. 21 CFR 880.6910 - Wheeled stretcher.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Wheeled stretcher. 880.6910 Section 880.6910 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES GENERAL HOSPITAL AND PERSONAL USE DEVICES General Hospital and Personal Use Miscellaneous Devices § 880.6910 Wheeled stretcher....

  8. Stretchers and compressors for ultra-high power laser systems

    SciTech Connect

    Yakovlev, I V

    2014-05-30

    This review is concerned with pulse stretchers and compressors as key components of ultra-high power laser facilities that take advantage of chirped-pulse amplification. The potentialities, characteristics, configurations and methods for the matching and alignment of these devices are examined, with particular attention to the history of the optics of ultra-short, ultra-intense pulses before and after 1985, when the chirped-pulse amplification method was proposed, which drastically changed the view of the feasibility of creating ultra-high power laser sources. The review is intended primarily for young scientists and experts who begin to address the amplification and compression of chirped pulses, experts in laser optics and all who are interested in scientific achievements in the field of ultra-high power laser systems. (review)

  9. Highly stable biased amplifier and stretcher system

    NASA Technical Reports Server (NTRS)

    Roddick, R. G.

    1970-01-01

    Amplifier and stretcher system, which minimizes thermal effects and compensates for repetition-rate effects, maintains resolution levels in spectrum analysis. An additional inverting amplifier is used in the system to provide a noiseless charge restorer.

  10. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  11. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  12. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  13. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  14. 21 CFR 880.6900 - Hand-carried stretcher.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Hand-carried stretcher. 880.6900 Section 880.6900 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... Devices § 880.6900 Hand-carried stretcher. (a) Identification. A hand-carried stretcher is a...

  15. A stretcher for the Brookhaven AGS

    SciTech Connect

    Foelsche, H.W.J.

    1989-01-01

    This paper summarizes the conceptual design of a 30 GeV Stretcher ring, which is designed to increase the capacity and the quality of the experimental physics program at the AGS. In a typical 3 second operating cycle the AGS now accomplishes two functions: accelerating the beam to full energy and then providing a slow spill on a 30 GeV flattop. These tasks consume approximately equal time. The proposed Stretcher, a dc storage ring, will take up the task of distributing the high energy beam with a continuous slow spill, making it possible for the AGS to provide beam for the program at more than twice the present repetition rate. Thus the average current delivered to the experimenters will be more than doubled, and the duty cycle of the spill will increase from the present optimum of about 40% to nearly 100%. The Stretcher will continue the gradual evolution of the AGS toward a kaon factory. At present, the AGS provides about 1 {mu}A average proton current. A Booster, now under construction, is expected to increase the current to above 4 {mu}a, and the Stretcher to about 8-10 {mu}A, an order of magnitude higher than now. 5 refs., 6 figs., 1 tab.

  16. A Stretcher for the Brookhaven AGS

    SciTech Connect

    Foelsche, H.W.J.

    1989-01-01

    Brookhaven National Laboratory is proposing to add a Stretcher ring to increase the capacity and the quality of the experimental physics program at the AGS. At the present time a typical AGS cycle is about equally divided between the task of accelerating the beam to full energy and the task of distributing it on a 30 GeV flattop. The Stretcher, a 30 GeV dc storage ring, will take over from the AGS the distribution of the high energy beam with a continuous slow spill, and the AGS can then provide beam for the program at more than twice the present repetition rate. In this manner the average current delivered to the experimenters will be more than doubled, and the duty cycle of the spill will increase from the present optimum of about 40% to nearly 100%. The Stretcher proposal continues the gradual evolution of the AGS toward a high intensity hadron factory. At the present time the AGS provides about 1 ..mu..A average proton current. With the booster alone, now under construction, this is expected to increase to above 4 ..mu..A, and with the Stretcher to about 8-10 ..mu..A, an order of magnitude higher than now. 5 refs., 9 figs.

  17. Ampère-Class Pulsed Field Emission from Carbon-Nanotube Cathodes in a Radiofrequency Resonator

    SciTech Connect

    Mihalcea, D.; Faillace, L.; Hartzell, J.; Panuganti, H.; Boucher, S. M.; Murokh, A.; Piot, P.; Thangaraj, J. C.T.

    2014-12-01

    Pulsed field emission from cold carbon-nanotube cathodes placed in a radiofrequency resonant cavity was observed. The cathodes were located on the backplate of a conventional $1+\\frac{1}{2}$-cell resonant cavity operating at 1.3-GHz and resulted in the production of bunch train with maximum average current close to 0.7 Amp\\`ere. The measured Fowler-Nordheim characteristic, transverse emittance, and pulse duration are presented and, when possible, compared to numerical simulations. The implications of our results to high-average-current electron sources are briefly discussed.

  18. Dispersion compensation in chirped pulse amplification systems

    SciTech Connect

    Bayramian, Andrew James; Molander, William A.

    2014-07-15

    A chirped pulse amplification system includes a laser source providing an input laser pulse along an optical path. The input laser pulse is characterized by a first temporal duration. The system also includes a multi-pass pulse stretcher disposed along the optical path. The multi-pass pulse stretcher includes a first set of mirrors operable to receive input light in a first plane and output light in a second plane parallel to the first plane and a first diffraction grating. The pulse stretcher also includes a second set of mirrors operable to receive light diffracted from the first diffraction grating and a second diffraction grating. The pulse stretcher further includes a reflective element operable to reflect light diffracted from the second diffraction grating. The system further includes an amplifier, a pulse compressor, and a passive dispersion compensator disposed along the optical path.

  19. Predicting stretcher carriage: Investigating variations in bilateral carry tests.

    PubMed

    Beck, Ben; Middleton, Kane J; Carstairs, Greg L; Billing, Daniel C; Caldwell, Joanne N

    2016-07-01

    Carrying a casualty on a stretcher is a critical task within military and emergency service occupations. This study evaluated the impact of manipulating carry speed and the object type in bilateral carries on the ability to predict performance and reflect the physical and physiological requirements of a unilateral stretcher carry. We demonstrated that three task-related predictive tests; a jerry can carry performed at 4.5 km h(-1)or 5.0 km h(-1) and a kettle-bell carry performed at 5.0 km h(-1) were strongly predictive of the physical and physiological demands of an individual participating as part of a four-person stretcher carry team. Therefore, bilateral predictive assessments have the utility for predicting the suitability of employees to effectively and safely conduct a four-person unilateral stretcher carry. PMID:26995042

  20. Conceptual design of a linac-stretcher ring to obtain a 2-GeV continuous electron beam

    SciTech Connect

    Cho, Y.; Holt, R.J.; Jackson, H.E.; Khoe, T.K.; Mavrogenes, G.S.

    1981-01-01

    In order to obtain a high duty factor, > 100 ..mu..A 2-GeV electron beam, we have designed a linac-stretcher ring system. The system is an attractive option because it draws heavily on the existing accelerator technology. The linac-stretcher ring consists of a 2-GeV SLAC-type pulsed linac which injects into a storage ring. In between linac pulses, the stored electron beam is to extract resonantly. This design differs from those discussed recently in several important respects. The storage ring includes an RF system whose purpose is to control the beam orbit and rate of extraction from the ring. With an RF system in the ring, the injection scheme consists of a few turns of synchronous transfers of beam between the linac and storage ring.

  1. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  2. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  3. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  4. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  5. 21 CFR 890.3690 - Powered wheeled stretcher.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Powered wheeled stretcher. 890.3690 Section 890.3690 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES PHYSICAL MEDICINE DEVICES Physical Medicine Prosthetic Devices § 890.3690 Powered...

  6. Development of an Arbitrary Waveform Membrane Stretcher for Dynamic Cell Culture

    PubMed Central

    Lau, Jason J.; Wang, Raymond M.; Black, Lauren D.

    2014-01-01

    In this paper, a novel cell stretcher design that mimics the real-time stretch of the heart wall is introduced. By culturing cells under stretched conditions that mimics the mechanical aspects of the native cardiac environment, better understanding on the role of biomechanical signaling on cell development can be achieved. The device utilizes a moving magnet linear actuator controlled through pulse-width modulated power combined with an automated closed loop feedback system for accurate generation of a designated mechanical stretch profile. The system’s capability to stretch a cell culture membrane and accuracy of the designated frequency and waveform production for cyclic stretching were evaluated. Temperature and degradation assessments as well as a scalable design demonstrated the system’s cell culture application for long term, in vitro studies. PMID:24473700

  7. Phase control and measurement of ultrashort optical pulses

    SciTech Connect

    Sullivan, A.; White, W.E.; Chu, K.C.; Heritage, J.P.

    1995-02-10

    We have used the Direct Optical Spectral Phase Measurement (DOSPM) technique to characterize the cubic phase tuning ability of our pulse stretcher. We have compared the measured phase to the phase determined from cross-correlation measurements.

  8. Temporal laser pulse manipulation using multiple optical ring-cavities

    NASA Technical Reports Server (NTRS)

    Nguyen, Quang-Viet (Inventor); Kojima, Jun (Inventor)

    2010-01-01

    An optical pulse stretcher and a mathematical algorithm for the detailed calculation of its design and performance is disclosed. The optical pulse stretcher has a plurality of optical cavities, having multiple optical reflectors such that an optical path length in each of the optical cavities is different. The optical pulse stretcher also has a plurality of beam splitters, each of which intercepts a portion of an input optical beam and diverts the portion into one of the plurality of optical cavities. The input optical beam is stretched and a power of an output beam is reduced after passing through the optical pulse stretcher and the placement of the plurality of optical cavities and beam splitters is optimized through a model that takes into account optical beam divergence and alignment in the pluralities of the optical cavities. The optical pulse stretcher system can also function as a high-repetition-rate (MHz) laser pulse generator, making it suitable for use as a stroboscopic light source for high speed ballistic projectile imaging studies, or it can be used for high speed flow diagnostics using a laser light sheet with digital particle imaging velocimetry. The optical pulse stretcher system can also be implemented using fiber optic components to realize a rugged and compact optical system that is alignment free and easy to use.

  9. Orthopedic stretcher with average-sized person can pass through 18-inch opening

    NASA Technical Reports Server (NTRS)

    Lothschuetz, F. X.

    1966-01-01

    Modified Robinson stretcher for vertical lifting and carrying, will pass through an opening 18 inches in diameter, while containing a person of average height and weight. A subject 6 feet tall and weighing 200 pounds was lowered and raised out of an 18 inch diameter opening in a tank to test the stretcher.

  10. Design of pulse stretching cell for a sodium guide star optical system

    SciTech Connect

    Friedman, H.W.; Horton, J.A.; Kuklo, T.J.; Wong, N.J.

    1992-11-10

    A pulse stretcher has been designed for the LLNL sodium guide star experiment to lower the laser flux and avoid saturation effects. The optical design, mechanical layout and wavefront error analysis are presented.

  11. Jerry can carriage is an effective predictor of stretcher carry performance.

    PubMed

    Beck, Benjamin; Carstairs, Greg L; Caldwell Odgers, Joanne N; Doyle, Tim L A; Middleton, Kane J

    2016-06-01

    Carrying a casualty on a stretcher is a critical task conducted in a range of occupations. To ensure that personnel have the requisite physical capacity to conduct this task, two bilateral jerry can carries were used to predict individual performance in a four-person stretcher carry. Results demonstrated a bilateral 22-kg jerry can carry (R(2) = 0.59) had superior predictive ability of stretcher carry performance than a bilateral 15-kg jerry can carry (R(2) = 0.46). Pre- to post-carry changes in grip endurance (p > 0.05), back-leg isometric strength (p > 0.05) and leg power (p > 0.05) were not significantly different between carry tasks. There was no significant difference in heart rate (p > 0.05) and oxygen consumption (p > 0.05) between the stretcher carry and either jerry can carry. Thus, on the basis of performance correlations and physiological measures, the 22-kg jerry can carry is an appropriate predictive assessment of four-person stretcher carriage. Practitioner Summary: This study investigated the ability of a jerry can carry to predict individual performance on a four-person stretcher carry. Performance correlations were substantiated with physiological measures to demonstrate similar physical requirements between task and test. These results can be used to set physical employment standards to assess stretcher carriage. PMID:26526182

  12. Laser Pulse-Stretching Using Multiple Optical Ring-Cavities

    NASA Technical Reports Server (NTRS)

    Kojima, Jun; Nguyen, Quang-Viet; Lee, Chi-Ming (Technical Monitor)

    2002-01-01

    We describe a simple and passive nanosecond-long (ns-long) laser 'pulse-stretcher' using multiple optical ring-cavities. We present a model of the pulse-stretching process for an arbitrary number of optical ring-cavities. Using the model, we optimize the design of a pulse-stretcher for use in a spontaneous Raman scattering excitation system that avoids laser-induced plasma spark problems. From the optimized design, we then experimentally demonstrate and verify the model with a 3-cavity pulse-stretcher system that converts a 1000 mJ, 8.4 ns-long input laser pulse into an approximately 75 ns-long (FWHM) output laser pulse with a peak power reduction of 0.10X, and an 83% efficiency.

  13. EMS Stretcher “Misadventures” in a Large, Urban EMS System: A Descriptive Analysis of Contributing Factors and Resultant Injuries

    PubMed Central

    Goodloe, Jeffrey M.; Crowder, Christopher J.; Arthur, Annette O.; Thomas, Stephen H.

    2012-01-01

    Purpose. There is a paucity of data regarding EMS stretcher-operation-related injuries. This study describes and analyzes characteristics associated with undesirable stretcher operations, with or without resultant injury in a large, urban EMS agency. Methods. In the study agency, all stretcher-related “misadventures” are required to be documented, regardless of whether injury results. All stretcher-related reports between July 1, 2009 and June 30, 2010 were queried in retrospective analysis, avoiding Hawthorne effect in stretcher operations. Results. During the year studied, 129,110 patients were transported. 23 stretcher incidents were reported (0.16 per 1,000 transports). No patient injury occurred. Four EMS providers sustained minor injuries. Among contributing aspects, the most common involved operations surrounding the stretcher-ambulance safety latch, 14/23 (60.9%). From a personnel injury prevention perspective, there exists a significant relationship between combative patients and crew injury related to stretcher operation, Fisher's exact test 0.048. Conclusions. In this large, urban EMS system, the incidence of injury related to stretcher operations in the one-year study period is markedly low, with few personnel injuries and no patient injuries incurred. Safety for EMS personnel and patients could be advanced by educational initiatives that highlight specific events and conditions contributing to stretcher-related adverse events. PMID:22606379

  14. A monolithic time stretcher for precision time recording

    SciTech Connect

    Varner, Gary S.

    2007-04-20

    Identifying light mesons which contain only up/down quarks (pions) from those containing a strange quark (kaons) over the typical meter length scales of a particle physics detector requires instrumentation capable of measuring flight times with a resolution on the order of 20ps. In the last few years a large number of inexpensive, multi-channel Time-to-Digital Converter (TDC) chips have become available. These devices typically have timing resolution performance in the hundreds of ps regime. A technique is presented that is a monolithic version of ``time stretcher'' solution adopted for the Belle Time-Of-Flight system to address this gap between resolution need and intrinsic multi-hit TDC performance.

  15. Experimental verification and analysis of wavelength effect on pulse stretching and compressing in mid-IR chirped-pulse amplification

    NASA Astrophysics Data System (ADS)

    Zhong, Haizhe; Yuan, Peng; Zhao, Kun; Zhang, Lifu; Ma, Jingui; Li, Ying; Fan, Dianyuan

    2016-02-01

    As a consequence of the general experimental challenge to detect signals in mid-IR range, taking dispersive chirped near-IR laser pulses as the injected signal source seems to be an artistic route avoiding the daunting mid-IR stretcher and constantly was applied in moderate energy mid-IR optical parametric chirped-pulse amplifications (OPCPA) systems. In this paper we study the wavelength effect on pulse stretching and compressing in detail. Beginning with the theoretical analysis on each dispersion term of grating pairs, we evaluate the residual dispersions when pulse stretcher and compressor work at distinct wavelengths, which shows that this wavelength effect will result in poorly compressed pulses far from transform-limited. Via proof-of-principle experiments based on mid-IR OPCPAs and corresponding numerical simulations, we show that this artful configuration led to un-compressible pulses of ∼2 ps with a time-bandwidth product of ∼ 10 when the chirped-pulse duration is ∼400 ps. To overcome this effect, we demonstrate a simple design of pulse stretcher and compressor. The presented design consisted of a reflection grism-pair compressor can simultaneously cancel the quadric and cubic dispersions of conventional grating based stretcher, showing a potential ability of supporting high-contrast, sub-100-fs pulse-duration and 10,000× of pulse expansion.

  16. High peak-power monolithic femtosecond ytterbium fiber chirped pulse amplifier with a spliced-on hollow core fiber compressor.

    PubMed

    Verhoef, A J; Jespersen, K; Andersen, T V; Grüner-Nielsen, L; Flöry, T; Zhu, L; Baltuška, A; Fernández, A

    2014-07-14

    We demonstrate a monolithic Yb-fiber chirped pulse amplifier that uses a dispersion matched fiber stretcher and a spliced-on hollow core photonic bandgap fiber compressor. For an output energy of 77 nJ, 220 fs pulses with 92% of the energy contained in the main pulse, can be obtained with minimal nonlinearities in the system. 135 nJ pulses are obtained with 226 fs duration and 82 percent of the energy in the main pulse. Due to the good dispersion match of the stretcher to the hollow core photonic bandgap fiber compressor, the duration of the output pulses is within 10% of the Fourier limited duration. PMID:25090494

  17. Unconstrained Respiration Measurement and Respiratory Arrest Detection Method by Dynamic Threshold in Transferring Patients by Stretchers

    NASA Astrophysics Data System (ADS)

    Kurihara, Yosuke; Watanabe, Kajiro; Kobayashi, Kazuyuki; Tanaka, Hiroshi

    General anesthesia used for surgical operations may cause unstable conditions of the patients after the operations, which could lead to respiratory arrests. Under such circumstances, nurses could fail in finding the change of the conditions, and other malpractices could also occur. It is highly possible that such malpractices may occur while transferring a patient from ICU to the room using a stretcher. Monitoring the change in the blood oxygen saturation concentration and other vital signs to detect a respiratory arrest is not easy when transferring a patient on a stretcher. Here we present several noise reduction system and algorithm to detect respiratory arrests in transferring a patient, based on the unconstrained air pressure method that the authors presented previously. As the result, when the acceleration level of the stretcher noise was 0.5G, the respiratory arrest detection ratio using this novel method was 65%, while that with the conventional method was 0%.

  18. Imaging of a linear diode bar for an optical cell stretcher

    PubMed Central

    Roth, K. B.; Neeves, K. B.; Squier, J.; Marr, D. W. M.

    2015-01-01

    We present a simplified approach for imaging a linear diode bar laser for application as an optical stretcher within a microfluidic geometry. We have recently shown that these linear sources can be used to measure cell mechanical properties; however, the source geometry creates imaging challenges. To minimize intensity losses and simplify implementation within microfluidic systems without the use of expensive objectives, we combine aspheric and cylindrical lenses to create a 1:1 image of the source at the stretcher focal plane and demonstrate effectiveness by measuring the deformation of human red blood cells and neutrophils. PMID:25798305

  19. 450 More Story Stretchers for the Primary Grades: Activities To Expand Children's Favorite Books.

    ERIC Educational Resources Information Center

    Raines, Shirley C.

    This book emphasizes the reading process by suggesting effective ways to read with children, to engage children as thinkers, and to model the processes of studying a text. The book's "story stretchers" are a means to extend children's enthusiasm for stories and to better connect children's books and teaching ideas with other areas of the…

  20. Pulse

    MedlinePlus

    Heart rate; Heart beat ... The pulse can be measured at areas where an artery passes close to the skin. These areas include the: ... side of the foot Wrist To measure the pulse at the wrist, place the index and middle ...

  1. The cell-stretcher: A novel device for the mechanical stimulation of cell populations.

    PubMed

    Seriani, S; Del Favero, G; Mahaffey, J; Marko, D; Gallina, P; Long, C S; Mestroni, L; Sbaizero, O

    2016-08-01

    Mechanical stimulation appears to be a critical modulator for many aspects of biology, both of living tissue and cells. The cell-stretcher, a novel device for the mechanical uniaxial stimulation of populations of cells, is described. The system is based on a variable stroke cam-lever-tappet mechanism which allows the delivery of cyclic stimuli with frequencies of up to 10 Hz and deformation between 1% and 20%. The kinematics is presented and a simulation of the dynamics of the system is shown, in order to compute the contact forces in the mechanism. The cells, following cultivation and preparation, are plated on an ad hoc polydimethylsiloxane membrane which is then loaded on the clamps of the cell-stretcher via force-adjustable magnetic couplings. In order to show the viability of the experimentation and biocompatibility of the cell-stretcher, a set of two in vitro tests were performed. Human epithelial carcinoma cell line A431 and Adult Mouse Ventricular Fibroblasts (AMVFs) from a dual reporter mouse were subject to 0.5 Hz, 24 h cyclic stretching at 15% strain, and to 48 h stimulation at 0.5 Hz and 15% strain, respectively. Visual analysis was performed on A431, showing definite morphological changes in the form of cellular extroflections in the direction of stimulation compared to an unstimulated control. A cytometric analysis was performed on the AMVF population. Results show a post-stimulation live-dead ratio deviance of less than 6% compared to control, which proves that the environment created by the cell-stretcher is suitable for in vitro experimentation. PMID:27587132

  2. The cell-stretcher: A novel device for the mechanical stimulation of cell populations

    NASA Astrophysics Data System (ADS)

    Seriani, S.; Del Favero, G.; Mahaffey, J.; Marko, D.; Gallina, P.; Long, C. S.; Mestroni, L.; Sbaizero, O.

    2016-08-01

    Mechanical stimulation appears to be a critical modulator for many aspects of biology, both of living tissue and cells. The cell-stretcher, a novel device for the mechanical uniaxial stimulation of populations of cells, is described. The system is based on a variable stroke cam-lever-tappet mechanism which allows the delivery of cyclic stimuli with frequencies of up to 10 Hz and deformation between 1% and 20%. The kinematics is presented and a simulation of the dynamics of the system is shown, in order to compute the contact forces in the mechanism. The cells, following cultivation and preparation, are plated on an ad hoc polydimethylsiloxane membrane which is then loaded on the clamps of the cell-stretcher via force-adjustable magnetic couplings. In order to show the viability of the experimentation and biocompatibility of the cell-stretcher, a set of two in vitro tests were performed. Human epithelial carcinoma cell line A431 and Adult Mouse Ventricular Fibroblasts (AMVFs) from a dual reporter mouse were subject to 0.5 Hz, 24 h cyclic stretching at 15% strain, and to 48 h stimulation at 0.5 Hz and 15% strain, respectively. Visual analysis was performed on A431, showing definite morphological changes in the form of cellular extroflections in the direction of stimulation compared to an unstimulated control. A cytometric analysis was performed on the AMVF population. Results show a post-stimulation live-dead ratio deviance of less than 6% compared to control, which proves that the environment created by the cell-stretcher is suitable for in vitro experimentation.

  3. A Novel First Aid Stretcher for Immobilization and Transportation of Spine Injured Patients

    PubMed Central

    Liu, Yan-Sheng; Feng, Ya-Ping; Xie, Jia-Xin; Luo, Zhuo-Jing; Shen, Cai-Hong; Niu, Fang; Zou, Jian; Tang, Shao-Feng; Hao, Jiang; Xu, Jia-Xiang; Xiao, Li-Ping; Xu, Xiao-Ming; Zhu, Hui

    2012-01-01

    Effective immobilization and transportation are vital to the life-saving acute medical care needed when treating critically injured people. However, the most common types of stretchers used today are wrought with problems that can lead to further medical complications, difficulty in employment and rescue, and ineffective transitions to hospital treatment. Here we report a novel first aid stretcher called the “emergency carpet”, which solves these problems with a unique design for spine injured patients. Polyurethane composite material, obtained by a novel process of manually mixing isocyanate and additives, can be poured into a specially designed fabric bag and allowed to harden to form a rigid human-shaped stretcher. The effectiveness of the emergency carpet was examined in the pre-hospital management of victims with spinal fractures. Additionally, it was tested on flat ground and complex terrain as well as in the sea and air. We demonstrated that the emergency carpet can be assembled and solidified on the scene in 5 minutes, providing effective immobilization to the entire injured body. With the protection of the emergency carpet, none of the 20 patients, who were finally confirmed to have spinal column fracture or dislocation, had any neurological deterioration during transportation. Furthermore, the carpet can be handled and transported by multiple means under differing conditions, without compromising immobilization. Finally, the emergency carpet allows the critically injured patient to receive multiple examinations such as X-ray, CT, and MRI without being removed from the carpet. Our results demonstrate that the emergency carpet has ideal capabilities for immobilization, extrication, and transportation of the spine injured patients. Compared with other stretchers, it allows for better mobility, effective immobilization, remarkable conformity to the body, and various means for transportation. The emergency carpet is promising for its intrinsic advantages

  4. A novel first aid stretcher for immobilization and transportation of spine injured patients.

    PubMed

    Liu, Yan-Sheng; Feng, Ya-Ping; Xie, Jia-Xin; Luo, Zhuo-Jing; Shen, Cai-Hong; Niu, Fang; Zou, Jian; Tang, Shao-Feng; Hao, Jiang; Xu, Jia-Xiang; Xiao, Li-Ping; Xu, Xiao-Ming; Zhu, Hui

    2012-01-01

    Effective immobilization and transportation are vital to the life-saving acute medical care needed when treating critically injured people. However, the most common types of stretchers used today are wrought with problems that can lead to further medical complications, difficulty in employment and rescue, and ineffective transitions to hospital treatment. Here we report a novel first aid stretcher called the "emergency carpet", which solves these problems with a unique design for spine injured patients. Polyurethane composite material, obtained by a novel process of manually mixing isocyanate and additives, can be poured into a specially designed fabric bag and allowed to harden to form a rigid human-shaped stretcher. The effectiveness of the emergency carpet was examined in the pre-hospital management of victims with spinal fractures. Additionally, it was tested on flat ground and complex terrain as well as in the sea and air. We demonstrated that the emergency carpet can be assembled and solidified on the scene in 5 minutes, providing effective immobilization to the entire injured body. With the protection of the emergency carpet, none of the 20 patients, who were finally confirmed to have spinal column fracture or dislocation, had any neurological deterioration during transportation. Furthermore, the carpet can be handled and transported by multiple means under differing conditions, without compromising immobilization. Finally, the emergency carpet allows the critically injured patient to receive multiple examinations such as X-ray, CT, and MRI without being removed from the carpet. Our results demonstrate that the emergency carpet has ideal capabilities for immobilization, extrication, and transportation of the spine injured patients. Compared with other stretchers, it allows for better mobility, effective immobilization, remarkable conformity to the body, and various means for transportation. The emergency carpet is promising for its intrinsic advantages in

  5. Internal gastargets in AmPS

    NASA Astrophysics Data System (ADS)

    Kaan, A. P.; Postma, O.; van den Brand, J. F. J.; van Leeuwen, E.; Doets, M.; Kraan, M.

    1997-05-01

    Internal gas targets in AmPS A.P. Kaan, O. Postma, J.F.J. van den Brand, E. van Leeuwen, M. Doets, M. Kra= an National Institute for Nuclear Physics and High Energy Physics; Kruislaan 409; 1098 SJ Amsterdam; Holland In the Amsterdam Puls Stretcher/storage ring AmPS(1 GeV electrons), we designed a set-up in order to accommodate a gas target with a density of 1016 mol/cm2. The storage cell needed for this purpose is a aluminium tube with a length of 40 cm, a diameter of 15 mm and a wall thickness of 25 =B5m. Three sets of conductance limiters on both sides of the target, combined with dry turbopumps are designed to be used as differential pumping stations. These limiters cause discontinuities in the beam path and must therefor be retractable and radio frequency compatible in both positions. Low =B5 materials must be used because of the depolarisation effects of changing magnetic fields. The calculations show that the flow resistance's are sufficient to reduce the load of the getter pumps to a level with which the lifetime of the pump elements remain acceptable. The design of the mechanics and the vacuum system will be explained. Recent results from the measurements after installation in combination with the influence on the lifetime on the beam will be presented

  6. Pulse

    MedlinePlus

    ... resting for at least 10 minutes. Take the exercise heart rate while you are exercising. ... pulse rate can help determine if the patient's heart is pumping. ... rate gives information about your fitness level and health.

  7. Local scattering stress distribution on surface of a spherical cell in optical stretcher

    NASA Astrophysics Data System (ADS)

    Bareil, Paul B.; Sheng, Yunlong; Chiou, Arthur

    2006-12-01

    We calculate stress distribution on the surface of a spherical cell trapped by two counter propagating beams in the optical stretcher in the ray optics regime. We demonstrate that the local scattering stress is perpendicular to the spherical refractive surface regardless of incident angle, polarization and the reflectance and transmittance at the surface. We explain the apparition of peaks in the stress distribution, which were not revealed in the existing theory. We consider the divergence of the incident beams from the fibers, and express the stress distribution as a function of fiber-to-cell distance. The new theory can predict the cell’s deformation more precisely.

  8. High-throughput linear optical stretcher for mechanical characterization of blood cells.

    PubMed

    Roth, Kevin B; Neeves, Keith B; Squier, Jeff; Marr, David W M

    2016-04-01

    This study describes a linear optical stretcher as a high-throughput mechanical property cytometer. Custom, inexpensive, and scalable optics image a linear diode bar source into a microfluidic channel, where cells are hydrodynamically focused into the optical stretcher. Upon entering the stretching region, antipodal optical forces generated by the refraction of tightly focused laser light at the cell membrane deform each cell in flow. Each cell relaxes as it flows out of the trap and is compared to the stretched state to determine deformation. The deformation response of untreated red blood cells and neutrophils were compared to chemically treated cells. Statistically significant differences were observed between normal, diamide-treated, and glutaraldehyde-treated red blood cells, as well as between normal and cytochalasin D-treated neutrophils. Based on the behavior of the pure, untreated populations of red cells and neutrophils, a mixed population of these cells was tested and the discrete populations were identified by deformability. © 2015 International Society for Advancement of Cytometry. PMID:26565892

  9. Spectral compression of femtosecond pulses using chirped volume Bragg gratings.

    PubMed

    Nejbauer, Michał; Kardaś, Tomasz M; Stepanenko, Yuriy; Radzewicz, Czesław

    2016-06-01

    In this Letter, we demonstrate a 360 fold spectral bandwidth reduction of femtosecond laser pulses using the method of sum frequency generation of pulses with opposite chirps. The reduction has been achieved in a compact setup in which a single chirped volume Bragg grating replaces conventional stretcher and compressor units. Starting with 180 fs pulses, we have obtained, with a 30% overall efficiency, pulses longer than 100 ps with the spectral bandwidth of 0.23  cm-1 (7 GHz). We also discuss our method on theoretical grounds. PMID:27244372

  10. Cyclic AMP in prokaryotes.

    PubMed Central

    Botsford, J L; Harman, J G

    1992-01-01

    Cyclic AMP (cAMP) is found in a variety of prokaryotes including both eubacteria and archaebacteria. cAMP plays a role in regulating gene expression, not only for the classic inducible catabolic operons, but also for other categories. In the enteric coliforms, the effects of cAMP on gene expression are mediated through its interaction with and allosteric modification of a cAMP-binding protein (CRP). The CRP-cAMP complex subsequently binds specific DNA sequences and either activates or inhibits transcription depending upon the positioning of the complex relative to the promoter. Enteric coliforms have provided a model to explore the mechanisms involved in controlling adenylate cyclase activity, in regulating adenylate cyclase synthesis, and in performing detailed examinations of CRP-cAMP complex-regulated gene expression. This review summarizes recent work focused on elucidating the molecular mechanisms of CRP-cAMP complex-mediated processes. For other bacteria, less detail is known. cAMP has been implicated in regulating antibiotic production, phototrophic growth, and pathogenesis. A role for cAMP has been suggested in nitrogen fixation. Often the only data that support cAMP involvement in these processes includes cAMP measurement, detection of the enzymes involved in cAMP metabolism, or observed effects of high concentrations of the nucleotide on cell growth. PMID:1315922

  11. Using a piezoelectric fiber stretcher to remove the depth ambiguity in optical Fourier domain imaging

    NASA Astrophysics Data System (ADS)

    Vergnole, Sébastien; Lamouche, Guy; Dufour, Marc; Gauthier, Bruno

    2007-07-01

    This paper reports the study of an Optical Fourier Domain Imaging (OFDI) setup for optical coherence tomography. One of the main drawbacks of OFDI is its inability to differentiate positive and negative depths. Some setups have already been proposed to remove this depth ambiguity by introducing a modulation by means of electro-optic or acousto-optic modulators. In our setup, we implement a piezoelectric fiber stretcher to generate a periodic phase shift between successive A-scans, thus introducing a transverse modulation. The depth ambiguity is then resolved by performing a Fourier treatment in the transverse direction before processing the data in the axial direction. It is similar to the B-M mode scanning already proposed for Spectral-Domain OCT1 but with a more efficient experimental setup. We discuss the advantages and the drawbacks of our technique compared to the technique based on acousto-optics modulators by comparing images of an onion obtained with both techniques.

  12. Compensation of nonlinear phase shifts with third-order dispersion in short-pulse fiber amplifiers.

    PubMed

    Zhou, Shian; Kuznetsova, Lyuba; Chong, Andy; Wise, Frank

    2005-06-27

    We show that nonlinear phase shifts and third-order dispersion can compensate each other in short-pulse fiber amplifiers. This compen-sation can be exploited in any implementation of chirped-pulse amplification, with stretching and compression accomplished with diffraction gratings, single-mode fiber, microstructure fiber, fiber Bragg gratings, etc. In particular, we consider chirped-pulse fiber amplifiers at wavelengths for which the fiber dispersion is normal. The nonlinear phase shift accumulated in the amplifier can be compensated by the third-order dispersion of the combination of a fiber stretcher and grating compressor. A numerical model is used to predict the compensation, and experimental results that exhibit the main features of the calculations are presented. In the presence of third-order dispersion, an optimal nonlinear phase shift reduces the pulse duration, and enhances the peak power and pulse contrast compared to the pulse produced in linear propagation. Contrary to common belief, fiber stretchers can perform as well or better than grating stretchers in fiber amplifiers, while offering the major practical advantages of a waveguide medium. PMID:19498473

  13. AMPED Program Overview

    ScienceCinema

    Gur, Ilan

    2014-04-02

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  14. AMPED Program Overview

    SciTech Connect

    Gur, Ilan

    2014-03-04

    An overview presentation about ARPA-E's AMPED program. AMPED projects seek to develop advanced sensing, control, and power management technologies that redefine the way we think about battery management. Energy storage can significantly improve U.S. energy independence, efficiency, and security by enabling a new generation of electric vehicles. While rapid progress is being made in new battery materials and storage technologies, few innovations have emerged in the management of advanced battery systems. AMPED aims to unlock enormous untapped potential in the performance, safety, and lifetime of today's commercial battery systems exclusively through system-level innovations, and is thus distinct from existing efforts to enhance underlying battery materials and architectures.

  15. Changes in Monkey Crystalline Lens Spherical Aberration During Simulated Accommodation in a Lens Stretcher

    PubMed Central

    Maceo Heilman, Bianca; Manns, Fabrice; de Castro, Alberto; Durkee, Heather; Arrieta, Esdras; Marcos, Susana; Parel, Jean-Marie

    2015-01-01

    Purpose. The purpose of this study was to quantify accommodation-induced changes in the spherical aberration of cynomolgus monkey lenses. Methods. Twenty-four lenses from 20 cynomolgus monkeys (Macaca fascicularis; 4.4–16.0 years of age; postmortem time 13.5 ± 13.0 hours) were mounted in a lens stretcher. Lens spherical aberration was measured in the unstretched (accommodated) and stretched (relaxed) states with a laser ray tracing system that delivered 51 equally spaced parallel rays along 1 meridian of the lens over the central 6-mm optical zone. A camera mounted below the lens was used to measure the ray height at multiple positions along the optical axis. For each entrance ray, the change in ray height with axial position was fitted with a third-order polynomial. The effective paraxial focal length and Zernike spherical aberration coefficients corresponding to a 6-mm pupil diameter were extracted from the fitted values. Results. The unstretched lens power decreased with age from 59.3 ± 4.0 diopters (D) for young lenses to 45.7 ± 3.1 D for older lenses. The unstretched lens shifted toward less negative spherical aberration with age, from −6.3 ± 0.7 μm for young lenses to −5.0 ± 0.5 μm for older lenses. The power and spherical aberration of lenses in the stretched state were independent of age, with values of 33.5 ± 3.4 D and −2.6 ± 0.5 μm, respectively. Conclusions. Spherical aberration is negative in cynomolgus monkey lenses and becomes more negative with accommodation. These results are in good agreement with the predicted values using computational ray tracing in a lens model with a reconstructed gradient refractive index. The spherical aberration of the unstretched lens becomes less negative with age. PMID:25670492

  16. Long-term carrier-envelope phase stability from a grating-based, chirped pulse amplifier.

    PubMed

    Gagnon, Etienne; Thomann, Isabell; Paul, Ariel; Lytle, Amy L; Backus, Sterling; Murnane, Margaret M; Kapteyn, Henry C; Sandhu, Arvinder S

    2006-06-15

    We demonstrate a carrier-envelope phase (CEP) stabilized, chirped pulse laser amplifier that exhibits greatly improved intrinsic long-term CEP stability compared with that of other amplifiers. This system employs a grating-based stretcher and compressor and a cryogenically cooled laser amplifier. Single-shot carrier envelope phase noise measurements are also presented that avoid underestimation of this parameter caused by fringe averaging and represent a rigorously accurate upper limit on CEP noise. PMID:16729097

  17. Characterization of perpendicular chirped phase volume grating pairs for laser pulse stretching

    SciTech Connect

    Loiseaux, B.; Delboulbe, A.; Huignard, J.P.; Tournois, P.; Cheriaux, G.; Salin, F.

    1996-06-01

    We report the characterization of a new pulse stretcher that provides a linear and positive variation of the group delay as a function of the optical frequency. It consists of a perpendicular chirped-grating pair introduced by Tournois [Opt. Commun. {bold 106}, 253 (1994)] that allows 20-fs pulses to be stretched to 100 ps. The system is tested by short-pulse spectral interferometry. We designed and realized the chirped gratings by phase volume holographic recording in a highly efficient photopolymer. {copyright} {ital 1996 Optical Society of America.}

  18. Chirped pulse amplification with a nonlinearly chirped fiber Bragg grating matched to the Treacy compressor.

    PubMed

    Imeshev, G; Hartl, I; Fermann, M E

    2004-04-01

    We demonstrate a fiber chirped pulse amplification system that uses an engineered nonlinearly chirped fiber Bragg grating stretcher dispersion matched to the Treacy compressor. The seed pulses at 1558 nm are stretched to 720 ps, amplified by more than 50 dB to 6.5-microJ energy, and recompressed to 940 fs. After almost 1000 times compression the pulses are within 30% of the bandwidth limit and have a contrast ratio of better than 30 dB. PMID:15072356

  19. Applying Mathematical Processes (AMP)

    ERIC Educational Resources Information Center

    Kathotia, Vinay

    2011-01-01

    This article provides insights into the "Applying Mathematical Processes" resources, developed by the Nuffield Foundation. It features Nuffield AMP activities--and related ones from Bowland Maths--that were designed to support the teaching and assessment of key processes in mathematics--representing a situation mathematically, analysing,…

  20. Carrier-envelope phase stabilization of a multi-millijoule, regenerative-amplifier-based chirped-pulse smplifier system.

    PubMed

    Fordell, T; Miranda, M; Persson, A; L'Huillier, A

    2009-11-01

    This article reports on the successful stabilization of the carrier-envelope phase of a 1-kHz laser system that includes a large grating stretcher, a regenerative amplifier, a multipass amplifier and a grating compressor. Phase stability for pulse energies up to 6 mJ is demonstrated using electronic feedback to the oscillator locking electronics as well as feedback via an acousto-optic programmable dispersive filter. PMID:19997348

  1. Precision control of carrier-envelope phase in grating based chirped pulse amplifiers.

    PubMed

    Li, Chengquan; Moon, Eric; Mashiko, Hiroki; Nakamura, Christopher M; Ranitovic, Predrag; Maharjan, Chakra M; Cocke, C Lewis; Chang, Zenghu; Paulus, Gerhard G

    2006-11-13

    It is demonstrated that the carrier-envelope (CE) phase of pulses from a high power ultrafast laser system with a grating-based stretcher and compressor can be stabilized to a root mean square (rms) value of 180 mrad over almost 2 hours, excluding a brief re-locking period. The stabilization was accomplished via feedback control of the grating separation in the stretcher. It shows that the long term CE phase stability of a grating based chirped pulse amplification system can be as good as that of lasers using a glass-block stretcher and a prism pair compressor. Moreover, by adjusting the grating separation to preset values, the relative CE phase could be locked to an arbitrary value in the range of 2pi. This method is better than using a pair of wedge plates to adjust the phase after the hollow-core fiber compressor. The CE phase stabilization after a hollow-core fiber compressor was confirmed by a CE-phase meter based on the measurement of the left-to-right asymmetry of electrons produced by above-threshold ionization. PMID:19529565

  2. Determination of cell elasticity through hybrid ray optics and continuum mechanics modeling of cell deformation in the optical stretcher

    PubMed Central

    Ekpenyong, Andrew E.; Posey, Carolyn L.; Chaput, Joy L.; Burkart, Anya K.; Marquardt, Meg M.; Smith, Timothy J.; Nichols, Michael G.

    2011-01-01

    The optical stretcher is a dual-beam trap capable of stretching individual cells. Previous studies have used either ray- or wave-optical models to compute the optical pressure on the surface of a spherical cell. We have extended the ray-optics model to account for focusing by the spherical interface and the effects of multiple internal reflections. Simulation results for red-blood cells (RBCs) show that internal reflections can lead to significant perturbation of the deformation, leading to a systematic error in the determination of cellular elasticity. Calibration studies show excellent agreement between the predicted and measured escape force, and RBC stiffness measurements are consistent with literature values. Measurements of the elasticity of murine osteogenic cells reveal that these cells are approximately 5.4 times stiffer than RBCs. PMID:19904335

  3. Pulse charging of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1980-01-01

    Pulse charging, as a method of rapidly and efficiently charging 300 amp-hour lead-acid traction cells for an electric vehicle application was investigated. A wide range of charge pulse current square waveforms were investigated and the results were compared to constant current charging at the time averaged pulse current values. Representative pulse current waveforms were: (1) positive waveform-peak charge pulse current of 300 amperes (amps), discharge pulse-current of zero amps, and a duty cycle of about 50%; (2) Romanov waveform-peak charge pulse current of 300 amps, peak discharge pulse current of 15 amps, and a duty of 50%; and (3) McCulloch waveform peak charge pulse current of 193 amps, peak discharge pulse current of about 575 amps, and a duty cycle of 94%. Experimental results indicate that on the basis of amp-hour efficiency, pulse charging offered no significant advantage as a method of rapidly charging 300 amp-hour lead-acid traction cells when compared to constant current charging at the time average pulse current value. There were, however, some disadvantages of pulse charging in particular a decrease in charge amp-hour and energy efficiencies and an increase in cell electrolyte temperature. The constant current charge method resulted in the best energy efficiency with no significant sacrifice of charge time or amp-hour output. Whether or not pulse charging offers an advantage over constant current charging with regard to the cell charge/discharge cycle life is unknown at this time.

  4. Spatiotemporal noise characterization for chirped-pulse amplification systems

    PubMed Central

    Ma, Jingui; Yuan, Peng; Wang, Jing; Wang, Yongzhi; Xie, Guoqiang; Zhu, Heyuan; Qian, Liejia

    2015-01-01

    Optical noise, the core of the pulse-contrast challenge for ultra-high peak power femtosecond lasers, exhibits spatiotemporal (ST) coupling induced by angular dispersion. Full characterization of such ST noise requires two-dimensional measurements in the ST domain. Thus far, all noise measurements have been made only in the temporal domain. Here we report the experimental characterization of the ST noise, which is made feasible by extending cross-correlation from the temporal domain to the ST domain. We experimentally demonstrate that the ST noise originates from the optical surface imperfections in the pulse stretcher/compressor and exhibits a linear ST coupling in the far-field plane. The contrast on the far-field axis, underestimated in the conventional measurements, is further improved by avoiding the far-field optics in the stretcher. These results enhance our understanding of the pulse contrast with respect to its ST-coupling nature and pave the way toward the design of high-contrast ultra-high peak power lasers. PMID:25648187

  5. Spatiotemporal noise characterization for chirped-pulse amplification systems.

    PubMed

    Ma, Jingui; Yuan, Peng; Wang, Jing; Wang, Yongzhi; Xie, Guoqiang; Zhu, Heyuan; Qian, Liejia

    2015-01-01

    Optical noise, the core of the pulse-contrast challenge for ultra-high peak power femtosecond lasers, exhibits spatiotemporal (ST) coupling induced by angular dispersion. Full characterization of such ST noise requires two-dimensional measurements in the ST domain. Thus far, all noise measurements have been made only in the temporal domain. Here we report the experimental characterization of the ST noise, which is made feasible by extending cross-correlation from the temporal domain to the ST domain. We experimentally demonstrate that the ST noise originates from the optical surface imperfections in the pulse stretcher/compressor and exhibits a linear ST coupling in the far-field plane. The contrast on the far-field axis, underestimated in the conventional measurements, is further improved by avoiding the far-field optics in the stretcher. These results enhance our understanding of the pulse contrast with respect to its ST-coupling nature and pave the way toward the design of high-contrast ultra-high peak power lasers. PMID:25648187

  6. Multiple THz pulse generation with variable energy ratio and delay

    NASA Astrophysics Data System (ADS)

    Ungureanu, R. G.; Grigore, O. V.; Dinca, M. P.; Cojocaru, G. V.; Ursescu, D.; Dascalu, T.

    2015-04-01

    Two methods for multiple high energetic THz pulse generation by two-color filamentation in air with controllable energy ratio and delay ranging from one to hundreds of ps were investigated. In the first method the laser pulse is split into two inside the optical stretcher of a CPA laser system, the resulting consecutive filaments occur in the same region and allows the study of the influence of the first plasma filament on the THz emission of the delayed filament. Based on a polarization sensitive thin film beam splitter placed in front of a 45° mirror, the second method produces multiple parallel consecutive filaments. Above a certain total pump level the THz energy delivered by multiple pulses exceeds the value given by a single filament for the same pump energy, thereby overcoming the THz emission saturation of the single filament.

  7. The IsoStretcher: An isotropic cell stretch device to study mechanical biosensor pathways in living cells.

    PubMed

    Schürmann, S; Wagner, S; Herlitze, S; Fischer, C; Gumbrecht, S; Wirth-Hücking, A; Prölß, G; Lautscham, L A; Fabry, B; Goldmann, W H; Nikolova-Krstevski, V; Martinac, B; Friedrich, O

    2016-07-15

    Mechanosensation in many organs (e.g. lungs, heart, gut) is mediated by biosensors (like mechanosensitive ion channels), which convert mechanical stimuli into electrical and/or biochemical signals. To study those pathways, technical devices are needed that apply strain profiles to cells, and ideally allow simultaneous live-cell microscopy analysis. Strain profiles in organs can be complex and multiaxial, e.g. in hollow organs. Most devices in mechanobiology apply longitudinal uniaxial stretch to adhered cells using elastomeric membranes to study mechanical biosensors. Recent approaches in biomedical engineering have employed intelligent systems to apply biaxial or multiaxial stretch to cells. Here, we present an isotropic cell stretch system (IsoStretcher) that overcomes some previous limitations. Our system uses a rotational swivel mechanism that translates into a radial displacement of hooks attached to small circular silicone membranes. Isotropicity and focus stability are demonstrated with fluorescent beads, and transmission efficiency of elastomer membrane stretch to cellular area change in HeLa/HEK cells. Applying our system to lamin-A overexpressing fibrosarcoma cells, we found a markedly reduced stretch of cell area, indicative of a stiffer cytoskeleton. We also investigated stretch-activated Ca(2+) entry into atrial HL-1 myocytes. 10% isotropic stretch induced robust oscillating increases in intracellular Fluo-4 Ca(2+) fluorescence. Store-operated Ca(2+) entry was not detected in these cells. The Isostretcher provides a useful versatile tool for mechanobiology. PMID:26991603

  8. Polarization-maintaining fiber pulse compressor by birefringent hollow-core photonic bandgap fiber.

    PubMed

    Shirakawa, Akira; Tanisho, Motoyuki; Ueda, Ken-Ichi

    2006-12-11

    Structural birefringent properties of a hollow-core photonic-bandgap fiber were carefully investigated and applied to all-fiber chirped-pulse amplification as a compressor. The group birefringence of as high as 6.9x10(-4) and the dispersion splitting by as large as 149 ps/nm/km between the two principal polarization modes were observed at 1557 nm. By launching the amplifier output to one of the polarization modes a 17-dB polarization extinction ratio was obtained without any pulse degradation originating from polarization-mode dispersion. A hybrid fiber stretcher effectively compensates the peculiar dispersion of the photonic-bandgap fiber and pedestal-free 440-fs pulses with a 1-W average power and 21-nJ pulse energy were obtained. Polarization-maintaining fiber-pigtail output of high-power femtosecond pulses is useful for various applications. PMID:19529631

  9. Ytterbium fiber-based, 270 fs, 100 W chirped pulse amplification laser system with 1 MHz repetition rate

    NASA Astrophysics Data System (ADS)

    Zhao, Zhigang; Kobayashi, Yohei

    2016-01-01

    A 100 W Yb-doped, fiber-based, femtosecond, chirped pulse amplification laser system was developed with a repetition rate of 1 MHz, corresponding to a pulse energy of 100 µJ. Large-scale, fused-silica transmission gratings were used for both the pulse stretcher and compressor, with a compression throughput efficiency of ∼85%. A pulse duration of 270 fs was measured by second harmonic generation frequency-resolved optical gating (SHG-FROG). To the best of our knowledge, this is the shortest pulse duration ever achieved by a 100-W-level fiber chirped pulse amplification laser system at a repetition rate of few megahertz, without any special post-compression manipulation.

  10. Pulse-shape discrimination in NE213 liquid scintillator detectors

    NASA Astrophysics Data System (ADS)

    Cavallaro, M.; Tropea, S.; Agodi, C.; Assié, M.; Azaiez, F.; Boiano, C.; Bondì, M.; Cappuzzello, F.; Carbone, D.; De Napoli, M.; de Séréville, N.; Foti, A.; Linares, R.; Nicolosi, D.; Scarpaci, J. A.

    2013-02-01

    The 16-channel fast stretcher BaFPro module, originally developed for processing signals of Barium Fluoride scintillators, has been modified to make a high performing analog pulse-shape analysis of signals from the NE213 liquid scintillators of the EDEN neutron detector array. The module produces two Gaussian signals, whose amplitudes are proportional to the height of the fast component of the output light and to the total energy deposited into the scintillator, respectively. An in-beam test has been performed at INFN-LNS (Italy) demonstrating a low detection threshold, a good pulse-shape discrimination even at low energies and a wide dynamic range for the measurement of the neutrons energy.

  11. A compact high voltage pulse generator

    SciTech Connect

    Rohwein, G.J.; Babcock, S.R.

    1994-07-01

    A compact, easily transportable, pulse generator has been developed for a variety of applications that require a pulse duration in the range of 1 {mu} sec., voltages from 150 to 300 KV and current levels from 2,000 to 3,000 amps. The generator has a simple cylindrical configuration and modular construction to facilitate assembly and service. The generator may be operated single-pulse or repetitively at pulse repetition rates to 50 Hz in a burst mode.

  12. Experiment definition studies for AMPS Spacelab

    NASA Technical Reports Server (NTRS)

    Liemohn, H.

    1975-01-01

    The electrical charging of the space shuttle orbiter is discussed in relation to the AMPS Spacelab payload along with an operations research technique for the selection of AMPS Spacelab experiments. Experiments proposed for AMPS include: hydromagnetic wave experiments; bistatic sounder of AMPS wake; and an artificial meteor gun. Experiment objectives and instrument functions are given for all experiments.

  13. High contrast, 86  fs, 35  mJ pulses from a diode-pumped, Yb:glass, double-chirped-pulse amplification laser system.

    PubMed

    Liebetrau, Hartmut; Hornung, Marco; Keppler, Sebastian; Hellwing, Marco; Kessler, Alexander; Schorcht, Frank; Hein, Joachim; Kaluza, Malte C

    2016-07-01

    We demonstrate the generation of 86 fs, 35 mJ, high-contrast laser pulses at 1030 nm with a repetition rate of 1 Hz from a diode-pumped double chirped-pulse amplification setup. The pulses exhibit a spectral bandwidth exceeding 27 nm full width at half-maximum. This could be achieved by using a laser architecture comprising two stages of chirped pulse amplification with a cross-polarized wave generation filter in between, by applying spectral shaping and by increasing the spectral hard-clip of the second stretcher. These are, to the best of our knowledge, the shortest pulses at the mJ level with ultra-high contrast generated with a diode-pumped front end at 1030 nm. PMID:27367087

  14. A Model Based on Receptor Desensitization for Cyclic AMP Signaling in Dictyostelium Cells

    PubMed Central

    Martiel, Jean-Louis; Goldbeter, Albert

    1987-01-01

    We analyze a model based on receptor modification for the cAMP signaling system that controls aggregation of the slime mold Dictyostelium discoideum after starvation. The model takes into account both the desensitization of the cAMP receptor by reversible phosphorylation and the activation of adenylate cyclase that follows binding of extracellular cAMP to the unmodified receptor. The dynamics of the signaling system is studied in terms of three variables, namely, intracellular and extracellular cAMP, and the fraction of receptor in active state. Using parameter values collected from experimental studies on cAMP signaling and receptor phosphorylation, we show that the model accounts qualitatively and, in a large measure, quantitatively for the various modes of dynamic behavior observed in the experiments: (a) autonomous oscillations of cAMP, (b) relay of suprathreshold cAMP pulses, i.e., excitability, characterized by both an absolute and a relative refractory period, and (c) adaptation to constant cAMP stimuli. A two-variable version of the model is used to demonstrate the link between excitability and oscillations by phase plane analysis. The response of the model to repetitive stimulation allows comprehension, in terms of receptor desensitization, of the role of periodic signaling in Dictyostelium and, more generally, the function of pulsatile patterns of hormone secretion. PMID:19431710

  15. Adaptive-feedback spectral-phase control for interactions with transform-limited ultrashort high-power laser pulses.

    PubMed

    Liu, Cheng; Zhang, Jun; Chen, Shouyuan; Golovin, Gregory; Banerjee, Sudeep; Zhao, Baozhen; Powers, Nathan; Ghebregziabher, Isaac; Umstadter, Donald

    2014-01-01

    Fourier-transform-limited light pulses were obtained at the laser-plasma interaction point of a 100-TW peak-power laser in vacuum. The spectral-phase distortion induced by the dispersion mismatching between the stretcher, compressor, and dispersive materials was fully compensated for by means of an adaptive closed-loop. The coherent temporal contrast on the sub-picosecond time scale was two orders of magnitude higher than that without adaptive control. This novel phase control capability enabled the experimental study of the dependence of laser wakefield acceleration on the spectral phase of intense laser light. PMID:24365827

  16. Brain Stretchers, Book 1.

    ERIC Educational Resources Information Center

    Anderson, Carolyn; Haller, Jackie

    This collection of activities is designed to help students develop critical thinking skills. The activities are non-graded and can be used from upper elementary to high school. Reading levels vary from no reading required to very little reading required and can be used effectively with students who are poor readers, bilingual, or at a special…

  17. Brain Stretchers, Book 2.

    ERIC Educational Resources Information Center

    Anderson, Carolyn; Haller, Jackie

    This collection of activities is designed to help students develop critical thinking skills. The activities are non-graded and can be used from upper elementary to high school. The reading levels vary from no reading required to very little reading required and can be used effectively with students who are poor readers, bilingual, or at a special…

  18. [Technological innovation and humanitarianism in the transport of war wounded: Nicasio Landa's report on a new elastic suspension system for stretchers (Pamplona, May 29, 1875)].

    PubMed

    Arrizabalaga, Jon; García-Reyes, Juan Carlos

    2016-01-01

    In May 1875, in the midst of a bloody civil conflict in Spain known as the Third Carlist War, Nicasio Landa, a medical officer with Military Health, wrote a report requesting authorization for the Spanish Red Cross, of which he was Inspector General, to adopt a new elastic suspension system for stretchers that he had designed, developed and tested. Intended above all for use in farm wagons - still the most widely-used method of transporting the wounded at the time - it was an inexpensive, sturdy mechanism that improved patient comfort and could also be installed in ambulance carriages, railway carriages and hospital ships. An annotated version of the report is included, preceded by a presentation of its contents. PMID:27557360

  19. Frequency conversion of high-intensity, femtosecond laser pulses

    SciTech Connect

    Banks, P S

    1997-06-01

    Almost since the invention of the laser, frequency conversion of optical pulses via non- linear processes has been an area of active interest. However, third harmonic generation using ~(~1 (THG) in solids is an area that has not received much attention because of ma- terial damage limits. Recently, the short, high-intensity pulses possible with chirped-pulse amplification (CPA) laser systems allow the use of intensities on the order of 1 TW/cm2 in thin solids without damage. As a light source to examine single-crystal THG in solids and other high field inter- actions, the design and construction of a Ti:sapphire-based CPA laser system capable of ultimately producing peak powers of 100 TW is presented. Of special interest is a novel, all-reflective pulse stretcher design which can stretch a pulse temporally by a factor of 20,000. The stretcher design can also compensate for the added material dispersion due to propagation through the amplifier chain and produce transform-limited 45 fs pulses upon compression. A series of laser-pumped amplifiers brings the peak power up to the terawatt level at 10 Hz, and the design calls for additional amplifiers to bring the power level to the 100 TW level for single shot operation. The theory for frequency conversion of these short pulses is presented, focusing on conversion to the third harmonic in single crystals of BBO, KD*P, and d-LAP (deuterated I-arginine phosphate). Conversion efficiencies of up to 6% are obtained with 500 fs pulses at 1053 nm in a 3 mm thick BBO crystal at 200 GW/cm 2. Contributions to this process by unphasematched, cascaded second harmonic generation and sum frequency generation are shown to be very significant. The angular relationship between the two orders is used to measure the tensor elements of C = xt3)/4 with Crs = -1.8 x 1O-23 m2/V2 and .15Cri + .54Crs = 4.0 x 1O-23 m2/V2. Conversion efficiency in d-LAP is about 20% that in BBO and conversion efficiency in KD*P is 1% that of BBO. It is calculated

  20. Modulators of cyclic AMP systems.

    PubMed

    Hess, S M; Chasin, M; Free, C A; Harris, D N

    1975-01-01

    On the basis of the data reported here, one may conclude that although many agents that act in the central nervous system are modulators of the action of cyclic AMP, it is difficult to establish a direct connection between the pharmacologic activity and the levels of cyclic AMP in the brain. This lack of interrelation applies to the benzodiazepines as well as to the pyrazolopyridines. The data for members of the latter group are somewhat frustrating in this regard, since an excellent correlation has been shown to exist between the potency of inhibition of PDE and activity in the antianxiety test. In measurements of steroidogenesis in the isolated adrenal cell, the correlation between activity in vito and the conflict assay is even better. The data presented here and reported elsewhere (Shimizu et al., 1974; Kelly et al., 1974; Mayer and King, 1974; King and Mayer, 1974) provide evidence that agents that act as inhibitors of PDE in cell-free systems exert their influence on cyclic AMP in tissue slices of the brain of guinea pigs by mechanisms that seem not to be related to an effect on PDE. Papaverine, and possibly chlordiazepoxide, may act by releasing agonists that, in turn, stimulate the accumulation of cyclic AMP. This activity is blocked bo other inhibitors of PDE, such as theophyline. Results obtained by the use of platelets are refreshingly clear. Inhibition of aggregation has been shown to occur when the level of cyclic AMP is raised, and a suggestive exists that the most potent inhibitors of platelet PDE are the best potentiators of the action of PGE1 in blocking aggregation. The study utilizing drugs collected from a large number of therapeutic classes makes clear that it is difficult to attribute the mechanism of action for any of the classes studied to modulation of cyclic AMP. An unexpected finding of this study, however, was the fact that pharmacologic agents include an unusually large number of inhibitors of PDE as compared with agents chosen at

  1. Stretching of Picosecond Laser Pulses with Uniform Reflecting Volume Bragg Gratings

    NASA Astrophysics Data System (ADS)

    Mokhov, Sergiy

    It is shown that a uniform reflecting volume Bragg grating (VBG) can be used as a compact monolithic stretcher of high-power picosecond laser pulses in cases when chirped Bragg gratings with an appropriate chirp rate are difficult to fabricate. A chirp-free reflected stretched pulse is generated of almost rectangular shape when incident short pulse propagates along a grating and experiences local Bragg diffraction. The increase in duration of the reflected pulse is approximately equal to twice the propagation times along the grating. We derived the analytic expression for diffraction efficiency, which incorporates incident pulse duration, grating thickness, and amplitude of refractive index modulation, enabling an optimum selection of the grating for pulse stretching. The typical expected theoretical value of diffraction efficiency is about 10% after taking into account the spectral narrowing of the reflected emission. We believe that the relatively low energy efficiency of the proposed method is more than offset by a number of advantages, which are chirp-free spectrum of a stretched pulse, compactness, robustness, preservation of setup alignment and beam quality, and tolerance to high power. Obtained pulses of several tens of picoseconds can be amplified by standard methods which are not requiring special measures to avoid undesirable non-linear effects. We propose a simple and reliable method to control the temporal parameters of the high-power picosecond pulses using the same laser source and the VGB of variable thickness that can significantly simplify the experiments requiring different pulse durations.

  2. Amps particle accelerator definition study

    NASA Technical Reports Server (NTRS)

    Sellen, J. M., Jr.

    1975-01-01

    The Particle Accelerator System of the AMPS (Atmospheric, Magnetospheric, and Plasmas in Space) payload is a series of charged particle accelerators to be flown with the Space Transportation System Shuttle on Spacelab missions. In the configuration presented, the total particle accelerator system consists of an energetic electron beam, an energetic ion accelerator, and both low voltage and high voltage plasma acceleration devices. The Orbiter is illustrated with such a particle accelerator system.

  3. Agile manufacturing prototyping system (AMPS)

    SciTech Connect

    Garcia, P.

    1998-05-09

    The Agile Manufacturing Prototyping System (AMPS) is being integrated at Sandia National Laboratories. AMPS consists of state of the industry flexible manufacturing hardware and software enhanced with Sandia advancements in sensor and model based control; automated programming, assembly and task planning; flexible fixturing; and automated reconfiguration technology. AMPS is focused on the agile production of complex electromechanical parts. It currently includes 7 robots (4 Adept One, 2 Adept 505, 1 Staubli RX90), conveyance equipment, and a collection of process equipment to form a flexible production line capable of assembling a wide range of electromechanical products. This system became operational in September 1995. Additional smart manufacturing processes will be integrated in the future. An automated spray cleaning workcell capable of handling alcohol and similar solvents was added in 1996 as well as parts cleaning and encapsulation equipment, automated deburring, and automated vision inspection stations. Plans for 1997 and out years include adding manufacturing processes for the rapid prototyping of electronic components such as soldering, paste dispensing and pick-and-place hardware.

  4. Pseudomonas aeruginosa β-lactamase induction requires two permeases, AmpG and AmpP

    PubMed Central

    2010-01-01

    Background In Enterobacteriaceae, β-lactam antibiotic resistance involves murein recycling intermediates. Murein recycling is a complex process with discrete steps taking place in the periplasm and the cytoplasm. The AmpG permease is critical to this process as it transports N-acetylglucosamine anhydrous N-acetylmuramyl peptides across the inner membrane. In Pseudomonadaceae, this intrinsic mechanism remains to be elucidated. Since the mechanism involves two cellular compartments, the characterization of transporters is crucial to establish the link. Results Pseudomonas aeruginosa PAO1 has two ampG paralogs, PA4218 (ampP) and PA4393 (ampG). Topology analysis using β-galactosidase and alkaline phosphatase fusions indicates ampP and ampG encode proteins which possess 10 and 14 transmembrane helices, respectively, that could potentially transport substrates. Both ampP and ampG are required for maximum expression of β-lactamase, but complementation and kinetic experiments suggest they act independently to play different roles. Mutation of ampG affects resistance to a subset of β-lactam antibiotics. Low-levels of β-lactamase induction occur independently of either ampP or ampG. Both ampG and ampP are the second members of two independent two-gene operons. Analysis of the ampG and ampP operon expression using β-galactosidase transcriptional fusions showed that in PAO1, ampG operon expression is β-lactam and ampR-independent, while ampP operon expression is β-lactam and ampR-dependent. β-lactam-dependent expression of the ampP operon and independent expression of the ampG operon is also dependent upon ampP. Conclusions In P. aeruginosa, β-lactamase induction occurs in at least three ways, induction at low β-lactam concentrations by an as yet uncharacterized pathway, at intermediate concentrations by an ampP and ampG dependent pathway, and at high concentrations where although both ampP and ampG play a role, ampG may be of greater importance. Both ampP and amp

  5. Autophosphorylation and rapid dephosphorylation of the cAMP-dependent protein kinase from Blastocladiella emersonii zoospores.

    PubMed

    Gomes, S L; Juliani, M H; da Costa Maia, J C; Rangel-Aldao, R

    1983-06-10

    The photoaffinity label 8-azido[32P]adenosine 3':5'-monophosphate and affinity chromatography on N6-(2-aminoethyl)-cAMP-Sepharose were used to analyze the cAMP-binding proteins present in cell-free extracts of Blastocladiella emersonii zoospores. In the presence of a mixture of protease inhibitors, 8-azido[32P]cAMP was specifically and quantitatively incorporated into a major protein band of Mr = 58,000, and three minor protein bands of Mr = 50,000, Mr = 43,000, and Mr = 36,000 respectively, after autoradiography following sodium dodecyl sulfate-polyacryl-amide gel electrophoresis. In the absence of the protease inhibitors, the Mr = 58,000 protein band was converted into the lower molecular weight cAMP-binding proteins, indicating a high sensitivity of the intact Mr = 58,000 protein band to endogenous proteases. The Mr = 58,000 protein corresponded to the regulatory subunit (R), of the cAMP-dependent protein kinase of zoospores, as shown by their identical behavior on DEAE-cellulose chromatography. The partially purified protein kinase incorporated 32P from [gamma-32P] ATP . Mg2+ into R as demonstrated by the specific adsorption of the 32P-labeled protein with N6-(2-aminoethyl)-cAMP-Sepharose. The incorporated 32P group was rapidly removed by endogenous phosphoprotein phosphatases in the presence of cAMP, as shown by pulse-chase experiments with [gamma-32P]ATP. Dephosphorylation of R-cAMP and rapid proteolysis may indicate two other mechanisms, in addition to cAMP, for the control of this protein kinase in vivo. PMID:6304069

  6. Modeling and simulation of ultra-short pulse amplification

    NASA Astrophysics Data System (ADS)

    Pflaum, Christoph; Hartmann, Rainer; Rahimi, Zhabiz

    2016-03-01

    Ultra-short pulses with high average power are required for a variety of technical and medical applications. Single, multi-pass, and regenerative amplifiers are used, in order to increase the power of ultra-short lasers. Typical laser crystals for such amplifiers include Ti:Sapphire or Yb:YAG laser crystals. Difficulties in the amplification of ultra-short pulses include gain narrowing effects and dispersion effects in the laser crystal. In particular, these complications arise, when a pulse stretcher is needed before amplification of the laser beam. We present a technique to model and simulate the amplification of ultra-short pulses. This technique allows to model both gain narrowing effects and decrease of beam quality caused by amplification of the laser beam. This requires a detailed 3-dimensional simulation of population inversion. Gain narrowing effects are taken into account by analyzing the gain of the spectrum of the laser beam. It is important to distinguish amplifiers with one or only two passes and a regenerative amplifier. These two different kind of amplifiers are modeled by different approaches. A regenerative amplifier is modeled by a set of time dependent rate equations. However, a single pass amplifier is modeled by a set of spatial dependent rate equations. In both cases, a system of rate equations arises from spectral discretization of the laser beam. Detailed simulation results are presented.

  7. High-repetition-rate chirped-pulse-amplification thin-disk laser system with joule-level pulse energy.

    PubMed

    Tümmler, J; Jung, R; Stiel, H; Nickles, P V; Sandner, W

    2009-05-01

    We are reporting on the development of a diode-pumped chirped-pulse-amplification (CPA) laser system based on Yb:YAG thin-disk technology with a repetition rate of 100 Hz and output pulse energy in the joule range. The focus lies with the first results of the preamplifier--a regenerative amplifier (RA) and a multipass amplifier (MP). The system consists of a front end including the CPA stretcher followed by an amplifier chain based on Yb:YAG thin-disk amplifiers and the CPA compressor. It is developed in the frame of our x-ray laser (XRL) program and fulfills all requirements for pumping a plasma-based XRL in grazing incidence pumping geometry. Of course it can also be used for other interesting applications. With the RA pulse energies of more than 165 mJ can be realized. At a repetition rate of 100 Hz a stability of 0.8% (1sigma) over a period of more than 45 min has been measured. The optical-to-optical efficiency is 14%. The following MP amplifier can increase the pulse energy to more than 300 mJ. A nearly bandwidth-limited recompression to less than 2 ps could be demonstrated. PMID:19412278

  8. Distinct potentiation of L-type currents and secretion by cAMP in rat chromaffin cells.

    PubMed

    Carabelli, V; Giancippoli, A; Baldelli, P; Carbone, E; Artalejo, A R

    2003-08-01

    We have investigated the potentiating action of cAMP on L-currents of rat chromaffin cells and the corresponding increase of Ca(2+)-evoked secretory responses with the aim of separating the action of cAMP on Ca(2+) entry through L-channels and the downstream effects of cAMP/protein kinase A (PKA) on exocytosis. In omega-toxin-treated rat chromaffin cells, exposure to the permeable cAMP analog 8-(4-chlorophenylthio)-adenosine 3',5'-monophosphate (pCPT-cAMP; 1 mM, 30 min) caused a moderate increase of Ca(2+) charge carried through L-channels (19% in 10 mM Ca(2+) at +10 mV) and a drastic potentiation of secretion ( approximately 100%), measured as membrane capacitance increments (deltaC). The apparent Ca(2+) dependency of exocytosis increased with pCPT-cAMP and was accompanied by 83% enhancement of the readily releasable pool of vesicles with no significant change of the probability of release, as evaluated with paired-pulse stimulation protocols. pCPT-cAMP effects could be mimicked by stimulation of beta(1)-adrenoreceptors and reversed by the PKA inhibitor H89, suggesting strict PKA dependence. For short pulses to +10 mV (100 ms), potentiation of exocytosis by pCPT-cAMP was proportional to the quantity of charge entering the cell and occurred independently of whether L, N, or P/Q channels were blocked, suggesting that cAMP acts as a constant amplification factor for secretion regardless of the channel type carrying Ca(2+). Analysis of statistical variations among depolarization-induced capacitance increments indicates that pCPT-cAMP acts downstream of Ca(2+) entry by almost doubling the mean size of unitary exocytic events, most likely as a consequence of an increased granule-to-granule rather than a granule-to-membrane fusion. PMID:12885675

  9. Distinct Potentiation of L-Type Currents and Secretion by cAMP in Rat Chromaffin Cells

    PubMed Central

    Carabelli, V.; Giancippoli, A.; Baldelli, P.; Carbone, E.; Artalejo, A. R.

    2003-01-01

    We have investigated the potentiating action of cAMP on L-currents of rat chromaffin cells and the corresponding increase of Ca2+-evoked secretory responses with the aim of separating the action of cAMP on Ca2+ entry through L-channels and the downstream effects of cAMP/protein kinase A (PKA) on exocytosis. In ω-toxin-treated rat chromaffin cells, exposure to the permeable cAMP analog 8-(4-chlorophenylthio)-adenosine 3′,5′-monophosphate (pCPT-cAMP; 1 mM, 30 min) caused a moderate increase of Ca2+ charge carried through L-channels (19% in 10 mM Ca2+ at +10 mV) and a drastic potentiation of secretion (∼100%), measured as membrane capacitance increments (ΔC). The apparent Ca2+ dependency of exocytosis increased with pCPT-cAMP and was accompanied by 83% enhancement of the readily releasable pool of vesicles with no significant change of the probability of release, as evaluated with paired-pulse stimulation protocols. pCPT-cAMP effects could be mimicked by stimulation of β1-adrenoreceptors and reversed by the PKA inhibitor H89, suggesting strict PKA dependence. For short pulses to +10 mV (100 ms), potentiation of exocytosis by pCPT-cAMP was proportional to the quantity of charge entering the cell and occurred independently of whether L, N, or P/Q channels were blocked, suggesting that cAMP acts as a constant amplification factor for secretion regardless of the channel type carrying Ca2+. Analysis of statistical variations among depolarization-induced capacitance increments indicates that pCPT-cAMP acts downstream of Ca2+ entry by almost doubling the mean size of unitary exocytic events, most likely as a consequence of an increased granule-to-granule rather than a granule-to-membrane fusion. PMID:12885675

  10. Pulse compression of a high-power thin disk laser using rod-type fiber amplifiers.

    PubMed

    Saraceno, C J; Heckl, O H; Baer, C R E; Südmeyer, T; Keller, U

    2011-01-17

    We report on two pulse compressors for a high-power thin disk laser oscillator using rod-type fiber amplifiers. Both systems are seeded by a standard SESAM modelocked thin disk laser that delivers 16 W of average power at a repetition rate of 10.6 MHz with a pulse energy of 1.5 μJ and a pulse duration of 1 ps. We discuss two results with different fiber parameters with different trade-offs in pulse duration, average power, damage and complexity. The first amplifier setup consists of a Yb-doped fiber amplifier with a 2200 μm2 core area and a length of 55 cm, resulting in a compressed average power of 55 W with 98-fs pulses at a repetition rate of 10.6 MHz. The second system uses a shorter 36-cm fiber with a larger core area of 4500 μm2. In a stretcher-free configuration we obtained 34 W of compressed average power and 65-fs pulses. In both cases peak powers of > 30 MW were demonstrated at several μJ pulse energies. The power scaling limitations due to damage and self-focusing are discussed. PMID:21263681

  11. Visualization of high-order dispersion for compression of few-cycle pulses

    NASA Astrophysics Data System (ADS)

    Zheng, Jiaan; Kobayashi, Wataru; Hamann, Thomas; Nürenberg, Daniel; Lührmann, Markus; L'huillier, Johannes A.; Wallenstein, Richard; Zacharias, Helmut

    2014-09-01

    We present a visually intuitive method for higher-order dispersion compensation based on multi-photon interpulse interference pulse scans. The dispersion values obtained from these scans are fed back as a correction to an acousto-optical programmable dispersive filter to compensate residual higher-order dispersions up to fifth order. This method is applied to the dispersion management of a non-collinear optical parametric chirped-pulse amplifier. A grism-pair stretcher is designed based on a global dispersion balance which provides a large stretching factor and supports a spectral bandwidth of up to 320 nm. It is implemented in a two-stage three-pass non-collinear optical parametric chirped-pulse amplifier and stretches 6-fs seed pulses to about 80 ps from 700 to 1,000 nm. The amplified pulses are compressed by material dispersion. Pulses of less than 10-fs duration with a pulse energy of 125 μJ are obtained at 20-kHz repetition rate.

  12. The AzTEC Mathematics Project (AMP).

    ERIC Educational Resources Information Center

    Johnson, Gae R.

    The AzTEC Mathematics Project (AMP) is a statewide partnership among Arizona's Regents universities and state community colleges, partner school districts, and economic communities. AzTec is committed to preparing highly qualified K-12 mathematics and science teachers. AMP targeted Native American teachers and teachers of Native American students…

  13. The dependence of Escherichia coli asparaginase II formation on cyclic AMP and cyclic AMP receptor protein.

    PubMed

    Russell, L; Yamazaki, H

    1978-05-01

    The amount of asparaginase II in an Escherichia coli wild-type strain (cya+, crp+) markedly increased upon a shift from aerobic to anaerobic growth. However, no such increase occurred in a mutant (cya) lacking cyclic AMP synthesis unless supplemented with exogenous cyclic AMP. Since a mutant (crp) deficient in cyclic AMP receptor protein also did not support the anaerobic formation of this enzyme, it is concluded that the formation of E. coli asparaginase II depends on both cyclic AMP and cyclic AMP receptor protein. PMID:207402

  14. Cyclic di-AMP mediates biofilm formation.

    PubMed

    Peng, Xian; Zhang, Yang; Bai, Guangchun; Zhou, Xuedong; Wu, Hui

    2016-03-01

    Cyclic di-AMP (c-di-AMP) is an emerging second messenger in bacteria. It has been shown to play important roles in bacterial fitness and virulence. However, transduction of c-di-AMP signaling in bacteria and the role of c-di-AMP in biofilm formation are not well understood. The level of c-di-AMP is modulated by activity of di-adenylyl cyclase that produces c-di-AMP and phosphodiesterase (PDE) that degrades c-di-AMP. In this study, we determined that increased c-di-AMP levels by deletion of the pdeA gene coding for a PDE promoted biofilm formation in Streptococcus mutans. Deletion of pdeA upregulated expression of gtfB, the gene coding for a major glucan producing enzyme. Inactivation of gtfB blocked the increased biofilm by the pdeA mutant. Two c-di-AMP binding proteins including CabPA (SMU_1562) and CabPB (SMU_1708) were identified. Interestingly, only CabPA deficiency inhibited both the increased biofilm formation and the upregulated expression of GtfB observed in the pdeA mutant. In addition, CabPA but not CabPB interacted with VicR, a known transcriptional factor that regulates expression of gtfB, suggesting that a signaling link between CabPA and GtfB through VicR. Increased biofilm by the pdeA deficiency also enhanced bacterial colonization of Drosophila in vivo. Taken together, our studies reveal a new role of c-di-AMP in mediating biofilm formation through a CabPA/VicR/GtfB signaling network in S. mutans. PMID:26564551

  15. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC

    PubMed Central

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  16. Three Yersinia enterocolitica AmpD Homologs Participate in the Multi-Step Regulation of Chromosomal Cephalosporinase, AmpC.

    PubMed

    Liu, Chang; Wang, Xin; Chen, Yuhuang; Hao, Huijing; Li, Xu; Liang, Junrong; Duan, Ran; Li, Chuchu; Zhang, Jing; Shao, Shihe; Jing, Huaiqi

    2016-01-01

    In many gram negative bacilli, AmpD plays a key role in both cell well-recycling pathway and β-lactamase regulation, inactivation of the ampD causes the accumulation of 1,6-anhydromuropeptides, and results in the ampC overproduction. In Yersinia enterocolitica, the regulation of ampC expression may also rely on the ampR-ampC system, the role of AmpD in this species is still unknown. In this study, three AmpD homologs (AmpD1, AmpD2, and AmpD3) have been identified in complete sequence of strain Y. enterocolitica subsp. palearctica 105.5R(r). To understand the role of three AmpD homologs, several mutant strains were constructed and analyzed where a rare ampC regulation mechanism was observed: low-effective ampD2 and ampD3 cooperate with the high-effective ampD1 in the three levels regulation of ampC expression. Enterobacteriaceae was used to be supposed to regulate ampC expression by two steps, three steps regulation was only observed in Pseudomonas aeruginosa. In this study, we first reported that Enterobacteriaceae Y. enterocolitica can also possess a three steps stepwise regulation mechanism, regulating the ampC expression precisely. PMID:27588018

  17. Discovery of a cAMP Deaminase That Quenches Cyclic AMP-Dependent Regulation

    PubMed Central

    Goble, Alissa M.; Feng, Youjun; Raushel, Frank M.; Cronan, John E.

    2013-01-01

    An enzyme of unknown function within the amidohydrolase superfamily was discovered to catalyze the hydrolysis of the universal second messenger, cyclic-3’, 5’-adenosine monophosphate (cAMP). The enzyme, which we have named CadD, is encoded by the human pathogenic bacterium Leptospira interrogans. Although CadD is annotated as an adenosine deaminase, the protein specifically deaminates cAMP to cyclic-3’, 5’-inosine monophosphate (cIMP) with a kcat/Km of 2.7 ± 0.4 × 105 M−1 s−1 and has no activity on adenosine, adenine, or 5’-adenosine monophosphate (AMP). This is the first identification of a deaminase specific for cAMP. Expression of CadD in Escherichia coli mimics the loss of adenylate cyclase in that it blocks growth on carbon sources that require the cAMP-CRP transcriptional activator complex for expression of the cognate genes. The cIMP reaction product cannot replace cAMP as the ligand for CRP binding to DNA in vitro and cIMP is a very poor competitor of cAMP activation of CRP for DNA binding. Transcriptional analyses indicate that CadD expression represses expression of several cAMP-CRP dependent genes. CadD adds a new activity to the cAMP metabolic network and may be a useful tool in intracellular study of cAMP-dependent processes. PMID:24074367

  18. High-energy, kHz, picosecond hybrid Yb-doped chirped-pulse amplifier.

    PubMed

    Chang, Chun-Lin; Krogen, Peter; Hong, Kyung-Han; Zapata, Luis E; Moses, Jeffrey; Calendron, Anne-Laure; Liang, Houkun; Lai, Chien-Jen; Stein, Gregory J; Keathley, Phillip D; Laurent, Guillaume; Kärtner, Franz X

    2015-04-20

    We report on a diode-pumped, hybrid Yb-doped chirped-pulse amplification (CPA) laser system with a compact pulse stretcher and compressor, consisting of Yb-doped fiber preamplifiers, a room-temperature Yb:KYW regenerative amplifier (RGA), and cryogenic Yb:YAG multi-pass amplifiers. The RGA provides a relatively broad amplification bandwidth and thereby a long pulse duration to mitigate B-integral in the CPA chain. The ~1030-nm laser pulses are amplified up to 70 mJ at 1-kHz repetition rate, currently limited by available optics apertures, and then compressed to ~6 ps with high efficiency. The near-diffraction-limited beam focusing quality is demonstrated with M(x)(2) = 1.1 and M(y)(2) = 1.2. The shot-to-shot energy fluctuation is as low as ~1% (rms), and the long-term energy drift and beam pointing stability for over 8 hours measurement are ~3.5% and <6 μrad (rms), respectively. To the best of our knowledge, this hybrid laser system produces the most energetic picosecond pulses at kHz repetition rates among rod-type laser amplifiers. With an optically synchronized Ti:sapphire seed laser, it provides a versatile platform optimized for pumping optical parametric chirped-pulse amplification systems as well as driving inverse Compton scattered X-rays. PMID:25969056

  19. Chirped pulse amplification of a dissipative soliton thulium-doped fiber laser

    NASA Astrophysics Data System (ADS)

    Tan, Fangzhou; Shi, Hongxing; Wang, Peng; Liu, Jiang; Wang, Pu

    2016-03-01

    We demonstrate on chirped pulse amplification of a dissipative soliton thulium-doped fiber laser. The system consists of an all-fiber seed laser, a fiber-based stretcher, two-stage fiber amplifier and a free space grating compressor. The oscillator works in the normal dispersion regime and delivers up-chirped pulses with output power of 3 mW at repetition rate of 29.3 MHz. The spectrum of the seed laser is located at 1938 nm with a 10 dB bandwidth of 50 nm. The output pulses are directly stretched in ~50 m normal dispersion fiber to 72 ps pulse duration. In the pre-amplifier and power amplifier, both forward pumping and backward pumping are tested in the experiment. Output power of 7 W has been achieved in the power amplifier with backward pumping corresponding to a pulse energy of 239 nJ, which has an amplification slope efficiency of 37.8%. The PER at the highest average output power was measured to be 19.5 dB. The amplified up-chirped pulses could be dechirped to a duration time of 121 fs with energy of 161 nJ using a pair of fused silica transmission gratings.

  20. Electrical Stimulation Decreases Coupling Efficiency Between Beta-Adrenergic Receptors and Cyclic AMP Production in Cultured Muscle Cells

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.

    1999-01-01

    Electrical stimulation of skeletal muscle cells in culture is an effective way to simulate the effects of muscle contraction and its effects on gene expression in muscle cells. Expression of the beta-adrenergic receptor and its coupling to cyclic AMP synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this project was to determine if electrical stimulation altered the beta-adrenergic response in muscle cells. Chicken skeletal muscle cells that had been grown for seven days in culture were subjected to electrical stimulation for an additional two days at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. At the end of this two-day stimulation period, beta-adrenergic receptor population was measured by the binding of tritium-labeled CGP-12177 to muscle cells, and coupling to cAMP synthesis was measured by Radioimmunoassay (RIA) after treating the cells for 10 min with the potent (beta)AR agonist, isoproterenol. The number of beta adrenergic receptors and the basal levels of intracellular cyclic AMP were not affected by electrical stimulation. However, the ability of these cells to synthesize cyclic AMP was reduced by approximately 50%. Thus, an enhanced level of contraction reduces the coupling efficiency of beta-adrenergic receptors for cyclic AMP production.

  1. Pulse Oximetry

    MedlinePlus

    ... www.thoracic.org amount of gases (oxygen and carbon dioxide) that are in your blood. To get an ... Also, a pulse oximeter does not measure your carbon dioxide level. How accurate is the pulse oximeter? The ...

  2. C++ Coding Standards for the AMP Project

    SciTech Connect

    Evans, Thomas M; Clarno, Kevin T

    2009-09-01

    This document provides an initial starting point to define the C++ coding standards used by the AMP nuclear fuel performance integrated code project and a part of AMP's software development process. This document draws from the experiences, and documentation [1], of the developers of the Marmot Project at Los Alamos National Laboratory. Much of the software in AMP will be written in C++. The power of C++ can be abused easily, resulting in code that is difficult to understand and maintain. This document gives the practices that should be followed on the AMP project for all new code that is written. The intent is not to be onerous but to ensure that the code can be readily understood by the entire code team and serve as a basis for collectively defining a set of coding standards for use in future development efforts. At the end of the AMP development in fiscal year (FY) 2010, all developers will have experience with the benefits, restrictions, and limitations of the standards described and will collectively define a set of standards for future software development. External libraries that AMP uses do not have to meet these requirements, although we encourage external developers to follow these practices. For any code of which AMP takes ownership, the project will decide on any changes on a case-by-case basis. The practices that we are using in the AMP project have been in use in the Denovo project [2] for several years. The practices build on those given in References [3-5]; the practices given in these references should also be followed. Some of the practices given in this document can also be found in [6].

  3. AmpC β-Lactamases

    PubMed Central

    Jacoby, George A.

    2009-01-01

    Summary: AmpC β-lactamases are clinically important cephalosporinases encoded on the chromosomes of many of the Enterobacteriaceae and a few other organisms, where they mediate resistance to cephalothin, cefazolin, cefoxitin, most penicillins, and β-lactamase inhibitor-β-lactam combinations. In many bacteria, AmpC enzymes are inducible and can be expressed at high levels by mutation. Overexpression confers resistance to broad-spectrum cephalosporins including cefotaxime, ceftazidime, and ceftriaxone and is a problem especially in infections due to Enterobacter aerogenes and Enterobacter cloacae, where an isolate initially susceptible to these agents may become resistant upon therapy. Transmissible plasmids have acquired genes for AmpC enzymes, which consequently can now appear in bacteria lacking or poorly expressing a chromosomal blaAmpC gene, such as Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis. Resistance due to plasmid-mediated AmpC enzymes is less common than extended-spectrum β-lactamase production in most parts of the world but may be both harder to detect and broader in spectrum. AmpC enzymes encoded by both chromosomal and plasmid genes are also evolving to hydrolyze broad-spectrum cephalosporins more efficiently. Techniques to identify AmpC β-lactamase-producing isolates are available but are still evolving and are not yet optimized for the clinical laboratory, which probably now underestimates this resistance mechanism. Carbapenems can usually be used to treat infections due to AmpC-producing bacteria, but carbapenem resistance can arise in some organisms by mutations that reduce influx (outer membrane porin loss) or enhance efflux (efflux pump activation). PMID:19136439

  4. Inducing coproporphyria in rat hepatocyte cultures using cyclic AMP and cyclic AMP-releasing agents.

    PubMed

    De Matteis, Francesco; Harvey, Carolyn

    2005-07-01

    Cyclic AMP (c-AMP), added on its own to rat hepatocyte cultures, caused a marked accumulation of coproporphyrin III. The results obtained by comparing the effect of c-AMP to that of exogenous 5-aminolevulinate (ALA), and from adding c-AMP and ALA together, indicated that the coproporphyrinogen III metabolism was blocked, even though no inhibition of the relevant enzyme, coproporphyrinogen oxidase, could be demonstrated. Preferential accumulation of coproporphyrin could also be produced in cultures of rat hepatocytes by agents that raise the cellular levels of cyclic AMP, such as glucagon. The effect of supplementing the culture medium with triiodothyronine (T3) on the response of rat hepatocytes to c-AMP was also investigated. T3, which is known to stimulate mitochondrial respiration, uncoupling O2 consumption from ATP synthesis, produced a c-AMP-like effect when given on its own and potentiated the effect of c-AMP, with an apparent increase in the severity of the metabolic block. It is suggested that an oxidative mechanism may be activated in c-AMP and T3-induced coproporphyria, preferentially involving the mitochondrial compartment, leading to oxidation of porphyrinogen intermediates of haem biosynthesis, especially coproporphyrinogen. Coproporphyin, the fully oxidized aromatic derivative produced, cannot be metabolized and will therefore accumulate. PMID:15902420

  5. SLAC collider injector, RF-drive synchronization and trigger electronics, and 15-AMP thermionic-gun development

    SciTech Connect

    Koontz, R.; Miller, R.; McKinney, T.; Wilmunder, A.

    1981-02-01

    The rf drive system for the Collider Injector Development (EL CID) including laser timing, subharmonic buncher drive and phasing, and accelerator rf drive is described. The rf synchronized master trigger generation scheme for the collider is outlined. Also, a 15 amp peak, 200 kV short pulse gun being developed at SLAC as a backup to the Sinclair laser gun is described.

  6. PULSE GENERATOR

    DOEpatents

    Roeschke, C.W.

    1957-09-24

    An improvement in pulse generators is described by which there are produced pulses of a duration from about 1 to 10 microseconds with a truly flat top and extremely rapid rise and fall. The pulses are produced by triggering from a separate input or by modifying the current to operate as a free-running pulse generator. In its broad aspect, the disclosed pulse generator comprises a first tube with an anode capacitor and grid circuit which controls the firing; a second tube series connected in the cathode circuit of the first tube such that discharge of the first tube places a voltage across it as the leading edge of the desired pulse; and an integrator circuit from the plate across the grid of the second tube to control the discharge time of the second tube, determining the pulse length.

  7. FY07 LDRD Final Report Precision, Split Beam, Chirped-Pulse, Seed Laser Technology

    SciTech Connect

    Dawson, J W; Messerly, M J; Phan, H H; Crane, J K; Beach, R J; Siders, C W; Barty, C J

    2009-11-12

    The goal of this LDRD ER was to develop a robust and reliable technology to seed high-energy laser systems with chirped pulses that can be amplified to kilo-Joule energies and recompressed to sub-picosecond pulse widths creating extremely high peak powers suitable for petawatt class physics experiments. This LDRD project focused on the development of optical fiber laser technologies compatible with the current long pulse National Ignition Facility (NIF) seed laser. New technologies developed under this project include, high stability mode-locked fiber lasers, fiber based techniques for reduction of compressed pulse pedestals and prepulses, new compact stretchers based on chirped fiber Bragg gratings (CFBGs), new techniques for manipulation of chirped pulses prior to amplification and new high-energy fiber amplifiers. This project was highly successful and met virtually all of its goals. The National Ignition Campaign has found the results of this work to be very helpful. The LDRD developed system is being employed in experiments to engineer the Advanced Radiographic Capability (ARC) front end and the fully engineered version of the ARC Front End will employ much of the technology and techniques developed here.

  8. Simultaneous visible and near-infrared emission from a pulse-stretched alexandrite laser source

    NASA Astrophysics Data System (ADS)

    Boczar, Bruce; Thevar, Thanga; Rousseva, Ivelina; Kramer, Norman; Pryor, Brian; Frost, Rick

    2004-07-01

    An efficient method to make multi-spectral laser light having any selected pulsed duration in the range of 100 ns to 1 μs has been demonstrated in the laboratory. This laser system, based on the alexandrite tunable solid-state gain medium, which is tunable in its fundamental between 720 and 800 nm, was constructed near the gain maximum of 755 nm. A novel intracavity pulse-stretcher provides control of the pulse duration up to about 5 μs using the Pockels effect. In the demonstration prototype, however, the pulse duration was restricted to 500 ns to maintain the peak power needed for efficient nonlinear conversion. Following an amplification stage, Raman shifting in hydrogen gas was used to achieve efficient wavelength conversion to 1100 nm. The Raman shifted beam was frequency doubled to 550 nm using two BBO crystals arranged for walk-off compensation. The result was a convenient source of light whose spectral content, pulse duration, as well as other parameters, could be critically controlled.

  9. Atmospheric, Magnetospheric and Plasmas in space (AMPS) spacelab payload definition study. Volume 4. Part 1, AMPS program specification

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    The AMPS Program Specification delineates the AMPS Program requirements consistent with the resources defined in the AMPS Project Plan. All subsidiary specifications and requirements shall conform to the requirements presented. The requirements hierarchy for the AMPS program is illustrated. A brief description of each of the requirements documents and their intended use is provided.

  10. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein.

    PubMed

    Underwood, Adam J; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-12-01

    Cyclic di-AMP (c-di-AMP) is a recently recognized bacterial signaling molecule. In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed using a novel pneumococcal c-di-AMP binding protein (CabP). With this method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. PMID:25239824

  11. Pulsed power

    NASA Astrophysics Data System (ADS)

    Stone, David H.

    Pulsed power systems are critical elements for such prospective weapons technologies as high-power microwaves, electrothermal and electromagnetic projectile launchers, neutral particle beams, space-based FELs, ground-based lasers, and charged particle beams. Pulsed power will also be essential for the development of nonweapon military systems such as lidars and ultrawideband radars, and could serve as the bases for nuclear weapon effect simulators. The pulsed power generation requirements for each of these systems is considered.

  12. Pulse Voltammetry

    NASA Astrophysics Data System (ADS)

    Stojek, Zbigniew

    The idea of imposing potential pulses and measuring the currents at the end of each pulse was proposed by Barker in a little-known journal as early as in 1958 [1]. However, the first reliable trouble-free and affordable polarographs offering voltammetric pulse techniques appeared on the market only in the 1970s. This delay was due to some limitations on the electronic side. In the 1990s, again substantial progress in electrochemical pulse instrumentation took place. This was related to the introduction of microprocessors, computers, and advanced software.

  13. Highly Efficient Tabletop Optical Parametric Chirped Pulse Amplifier at 1 (micron)m

    SciTech Connect

    Jovanovic, I.; Ebbers, C.A.; Comaskey, B.J.; Bonner, R.A.; Morse, E.C.

    2001-12-04

    Optical parametric chirped pulse amplification (OPCPA) is a scalable technology, for ultrashort pulse amplification. Its major advantages include design simplicity, broad bandwidth, tunability, low B-integral, high contrast, and high beam quality. OPCPA is suitable both for scaling to high peak power as well as high average power. We describe the amplification of stretched 100 fs oscillator pulses in a three-stage OPCPA system pumped by a commercial, single-longitudinal-mode, Q-switched Nd:YAG laser. The stretched pulses were centered around 1054 nm with a FWHM bandwidth of 16.5 nm and had an energy of 0.5 nJ. Using our OPCPA system, we obtained an amplified pulse energy of up to 31 mJ at a 10 Hz repetition rate. The overall conversion efficiency from pump to signal is 6%, which is the highest efficiency obtained With a commercial tabletop pump laser to date. The overall conversion efficiency is limited due to the finite temporal overlap of the seed (3 ns) with respect to the duration of the pump (8.5 ns). Within the temporal window of the seed pulse the pump to signal conversion efficiency exceeds 20%. Recompression of the amplified signal was demonstrated to 310 fs, limited by the aberrations initially present in the low energy seed imparted by the pulse stretcher. The maximum gain in our OPCPA system is 6 x 10{sup 7}, obtained through single passing of 40 mm of beta-barium borate. We present data on the beam quality obtained from our system (M{sup 2}=1.1). This relatively simple system replaces a significantly more complex Ti:sapphire regenerative amplifier based CPA system used in the front end of a high energy short pulse laser. Future improvement will include obtaining shorter amplified pulses and higher average power.

  14. PULSE AMPLIFIER

    DOEpatents

    Johnstone, C.W.

    1958-06-17

    The improvement of pulse amplifiers used with scintillation detectors is described. The pulse amplifier circuit has the advantage of reducing the harmful effects of overloading cause by large signal inputs. In general the pulse amplifier circuit comprises two amplifier tubes with the input pulses applied to one amplifier grid and coupled to the second amplifier tube through a common cathode load. The output of the second amplifier is coupled from the plate circuit to a cathode follower tube grid and a diode tube in connected from grid to cathode of the cathode follower tube. Degenerative feedback is provided in the second amplifier by coupling a signal from the cathode follower cathode to the second amplifier grid. The circuit proqides moderate gain stability, and overload protection for subsequent pulse circuits.

  15. AMPS/PC - AUTOMATIC MANUFACTURING PROGRAMMING SYSTEM

    NASA Technical Reports Server (NTRS)

    Schroer, B. J.

    1994-01-01

    The AMPS/PC system is a simulation tool designed to aid the user in defining the specifications of a manufacturing environment and then automatically writing code for the target simulation language, GPSS/PC. The domain of problems that AMPS/PC can simulate are manufacturing assembly lines with subassembly lines and manufacturing cells. The user defines the problem domain by responding to the questions from the interface program. Based on the responses, the interface program creates an internal problem specification file. This file includes the manufacturing process network flow and the attributes for all stations, cells, and stock points. AMPS then uses the problem specification file as input for the automatic code generator program to produce a simulation program in the target language GPSS. The output of the generator program is the source code of the corresponding GPSS/PC simulation program. The system runs entirely on an IBM PC running PC DOS Version 2.0 or higher and is written in Turbo Pascal Version 4 requiring 640K memory and one 360K disk drive. To execute the GPSS program, the PC must have resident the GPSS/PC System Version 2.0 from Minuteman Software. The AMPS/PC program was developed in 1988.

  16. Separate roles of PKA and EPAC in renal function unraveled by the optogenetic control of cAMP levels in vivo.

    PubMed

    Efetova, Marina; Petereit, Linda; Rosiewicz, Kamil; Overend, Gayle; Haußig, Florian; Hovemann, Bernhard T; Cabrero, Pablo; Dow, Julian A T; Schwärzel, Martin

    2013-02-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger that regulates a variety of essential processes in diverse cell types, functioning via cAMP-dependent effectors such as protein kinase A (PKA) and/or exchange proteins directly activated by cAMP (EPAC). In an intact tissue it is difficult to separate the contribution of each cAMP effector in a particular cell type using genetic or pharmacological approaches alone. We, therefore, utilized optogenetics to overcome the difficulties associated with examining a multicellular tissue. The transgenic photoactive adenylyl cyclase bPAC can be activated to rapidly and reversibly generate cAMP pulses in a cell-type-specific manner. This optogenetic approach to cAMP manipulation was validated in vivo using GAL4-driven UAS-bPAC in a simple epithelium, the Drosophila renal (Malpighian) tubules. As bPAC was expressed under the control of cell-type-specific promoters, each cAMP signal could be directed to either the stellate or principal cells, the two major cell types of the Drosophila renal tubule. By combining the bPAC transgene with genetic and pharmacological manipulation of either PKA or EPAC it was possible to investigate the functional impact of PKA and EPAC independently of each other. The results of this investigation suggest that both PKA and EPAC are involved in cAMP sensing, but are engaged in very different downstream physiological functions in each cell type: PKA is necessary for basal secretion in principal cells only, and for stimulated fluid secretion in stellate cells only. By contrast, EPAC is important in stimulated fluid secretion in both cell types. We propose that such optogenetic control of cellular cAMP levels can be applied to other systems, for example the heart or the central nervous system, to investigate the physiological impact of cAMP-dependent signaling pathways with unprecedented precision. PMID:23264735

  17. Simultaneous second- and third- order spectral phase control of Ti:sapphire laser pulses using achromatic doublet prisms.

    PubMed

    Mueller, Alexander; Fuerbach, Alexander

    2016-03-20

    The standard technique commonly utilized to introduce large amounts of negative group delay dispersion (GDD) into the beam path of ultrashort laser pulses with low insertion losses is the use of a pair of prisms in a double pass configuration. However, one disadvantage of this approach is the unavoidable introduction of additional high-order spectral phase errors, most notably third-order dispersion (TOD) due to the characteristics of the refractive index of available optical materials. In this paper we provide an overview of the dispersive properties of more than 100 common types of optical glasses, used either as a bulk stretcher or in a prism compressor configuration. In addition, we present a novel method that enables independent control of GDD and TOD in a prism-only setup. The performance of different prism combinations is analyzed numerically, and design guidelines are given. PMID:27140563

  18. cAMP phosphodiesterase and activator protein of mammalian cAMP phosphodiesterase from Trypanosoma cruzi.

    PubMed

    Gonçalves, M F; Zingales, B; Colli, W

    1980-04-01

    Epimastigote forms of Trypanosoma cruzi contain a soluble cAMP phosphodiesterase. Optimal activity was found at pH 8.0 and in the presence of 5 mM Mn2+. Other cations were less efficient and did not give rise to an additional stimulation when added in the presence of optimal concentrations of Mn2+. The enzyme is not Ca2+ dependent. The apparent Km of the enzyme for the substrate is 40 microM and no kinetic evidence for the existence of two enzymes has been found. Theophylline and caffein did not inhibit the T. cruzi cAMP phosphodiesterase. The enzyme activity does not change during cell growth suggesting that the fluctuation observed in the levels of cAMP are largely a response to variations in adenylyl cyclase activity. The intracellular concentrations of cAMP ranged between 0.04--0.15 microM. No evidence that the T. cruzi cAMP phosphodiesterase is regulated by an endogenous activator could be found. However, T. cruzi contains a heat-stable, low molecular weight, non-dialysable protein that activates mammalian cAMP phosphodiesterase in the presence of Ca2+. The properties so far studied of such an activator suggest that it might be equivalent to other Ca2+-dependent regulators described in vertebrate and invertebrate species. PMID:6255327

  19. Pulse Voltammetry.

    ERIC Educational Resources Information Center

    Osteryoung, Janet

    1983-01-01

    Discusses the nature of pulse voltammetry, indicating that its widespread use arises from good sensitivity and detection limits and from ease of application and low cost. Provides analytical and mechanistic applications of the procedure. (JN)

  20. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917.

    PubMed

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin; Zhou, Xianxuan

    2015-11-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. (1)H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  1. Cyclic AMP (cAMP) Receptor Protein-cAMP Complex Regulates Heparosan Production in Escherichia coli Strain Nissle 1917

    PubMed Central

    Yan, Huihui; Bao, Feifei; Zhao, Liping; Yu, Yanying; Tang, Jiaqin

    2015-01-01

    Heparosan serves as the starting carbon backbone for the chemoenzymatic synthesis of heparin, a widely used clinical anticoagulant drug. The availability of heparosan is a significant concern for the cost-effective synthesis of bioengineered heparin. The carbon source is known as the pivotal factor affecting heparosan production. However, the mechanism by which carbon sources control the biosynthesis of heparosan is unclear. In this study, we found that the biosynthesis of heparosan was influenced by different carbon sources. Glucose inhibits the biosynthesis of heparosan, while the addition of either fructose or mannose increases the yield of heparosan. Further study demonstrated that the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex binds to the upstream region of the region 3 promoter and stimulates the transcription of the gene cluster for heparosan biosynthesis. Site-directed mutagenesis of the CRP binding site abolished its capability of binding CRP and eliminated the stimulative effect on transcription. 1H nuclear magnetic resonance (NMR) analysis was further performed to determine the Escherichia coli strain Nissle 1917 (EcN) heparosan structure and quantify extracellular heparosan production. Our results add to the understanding of the regulation of heparosan biosynthesis and may contribute to the study of other exopolysaccharide-producing strains. PMID:26319872

  2. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  3. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  4. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  5. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  6. 7 CFR 772.14 - Reamortization of AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Reamortization of AMP loans. 772.14 Section 772.14... AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.14 Reamortization of AMP loans. The Agency may approve reamortization of AMP loans provided: (a) There is no extension of the final maturity...

  7. Measurements of plasma-wave generation using a short-pulse high-intensity laser beat wave

    SciTech Connect

    Walton, B.; Najmudin, Z.; Wei, M.S.; Marle, C.; Kingham, R.J.; Krushelnick, K.; Dangor, A.E.; Clarke, R.J.; Poulter, M. J.; Hernandez-Gomez, C.; Hawkes, S.; Neely, D.; Collier, J.L.; Danson, C.N.; Fritzler, S.; Malka, V.

    2006-01-15

    Experiments to examine the generation of relativistic plasma waves via a high-intensity short-pulse beat-wave scheme are described in detail. The pulse stretcher of the Vulcan chirped-pulse amplification (CPA) laser system was modified to produce two frequency, 3 ps pulses focusable to intensities up to 10{sup 18} W cm{sup -2}. Short high-intensity pulses were used to avoid limitations to the plasma-wave amplitude due to the modulational instability. Two experiments were undertaken, at 3 and 10 TW, with the generation of plasma waves diagnosed by measuring the sidebands produced in the spectrum of the forward scattered beam. A resonance in the sideband signal was observed for an initial plasma density higher than expected for the given beat frequency. This resonance shift can be attributed to transverse ponderomotive expulsion of plasma electrons from the laser focal region. A monotonically increasing background was also observed, which was due to nonresonant cross-phase modulation.

  8. Detection of cyclic di-AMP using a competitive ELISA with a unique pneumococcal cyclic di-AMP binding protein

    PubMed Central

    Underwood, Adam J.; Zhang, Yang; Metzger, Dennis W.; Bai, Guangchun

    2014-01-01

    Cyclic di-AMP (c-di-AMP) is a signaling molecule that has been shown to play important roles in bacterial physiology and infections. Currently, c-di-AMP detection and quantification relies mostly on the use of high-performance liquid chromatography (HPLC) or liquid chromatography-mass spectrometry (LC-MS). In this study, a competitive enzyme-linked immunosorbent assay (ELISA) for the quantification of c-di-AMP was developed, which utilizes a novel pneumococcal c-di-AMP binding protein (CabP) and a newly commercialized c-di-AMP derivative. With this new method, c-di-AMP concentrations in biological samples can be quickly and accurately quantified. Furthermore, this assay is much more efficient than current methods as it requires less overall cost and training while processing many samples at once. Therefore, this assay can be extensively used in research into c-di-AMP signaling. PMID:25239824

  9. AMPS Supporting Research and Technology (SR and T) report. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) definition study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A listing of candidate technology areas that require additional study is presented. These candidate tasks, identified during the AMPS Phase B studies, are requisites to the design, development, and operation of the AMPS concept selected for preliminary design.

  10. Cyclic AMP Receptor Protein-Aequorin Molecular Switch for Cyclic AMP

    PubMed Central

    Scott, Daniel; Hamorsky, Krystal Teasley; Ensor, C. Mark; Anderson, Kimberly W.; Daunert, Sylvia

    2011-01-01

    Molecular switches are designer molecules that combine the functionality of two individual proteins into one, capable of manifesting an “on/off” signal in response to a stimulus. These switches have unique properties and functionalities and thus, can be employed as nanosensors in a variety of applications. To that end, we have developed a bioluminescent molecular switch for cyclic AMP. Bioluminescence offers many advantages over fluorescence and other detection methods including the fact that there is essentially zero background signal in physiological fluids, allowing for more sensitive detection and monitoring. The switch was created by combining the properties of the cyclic AMP receptor protein (CRP), a transcriptional regulatory protein from E. coli that binds selectively to cAMP with those of aequorin, a bioluminescent photoprotein native of the jellyfish Aequorea victoria. Genetic manipulation to split the genetic coding sequence of aequorin in two and genetically attach the fragments to the N and C termini of CRP, resulted in a hybrid protein molecular switch. The conformational change experienced by CRP upon the binding of cyclic AMP is suspected to result in the observed loss of bioluminescent signal from aequorin. The “on/off” bioluminescence can be modulated by cyclic AMP over a range of several orders of magnitude in a linear fashion in addition to the capacity to detect changes in cellular cyclic AMP of intact cells exposed to different external stimuli without the need to lyse the cells. We envision that the molecular switch could find applications in vitro as well as in vivo cyclic AMP detection and/or imaging. PMID:21329338

  11. Fiscal Year 2011 Infrastructure Refactorizations in AMP

    SciTech Connect

    Berrill, Mark A.; Philip, Bobby; Sampath, Rahul S.; Allu, Srikanth; Barai, Pallab; Cochran, Bill; Clarno, Kevin T.; Dilts, Gary A.

    2011-09-01

    In Fiscal Year 2011 (FY11), the AMP (Advanced MultiPhysics) Nuclear Fuel Performance code [1] went through a thorough review and refactorization based on the lessons-learned from the previous year, in which the version 0.9 of the software was released as a prototype. This report describes the refactorization work that has occurred or is in progress during FY11.

  12. The Applied Mathematics for Power Systems (AMPS)

    SciTech Connect

    Chertkov, Michael

    2012-07-24

    Increased deployment of new technologies, e.g., renewable generation and electric vehicles, is rapidly transforming electrical power networks by crossing previously distinct spatiotemporal scales and invalidating many traditional approaches for designing, analyzing, and operating power grids. This trend is expected to accelerate over the coming years, bringing the disruptive challenge of complexity, but also opportunities to deliver unprecedented efficiency and reliability. Our Applied Mathematics for Power Systems (AMPS) Center will discover, enable, and solve emerging mathematics challenges arising in power systems and, more generally, in complex engineered networks. We will develop foundational applied mathematics resulting in rigorous algorithms and simulation toolboxes for modern and future engineered networks. The AMPS Center deconstruction/reconstruction approach 'deconstructs' complex networks into sub-problems within non-separable spatiotemporal scales, a missing step in 20th century modeling of engineered networks. These sub-problems are addressed within the appropriate AMPS foundational pillar - complex systems, control theory, and optimization theory - and merged or 'reconstructed' at their boundaries into more general mathematical descriptions of complex engineered networks where important new questions are formulated and attacked. These two steps, iterated multiple times, will bridge the growing chasm between the legacy power grid and its future as a complex engineered network.

  13. Copper regulates cyclic-AMP-dependent lipolysis.

    PubMed

    Krishnamoorthy, Lakshmi; Cotruvo, Joseph A; Chan, Jefferson; Kaluarachchi, Harini; Muchenditsi, Abigael; Pendyala, Venkata S; Jia, Shang; Aron, Allegra T; Ackerman, Cheri M; Wal, Mark N Vander; Guan, Timothy; Smaga, Lukas P; Farhi, Samouil L; New, Elizabeth J; Lutsenko, Svetlana; Chang, Christopher J

    2016-08-01

    Cell signaling relies extensively on dynamic pools of redox-inactive metal ions such as sodium, potassium, calcium and zinc, but their redox-active transition metal counterparts such as copper and iron have been studied primarily as static enzyme cofactors. Here we report that copper is an endogenous regulator of lipolysis, the breakdown of fat, which is an essential process in maintaining body weight and energy stores. Using a mouse model of genetic copper misregulation, in combination with pharmacological alterations in copper status and imaging studies in a 3T3-L1 white adipocyte model, we found that copper regulates lipolysis at the level of the second messenger, cyclic AMP (cAMP), by altering the activity of the cAMP-degrading phosphodiesterase PDE3B. Biochemical studies of the copper-PDE3B interaction establish copper-dependent inhibition of enzyme activity and identify a key conserved cysteine residue in a PDE3-specific loop that is essential for the observed copper-dependent lipolytic phenotype. PMID:27272565

  14. Emission of ESBL/AmpC-producing Escherichia coli from pig fattening farms to surrounding areas.

    PubMed

    von Salviati, Christina; Laube, Henriette; Guerra, Beatriz; Roesler, Uwe; Friese, Anika

    2015-01-30

    The presence of ESBL/AmpC-producing Escherichia coli in livestock such as pigs has been known for some time. However, to date there is little information about the transmission of these resistant bacteria between pig farms and their surroundings. Thus, the aim of this study was to explore this topic by investigating seven German pig fattening farms. Samples from outside (including ground surfaces, ambient air, slurry and digestate from biogas plants) and, in parallel, from inside the pig barns (including pig feces, dust, barn air, flies and mice feces) were examined for ESBL/AmpC-producing E. coli and selected isolates were compared by pulsed-field gel electrophoresis (PFGE) analysis. 14/17 (82.4%) slurry samples and three of four samples of digestate from biogas plants tested positive for ESBL/AmpC-producing E. coli. In the vicinity of the pig barns these resistant bacteria were detected in 14/87 (16.1%) boot swabs taken from various ground surfaces and in 2/36 (6%) ambient air samples. Inside the pig barns, 6/63 (9.5%) barn air samples and a small proportion of flies and mice feces samples were ESBL/AmpC-positive. PFGE analysis proved fecal emission as well as a possible spread via flies, as identical ESBL-E. coli isolates were detected in slurry and on fertilized fields, as well as in flies and pooled feces from inside the barn and slurry. Contaminated slurry presented the major emission source for ESBL/AmpC-producing E. coli in the pig fattening farms, but a spread via the airborne route or via different vectors also seems possible. PMID:25465658

  15. The Cyclic AMP Phenotype of Fragile X and Autism

    PubMed Central

    Kelley, Daniel J; Bhattacharyya, Anita; Lahvis, Garet P; Yin, Jerry CP; Malter, Jim; Davidson, Richard J

    2008-01-01

    Cyclic AMP (cAMP) is a second messenger involved in many processes including mnemonic processing and anxiety. Memory deficits and anxiety are noted in the phenotype of fragile X (FX), the most common heritable cause of mental retardation and autism. Here we review reported observations of altered cAMP cascade function in FX and autism. Cyclic AMP is a potentially useful biochemical marker to distinguish autism comorbid with FX from autism per se and the cAMP cascade may be a viable therapeutic target for both FX and autism. PMID:18601949

  16. Effect of electrical stimulation on beta-adrenergic receptor population and cyclic amp production in chicken and rat skeletal muscle cell cultures

    NASA Technical Reports Server (NTRS)

    Young, R. B.; Bridge, K. Y.; Strietzel, C. J.

    2000-01-01

    Expression of the beta-adrenergic receptor (betaAR) and its coupling to cyclic AMP (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy, and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the betaAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically, chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the betaAR population was not significantly affected by electrical stimulation; however, the ability of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the betaAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  17. Characterization of Beta-lactamases in Faecal Enterobacteriaceae Recovered from Healthy Humans in Spain: Focusing on AmpC Polymorphisms.

    PubMed

    Porres-Osante, Nerea; Sáenz, Yolanda; Somalo, Sergio; Torres, Carmen

    2015-07-01

    The intestinal tract is a huge reservoir of Enterobacteriaceae, some of which are opportunist pathogens. Several genera of these bacteria harbour intrinsic antibiotic resistance genes, such as ampC genes in species of Citrobacter, Enterobacter or Escherichia genera. In this work, beta-lactamases and other resistance mechanisms have been characterized in Enterobacteriaceae isolates recovered from healthy human faecal samples, focusing on the ampC beta-lactamase genes. Fifty human faecal samples were obtained, and 70 Enterobacteriaceae bacteria were isolated: 44 Escherichia coli, 4 Citrobacter braakii, 9 Citrobacter freundii, 8 Enterobacter cloacae, 1 Proteus mirabilis, 1 Proteus vulgaris, 1 Klebsiella oxytoca, 1 Serratia sp. and 1 Cronobacter sp. A high percentage of resistance to ampicillin was detected (57%), observing the AmpC phenotype in 22 isolates (31%) and the ESBL phenotype in 3 isolates. AmpC molecular characterization showed high diversity into bla CMY and bla ACT genes from Citrobacter and Enterobacter species, respectively, and the pulsed-field gel electrophoresis (PFGE) analysis demonstrated low clonality among them. The prevalence of people colonized by strains carrying plasmid-mediated ampC genes obtained in this study was 2%. The unique plasmid-mediated bla AmpC identified in this study was the bla CMY-2 gene, detected in an E. coli isolate ascribed to the sequence type ST405 which belonged to phylogenetic group D. The hybridization and conjugation experiments demonstrated that the ISEcp1-bla CMY-2-blc structure was carried by a ~78-kb self-transferable IncK plasmid. This study shows a high polymorphism among beta-lactamase genes in Enterobacteriaceae from healthy people microbiota. Extensive AmpC-carrier studies would provide important information and could allow the anticipation of future global health problems. PMID:25501887

  18. Directed evolution of the Escherichia coli cAMP receptor protein at the cAMP pocket.

    PubMed

    Gunasekara, Sanjiva M; Hicks, Matt N; Park, Jin; Brooks, Cory L; Serate, Jose; Saunders, Cameron V; Grover, Simranjeet K; Goto, Joy J; Lee, Jin-Won; Youn, Hwan

    2015-10-30

    The Escherichia coli cAMP receptor protein (CRP) requires cAMP binding to undergo a conformational change for DNA binding and transcriptional regulation. Two CRP residues, Thr(127) and Ser(128), are known to play important roles in cAMP binding through hydrogen bonding and in the cAMP-induced conformational change, but the connection between the two is not completely clear. Here, we simultaneously randomized the codons for these two residues and selected CRP mutants displaying high CRP activity in a cAMP-producing E. coli. Many different CRP mutants satisfied the screening condition for high CRP activity, including those that cannot form any hydrogen bonds with the incoming cAMP at the two positions. In vitro DNA-binding analysis confirmed that these selected CRP mutants indeed display high CRP activity in response to cAMP. These results indicate that the hydrogen bonding ability of the Thr(127) and Ser(128) residues is not critical for the cAMP-induced CRP activation. However, the hydrogen bonding ability of Thr(127) and Ser(128) was found to be important in attaining high cAMP affinity. Computational analysis revealed that most natural cAMP-sensing CRP homologs have Thr/Ser, Thr/Thr, or Thr/Asn at positions 127 and 128. All of these pairs are excellent hydrogen bonding partners and they do not elevate CRP activity in the absence of cAMP. Taken together, our analyses suggest that CRP evolved to have hydrogen bonding residues at the cAMP pocket residues 127 and 128 for performing dual functions: preserving high cAMP affinity and keeping CRP inactive in the absence of cAMP. PMID:26378231

  19. PULSE COUNTER

    DOEpatents

    Trumbo, D.E.

    1959-02-10

    A transistorized pulse-counting circuit adapted for use with nuclear radiation detecting detecting devices to provide a small, light weight portable counter is reported. The small size and low power requirements of the transistor are of particular value in this instance. The circuit provides an adjustable count scale with a single transistor which is triggered by the accumulated charge on a storage capacitor.

  20. Cyclic AMP phosphodiesterase in Salmonella typhimurium: characteristics and physiological function.

    PubMed

    Botsford, J L

    1984-11-01

    The physiological function of cyclic AMP (cAMP) phosphodiesterase in Salmonella typhimurium was investigated with strains which were isogenic except for the cpd locus. In crude broken-cell extracts the properties of the enzyme were found to be similar to those reported for Escherichia coli. The specific activity in the mutant was less than 1% that in the wild type. Rates of cAMP production in the mutant were as much as twice those observed in the wild type. The amount of cAMP accumulated when cells grew overnight with limiting glucose was 4.5-fold greater in the mutant than in the wild type. The intracellular concentration of cAMP in the two strains was measured directly, using four different techniques to wash the cells to remove extracellular cAMP. The cAMP level in the cpd strain was only 25% greater than in the wild type. The functional concentration of the cAMP receptor protein-cAMP complex was estimated indirectly from the specific activity of beta-galactosidase in the two strains after introducing F'lac. When cells were grown with carbon sources permitting synthesis of different levels of cAMP, the specific activity of the enzyme was at most 25% greater in the cpd strain. The cpd strain was more sensitive to the effects of exogenous cAMP. Exogenous cAMP relieved both permanent and transient catabolite repression of the lac operon at lower concentrations in the cpd strain than in the wild type. When cells grew with glucose, glycerol, or ribose, exogenous cAMP inhibited growth of the mutant strain more than the wild type. PMID:6094495

  1. Cyclic Di-AMP Impairs Potassium Uptake Mediated by a Cyclic Di-AMP Binding Protein in Streptococcus pneumoniae

    PubMed Central

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M.; Zhang, Yang; Metzger, Dennis W.

    2014-01-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  2. Cyclic di-AMP impairs potassium uptake mediated by a cyclic di-AMP binding protein in Streptococcus pneumoniae.

    PubMed

    Bai, Yinlan; Yang, Jun; Zarrella, Tiffany M; Zhang, Yang; Metzger, Dennis W; Bai, Guangchun

    2014-02-01

    Cyclic di-AMP (c-di-AMP) has been shown to play important roles as a second messenger in bacterial physiology and infections. However, understanding of how the signal is transduced is still limited. Previously, we have characterized a diadenylate cyclase and two c-di-AMP phosphodiesterases in Streptococcus pneumoniae, a Gram-positive pathogen. In this study, we identified a c-di-AMP binding protein (CabP) in S. pneumoniae using c-di-AMP affinity chromatography. We demonstrated that CabP specifically bound c-di-AMP and that this interaction could not be interrupted by competition with other nucleotides, including ATP, cAMP, AMP, phosphoadenylyl adenosine (pApA), and cyclic di-GMP (c-di-GMP). By using a bacterial two-hybrid system and genetic mutagenesis, we showed that CabP directly interacted with a potassium transporter (SPD_0076) and that both proteins were required for pneumococcal growth in media with low concentrations of potassium. Interestingly, the interaction between CabP and SPD_0076 and the efficiency of potassium uptake were impaired by elevated c-di-AMP in pneumococci. These results establish a direct c-di-AMP-mediated signaling pathway that regulates pneumococcal potassium uptake. PMID:24272783

  3. Parallel Allostery by cAMP and PDE Coordinates Activation and Termination Phases in cAMP Signaling.

    PubMed

    Krishnamurthy, Srinath; Tulsian, Nikhil Kumar; Chandramohan, Arun; Anand, Ganesh S

    2015-09-15

    The second messenger molecule cAMP regulates the activation phase of the cAMP signaling pathway through high-affinity interactions with the cytosolic cAMP receptor, the protein kinase A regulatory subunit (PKAR). Phosphodiesterases (PDEs) are enzymes responsible for catalyzing hydrolysis of cAMP to 5' AMP. It was recently shown that PDEs interact with PKAR to initiate the termination phase of the cAMP signaling pathway. While the steps in the activation phase are well understood, steps in the termination pathway are unknown. Specifically, the binding and allosteric networks that regulate the dynamic interplay between PKAR, PDE, and cAMP are unclear. In this study, PKAR and PDE from Dictyostelium discoideum (RD and RegA, respectively) were used as a model system to monitor complex formation in the presence and absence of cAMP. Amide hydrogen/deuterium exchange mass spectrometry was used to monitor slow conformational transitions in RD, using disordered regions as conformational probes. Our results reveal that RD regulates its interactions with cAMP and RegA at distinct loci by undergoing slow conformational transitions between two metastable states. In the presence of cAMP, RD and RegA form a stable ternary complex, while in the absence of cAMP they maintain transient interactions. RegA and cAMP each bind at orthogonal sites on RD with resultant contrasting effects on its dynamics through parallel allosteric relays at multiple important loci. RD thus serves as an integrative node in cAMP termination by coordinating multiple allosteric relays and governing the output signal response. PMID:26276689

  4. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish.

    PubMed

    Lundegaard, Pia R; Anastasaki, Corina; Grant, Nicola J; Sillito, Rowland R; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J Douglas; Porteous, David J; Patton, E Elizabeth

    2015-10-22

    Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  5. Pulsed hydrojet

    DOEpatents

    Bohachevsky, I.O.; Torrey, M.D.

    1986-06-10

    An underwater pulsed hydrojet propulsion system is provided for accelerating and propelling a projectile or other vessel. A reactant, such as lithium, is fluidized and injected into a water volume. The resulting reaction produces an energy density in a time effective to form a steam pocket. Thrust flaps or baffles direct the pressure from the steam pocket toward an exit nozzle for accelerating a water volume to create thrust. A control system regulates the dispersion of reactant to control thrust characteristics.

  6. Oscillations of cAMP with the cardiac cycle.

    PubMed

    Wikman-Coffelt, J; Sievers, R; Coffelt, R J; Parmley, W W

    1983-03-16

    Oscillations of cAMP with the cardiac cycle were demonstrated in the rat heart using a stimulator-triggered rapid freeze-clamp to decrease the temperature of the heart from 37 degrees C to -80 degrees C in 5 msec (20,000 degrees/sec) at a predetermined phase of the cardiac cycle. The nucleotide, cAMP, oscillated 60% with the cardiac cycle during normal working conditions, the higher cAMP value occurring during systole. PMID:6301471

  7. Didactical formulation of the Ampère law

    NASA Astrophysics Data System (ADS)

    Barchiesi, Dominique

    2014-05-01

    The Ampère law is useful to calculate the magnetostatic field in the cases of distributions of current with high degree of symmetry. Nevertheless the magnetic field produced by a thin straight wire carrying a current I requires the Biot-Savart law and the use of the Ampère law leads to a mistake. A didactical formulation of the Ampère law is proposed to prevent misinterpretations.

  8. Cardiac cAMP: production, hydrolysis, modulation and detection.

    PubMed

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3',5'-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  9. Cardiac cAMP: production, hydrolysis, modulation and detection

    PubMed Central

    Boularan, Cédric; Gales, Céline

    2015-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP) modulates a broad range of biological processes including the regulation of cardiac myocyte contractile function where it constitutes the main second messenger for β-adrenergic receptors' signaling to fulfill positive chronotropic, inotropic and lusitropic effects. A growing number of studies pinpoint the role of spatial organization of the cAMP signaling as an essential mechanism to regulate cAMP outcomes in cardiac physiology. Here, we will briefly discuss the complexity of cAMP synthesis and degradation in the cardiac context, describe the way to detect it and review the main pharmacological arsenal to modulate its availability. PMID:26483685

  10. Detection of amp C in Enterobacter cloacae in China.

    PubMed

    Zhang, Y L; Li, J T; Zhao, M W

    2001-10-01

    PCR amplification of 55 strains of Enterobacter cloacae indicated 51 of them had amp C structural gene verified by DNA sequence and Southern blotting. All PCR products were cleaved into 666- and 328-bp fragments by Kpn1 restriction enzyme. Imipenem was the most potent inducer for mRNA expression of amp C gene and beta-lactamase activity. The beta-Lactamase inhibitor R0481220 strongly inhibited Amp C beta-lactamases; 96.4% (53/55) of Enterobacter cloacae producing Amp C enzyme were susceptible to cefepime. PMID:11691570

  11. Mechanisms Restricting Diffusion of Intracellular cAMP

    PubMed Central

    Agarwal, Shailesh R.; Clancy, Colleen E.; Harvey, Robert D.

    2016-01-01

    Although numerous receptors stimulate cAMP production in a wide array of cells, many elicit distinct, highly localized responses, implying that the subcellular distribution of cAMP is not uniform. One often used explanation is that phosphodiesterases, which breakdown cAMP, act as functional barriers limiting diffusion. However, several studies refute the notion that this is sufficient, suggesting that phosphodiesterase-independent movement of cAMP must occur at rates slower than free diffusion. But, until now this has never been demonstrated. Using Raster Image Correlation Spectroscopy (RICS), we measured the diffusion coefficient of a fluorescently-labeled cAMP derivative (φ450-cAMP) as well as other fluorescent molecules in order to investigate the role that molecular size, cell morphology, and buffering by protein kinase A (PKA) play in restricting cAMP mobility in different cell types. Our results demonstrate that cytosolic movement of cAMP is indeed much slower than the rate of free diffusion and that interactions with PKA, especially type II PKA associated with mitochondria, play a significant role. These findings have important implications with respect to cAMP signaling in all cells. PMID:26795432

  12. The cAMP-binding proteins of Leishmania are not the regulatory subunits of cAMP-dependent protein kinase.

    PubMed

    Banerjee, C; Sarkar, D

    2001-09-01

    The most commonly used method to determine the cAMP binding activity in cytosolic extracts of promastigotes of Leishmania spp. underestimated by approximately 11.5-fold the total amount of [(3)H]cAMP bound, when compared with results obtained by the modified Millipore filter technique. Three cAMP-binding proteins (BPI, BPII and BPIII) were partially purified and characterized. The native molecular masses of BPI, BPII and BPIII were estimated to be 105, 155 and 145 kDa, respectively. The binding of [(3)H]cAMP to these proteins was affected to different extents by several cAMP analogues. Antibodies directed against the types I and II regulatory subunits of PKA did not cross-react with the leishmanial extract. Photoaffinity labeling of the cytosolic extracts with 8-N(3)-[(32)P]cAMP specifically labeled a band of M(r) 116000 and a band of M(r) 80000 partially saturable by cAMP. From these results, it is concluded that the leishmanial cAMP-binding proteins appear to belong to a different class distinct from the regulatory subunits of cAMP-dependent protein kinases. PMID:11544092

  13. PULSE COLUMN

    DOEpatents

    Grimmett, E.S.

    1964-01-01

    This patent covers a continuous countercurrent liquidsolids contactor column having a number of contactor states each comprising a perforated plate, a layer of balls, and a downcomer tube; a liquid-pulsing piston; and a solids discharger formed of a conical section at the bottom of the column, and a tubular extension on the lowest downcomer terminating in the conical section. Between the conical section and the downcomer extension is formed a small annular opening, through which solids fall coming through the perforated plate of the lowest contactor stage. This annular opening is small enough that the pressure drop thereacross is greater than the pressure drop upward through the lowest contactor stage. (AEC)

  14. Effect of Electrical Stimulation on Beta-Adrenergic Receptor Population and Cyclic AMP Production in Chicken and Rat Skeletal Muscle Cell Cultures

    NASA Technical Reports Server (NTRS)

    Young, Ronald B.; Bridge, Kristin Y.; Strietzel, Catherine J.

    2000-01-01

    Expression of the beta-adrenergic receptor (PAR) and its coupling to Adenosine 3'5' Cyclic Monophosphate (cAMP) synthesis are important components of the signaling system that controls muscle atrophy and hypertrophy and the goal of this study was to determine if electrical stimulation in a pattern simulating slow muscle contraction would alter the PAR response in primary cultures of avian and mammalian skeletal muscle cells. Specifically chicken skeletal muscle cells and rat skeletal muscle cells that had been grown for 7 d in culture, were subjected to electrical stimulation for an additional 2 d at a pulse frequency of 0.5 pulses/sec and a pulse duration of 200 msec. In chicken skeletal muscle cells, the PAR population was not significantly affected by electrical stimulation; however, the ability, of these cells to synthesize cyclic AMP was reduced by approximately one-half. In contrast, the PAR population in rat muscle cells was increased slightly but not significantly by electrical stimulation, and the ability of these cells to synthesize cyclic AMP was increased by almost twofold. The basal levels of intracellular cyclic AMP in neither rat muscle cells nor chicken muscle cells were affected by electrical stimulation.

  15. Tapered pulse tube for pulse tube refrigerators

    DOEpatents

    Swift, Gregory W.; Olson, Jeffrey R.

    1999-01-01

    Thermal insulation of the pulse tube in a pulse-tube refrigerator is maintained by optimally varying the radius of the pulse tube to suppress convective heat loss from mass flux streaming in the pulse tube. A simple cone with an optimum taper angle will often provide sufficient improvement. Alternatively, the pulse tube radius r as a function of axial position x can be shaped with r(x) such that streaming is optimally suppressed at each x.

  16. Counteracting Roles of AMP Deaminase and AMP Kinase in the Development of Fatty Liver

    PubMed Central

    Lanaspa, Miguel A.; Cicerchi, Christina; Garcia, Gabriela; Li, Nanxing; Roncal-Jimenez, Carlos A.; Rivard, Christopher J.; Hunter, Brandi; Andrés-Hernando, Ana; Ishimoto, Takuji; Sánchez-Lozada, Laura G.; Thomas, Jeffrey; Hodges, Robert S.; Mant, Colin T.; Johnson, Richard J.

    2012-01-01

    Fatty liver (hepatic steatosis) is associated with nucleotide turnover, loss of ATP and generation of adenosine monophosphate (AMP). It is well known that in fatty liver, activity of the AMP-activated kinase (AMPK) is reduced and that its stimulation can prevent hepatic steatosis by both enhancing fat oxidation and reducing lipogenesis. Here we show that another AMP dependent enzyme, AMPD2, has opposing effects on fatty acid oxidation when compared to AMPK. In human hepatocytres, AMPD2 activation –either by overexpression or by lowering intracellular phosphate levels with fructose- is associated with a significant reduction in AMPK activity. Likewise, silencing of AMPK spontaneously increases AMPD activity, demonstrating that these enzymes counter-regulate each other. Furthermore, we show that a downstream product of AMP metabolism through AMPD2, uric acid, can inhibit AMPK activity in human hepatocytes. Finally, we show that fructose-induced fat accumulation in hepatocytes is due to a dominant stimulation of AMPD2 despite stimulating AMPK. In this regard, AMPD2-deficient hepatocytes demonstrate a further activation of AMPK after fructose exposure in association with increased fatty acid oxidation, and conversely silencing AMPK enhances AMPD-dependent fat accumulation. In vivo, we show that sucrose fed rats also develop fatty liver that is blocked by metformin in association with both a reduction in AMPD activity and an increase in AMPK activity. In summary, AMPD and AMPK are both important in hepatic fat accumulation and counter-regulate each other. We present the novel finding that uric acid inhibits AMPK kinase activity in fructose-fed hepatocytes thus providing new insights into the pathogenesis of fatty liver. PMID:23152807

  17. Rp-cAMPS Prodrugs Reveal the cAMP Dependence of First-Phase Glucose-Stimulated Insulin Secretion.

    PubMed

    Schwede, Frank; Chepurny, Oleg G; Kaufholz, Melanie; Bertinetti, Daniela; Leech, Colin A; Cabrera, Over; Zhu, Yingmin; Mei, Fang; Cheng, Xiaodong; Manning Fox, Jocelyn E; MacDonald, Patrick E; Genieser, Hans-G; Herberg, Friedrich W; Holz, George G

    2015-07-01

    cAMP-elevating agents such as the incretin hormone glucagon-like peptide-1 potentiate glucose-stimulated insulin secretion (GSIS) from pancreatic β-cells. However, a debate has existed since the 1970s concerning whether or not cAMP signaling is essential for glucose alone to stimulate insulin secretion. Here, we report that the first-phase kinetic component of GSIS is cAMP-dependent, as revealed through the use of a novel highly membrane permeable para-acetoxybenzyl (pAB) ester prodrug that is a bioactivatable derivative of the cAMP antagonist adenosine-3',5'-cyclic monophosphorothioate, Rp-isomer (Rp-cAMPS). In dynamic perifusion assays of human or rat islets, a step-wise increase of glucose concentration leads to biphasic insulin secretion, and under these conditions, 8-bromoadenosine-3',5'-cyclic monophosphorothioate, Rp-isomer, 4-acetoxybenzyl ester (Rp-8-Br-cAMPS-pAB) inhibits first-phase GSIS by up to 80%. Surprisingly, second-phase GSIS is inhibited to a much smaller extent (≤20%). Using luciferase, fluorescence resonance energy transfer, and bioluminescence resonance energy transfer assays performed in living cells, we validate that Rp-8-Br-cAMPS-pAB does in fact block cAMP-dependent protein kinase activation. Novel effects of Rp-8-Br-cAMPS-pAB to block the activation of cAMP-regulated guanine nucleotide exchange factors (Epac1, Epac2) are also validated using genetically encoded Epac biosensors, and are independently confirmed in an in vitro Rap1 activation assay using Rp-cAMPS and Rp-8-Br-cAMPS. Thus, in addition to revealing the cAMP dependence of first-phase GSIS from human and rat islets, these findings establish a pAB-based chemistry for the synthesis of highly membrane permeable prodrug derivatives of Rp-cAMPS that act with micromolar or even nanomolar potency to inhibit cAMP signaling in living cells. PMID:26061564

  18. Synergistic Antipseudomonal Effects of Synthetic Peptide AMP38 and Carbapenems.

    PubMed

    Rudilla, Héctor; Fusté, Ester; Cajal, Yolanda; Rabanal, Francesc; Vinuesa, Teresa; Viñas, Miguel

    2016-01-01

    The aim was to explore the antimicrobial activity of a synthetic peptide (AMP38) and its synergy with imipenem against imipenem-resistant Pseudomonas aeruginosa. The main mechanism of imipenem resistance is the loss or alteration of protein OprD. Time-kill and minimal biofilm eradication concentration (MBEC) determinations were carried out by using clinical imipenem-resistant strains. AMP38 was markedly synergistic with imipenem when determined in imipenem-resistant P. aeruginosa. MBEC obtained for the combination of AMP38 and imipenem was of 62.5 μg/mL, whereas the MBEC of each antimicrobial separately was 500 μg/mL. AMP38 should be regarded as a promising antimicrobial to fight MDR P. aeruginosa infections. Moreover, killing effect and antibiofilm activity of AMP38 plus imipenem was much higher than that of colistin plus imipenem. PMID:27626405

  19. Control of bacterial exoelectrogenesis by c-AMP-GMP

    PubMed Central

    Nelson, James W.; Sudarsan, Narasimhan; Phillips, Grace E.; Stav, Shira; Lünse, Christina E.; McCown, Phillip J.; Breaker, Ronald R.

    2015-01-01

    Major changes in bacterial physiology including biofilm and spore formation involve signaling by the cyclic dinucleotides c-di-GMP and c-di-AMP. Recently, another second messenger dinucleotide, c-AMP-GMP, was found to control chemotaxis and colonization by Vibrio cholerae. We have identified a superregulon of genes controlled by c-AMP-GMP in numerous Deltaproteobacteria, including Geobacter species that use extracellular insoluble metal oxides as terminal electron acceptors. This exoelectrogenic process has been studied for its possible utility in energy production and bioremediation. Many genes involved in adhesion, pilin formation, and others that are important for exoelectrogenesis are controlled by members of a variant riboswitch class that selectively bind c-AMP-GMP. These RNAs constitute, to our knowledge, the first known specific receptors for c-AMP-GMP and reveal that this molecule is used by many bacteria to control specialized physiological processes. PMID:25848023

  20. Activated cAMP receptors switch encystation into sporulation

    PubMed Central

    Kawabe, Yoshinori; Morio, Takahiro; James, John L.; Prescott, Alan R.; Tanaka, Yoshimasa; Schaap, Pauline

    2009-01-01

    Metazoan embryogenesis is controlled by a limited number of signaling modules that are used repetitively at successive developmental stages. The development of social amoebas shows similar reiterated use of cAMP-mediated signaling. In the model Dictyostelium discoideum, secreted cAMP acting on 4 cAMP receptors (cARs1-4) coordinates cell movement during aggregation and fruiting body formation, and induces the expression of aggregation and sporulation genes at consecutive developmental stages. To identify hierarchy in the multiple roles of cAMP, we investigated cAR heterogeneity and function across the social amoeba phylogeny. The gene duplications that yielded cARs 2-4 occurred late in evolution. Many species have only a cAR1 ortholog that duplicated independently in the Polysphondylids and Acytostelids. Disruption of both cAR genes of Polysphondylium pallidum (Ppal) did not affect aggregation, but caused complete collapse of fruiting body morphogenesis. The stunted structures contained disorganized stalk cells, which supported a mass of cysts instead of spores; cAMP triggered spore gene expression in Ppal, but not in the cAR null mutant, explaining its sporulation defect. Encystation is the survival strategy of solitary amoebas, and lower taxa, like Ppal, can still encyst as single cells. Recent findings showed that intracellular cAMP accumulation suffices to trigger encystation, whereas it is a complementary requirement for sporulation. Combined, the data suggest that cAMP signaling in social amoebas evolved from cAMP-mediated encystation in solitary amoebas; cAMP secretion in aggregates prompted the starving cells to form spores and not cysts, and additionally organized fruiting body morphogenesis. cAMP-mediated aggregation was the most recent innovation. PMID:19369200

  1. Identification of DHA-23, a novel plasmid-mediated and inducible AmpC beta-lactamase from Enterobacteriaceae in Northern Taiwan

    PubMed Central

    Hsieh, Wen-Shyang; Wang, Nai-Yu; Feng, Jou-An; Weng, Li-Chuan; Wu, Hsueh-Hsia

    2015-01-01

    Objectives: AmpC β-lactamases are classified as Amber Class C and Bush Group 1. AmpC β-lactamases can hydrolyze broad and extended-spectrum cephalosporins, and are not inhibited by β-lactamase inhibitors such as clavulanic acid. This study was conducted to identify DHA-23, a novel plasmid-mediated and inducible AmpC β-lactamase obtained from Enterobacteriaceae. Methods: A total of 210 carbapenem-resistant Enterobacteriaceae isolates were collected from a medical center (comprising two branches) in Northern Taiwan during 2009–2012. AmpC β-lactamase genes were analyzed through a polymerase chain reaction using plasmid DNA templates and gene sequencing. The genetic relationships of the isolates were typed using pulsed-field gel electrophoresis following the digestion of intact genomic DNA by using XbaI. Results: Three enterobacterial isolates (one Escherichia coli and two Klebsiella pneumoniae) were obtained from three hospitalized patients. All three isolates were resistant or intermediately susceptible to all β-lactams, and exhibited reduced susceptibility to carbapenems. These three isolates expressed a novel AmpC β-lactamase, designated DHA-23, approved by the curators of the Lahey website. DHA-23 differs from DHA-1 and DHA-6 by one amino acid substitution (Ser245Ala), exhibiting three amino acid changes compared with DHA-7 and DHA-Morganella morganii; three amino acid changes compared with DHA-3; four amino acid changes compared with DHA-5; and eight amino acid changes compared with DHA-2 (>97% identity). This AmpC β-lactamase is inducible using a system involving ampR. Conclusion: This is the first report to address DHA-23, a novel AmpC β-lactamase. DHA-type β-lactamases are continuous threat in Taiwan. PMID:25999942

  2. Evolution of self-organisation in Dictyostelia by adaptation of a non-selective phosphodiesterase and a matrix component for regulated cAMP degradation

    PubMed Central

    Kawabe, Yoshinori; Weening, Karin E.; Marquay-Markiewicz, Jacques; Schaap, Pauline

    2012-01-01

    Dictyostelium discoideum amoebas coordinate aggregation and morphogenesis by secreting cyclic adenosine monophosphate (cAMP) pulses that propagate as waves through fields of cells and multicellular structures. To retrace how this mechanism for self-organisation evolved, we studied the origin of the cAMP phosphodiesterase PdsA and its inhibitor PdiA, which are essential for cAMP wave propagation. D. discoideum and other species that use cAMP to aggregate reside in group 4 of the four major groups of Dictyostelia. We found that groups 1-3 express a non-specific, low affinity orthologue of PdsA, which gained cAMP selectivity and increased 200-fold in affinity in group 4. A low affinity group 3 PdsA only partially restored aggregation of a D. discoideum pdsA-null mutant, but was more effective at restoring fruiting body morphogenesis. Deletion of a group 2 PdsA gene resulted in disruption of fruiting body morphogenesis, but left aggregation unaffected. Together, these results show that groups 1-3 use a low affinity PdsA for morphogenesis that is neither suited nor required for aggregation. PdiA belongs to a family of matrix proteins that are present in all Dictyostelia and consist mainly of cysteine-rich repeats. However, in its current form with several extensively modified repeats, PdiA is only present in group 4. PdiA is essential for initiating spiral cAMP waves, which, by organising large territories, generate the large fruiting structures that characterise group 4. We conclude that efficient cAMP-mediated aggregation in group 4 evolved by recruitment and adaptation of a non-selective phosphodiesterase and a matrix component into a system for regulated cAMP degradation. PMID:22357931

  3. Atmosphere, Magnetosphere and Plasmas in Space (AMPS). Spacelab payload definition study. Volume 3, book 2: AMPS equipment to Spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The interfaces between AMPS Payload No.(TBD) and Spacelab are described. The interfaces specified cover the AMPS physical, electrical, and thermal interfaces that are established to prescribe the standard Spacelab configuration required to perform the mission. If the configuration definition changes due to change of Spacelab equipment model, or serial numbers, then reidentification of the Labcraft payload may be required.

  4. The Popeye Domain Containing Genes and cAMP Signaling

    PubMed Central

    Brand, Thomas; Poon, Kar Lai; Simrick, Subreena; Schindler, Roland F.R.

    2016-01-01

    3'-5'-cyclic adenosine monophosphate (cAMP) is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs). Initially, it was thought that protein kinase A (PKA) exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC) and hyperpolarizing cyclic nucleotide-gated (HCN) channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc) genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins. PMID:27500161

  5. Phorbol esters modulate cyclic AMP accumulation in porcine thyroid cells

    SciTech Connect

    Emoto, T.; Kasai, K.; Hiraiwa, M.; Shimoda, S.

    1988-01-01

    In cultured porcine thyroid cells, during 60 min incubation phorbol 12-myristate 13-acetate (PMA) had no effect on basal cyclic AMP accumulation and slightly stimulated cyclic AMP accumulation evoked by thyroid stimulating hormone (TSH) or forskolin. Cholera toxin-induced cyclic AMP accumulation was significantly stimulated by PMA. On the other hand, cyclic AMP accumulation evoked by prostaglandin E/sub 1/ or E/sub 2/ (PGE/sub 1/ and PGE/sub 2/) was markedly depressed by simultaneous addition of PMA. These opposing effects of PMA on cyclic AMP accumulation evoked by PGE and cholera toxin were observed in a dose-related fashion, with half-maximal effect of around 10/sup -9/ M in either case. The almost same effects of PMA on cyclic AMP accumulation in basal and stimulated conditions were also observed in freshly prepared thyroid cells. The present study was performed in the presence of phosphodiesterase inhibitor, 3-iso-butyl-1-methylxanthine (IBMX), indicating that PMA affected adenylate cyclase activity. Therefore, it is suggested that PMA may modulate the production of cyclic AMP in response to different stimuli, possibly by affecting several sites in the adenylate cyclase complex in thyroid cells.

  6. Cyclic AMP-dependent protein kinase activity in Trypanosoma cruzi.

    PubMed Central

    Ulloa, R M; Mesri, E; Esteva, M; Torres, H N; Téllez-Iñón, M T

    1988-01-01

    A cyclic AMP-dependent protein kinase activity from epimastigote forms of Trypanosoma cruzi was characterized. Cytosolic extracts were chromatographed on DEAE-cellulose columns, giving two peaks of kinase activity, which were eluted at 0.15 M- and 0.32 M-NaCl respectively. The second activity peak was stimulated by nanomolar concentrations of cyclic AMP. In addition, a cyclic AMP-binding protein co-eluted with the second kinase activity peak. Cyclic AMP-dependent protein kinase activity was further purified by gel filtration, affinity chromatography on histone-agarose and cyclic AMP-agarose, as well as by chromatography on CM-Sephadex. The enzyme ('holoenzyme') could be partially dissociated into two different components: 'catalytic' and 'regulatory'. The 'regulatory' component had specific binding for cyclic AMP, and it inhibited phosphotransferase activity of the homologous 'catalytic component' or of the 'catalytic subunit' from bovine heart. Cyclic AMP reversed these inhibitions. A 'holoenzyme preparation' was phosphorylated in the absence of exogenous phosphate acceptor and analysed by polyacrylamide-gel electrophoresis. A 56 kDa band was phosphorylated. The same preparation was analysed by Western blotting, by using polyclonal antibodies to the regulatory subunits of protein kinases type I or II. Both antibodies reacted with the 56 kDa band. Images Fig. 7. Fig. 8. PMID:2848508

  7. cAMP-induced Mitochondrial Compartment Biogenesis

    PubMed Central

    Yoboue, Edgar D.; Augier, Eric; Galinier, Anne; Blancard, Corinne; Pinson, Benoît; Casteilla, Louis; Rigoulet, Michel; Devin, Anne

    2012-01-01

    Cell fate and proliferation are tightly linked to the regulation of the mitochondrial energy metabolism. Hence, mitochondrial biogenesis regulation, a complex process that requires a tight coordination in the expression of the nuclear and mitochondrial genomes, has a major impact on cell fate and is of high importance. Here, we studied the molecular mechanisms involved in the regulation of mitochondrial biogenesis through a nutrient-sensing pathway, the Ras-cAMP pathway. Activation of this pathway induces a decrease in the cellular phosphate potential that alleviates the redox pressure on the mitochondrial respiratory chain. One of the cellular consequences of this modulation of cellular phosphate potential is an increase in the cellular glutathione redox state. The redox state of the glutathione disulfide-glutathione couple is a well known important indicator of the cellular redox environment, which is itself tightly linked to mitochondrial activity, mitochondria being the main cellular producer of reactive oxygen species. The master regulator of mitochondrial biogenesis in yeast (i.e. the transcriptional co-activator Hap4p) is positively regulated by the cellular glutathione redox state. Using a strain that is unable to modulate its glutathione redox state (Δglr1), we pinpoint a positive feedback loop between this redox state and the control of mitochondrial biogenesis. This is the first time that control of mitochondrial biogenesis through glutathione redox state has been shown. PMID:22396541

  8. AMP-18 Targets p21 to Maintain Epithelial Homeostasis

    PubMed Central

    Chen, Peili; Li, Yan Chun; Toback, F. Gary

    2015-01-01

    Dysregulated homeostasis of epithelial cells resulting in disruption of mucosal barrier function is an important pathogenic mechanism in inflammatory bowel diseases (IBD). We have characterized a novel gastric protein, Antrum Mucosal Protein (AMP)-18, that has pleiotropic properties; it is mitogenic, anti-apoptotic and can stimulate formation of tight junctions. A 21-mer synthetic peptide derived from AMP-18 exhibits the same biological functions as the full-length protein and is an effective therapeutic agent in mouse models of IBD. In this study we set out to characterize therapeutic mechanisms and identify molecular targets by which AMP-18 maintains and restores disrupted epithelial homeostasis in cultured intestinal epithelial cells and a mouse model of IBD. Tumor necrosis factor (TNF)-α, a pro-inflammatory cytokine known to mediate gastrointestinal (GI) mucosal injury in IBD, was used to induce intestinal epithelial cell injury, and study the effects of AMP-18 on apoptosis and the cell cycle. An apoptosis array used to search for targets of AMP-18 in cells exposed to TNF-α identified the cyclin-dependent kinase inhibitor p21WAF1/CIP1. Treatment with AMP-18 blunted increases in p21 expression and apoptosis, while reversing disturbed cell cycle kinetics induced by TNF-α. AMP-18 appears to act through PI3K/AKT pathways to increase p21 phosphorylation, thereby reducing its nuclear accumulation to overcome the antiproliferative effects of TNF-α. In vitamin D receptor-deficient mice with TNBS-induced IBD, the observed increase in p21 expression in colonic epithelial cells was suppressed by treatment with AMP peptide. The results indicate that AMP-18 can maintain and/or restore the homeostatic balance between proliferation and apoptosis in intestinal epithelial cells to protect and repair mucosal barrier homeostasis and function, suggesting a therapeutic role in IBD. PMID:25919700

  9. Imaging cytoplasmic cAMP in mouse brainstem neurons

    PubMed Central

    Mironov, SL; Skorova, E; Taschenberger, G; Hartelt, N; Nikolaev, VO; Lohse, MJ; Kügler, S

    2009-01-01

    Background cAMP is an ubiquitous second messenger mediating various neuronal functions, often as a consequence of increased intracellular Ca2+ levels. While imaging of calcium is commonly used in neuroscience applications, probing for cAMP levels has not yet been performed in living vertebrate neuronal tissue before. Results Using a strictly neuron-restricted promoter we virally transduced neurons in the organotypic brainstem slices which contained pre-Bötzinger complex, constituting the rhythm-generating part of the respiratory network. Fluorescent cAMP sensor Epac1-camps was expressed both in neuronal cell bodies and neurites, allowing us to measure intracellular distribution of cAMP, its absolute levels and time-dependent changes in response to physiological stimuli. We recorded [cAMP]i changes in the micromolar range after modulation of adenylate cyclase, inhibition of phosphodiesterase and activation of G-protein-coupled metabotropic receptors. [cAMP]i levels increased after membrane depolarisation and release of Ca2+ from internal stores. The effects developed slowly and reached their maximum after transient [Ca2+]i elevations subsided. Ca2+-dependent [cAMP]i transients were suppressed after blockade of adenylate cyclase with 0.1 mM adenylate cyclase inhibitor 2'5'-dideoxyadenosine and potentiated after inhibiting phosphodiesterase with isobutylmethylxanthine and rolipram. During paired stimulations, the second depolarisation and Ca2+ release evoked bigger cAMP responses. These effects were abolished after inhibition of protein kinase A with H-89 pointing to the important role of phosphorylation of calcium channels in the potentiation of [cAMP]i transients. Conclusion We constructed and characterized a neuron-specific cAMP probe based on Epac1-camps. Using viral gene transfer we showed its efficient expression in organotypic brainstem preparations. Strong fluorescence, resistance to photobleaching and possibility of direct estimation of [cAMP] levels using

  10. ADJUSTABLE DOUBLE PULSE GENERATOR

    DOEpatents

    Gratian, J.W.; Gratian, A.C.

    1961-08-01

    >A modulator pulse source having adjustable pulse width and adjustable pulse spacing is described. The generator consists of a cross coupled multivibrator having adjustable time constant circuitry in each leg, an adjustable differentiating circuit in the output of each leg, a mixing and rectifying circuit for combining the differentiated pulses and generating in its output a resultant sequence of negative pulses, and a final amplifying circuit for inverting and square-topping the pulses. (AEC)

  11. FRET measurements of intracellular cAMP concentrations and cAMP analog permeability in intact cells.

    PubMed

    Börner, Sebastian; Schwede, Frank; Schlipp, Angela; Berisha, Filip; Calebiro, Davide; Lohse, Martin J; Nikolaev, Viacheslav O

    2011-04-01

    Real-time measurements of second messengers in living cells, such as cAMP, are usually performed by ratiometric fluorescence resonance energy transfer (FRET) imaging. However, correct calibration of FRET ratios, accurate calculations of absolute cAMP levels and actual permeabilities of different cAMP analogs have been challenging. Here we present a protocol that allows precise measurements of cAMP concentrations and kinetics by expressing FRET-based cAMP sensors in cells and modulating them with an inhibitor of adenylyl cyclase activity and a cell-permeable cAMP analog that fully inhibits and activates the sensors, respectively. Using this protocol, we observed different basal cAMP levels in primary mouse cardiomyocytes, thyroid cells and in 293A cells. The protocol can be generally applied for calibration of second messenger or metabolite concentrations measured by FRET, and for studying kinetics and pharmacological properties of their membrane-permeable analogs. The complete procedure, including cell preparation and FRET measurements, takes 3-6 d. PMID:21412271

  12. High current density pulsed cathode experiments at SLAC

    SciTech Connect

    Koontz, R.; Fant, K.; Vlieks, A.

    1990-06-01

    A 1.9 microperveance beam diode has been constructed to test high current density cathodes for use in klystrons. Several standard and specially coated dispenser cathodes are being tested. Results of tests to date show average cathode current densities in excess of 25 amps/cm, and maximum electric field gradients of more than 450 kV/cm for pulses of the order of 1{mu}sec. 3 refs., 11 figs.

  13. cAMP Regulation of the lactose operon.

    PubMed

    Szeberenyi, Jozsef

    2004-05-01

    Terms to be familiar with before you start to solve the test: lactose operon, adenylate cyclase, cAMP, catabolite activator protein (CAP), expression plasmid, lac operator, lac repressor, lactose, glucose, promoter, cis- and trans-acting factors. PMID:21706723

  14. Cyclic di-AMP: another second messenger enters the fray.

    PubMed

    Corrigan, Rebecca M; Gründling, Angelika

    2013-08-01

    Nucleotide signalling molecules contribute to the regulation of cellular pathways in all forms of life. In recent years, the discovery of new signalling molecules in bacteria and archaea, as well as the elucidation of the pathways they regulate, has brought insights into signalling mechanisms not only in bacterial and archaeal cells but also in eukaryotic host cells. Here, we provide an overview of the synthesis and regulation of cyclic di-AMP (c-di-AMP), one of the latest cyclic nucleotide second messengers to be discovered in bacteria. We also discuss the currently known receptor proteins and pathways that are directly or indirectly controlled by c-di-AMP, the domain structure of the enzymes involved in its production and degradation, and the recognition of c-di-AMP by the eukaryotic host. PMID:23812326

  15. Amped Up! - Volume 1, No. 3, May/June 2015

    SciTech Connect

    2015-05-01

    Welcome to the latest issue of our bimonthly newsletter, Amped Up!, highlighting the initiatives, events and technologies in the Office of Energy Efficiency and Renewable Energy that influence change.

  16. Why Ampère did not discover electromagnetic induction

    NASA Astrophysics Data System (ADS)

    Williams, L. Pearce

    1986-04-01

    In 1832, after Michael Faraday had announced his discovery of electromagnetic induction, Andre-Marie Ampère claimed that he had actually discovered the induction of one current by another in 1822. In fact, he had, but did not really publish the fact at that time. This article explores the reasons for Ampère's failure to lay claim to a discovery that would have guaranteed him scientific immortality.

  17. Airborne Multisensor Pod System (AMPS) data management overview

    SciTech Connect

    Wiberg, J.D.; Blough, D.K.; Daugherty, W.R.; Hucks, J.A.; Gerhardstein, L.H.; Meitzler, W.D.; Melton, R.B.; Shoemaker, S.V.

    1994-09-01

    An overview of the Data Management Plan for the Airborne Multisensor Pod System (AMPS) pro-grain is provided in this document. The Pacific Northwest Laboratory (PNL) has been assigned the responsibility of data management for the program, which includes defining procedures for data management and data quality assessment. Data management is defined as the process of planning, acquiring, organizing, qualifying and disseminating data. The AMPS program was established by the U.S. Department of Energy (DOE), Office of Arms Control and Non-Proliferation (DOE/AN) and is integrated into the overall DOE AN-10.1 technology development program. Sensors used for collecting the data were developed under the on-site inspection, effluence analysis, and standoff sensor program, the AMPS program interacts with other technology programs of DOE/NN-20. This research will be conducted by both government and private industry. AMPS is a research and development program, and it is not intended for operational deployment, although the sensors and techniques developed could be used in follow-on operational systems. For a complete description of the AMPS program, see {open_quotes}Airborne Multisensor Pod System (AMPS) Program Plan{close_quotes}. The primary purpose of the AMPS is to collect high-quality multisensor data to be used in data fusion research to reduce interpretation problems associated with data overload and to derive better information than can be derived from any single sensor. To collect the data for the program, three wing-mounted pods containing instruments with sensors for collecting data will be flight certified on a U.S. Navy RP-3A aircraft. Secondary objectives of the AMPS program are sensor development and technology demonstration. Pod system integrators and instrument developers will be interested in the performance of their deployed sensors and their supporting data acquisition equipment.

  18. Design of digital hardware system for pulse signals.

    PubMed

    Lee, J; Kim, J; Lee, M

    2001-12-01

    In this study, we have developed the digital hardware system which performs signal processing necessary for the filtering to eliminate noises by inputting pulse wave signals from the sensor group. With a view to obtain clinically effective information, we analyzed structural elements of pulse waveform and, thus, conducted a systematic classification. What is more, we performed the modeling of the digital filter by using the Steiglitz-McBride iteration method in order to get the same results with output signals coming out of an galvanometer of analog type of existing Pulse diagnosis system with input signals entering into galvanometer and coming out of the amp group of the Pulse diagnosis system. PMID:11708398

  19. Long pulse production from short pulses

    DOEpatents

    Toeppen, J.S.

    1994-08-02

    A method of producing a long output pulse from a short pump pulse is disclosed, using an elongated amplified fiber having a doped core that provides an amplifying medium for light of one color when driven into an excited state by light of a shorter wavelength and a surrounding cladding. A seed beam of the longer wavelength is injected into the core at one end of the fiber and a pump pulse of the shorter wavelength is injected into the cladding at the other end of the fiber. The counter-propagating seed beam and pump pulse will produce an amplified output pulse having a time duration equal to twice the transit time of the pump pulse through the fiber plus the length of the pump pulse. 3 figs.

  20. Long pulse production from short pulses

    DOEpatents

    Toeppen, John S.

    1994-01-01

    A method of producing a long output pulse (SA) from a short pump pulse (P), using an elongated amplified fiber (11) having a doped core (12) that provides an amplifying medium for light of one color when driven into an excited state by light of a shorter wavelength and a surrounding cladding 13. A seed beam (S) of the longer wavelength is injected into the core (12) at one end of the fiber (11) and a pump pulse (P) of the shorter wavelength is injected into the cladding (13) at the other end of the fiber (11). The counter-propagating seed beam (S) and pump pulse (P) will produce an amplified output pulse (SA) having a time duration equal to twice the transit time of the pump pulse (P) through the fiber (11) plus the length of the pump pulse (P).

  1. Allostery and conformational dynamics in cAMP-binding acyltransferases.

    PubMed

    Podobnik, Marjetka; Siddiqui, Nida; Rebolj, Katja; Nambi, Subhalaxmi; Merzel, Franci; Visweswariah, Sandhya S

    2014-06-01

    Mycobacteria harbor unique proteins that regulate protein lysine acylation in a cAMP-regulated manner. These lysine acyltransferases from Mycobacterium smegmatis (KATms) and Mycobacterium tuberculosis (KATmt) show distinctive biochemical properties in terms of cAMP binding affinity to the N-terminal cyclic nucleotide binding domain and allosteric activation of the C-terminal acyltransferase domain. Here we provide evidence for structural features in KATms that account for high affinity cAMP binding and elevated acyltransferase activity in the absence of cAMP. Structure-guided mutational analysis converted KATms from a cAMP-regulated to a cAMP-dependent acyltransferase and identified a unique asparagine residue in the acyltransferase domain of KATms that assists in the enzymatic reaction in the absence of a highly conserved glutamate residue seen in Gcn5-related N-acetyltransferase-like acyltransferases. Thus, we have identified mechanisms by which properties of similar proteins have diverged in two species of mycobacteria by modifications in amino acid sequence, which can dramatically alter the abundance of conformational states adopted by a protein. PMID:24748621

  2. Regulation of cAMP by Phosphodiesterases in Erythrocytes

    PubMed Central

    Adderley, Shaquria P.; Sprague, Randy S.; Stephenson, Alan H.; Hanson, Madelyn S.

    2010-01-01

    The erythrocyte, a cell responsible for carrying and delivering oxygen in the body, has often been regarded as simply a vehicle for the circulation of hemoglobin. However, it has become evident that this cell also participates in the regulation of vascular caliber in the microcirculation via release of the potent vasodilator, adenosine triphosphate (ATP). The regulated release of ATP from erythrocytes occurs via a defined signaling pathway and requires increases in cyclic 3’ 5’ adenosine monophosphate (cAMP). It is well recognized that cAMP is a critical second messenger in diverse signaling pathways. In all cells increases in cAMP are localized and regulated by the activity of phosphodiesterases (PDEs). In erythrocytes activation of either β adrenergic receptors (β 2AR) or the prostacyclin receptor (IPR) results in increases in cAMP and ATP release. Receptor-mediated increases in cAMP are tightly regulated by distinct PDEs associated with each signaling pathway as shown by the finding that selective inhibitors of the PDEs localized to each pathway potentiate both increases in cAMP and ATP release. Here we review the profile of PDEs identified in erythrocytes, their association with specific signaling pathways and their role in the regulation of ATP release from these cells. Understanding the contribution of PDEs to the control of ATP release from erythrocytes identifies this cell as a potential target for the development of drugs for the treatment of vascular disease. PMID:20631411

  3. Dibutyryl cyclic AMP reduces the radiosensitivity of cultured endothelial cells

    SciTech Connect

    Ward, W.; Molteni, A.; Ts'ao, C.; Hinz, J. )

    1991-03-11

    The purpose of this study was to determine whether dibutyryl cyclic AMP modifies the radiosensitivity of confluent monolayers of bovine aortic endothelial cells (BAEC). Three indices of BAEC function were monitored from 4-24 hrs after exposure to 1-10 Gy of {sup 60}Co gamma rays: the release of {sup 51}Cr from prelabeled cells, and release of lactate dehydrogenase (LDH) and plasminogen activator (PLA) into the culture medium. There was a time- and radiation dose-dependent increase in {sup 51}Cr, LDH and PLA release from the BAEC, detectable within 12 hrs after 5 Gy or higher, and by 24 hrs after 1 Gy or higher. This increased release was accompanied by a radiation dose-dependent decrease in {sup 51}Cr and LDH, and an increase in PLA activity in the lysate of cells adherent to the monolayer at 24 hrs. The continuous presence of cAMP from 1 hr before to 24 hrs after irradiation reduced all of these radiation reactions, although mM concentrations of cAMP were required for significant sparing. The presence of cAMP from 1 hr before to 10 min after irradiation had no effect on BAEC sensitivity, whereas cAMP added 10 min after irradiation was fully as effective as continuously administered drug. Thus, cultured BAEC exhibit membrane dysfunction within 24 hrs after clinically relevant radiation doses, and this dysfunction is ameliorated by cAMP present after irradiation.

  4. MEK Inhibitors Reverse cAMP-Mediated Anxiety in Zebrafish

    PubMed Central

    Lundegaard, Pia R.; Anastasaki, Corina; Grant, Nicola J.; Sillito, Rowland R.; Zich, Judith; Zeng, Zhiqiang; Paranthaman, Karthika; Larsen, Anders Peter; Armstrong, J. Douglas; Porteous, David J.; Patton, E. Elizabeth

    2015-01-01

    Summary Altered phosphodiesterase (PDE)-cyclic AMP (cAMP) activity is frequently associated with anxiety disorders, but current therapies act by reducing neuronal excitability rather than targeting PDE-cAMP-mediated signaling pathways. Here, we report the novel repositioning of anti-cancer MEK inhibitors as anxiolytics in a zebrafish model of anxiety-like behaviors. PDE inhibitors or activators of adenylate cyclase cause behaviors consistent with anxiety in larvae and adult zebrafish. Small-molecule screening identifies MEK inhibitors as potent suppressors of cAMP anxiety behaviors in both larvae and adult zebrafish, while causing no anxiolytic behavioral effects on their own. The mechanism underlying cAMP-induced anxiety is via crosstalk to activation of the RAS-MAPK signaling pathway. We propose that targeting crosstalk signaling pathways can be an effective strategy for mental health disorders, and advance the repositioning of MEK inhibitors as behavior stabilizers in the context of increased cAMP. PMID:26388333

  5. Activation of AMP-kinase by Policosanol Requires Peroxisomal Metabolism

    PubMed Central

    Banerjee, Subhashis; Ghoshal, Sarbani

    2011-01-01

    Policosanol, a well-defined mixture of very long chain primary alcohols that is available as a nutraceutical product, has been reported to lower blood cholesterol levels. The present studies demonstrate that policosanol promotes the phosphorylation of AMP-kinase and HMG-CoA reductase in hepatoma cells and in mouse liver after intragastric administration, providing a possible means by which policosanol might lower blood cholesterol levels. Treatment of hepatoma cells with policosanol produced a 2.5-fold or greater increase in the phosphorylation of AMP-kinase and HMG-CoA reductase, and increased the phosphorylation of Ca++/calmodulin-dependent kinase kinase (CaMKK), an upstream AMP-kinase kinase. Intra-gastric administration of policosanol to mice similarly increased the phosphorylation of hepatic HMG-CoA reductase and AMP-kinase by greater than 2-fold. siRNA-mediated suppression of fatty aldehyde dehydrogenase, fatty acyl-CoA synthetase 4, and acyl-CoA acetyltransferase expression in hepatoma cells prevented the phosphorylation of AMP-kinase and HMG-CoA reductase by policosanol, indicating that metabolism of these very long chain alcohols to activated fatty acids is necessary for the suppression of cholesterol synthesis, presumably by increasing cellular AMP levels. Subsequent peroxisomal β-oxidation probably augments this effect. PMID:21359855

  6. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 2: AMPS payload to spacelab ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    The AMPS to Spacelab Interface Control Document which is to be used as a guide for format and information content in generating specific AMPS Mission ICDs is presented. This document is meant to supplement the Spacelab Payload Accommodations Handbook in that it only defines interfaces which are not discussed in the handbook to the level required for design purposes. The AMPS Top Level Requirements Tree, illustrates this ICD by a shaded area and its relationship to the other AMPS technical documents. Other interface documents shown are the Level II, AMPS to Space Shuttle Vehicle ICD and the Level III, AMPS to Instruments ICD.

  7. β-Adrenergic cAMP Signals Are Predominantly Regulated by Phosphodiesterase Type 4 in Cultured Adult Rat Aortic Smooth Muscle Cells

    PubMed Central

    Nicolas, Valérie; Ji, Guangju; Fischmeister, Rodolphe; Leblais, Véronique

    2012-01-01

    Background We investigated the role of cyclic nucleotide phosphodiesterases (PDEs) in the spatiotemporal control of intracellular cAMP concentrations in rat aortic smooth muscle cells (RASMCs). Methodology/Principal Findings The rank order of PDE families contributing to global cAMP-PDE activity was PDE4> PDE3  =  PDE1. PDE7 mRNA expression but not activity was confirmed. The Fluorescence Resonance Energy Transfer (FRET)-based cAMP sensor, Epac1-camps, was used to monitor the time course of cytosolic cAMP changes. A pulse application of the β-adrenoceptor (β-AR) agonist isoproterenol (Iso) induced a transient FRET signal. Both β1- and β2-AR antagonists decreased the signal amplitude without affecting its kinetics. The non-selective PDE inhibitor (IBMX) dramatically increased the amplitude and delayed the recovery phase of Iso response, in agreement with a role of PDEs in degrading cAMP produced by Iso. Whereas PDE1, PDE3 and PDE7 blockades [with MIMX, cilostamide (Cil) and BRL 50481 (BRL), respectively] had no or minor effect on Iso response, PDE4 inhibition [with Ro-20-1724 (Ro)] strongly increased its amplitude and delayed its recovery. When Ro was applied concomitantly with MIMX or Cil (but not with BRL), the Iso response was drastically further prolonged. PDE4 inhibition similarly prolonged both β1- and β2-AR-mediated responses. When a membrane-targeted FRET sensor was used, PDE3 and PDE4 acted in a synergistic manner to hydrolyze the submembrane cAMP produced either at baseline or after β-AR stimulation. Conclusion/Significance Our study underlines the importance of cAMP-PDEs in the dynamic control of intracellular cAMP signals in RASMCs, and demonstrates the prominent role of PDE4 in limiting β-AR responses. PDE4 inhibition unmasks an effect of PDE1 and PDE3 on cytosolic cAMP hydrolyzis, and acts synergistically with PDE3 inhibition at the submembrane compartment. This suggests that mixed PDE4/PDE1 or PDE4/PDE3 inhibitors would be attractive to

  8. Prevalence and molecular epidemiology of acquired AmpC β-lactamases and carbapenemases in Enterobacteriaceae isolates from 35 hospitals in Spain.

    PubMed

    Miró, E; Agüero, J; Larrosa, M N; Fernández, A; Conejo, M C; Bou, G; González-López, J J; Lara, N; Martínez-Martínez, L; Oliver, A; Aracil, B; Oteo, J; Pascual, A; Rodríguez-Baño, J; Zamorano, L; Navarro, F

    2013-02-01

    The purpose of this investigation was to determine the prevalence of plasmid-mediated AmpC (pAmpC) and carbapenemases in Enterobacteriaceae collected from 35 hospitals in Spain and to establish their epidemiological relationships. We conducted a prospective multi-centre study on pAmpC- or carbapenemase-producing Enterobacteriaceae isolates from clinical samples collected from February to July 2009. The strains suspected to carry pAmpC were resistant or showed intermediate susceptibility to co-amoxiclav and second- or third-generation cephalosporins. Strains suspected to carry a carbapenemase were selected because they showed a minimum inhibitory concentration (MIC) to imipenem >1 mg/L. Polymerase chain reaction (PCR) and a sequencing strategy were used to characterise the enzymes. The clonal relationships between isolates was analysed by pulsed field gel electrophoresis (PFGE). Among 100,132 Enterobacteriaceae isolates collected, 1,654 were compatible with the production of pAmpC or carbapenemases. We found a prevalence of 0.64 % of pAmpC (n = 635) and 0.04 % of carbapenemases (n = 43). The most prevalent pAmpC enzymes were CMY-type (78.3 %), DHA-type (19.5 %), ACC-type (1.6 %) and FOX-type (0.6 %). The CMY-type was the most frequent in Escherichia coli and Proteus mirabilis species, whereas the DHA-type was mainly found in Klebsiella spp. The enzymes involved in carbapenem resistance were VIM-1, IMP-22 and the new IMP-28. Nine new bla genes were described: bla (CMY-54), bla (CMY-55), bla (CMY-56), bla (CMY-57), bla (CMY-96), bla (DHA-6), bla (DHA-7), bla (FOX-8) and bla (IMP-28). The prevalence of pAmpC or carbapenemases found is not negligible. The CMY-types were the predominant pAmpC, whereas the VIM or IMP enzymes were the predominant carbapenemases. Furthermore, we observed a great genetic diversity among pAmpC-producing strains and a close clonal relationship between carbapenemase-producing strains. PMID:22956023

  9. Insulin alters cAMP-activated lipolysis but not cAMP-inhibited glycogen synthase in permeabilized adipocytes

    SciTech Connect

    Mooney, R.A.; Wisniewski, J.L.

    1986-05-01

    Lipolysis and, to a lesser extent, glycogen synthase activity are regulated in adipocytes by cellular cAMP and counter-regulated by insulin. These activities were measured in situ in digitonin (20 ..mu..g/ml) permeabilized rat adipocytes. Incorporation of /sup 3/H UDP-glucose into endogenous glycogen in the presence of KF, EDTA and 10mM glucose-6-phosphate was the basis of the G.S. assay. Cellular GS activity determined by this technique was 1.4 +/- 0.2 fold greater than that of matched homogenates. Insulin treatment of intact cells prior to permeabilization increased GS activity ratio (-/+ G-6-P) 2.5 fold when subsequently measured by the in situ assay. Following digitonin permeabilization, addition of cAMP to the suspension medium increased lipolysis 7 fold and decreased GS activity ratio to 0.38 +/- 0.01 from a basal value of 0.44 +/- 0.06. ATP had a negligible effect on lipolysis but decreased GS to 0.16 +/- 0.04. ATP plus cAMP was only slightly more effective on GS than ATP alone. Insulin at 10/sup -9/M inhibited cAMP-dependent lipolysis by 27% but had no effect on the cAMP- or ATP-dependent decrease in GS. These results suggest that insulin's counter-regulatory mechanisms on these two cAMP-dependent processes may be different.

  10. In vitro and in vivo characterization of the Pseudomonas aeruginosa cyclic AMP (cAMP) phosphodiesterase CpdA, required for cAMP homeostasis and virulence factor regulation.

    PubMed

    Fuchs, Erin L; Brutinel, Evan D; Klem, Erich R; Fehr, Anthony R; Yahr, Timothy L; Wolfgang, Matthew C

    2010-06-01

    Cyclic AMP (cAMP) is an important second messenger signaling molecule that controls a wide variety of eukaryotic and prokaryotic responses to extracellular cues. For cAMP-dependent signaling pathways to be effective, the intracellular cAMP concentration is tightly controlled at the level of synthesis and degradation. In the opportunistic human pathogen Pseudomonas aeruginosa, cAMP is a key regulator of virulence gene expression. To better understand the role of cAMP homeostasis in this organism, we identified and characterized the enzyme CpdA, a putative cAMP phosphodiesterase. We demonstrate that CpdA possesses 3',5'-cAMP phosphodiesterase activity in vitro and that it utilizes an iron-dependent catalytic mechanism. Deletion of cpdA results in the accumulation of intracellular cAMP and altered regulation of P. aeruginosa virulence traits. Further, we demonstrate that the cAMP-dependent transcription factor Vfr directly regulates cpdA expression in response to intracellular cAMP accumulation, thus providing a feedback mechanism for controlling cAMP levels and fine-tuning virulence factor expression. PMID:20348254

  11. Exploring intense attosecond pulses

    NASA Astrophysics Data System (ADS)

    Charalambidis, D.; Tzallas, P.; Benis, E. P.; Skantzakis, E.; Maravelias, G.; Nikolopoulos, L. A. A.; Peralta Conde, A.; Tsakiris, G. D.

    2008-02-01

    After introducing the importance of non-linear processes in the extreme-ultra-violet (XUV) spectral regime to the attosecond (asec) pulse metrology and time domain applications, we present two successfully implemented techniques with excellent prospects in generating intense asec pulse trains and isolated asec pulses, respectively. For the generation of pulse trains two-color harmonic generation is exploited. The interferometric polarization gating technique appropriate for the generation of intense isolated asec pulses is discussed and compared to other relevant approaches.

  12. Multifunctional pulse sequence generator for pulse NMR

    NASA Astrophysics Data System (ADS)

    Wang, Dongsheng

    1988-06-01

    A new multifunctional pulse sequence generator has been designed and constructed. It can conveniently generate various pulse sequences used in nuclear-magnetic resonance (NMR) to measure the spin-lattice relaxation time T1, the spin-spin relaxation time T2, and the spin-locking relaxation time T1 ρ. It can also be used in pulse Fourier transform NMR and double resonance. The intervals of pulses can increase automatically with sequence repetitions and the generator can be used in two-dimensional spectrum measurement and spin-density imaging research. The sequences can be generated through four different triggering methods and there are two synchronous pulse outputs and fifteen auxiliary pulse outputs, so the generator can be conveniently interfaced with a computer or other instruments. The circuitry, functions, and features of the generator are described in this article.

  13. DIFFERENTIAL PULSE HEIGHT DISCRIMINATOR

    DOEpatents

    Test, L.D.

    1958-11-11

    Pulse-height discriminators are described, specifically a differential pulse-height discriminator which is adapted to respond to pulses of a band of amplitudes, but to reject pulses of amplitudes greater or less than tbe preselected band. In general, the discriminator includes a vacuum tube having a plurality of grids adapted to cut off plate current in the tube upon the application of sufficient negative voltage. One grid is held below cutoff, while a positive pulse proportional to the amplltude of each pulse is applled to this grid. Another grid has a negative pulse proportional to the amplitude of each pulse simultaneously applied to it. With this arrangement the tube will only pass pulses which are of sufficlent amplitude to counter the cutoff bias but not of sufficlent amplitude to cutoff the tube.

  14. [cAMP cascade in regulation of protein glycosylation].

    PubMed

    Surman, Magdalena; Janik, Marcelina

    2014-01-01

    O- and N-glycosylation are the most common and complex of the post-translational modifications. Both are enzymatic processes and it was suggested that both could be regulated by cAMP cascade at the early stages. N-glycosylation starts with the formation of lipid-linked oligosaccharides and this process is catalysed by crucial glycosyltransferase - dolichol phosphate mannose synthase. The results of several studies strongly suggest that the cAMP acting through a cAMP-dependent protein kinase A-mediated protein phosphorylation/dephosphorylation cycle may modulate activation of this enzyme. It was shown that cAMP can also up regulate another enzyme involved in phosphodolichole synthesis - cis-prenyltransferase. The mechanism acting here is the alteration of the rate of its gene expression. cAMP cascade is also involved in regulation of O-glycosylation since phosphorylation of human glutamine:fructose-6-phosphate amidotransferase results in depletion of O-GlcNAc structure formation. These observation suggested an important role of GPCRs and their ligand in regulation of N- and O-glycan synthesis. PMID:26263760

  15. Cyclic AMP Regulates Social Behavior in African Trypanosomes

    PubMed Central

    Oberholzer, Michael; Saada, Edwin A.

    2015-01-01

    ABSTRACT The protozoan parasite Trypanosoma brucei engages in surface-induced social behavior, termed social motility, characterized by single cells assembling into multicellular groups that coordinate their movements in response to extracellular signals. Social motility requires sensing and responding to extracellular signals, but the underlying mechanisms are unknown. Here we report that T. brucei social motility depends on cyclic AMP (cAMP) signaling systems in the parasite’s flagellum (synonymous with cilium). Pharmacological inhibition of cAMP-specific phosphodiesterase (PDE) completely blocks social motility without impacting the viability or motility of individual cells. Using a fluorescence resonance energy transfer (FRET)-based sensor to monitor cAMP dynamics in live cells, we demonstrate that this block in social motility correlates with an increase in intracellular cAMP levels. RNA interference (RNAi) knockdown of the flagellar PDEB1 phenocopies pharmacological PDE inhibition, demonstrating that PDEB1 is required for social motility. Using parasites expressing distinct fluorescent proteins to monitor individuals in a genetically heterogeneous community, we found that the social motility defect of PDEB1 knockdowns is complemented by wild-type parasites in trans. Therefore, PDEB1 knockdown cells are competent for social motility but appear to lack a necessary factor that can be provided by wild-type cells. The combined data demonstrate that the role of cyclic nucleotides in regulating microbial social behavior extends to African trypanosomes and provide an example of transcomplementation in parasitic protozoa. PMID:25922395

  16. Profound Asymmetry in the Structure of the cAMP-free cAMP Receptor Protein (CRP) from Mycobacterium tuberculosis

    SciTech Connect

    Gallagher, D.; Smith, N; Kim, S; Robinson, H; Reddy, P

    2009-01-01

    The cyclic AMP receptor protein (CRP, also called catabolite gene activator protein or CAP) plays a key role in metabolic regulation in bacteria and has become a widely studied model allosteric transcription factor. On binding its effector cAMP in the N-terminal domain, CRP undergoes a structural transition to a conformation capable of specific DNA binding in the C-terminal domain and transcription initiation. The crystal structures of Escherichia coli CRP (EcCRP) in the cAMP-bound state, both with and without DNA, are known, although its structure in the off state (cAMP-free, apoCRP) remains unknown. We describe the crystal structure at 2.0A resolution of the cAMP-free CRP homodimer from Mycobacterium tuberculosis H37Rv (MtbCRP), whose sequence is 30% identical with EcCRP, as the first reported structure of an off-state CRP. The overall structure is similar to that seen for the cAMP-bound EcCRP, but the apo MtbCRP homodimer displays a unique level of asymmetry, with a root mean square deviation of 3.5A between all C? positions in the two subunits. Unlike structures of on-state EcCRP and other homologs in which the C-domains are asymmetrically positioned but possess the same internal conformation, the two C-domains of apo MtbCRP differ both in hinge structure and in internal arrangement, with numerous residues that have completely different local environments and hydrogen bond interactions, especially in the hinge and DNA-binding regions. Comparison of the structures of apo MtbCRP and DNA-bound EcCRP shows how DNA binding would be inhibited in the absence of cAMP and supports a mechanism involving functional asymmetry in apoCRP.

  17. Laser pulse stacking method

    DOEpatents

    Moses, Edward I.

    1992-01-01

    A laser pulse stacking method is disclosed. A problem with the prior art has been the generation of a series of laser beam pulses where the outer and inner regions of the beams are generated so as to form radially non-synchronous pulses. Such pulses thus have a non-uniform cross-sectional area with respect to the outer and inner edges of the pulses. The present invention provides a solution by combining the temporally non-uniform pulses in a stacking effect to thus provide a more uniform temporal synchronism over the beam diameter.

  18. Nerve-pulse interactions

    SciTech Connect

    Scott, A.C.

    1982-01-01

    Some recent experimental and theoretical results on mechanisms through which individual nerve pulses can interact are reviewed. Three modes of interactions are considered: (1) interaction of pulses as they travel along a single fiber which leads to velocity dispersion; (2) propagation of pairs of pulses through a branching region leading to quantum pulse code transformations; and (3) interaction of pulses on parallel fibers through which they may form a pulse assembly. This notion is analogous to Hebb's concept of a cell assembly, but on a lower level of the neural hierarchy.

  19. Laser pulse stacking method

    DOEpatents

    Moses, E.I.

    1992-12-01

    A laser pulse stacking method is disclosed. A problem with the prior art has been the generation of a series of laser beam pulses where the outer and inner regions of the beams are generated so as to form radially non-synchronous pulses. Such pulses thus have a non-uniform cross-sectional area with respect to the outer and inner edges of the pulses. The present invention provides a solution by combining the temporally non-uniform pulses in a stacking effect to thus provide a more uniform temporal synchronism over the beam diameter. 2 figs.

  20. Intracellular tortuosity underlies slow cAMP diffusion in adult ventricular myocytes

    PubMed Central

    Richards, Mark; Lomas, Oliver; Jalink, Kees; Ford, Kerrie L.; Vaughan-Jones, Richard D.; Lefkimmiatis, Konstantinos; Swietach, Pawel

    2016-01-01

    Aims 3′,5′-Cyclic adenosine monophosphate (cAMP) signals in the heart are often confined to concentration microdomains shaped by cAMP diffusion and enzymatic degradation. While the importance of phosphodiesterases (degradative enzymes) in sculpting cAMP microdomains is well established in cardiomyocytes, less is known about cAMP diffusivity (DcAMP) and factors affecting it. Many earlier studies have reported fast diffusivity, which argues against sharply defined microdomains. Methods and results [cAMP] dynamics in the cytoplasm of adult rat ventricular myocytes were imaged using a fourth generation genetically encoded FRET-based sensor. The [cAMP]-response to the addition and removal of isoproterenol (β-adrenoceptor agonist) quantified the rates of cAMP synthesis and degradation. To obtain a read out of DcAMP, a stable [cAMP] gradient was generated using a microfluidic device which delivered agonist to one half of the myocyte only. After accounting for phosphodiesterase activity, DcAMP was calculated to be 32 µm2/s; an order of magnitude lower than in water. Diffusivity was independent of the amount of cAMP produced. Saturating cAMP-binding sites with the analogue 6-Bnz-cAMP did not accelerate DcAMP, arguing against a role of buffering in restricting cAMP mobility. cAMP diffused at a comparable rate to chemically unrelated but similar sized molecules, arguing for a common physical cause of restricted diffusivity. Lower mitochondrial density and order in neonatal cardiac myocytes allowed for faster diffusion, demonstrating the importance of mitochondria as physical barriers to cAMP mobility. Conclusion In adult cardiac myocytes, tortuosity due to physical barriers, notably mitochondria, restricts cAMP diffusion to levels that are more compatible with microdomain signalling. PMID:27089919

  1. cAMP Sensor EPAC Proteins and Energy Homeostasis

    PubMed Central

    Almahariq, Muayad; Mei, Fang C.; Cheng, Xiaodong

    2013-01-01

    The pleotropic second messenger cAMP plays a critical role in mediating the effects of various hormones on metabolism. The major intracellular functions of cAMP are transduced by protein kinase A (PKA) and exchange proteins directly activated by cAMP (EPACs). The latter act as guanine nucleotide exchange factors for the RAS-like small G-proteins Rap1 and Rap2. While the role of PKA in regulating energy balance has been extensively studied, EPACs’ impact remains relatively enigmatic. This review summarizes recent genetic and pharmacological studies concerning EPACs’ involvement in glucose homeostasis and energy balance, through regulation of leptin and insulin signaling pathways. Additionally, the development of small molecule EPAC-specific modulators and their therapeutic potential for the treatment of diabetes and obesity are discussed. PMID:24231725

  2. Cyclic AMP system in muscle tissue during prolonged hypokinesia

    NASA Technical Reports Server (NTRS)

    Antipenko, Y. A.; Bubeyev, Y. A.; Korovkin, B. F.; Mikhaleva, N. P.

    1980-01-01

    Components of the cyclic Adenosine-cyclic-35-monophosphate (AMP) system in the muscle tissue of white rats were studied during 70-75 days of hypokinesia, created by placing the animals in small booths which restricted their movements, and during the readaptation period. In the initial period, cyclic AMP levels and the activities of phosphodiesterase and adenylate cyclase in muscle tissue were increased. The values for these indices were roughly equal for controls and experimental animals during the adaptation period, but on the 70th day of the experiment cAMP levels dropped, phosphodiesterase activity increased, and the stimulative effect of epinephrine on the activity of adenylate cyclase decreased. The indices under study normalized during the readaptation period.

  3. Pulse to pulse klystron diagnosis system

    SciTech Connect

    Nowak, J.; Davidson, V.; Genova, L.; Johnson, R.; Reagan, D.

    1981-03-01

    This report describes a system used to study the behavior of SLAC high powered klystrons operating with a twice normal pulse width of 5 ..mu..s. At present, up to eight of the klystrons installed along the accelerator can be operated with long pulses and monitored by this system. The report will also discuss some of the recent findings and investigations.

  4. Effect of positive pulse charge waveforms on the energy efficiency of lead-acid traction cells

    NASA Technical Reports Server (NTRS)

    Smithrick, J. J.

    1981-01-01

    The effects of four different charge methods on the energy conversion efficiency of 300 ampere hour lead acid traction cells were investigated. Three of the methods were positive pulse charge waveforms; the fourth, a constant current method, was used as a baseline of comparison. The positive pulse charge waveforms were: 120 Hz full wave rectified sinusoidal; 120 Hz silicon controlled rectified; and 1 kHz square wave. The constant current charger was set at the time average pulse current of each pulse waveform, which was 150 amps. The energy efficiency does not include charger losses. The lead acid traction cells were charged to 70 percent of rated ampere hour capacity in each case. The results of charging the cells using the three different pulse charge waveforms indicate there was no significant difference in energy conversion efficiency when compared to constant current charging at the time average pulse current value.

  5. Transcriptomic analysis of cyclic AMP response in bovine cumulus cells.

    PubMed

    Khan, D R; Guillemette, C; Sirard, M A; Richard, F J

    2015-09-01

    Acquisition of oocyte developmental competence needs to be understood to improve clinical outcomes of assisted reproduction. The stimulation of cumulus cell concentration of cyclic adenosine 3'5'-monophosphate (cAMP) by pharmacological agents during in vitro maturation (IVM) participates in improvement of oocyte quality. However, precise coordination and downstream targets of cAMP signaling in cumulus cells are largely unknown. We have previously demonstrated better embryo development after cAMP stimulation for first 6 h during IVM. Using this model, we investigated cAMP signaling in cumulus cells through in vitro culture of cumulus-oocyte complexes (COCs) in the presence of cAMP raising agents: forskolin, IBMX, and dipyridamole (here called FID treatment). Transcriptomic analysis of cumulus cells indicated that FID-induced differentially expressed transcripts were implicated in cumulus expansion, steroidogenesis, cell metabolism, and oocyte competence. Functional genomic analysis revealed that protein kinase-A (PKA), extracellular signal regulated kinases (ERK1/2), and calcium (Ca(2+)) pathways as key regulators of FID signaling. Inhibition of PKA (H89) in FID-supplemented COCs or substitution of FID with calcium ionophore (A23187) demonstrated that FID activated primarily the PKA pathway which inhibited ERK1/2 phosphorylation and was upstream of calcium signaling. Furthermore, inhibition of ERK1/2 phosphorylation by FID supported a regulation by dual specific phosphatase (DUSP1) via PKA. Our findings imply that cAMP (FID) regulates cell metabolism, steroidogenesis, intracellular signaling and cumulus expansion through PKA which modulates these functions through optimization of ERK1/2 phosphorylation and coordination of calcium signaling. These findings have implications for development of new strategies for improving oocyte in vitro maturation leading to better developmental competence. PMID:26082143

  6. Toxoplasma gondii Cyclic AMP-Dependent Protein Kinase Subunit 3 Is Involved in the Switch from Tachyzoite to Bradyzoite Development

    PubMed Central

    Sugi, Tatsuki; Ma, Yan Fen; Tomita, Tadakimi; Murakoshi, Fumi; Eaton, Michael S.; Yakubu, Rama; Han, Bing; Tu, Vincent; Kato, Kentaro; Kawazu, Shin-Ichiro; Gupta, Nishith; Suvorova, Elena S.; White, Michael W.; Kim, Kami

    2016-01-01

    ABSTRACT Toxoplasma gondii is an obligate intracellular apicomplexan parasite that infects warm-blooded vertebrates, including humans. Asexual reproduction in T. gondii allows it to switch between the rapidly replicating tachyzoite and quiescent bradyzoite life cycle stages. A transient cyclic AMP (cAMP) pulse promotes bradyzoite differentiation, whereas a prolonged elevation of cAMP inhibits this process. We investigated the mechanism(s) by which differential modulation of cAMP exerts a bidirectional effect on parasite differentiation. There are three protein kinase A (PKA) catalytic subunits (TgPKAc1 to -3) expressed in T. gondii. Unlike TgPKAc1 and TgPKAc2, which are conserved in the phylum Apicomplexa, TgPKAc3 appears evolutionarily divergent and specific to coccidian parasites. TgPKAc1 and TgPKAc2 are distributed in the cytomembranes, whereas TgPKAc3 resides in the cytosol. TgPKAc3 was genetically ablated in a type II cyst-forming strain of T. gondii (PruΔku80Δhxgprt) and in a type I strain (RHΔku80Δhxgprt), which typically does not form cysts. The Δpkac3 mutant exhibited slower growth than the parental and complemented strains, which correlated with a higher basal rate of tachyzoite-to-bradyzoite differentiation. 3-Isobutyl-1-methylxanthine (IBMX) treatment, which elevates cAMP levels, maintained wild-type parasites as tachyzoites under bradyzoite induction culture conditions (pH 8.2/low CO2), whereas the Δpkac3 mutant failed to respond to the treatment. This suggests that TgPKAc3 is the factor responsible for the cAMP-dependent tachyzoite maintenance. In addition, the Δpkac3 mutant had a defect in the production of brain cysts in vivo, suggesting that a substrate of TgPKAc3 is probably involved in the persistence of this parasite in the intermediate host animals. PMID:27247232

  7. AKAPs: The Architectural Underpinnings of Local cAMP signaling

    PubMed Central

    Kritzer, Michael D.; Li, Jinliang; Dodge-Kafka, Kimberly; Kapiloff, Michael S.

    2011-01-01

    The cAMP-dependent protein kinase A (PKA) is targeted to specific compartments in the cardiac myocyte by A-kinase anchoring proteins (AKAPs), a diverse set of scaffold proteins that have been implicated in the regulation of excitation-contraction coupling and cardiac remodeling. AKAPs bind not only PKA, but also a large variety of structural and signaling molecules. In this review, we discuss the basic concepts underlying compartmentation of cAMP and PKA signaling, as well as a few of the individual AKAPs that have been shown to be functionally relevant in the heart. PMID:21600214

  8. Regulation and organization of adenylyl cyclases and cAMP.

    PubMed Central

    Cooper, Dermot M F

    2003-01-01

    Adenylyl cyclases are a critically important family of multiply regulated signalling molecules. Their susceptibility to many modes of regulation allows them to integrate the activities of a variety of signalling pathways. However, this property brings with it the problem of imparting specificity and discrimination. Recent studies are revealing the range of strategies utilized by the cyclases to solve this problem. Microdomains are a consequence of these solutions, in which cAMP dynamics may differ from the broad cytosol. Currently evolving methodologies are beginning to reveal cAMP fluctuations in these various compartments. PMID:12940771

  9. Developmental regulation of expression of the regulatory subunit of the cAMP-dependent protein kinase of Blastocladiella emersonii.

    PubMed

    Marques, M do V; Juliani, M H; Maia, J C; Gomes, S L

    1989-01-01

    A monospecific polyclonal antiserum to the regulatory subunit (R) of the cAMP-dependent protein kinase of Blastocladiella emersonii has been developed by immunization with purified regulatory subunit. In Western blots, the antiserum displays high affinity and specificity for the intact R monomer of Mr = 58,000, as well as for its proteolytic products of Mr = 43,000 and Mr = 36,000, even though the antiserum has been raised against the Mr = 43,000 fragment. Western blots of cell extracts prepared at different times during the life cycle of the fungus indicate that the increase in cAMP-binding activity occurring during sporulation, as well as its decrease during germination, are associated with the accumulation of the regulatory subunit during sporulation and its disappearance during germination, respectively. Pulse labeling with [35S]methionine and immunoprecipitation indicate that the accumulation of R is due to its increased synthesis during sporulation. Two-dimensional gel electrophoresis of affinity purified cell extracts obtained after [35S]methionine pulse labeling during sporulation confirms de novo synthesis of R during this stage and furthermore shows that the protein is rapidly phosphorylated after its synthesis. In vitro translation studies using RNA isolated from different stages of the life cycle followed by immunoprecipitation have shown that the time course of expression of the mRNA coding for the regulatory subunit parallels the rate of its synthesis in vivo. PMID:2912735

  10. Radial pulse (image)

    MedlinePlus

    ... heart. The arteries are the vessels with the "pulse", a rhythmic pushing of the blood in the ... a refilling of the heart chamber. To determine heart rate, one feels the beats at a pulse point ...

  11. Wrist pulse (image)

    MedlinePlus

    To measure the pulse at the wrist, place the index and middle finger over the underside of the opposite wrist, below the base ... firmly with flat fingers until you feel the pulse in the radial artery.

  12. Alternate drop pulse polarography

    USGS Publications Warehouse

    Christie, J.H.; Jackson, L.L.; Osteryoung, R.A.

    1976-01-01

    The new technique of alternate drop pulse polarography is presented. An experimental evaluation of alternate drop pulse polarography shows complete compensation of the capacitative background due to drop expansion. The capillary response phenomenon was studied in the absence of faradaic reaction and the capillary response current was found to depend on the pulse width to the -0.72 power. Increased signal-to-noise ratios were obtained using alternate drop pulse polarography at shorter drop times.

  13. Electrical pulse generator

    DOEpatents

    Norris, Neil J.

    1979-01-01

    A technique for generating high-voltage, wide dynamic range, shaped electrical pulses in the nanosecond range. Two transmission lines are coupled together by resistive elements distributed along the length of the lines. The conductance of each coupling resistive element as a function of its position along the line is selected to produce the desired pulse shape in the output line when an easily produced pulse, such as a step function pulse, is applied to the input line.

  14. Optically pulsed electron accelerator

    DOEpatents

    Fraser, J.S.; Sheffield, R.L.

    1985-05-20

    An optically pulsed electron accelerator can be used as an injector for a free electron laser and comprises a pulsed light source, such as a laser, for providing discrete incident light pulses. A photoemissive electron source emits electron bursts having the same duration as the incident light pulses when impinged upon by same. The photoemissive electron source is located on an inside wall of a radiofrequency-powered accelerator cell which accelerates the electron burst emitted by the photoemissive electron source.

  15. Optically pulsed electron accelerator

    DOEpatents

    Fraser, John S.; Sheffield, Richard L.

    1987-01-01

    An optically pulsed electron accelerator can be used as an injector for a free electron laser and comprises a pulsed light source, such as a laser, for providing discrete incident light pulses. A photoemissive electron source emits electron bursts having the same duration as the incident light pulses when impinged upon by same. The photoemissive electron source is located on an inside wall of a radio frequency powered accelerator cell which accelerates the electron burst emitted by the photoemissive electron source.

  16. Constant potential pulse polarography

    USGS Publications Warehouse

    Christie, J.H.; Jackson, L.L.; Osteryoung, R.A.

    1976-01-01

    The new technique of constant potential pulse polarography, In which all pulses are to be the same potential, is presented theoretically and evaluated experimentally. The response obtained is in the form of a faradaic current wave superimposed on a constant capacitative component. Results obtained with a computer-controlled system exhibit a capillary response current similar to that observed In normal pulse polarography. Calibration curves for Pb obtained using a modified commercial pulse polarographic instrument are in good accord with theoretical predictions.

  17. Formation of dAMP-glycerol and dAMP-Tris Derivatives by Thermococcus kodakaraensis DNA Primase*

    PubMed Central

    Chemnitz Galal, Wiebke; Pan, Miao; Giulian, Gary; Yuan, Wei; Li, Shuwei; Edwards, James L.; Marino, John P.; Kelman, Zvi; Hurwitz, Jerard

    2012-01-01

    In the presence of dATP, glycerol, and Tris buffer, the DNA primase isolated from Thermococcus kodakaraensis catalyzed the formation of dAMP and two products that were identified as dAMP-glycerol and dAMP-Tris. These products were formed by the T. kodakaraensis p41 catalytic subunit alone and the T. kodakaraensis p41-p46 complex in the absence of a DNA template. They were not formed with preparations containing the catalytically inactive p41 subunit. Similar glycerol and Tris derivatives as well as dNMPs were also formed with dGTP, dCTP, or dTTP. The mechanism contributing to the formation of these products and its implications in the initiation reaction catalyzed by the T. kodakaraensis primase are discussed. PMID:22427647

  18. Direct regulation of the natural competence regulator gene tfoX by cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Vibrios

    PubMed Central

    Wu, Rui; Zhao, Meng; Li, Jing; Gao, He; Kan, Biao; Liang, Weili

    2015-01-01

    TfoX (Sxy) and CRP are two important competence activators. The link between tfoX and CRP has been shown in H. influenza but lacking evidence of direct interaction. Recently a Sxy-dependent CRP (CRP-S) site autoregulating Sxy was reported in E. coli. Here, we show that the cAMP-CRP complex transcriptionally regulates tfoX expression through multiple canonical CRP (CRP-N) sites in Vibrios. This conclusion is supported by an analysis of the tfoX mRNA levels and tfoX transcriptional reporter fusions. The reduced expression of tfoXVC was restored by trans-complementation of crp in ∆crp and by exogenous cAMP in ∆cya. A promoter deletion analysis and the site-directed mutagenesis of the putative CRP-N sites revealed the presence of two functional CRP-N sites. The direct binding of cAMP-CRP to the tfoXVCpromoter was demonstrated by EMSA assays. Additionally, the transcriptional start site (TSS) of tfoXVF in V. fluvialis was determined, and −10/−35 regions were predicted. Further comparison of the tfoX promoter in Vibrios revealed the existence of similar −10 motifs and putative CRP-N sites, indicating the conserved mechanism of CRP regulation on tfoX. Our study demonstrates the direct binding of the cAMP-CRP complex to tfoX promoter, and broadens the understanding of the molecular mechanism regulating tfoX in Vibrios. PMID:26442598

  19. Design of a 50 TW/20 J chirped-Pulse Amplification Laser for High-Energy-Density Plasma Physics Experiments at the Nevada Terawatt Facility of the University of Nevada

    SciTech Connect

    Erlandson, A C; Astanovitskiy, A; Batie, S; Bauer, B; Bayramian, A; Caird, J A; Cowan, T; Ebbers, C; Fuchs, J; Faretto, H; Glassman, J; Ivanov, V; LeGalloudec, B; LeGalloudec, N; Letzring, S; Payne, S; Stuart, B

    2003-09-07

    We have developed a conceptual design for a 50 TW/20 J short-pulse laser for performing high-energy-density plasma physics experiments at the Nevada Terawatt Facility of the University of Nevada, Reno. The purpose of the laser is to develop proton and x-ray radiography techniques, to use these techniques to study z-pinch plasmas, and to study deposition of intense laser energy into both magnetized and unmagnetized plasmas. Our design uses a commercial diode-pumped Nd:glass oscillator to generate 3-nJ. 200-fs mode-locked pulses at 1059 m. An all-reflective grating stretcher increases pulse duration to 1.1 ns. A two-stage chirped-pulse optical parametric amplifier (OPCPA) using BBO crystals boosts pulse energy to 12 mJ. A chain using mixed silicate-phosphate Nd:glass increases pulse energy to 85 J while narrowing bandwidth to 7.4 nm (FWHM). About 50 J is split off to the laser target chamber to generate plasma while the remaining energy is directed to a roof-mirror pulse compressor, where two 21 cm x 42 cm gold gratings recompress pulses to {approx}350 fs. A 30-cm-focal-length off-axis parabolic reflector (OAP) focuses {approx}20 J onto target, producing an irradiance of 10{sup 19} W/cm{sup 2} in a 10-{micro}m-diameter spot. This paper describes planned plasma experiments, system performance requirements, the laser design, and the target area design.

  20. Field measurements and interpretation of TMI-2 instrumentation: YM-AMP-7023 and YM-AMP-7025

    SciTech Connect

    Jones, J E; Smith, J T; Mathis, M V

    1982-01-01

    This report describes the measurement and results of the Loose Part Monitor Channels YM-AMP-7023 and YM-AMP-7025. These instruments consist of an Endevco Model 2276 accelerometer and a model 2652M4 charge amplifier connected to the Loose Parts Monitorng System terminals by approximately 400 feet (500 feet for 7025) of cable. The instruments were being incorporated into a B and W supplied system when the measurements were taken; therefore, the equipment was not expected to be fully operational.

  1. Hybrid chirped pulse amplification system

    DOEpatents

    Barty, Christopher P.; Jovanovic, Igor

    2005-03-29

    A hybrid chirped pulse amplification system wherein a short-pulse oscillator generates an oscillator pulse. The oscillator pulse is stretched to produce a stretched oscillator seed pulse. A pump laser generates a pump laser pulse. The stretched oscillator seed pulse and the pump laser pulse are directed into an optical parametric amplifier producing an optical parametric amplifier output amplified signal pulse and an optical parametric amplifier output unconverted pump pulse. The optical parametric amplifier output amplified signal pulse and the optical parametric amplifier output laser pulse are directed into a laser amplifier producing a laser amplifier output pulse. The laser amplifier output pulse is compressed to produce a recompressed hybrid chirped pulse amplification pulse.

  2. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  3. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  4. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  5. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  6. 21 CFR 862.1230 - Cyclic AMP test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Cyclic AMP test system. 862.1230 Section 862.1230 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry Test Systems §...

  7. cAMP signaling in cortisol-producing adrenal adenoma.

    PubMed

    Calebiro, Davide; Di Dalmazi, Guido; Bathon, Kerstin; Ronchi, Cristina L; Beuschlein, Felix

    2015-10-01

    The cAMP signaling pathway is one of the major players in the regulation of growth and hormonal secretion in adrenocortical cells. Although its role in the pathogenesis of adrenocortical hyperplasia associated with Cushing's syndrome has been clarified, a clear involvement of the cAMP signaling pathway and of one of its major downstream effectors, the protein kinase A (PKA), in sporadic adrenocortical adenomas remained elusive until recently. During the last year, a report by our group and three additional independent groups showed that somatic mutations of PRKACA, the gene coding for the catalytic subunit α of PKA, are a common genetic alteration in patients with Cushing's syndrome due to adrenal adenomas, occurring in 35-65% of the patients. In vitro studies revealed that those mutations are able to disrupt the association between catalytic and regulatory subunits of PKA, leading to a cAMP-independent activity of the enzyme. Despite somatic PRKACA mutations being a common finding in patients with clinically manifest Cushing's syndrome, the pathogenesis of adrenocortical adenomas associated with subclinical hypercortisolism seems to rely on a different molecular background. In this review, the role of cAMP/PKA signaling in the regulation of adrenocortical cell function and its alterations in cortisol-producing adrenocortical adenomas will be summarized, with particular focus on recent developments. PMID:26139209

  8. Characteristics of cyclic AMP transport by marine bacteria

    SciTech Connect

    Ammerman, J.W.; Azam, F.

    1987-12-01

    Uptake and autoradiography experiments with natural populations of marine bacteria, sea water cultures, and cultured isolates showed that the high-affinity cyclic AMP transport system in marine bacteria has stringent structural requirements, is found in a minority of cells in mixed bacterial assemblages, and appears to be related to the culture growth state.

  9. Metabolic benefits of inhibiting cAMP-PDEs with resveratrol.

    PubMed

    Chung, Jay H

    2012-10-01

    Calorie restriction (CR) extends lifespan in species ranging from yeast to mammals. There is evidence that CR also protects against aging-related diseases in non-human primates. This has led to an intense interest in the development of CR-mimetics to harness the beneficial effects of CR to treat aging-related diseases. One CR-mimetic that has received a great deal of attention is resveratrol. Resveratrol extends the lifespan of obese mice and protects against obesity-related diseases such as type 2 diabetes. The specific mechanism of resveratrol action has been difficult to elucidate because resveratrol has a promiscuous target profile. A recent finding indicates that the metabolic effects of resveratrol may result from competitive inhibition of cAMP-degrading phosphodiesterases (PDEs), which increases cAMP levels. The cAMP-dependent pathways activate AMP-activated protein kinase (AMPK), which is essential for the metabolic effects of resveratrol. Inhibiting PDE4 with rolipram reproduces all of the metabolic benefits of resveratrol, including protection against diet-induced obesity and an increase in mitochondrial function, physical stamina and glucose tolerance in mice. This discovery suggests that PDE inhibitors may be useful for treating metabolic diseases associated with aging. PMID:23700542

  10. Stress pulse phenomena

    SciTech Connect

    McGlaun, M.

    1993-08-01

    This paper is an introductory discussion of stress pulse phenomena in simple solids and fluids. Stress pulse phenomena is a very rich and complex field that has been studied by many scientists and engineers. This paper describes the behavior of stress pulses in idealized materials. Inviscid fluids and simple solids are realistic enough to illustrate the basic behavior of stress pulses. Sections 2 through 8 deal with the behavior of pressure pulses. Pressure is best thought of as the average stress at a point. Section 9 deals with shear stresses which are most important in studying solids.

  11. Laser fusion pulse shape controller

    DOEpatents

    Siebert, Larry D.

    1977-01-01

    An apparatus for controlling the pulse shape, i.e., the pulse duration and intensity pattern, of a pulsed laser system, and which is particularly well adapted for controlling the pellet ignition pulse in a laser-driven fusion reaction system. The apparatus comprises a laser generator for providing an optical control pulse of the shape desired, a pulsed laser triggered by the control pulse, and a plurality of optical Kerr-effect gates serially disposed at the output of the pulsed laser and selectively triggered by the control pulse to pass only a portion of the pulsed laser output generally corresponding in shape to the control pulse.

  12. PULSE DURATION LENGTHENER

    DOEpatents

    Aiken, W.R.

    1958-02-01

    This patent pertains to pulse modifying apparatus and, more particularly, describes a device to provide a rise time and time base expander for signal pulses having a very short duration. The basic element of the device is a vacuum tube comprising a charged particie beam, grid control means, an accelerating electrode, a drift tube, and a collector electrode. As the short duration input pulse modulates the particle beam through the grid control means, the voltage between the drift tube and accelerating electrode is caused to vary, whereby the output signal from the collector is a pulse having longer rise time, expanded duration and proportionate characteristics of the original pulse. The invention is particuiarly useful where subsequent pulse circultry does not have the frequency bandwidth to handle the short duration pulse without distorting it.

  13. ELECTRICAL PULSE COUNTER APPARATUS

    DOEpatents

    Kaufman, W.M.; Jeeves, T.A.

    1962-09-01

    A progressive electrical pulse counter circuit rs designed for the counting of a chain of input pulses. The circuit employs a series of direct connected bistable counting stages simultaneously pulsed by each input pulse and a delay means connected between each of the stages. Each bistable stage has two d-c operative states, which stage, when in its initial state, prevents the next succeeding stage from changing its condition when the latter stage is pulsed. Since the delay circuits between the stages prevents the immediate decay of the d-c state of each stage when the stages are pulsed, only one stage will change its state for each input pulse, thereby providing progressive stage-by-stage counting. (AEC)

  14. Mobile Genetic Elements Related to the Diffusion of Plasmid-Mediated AmpC β-Lactamases or Carbapenemases from Enterobacteriaceae: Findings from a Multicenter Study in Spain

    PubMed Central

    Zamorano, L.; Miró, E.; Juan, C.; Gómez, L.; Bou, G.; González-López, J. J.; Martínez-Martínez, L.; Aracil, B.; Conejo, M. C.; Oliver, A.

    2015-01-01

    We examined the genetic context of 74 acquired ampC genes and 17 carbapenemase genes from 85 of 640 Enterobacteriaceae isolates collected in 2009. Using S1 pulsed-field gel electrophoresis and Southern hybridization, 37 of 74 blaAmpC genes were located on large plasmids of different sizes belonging to six incompatibility groups. We used sequencing and PCR mapping to investigate the regions flanking the acquired ampC genes. The blaCMY-2-like genes were associated with ISEcp1; the surrounding blaDHA genes were similar to Klebsiella pneumoniae plasmid pTN60013 associated with IS26 and the psp and sap operons; and the blaACC-1 genes were associated with IS26 elements inserted into ISEcp1. All of the carbapenemase genes (blaVIM-1, blaIMP-22, and blaIMP-28) were located in class 1 integrons. Therefore, although plasmids are the main cause of the rapid dissemination of ampC genes among Enterobacteriaceae, we need to be aware that other mobile genetic elements, such as insertion sequences, transposons, or integrons, can be involved in the mobilization of these genes of chromosomal origin. Additionally, three new integrons (In846 to In848) are described in this study. PMID:26077249

  15. Mobile genetic elements related to the diffusion of plasmid-mediated AmpC β-lactamases or carbapenemases from Enterobacteriaceae: findings from a multicenter study in Spain.

    PubMed

    Zamorano, L; Miró, E; Juan, C; Gómez, L; Bou, G; González-López, J J; Martínez-Martínez, L; Aracil, B; Conejo, M C; Oliver, A; Navarro, F

    2015-09-01

    We examined the genetic context of 74 acquired ampC genes and 17 carbapenemase genes from 85 of 640 Enterobacteriaceae isolates collected in 2009. Using S1 pulsed-field gel electrophoresis and Southern hybridization, 37 of 74 bla AmpC genes were located on large plasmids of different sizes belonging to six incompatibility groups. We used sequencing and PCR mapping to investigate the regions flanking the acquired ampC genes. The bla CMY-2-like genes were associated with ISEcp1; the surrounding bla DHA genes were similar to Klebsiella pneumoniae plasmid pTN60013 associated with IS26 and the psp and sap operons; and the bla ACC-1 genes were associated with IS26 elements inserted into ISEcp1. All of the carbapenemase genes (bla VIM-1, bla IMP-22, and bla IMP-28) were located in class 1 integrons. Therefore, although plasmids are the main cause of the rapid dissemination of ampC genes among Enterobacteriaceae, we need to be aware that other mobile genetic elements, such as insertion sequences, transposons, or integrons, can be involved in the mobilization of these genes of chromosomal origin. Additionally, three new integrons (In846 to In848) are described in this study. PMID:26077249

  16. PULSE RATE DIVIDER

    DOEpatents

    McDonald, H.C. Jr.

    1962-12-18

    A compact pulse-rate divider circuit affording low impedance output and high input pulse repetition rates is described. The circuit features a single secondary emission tube having a capacitor interposed between its dynode and its control grid. An output pulse is produced at the anode of the tube each time an incoming pulse at the control grid drives the tube above cutoff and the duration of each output pulse corresponds to the charging time of the capacitor. Pulses incoming during the time the grid bias established by the discharging capacitor is sufficiently negative that the pulses are unable to drive the tube above cutoff do not produce output pulses at the anode; these pulses are lost and a dividing action is thus produced by the circuit. The time constant of the discharge path may be vanied to vary in turn the division ratio of the circuit; the time constant of the charging circuit may be varied to vary the width of the output pulses. (AEC)

  17. PULSE HEIGHT ANALYZER

    DOEpatents

    Goldsworthy, W.W.

    1958-06-01

    A differential pulse-height discriminator circuit is described which is readily adaptable for operation in a single-channel pulse-height analyzer. The novel aspect of the circuit lies in the specific arrangement of differential pulse-height discriminator which includes two pulse-height discriminators having a comnnon input and an anticoincidence circuit having two interconnected vacuum tubes with a common cathode resistor. Pulses from the output of one discriminator circuit are delayed and coupled to the grid of one of the anticoincidence tubes by a resistor. The output pulses from the other discriminator circuit are coupled through a cathode follower circuit, which has a cathode resistor of such value as to provide a long time constant with the interelectrode capacitance of the tube, to lenthen the output pulses. The pulses are then fed to the grid of the other anticoincidence tube. With such connections of the circuits, only when the incoming pulse has a pesk value between the operating levels of the two discriminators does an output pulse occur from the anticoincidence circuit.

  18. PULSE AMPLITUDE ANALYZER

    DOEpatents

    Gray, G.W.; Jensen, A.S.

    1957-10-22

    A pulse-height analyzer system of improved design for sorting and counting a series of pulses, such as provided by a scintillation detector in nuclear radiation measurements, is described. The analyzer comprises a main transmission line, a cathode-ray tube for each section of the line with its deflection plates acting as the line capacitance; means to bias the respective cathode ray tubes so that the beam strikes a target only when a prearranged pulse amplitude is applied, with each tube progressively biased to respond to smaller amplitudes; pulse generating and counting means associated with each tube to respond when the beam is deflected; a control transmission line having the same time constant as the first line per section with pulse generating means for each tube for initiating a pulse on the second transmission line when a pulse triggers the tube of corresponding amplitude response, the former pulse acting to prevent successive tubes from responding to the pulse under test. This arrangement permits greater deflection sensitivity in the cathode ray tube and overcomes many of the disadvantages of prior art pulse-height analyzer circuits.

  19. [Investigation of plasmid mediated AmpC beta-lactamases among Escherichia coli and Klebsiella pneumoniae isolated from blood cultures].

    PubMed

    Sarı, Ayşe Nur; Biçmen, Meral; Gülay, Zeynep

    2013-10-01

    The aim of this study was to investigate the prevalence and types of plasmid-mediated AmpC (pAmpC) beta-lactamase enzymes in Escherichia coli and Klebsiella pneumoniae strains isolated from blood cultures of hospitalized patients in Dokuz Eylul University Hospital between 2007 and 2012. A total of 261 isolates which consisted of 184 E.coli (70.5%) and 77 K.pneumoniae (29.5%) were included in the study. All isolates were resistant to cefotaxime and/or ceftazidime but susceptible to imipenem. Cefoxitin resistance was investigated as an indicator of AmpC type enzymes. A total of 57 (21.8%) isolates which were cefoxitin-resistant (32 E.coli, 25 K.pneumoniae), were screened for pampC genes by a multiplex polymerase chain reaction (PCR) assay. Additionally, 10 of each cefoxitin susceptible isolates per year were chosen randomly and screened by the same PCR assay to detect the presence of ACC enzymes, which can not hydrolyze cefoxitin. Positive PCR results were confirmed by sequence analysis. Plasmid analysis and macrorestriction analysis were performed for pampC-positive isolates. The presence of pAmpC enzymes has been shown in 9.4% (3/32) of cefoxitin-resistant E.coli, and 8% (2/25) of cefoxitin-resistant K.pneumoniae strains. It was noted that there were no strains producing this enzyme isolated in 2007 and 2008, however the prevalence of pAmpC was detected as 1.6% in 2009 (one ACT-1 producing K.pneumoniae), increasing to 4.8% in 2011 (one ACT-1 producing K.pneumoniae) and 6.4% in 2012 (three CMY-2 producing E.coli). These enzymes were found to be carried on 81 kb size plasmids in K.pneumoniae isolates and on a 9 kb size plasmid in E.coli isolates. Macrorestriction analysis indicated that two of the three CMY-2 producing E.coli had the same PFGE (Pulsed-field gel electrophoresis) pattern. If these two strains are considered as identical, it can be concluded that the prevalence of pAmpC was low in the strains isolated between 2007-2012 (4/261; 1.5%) in our institution

  20. Analyzing broadband electromagnetic pulses to geo-locate lightning

    NASA Astrophysics Data System (ADS)

    Remmert, Thomas

    2009-10-01

    Lightning discharges are taking place globally on average of 100 times per second. Systems exist to detect the location of cloud-to-ground and cloud-to-cloud discharges, but have disadvantages. Commercial units are generally expensive, have short range, and are densely packed in a small geographic location. When the strike occurs, a large electromagnetic pulse is generated. This pulse encompasses a large portion of the electromagnetic spectrum, including ELF (extremely low frequencies) and VLF (very low frequencies). Because of the low signal attenuation in these bands, the pulse is able to travel between the earth and the ionosphere great distances. By using a minimum of two stations globally, we are able to geographically locate the strike and plot it on a map in real- time. Both stations are equipped with a ELF/VLF magnetic directional antenna, a pre-amp, and computer software to perform the calculations. When a strike occurs, a voltage is induced in the antenna due to Faraday's law. This voltage is sent to a pre-amp, which filters unwanted interference, amplifies the signal, and sends it to the sound card of a computer. Complex algorithms have been designed to remove unwanted emi, including the 60Hz hum from the power lines. The software is responsible for determining the direction of the strike and the time of the strike. Once these values are calculated, this information can be shared with your partner station, and a location can be determined.

  1. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System

    PubMed Central

    Zahid, M. Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M.; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  2. Suppression of Virulence of Toxigenic Vibrio cholerae by Anethole through the Cyclic AMP (cAMP)-cAMP Receptor Protein Signaling System.

    PubMed

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Asakura, Masahiro; Chatterjee, Shruti; Hinenoya, Atsushi; Faruque, Shah M; Yamasaki, Shinji

    2015-01-01

    Use of natural compounds as antivirulence drugs could be an alternative therapeutic approach to modify the outcome of bacterial infections, particularly in view of growing resistance to available antimicrobials. Here, we show that sub-bactericidal concentration of anethole, a component of sweet fennel seed, could suppress virulence potential in O1 El Tor biotype strains of toxigenic Vibrio cholerae, the causative agent of the ongoing 7th cholera pandemic. The expression of cholera toxin (CT) and toxin coregulated pilus (TCP), the major virulence factors of V. cholerae, is controlled through a regulatory cascade involving activation of ToxT with synergistic coupling interaction of ToxR/ToxS with TcpP/TcpH. We present evidence that anethole inhibits in vitro expression of CT and TCP in a toxT-dependent but toxR/toxS-independent manner and through repression of tcpP/tcpH, by using bead-ELISA, western blotting and quantitative real-time RT-PCR assays. The cyclic AMP (cAMP)-cAMP receptor protein (CRP) is a well-studied global signaling system in bacterial pathogens, and this complex is known to suppress expression of tcpP/tcpH in V. cholerae. We find that anethole influences the virulence regulatory cascade by over-expressing cyaA and crp genes. Moreover, suppression of toxigenic V. cholerae-mediated fluid accumulation in ligated ileum of rabbit by anethole demonstrates its potentiality as an antivirulence drug candidate against the diseases caused by toxigenic V. cholerae. Taken altogether, these results revealing a mechanism of virulence inhibition in V. cholerae by the natural compound anethole, may have relevance in designing antivirulence compounds, particularly against multiple antibiotic resistant bacterial pathogens. PMID:26361388

  3. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 7 Agriculture 7 2012-01-01 2012-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  4. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 7 Agriculture 7 2014-01-01 2014-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  5. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 7 Agriculture 7 2011-01-01 2011-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  6. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 7 Agriculture 7 2013-01-01 2013-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  7. 7 CFR 772.10 - Transfer and assumption-AMP loans.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Transfer and assumption-AMP loans. 772.10 Section 772..., DEPARTMENT OF AGRICULTURE SPECIAL PROGRAMS SERVICING MINOR PROGRAM LOANS § 772.10 Transfer and assumption—AMP loans. (a) Eligibility. The Agency may approve transfers and assumptions of AMP loans when: (1)...

  8. Electrodeposition of low contraction chromium/molybdenum alloys using pulse-reverse plating. Final report

    SciTech Connect

    Miller, M.D.; Langston, S.

    1994-12-01

    The use of modulated pulse periodic reverse (pulse-reverse) current to electrodeposit a low contraction (LC) chromium/molybdenum alloy has been evaluated. When using one full pulse-reverse plating cycle, the percent molybdenum in the deposit increased almost 400 percent (from 1 to 4 percent) as the current in the reverse cycle was increased from 0 to 10 amps. However, when the pulse reverse current was carried to six full plating cycles, the percent molybdenum in the deposit was not dependent upon the current and remained constant at about 1 percent. This is about the same percent molybdenum that could be expected in direct current-plated LC chromium/molybdenum alloy and about half the percent molybdenum that could be expected in an on/off pulse-plated LC chromium/molybdenum alloy.

  9. PULSE AMPLITUDE ANALYZER

    DOEpatents

    Greenblatt, M.H.

    1958-03-25

    This patent pertains to pulse amplitude analyzers for sorting and counting a serles of pulses, and specifically discloses an analyzer which ls simple in construction and presents the puise height distribution visually on an oscilloscope screen. According to the invention, the pulses are applied to the vertical deflection plates of an oscilloscope and trigger the horizontal sweep. Each pulse starts at the same point on the screen and has a maximum amplitude substantially along the same vertical line. A mask is placed over the screen except for a slot running along the line where the maximum amplitudes of the pulses appear. After the slot has been scanned by a photocell in combination with a slotted rotating disk, the photocell signal is displayed on an auxiliary oscilloscope as vertical deflection along a horizontal time base to portray the pulse amplitude distribution.

  10. Random pulse generator

    NASA Technical Reports Server (NTRS)

    Lindsey, R. S., Jr. (Inventor)

    1975-01-01

    An exemplary embodiment of the present invention provides a source of random width and random spaced rectangular voltage pulses whose mean or average frequency of operation is controllable within prescribed limits of about 10 hertz to 1 megahertz. A pair of thin-film metal resistors are used to provide a differential white noise voltage pulse source. Pulse shaping and amplification circuitry provide relatively short duration pulses of constant amplitude which are applied to anti-bounce logic circuitry to prevent ringing effects. The pulse outputs from the anti-bounce circuits are then used to control two one-shot multivibrators whose output comprises the random length and random spaced rectangular pulses. Means are provided for monitoring, calibrating and evaluating the relative randomness of the generator.

  11. PULSE AMPLITUDE ANALYSERS

    DOEpatents

    Lewis, I.A.D.

    1956-05-15

    This patent pentains to an electrical pulse amplitude analyzer, capable of accepting input pulses having a separation between adjacent pulses in the order of one microsecond while providing a large number of channels of classification. In its broad aspect the described pulse amplitude analyzer utilizes a storage cathode ray tube und control circuitry whereby the amplitude of the analyzed pulses controls both the intensity and vertical defiection of the beam to charge particular spots in horizontal sectors of the tube face as the beam is moved horizontally across the tube face. As soon as the beam has swept the length of the tube the information stored therein is read out by scanning individually each horizontal sector corresponding to a certain range of pulse amplitudes and applying the output signal from each scan to separate indicating means.

  12. Stimulators of AMP-activated kinase (AMPK) inhibit seawater- but not cAMP-induced oocyte maturation in a marine worm: Implications for interactions between cAMP and AMPK signaling.

    PubMed

    Stricker, Stephen A; Swiderek, Lee; Nguyen, Thanh

    2010-06-01

    Previous studies have shown that elevations in intraoocytic cAMP prevent mammalian oocytes from maturing, whereas cAMP degradation allows these oocytes to begin maturation, as evidenced by the onset of oocyte nuclear disassembly (="germinal vesicle breakdown", GVBD). Moreover, such cAMP degradation not only reduces cAMP levels but also generates AMP, which in turn can stimulate AMP-activated kinase (AMPK), a well-documented inducer of GVBD in mice. Alternatively, in some marine invertebrates, intraoocytic cAMP triggers, rather than blocks, GVBD, and whether AMPK up- or downregulates maturation in these species has not been tested. Thus, AMPK was monitored in the nemertean worm Cerebratulus during GVBD stimulated by seawater (SW) or cAMP elevators. In oocytes lacking surrounding follicle cells, AMPK activity was initially elevated in immature oocytes but subsequently reduced during SW- or cAMP-induced GVBD, given that the catalytic alpha-subunit of AMPK in maturing oocytes displayed a decreased stimulatory phosphorylation at T172 and an increased inhibitory phosphorylation at S485/491. Accordingly, AMPK-mediated phosphorylation of acetyl-CoA carboxylase, a known target of active AMPK, also declined during maturation. Moreover, treatments with either ice-cold calcium-free seawater (CaFSW) or AMPK agonists dissolved in SW maintained AMPK activity and inhibited GVBD. Conversely, adding cAMP elevators to CaFSW- or SW-solutions of AMPK activators restored GVBD while promoting S485/491 phosphorylation and AMPK deactivation. Collectively, such findings not only demonstrate for the first time that intraoocytic AMPK can block GVBD in the absence of surrounding follicle cells, but these results also provide evidence for a novel GVBD-regulating mechanism involving AMPK deactivation by cAMP-mediated S485/491 phosphorylation. PMID:20336704

  13. PULSED INDICATOR CIRCUIT

    DOEpatents

    Linlor, W.I.; Kerns, Q.A.

    1960-11-15

    A system is given for detecting incremental changes in a transducer impedance terminating a transmission line. Principal novelty resides in the transducer impedance terminating the line in a mismatch and a pulse generator being provided to apply discrete pulses to the input end of the line. The amplitudes of the pulses reflected to the input end of the line from the mismatched transducer impedance are then observed as a very accurate measure of the instantaneous value of the latter.

  14. PulseSoar

    SciTech Connect

    Carter, P.; Peglow, S.

    1992-07-21

    This paper is an introduction to the PulseSoar concept. PulseSoar is a hypervelocity airplane that uses existing airport facilities and current technologies to fly at the very edge of space. It will be shown that PulseSoar can fly between any two points on the globe in less than two hours with fuel efficiency exceeding current state of the art commercial airliners. In addition, it will be shown that PulseSoar avoids environmental issues concerning the ozone layer and sonic booms because of its unique flight profile. All of this can be achieved with current technology. PulseSoar does not require the development of enabling technology. It is a concept which can be demonstrated today. The importance of this idea goes beyond the technical significance`s of PulseSoar in terms of feasibility and performance. PulseSoar could provide a crucial economic advantage to America`s largest export market: commercial aircraft. PulseSoar is a breakthrough concept for addressing the emerging markets of long range and high speed aircraft. Application of PulseSoar to commercial transport could provide the US Aerospace industry a substantial lead in offering high speed/long range aircraft to the world`s airlines. The rapid emergence of a US developed high speed aircraft could also be important to our competitiveness in the Pacific Rim and South American economies. A quick and inexpensive demonstration vehicle is proposed to bang the concept to reality within two years. This discussion will address all the major technical subjects encompassed by PulseSoar and identifies several near-term, and low risk, applications which may be further explored with the initial demonstration vehicle. What is PulseSoar? PulseSoar could enable high speed, high altitude and long range flight without many of the difficulties encountered by traditional hypersonic vehicles.

  15. High voltage pulse conditioning

    DOEpatents

    Springfield, Ray M.; Wheat, Jr., Robert M.

    1990-01-01

    Apparatus for conditioning high voltage pulses from particle accelerators in order to shorten the rise times of the pulses. Flashover switches in the cathode stalk of the transmission line hold off conduction for a determinable period of time, reflecting the early portion of the pulses. Diodes upstream of the switches divert energy into the magnetic and electrostatic storage of the capacitance and inductance inherent to the transmission line until the switches close.

  16. Molecular characterisation of acquired and overproduced chromosomal blaAmpC in Escherichia coli clinical isolates.

    PubMed

    Alonso, Noemí; Miró, Elisenda; Pascual, Vanesa; Rivera, Alba; Simó, Maria; Garcia, Maria Consol; Xercavins, Mariona; Morera, Maria Antonia; Espejo, Elena; Gurguí, Mercè; Pérez, Josefa; Rodríguez-Carballeira, Mònica; Garau, Javier; Calbo, Esther; Navarro, Ferran; Mirelis, Beatriz; Coll, Pere

    2016-01-01

    Escherichia coli recovered from three hospitals in Barcelona (Spain) were studied to determine the prevalence of isolates with acquired AmpC (ac-AmpC) and/or overproduced chromosomal AmpC (c-AmpC). Mechanisms involved in blac-AmpC overexpression, blaac-AmpC and the plasmids associated with their distribution as well as the prevalence of plasmid-mediated quinolone resistance (PMQR) in AmpC-producing isolates were also determined. Isolates were selected according to their resistance phenotype. blaac-AmpC, alterations in the blac-AmpC promoter/attenuator, and PMQR genes [qnrA, qnrB, qnrS, aac(6')-Ib-cr and qepA] were characterised by PCR and sequencing. blac-AmpC expression was determined by qRT-PCR. Population structure analysis was performed using PFGE, MLST and phylogenetic group PCR. Plasmids carrying blaac-AmpC were characterised by PCR-based replicon typing and S1-PFGE. IncI1 and IncF plasmids were also analysed by plasmid MLST and replicon sequence typing, respectively. Among 21563 E. coli isolates, 240 (1.1%) overproduced AmpC β-lactamases, including 180 (75.0%) harbouring ac-AmpC (132 CMY-2 variants and 48 DHA-1) and 60 (25.0%) c-AmpC enzymes. Three mutation profiles in the blac-AmpC promoter/attenuator were associated with a 72.5-, 19.9- and 5.8-fold increased expression, respectively. Moreover, 63.3% of ac-AmpC and 43.3% of c-AmpC isolates belonged to B2, D, E or F phylogenetic groups. PMQR was found in 31% of ac-AmpC isolates [38 qnrB4, 8 aac(6')-Ib-cr, 6 qnrS1 and 3 qnrB19] and in 10% of c-AmpC isolates [5 aac(6')-Ib-cr and 1 qnrS1]. IncI1-ST12 and IncF were associated with blaCMY-2 and blaDHA-1, respectively. These results suggest that ac-AmpC β-lactamases were the main mechanism of AmpC production. Isolates and plasmids both showed high genetic diversity. PMID:26607336

  17. Pulse Tube Refrigerator

    NASA Astrophysics Data System (ADS)

    Matsubara, Yoichi

    The pulse tube refrigerator is one of the regenerative cycle refrigerators such as Stirling cycle or Gifford-McMahon cycle which gives the cooling temperature below 150 K down to liquid helium temperature. In 1963, W. E. Gifford invented a simple refrigeration cycle which is composed of compressor, regenerator and simple tube named as pulse tube which gives a similar function of the expander in Stirling or Gifford-McMahon cycle. The thermodynamically performance of this pulse tube refrigerator is inferior to that of other regenerative cycles. In 1984, however, Mikulin and coworkers made a significant advance in pulse tube configuration called as orifice pulse tube. After this, several modifications of the pulse tube hot end configuration have been developed. With those modifications, the thermodynamic performance of the pulse tube refrigerator became the same order to that of Stirling and Gifford-McMahon refrigerator. This article reviews the brief history of the pulse tube refrigerator development in the view point of its thermodynamically efficiency. Simplified theories of the energy flow in the pulse tube have also been described.

  18. Femtosecond polarization pulse shaping.

    PubMed

    Brixner, T; Gerber, G

    2001-04-15

    We report computer-controlled femtosecond polarization pulse shaping where intensity, momentary frequency, and light polarization are varied as functions of time. For the first time to our knowledge, a pulse shaper is used to modulate the degree of ellipticity as well as the orientation of the elliptical principal axes within a single laser pulse by use of a 256-pixel two-layer liquid-crystal display inside a zero-dispersion compressor. Interferometric stability of the setup is not required. Complete pulse characterization is achieved by dual-channel spectral interferometry. This technology has a large range of applications, especially in the field of quantum control. PMID:18040384

  19. Modeling the cAMP-induced allosteric transition using the crystal structure of CAP-cAMP at 2.1 A resolution.

    PubMed

    Passner, J M; Schultz, S C; Steitz, T A

    2000-12-15

    After an allosteric transition produced by the binding of cyclic AMP (cAMP), the Escherichia coli catabolite gene activator protein (CAP) binds DNA specifically and activates transcription. The three-dimensional crystal structure of the CAP-cAMP complex has been refined at 2.1 A resolution, thus enabling a better evaluation of the structural basis for CAP phenotypes, the interactions of cAMP with CAP and the roles played by water structure. A review of mutational analysis of CAP together with the additional structural information presented here suggests a possible mechanism for the cAMP-induced allostery required for DNA binding and transcriptional activation. We hypothesize that cAMP binding may reorient the coiled-coil C-helices, which provide most of the dimer interface, thereby altering the relative positions of the DNA-binding domains of the CAP dimer. Additionally, cAMP binding may cause a further rearrangement of the DNA-binding and cAMP-binding domains of CAP via a flap consisting of beta-strands 4 and 5 which lies over the cAMP. PMID:11124031

  20. Chronic fatigue syndrome and impaired peripheral pulse characteristics on orthostasis--a new potential diagnostic biomarker.

    PubMed

    Allen, John; Murray, Alan; Di Maria, Costanzo; Newton, Julia L

    2012-02-01

    Autonomic nervous system dysfunction is frequently reported in chronic fatigue syndrome (CFS) with orthostatic intolerance, a common symptom that can be objectively assessed. The frequent finding of autonomic dysfunction and symptoms on standing has the potential to provide a diagnostic biomarker in chronic fatigue. In this study we explored the clinical value of non-invasive optical multi-site photoplethysmography (PPG) technology to assess cardiovascular responses to standing. Multi-site PPG pulses were collected from tissue pads of the ears, fingers and toes of 14 patients with CFS and 14 age-matched sedentary subjects using a measurement protocol of a 10 min baseline (subject supine) followed by 3 min of tilting on a tilt table (head-up to 70°). Percentage change in pulse timing (pulse transit time, PTTf) and pulse amplitude (AMP) at each site were calculated using beat-to-beat pulse wave analysis. A significant reduction in the overall pulse timing response to controlled standing was found for the CFS group (using summed absolute percentage change in PTTf for ear, finger and toe sites, median change of 26% for CFS and 37% for control with p = 0.002). There were no significant differences between subject groups for the AMP measure at any site. Changes in AMP with tilt were, however, weakly significantly and negatively correlated with fatigue severity (p < 0.05). Receiver operating characteristic (ROC) analysis of timing measures produced an area under the curve of 0.81. Experimental linear discriminant classification analysis comparing both timing and amplitude measures produced an overall diagnostic accuracy of 82%. Pulse wave abnormalities have been observed in CFS and represent a potential objective measure to help differentiate between CFS patients and healthy controls. PMID:22273713

  1. Purification of the surface cAMP receptor in Dictyostelium

    SciTech Connect

    Klein, P.; Knox, B.; Borleis, J.; Devreotes, P.

    1987-01-05

    We have previously identified and demonstrated reversible ligand-induced modification of the major cell surface cAMP receptor in Dictyostelium discoideum. The receptor, or a subunit of it, has been purified to homogeneity by hydroxylapatite chromatography followed by two-dimensional preparative sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The purification was monitored by following /sup 32/Pi incorporated by photoaffinity labeling with 8-azido-(/sup 32/P)cAMP or by in vivo labeling with /sup 32/Pi. Two interconvertible forms of the receptor, designated R (Mr 40,000) and D (Mr 43,000), co-purified. Two-dimensional peptide maps of independently purified and /sup 125/I-iodinated R and D forms of the receptor were nearly identical but did have several distinct peptides. The estimated 6000-fold purification required is consistent with the number of cell surface binding sites assuming there are not multiple binding sites/polypeptide. In the accompanying article we report the generation of a monospecific polyclonal antiserum which has helped to further elucidate the physical properties and developmental regulation of the cAMP receptor.

  2. Software Design Document for the AMP Nuclear Fuel Performance Code

    SciTech Connect

    Philip, Bobby; Clarno, Kevin T; Cochran, Bill

    2010-03-01

    The purpose of this document is to describe the design of the AMP nuclear fuel performance code. It provides an overview of the decomposition into separable components, an overview of what those components will do, and the strategic basis for the design. The primary components of a computational physics code include a user interface, physics packages, material properties, mathematics solvers, and computational infrastructure. Some capability from established off-the-shelf (OTS) packages will be leveraged in the development of AMP, but the primary physics components will be entirely new. The material properties required by these physics operators include many highly non-linear properties, which will be replicated from FRAPCON and LIFE where applicable, as well as some computationally-intensive operations, such as gap conductance, which depends upon the plenum pressure. Because there is extensive capability in off-the-shelf leadership class computational solvers, AMP will leverage the Trilinos, PETSc, and SUNDIALS packages. The computational infrastructure includes a build system, mesh database, and other building blocks of a computational physics package. The user interface will be developed through a collaborative effort with the Nuclear Energy Advanced Modeling and Simulation (NEAMS) Capability Transfer program element as much as possible and will be discussed in detail in a future document.

  3. Sustained cyclic AMP production by parathyroid hormone receptor endocytosis

    PubMed Central

    Ferrandon, Sébastien; Feinstein, Timothy N; Castro, Marian; Wang, Bin; Bouley, Richard; Potts, John T; Gardella, Thomas J; Vilardaga, Jean-Pierre

    2011-01-01

    Cell signaling mediated by the G protein-coupled parathyroid hormone receptor type 1 (PTHR) is fundamental to bone and kidney physiology. It has been unclear how the two ligand systems—PTH, endocrine and homeostatic, and PTH-related peptide (PTHrP), paracrine—can effectively operate with only one receptor and trigger different durations of the cAMP responses. Here we analyze the ligand response by measuring the kinetics of activation and deactivation for each individual reaction step along the PTHR signaling cascade. We found that during the time frame of G protein coupling and cAMP production, PTHrP1–36 action was restricted to the cell surface, whereas PTH1–34 had moved to internalized compartments where it remained associated with the PTHR and Gαs, potentially as a persistent and active ternary complex. Such marked differences suggest a mechanism by which PTH and PTHrP induce differential responses, and these results indicate that the central tenet that cAMP production originates exclusively at the cell membrane must be revised. PMID:19701185

  4. Opportunities in pulse combustion

    NASA Astrophysics Data System (ADS)

    Brenchley, D. L.; Bomelburg, H. J.

    1985-10-01

    In most pulse combustors, the combustion occurs near the closed end of a tube where inlet valves operate in phase with the pressure amplitude variations. Thus, within the combustion zone, both the temperature and the pressure oscillate around a mean value. However, the development of practical applications of pulse combustion has been hampered because effective design requires the right combination of the combustor's dimensions, valve characteristics, fuel/oxidizer combination, and flow pattern. Pulse combustion has several additional advantages for energy conversion efficiency, including high combustion and thermal efficiency, high combustion intensity, and high convective heat transfer rates. Also, pulse combustion can be self-aspirating, generating a pressure boost without using a blower. This allows the use of a compact heat exchanger that may include a condensing section and may obviate the need for a chimney. In the last decade, these features have revived interest in pulse combustion research and development, which has resulted in the development of a pulse combustion air heater by Lennox, and a pulse combustion hydronic unit by Hydrotherm, Inc. To appraise this potential for energy savings, a systematic study was conducted of the many past and present attempts to use pulse combustion for practical purposes. The authors recommended areas where pulse combustion technology could possibly be applied in the future and identified areas in which additional R and D would be necessary. Many of the results of the study project derived from a special workshop on pulse combustion. This document highlights the main points of the study report, with particular emphasis on pulse combustion application in chemical engineering.

  5. Pulse pile-up effects

    SciTech Connect

    Tenney, F.H.

    1983-05-01

    The energy spectrum containing the effects of all orders of pulse pileup is predicted for an idealized x-ray pulse-height-analysis system measuring randomly occurring events. Two simplifying assumptions used are first a fixed pulse resolution time and second that the measured energy of piled-up pulses is the algebraic sum of the energy associated with each pulse.

  6. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  7. PULSE AMPLITUDE DISTRIBUTION RECORDER

    DOEpatents

    Cowper, G.

    1958-08-12

    A device is described for automatica1ly recording pulse annplitude distribution received from a counter. The novelty of the device consists of the over-all arrangement of conventional circuit elements to provide an easy to read permanent record of the pulse amplitude distribution during a certain time period. In the device a pulse analyzer separates the pulses according to annplitude into several channels. A scaler in each channel counts the pulses and operates a pen marker positioned over a drivable recorder sheet. Since the scalers in each channel have the sanne capacity, the control circuitry permits counting of the incoming pulses until one scaler reaches capacity, whereupon the input is removed and an internal oscillator supplies the necessary pulses to fill up the other scalers. Movement of the chart sheet is initiated wben the first scaler reaches capacity to thereby give a series of marks at spacings proportional to the time required to fill the remaining scalers, and accessory equipment marks calibration points on the recorder sheet to facilitate direct reading of the number of external pulses supplied to each scaler.

  8. PULSE HEIGHT ANALYZER

    DOEpatents

    Johnstone, C.W.

    1958-01-21

    An anticoincidence device is described for a pair of adjacent channels of a multi-channel pulse height analyzer for preventing the lower channel from generating a count pulse in response to an input pulse when the input pulse has sufficient magnitude to reach the upper level channel. The anticoincidence circuit comprises a window amplifier, upper and lower level discriminators, and a biased-off amplifier. The output of the window amplifier is coupled to the inputs of the discriminators, the output of the upper level discriminator is connected to the resistance end of a series R-C network, the output of the lower level discriminator is coupled to the capacitance end of the R-C network, and the grid of the biased-off amplifier is coupled to the junction of the R-C network. In operation each discriminator produces a negative pulse output when the input pulse traverses its voltage setting. As a result of the connections to the R-C network, a trigger pulse will be sent to the biased-off amplifier when the incoming pulse level is sufficient to trigger only the lower level discriminator.

  9. Sources of pulsed radiation

    SciTech Connect

    Sauer, M.C. Jr.

    1981-01-01

    Characteristics of various sources of pulsed radiation are examined from the viewpoint of their importance to the radiation chemist, and some examples of uses of such sources are mentioned. A summary is given of the application of methods of physical dosimetry to pulsed sources, and the calibration of convenient chemical dosimeters by physical dosimetry is outlined. 7 figures, 1 table.

  10. Extrusion cooking: Legume pulses

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Extrusion is used commercially to produce high value breakfast and snack foods based on cereals such as wheat or corn. However, this processing method is not being commercially used for legume pulses seeds due to the perception that they do not expand well in extrusion. Extrusion cooking of pulses (...

  11. Opposing Activity Changes in AMP Deaminase and AMP-Activated Protein Kinase in the Hibernating Ground Squirrel

    PubMed Central

    Cicerchi, Christina; Garcia, Gabriela E.; Roncal-Jimenez, Carlos A.; Trostel, Jessica; Jain, Swati; Mant, Colin T.; Rivard, Christopher J.; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L.; Johnson, Richard J.

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  12. Temporal Analysis of the Magnaporthe Oryzae Proteome During Conidial Germination and Cyclic AMP (cAMP)-mediated Appressorium Formation*

    PubMed Central

    Franck, William L.; Gokce, Emine; Oh, Yeonyee; Muddiman, David C.; Dean, Ralph A.

    2013-01-01

    Rice blast disease caused by Magnaporthe oryzae is one of the most serious threats to global rice production. During the earliest stages of rice infection, M. oryzae conidia germinate on the leaf surface and form a specialized infection structure termed the appressorium. The development of the appressorium represents the first critical stage of infectious development. A total of 3200 unique proteins were identified by nanoLC-MS/MS in a temporal study of conidial germination and cAMP-induced appressorium formation in M. oryzae. Using spectral counting based label free quantification, observed changes in relative protein abundance during the developmental process revealed changes in the cell wall biosynthetic machinery, transport functions, and production of extracellular proteins in developing appressoria. One hundred and sixty-six up-regulated and 208 down-regulated proteins were identified in response to cAMP treatment. Proteomic analysis of a cAMP-dependent protein kinase A mutant that is compromised in the ability to form appressoria identified proteins whose developmental regulation is dependent on cAMP signaling. Selected reaction monitoring was used for absolute quantification of four regulated proteins to validate the global proteomics data and confirmed the germination or appressorium specific regulation of these proteins. Finally, a comparison of the proteome and transcriptome was performed and revealed little correlation between transcript and protein regulation. A subset of regulated proteins were identified whose transcripts show similar regulation patterns and include many of the most strongly regulated proteins indicating a central role in appressorium formation. A temporal quantitative RT-PCR analysis confirmed a strong correlation between transcript and protein abundance for some but not all genes. Collectively, the data presented here provide the first comprehensive view of the M. oryzae proteome during early infection-related development and

  13. Opposing activity changes in AMP deaminase and AMP-activated protein kinase in the hibernating ground squirrel.

    PubMed

    Lanaspa, Miguel A; Epperson, L Elaine; Li, Nanxing; Cicerchi, Christina; Garcia, Gabriela E; Roncal-Jimenez, Carlos A; Trostel, Jessica; Jain, Swati; Mant, Colin T; Rivard, Christopher J; Ishimoto, Takuji; Shimada, Michiko; Sanchez-Lozada, Laura Gabriela; Nakagawa, Takahiko; Jani, Alkesh; Stenvinkel, Peter; Martin, Sandra L; Johnson, Richard J

    2015-01-01

    Hibernating animals develop fatty liver when active in summertime and undergo a switch to a fat oxidation state in the winter. We hypothesized that this switch might be determined by AMP and the dominance of opposing effects: metabolism through AMP deaminase (AMPD2) (summer) and activation of AMP-activated protein kinase (AMPK) (winter). Liver samples were obtained from 13-lined ground squirrels at different times during the year, including summer and multiples stages of winter hibernation, and fat synthesis and β-fatty acid oxidation were evaluated. Changes in fat metabolism were correlated with changes in AMPD2 activity and intrahepatic uric acid (downstream product of AMPD2), as well as changes in AMPK and intrahepatic β-hydroxybutyrate (a marker of fat oxidation). Hepatic fat accumulation occurred during the summer with relatively increased enzymes associated with fat synthesis (FAS, ACL and ACC) and decreased enoyl CoA hydratase (ECH1) and carnitine palmitoyltransferase 1A (CPT1A), rate limiting enzymes of fat oxidation. In summer, AMPD2 activity and intrahepatic uric acid levels were high and hepatic AMPK activity was low. In contrast, the active phosphorylated form of AMPK and β-hydroxybutyrate both increased during winter hibernation. Therefore, changes in AMPD2 and AMPK activity were paralleled with changes in fat synthesis and fat oxidation rates during the summer-winter cycle. These data illuminate the opposing forces of metabolism of AMP by AMPD2 and its availability to activate AMPK as a switch that governs fat metabolism in the liver of hibernating ground squirrel. PMID:25856396

  14. Pulsed electromagnetic fields potentiate neurite outgrowth in the dopaminergic MN9D cell line.

    PubMed

    Lekhraj, Rukmani; Cynamon, Deborah E; DeLuca, Stephanie E; Taub, Eric S; Pilla, Arthur A; Casper, Diana

    2014-06-01

    Pulsed electromagnetic fields (PEMF) exert biological effects and are in clinical use to facilitate bone repair and wound healing. Research has demonstrated that PEMF can induce signaling molecules and growth factors, molecules that play important roles in neuronal differentiation. Here, we tested the effects of a low-amplitude, nonthermal, pulsed radiofrequency signal on morphological neuronal differentiation in MN9D, a dopaminergic cell line. Cells were plated in medium with 10% fetal calf serum. After 1 day, medium was replaced with serum-containing medium, serum-free medium, or medium supplemented with dibutyryl cyclic adenosine monophosphate (Bt2 cAMP), a cAMP analog known to induce neurite outgrowth. Cultures were divided into groups and treated with PEMF signals for either 30 min per day or continuously for 15 min every hour for 3 days. Both serum withdrawal and Bt2 cAMP significantly increased neurite length. PEMF treatment similarly increased neurite length under both serum-free and serum-supplemented conditions, although to a lesser degree in the presence of serum, when continuous treatments had greater effects. PEMF signals also increased cell body width, indicating neuronal maturation, and decreased protein content, suggesting that this treatment was antimitotic, an effect reversed by the inhibitor of cAMP formation dideoxyadenosine. Bt2 cAMP and PEMF effects were not additive, suggesting that neurite elongation was achieved through a common pathway. PEMF signals increased cAMP levels from 3 to 5 hr after treatment, supporting this mechanism of action. Although neuritogenesis is considered a developmental process, it may also represent the plasticity required to form and maintain synaptic connections throughout life. PMID:24523147

  15. THE ABC TRANSPORTER, AbcB3, MEDIATES cAMP EXPORT IN D. DISCOIDEUM DEVELOPMENT

    PubMed Central

    Miranda, Edward Roshan; Nam, Edward A.; Kuspa, Adam; Shaulsky, Gad

    2014-01-01

    Extracellular cAMP functions as a primary ligand for cell surface cAMP receptors throughout Dictyostelium discoideum development, controlling chemotaxis and morphogenesis. The developmental consequences of cAMP signaling and the metabolism of cAMP have been studied in great detail, but it has been unclear how cells export cAMP across the plasma membrane. Here we show pharmacologically and genetically that ABC transporters mediate cAMP export. Using an evolutionary-developmental biology approach, we identified several candidate abc genes and characterized one of them, abcB3, in more detail. Genetic and biochemical evidence suggest that AbcB3 is a component of the cAMP export mechanism in D. discoideum development. PMID:25448698

  16. Cyclic Amp phosphodiesterase activity in normal and inflamed human dental pulp.

    PubMed

    Spoto, G; Menna, V; Serra, E; Santoleri, F; Perfetti, G; Ciavarelli, L; Trentini, P

    2004-01-01

    Cyclic AMP phosphodiesterase (cAMP PDE) seems to be important in pulp tissues. High levels of cAMP PDE have been demonstrated to be in dental pulp cells. In the present study cAMP PDE activity was analyzed in normal healthy human dental pulps, in reversible pulpitis and in irreversible pulpitis. Enzymatic cAMP PDE control values for normal healthy pulps were 12.14 +/- 3.74 nmols/mg of proteins. In reversible pulpitis the cAMP PDE activity increased almost 2.5 times. In irreversible pulpitis specimens the values increased 4.5 times compared with normal healthy pulps activity. The differences between the groups (control vs. reversible pulpitis and vs. irreversible pulpitis) were statistically significant. These results could point to a role of cAMP PDE in the initial pulp response after injury. PMID:16857100

  17. Bipolar pulse generator for intense pulsed ion beam accelerator

    SciTech Connect

    Ito, H.; Igawa, K.; Kitamura, I.; Masugata, K.

    2007-01-15

    A new type of pulsed ion beam accelerator named ''bipolar pulse accelerator'' (BPA) has been proposed in order to improve the purity of intense pulsed ion beams. To confirm the principle of the BPA, we developed a bipolar pulse generator for the bipolar pulse experiment, which consists of a Marx generator and a pulse forming line (PFL) with a rail gap switch on its end. In this article, we report the first experimental result of the bipolar pulse and evaluate the electrical characteristics of the bipolar pulse generator. When the bipolar pulse generator was operated at 70% of the full charge condition of the PFL, the bipolar pulse with the first (-138 kV, 72 ns) and the second pulse (+130 kV, 70 ns) was successfully obtained. The evaluation of the electrical characteristics indicates that the developed generator can produce the bipolar pulse with fast rise time and sharp reversing time.

  18. Bipolar pulse generator for intense pulsed ion beam accelerator.

    PubMed

    Ito, H; Igawa, K; Kitamura, I; Masugata, K

    2007-01-01

    A new type of pulsed ion beam accelerator named "bipolar pulse accelerator" (BPA) has been proposed in order to improve the purity of intense pulsed ion beams. To confirm the principle of the BPA, we developed a bipolar pulse generator for the bipolar pulse experiment, which consists of a Marx generator and a pulse forming line (PFL) with a rail gap switch on its end. In this article, we report the first experimental result of the bipolar pulse and evaluate the electrical characteristics of the bipolar pulse generator. When the bipolar pulse generator was operated at 70% of the full charge condition of the PFL, the bipolar pulse with the first (-138 kV, 72 ns) and the second pulse (+130 kV, 70 ns) was successfully obtained. The evaluation of the electrical characteristics indicates that the developed generator can produce the bipolar pulse with fast rise time and sharp reversing time. PMID:17503918

  19. Composite Pulse Tube

    NASA Technical Reports Server (NTRS)

    Martin, Jerry L.; Cloyd, Jason H.

    2007-01-01

    A modification of the design of the pulse tube in a pulse-tube cryocooler reduces axial thermal conductance while preserving radial thermal conductance. It is desirable to minimize axial thermal conductance in the pulse-tube wall to minimize leakage of heat between the warm and cold ends of the pulse tube. At the same time, it is desirable to maximize radial thermal conductance at the cold end of the pulse tube to ensure adequate thermal contact between (1) a heat exchanger in the form of a stack of copper screens inside the pulse tube at the cold end and (2) the remainder of the cold tip, which is the object to which the heat load is applied and from which heat must be removed. The modified design yields a low-heat-leak pulse tube that can be easily integrated with a cold tip. A typical pulse tube of prior design is either a thin-walled metal tube or a metal tube with a nonmetallic lining. It is desirable that the outer surface of a pulse tube be cylindrical (in contradistinction to tapered) to simplify the design of a regenerator that is also part of the cryocooler. Under some conditions, it is desirable to taper the inner surface of the pulse tube to reduce acoustic streaming. The combination of a cylindrical outer surface and a tapered inner surface can lead to unacceptably large axial conduction if the pulse tube is made entirely of metal. Making the pulse-tube wall of a nonmetallic, lowthermal- conductivity material would not solve the problem because the wall would not afford the needed thermal contact for the stack of screens in the cold end. The modified design calls for fabricating the pulse tube in two parts: a longer, nonmetallic part that is tapered on the inside and cylindrical on the outside and a shorter, metallic part that is cylindrical on both the inside and the outside. The nonmetallic part can be made from G-10 fiberglass-reinforced epoxy or other low-thermal-conductivity, cryogenically compatible material. The metallic part must have high

  20. ELECTRIC PULSE GENERATOR

    DOEpatents

    Buntenbach, R.W.

    1959-06-01

    S>An electro-optical apparatus is described which produces electric pulses in programmed sequences at times and durations controlled with great accuracy. An oscilloscope CRT is supplied with signals to produce a luminous spot moving in a circle. An opaque mask with slots of variable width transmits light from the spot to a photoelectric transducer. For shorter pulse decay times a CRT screen which emits UV can be used with a UVtransmitting filter and a UV- sensitive photoelectric cell. Pulses are varied by changing masks or by using masks with variable slots. This device may be used in multiple arrangements to produce other pulse aT rangements, or it can be used to trigger an electronic pulse generator. (T.R.H.)

  1. Pulsed hall thruster system

    NASA Technical Reports Server (NTRS)

    Hruby, Vladimir J. (Inventor); Pote, Bruce M. (Inventor); Gamero-Castano, Manuel (Inventor)

    2004-01-01

    A pulsed Hall thruster system includes a Hall thruster having an electron source, a magnetic circuit, and a discharge chamber; a power processing unit for firing the Hall thruster to generate a discharge; a propellant storage and delivery system for providing propellant to the discharge chamber and a control unit for defining a pulse duration .tau.<0.1d.sup.3.rho./m, where d is the characteristic size of the thruster, .rho. is the propellant density at standard conditions, and m is the propellant mass flow rate for operating either the power processing unit to provide to the Hall thruster a power pulse of a pre-selected duration, .tau., or operating the propellant storage and delivery system to provide a propellant flow pulse of duration, .tau., or providing both as pulses, synchronized to arrive coincidentally at the discharge chamber to enable the Hall thruster to produce a discreet output impulse.

  2. Localized wave pulse experiments

    SciTech Connect

    Chambers, D L; Henderson, T L; Krueger, K L; Lewis, D K; Zilkowski, R N

    1999-06-01

    The Localized Wave project of the Strategic System Support Program has recently finished an experiment in cooperation with the Advanced SONAR group of the Applied Research Laboratory of the University of Texas at Austin. The purpose of the experiment was three-fold. They wanted to see if (1) the LW pulse could propagate over significant distances, to see if (2) a new type of array and drive system specifically designed for the pulse would increase efficiency over single frequency tone bursts, and to see if (3) the complexity of our 24 channel drivers resulted in better efficiency than a single equivalent pulse driving a piston. In the experiment, several LW pulses were launched from the Lake Travis facility and propagated over distances of either 100 feet or 600 feet, through a thermocline for the 600 foot measurements. The results show conclusively that the Localized Wave will propagate past the near field distance. The LW pulses resulted in extremely broad frequency band width pulses with narrow spatial beam patterns and unmeasurable side lobes. Their array gain was better than most tone bursts and further, were better than their equivalent piston pulses. This marks the first test of several Low Diffraction beams against their equivalent piston pulses, as well as the first propagation of LW pulses over appreciable distances. The LW pulse is now proven a useful tool in open water, rather than a laboratory curiosity. The experimental system and array were built by ARL, and the experiments were conducted by ARL staff on their standard test range. The 600 feet measurements were made at the farthest extent of that range.

  3. Three-dimensional measurement of cAMP gradients using hyperspectral confocal microscopy

    NASA Astrophysics Data System (ADS)

    Rich, Thomas C.; Annamdevula, Naga; Britain, Andrea L.; Mayes, Samuel; Favreau, Peter F.; Leavesley, Silas J.

    2016-03-01

    Cyclic AMP (cAMP) is a ubiquitous second messenger known to differentially regulate many cellular functions over a wide range of timescales. Several lines of evidence have suggested that the distribution of cAMP within cells is not uniform, and that cAMP compartmentalization is largely responsible for signaling specificity within the cAMP signaling pathway. However, to date, no studies have experimentally measured three dimensional (3D) cAMP distributions within cells. Here we use both 2D and 3D hyperspectral microscopy to visualize cAMP gradients in endothelial cells from the pulmonary microvasculature (PMVECs). cAMP levels were measured using a FRETbased cAMP sensor comprised of a cAMP binding domain from EPAC sandwiched between FRET donors and acceptors -- Turquoise and Venus fluorescent proteins. Data were acquired using either a Nikon A1R spectral confocal microscope or custom spectral microscopy system. Analysis of hyperspectral image stacks from a single confocal slice or from summed images of all slices (2D analysis) indicated little or no cAMP gradients were formed within PMVECs under basal conditions or following agonist treatment. However, analysis of hyperspectral image stacks from 3D cellular geometries (z stacks) demonstrate marked cAMP gradients from the apical to basolateral membrane of PMVECs. These results strongly suggest that 2D imaging studies of cAMP compartmentalization -- whether epifluorescence or confocal microscopy -- may lead to erroneous conclusions about the existence of cAMP gradients, and that 3D studies are required to assess mechanisms of signaling specificity.

  4. Expression and organization of BP74, a cyclic AMP-regulated gene expressed during Dictyostelium discoideum development.

    PubMed Central

    Hopkinson, S B; Pollenz, R S; Drummond, I; Chisholm, R L

    1989-01-01

    We have characterized a cDNA and the corresponding gene for a cyclic AMP-inducible gene expressed during Dictyostelium development. This gene, BP74, was found to be first expressed about the time of aggregate formation, approximately 6 h after starvation. Accumulation of BP74 mRNA did not occur in Dictyostelium cells that had been starved in fast-shaken suspension cultures but was induced in similar cultures to which cyclic AMP pulses had been added. The BP74 cDNA and gene were characterized by DNA sequence analysis and transcriptional mapping. When the BP74 promoter region was fused with a chloramphenicol acetyltransferase reporter gene and reintroduced into Dictyostelium cells, the transfected chloramphenicol acetyltransferase gene displayed the same developmentally regulated pattern of expression as did the endogenous BP74 gene, suggesting that all of the cis-acting elements required for regulated expression were carried by a 2-kilobase cloned genomic fragment. On the basis of sequence analysis, the gene appeared to encode a protein containing a 20-residue hydrophobic sequence at the amino-terminal end and 26 copies of a 20-amino-acid repeat. Images PMID:2555685

  5. Activation of the cAMP-dependent protein kinase signaling pathway by luteinizing hormone in trout theca layers.

    PubMed

    Méndez, Eva; Maeland, Mari; Skålhegg, Bjørn S; Planas, Josep V

    2003-07-31

    In the fish ovary, LH is the main factor regulating the production of steroids during the periovulatory period and its effects are believed to be mediated, at least partially, through the cAMP-dependent protein kinase (PKA) signaling pathway. However, there is no direct evidence for the presence of PKA in the fish ovary nor on the regulation of its activity by fish LH. Here, we show the identification of regulatory (R) and catalytic (C) subunits of PKA in trout theca cells by immunoblotting. DEAE-cellulose chromatography of theca cell extracts indicated the presence of PKA type I and II and showed that trout theca cells display PKA-specific phosphotransferase and cAMP-binding activities. Salmon LH (sLH) stimulated PKA activity and increased the levels of immunoreactive RIIalpha, RIIbeta and C subunits in trout theca layers. These observations, coupled with the sLH-dependent decrease in the half-life of the C subunit, as shown by pulse-chase experiments, strongly suggest that sLH activates PKA in trout theca cells. Furthermore, our results suggest that ovarian PKA activity and its regulation by LH has been well conserved from fish to humans. PMID:12890563

  6. A nosocomial outbreak of Serratia marcescens producing inducible Amp C-type beta-lactamase enzyme and carrying antimicrobial resistance genes within a class 1 integron.

    PubMed

    Bagattini, M; Crispino, M; Gentile, F; Barretta, E; Schiavone, D; Boccia, M C; Triassi, M; Zarrilli, R

    2004-01-01

    We investigated an outbreak of Serratia marcescens in the adult intensive care unit of the University Hospital of Napoli. The outbreak involved 13 cases of infection by S. marcescens over a nine-month period and was caused by a single pulsed-field gel electrophoresis clone. The epidemic strain was multiply antibiotic resistant, producing an inducible Amp C-type beta-lactamase enzyme and carrying the trimethoprim-resistance gene and the adenyltransferase gene, which confers resistance to streptomycin and spectinomycin, within a class 1 integron. Antimicrobial therapy with beta-lactams was associated with S. marcescens acquisition in the intensive care unit. PMID:14706268

  7. Interface demarcation in GaAs by current pulsing

    NASA Technical Reports Server (NTRS)

    Matthiesen, D. H.; Kafalas, J. A.; Duchene, G. A.; Bellows, A. H.

    1990-01-01

    GTE Laboratories is currently conducting a program to investigate the effect of convection in the melt on the properties of bulk grown gallium arsenide (GaAs). In addition to extensive ground based experimentation, a Get Away Special growth system has been developed to grow two GaAs crystals aboard the Space Shuttle, each with a one inch diameter. In order to perform a complete segregation analysis of the crystals grown in space, it is necessary to measure the interface shape and growth rate as well as the spatial distribution of the selenium dopant. The techniques for interface demarcation in selenium doped GaAs by current pulsing have been developed at GTE Laboratories and successful interface demarcation has been achieved for current pulses ranging from 20 to 90 amps, in both single crystal and polycrystalline regions.

  8. Dynamic pulse difference circuit

    DOEpatents

    Erickson, Gerald L.

    1978-01-01

    A digital electronic circuit of especial use for subtracting background activity pulses in gamma spectrometry comprises an up-down counter connected to count up with signal-channel pulses and to count down with background-channel pulses. A detector responsive to the count position of the up-down counter provides a signal when the up-down counter has completed one scaling sequence cycle of counts in the up direction. In an alternate embodiment, a detector responsive to the count position of the up-down counter provides a signal upon overflow of the counter.

  9. Pulsed atomic soliton laser

    SciTech Connect

    Carr, L.D.; Brand, J.

    2004-09-01

    It is shown that simultaneously changing the scattering length of an elongated, harmonically trapped Bose-Einstein condensate from positive to negative and inverting the axial portion of the trap, so that it becomes expulsive, results in a train of self-coherent solitonic pulses. Each pulse is itself a nondispersive attractive Bose-Einstein condensate that rapidly self-cools. The axial trap functions as a waveguide. The solitons can be made robustly stable with the right choice of trap geometry, number of atoms, and interaction strength. Theoretical and numerical evidence suggests that such a pulsed atomic soliton laser can be made in present experiments.

  10. Exchange protein directly activated by cAMP (epac): a multidomain cAMP mediator in the regulation of diverse biological functions.

    PubMed

    Schmidt, Martina; Dekker, Frank J; Maarsingh, Harm

    2013-04-01

    Since the discovery nearly 60 years ago, cAMP is envisioned as one of the most universal and versatile second messengers. The tremendous feature of cAMP to tightly control highly diverse physiologic processes, including calcium homeostasis, metabolism, secretion, muscle contraction, cell fate, and gene transcription, is reflected by the award of five Nobel prizes. The discovery of Epac (exchange protein directly activated by cAMP) has ignited a new surge of cAMP-related research and has depicted novel cAMP properties independent of protein kinase A and cyclic nucleotide-gated channels. The multidomain architecture of Epac determines its activity state and allows cell-type specific protein-protein and protein-lipid interactions that control fine-tuning of pivotal biologic responses through the "old" second messenger cAMP. Compartmentalization of cAMP in space and time, maintained by A-kinase anchoring proteins, phosphodiesterases, and β-arrestins, contributes to the Epac signalosome of small GTPases, phospholipases, mitogen- and lipid-activated kinases, and transcription factors. These novel cAMP sensors seem to implement certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Agonists and antagonists selective for Epac are developed and will support further studies on the biologic net outcome of the activation of Epac. This will increase our current knowledge on the pathophysiology of devastating diseases, such as diabetes, cognitive impairment, renal and heart failure, (pulmonary) hypertension, asthma, and chronic obstructive pulmonary disease. Further insights into the cAMP dynamics executed by the Epac signalosome will help to optimize the pharmacological treatment of these diseases. PMID:23447132

  11. A novel biosensor to study cAMP dynamics in cilia and flagella

    PubMed Central

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca2+, basal SACY activity is suppressed by Ca2+. Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. DOI: http://dx.doi.org/10.7554/eLife.14052.001 PMID:27003291

  12. Cardiac myocyte–secreted cAMP exerts paracrine action via adenosine receptor activation

    PubMed Central

    Sassi, Yassine; Ahles, Andrea; Truong, Dong-Jiunn Jeffery; Baqi, Younis; Lee, Sang-Yong; Husse, Britta; Hulot, Jean-Sébastien; Foinquinos, Ariana; Thum, Thomas; Müller, Christa E.; Dendorfer, Andreas; Laggerbauer, Bernhard; Engelhardt, Stefan

    2014-01-01

    Acute stimulation of cardiac β-adrenoceptors is crucial to increasing cardiac function under stress; however, sustained β-adrenergic stimulation has been implicated in pathological myocardial remodeling and heart failure. Here, we have demonstrated that export of cAMP from cardiac myocytes is an intrinsic cardioprotective mechanism in response to cardiac stress. We report that infusion of cAMP into mice averted myocardial hypertrophy and fibrosis in a disease model of cardiac pressure overload. The protective effect of exogenous cAMP required adenosine receptor signaling. This observation led to the identification of a potent paracrine mechanism that is dependent on secreted cAMP. Specifically, FRET-based imaging of cAMP formation in primary cells and in myocardial tissue from murine hearts revealed that cardiomyocytes depend on the transporter ABCC4 to export cAMP as an extracellular signal. Extracellular cAMP, through its metabolite adenosine, reduced cardiomyocyte cAMP formation and hypertrophy by activating A1 adenosine receptors while delivering an antifibrotic signal to cardiac fibroblasts by A2 adenosine receptor activation. Together, our data reveal a paracrine role for secreted cAMP in intercellular signaling in the myocardium, and we postulate that secreted cAMP may also constitute an important signal in other tissues. PMID:25401477

  13. Leveraging family-specific signatures for AMP discovery and high-throughput annotation

    PubMed Central

    Waghu, Faiza Hanif; Barai, Ram Shankar; Idicula-Thomas, Susan

    2016-01-01

    Antimicrobial peptides (AMPs) are diverse, biologically active, essential components of the innate immune system. As compared to conventional antibiotics, AMPs exhibit broad spectrum antimicrobial activity, reduced toxicity and reduced microbial resistance. They are widely researched for their therapeutic potential, especially against multi-drug resistant pathogens. AMPs are known to have family-specific sequence composition, which can be mined for their discovery and rational design. Here, we present a detailed family-based study on AMP families. The study involved the use of sequence signatures represented by patterns and hidden Markov models (HMMs) present in experimentally studied AMPs to identify novel AMPs. Along with AMPs, peptides hitherto lacking antimicrobial annotation were also retrieved and wet-lab studies on randomly selected sequences proved their antimicrobial activity against Escherichia coli. CAMPSign, a webserver has been created for researchers to effortlessly exploit the use of AMP family signatures for identification of AMPs. The webserver is available online at www.campsign.bicnirrh.res.in. In this work, we demonstrate an optimised and experimentally validated protocol along with a freely available webserver that uses family-based sequence signatures for accelerated discovery of novel AMPs. PMID:27089856

  14. A novel biosensor to study cAMP dynamics in cilia and flagella.

    PubMed

    Mukherjee, Shatanik; Jansen, Vera; Jikeli, Jan F; Hamzeh, Hussein; Alvarez, Luis; Dombrowski, Marco; Balbach, Melanie; Strünker, Timo; Seifert, Reinhard; Kaupp, U Benjamin; Wachten, Dagmar

    2016-01-01

    The cellular messenger cAMP regulates multiple cellular functions, including signaling in cilia and flagella. The cAMP dynamics in these subcellular compartments are ill-defined. We introduce a novel FRET-based cAMP biosensor with nanomolar sensitivity that is out of reach for other sensors. To measure cAMP dynamics in the sperm flagellum, we generated transgenic mice and reveal that the hitherto methods determining total cAMP levels do not reflect changes in free cAMP levels. Moreover, cAMP dynamics in the midpiece and principal piece of the flagellum are distinctively different. The sole cAMP source in the flagellum is the soluble adenylate cyclase (SACY). Although bicarbonate-dependent SACY activity requires Ca(2+), basal SACY activity is suppressed by Ca(2+). Finally, we also applied the sensor to primary cilia. Our new cAMP biosensor features unique characteristics that allow gaining new insights into cAMP signaling and unravel the molecular mechanisms underlying ciliary function in vitro and in vivo. PMID:27003291

  15. Nanomolar Inhibitors of AmpC [beta]-Lactamase

    SciTech Connect

    Morandi, Federica; Caselli, Emilia; Morandi, Stefania; Focia, Pamela J.; Blazquez, Jesus; Shoichet, Brian K.; Prati, Fabio

    2010-03-08

    {beta}-lactamases are the most widespread resistance mechanism to {beta}-lactam antibiotics, such as the penicillins and the cephalosporins. In an effort to combat these enzymes, a combination of stereoselective organic synthesis, enzymology, microbiology, and X-ray crystallography was used to design and evaluate new carboxyphenyl-glycylboronic acid transition-state analogue inhibitors of the class C {beta}-lactamase AmpC. The new compounds improve inhibition by over 2 orders of magnitude compared to analogous glycylboronic acids, with K{sub i} values as low as 1 nM. On the basis of the differential binding of different analogues, the introduced carboxylate alone contributes about 2.1 kcal/mol in affinity. This carboxylate corresponds to the ubiquitous C3(4)' carboxylate of {beta}-lactams, and this energy represents the first thermodynamic measurement of the importance of this group in molecular recognition by class C {beta}-lactamases. The structures of AmpC in complex with two of these inhibitors were determined by X-ray crystallography at 1.72 and 1.83 {angstrom} resolution. These structures suggest a structural basis for the high affinity of the new compounds and provide templates for further design. The highest affinity inhibitor was 5 orders of magnitude more selective for AmpC than for characteristic serine proteases, such as chymotrypsin. This inhibitor reversed the resistance of clinical pathogens to the third generation cephalosporin ceftazidime; it may serve as a lead compound for drug discovery to combat bacterial resistance to {beta}-lactam antibiotics.

  16. Functional Analysis of a c-di-AMP-specific Phosphodiesterase MsPDE from Mycobacterium smegmatis

    PubMed Central

    Tang, Qing; Luo, Yunchao; Zheng, Cao; Yin, Kang; Ali, Maria Kanwal; Li, Xinfeng; He, Jin

    2015-01-01

    Cyclic di‑AMP (c-di-AMP) is a second signaling molecule involved in the regulation of bacterial physiological processes and interaction between pathogen and host. However, the regulatory network mediated by c-di-AMP in Mycobacterium remains obscure. In M. smegmatis, a diadenylate cyclase (DAC) was reported recently, but there is still no investigation on c-di-AMP phosphodiesterase (PDE). Here, we provide a systematic study on signaling mechanism of c-di-AMP PDE in M. smegmatis. Based on our enzymatic analysis, MsPDE (MSMEG_2630), which contained a DHH-DHHA1 domain, displayed a 200-fold higher hydrolytic efficiency (kcat/Km) to c-di-AMP than to c-di-GMP. MsPDE was capable of converting c-di-AMP to pApA and AMP, and hydrolyzing pApA to AMP. Site-directed mutations in DHH and DHHA1 revealed that DHH domain was critical for the phosphodiesterase activity. To explore the regulatory role of c-di-AMP in vivo, we constructed the mspde mutant (Δmspde) and found that deficiency of MsPDE significantly enhanced intracellular C12-C20 fatty acid accumulation. Deficiency of DAC in many bacteria results in cell death. However, we acquired the M. smegmatis strain with DAC gene disrupted (ΔmsdisA) by homologous recombination approach. Deletion of msdisA reduced bacterial C12-C20 fatty acids production but scarcely affected bacterial survival. We also provided evidences that superfluous c-di-AMP in M. smegmatis could lead to abnormal colonial morphology. Collectively, our results indicate that MsPDE is a functional c-di-AMP-specific phosphodiesterase both in vitro and in vivo. Our study also expands the regulatory network mediated by c-di-AMP in M. smegmatis. PMID:26078723

  17. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation.

    PubMed

    Yang, Pei-Chi; Boras, Britton W; Jeng, Mao-Tsuen; Docken, Steffen S; Lewis, Timothy J; McCulloch, Andrew D; Harvey, Robert D; Clancy, Colleen E

    2016-07-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  18. A Computational Modeling and Simulation Approach to Investigate Mechanisms of Subcellular cAMP Compartmentation

    PubMed Central

    Yang, Pei-Chi; Boras, Britton W.; Jeng, Mao-Tsuen; Lewis, Timothy J.; McCulloch, Andrew D.; Harvey, Robert D.; Clancy, Colleen E.

    2016-01-01

    Subcellular compartmentation of the ubiquitous second messenger cAMP has been widely proposed as a mechanism to explain unique receptor-dependent functional responses. How exactly compartmentation is achieved, however, has remained a mystery for more than 40 years. In this study, we developed computational and mathematical models to represent a subcellular sarcomeric space in a cardiac myocyte with varying detail. We then used these models to predict the contributions of various mechanisms that establish subcellular cAMP microdomains. We used the models to test the hypothesis that phosphodiesterases act as functional barriers to diffusion, creating discrete cAMP signaling domains. We also used the models to predict the effect of a range of experimentally measured diffusion rates on cAMP compartmentation. Finally, we modeled the anatomical structures in a cardiac myocyte diad, to predict the effects of anatomical diffusion barriers on cAMP compartmentation. When we incorporated experimentally informed model parameters to reconstruct an in silico subcellular sarcomeric space with spatially distinct cAMP production sites linked to caveloar domains, the models predict that under realistic conditions phosphodiesterases alone were insufficient to generate significant cAMP gradients. This prediction persisted even when combined with slow cAMP diffusion. When we additionally considered the effects of anatomic barriers to diffusion that are expected in the cardiac myocyte dyadic space, cAMP compartmentation did occur, but only when diffusion was slow. Our model simulations suggest that additional mechanisms likely contribute to cAMP gradients occurring in submicroscopic domains. The difference between the physiological and pathological effects resulting from the production of cAMP may be a function of appropriate compartmentation of cAMP signaling. Therefore, understanding the contribution of factors that are responsible for coordinating the spatial and temporal

  19. Regulation of the Dictyostelium glycogen phosphorylase 2 gene by cyclic AMP.

    PubMed

    Sucic, J F; Selmin, O; Rutherford, C L

    1993-01-01

    A crucial developmental event in the cellular slime mold, Dictyostelium discoideum, is glycogen degradation. The enzyme that catalyzes this degradation, glycogen phosphorylase 2 (gp-2), is developmentally regulated and cAMP appears to be involved in this regulation. We have examined several aspects of the cAMP regulation of gp-2. We show that addition of exogenous cAMP to aggregation competent amoebae induced the appearance of gp-2 mRNA. The induction of gp-2 mRNA occurred within 1 and 1.5 h after the initial exposure to cAMP. Exposure to exogenous cAMP concentrations as low as 1.0 microM could induce gp-2 mRNA. We also examined the molecular mechanism through which cAMP induction of gp-2 occurs. Induction of gp-2 appears to result from a mechanism that does not require intracellular cAMP signaling, and may occur directly through a cAMP binding protein without the requirement of any intracellular signalling. We also examined the promoter region of the gp-2 gene for cis-acting elements that are involved in the cAMP regulation of gp-2. A series of deletions of the promoter were fused to a luciferase reporter gene and then analyzed for cAMP responsiveness. The results indicated that a region from -258 nucleotides to the transcriptional start site is sufficient for essentially full activity and appears to carry all necessary cis-acting sites for cAMP induction. Further deletion of 58 nucleotides from the 5' end, results in fivefold less activity in the presence of cAMP. Deletion of the next 104 nucleotides eliminates the cAMP response entirely. PMID:8222346

  20. Pulse Coil Tester

    NASA Technical Reports Server (NTRS)

    Simon, Richard A.

    1988-01-01

    Set of relays tested easily and repeatedly. Pulse coil tester causes coil under test to generate transient voltage; waveform indicates condition of coil. Tester accommodates assembly of up to four coils at a time.

  1. HIGH POWER PULSED OSCILLATOR

    DOEpatents

    Singer, S.; Neher, L.K.

    1957-09-24

    A high powered, radio frequency pulse oscillator is described for generating trains of oscillations at the instant an input direct voltage is impressed, or immediately upon application of a light pulse. In one embodiment, the pulse oscillator comprises a photo-multiplier tube with the cathode connected to the first dynode by means of a resistor, and adjacent dynodes are connected to each other through adjustable resistors. The ohmage of the resistors progressively increases from a very low value for resistors adjacent the cathode to a high value adjacent the plate, the last dynode. Oscillation occurs with this circuit when a high negative voltage pulse is applied to the cathode and the photo cathode is bombarded. Another embodiment adds capacitors at the resistor connection points of the above circuit to increase the duration of the oscillator train.

  2. Pulsed-neutron monochromator

    DOEpatents

    Mook, H.A. Jr.

    1984-01-01

    In one aspect, the invention is an improved pulsed-neutron monochromator of the vibrated-crystal type. The monochromator is designed to provide neutron pulses which are characterized both by short duration and high density. A row of neutron-reflecting crystals is disposed in a neutron beam to reflect neutrons onto a common target. The crystals in the row define progressively larger neutron-scattering angles and are vibrated sequentially in descending order with respect to the size of their scattering angles, thus generating neutron pulses which arrive simultaneously at the target. Transducers are coupled to one end of the crystals to vibrate them in an essentially non-resonant mode. The transducers propagate transverse waves in the crystal which progress longitudinally therein. The waves are absorbed at the undriven ends of the crystals by damping material mounted thereon. In another aspect, the invention is a method for generating neutron pulses characterized by high intensity and short duration.

  3. Pulsed-neutron monochromator

    DOEpatents

    Mook, Jr., Herbert A.

    1985-01-01

    In one aspect, the invention is an improved pulsed-neutron monochromator of the vibrated-crystal type. The monochromator is designed to provide neutron pulses which are characterized both by short duration and high density. A row of neutron-reflecting crystals is disposed in a neutron beam to reflect neutrons onto a common target. The crystals in the row define progressively larger neutron-scattering angles and are vibrated sequentially in descending order with respect to the size of their scattering angles, thus generating neutron pulses which arrive simultaneously at the target. Transducers are coupled to one end of the crystals to vibrate them in an essentially non-resonant mode. The transducers propagate transverse waves in the crystal which progress longitudinally therein. The wave are absorbed at the undriven ends of the crystals by damping material mounted thereon. In another aspect, the invention is a method for generating neutron pulses characterized by high intensity and short duration.

  4. Pulse measurement apparatus and method

    DOEpatents

    Marciante, John R.; Donaldson, William R.; Roides, Richard G.

    2011-10-25

    An embodiment of the invention is directed to a pulse measuring system that measures a characteristic of an input pulse under test, particularly the pulse shape of a single-shot, nano-second duration, high shape-contrast optical or electrical pulse. An exemplary system includes a multi-stage, passive pulse replicator, wherein each successive stage introduces a fixed time delay to the input pulse under test, a repetitively-gated electronic sampling apparatus that acquires the pulse train including an entire waveform of each replica pulse, a processor that temporally aligns the replicated pulses, and an averager that temporally averages the replicated pulses to generate the pulse shape of the pulse under test. An embodiment of the invention is directed to a method for measuring an optical or an electrical pulse shape. The method includes the steps of passively replicating the pulse under test with a known time delay, temporally stacking the pulses, and temporally averaging the stacked pulses. An embodiment of the invention is directed to a method for increasing the dynamic range of a pulse measurement by a repetitively-gated electronic sampling device having a rated dynamic range capability, beyond the rated dynamic range of the sampling device; e.g., enhancing the dynamic range of an oscilloscope. The embodied technique can improve the SNR from about 300:1 to 1000:1. A dynamic range enhancement of four to seven bits may be achieved.

  5. Pulsed spallation Neutron Sources

    SciTech Connect

    Carpenter, J.M.

    1994-12-31

    This paper reviews the early history of pulsed spallation neutron source development at Argonne and provides an overview of existing sources world wide. A number of proposals for machines more powerful than currently exist are under development, which are briefly described. The author reviews the status of the Intense Pulsed Neutron Source, its instrumentation, and its user program, and provides a few examples of applications in fundamental condensed matter physics, materials science and technology.

  6. Pulsed spallation neutron sources

    SciTech Connect

    Carpenter, J.M.

    1996-05-01

    This paper reviews the early history of pulsed spallation neutron source development ar Argonne and provides an overview of existing sources world wide. A number of proposals for machines more powerful than currently exist are under development, which are briefly described. The author reviews the status of the Intense Pulsed Neutron Source, its instrumentation, and its user program, and provide a few examples of applications in fundamental condensed matter physics, materials science and technology.

  7. Pulse magnetic welder

    DOEpatents

    Christiansen, D.W.; Brown, W.F.

    1984-01-01

    A welder is described for automated closure of fuel pins by a pulsed magnetic process in which the open end of a length of cladding is positioned within a complementary tube surrounded by a pulsed magnetic welder. Seals are provided at each end of the tube, which can be evacuated or can receive tag gas for direct introduction to the cladding interior. Loading of magnetic rings and end caps is accomplished automatically in conjunction with the welding steps carried out within the tube.

  8. An Essential Poison: Synthesis and Degradation of Cyclic Di-AMP in Bacillus subtilis

    PubMed Central

    Gundlach, Jan; Mehne, Felix M. P.; Herzberg, Christina; Kampf, Jan; Valerius, Oliver; Kaever, Volkhard

    2015-01-01

    ABSTRACT Gram-positive bacteria synthesize the second messenger cyclic di-AMP (c-di-AMP) to control cell wall and potassium homeostasis and to secure the integrity of their DNA. In the firmicutes, c-di-AMP is essential for growth. The model organism Bacillus subtilis encodes three diadenylate cyclases and two potential phosphodiesterases to produce and degrade c-di-AMP, respectively. Among the three cyclases, CdaA is conserved in nearly all firmicutes, and this enzyme seems to be responsible for the c-di-AMP that is required for cell wall homeostasis. Here, we demonstrate that CdaA localizes to the membrane and forms a complex with the regulatory protein CdaR and the glucosamine-6-phosphate mutase GlmM. Interestingly, cdaA, cdaR, and glmM form a gene cluster that is conserved throughout the firmicutes. This conserved arrangement and the observed interaction between the three proteins suggest a functional relationship. Our data suggest that GlmM and GlmS are involved in the control of c-di-AMP synthesis. These enzymes convert glutamine and fructose-6-phosphate to glutamate and glucosamine-1-phosphate. c-di-AMP synthesis is enhanced if the cells are grown in the presence of glutamate compared to that in glutamine-grown cells. Thus, the quality of the nitrogen source is an important signal for c-di-AMP production. In the analysis of c-di-AMP-degrading phosphodiesterases, we observed that both phosphodiesterases, GdpP and PgpH (previously known as YqfF), contribute to the degradation of the second messenger. Accumulation of c-di-AMP in a gdpP pgpH double mutant is toxic for the cells, and the cells respond to this accumulation by inactivation of the diadenylate cyclase CdaA. IMPORTANCE Bacteria use second messengers for signal transduction. Cyclic di-AMP (c-di-AMP) is the only second messenger known so far that is essential for a large group of bacteria. We have studied the regulation of c-di-AMP synthesis and the role of the phosphodiesterases that degrade this second

  9. LED flicker pulsing

    NASA Astrophysics Data System (ADS)

    Johnson, Mark A.; Cote, Paul J.

    2001-08-01

    There is need to replace hazardous radioluminescent light sources with a means of illumination that is environmentally friendly. This paper describes an electronic source that was developed as a potential candidate to replace low intensity tritium in a military system. It employs an LED for illumination and a 3-volt coin cell battery as a power source. This new light source is electronically invisible, requires minimal maintenance, and provides the lowest practical illumination to preclude detection by optical means. The low intensity requires that the LED be driven at DC current levels resulting in poor luminous efficiency. Therefore, in an effort to maximize battery life, the LED is pulsed into a more optically efficient mode of operation. However, conventional pulsing techniques are not employed because of concerns the electronics could be identified by conspicuous power spectral density (PSD) components in the electromagnetic spectrum generated by a pulsed LED. Therefore, flicker noise concepts have been employed to efficiently drive the LED while generating a virtually undetectable spectral signature. Although ideally the pulse durations, magnitudes, and spacings should be random, a significant reduction in conspicuous PSD components can be achieved when imposing practical constraints. The dominant components of the power spectrum are significantly reduced using fixed pulse durations and magnitudes while varying only the pulse spacing. The mean duty cycle is set to provide the same effective illumination as DC operation while generating a PSD normally associated with natural phenomena.

  10. A versatile pulse programmer for pulsed nuclear magnetic resonance spectroscopy.

    NASA Technical Reports Server (NTRS)

    Tarr, C. E.; Nickerson, M. A.

    1972-01-01

    A digital pulse programmer producing the standard pulse sequences required for pulsed nuclear magnetic resonance spectroscopy is described. In addition, a 'saturation burst' sequence, useful in the measurement of long relaxation times in solids, is provided. Both positive and negative 4 V trigger pulses are produced that are fully synchronous with a crystal-controlled time base, and the pulse programmer may be phase-locked with a maximum pulse jitter of 3 ns to the oscillator of a coherent pulse spectrometer. Medium speed TTL integrated circuits are used throughout.

  11. Temporal and spatial regulation of cAMP signaling in disease: role of cyclic nucleotide phosphodiesterases.

    PubMed

    Otero, Carolina; Peñaloza, Juan P; Rodas, Paula I; Fernández-Ramires, Ricardo; Velasquez, Luis; Jung, Juan E

    2014-12-01

    Since its discovery, cAMP has been proposed as one of the most versatile second messengers. The remarkable feature of cAMP to tightly control highly diverse physiological processes, including metabolism, homeostasis, secretion, muscle contraction, cell proliferation and migration, immune response, and gene transcription, is reflected by millions of different articles worldwide. Compartmentalization of cAMP in space and time, maintained by mainly phosphodiesterases, contributes to the maintenance of equilibrium inside the cell where one signal can trigger many different events. Novel cAMP sensors seem to carry out certain unexpected signaling properties of cAMP and thereby to permit delicate adaptations of biologic responses. Measuring space and time events with biosensors will increase our current knowledge on the pathophysiology of diseases, such as chronic obstructive pulmonary disease, asthma, cognitive impairment, cancer, and renal and heart failure. Further insights into the cAMP dynamics will help to optimize the pharmacological treatment for these diseases. PMID:24750474

  12. cAMP and Ca2+ signaling in secretory epithelia: Crosstalk and Synergism

    PubMed Central

    Ahuja, Malini; Jha, Archana; Maléth, Jozsef; Park, Seonghee; Muallem, Shmuel

    2014-01-01

    The Ca2+ and cAMP/PKA pathways are the primary signaling systems in secretory epithelia that control virtually all secretory gland functions. Interaction and crosstalk in Ca2+ and cAMP signaling occur at multiple levels to control and tune the activity of each other. Physiologically, Ca2+ and cAMP signaling operate at 5–10% of maximal strength, but synergize to generate the maximal response. Although synergistic action of the Ca2+ and cAMP signaling is the common mode of signaling and has been known for many years, we know very little of the molecular mechanism and mediators of the synergism. In this review, we discuss crosstalk between the Ca2+ and cAMP signaling and the function of IRBIT (IP3 receptors binding protein release with IP3) as a third messenger that mediates the synergistic action of the Ca2+ and cAMP signaling. PMID:24613710

  13. Enzymatic production of 5'-inosinic acid by AMP deaminase from a newly isolated Aspergillus oryzae.

    PubMed

    Li, Shubo; Chen, Leitao; Hu, Yangjun; Fang, Guohui; Zhao, Mouming; Guo, Yuan; Pang, Zongwen

    2017-02-01

    5'-adenylic acid deaminase (AMP deaminase), an important enzyme for the food industry, can catalyze the irreversible hydrolysis of adenosine monophosphate (AMP) to inosine monophosphate (IMP) and ammonia. In this study, a new strain was screened that efficiently produces 3191.6U/g of AMP deaminase at 32°C. After purification, the optimal temperature and pH of the AMP deaminase were found to be 40°C and 6.0, respectively, but it was partially inhibited by Fe(3+), Cu(2+), Al(3+), and Zn(2+). With amplification of the AMP deaminase production system, 6mL of crude enzyme could produce 2.00mg/g of IMP from 2.04mg/g of dried yeast with an 84.8% molar yield after 40min. These results provide a new insight into AMP deaminase production and offer a potential platform for producing 5'-IMP. PMID:27596420

  14. Electrostatic steering enhances the rate of cAMP binding to phosphodiesterase: Brownian dynamics modeling.

    PubMed

    Huang, Yu-ming M; Huber, Gary; McCammon, J Andrew

    2015-11-01

    Signaling in cells often involves co-localization of the signaling molecules. Most experimental evidence has shown that intracellular compartmentalization restricts the range of action of the second messenger, 3'-5'-cyclic adenosine monophosphate (cAMP), which is degraded by phosphodiesterases (PDEs). The objective of this study is to understand the details of molecular encounter that may play a role in efficient operation of the cAMP signaling apparatus. The results from electrostatic potential calculations and Brownian dynamics simulations suggest that positive potential of the active site from PDE enhances capture of diffusing cAMP molecules. This electrostatic steering between cAMP and the active site of a PDE plays a major role in the enzyme-substrate encounter, an effect that may be of significance in sequestering cAMP released from a nearby binding site or in attracting more freely diffusing cAMP molecules. PMID:26346301

  15. Functions of AMP-activated protein kinase in adipose tissue

    PubMed Central

    Daval, Marie; Foufelle, Fabienne; Ferré, Pascal

    2006-01-01

    AMP-activated protein kinase (AMPK) is involved in cellular energy homeostasis. Its functions have been extensively studied in muscles and liver. AMPK stimulates pathways which increase energy production (glucose transport, fatty acid oxidation) and switches off pathways which consume energy (lipogenesis, protein synthesis, gluconeogenesis). This has led to the concept that AMPK has an interesting pharmaceutical potential in situations of insulin resistance and it is indeed the target of existing drugs and hormones which improve insulin sensitivity. Adipose tissue is a key player in energy metabolism through the release of substrates and hormones involved in metabolism and insulin sensitivity. Activation of AMPK in adipose tissue can be achieved through situations such as fasting and exercise. Leptin and adiponectin as well as hypoglycaemic drugs are activators of adipose tissue AMPK. This activation probably involves changes in the AMP/ATP ratio and the upstream kinase LKB1. When activated, AMPK limits fatty acid efflux from adipocytes and favours local fatty acid oxidation. Since fatty acids have a key role in insulin resistance, especially in muscles, activating AMPK in adipose tissue might be found to be beneficial in insulin-resistant states, particularly as AMPK activation also reduces cytokine secretion in adipocytes. PMID:16709632

  16. Solution structure of the cAMP-dependent protein kinase

    SciTech Connect

    Trewhella, J.; Olah, G.A.; Walsh, D.A.; Mitchell, R.D.

    1998-12-31

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project as Los Alamos National Laboratory (LANL). Protein phosphorylation is well established as one of the most important mechanisms of signal transduction and cellular regulation. Two of the key enzymes that catalyze these phosphorylation reactions are the cAMP- (PKA) and cGMP- (PKG) dependent protein kinases. PKA has served as the prototypic model of this class of enzymes that now comprises in excess of 300 phylogenetically related proteins. A large number of these protein kinases are critical for the regulation of cell function and a full analysis of their similarities and differences is essential to understand their diverse physiological roles. The cAMP-dependent protein kinase has the subunit structure R2C2, in which C and R refer to the catalytic and regulatory subunits, respectively. The cGMP-dependent protein kinase (PKG) is highly homologous to PKA but is distinguished from it by having the regulatory and catalytic domains on a contiguous polypeptide. The studies described here use small-angle scattering and Fourier Transform InfraRed (FTIR) spectroscopy to study domain movements and conformational changes in these enzymes in different functional states in order to elucidate the molecular bases for the regulation of their activities.

  17. Dynamics of β-adrenergic/cAMP signaling and morphological changes in cultured astrocytes.

    PubMed

    Vardjan, Nina; Kreft, Marko; Zorec, Robert

    2014-04-01

    The morphology of astrocytes, likely regulated by cAMP, determines the structural association between astrocytes and the synapse, consequently modulating synaptic function. β-Adrenergic receptors (β-AR), which increase cytosolic cAMP concentration ([cAMP]i ), may affect cell morphology. However, the real-time dynamics of β-AR-mediated cAMP signaling in single live astrocytes and its effect on cell morphology have not been studied. We used the fluorescence resonance energy transfer (FRET)-based cAMP biosensor Epac1-camps to study time-dependent changes in [cAMP]i ; morphological changes in primary rat astrocytes were monitored by real-time confocal microscopy. Stimulation of β-AR by adrenaline, noradrenaline, and isoprenaline, a specific agonist of β-AR, rapidly increased [cAMP]i (∼15 s). The FRET signal response, mediated via β-AR, was faster than in the presence of forskolin (twofold) and dibutyryl-cAMP (>35-fold), which directly activate adenylyl cyclase and Epac1-camps, respectively, likely due to slow entry of these agents into the cytosol. Oscillations in [cAMP]i have not been recorded, indicating that cAMP-dependent processes operate in a slow time domain. Most Epac1-camps expressing astrocytes revealed a morphological change upon β-AR activation and attained a stellate morphology within 1 h. The morphological changes exhibited a bell-shaped dependency on [cAMP]i . The 5-10% decrease in cell cross-sectional area and the 30-50% increase in cell perimeter are likely due to withdrawal of the cytoplasm to the perinuclear region and the appearance of protrusions on the surface of astrocytes. Because astrocyte processes ensheath neurons, β-AR/cAMP-mediated morphological changes can modify the geometry of the extracellular space, affecting synaptic, neuronal, and astrocyte functions in health and disease. PMID:24464905

  18. Is This Op-Amp Any Good?: Lab-Built Checker Removes All Doubt!

    ERIC Educational Resources Information Center

    Harman, Charles

    2007-01-01

    Electronics instructors and students find it very helpful to be able to check an operational amplifier at the proto-board stage. Most students lack the experience or knowledge that it takes to recognize whether an op-amp is operating normally or not. This article discusses a handy op-amp checker that allows one to check and/or test op-amps at the…

  19. Mathematical model of cAMP-dependent signaling pathway in constitutive and UV-induced melanogenesis

    NASA Astrophysics Data System (ADS)

    Stolnitz, Mikhail M.; Peshkova, Anna Y.

    2002-07-01

    Cascade of reactions of cAMP-dependent signaling pathway in melanocytes is investigated by mathematical modeling. Model takes into account (alpha) -melanocyte stimulating hormone binding to melanocortin-1 receptor, adenylate cyclase activation by G-protein, increase of the intracellular cAMP concentration, PKA activation by cAMP, CREB phosphorylation by PKA, microphthalmia gene expression, microphthalmia binding to tyrosinase gene promoter, increase of tyrosinase synthesis. Positive and negative feedback loops of this system are analyzed.

  20. Pulse shaping with transmission lines

    DOEpatents

    Wilcox, R.B.

    1985-08-15

    A method and apparatus for forming shaped voltage pulses uses passive reflection from a transmission line with nonuniform impedance. The impedance of the reflecting line varies with length in accordance with the desired pulse shape. A high voltage input pulse is transmitted to the reflecting line. A reflected pulse is produced having the desired shape and is transmitted by pulse removal means to a load. Light activated photoconductive switches made of silicon can be utilized. The pulse shaper can be used to drive a Pockels cell to produce shaped optical pulses.

  1. Pulse shaping with transmission lines

    DOEpatents

    Wilcox, Russell B.

    1987-01-01

    A method and apparatus for forming shaped voltage pulses uses passive reflection from a transmission line with nonuniform impedance. The impedance of the reflecting line varies with length in accordance with the desired pulse shape. A high voltage input pulse is transmitted to the reflecting line. A reflected pulse is produced having the desired shape and is transmitted by pulse removal means to a load. Light activated photoconductive switches made of silicon can be utilized. The pulse shaper can be used to drive a Pockels cell to produce shaped optical pulses.

  2. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms

    SciTech Connect

    Ghayor, Chafik; Ehrbar, Martin; Miguel, Blanca San; Graetz, Klaus W.; Weber, Franz E.

    2009-04-03

    Recent studies suggest that the elevation of intracellular cyclic adenosine monophosphate (cAMP) and the activation of the protein kinase A regulate BMP-induced osteogenesis. However, the precise mechanisms underlying the enhancing effect of cAMP on BMP2 signaling were not completely revealed. In this study we investigated the effect of elevated cAMP level and PKA activation on the BMP2-induced osteoblastic differentiation in pluripotent C2C12 cells. Alkaline phosphatase activity and its mRNA were consistently induced by BMP2 treatment. The pretreatment of C2C12 cells with Forskolin, a cAMP generating agent, dbcAMP, an analogue of cAMP, or IBMX (3-isobutyl 1-methyl xanthine), and a nonspecific inhibitor of phosphodiesterases elicited further activation of alkaline phosphatase. Furthermore, elevated intracellular cAMP level increased BMP2-induced MKP1. On the other hand, BMP2-induced Erk phosphorylation (p44/p42) and cell proliferation were suppressed in the presence of cAMP. Thus, cAMP might enhance BMP2-induced osteoblastic differentiation by a MKP1-Erk-dependent mechanism.

  3. A-kinase anchoring proteins: cAMP compartmentalization in neurodegenerative and obstructive pulmonary diseases

    PubMed Central

    Poppinga, W J; Muñoz-Llancao, P; González-Billault, C; Schmidt, M

    2014-01-01

    The universal second messenger cAMP is generated upon stimulation of Gs protein-coupled receptors, such as the β2-adreneoceptor, and leads to the activation of PKA, the major cAMP effector protein. PKA oscillates between an on and off state and thereby regulates a plethora of distinct biological responses. The broad activation pattern of PKA and its contribution to several distinct cellular functions lead to the introduction of the concept of compartmentalization of cAMP. A-kinase anchoring proteins (AKAPs) are of central importance due to their unique ability to directly and/or indirectly interact with proteins that either determine the cellular content of cAMP, such as β2-adrenoceptors, ACs and PDEs, or are regulated by cAMP such as the exchange protein directly activated by cAMP. We report on lessons learned from neurons indicating that maintenance of cAMP compartmentalization by AKAP5 is linked to neurotransmission, learning and memory. Disturbance of cAMP compartments seem to be linked to neurodegenerative disease including Alzheimer's disease. We translate this knowledge to compartmentalized cAMP signalling in the lung. Next to AKAP5, we focus here on AKAP12 and Ezrin (AKAP78). These topics will be highlighted in the context of the development of novel pharmacological interventions to tackle AKAP-dependent compartmentalization. PMID:25132049

  4. cAMP diffusion in Dictyostelium discoideum: A Green's function method

    NASA Astrophysics Data System (ADS)

    Calovi, Daniel S.; Brunnet, Leonardo G.; de Almeida, Rita M. C.

    2010-07-01

    A Green’s function method is developed to approach the spatiotemporal equations describing the cAMP production in Dictyostelium discoideum, markedly reducing numerical calculations times: cAMP concentrations and gradients are calculated just at the amoeba locations. A single set of parameters is capable of reproducing the different observed behaviors, from cAMP synchronization, spiral waves and reaction-diffusion patterns to streaming and mound formation. After aggregation, the emergence of a circular motion of amoebas, breaking the radial cAMP field symmetry, is observed.

  5. Role of site-selective cAMP analogs in the control and reversal of malignancy.

    PubMed

    Cho-Chung, Y S; Clair, T; Tortora, G; Yokozaki, H

    1991-01-01

    Two isoforms of cAMP receptor protein, RI and RII, the regulatory subunits of cAMP-dependent protein kinase, transduce opposite signals, the RI being stimulatory and the RII being inhibitory of cell proliferation. In normal cells RI and RII exist at a specific physiological ratio whereas in cancer cells such physiological balance of these receptor proteins is disrupted. Reversal and suppression of malignancy can be achieved when the physiologic ratio of these intracellular signal transducers of cAMP is restored as shown by the use of site-selective cAMP analogs, antisense oligodeoxynucleotides or gene transfer, suggesting new approaches to cancer control. PMID:1653961

  6. Active site coupling in PDE:PKA complexes promotes resetting of mammalian cAMP signaling.

    PubMed

    Krishnamurthy, Srinath; Moorthy, Balakrishnan Shenbaga; Xin Xiang, Lim; Xin Shan, Lim; Bharatham, Kavitha; Tulsian, Nikhil Kumar; Mihalek, Ivana; Anand, Ganesh S

    2014-09-16

    Cyclic 3'5' adenosine monophosphate (cAMP)-dependent-protein kinase (PKA) signaling is a fundamental regulatory pathway for mediating cellular responses to hormonal stimuli. The pathway is activated by high-affinity association of cAMP with the regulatory subunit of PKA and signal termination is achieved upon cAMP dissociation from PKA. Although steps in the activation phase are well understood, little is known on how signal termination/resetting occurs. Due to the high affinity of cAMP to PKA (KD ∼ low nM), bound cAMP does not readily dissociate from PKA, thus begging the question of how tightly bound cAMP is released from PKA to reset its signaling state to respond to subsequent stimuli. It has been recently shown that phosphodiesterases (PDEs) can catalyze dissociation of bound cAMP and thereby play an active role in cAMP signal desensitization/termination. This is achieved through direct interactions with the regulatory subunit of PKA, thereby facilitating cAMP dissociation and hydrolysis. In this study, we have mapped direct interactions between a specific cyclic nucleotide phosphodiesterase (PDE8A) and a PKA regulatory subunit (RIα isoform) in mammalian cAMP signaling, by a combination of amide hydrogen/deuterium exchange mass spectrometry, peptide array, and computational docking. The interaction interface of the PDE8A:RIα complex, probed by peptide array and hydrogen/deuterium exchange mass spectrometry, brings together regions spanning the phosphodiesterase active site and cAMP-binding sites of RIα. Computational docking combined with amide hydrogen/deuterium exchange mass spectrometry provided a model for parallel dissociation of bound cAMP from the two tandem cAMP-binding domains of RIα. Active site coupling suggests a role for substrate channeling in the PDE-dependent dissociation and hydrolysis of cAMP bound to PKA. This is the first instance, to our knowledge, of PDEs directly interacting with a cAMP-receptor protein in a mammalian system, and

  7. Ethanol-induced loss of brain cyclic AMP binding proteins: correlation with growth suppression

    SciTech Connect

    Pennington, S.; Kalmus, G.

    1987-05-01

    Brain hypoplasia secondary to maternal ethanol consumption is a common fetal defect observed in all models of fetal alcohol syndrome. The molecular mechanism by which ethanol inhibits growth is unknown but has been hypothesized to involve ethanol-induced changes in the activity of cyclic-AMP stimulated protein kinase. Acute and chronic alcohol exposure elevate cyclic AMP level in many tissues, including brain. This increase in cyclic AMP should increase the phosphorylating activity of kinase by increasing the amount of dissociated (active) kinase catalytic subunit. In 7-day embryonic chick brains, ethanol-induced growth suppression was correlated with increased brain cyclic AMP content but neither basal nor cyclic AMP stimulated kinase catalytic activity was increased. However, the levels of cyclic AMP binding protein (kinase regulatory subunit) were significantly lowered by ethanol exposure. Measured as either /sup 3/H cyclic AMP binding or as 8-azido cyclic AM/sup 32/P labeling, ethanol-exposed brains had significantly less cyclic AMP binding activity (51 +/- 14 versus 29 +/- 10 units/..mu..g protein for 8-azido cyclic AMP binding). These findings suggest that ethanol's effect on kinase activity may involve more than ethanol-induced activation of adenylate cyclase.

  8. cAMP signaling microdomains and their observation by optical methods

    PubMed Central

    Calebiro, Davide; Maiellaro, Isabella

    2014-01-01

    The second messenger cyclic AMP (cAMP) is a major intracellular mediator of many hormones and neurotransmitters and regulates a myriad of cell functions, including synaptic plasticity in neurons. Whereas cAMP can freely diffuse in the cytosol, a growing body of evidence suggests the formation of cAMP gradients and microdomains near the sites of cAMP production, where cAMP signals remain apparently confined. The mechanisms responsible for the formation of such microdomains are subject of intensive investigation. The development of optical methods based on fluorescence resonance energy transfer (FRET), which allow a direct observation of cAMP signaling with high temporal and spatial resolution, is playing a fundamental role in elucidating the nature of such microdomains. Here, we will review the optical methods used for monitoring cAMP and protein kinase A (PKA) signaling in living cells, providing some examples of their application in neurons, and will discuss the major hypotheses on the formation of cAMP/PKA microdomains. PMID:25389388

  9. A Universal Stress Protein (USP) in Mycobacteria Binds cAMP

    PubMed Central

    Banerjee, Arka; Adolph, Ramona S.; Gopalakrishnapai, Jayashree; Kleinboelting, Silke; Emmerich, Christiane; Steegborn, Clemens; Visweswariah, Sandhya S.

    2015-01-01

    Mycobacteria are endowed with rich and diverse machinery for the synthesis, utilization, and degradation of cAMP. The actions of cyclic nucleotides are generally mediated by binding of cAMP to conserved and well characterized cyclic nucleotide binding domains or structurally distinct cGMP-specific and -regulated cyclic nucleotide phosphodiesterase, adenylyl cyclase, and E. coli transcription factor FhlA (GAF) domain-containing proteins. Proteins with cyclic nucleotide binding and GAF domains can be identified in the genome of mycobacterial species, and some of them have been characterized. Here, we show that a significant fraction of intracellular cAMP is bound to protein in mycobacterial species, and by using affinity chromatography techniques, we identify specific universal stress proteins (USP) as abundantly expressed cAMP-binding proteins in slow growing as well as fast growing mycobacteria. We have characterized the biochemical and thermodynamic parameters for binding of cAMP, and we show that these USPs bind cAMP with a higher affinity than ATP, an established ligand for other USPs. We determined the structure of the USP MSMEG_3811 bound to cAMP, and we confirmed through structure-guided mutagenesis, the residues important for cAMP binding. This family of USPs is conserved in all mycobacteria, and we suggest that they serve as “sinks” for cAMP, making this second messenger available for downstream effectors as and when ATP levels are altered in the cell. PMID:25802331

  10. Photoactivated adenylyl cyclase (PAC) reveals novel mechanisms underlying cAMP-dependent axonal morphogenesis

    PubMed Central

    Zhou, Zhiwen; Tanaka, Kenji F.; Matsunaga, Shigeru; Iseki, Mineo; Watanabe, Masakatsu; Matsuki, Norio; Ikegaya, Yuji; Koyama, Ryuta

    2016-01-01

    Spatiotemporal regulation of axonal branching and elongation is essential in the development of refined neural circuits. cAMP is a key regulator of axonal growth; however, whether and how intracellular cAMP regulates axonal branching and elongation remain unclear, mainly because tools to spatiotemporally manipulate intracellular cAMP levels have been lacking. To overcome this issue, we utilized photoactivated adenylyl cyclase (PAC), which produces cAMP in response to blue-light exposure. In primary cultures of dentate granule cells transfected with PAC, short-term elevation of intracellular cAMP levels induced axonal branching but not elongation, whereas long-term cAMP elevation induced both axonal branching and elongation. The temporal dynamics of intracellular cAMP levels regulated axonal branching and elongation through the activation of protein kinase A (PKA) and exchange protein directly activated by cAMP (Epac), respectively. Thus, using PAC, our study for the first time reveals that temporal cAMP dynamics could regulate axonal branching and elongation via different signaling pathways. PMID:26795422

  11. Structural and functional characterization of Pseudomonas aeruginosa global regulator AmpR.

    PubMed

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen; Mathee, Kalai

    2014-11-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5' rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ(54) and σ(70) consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  12. Structural and Functional Characterization of Pseudomonas aeruginosa Global Regulator AmpR

    PubMed Central

    Caille, Olivier; Zincke, Diansy; Merighi, Massimo; Balasubramanian, Deepak; Kumari, Hansi; Kong, Kok-Fai; Silva-Herzog, Eugenia; Narasimhan, Giri; Schneper, Lisa; Lory, Stephen

    2014-01-01

    Pseudomonas aeruginosa is a dreaded pathogen in many clinical settings. Its inherent and acquired antibiotic resistance thwarts therapy. In particular, derepression of the AmpC β-lactamase is a common mechanism of β-lactam resistance among clinical isolates. The inducible expression of ampC is controlled by the global LysR-type transcriptional regulator (LTTR) AmpR. In the present study, we investigated the genetic and structural elements that are important for ampC induction. Specifically, the ampC (PampC) and ampR (PampR) promoters and the AmpR protein were characterized. The transcription start sites (TSSs) of the divergent transcripts were mapped using 5′ rapid amplification of cDNA ends-PCR (RACE-PCR), and strong σ54 and σ70 consensus sequences were identified at PampR and PampC, respectively. Sigma factor RpoN was found to negatively regulate ampR expression, possibly through promoter blocking. Deletion mapping revealed that the minimal PampC extends 98 bp upstream of the TSS. Gel shifts using membrane fractions showed that AmpR binds to PampC in vitro whereas in vivo binding was demonstrated using chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR). Additionally, site-directed mutagenesis of the AmpR helix-turn-helix (HTH) motif identified residues critical for binding and function (Ser38 and Lys42) and critical for function but not binding (His39). Amino acids Gly102 and Asp135, previously implicated in the repression state of AmpR in the enterobacteria, were also shown to play a structural role in P. aeruginosa AmpR. Alkaline phosphatase fusion and shaving experiments suggest that AmpR is likely to be membrane associated. Lastly, an in vivo cross-linking study shows that AmpR dimerizes. In conclusion, a potential membrane-associated AmpR dimer regulates ampC expression by direct binding. PMID:25182487

  13. TSH-induced cyclic AMP production in an ovine thyroid cell line: OVNIS 5H.

    PubMed

    Fayet, G; Aouani, A; Hovsépian, S

    1986-01-01

    The TSH-induced cyclic AMP response was studied using a 3-year-old ovine thyroid cell line TSH-independent for growth: OVNIS 5H. The kinetics of cyclic AMP production was followed both in cell layers and in cell culture media, with or without phosphodiesterase inhibitor. It is noteworthy that following the first wave in cyclic AMP obtained within minutes, we observed later a sustained exponential increase in cyclic AMP during the 5 days following TSH stimulation. A bioassay of TSH was derived allowing measurement of 1 microU/ml TSH from a crude bTSH preparation. PMID:3000830

  14. Efficient optical pulse stacker system

    DOEpatents

    Seppala, Lynn G.; Haas, Roger A.

    1982-01-01

    Method and apparatus for spreading and angle-encoding each pulse of a multiplicity of small area, short pulses into several temporally staggered pulses by use of appropriate beam splitters, with the optical elements being arranged so that each staggered pulse is contiguous with one or two other such pulses, and the entire sequence of stacked pulses comprising a single, continuous long pulse. The single long pulse is expanded in area, and then doubly passed through a nonstorage laser amplifier such as KrF. After amplification, the physically separated, angle-encoded and temporally staggered pulses are recombined into a single pulse of short duration. This high intensity output beam is well collimated and may be propagated over long distance, or used for irradiating inertial confinement fusion targets.

  15. High voltage pulse generator

    DOEpatents

    Fasching, George E.

    1977-03-08

    An improved high-voltage pulse generator has been provided which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of a first one of the rectifiers connected between the first and second of the plurality of charging capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. Alternate circuits are provided for controlling the application of the charging voltage from a charging circuit to be applied to the parallel capacitors which provides a selection of at least two different intervals in which the charging voltage is turned "off" to allow the SCR's connecting the capacitors in series to turn "off" before recharging begins. The high-voltage pulse-generating circuit including the N capacitors and corresponding SCR's which connect the capacitors in series when triggered "on" further includes diodes and series-connected inductors between the parallel-connected charging capacitors which allow sufficiently fast charging of the capacitors for a high pulse repetition rate and yet allow considerable control of the decay time of the high-voltage pulses from the pulse-generating circuit.

  16. Photoconductive circuit element pulse generator

    DOEpatents

    Rauscher, Christen

    1989-01-01

    A pulse generator for characterizing semiconductor devices at millimeter wavelength frequencies where a photoconductive circuit element (PCE) is biased by a direct current voltage source and produces short electrical pulses when excited into conductance by short laser light pulses. The electrical pulses are electronically conditioned to improve the frequency related amplitude characteristics of the pulses which thereafter propagate along a transmission line to a device under test.

  17. Direct autocrine inhibition and cAMP-dependent potentiation of single L-type Ca2+ channels in bovine chromaffin cells.

    PubMed

    Carabelli, V; Hernández-Guijo, J M; Baldelli, P; Carbone, E

    2001-04-01

    Using the cell-attached recording configuration, we found that in adult bovine chromaffin cells there exists a direct membrane-delimited inhibition of single Bay K-modified L-channels mediated by opioids and ATP locally released in the recording pipette. This autocrine modulation is mediated by pertussis toxin (PTX)-sensitive G-proteins and causes a 50 % decrease of the open channel probability (Po) and an equivalent percentage increase of null sweeps at +10 mV with no changes to the activation kinetics, single channel conductance and mean open time. The decrease in Po is mainly due to an increase in the occurrence and duration of slow closed times (> 40 ms). Addition of purinergic and opioidergic antagonists (suramin and naloxone) or cell pre-treatment with PTX removes the inhibition while addition of ATP and opioids inside the pipette, but not outside, mimics the effect. Strong pre-pulses (+150 mV, 280 ms) followed by short repolarizations are unable to remove the inhibition at test potential (+10 mV). Increasing the level of cAMP by either direct application of 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP) or mixtures of forskolin and 1-methyl-3-isobutylxanthine (IBMX) potentiates the activity of L-channels by increasing the mean open time and decreasing the mean closed time and percentage of null sweeps. The cAMP-induced potentiation occurs regardless of whether the G-protein-mediated inhibition is activated by ATP and opioids or inactivated by PTX. Protein kinase inhibitors (H7 and H89) prevent the effects of cAMP without altering the basal autocrine modulation associated with PTX-sensitive G-proteins. Our results provide new evidence for the coexistence of two distinct modulations that may converge on the same neuroendocrine L-channel: a direct G-protein-dependent inhibition and a cAMP-mediated potentiation, which may work in combination to regulate Ca2+ entry during neurosecretion. PMID:11283226

  18. Direct autocrine inhibition and cAMP-dependent potentiation of single L-type Ca2+ channels in bovine chromaffin cells

    PubMed Central

    Carabelli, Valentina; Hernández-Guijo, Jesús M; Baldelli, Pietro; Carbone, Emilio

    2001-01-01

    Using the cell-attached recording configuration, we found that in adult bovine chromaffin cells there exists a direct membrane-delimited inhibition of single Bay K-modified L-channels mediated by opioids and ATP locally released in the recording pipette. This autocrine modulation is mediated by pertussis toxin (PTX)-sensitive G-proteins and causes a 50 % decrease of the open channel probability (Po) and an equivalent percentage increase of null sweeps at +10 mV with no changes to the activation kinetics, single channel conductance and mean open time. The decrease in Po is mainly due to an increase in the occurrence and duration of slow closed times (> 40 ms). Addition of purinergic and opioidergic antagonists (suramin and naloxone) or cell pre-treatment with PTX removes the inhibition while addition of ATP and opioids inside the pipette, but not outside, mimics the effect. Strong pre-pulses (+150 mV, 280 ms) followed by short repolarizations are unable to remove the inhibition at test potential (+10 mV). Increasing the level of cAMP by either direct application of 8-(4-chlorophenylthio)-cAMP (8-CPT-cAMP) or mixtures of forskolin and 1-methyl-3-isobutylxanthine (IBMX) potentiates the activity of L-channels by increasing the mean open time and decreasing the mean closed time and percentage of null sweeps. The cAMP-induced potentiation occurs regardless of whether the G-protein-mediated inhibition is activated by ATP and opioids or inactivated by PTX. Protein kinase inhibitors (H7 and H89) prevent the effects of cAMP without altering the basal autocrine modulation associated with PTX-sensitive G-proteins. Our results provide new evidence for the coexistence of two distinct modulations that may converge on the same neuroendocrine L-channel: a direct G-protein-dependent inhibition and a cAMP-mediated potentiation, which may work in combination to regulate Ca2+ entry during neurosecretion. PMID:11283226

  19. HydroPulse Drilling

    SciTech Connect

    J.J. Kolle

    2004-04-01

    Tempress HydroPulse{trademark} tool increases overbalanced drilling rates by generating intense suction pulses at the drill bit. This report describes the operation of the tool; results of pressure drilling tests, wear tests and downhole drilling tests; and the business case for field applications. The HydroPulse{trademark} tool is designed to operate on weighted drilling mud at conventional flow rates and pressures. Pressure drilling tests confirm that the HydroPulse{trademark} tool provides 33% to 200% increased rate of penetration. Field tests demonstrated conventional rotary and mud motor drilling operations. The tool has been operated continuous for 50 hours on weighted mud in a wear test stand. This level of reliability is the threshold for commercial application. A seismic-while-drilling version of the tool was also developed and tested. This tool was used to demonstrate reverse vertical seismic profiling while drilling an inclined test well with a PDC bit. The primary applications for the HydroPulse{trademark} tool are deep onshore and offshore drilling where rate of penetration drives costs. The application of the seismic tool is vertical seismic profiling-while-drilling and look-ahead seismic imaging while drilling.

  20. Giant radio pulses

    NASA Astrophysics Data System (ADS)

    Kondratiev, Vladislav

    Rotation-powered radio pulsars exhibit a remarkably diverse spectrum of variability with characteristic time scales from days and even years (intermittent pulsars) to minutes-seconds (nulling) and (sub-)microseconds. The latter time scales are associated with the phenomenon of giant pulses (GPs) and micropulses. The story of GPs started in 1968, when Staelin and Reifenstein discovered the Crab pulsar through its spectacularly bright radio pulses. To date, only seven pulsars out of more than 2200 are known to show GP emission, namely the pulsars B0531+21, B1937+21, B0540-69, B1821-24, B1957+20, J0218+4232, and B1820-30A. Giant pulses are characterized by large energies (more than ten times of the energy of the average pulse), short durations, power-law energy distribution, specific rotational phase of occurrence, high degree of polarization, and accompanying high-energy radiation. Large energies of GPs and coincidence of their phase of occurrence with peaks of high-energy profiles hint at the same mechanism of radio GP and high-energy emission. The correlation of Crab pulsar GPs with optical, X-ray and gamma-ray photons was studied for the past 20 years, with only radio/optical link confirmed so far. In my talk I will present the summary of the observational evidence of radio GPs and give an overview of theoretical advances on giant-pulse emission mechanism.

  1. Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

    PubMed Central

    Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

    2016-01-01

    High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

  2. Role of Membrane Microdomains in Compartmentation of cAMP Signaling

    PubMed Central

    Agarwal, Shailesh R.; Yang, Pei-Chi; Rice, Monica; Singer, Cherie A.; Nikolaev, Viacheslav O.; Lohse, Martin J.; Clancy, Colleen E.; Harvey, Robert D.

    2014-01-01

    Spatially restricting cAMP production to discrete subcellular locations permits selective regulation of specific functional responses. But exactly where and how cAMP signaling is confined is not fully understood. Different receptors and adenylyl cyclase isoforms responsible for cAMP production are not uniformly distributed between lipid raft and non-lipid raft domains of the plasma membrane. We sought to determine the role that these membrane domains play in organizing cAMP responses in HEK293 cells. The freely diffusible FRET-based biosensor Epac2-camps was used to measure global cAMP responses, while versions of the probe targeted to lipid raft (Epac2-MyrPalm) and non-raft (Epac2-CAAX) domains were used to monitor local cAMP production near the plasma membrane. Disruption of lipid rafts by cholesterol depletion selectively altered cAMP responses produced by raft-associated receptors. The results indicate that receptors associated with lipid raft as well as non-lipid raft domains can contribute to global cAMP responses. In addition, basal cAMP activity was found to be significantly higher in non-raft domains. This was supported by the fact that pharmacologic inhibition of adenylyl cyclase activity reduced basal cAMP activity detected by Epac2-CAAX but not Epac2-MyrPalm or Epac2-camps. Responses detected by Epac2-CAAX were also more sensitive to direct stimulation of adenylyl cyclase activity, but less sensitive to inhibition of phosphodiesterase activity. Quantitative modeling was used to demonstrate that differences in adenylyl cyclase and phosphodiesterase activities are necessary but not sufficient to explain compartmentation of cAMP associated with different microdomains of the plasma membrane. PMID:24752595

  3. Dose and Chemical Modification Considerations for Continuous Cyclic AMP Analog Delivery to the Injured CNS

    PubMed Central

    Fouad, Karim; Ghosh, Mousumi; Vavrek, Romana; Tse, Arthur D.

    2009-01-01

    Abstract In this investigation, two cell-permeable synthetic analogs of cAMP, dibutyryl-cAMP (db-cAMP) and 8-bromo-cAMP, which are widely used to elevate intracellular cAMP levels under experimental conditions, were investigated for their ability to dose-dependently improve histological and functional outcomes following continuous delivery in two models of incomplete spinal cord injury (SCI). The cAMP analogs were delivered via osmotic minipumps at 1–250 mM through an indwelling cortical cannula or by intrathecal infusion for up to 4 weeks after either a T8 unilateral over-hemisection or a C2-3 dorsolateral quadrant lesion, respectively. In both SCI models, continuous db-cAMP delivery was associated with histopathological changes that included sporadic micro-hemorrhage formation and cavitation, enhanced macrophage infiltration and tissue damage at regions beyond the immediate application site; no deleterious or beneficial effect of agent delivery was observed at the spinal injury site. Furthermore, these changes were accompanied by pronounced behavioral deficits that included an absence of progressive locomotor recovery, increased extensor tone, paralysis, and sensory abnormalities. These deleterious effects were not observed in saline-treated animals, in animals in which the db-cAMP dose did not exceed 1 mM, or in those animals that received a high dose (250 mM) of the alternative cAMP analog, 8-bromo-cAMP. These results demonstrate that, for continuous intraparenchymal or intrathecal administration of cAMP analogs for the study of biological or therapeutic effects within the central nervous system (CNS), consideration of the effective concentration applied as well as the potential toxicity of chemical moieties on the parent molecule and/or their activity needs to be taken into account. PMID:19397425

  4. cAMP signaling prevents podocyte apoptosis via activation of protein kinase A and mitochondrial fusion.

    PubMed

    Li, Xiaoying; Tao, Hua; Xie, Kewei; Ni, Zhaohui; Yan, Yucheng; Wei, Kai; Chuang, Peter Y; He, John Cijiang; Gu, Leyi

    2014-01-01

    Our previous in vitro studies suggested that cyclic AMP (cAMP) signaling prevents adriamycin (ADR) and puromycin aminonucleoside (PAN)-induced apoptosis in podocytes. As cAMP is an important second messenger and plays a key role in cell proliferation, differentiation and cytoskeleton formation via protein kinase A (PKA) or exchange protein directly activated by cAMP (Epac) pathways, we sought to determine the role of PKA or Epac signaling in cAMP-mediated protection of podocytes. In the ADR nephrosis model, we found that forskolin, a selective activator of adenylate cyclase, attenuated albuminuria and improved the expression of podocyte marker WT-1. When podocytes were treated with pCPT-cAMP (a selective cAMP/PKA activator), PKA activation was increased in a time-dependent manner and prevented PAN-induced podocyte loss and caspase 3 activation, as well as a reduction in mitochondrial membrane potential. We found that PAN and ADR resulted in a decrease in Mfn1 expression and mitochondrial fission in podocytes. pCPT-cAMP restored Mfn1 expression in puromycin or ADR-treated podocytes and induced Drp1 phosphorylation, as well as mitochondrial fusion. Treating podocytes with arachidonic acid resulted in mitochondrial fission, podocyte loss and cleaved caspase 3 production. Arachidonic acid abolished the protective effects of pCPT-cAMP on PAN-treated podocytes. Mdivi, a mitochondrial division inhibitor, prevented PAN-induced cleaved caspase 3 production in podocytes. We conclude that activation of cAMP alleviated murine podocyte caused by ADR. PKA signaling resulted in mitochondrial fusion in podocytes, which at least partially mediated the effects of cAMP. PMID:24642777

  5. Genetically-encoded tools for cAMP probing and modulation in living systems

    PubMed Central

    Paramonov, Valeriy M.; Mamaeva, Veronika; Sahlgren, Cecilia; Rivero-Müller, Adolfo

    2015-01-01

    Intracellular 3′-5′-cyclic adenosine monophosphate (cAMP) is one of the principal second messengers downstream of a manifold of signal transduction pathways, including the ones triggered by G protein-coupled receptors. Not surprisingly, biochemical assays for cAMP have been instrumental for basic research and drug discovery for decades, providing insights into cellular physiology and guiding pharmaceutical industry. However, despite impressive track record, the majority of conventional biochemical tools for cAMP probing share the same fundamental shortcoming—all the measurements require sample disruption for cAMP liberation. This common bottleneck, together with inherently low spatial resolution of measurements (as cAMP is typically analyzed in lysates of thousands of cells), underpin the ensuing limitations of the conventional cAMP assays: (1) genuine kinetic measurements of cAMP levels over time in a single given sample are unfeasible; (2) inability to obtain precise information on cAMP spatial distribution and transfer at subcellular levels, let alone the attempts to pinpoint dynamic interactions of cAMP and its effectors. At the same time, tremendous progress in synthetic biology over the recent years culminated in drastic refinement of our toolbox, allowing us not only to bypass the limitations of conventional assays, but to put intracellular cAMP life-span under tight control—something, that seemed scarcely attainable before. In this review article we discuss the main classes of modern genetically-encoded tools tailored for cAMP probing and modulation in living systems. We examine the capabilities and weaknesses of these different tools in the context of their operational characteristics and applicability to various experimental set-ups involving living cells, providing the guidance for rational selection of the best tools for particular needs. PMID:26441653

  6. Pulse shaping system

    DOEpatents

    Skeldon, M.D.; Letzring, S.A.

    1999-03-23

    Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses. 8 figs.

  7. Pulse shaping system

    DOEpatents

    Skeldon, Mark D.; Letzring, Samuel A.

    1999-03-23

    Temporally shaped electrical waveform generation provides electrical waveforms suitable for driving an electro-optic modulator (EOM) which produces temporally shaped optical laser pulses for inertial confinement fusion (ICF) research. The temporally shaped electrical waveform generation is carried out with aperture coupled transmission lines having an input transmission line and an aperture coupled output transmission line, along which input and output pulses propagate in opposite directions. The output electrical waveforms are shaped principally due to the selection of coupling aperture width, in a direction transverse to the lines, which varies along the length of the line. Specific electrical waveforms, which may be high voltage (up to kilovolt range), are produced and applied to the EOM to produce specifically shaped optical laser pulses.

  8. Pulse power linac

    DOEpatents

    Villa, Francesco

    1990-01-01

    A linear acceleration for charged particles is constructed of a plurality of transmission line sections that extend between a power injection region and an accelerating region. Each line section is constructed of spaced plate-like conductors and is coupled to an accelerating gap located at the accelerating region. Each gap is formed between a pair of apertured electrodes, with all of the electrode apertures being aligned along a particle accelerating path. The accelerating gaps are arranged in series, and at the injection region the line sections are connected in parallel. At the injection region a power pulse is applied simultaneously to all line sections. The line sections are graduated in length so that the pulse reaches the gaps in a coordinated sequence whereby pulse energy is applied to particles as they reach each of the gaps along the accelerating path.

  9. PULSE AMPLITUDE ANALYZERS

    DOEpatents

    Gray, G.W.; Jensen, A.S.

    1958-06-01

    An analyzer system incorporating a cathode-ray tube and linearly spaced targets masked by a plate having slits at points corresponding to the location of the targets is described. The advantages of the system include reduction in the required amplified band width and also the reduction in possible double counting of a pulse by striking two targets. The system comprises integrating means for each pulse, the signal from which is applied to a pair of deflection plates, and a control circuit for turning on the electron beam when the pulse has almost reached its maximum value. The mask prevents the beam from overlapping on a target adjacent to the proper one, while a control circuit responsive to the target output signals acts to cut off the beam immediately after the beam strikes a target to permit the beam to impinge on only one target.

  10. Discharge pulse phenomenology

    NASA Technical Reports Server (NTRS)

    Frederickson, A. R.

    1985-01-01

    A model was developed which places radiation induced discharge pulse results into a unified conceptual framework. Only two phenomena are required to interpret all space and laboratory results: (1) radiation produces large electrostatic fields inside insulators via the trapping of a net space charge density; and (2) the electrostatic fields initiate discharge streamer plasmas similar to those investigated in high voltage electrical insulation materials; these streamer plasmas generate the pulsing phenomena. The apparent variability and diversity of results seen is an inherent feature of the plasma streamer mechanism acting in the electric fields which is created by irradiation of the dielectrics. The implications of the model are extensive and lead to constraints over what can be done about spacecraft pulsing.

  11. Pulsed welding plasma source

    NASA Astrophysics Data System (ADS)

    Knyaz'kov, A.; Pustovykh, O.; Verevkin, A.; Terekhin, V.; Shachek, A.; Tyasto, A.

    2016-04-01

    It is shown that in order to form the current pulse of a near rectangular shape, which provides conversion of the welding arc into a dynamic mode, it is rational to connect a forming element made on the basis of an artificial forming line in series to the welding DC circuit. The paper presents a diagram of a pulsed device for welding with a non-consumable electrode in argon which was developed using the forming element. The conversion of the arc into the dynamic mode is illustrated by the current and voltage oscillograms of the arc gap and the dynamic characteristic of the arc within the interval of one pulse generation time in the arc gap. The background current travels in the interpulse interval.

  12. Pulsed eddy current testing

    NASA Astrophysics Data System (ADS)

    Workman, G. L.

    1980-10-01

    Since a large number of the procedures used for inspecting the external tank are concerned with determining flaws in welds, there is a need to develop an inspection technique, which can be automated, to determine flaws in welds and structures with complex geometries. Techniques whereby an eddy current is generated in a metallic material and the changes in the circuit parameters due to material differences are observed, were chosen as one possible approach. Pulsed eddy current and its relationship to multifrequency techniques is discussed as well as some preliminary results obtained from observing pulsed waveforms with apparatus and algorithms currently in use for ultrasonic testing of welds. It can be shown the pulsed eddy current techniques can provide similar results, can eliminate some of the noncritical parameters affecting the eddy current signals, and can facilitate in the detection of critical parameter such as flaws, subsurface voids, and corrosion.

  13. Laser pulse sampler

    DOEpatents

    Vann, Charles

    1998-01-01

    The Laser Pulse Sampler (LPS) measures temporal pulse shape without the problems of a streak camera. Unlike the streak camera, the laser pulse directly illuminates a camera in the LPS, i.e., no additional equipment or energy conversions are required. The LPS has several advantages over streak cameras. The dynamic range of the LPS is limited only by the range of its camera, which for a cooled camera can be as high as 16 bits, i.e., 65,536. The LPS costs less because there are fewer components, and those components can be mass produced. The LPS is easier to calibrate and maintain because there is only one energy conversion, i.e., photons to electrons, in the camera.

  14. Laser pulse sampler

    DOEpatents

    Vann, C.

    1998-03-24

    The Laser Pulse Sampler (LPS) measures temporal pulse shape without the problems of a streak camera. Unlike the streak camera, the laser pulse directly illuminates a camera in the LPS, i.e., no additional equipment or energy conversions are required. The LPS has several advantages over streak cameras. The dynamic range of the LPS is limited only by the range of its camera, which for a cooled camera can be as high as 16 bits, i.e., 65,536. The LPS costs less because there are fewer components, and those components can be mass produced. The LPS is easier to calibrate and maintain because there is only one energy conversion, i.e., photons to electrons, in the camera. 5 figs.

  15. Pulsed neutron detector

    DOEpatents

    Robertson, deceased, J. Craig; Rowland, Mark S.

    1989-03-21

    A pulsed neutron detector and system for detecting low intensity fast neutron pulses has a body of beryllium adjacent a body of hydrogenous material the latter of which acts as a beta particle detector, scintillator, and moderator. The fast neutrons (defined as having En>1.5 MeV) react in the beryllium and the hydrogenous material to produce larger numbers of slow neutrons than would be generated in the beryllium itself and which in the beryllium generate hellium-6 which decays and yields beta particles. The beta particles reach the hydrogenous material which scintillates to yield light of intensity related to the number of fast neutrons. A photomultiplier adjacent the hydrogenous material (scintillator) senses the light emission from the scintillator. Utilization means, such as a summing device, sums the pulses from the photo-multiplier for monitoring or other purposes.

  16. Atmospheric, Magnetospheric and Plasmas in Space (AMPS) spacelab payload definition study. Volume 3: Interface control documents. Part 1: AMPS payload to shuttle ICD

    NASA Technical Reports Server (NTRS)

    1976-01-01

    Physical, functional, and operational interfaces between the space shuttle orbiter and the AMPS payload are described for the ground handling and test phases, prelaunch, launch and ascent, operational, stowage, and reentry and landing activities.

  17. Polynomial solutions of the Monge-Ampère equation

    SciTech Connect

    Aminov, Yu A

    2014-11-30

    The question of the existence of polynomial solutions to the Monge-Ampère equation z{sub xx}z{sub yy}−z{sub xy}{sup 2}=f(x,y) is considered in the case when f(x,y) is a polynomial. It is proved that if f is a polynomial of the second degree, which is positive for all values of its arguments and has a positive squared part, then no polynomial solution exists. On the other hand, a solution which is not polynomial but is analytic in the whole of the x, y-plane is produced. Necessary and sufficient conditions for the existence of polynomial solutions of degree up to 4 are found and methods for the construction of such solutions are indicated. An approximation theorem is proved. Bibliography: 10 titles.

  18. Differential effects on cAMP on the MAP kinase cascade: evidence for a cAMP-insensitive step that can bypass Raf-1.

    PubMed Central

    Faure, M; Bourne, H R

    1995-01-01

    Because cAMP exerts opposite effects on cell proliferation in different cell types, we undertook to study its effect on the mitogen-activated protein kinase (MAPK) pathway in three cell lines (Rat-1, Swiss-3T3, and COS-7) chosen for their different mitogenic responses to cAMP. We measured the effect of cAMP on MAPK, MEK, and Raf-1 activities after stimulation by agonists acting through a tyrosine kinase receptor (epidermal growth factor) or a G protein-coupled receptor (lysophosphatidic acid). In Rat-1 cells we found that cAMP strongly inhibited all three activities (MAPK, MEK, and Raf-1), in good agreement with its effect on cell proliferation in these cells. In Swiss-3T3 and COS-7 cells, on the contrary, cAMP did not inhibit epidermal growth factor- and lysophosphatidic acid-induced stimulation of MAPK and MEK activities, and even stimulated MAPK activity slightly on its own. Again these results are in good agreement with the proliferative effect of cAMP in Swiss-3T3 cells. Raf-1 activity on the hand, was inhibited by cAMP in Swiss-3T3 and COS-7 as it was in Rat-1 cells. This result indicates that signaling pathways in Swiss-3T3 and COS-7 cells can activate MEK and MAPK in a Raf-1-independent and cAMP-insensitive manner. Our results add to growing evidence for the existence of Ras- and/or Raf-1-independent pathways leading to MEK and MAPK activation. Images PMID:7579705

  19. Pulsed NMR spectroscopy

    NASA Technical Reports Server (NTRS)

    Burum, D. P.; Elleman, D. D.; Rhim, W.

    1978-01-01

    Method gives results approximating those of classical continuous-irradiation method but in less time. Method also makes it possible to measure chemical shifts and spin-lattice relaxation times with improved sensitivity. Equipment can be used for adiabatic demagnetization experiments, measurements of rotating-frame spin/lattice relaxation times, and accurate measurements of exact resonance points. When measuring relaxation times, pulse technique can be very effective since pulses may be limited in amplitude and length to prevent spin system from being driven into saturation.

  20. Pulse Propagation in Phaseonium

    NASA Astrophysics Data System (ADS)

    Rahman, Ashiqur; Eberly, J. H.

    1996-05-01

    Phaseonium [1] is a medium where the quantum atomic phase is held fixed for long times compared with various relaxation processes. In inhomogeneously broadened two-level phaseonium, we have found a new area theorem (similar to self-induced transparency [2]) for pulse propagation, where pulses of arbitrary area can be stable instead of 2π area. We will also report results for inhomogeneously broadened three-level phaseonium. Research partially supported by NSF grant PHY94-08733. [1] M.O. Scully, Phys. Rev. Lett. 55, 2802 (1985), also Quant. Opt. 6, 203 (1994). [2] S. L. McCall and E. L. Hahn, Phys. Rev. 183, 457 (1969).

  1. The possible role of cyclic AMP in the neurotrophic control of skeletal muscle.

    PubMed Central

    Carlsen, R C

    1975-01-01

    1. Motoneurones provide trophic control of some of the functional characteristics of skeletal muscle fibres. This study has been designed to test whether the adenylate cyclase: cyclic AMP system may offer one potential mechanism for the mediation of neurotrophic regulation. 2. The concentration of cyclic AMP was measured at various intervals after muscle denervation. Muscle cyclic AMP concentration increases for the first 2 days after nerve section. It reaches a maximum value at 48 h and subsequently returns to the control value at 7 days. 3. Cyclic AMP concentration is unchanged by muscle disuse for the first 3 days following limb immobilization. Four days after immobilization, however, cyclic AMP increases in both the disused and contralateral control muscles. This phenomenon has been tentatively ascribed to some aspect of the inflammatory response. 4. Changing the level of nerve section, and therefore the length of the residual nerve stump, changes the temporal pattern of the increase in muscle cyclic AMP concentration. 5. Reinnervation of a denervated muscle produces a decrease in muscle cyclic AMP concentration. 6. It is concluded from the results that some aspect of nerve function provides trophic regulation of the muscle adenylate cyclase: cyclic AMP system. The mechanisms by which this regulation may be applied are considered in the Discussion. PMID:168354

  2. A Temporal-Specific and Transient cAMP Increase Characterizes Odorant Classical Conditioning

    ERIC Educational Resources Information Center

    Cui, Wen; Smith, Andrew; Darby-King, Andrea; Harley, Carolyn W.; McLean, John H.

    2007-01-01

    Increases in cyclic adenosine monophosphate (cAMP) are proposed to initiate learning in a wide variety of species. Here, we measure changes in cAMP in the olfactory bulb prior to, during, and following a classically conditioned odor preference trial in rat pups. Measurements were taken up to the point of maximal CREB phosphorylation in olfactory…

  3. cAMP biosensors applied in molecular pharmacological studies of G protein-coupled receptors.

    PubMed

    Mathiesen, Jesper Mosolff; Vedel, Line; Bräuner-Osborne, Hans

    2013-01-01

    Cyclic adenosine monophosphate (cAMP) is a common second messenger that mediates numerous biological responses. Intracellular cAMP levels are increased by activation of G(s)-coupled G protein-coupled receptors (GPCRs) and decreased by activation of G(i)-coupled GPCRs via the adenylyl cyclase. Many end-point assays for quantifying GPCR-mediated changes in intracellular cAMP levels exist. More recently, fluorescence resonance energy transfer (FRET)-based cAMP biosensors that can quantify intracellular cAMP levels in real time have been developed. These FRET-based cAMP biosensors have been used primarily in single cell FRET microscopy to monitor and visualize changes in cAMP upon GPCR activation. Here, a similar cAMP biosensor with a more efficient mCerulean/mCitrine FRET pair is described for use in the 384-well plate format. After cloning and expression in HEK293 cells, the biosensor is characterized in the 384-well plate format and used for measuring the signaling of the G(s)-coupled β(2)-adrenergic receptor. The procedures described may be applied for other FRET-based biosensors in terms of characterization and conversion to the 384-well plate format. PMID:23374187

  4. 78 FR 1264 - CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative Determination Regarding...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-01-08

    ... Employment and Training Administration CalAmp Wireless Networks Corporation, Waseca, MN; Notice of Negative... workers of the subject firm (TA-W-80,399A; CalAmp Wireless Networks Corporation, Waseca, Minnesota... Wireless Networks Corporation, Waseca, Minnesota to apply for TAA, the Department determines that...

  5. Prostaglandin E2 inhibits apoptosis in human neutrophilic polymorphonuclear leukocytes: role of intracellular cyclic AMP levels.

    PubMed

    Ottonello, L; Gonella, R; Dapino, P; Sacchetti, C; Dallegri, F

    1998-08-01

    Human neutrophilic polymorphonuclear leukocytes (neutrophils) are terminally differentiated cells that die by undergoing apoptosis. At present, the intracellular pathways governing this process are only partially known. In particular, although the adenylate cyclase-dependent generation of cyclic AMP (cAMP) has been implicated in the triggering of apoptosis in lymphoid cells, the role of the intracellular cAMP pathway in neutrophil apoptosis remains controversial. In the present study, we found that two cAMP-elevating agents, prostaglandin E2 (PGE2) and the phosphodiesterase type IV inhibitor RO 20-1724, inhibit neutrophil apoptosis without inducing cell necrosis. When administered in combination, PGE2 and RO 20-1724 displayed additive effects. Moreover, neutrophil apoptosis was inhibited by a membrane-permeable analog of cAMP, dibutyryl-cAMP, in a dose-dependent manner. Finally, treatment of neutrophils with the protein kinase A inhibitor H-89 prevented PGE2- and RO 20-1724-induced inhibition of cell apoptosis. In conclusion, taking into account that PGE2 and other cAMP-elevating agents are well known downregulators of neutrophil functions, our results suggest that conditions favoring a state of functional rest, such as intracellular cAMP elevation, prolong the life span of neutrophils by delaying apoptosis. PMID:9694511

  6. Comparative biology of cAMP-induced germinal vesicle breakdown in marine invertebrate oocytes.

    PubMed

    Deguchi, Ryusaku; Takeda, Noriyo; Stricker, Stephen A

    2011-01-01

    During maturation, oocytes must undergo a process of nuclear disassembly, or "germinal vesicle breakdown" (GVBD), that is regulated by signaling pathways involving cyclic AMP (cAMP). In vertebrate and starfish oocytes, cAMP elevation typically prevents GVBD. Alternatively, increased concentrations of intra-oocytic cAMP trigger, rather than inhibit, GVBD in several groups of marine invertebrates. To integrate what is known about the stimulation of GVBD by intra-oocytic cAMP, this article reviews published data for ascidian, bivalve, brittle star, jellyfish, and nemertean oocytes. The bulk of the review concentrates on the three most intensively analyzed groups known to display cAMP-induced GVBD-nemerteans, ascidians, and jellyfish. In addition, this synopsis also presents some previously unpublished findings regarding the stimulatory effects of intra-oocytic cAMP on GVBD in jellyfish and the annelid worm Pseudopotamilla occelata. Finally, factors that may account for the currently known distribution of cAMP-induced GVBD across animal groups are discussed. PMID:21774023

  7. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration

    PubMed Central

    Siddiq, Mustafa M.; Hannila, Sari S.

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  8. Targeting brain tumor cAMP: the case for sex-specific therapeutics

    PubMed Central

    Warrington, Nicole M.; Sun, Tao; Rubin, Joshua B.

    2015-01-01

    A relationship between cyclic adenosine 3′, 5′-monophosphate (cAMP) levels and brain tumor biology has been evident for nearly as long as cAMP and its synthetase, adenylate cyclase (ADCY) have been known. The importance of the pathway in brain tumorigenesis has been demonstrated in vitro and in multiple animal models. Recently, we provided human validation for a cooperating oncogenic role for cAMP in brain tumorigenesis when we found that SNPs in ADCY8 were correlated with glioma (brain tumor) risk in individuals with Neurofibromatosis type 1 (NF1). Together, these studies provide a strong rationale for targeting cAMP in brain tumor therapy. However, the cAMP pathway is well-known to be sexually dimorphic, and SNPs in ADCY8 affected glioma risk in a sex-specific fashion, elevating the risk for females while protecting males. The cAMP pathway can be targeted at multiple levels in the regulation of its synthesis and degradation. Sex differences in response to drugs that target cAMP regulators indicate that successful targeting of the cAMP pathway for brain tumor patients is likely to require matching specific mechanisms of drug action with patient sex. PMID:26283963

  9. A Cell-Autonomous Molecular Cascade Initiated by AMP-Activated Protein Kinase Represses Steroidogenesis

    PubMed Central

    Abdou, Houssein S.; Bergeron, Francis

    2014-01-01

    Steroid hormones regulate essential physiological processes, and inadequate levels are associated with various pathological conditions. In testosterone-producing Leydig cells, steroidogenesis is strongly stimulated by luteinizing hormone (LH) via its receptor leading to increased cyclic AMP (cAMP) production and expression of the steroidogenic acute regulatory (STAR) protein, which is essential for the initiation of steroidogenesis. Steroidogenesis then passively decreases with the degradation of cAMP into AMP by phosphodiesterases. In this study, we show that AMP-activated protein kinase (AMPK) is activated following cAMP-to-AMP breakdown in MA-10 and MLTC-1 Leydig cells. Activated AMPK then actively inhibits cAMP-induced steroidogenesis by repressing the expression of key regulators of steroidogenesis, including Star and Nr4a1. Similar results were obtained in Y-1 adrenal cells and in the constitutively steroidogenic R2C cells. We have also determined that maximum AMPK activation following stimulation of steroidogenesis in MA-10 Leydig cells occurs when steroid hormone production has reached a plateau. Our data identify AMPK as a molecular rheostat that actively represses steroid hormone biosynthesis to preserve cellular energy homeostasis and prevent excess steroid production. PMID:25225331

  10. Looking downstream: the role of cyclic AMP-regulated genes in axonal regeneration.

    PubMed

    Siddiq, Mustafa M; Hannila, Sari S

    2015-01-01

    Elevation of intracellular cyclic AMP (cAMP) levels has proven to be one of the most effective means of overcoming inhibition of axonal regeneration by myelin-associated inhibitors such as myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein. Pharmacological manipulation of cAMP through the administration of dibutyryl cAMP or rolipram leads to enhanced axonal growth both in vivo and in vitro, and importantly, upregulation of cAMP within dorsal root ganglion neurons is responsible for the conditioning lesion effect, which indicates that cAMP plays a significant role in the endogenous mechanisms that promote axonal regeneration. The effects of cAMP are transcription-dependent and are mediated through the activation of protein kinase A (PKA) and the transcription factor cyclic AMP response element binding protein (CREB). This leads to the induction of a variety of genes, several of which have been shown to overcome myelin-mediated inhibition in their own right. In this review, we will highlight the pro-regenerative effects of arginase I (ArgI), interleukin (IL)-6, secretory leukocyte protease inhibitor (SLPI), and metallothionein (MT)-I/II, and discuss their potential for therapeutic use in spinal cord injury. PMID:26150769

  11. Subcelluar compartmentalization of cAMP-dependent protein kinase regulatory subunits during palate ontogeny

    SciTech Connect

    Linask, K.K.; Greene, R.M. )

    1989-01-01

    Mammalian palatal ontogeny involves epithelial-mesenchymal interactions, cell differentiation, and cell movement. These events occur on days 12, 13, and 14 of gestation in the C57BL/6J mouse embryo. During this period intracellular cAMP levels and cAMP-dependent protein kinase (cAMP-dPK) levels in the palate transiently elevate. Cyclic AMP activates cAMP-dPK by binding primarily to two types of regulatory subunits of this enzyme, designated as R{sub I} and R{sub II}. To assess whether differential compartmentalization of the regulatory subunits occurs during palatal ontogeny, cytosolic, nuclear, and particulate fractions were prepared from day 12, 13, and 14 embryonic maxillary and palatal tissue. After photo-affinity labeling of each fraction with 8-azido ({sup 32}P) cAMP, SDS-PAGE, and autoradiography, autoradiograms were analyzed densitometrically. The R{sub I} isoform predominated in the nuclear and particulate fractions on all three developmental days; whereas R{sub II} predominated in the cytosolic fractions. Thus, differential compartmentalization of cAMP-dPK may be a means by which cAMP dependent responses are regulated during palatogenesis.

  12. Global and local missions of cAMP signaling in neural plasticity, learning, and memory

    PubMed Central

    Lee, Daewoo

    2015-01-01

    The fruit fly Drosophila melanogaster has been a popular model to study cAMP signaling and resultant behaviors due to its powerful genetic approaches. All molecular components (AC, PDE, PKA, CREB, etc) essential for cAMP signaling have been identified in the fly. Among them, adenylyl cyclase (AC) gene rutabaga and phosphodiesterase (PDE) gene dunce have been intensively studied to understand the role of cAMP signaling. Interestingly, these two mutant genes were originally identified on the basis of associative learning deficits. This commentary summarizes findings on the role of cAMP in Drosophila neuronal excitability, synaptic plasticity and memory. It mainly focuses on two distinct mechanisms (global versus local) regulating excitatory and inhibitory synaptic plasticity related to cAMP homeostasis. This dual regulatory role of cAMP is to increase the strength of excitatory neural circuits on one hand, but to act locally on postsynaptic GABA receptors to decrease inhibitory synaptic plasticity on the other. Thus the action of cAMP could result in a global increase in the neural circuit excitability and memory. Implications of this cAMP signaling related to drug discovery for neural diseases are also described. PMID:26300775

  13. Expression of AMP-activated protein kinase subunits during chicken embryonic and post-hatch development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    AMP-activated protein kinase (AMPK) is a highly conserved serine/threonine protein kinase that senses cellular energy status (AMP/ATP ratio) and acts to maintain energy homeostasis by regulating the activities of energy-consuming and energy-generating metabolic pathways. AMPK is a heterotrimeric en...

  14. Reciprocal regulation of insulin and plasma 5'-AMP in glucose homeostasis in mice.

    PubMed

    Xia, Lin; Wang, Zhongqiu; Zhang, Ying; Yang, Xiao; Zhan, Yibei; Cheng, Rui; Wang, Shiming; Zhang, Jianfa

    2015-03-01

    A previous investigation has demonstrated that plasma 5'-AMP (pAMP) exacerbates and causes hyperglycemia in diabetic mice. However, the crosstalk between pAMP and insulin signaling to regulate glucose homeostasis has not been investigated in depth. In this study, we showed that the blood glucose level was more dependent on the ratio of insulin to pAMP than on the absolute level of these two factors. Administration of 5'-AMP significantly attenuated the insulin-stimulated insulin receptor (IR) autophosphorylation in the liver and muscle tissues, resulting in the inhibition of downstream AKT phosphorylation. A docking analysis indicated that adenosine was a potential inhibitor of IR tyrosine kinase. Moreover, the 5'-AMP treatment elevated the ATP level in the pancreas and in the isolated islets, stimulating insulin secretion and increasing the plasma level of insulin. The insulin administration decreased the 5'-AMP-induced hyper-adenosine level by the up-regulation of adenosine kinase activities. Our results indicate that blood glucose homeostasis is reciprocally regulated by pAMP and insulin. PMID:25512345

  15. SNMR pulse sequence phase cycling

    DOEpatents

    Walsh, David O; Grunewald, Elliot D

    2013-11-12

    Technologies applicable to SNMR pulse sequence phase cycling are disclosed, including SNMR acquisition apparatus and methods, SNMR processing apparatus and methods, and combinations thereof. SNMR acquisition may include transmitting two or more SNMR pulse sequences and applying a phase shift to a pulse in at least one of the pulse sequences, according to any of a variety cycling techniques. SNMR processing may include combining SNMR from a plurality of pulse sequences comprising pulses of different phases, so that desired signals are preserved and indesired signals are canceled.

  16. Passive and active pulse stacking scheme for pulse shaping

    DOEpatents

    Harney, Robert C.; Schipper, John F.

    1977-01-01

    Apparatus and method for producing a sequence of radiation pulses with a pulse envelope of time variation which is controllable by an external electromagnetic signal applied to an active medium or by a sectored reflector, through which the radiation passes.

  17. Pulse distortion in single-mode fibers. 3: Chirped pulses.

    PubMed

    Marcuse, D

    1981-10-15

    The theory of pulse distortion in single-mode fibers is extended to include laser sources that suffer a linear wavelength sweep (chirp) during the duration of the pulse. The transmitted pulse is expressed as a Fourier integral whose spectral function is given by an analytical expression in closed form. The rms width of the transmitted pulse is also expressed in closed form. Numerical examples illustrate the influence of the chirp on the shape and rms width of the pulse. A somewhat paradoxical situation exists. A given input pulse can be made arbitrarily short by a sufficiently large amount of chirping, and, after a given fiber length, this chirped pulse returns to its original width. But at this particular distance an unchirped pulse would be only [equiation] times longer. Thus chirping can improve the rate of data transmission by only 40%. PMID:20372221

  18. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    SciTech Connect

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer cAMP blocks cell death induced by TNF and actinomycin D in cultured hepatocytes. Black-Right-Pointing-Pointer cAMP blocks NF-{kappa}B activation induced by TNF and actinomycin D. Black-Right-Pointing-Pointer cAMP blocks DISC formation following TNF and actinomycin D exposure. Black-Right-Pointing-Pointer cAMP blocks TNF signaling at a proximal step. -- Abstract: Tumor necrosis factor {alpha} (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found

  19. Pulse Oximetry: A Non-Invasive, Novel Marker for the Quality of Chest Compressions in Porcine Models of Cardiac Arrest

    PubMed Central

    Han, Fei; Li, Yan; Walline, Joseph; Fu, Yangyang; Yao, Dongqi; Zhang, Xiaocui; Zhang, Hui; Zhu, Huadong; Guo, Shubin; Wang, Zhong; Yu, Xuezhong

    2015-01-01

    Objective Pulse oximetry, which noninvasively detects the blood flow of peripheral tissue, has achieved widespread clinical use. We have noticed that the better the quality of cardiopulmonary resuscitation (CPR), the better the appearance of pulse oximetry plethysmographic waveform (POP). We investigated whether the area under the curve (AUC) and/or the amplitude (Amp) of POP could be used to monitor the quality of CPR. Design Prospective, randomized controlled study. Setting Animal experimental center in Peking Union Medical Collage Hospital, Beijing, China. Subjects Healthy 3-month-old male domestic swine. Interventions 34 local pigs were enrolled in this study. After 4 minutes of untreated ventricular fibrillation, animals were randomly assigned into two resuscitation groups: a “low quality” group (with a compression depth of 3cm) and a “high quality” group (with a depth of 5cm). All treatments between the two groups were identical except for the depth of chest compressions. Hemodynamic parameters [coronary perfusion pressure (CPP), partial pressure of end-tidal carbon dioxide (PETCO2)] as well as AUC and Amp of POP were all collected and analyzed. Measurements and Findings There were statistical differences between the “high quality” group and the “low quality” group in AUC, Amp, CPP and PETCO2 during CPR (P<0.05). AUC, Amp and CPP were positively correlated with PETCO2, respectively (P<0.01). There was no statistical difference between the heart rate calculated according to the POP (FCPR) and the frequency of mechanical CPR at the 3rd minute of CPR. The FCPR was lower than the frequency of mechanical CPR at the 6th and the 9th minute of CPR. Conclusions Both the AUC and Amp of POP correlated well with CPP and PETCO2 in animal models. The frequency of POP closely matched the CPR heart rate. AUC and Amp of POP might be potential noninvasive quality monitoring markers for CPR. PMID:26485651

  20. Experiments in Pulsed Ultrasonics

    ERIC Educational Resources Information Center

    Palmer, S. B.; Forster, G. A.

    1970-01-01

    Describes and apparatus designed to generate and detect pulsed ultrasonics in solids and liquids over the frequency range 1-20 MHz. Experiments are suggested for velocity of sound, elastic constant and ultrasonic attenuation measurements on various materials over a wide temperature range. The equipment should be useful for demonstration purposes.…

  1. Pulsed Plasma Thruster

    NASA Technical Reports Server (NTRS)

    2002-01-01

    Dr. Tom Markusic, a propulsion research engineer at the Marshall Space Flight Center (MSFC), adjusts a diagnostic laser while a pulsed plasma thruster (PPT) fires in a vacuum chamber in the background. NASA/MSFC's Propulsion Research Center (PRC) is presently investigating plasma propulsion for potential use on future nuclear-powered spacecraft missions, such as human exploration of Mars.

  2. Analog pulse processor

    DOEpatents

    Wessendorf, Kurt O.; Kemper, Dale A.

    2003-06-03

    A very low power analog pulse processing system implemented as an ASIC useful for processing signals from radiation detectors, among other things. The system incorporates the functions of a charge sensitive amplifier, a shaping amplifier, a peak sample and hold circuit, and, optionally, an analog to digital converter and associated drivers.

  3. Weak Radial Artery Pulse

    PubMed Central

    Venugopalan, Poothirikovil; Sivakumar, Puthuval; Ardley, Robert G.; Oates, Crispian

    2012-01-01

    We present an 11year-old boy with a weak right radial pulse, and describe the successful application of vascular ultrasound to identify the ulnar artery dominance and a thin right radial artery with below normal Doppler flow velocity that could explain the discrepancy. The implications of identifying this anomaly are discussed. PMID:22375269

  4. Pulsed electric fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The concept of pulsed electric fields (PEF) was first proposed in 1967 to change the behavior or microorganisms. The electric field phenomenon was identified as membrane rupture theory in the 1980s. Increasing the membrane permeability led to the application of PEF assisted extraction of cellular co...

  5. Lectures on pulsed NMR

    SciTech Connect

    Pines, A.

    1988-08-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 32 refs., 56 figs.

  6. Lectures on pulsed NMR

    SciTech Connect

    Pines, A.

    1986-09-01

    These lectures discuss some recent developments in pulsed NMR, emphasizing fundamental principles with selected illustrative applications. Major topics covered include multiple-quantum spectroscopy, spin decoupling, the interaction of spins with a quantized field, adiabatic rapid passage, spin temperature and statistics of cross-polarization, coherent averaging, and zero field NMR. 55 figs.

  7. Pulsed inductive HF laser

    NASA Astrophysics Data System (ADS)

    Razhev, A. M.; Churkin, D. S.; Kargapol'tsev, E. S.; Demchuk, S. V.

    2016-03-01

    We report the results of experimentally investigated dependences of temporal, spectral and spatial characteristics of an inductive HF-laser generation on the pump conditions. Gas mixtures H2 – F2(NF3 or SF66) and He(Ne) – H2 – F2(NF3 or SF6) were used as active media. The FWHM pulse duration reached 0.42 μs. This value corresponded to a pulsed power of 45 kW. For the first time, the emission spectrum of an inductive HF laser was investigated, which consisted of seven groups of bands with centres around the wavelengths of 2732, 2736, 2739, 2835, 2837, 2893 and 2913 nm. The cross section profile of the laser beam was a ring with a diameter of about 20 mm and width of about 5 mm. Parameters of laser operation in the repetitively pulsed regime were sufficiently stable. The amplitude instability of light pulses was no greater than 5% – 6%.

  8. Downhole pulse tube refrigerators

    SciTech Connect

    Swift, G.; Gardner, D.

    1997-12-01

    This report summarizes a preliminary design study to explore the plausibility of using pulse tube refrigeration to cool instruments in a hot down-hole environment. The original motivation was to maintain Dave Reagor`s high-temperature superconducting electronics at 75 K, but the study has evolved to include three target design criteria: cooling at 30 C in a 300 C environment, cooling at 75 K in a 50 C environment, cooling at both 75 K and 30 C in a 250 C environment. These specific temperatures were chosen arbitrarily, as representative of what is possible. The primary goals are low cost, reliability, and small package diameter. Pulse-tube refrigeration is a rapidly growing sub-field of cryogenic refrigeration. The pulse tube refrigerator has recently become the simplest, cheapest, most rugged and reliable low-power cryocooler. The authors expect this technology will be applicable downhole because of the ratio of hot to cold temperatures (in absolute units, such as Kelvin) of interest in deep drilling is comparable to the ratios routinely achieved with cryogenic pulse-tube refrigerators.

  9. Regulation of ciliary motility by membrane potential in Paramecium: a role for cyclic AMP.

    PubMed

    Bonini, N M; Gustin, M C; Nelson, D L

    1986-01-01

    The membrane potential of Paramecium controls the frequency and direction of the ciliary beat, thus determining the cell's swimming behavior. Stimuli that hyperpolarize the membrane potential increase the ciliary beat frequency and therefore increase forward swimming speed. We have observed that 1) drugs that elevate intracellular cyclic AMP increased swimming speed 2-3-fold, 2) hyperpolarizing the membrane potential by manipulation of extracellular cations (e.g., K+) induced both a transient increase in, and a higher sustained level of cyclic AMP compared to the control, and 3) the swimming speed of detergent-permeabilized cells in MgATP was stimulated 2-fold by the addition of cyclic AMP. Our results suggest that the membrane potential can regulate intracellular cAMP in Paramecium and that control of swimming speed by membrane potential may in part be mediated by cAMP. PMID:2427226

  10. AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

    NASA Astrophysics Data System (ADS)

    Dai, Tongcheng; Li, Na; Liu, Lu; Liu, Qin; Zhang, Yuanxing

    2015-11-01

    Quantum dots (QDs) are engineered nanoparticles that possess special optical and electronic properties and have shown great promise for future biomedical applications. In this work, adenosine 5'-monophosphate (AMP), a small biocompatible molecular, was conjugated to organic QDs to produce hydrophilic AMP-QDs. Using macrophage J774A.1 as the cell model, AMP-QDs exhibited both prior imaging property and low toxicity, and more importantly, triggered limited innate immune responses in macrophage, indicating low immunotoxicity in vitro. Using BALB/c mice as the animal model, AMP-QDs were found to be detained in immune organs but did not evoke robust inflammation responses or obvious histopathological abnormalities, which reveals low immunotoxicity in vivo. This work suggests that AMP is an excellent surface ligand with low immunotoxicity, and potentially used in surface modification for more extensive nanoparticles.

  11. Occurrence of cyclic AMP and related enzymes during germination of Pinus pinea seeds.

    PubMed

    Martelli, P; Lusini, P; Bovalini, L; Bartali, R; Franchi, G G; Cinci, G

    1987-01-01

    The occurrence of cAMP, adenylate cyclase and cAMP phosphodiesterase has been tested in Pinus pinea seed during germination. The study has been carried out on dormant and imbibed seeds, seedlings, endospermic residues, roots and cotyledons. cAMP has been detected by the protein binding method and its occurrence has been verified by HPLC detections. cAMP phosphodiesterase shows a very high activity at acidic pH, while being completely inactive at pH 7.4. At this pH value, well detectable levels of adenylate cyclase have been observed. Therefore, the classical pathway of synthesis and breakdown of cAMP, already accepted for animal and bacterial cells, seems to be operating in Pinus pinea plant too. PMID:3038780

  12. cAMP stimulates the ubiquitin/proteasome pathway in rat spinal cord neurons.

    PubMed

    Myeku, Natura; Wang, Hu; Figueiredo-Pereira, Maria E

    2012-10-11

    Proteasome impairment and accumulation of ubiquitinated proteins are implicated in neurodegeneration associated with different forms of spinal cord injury. We show herein that elevating cAMP in rat spinal cord neurons increases 26S proteasome activity in a protein kinase A-dependent manner. Treating spinal cord neurons with dibutyryl-cAMP (db-cAMP) also raised the levels of various components of the UPP including proteasome subunits Rpt6 and β5, polyubiquitin shuttling factor p62/sequestosome1, E3 ligase CHIP, AAA-ATPase p97 and the ubiquitin gene ubB. Finally, db-cAMP reduced the accumulation of ubiquitinated proteins, proteasome inhibition, and neurotoxicity triggered by the endogenous product of inflammation prostaglandin J2. We propose that optimizing the effects of cAMP/PKA-signaling on the UPP could offer an effective therapeutic approach to prevent UPP-related proteotoxicity in spinal cord neurons. PMID:22982149

  13. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.

    2009-01-01

    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  14. Cell-to-cell coordination for the spontaneous cAMP oscillation in Dictyostelium

    NASA Astrophysics Data System (ADS)

    Nagano, Seido; Sakurai, Shunsuke

    2013-12-01

    We propose a new cellular dynamics scheme for the spontaneous cAMP oscillations in Dictyostelium discoideum. Our scheme seamlessly integrates both receptor dynamics and G-protein dynamics into our previously developed cellular dynamics scheme. Extensive computer simulation studies based on our new cellular dynamics scheme were conducted in mutant cells to evaluate the molecular network. The validity of our proposed molecular network as well as the controversial PKA-dependent negative feedback mechanism was supported by our simulation studies. Spontaneous cAMP oscillations were not observed in a single mutant cell. However, multicellular states of various mutant cells consistently initiated spontaneous cAMP oscillations. Therefore, cell-to-cell coordination via the cAMP receptor is essential for the robust initiation of spontaneous cAMP oscillations.

  15. The Pseudomonas aeruginosa Chp Chemosensory System Regulates Intracellular cAMP Levels by Modulating Adenylate Cyclase Activity

    PubMed Central

    Fulcher, Nanette B.; Holliday, Phillip M.; Klem, Erich; Cann, Martin J.; Wolfgang, Matthew C.

    2010-01-01

    Summary Multiple virulence systems in the opportunistic pathogen Pseudomonas aeruginosa are regulated by the second messenger signaling molecule adenosine 3’, 5’-cyclic monophosphate (cAMP). Production of cAMP by the putative adenylate cyclase enzyme CyaB represents a critical control point for virulence gene regulation. To identify regulators of CyaB, we screened a transposon insertion library for mutants with reduced intracellular cAMP. The majority of insertions resulting in reduced cAMP mapped to the Chp gene cluster encoding a putative chemotaxis-like chemosensory system. Further genetic analysis of the Chp system revealed that it has both positive and negative effects on intracellular cAMP and that it regulates cAMP levels by modulating CyaB activity. The Chp system was previously implicated in the production and function of type IV pili (TFP). Given that cAMP and the cAMP-dependent transcriptional regulator Vfr control TFP biogenesis gene expression, we explored the relationship between cAMP, the Chp system and TFP regulation. We discovered that the Chp system controls TFP production through modulation of cAMP while control of TFP-dependent twitching motility is cAMP-independent. Overall, our data define a novel function for a chemotaxis-like system in controlling cAMP production and establish a regulatory link between the Chp system, TFP and other cAMP-dependent virulence systems. PMID:20345659

  16. cAMP prevents TNF-induced apoptosis through inhibiting DISC complex formation in rat hepatocytes

    PubMed Central

    Bhattacharjee, Rajesh; Xiang, Wenpei; Wang, Yinna; Zhang, Xiaoying; Billiar, Timothy R.

    2013-01-01

    Tumor necrosis factor α (TNF) is a pleiotropic proinflammatory cytokine that plays a role in immunity and the control of cell proliferation, cell differentiation, and apoptosis. The pleiotropic nature of TNF is due to the formation of different signaling complexes upon the binding of TNF to its receptor, TNF receptor type 1 (TNFR1). TNF induces apoptosis in various mammalian cells when the cells are co-treated with a transcription inhibitor like actinomycin D (ActD). When TNFR1 is activated, it recruits an adaptor protein, TNF receptor-associated protein with death domain (TRADD), through its cytoplasmic death effector domain (DED). TRADD, in turn, recruits other signaling proteins, including TNF receptor-associated protein 2 (TRAF2) and receptor-associated protein kinase (RIPK) 1, to form a complex. Subsequently, this complex combines with FADD and procaspase-8, converts into a death-inducing signaling complex (DISC) to induce apoptosis. Cyclic AMP (cAMP) is a second messenger that regulates various cellular processes such as cell proliferation, gene expression, and apoptosis. cAMP analogues are reported to act as anti-apoptotic agents in various cell types, including hepatocytes. We found that a cAMP analogue, dibutyryl cAMP (db-cAMP), inhibits TNF + ActD-induced apoptosis in rat hepatocytes. The protein kinase A (PKA) inhibitor KT-5720 reverses this inhibitory effect of cAMP on apoptosis. Cytoprotection by cAMP involves down-regulation of various apoptotic signal regulators like TRADD and FADD and inhibition of caspase-8 and caspase-3 cleavage. We also found that cAMP exerts its affect at the proximal level of TNF signaling by inhibiting the formation of the DISC complex upon the binding of TNF to TNFR1. In conclusion, our study shows that cAMP prevents TNF + ActD-induced apoptosis in rat hepatocytes by inhibiting DISC complex formation. PMID:22634003

  17. cAMP/PKA signaling inhibits osteogenic differentiation and bone formation in rodent models.

    PubMed

    Siddappa, Ramakrishnaiah; Mulder, Winfried; Steeghs, Ilse; van de Klundert, Christine; Fernandes, Hugo; Liu, Jun; Arends, Roel; van Blitterswijk, Clemens; de Boer, Jan

    2009-08-01

    We previously demonstrated that cAMP-mediated protein kinase A (PKA) activation induces in vitro osteogenesis and in vivo bone formation by human mesenchymal stem cells (hMSCs). To analyze the species-specific response of this phenomenon and to translate our findings into a clinical trial, suitable animal models and cell lines are desirable. In this report, we assessed whether PKA plays a similar proosteogenic role played by two commonly used PKA activators-N6,2'-O-dibutyryl-cAMP (db-cAMP) and 8-bromo cAMP (8b-cAMP)-in a number of model systems. To this end, we treated MC3T3-E1 cells, mouse calvarial osteoblasts, mouse MSCs, and rat MSCs with cAMP. We demonstrate that cAMP inhibits osteogenesis in rodent cell types, evidenced by inhibition of osteogenic markers such as alkaline phosphatase (ALP), osteocalcin (BGLAP), and collagen type 1 (COL1A1). In support of this, ex vivo-cultured mouse calvaria exposed to db-cAMP showed a reduction in bone volume. Interestingly, cAMP even stimulated adipogenic differentiation in rat MSCs. Taken together, our data demonstrate that cAMP inhibits osteogenesis in vitro and bone formation ex vivo in rodent models in contrast to our earlier findings in hMSCs. The species discrepancy in response to various osteogenic signals is a critical need to be tested in clinically relevant models to translate the fundamental findings in lower species level to clinical applications. PMID:19231969

  18. Differential regulation by AMP and ADP of AMPK complexes containing different γ subunit isoforms

    PubMed Central

    Ross, Fiona A.; Jensen, Thomas E.; Hardie, D. Grahame

    2015-01-01

    The γ subunits of heterotrimeric AMPK complexes contain the binding sites for the regulatory adenine nucleotides AMP, ADP and ATP. We addressed whether complexes containing different γ isoforms display different responses to adenine nucleotides by generating cells stably expressing FLAG-tagged versions of the γ1, γ2 or γ3 isoform. When assayed at a physiological ATP concentration (5 mM), γ1- and γ2-containing complexes were allosterically activated almost 10-fold by AMP, with EC50 values one to two orders of magnitude lower than the ATP concentration. By contrast, γ3 complexes were barely activated by AMP under these conditions, although we did observe some activation at lower ATP concentrations. Despite this, all three complexes were activated, due to increased Thr172 phosphorylation, when cells were incubated with mitochondrial inhibitors that increase cellular AMP. With γ1 complexes, activation and Thr172 phosphorylation induced by the upstream kinase LKB1 [liver kinase B1; but not calmodulin-dependent kinase kinase (CaMKKβ)] in cell-free assays was markedly promoted by AMP and, to a smaller extent and less potently, by ADP. However, effects of AMP or ADP on activation and phosphorylation of the γ2 and γ3 complexes were small or insignificant. Binding of AMP or ADP protected all three γ subunit complexes against inactivation by Thr172 dephosphorylation; with γ2 complexes, ADP had similar potency to AMP, but with γ1 and γ3 complexes, ADP was less potent than AMP. Thus, AMPK complexes containing different γ subunit isoforms respond differently to changes in AMP, ADP or ATP. These differences may tune the responses of the isoforms to fit their differing physiological roles. PMID:26542978

  19. Dibutyryl cAMP effects on thromboxane and leukotriene production in decompression-induced lung injury

    NASA Technical Reports Server (NTRS)

    Little, T. M.; Butler, B. D.

    1997-01-01

    Decompression-induced venous bubble formation has been linked to increased neutrophil counts, endothelial cell injury, release of vasoactive eicosanoids, and increased vascular membrane permeability. These actions may account for inflammatory responses and edema formation. Increasing the intracellular cAMP has been shown to decrease eicosanoid production and edema formation in various models of lung injury. Reduction of decompression-induced inflammatory responses was evaluated in decompressed rats pretreated with saline (controls) or dibutyryl cAMP (DBcAMP, an analog of cAMP). After pretreatment, rats were exposed to either 616 kPa for 120 min or 683 kPa for 60 min. The observed increases in extravascular lung water ratios (pulmonary edema), bronchoalveolar lavage, and pleural protein in the saline control group (683 kPa) were not evident with DBcAMP treatment. DBcAMP pretreatment effects were also seen with the white blood cell counts and the percent of neutrophils in the bronchoalveolar lavage. Urinary levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were significantly increased with the 683 kPa saline control decompression exposure. DBcAMP reduced the decompression-induced leukotriene E4 production in the urine. Plasma levels of thromboxane B2, 11-dehydrothromboxane B2, and leukotriene E4 were increased with the 683-kPa exposure groups. DBcAMP treatment did not affect these changes. The 11-dehydrothromboxane B2 and leukotriene E4 levels in the bronchoalveolar lavage were increased with the 683 kPa exposure and were reduced with the DBcAMP treatment. Our results indicate that DBcAMP has the capability to reduce eicosanoid production and limit membrane permeability and subsequent edema formation in rats experiencing decompression sickness.

  20. Complex Regulation Pathways of AmpC-Mediated β-Lactam Resistance in Enterobacter cloacae Complex

    PubMed Central

    Guérin, François; Isnard, Christophe; Giard, Jean Christophe

    2015-01-01

    Enterobacter cloacae complex (ECC), an opportunistic pathogen causing numerous infections in hospitalized patients worldwide, is able to resist β-lactams mainly by producing the AmpC β-lactamase enzyme. AmpC expression is highly inducible in the presence of some β-lactams, but the underlying genetic regulation, which is intricately linked to peptidoglycan recycling, is still poorly understood. In this study, we constructed different mutant strains that were affected in genes encoding enzymes suspected to be involved in this pathway. As expected, the inactivation of ampC, ampR (which encodes the regulator protein of ampC), and ampG (encoding a permease) abolished β-lactam resistance. Reverse transcription-quantitative PCR (qRT-PCR) experiments combined with phenotypic studies showed that cefotaxime (at high concentrations) and cefoxitin induced the expression of ampC in different ways: one involving NagZ (a N-acetyl-β-d-glucosaminidase) and another independent of NagZ. Unlike the model established for Pseudomonas aeruginosa, inactivation of DacB (also known as PBP4) was not responsible for a constitutive ampC overexpression in ECC, whereas it caused AmpC-mediated high-level β-lactam resistance, suggesting a post-transcriptional regulation mechanism. Global transcriptomic analysis by transcriptome sequencing (RNA-seq) of a dacB deletion mutant confirmed these results. Lastly, analysis of 37 ECC clinical isolates showed that amino acid changes in the AmpD sequence were likely the most crucial event involved in the development of high-level β-lactam resistance in vivo as opposed to P. aeruginosa where dacB mutations have been commonly found. These findings bring new elements for a better understanding of β-lactam resistance in ECC, which is essential for the identification of novel potential drug targets. PMID:26438498

  1. Atrazine Acts as an Endocrine Disrupter by Inhibiting cAMP-specific Phosphodiesterase-4

    PubMed Central

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2014-01-01

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. PMID:23022511

  2. cAMP-binding proteins in medullary tubules from rat kidney: effect of ADH

    SciTech Connect

    Gapstur, S.M.; Homma, S.; Dousa, T.P.

    1988-08-01

    Little is known of the regulatory steps in the cellular action of vasopressin (AVP) on the renal epithelium, subsequent to the cAMP generation. We studied cAMP-binding proteins in the medullary collecting tubule (MCT) and the thick ascending limb of Henle's loop (MTAL) microdissected from the rat kidney by use of photoaffinity labeling. Microdissected tubules were homogenized and photoaffinity labeled by incubation with 1 microM 32P-labeled 8-azido-adenosine 3',5'-cyclic monophosphate (N3-8-(32P)-cAMP); the incorporated 32P was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. Both in MCT and MTAL preparations, the analyses showed incorporation of N3-8-(32P)cAMP into two bands (Mr = 49,000 and Mr = 55,000) that comigrated with standards of the cAMP-dependent protein kinase regulatory subunits RI and RII. In MCT, most of the 32P (80%) was incorporated into RI, whereas in MTAL the 32P incorporated into RI and RII was equivalent. When freshly dissected MCT segments were incubated with 10(-12)-10(-6) M AVP, the subsequent photoaffinity labeling of RI with N3-8-(32P)cAMP was markedly diminished in a dose-dependent manner compared with controls. Our results suggest that cAMP binds in MCT and MTAL to regulatory subunits RI and RII of cAMP-dependent protein kinase. However, in MCT the dominant type of cAMP-dependent protein kinase appears to be type I. The outlined procedure is suitable to indirectly measure the occupancy of RI by endogenous cAMP generated in MCT cells in response to physiological levels (10(-12) M) of AVP.

  3. Cyclic AMP can promote APL progression and protect myeloid leukemia cells against anthracycline-induced apoptosis

    PubMed Central

    Gausdal, G; Wergeland, A; Skavland, J; Nguyen, E; Pendino, F; Rouhee, N; McCormack, E; Herfindal, L; Kleppe, R; Havemann, U; Schwede, F; Bruserud, Ø; Gjertsen, B T; Lanotte, M; Ségal-Bendirdjian, E; Døskeland, S O

    2013-01-01

    We show that cyclic AMP (cAMP) elevating agents protect blasts from patients with acute promyelocytic leukemia (APL) against death induced by first-line anti-leukemic anthracyclines like daunorubicin (DNR). The cAMP effect was reproduced in NB4 APL cells, and shown to depend on activation of the generally cytoplasmic cAMP-kinase type I (PKA-I) rather than the perinuclear PKA-II. The protection of both NB4 cells and APL blasts was associated with (inactivating) phosphorylation of PKA site Ser118 of pro-apoptotic Bad and (activating) phosphorylation of PKA site Ser133 of the AML oncogene CREB. Either event would be expected to protect broadly against cell death, and we found cAMP elevation to protect also against 2-deoxyglucose, rotenone, proteasome inhibitor and a BH3-only mimetic. The in vitro findings were mirrored by the findings in NSG mice with orthotopic NB4 cell leukemia. The mice showed more rapid disease progression when given cAMP-increasing agents (prostaglandin E2 analog and theophylline), both with and without DNR chemotherapy. The all-trans retinoic acid (ATRA)-induced terminal APL cell differentiation is a cornerstone in current APL treatment and is enhanced by cAMP. We show also that ATRA-resistant APL cells, believed to be responsible for treatment failure with current ATRA-based treatment protocols, were protected by cAMP against death. This suggests that the beneficial pro-differentiating and non-beneficial pro-survival APL cell effects of cAMP should be weighed against each other. The results suggest also general awareness toward drugs that can affect bone marrow cAMP levels in leukemia patients. PMID:23449452

  4. Chirped-pulse amplification of 100-fsec pulses.

    PubMed

    Pessot, M; Squier, J; Mourou, G; Harter, D J

    1989-08-01

    Chirped-pulse amplification is used to generate 2-mJ pulses of 106-fsec duration in an alexandrite amplifier. Compression of the optical pulse is achieved by using a sequence of intracavity prisms in conjunction with diffraction gratings. This allows for the compensation of both linear and quadratic contributions to the dispersion from the amplifier. PMID:19752971

  5. All about Heart Rate (Pulse)

    MedlinePlus

    ... Pressure High Blood Pressure Tools & Resources Stroke More All About Heart Rate (Pulse) Updated:Apr 19,2016 ... Sodium and Salt 3 Low Blood Pressure 4 All About Heart Rate (Pulse) 5 How to Eat ...

  6. Nondegenerate optical parametric chirped pulse amplifier

    DOEpatents

    Jovanovic, Igor; Ebbers, Christopher A.

    2005-03-22

    A system provides an input pump pulse and a signal pulse. A first dichroic beamsplitter is highly reflective for the input signal pulse and highly transmissive for the input pump pulse. A first optical parametric amplifier nonlinear crystal transfers part of the energy from the input pump pulse to the input signal pulse resulting in a first amplified signal pulse and a first depleted pump pulse. A second dichroic beamsplitter is highly reflective for the first amplified signal pulse and highly transmissive for the first depleted pump pulse. A second optical parametric amplifier nonlinear crystal transfers part of the energy from the first depleted pump pulse to the first amplified signal pulse resulting in a second amplified signal pulse and a second depleted pump pulse. A third dichroic beamsplitter receives the second amplified signal pulse and the second depleted pump pulse. The second depleted pump pulse is discarded.

  7. Sequentially pulsed traveling wave accelerator

    DOEpatents

    Caporaso, George J.; Nelson, Scott D.; Poole, Brian R.

    2009-08-18

    A sequentially pulsed traveling wave compact accelerator having two or more pulse forming lines each with a switch for producing a short acceleration pulse along a short length of a beam tube, and a trigger mechanism for sequentially triggering the switches so that a traveling axial electric field is produced along the beam tube in synchronism with an axially traversing pulsed beam of charged particles to serially impart energy to the particle beam.

  8. Construction of a 400 KJ-class pulsed superconducting magnet and its operating characteristics

    SciTech Connect

    Onishi, T.; Tateishi, H.; Komuro, K.; Koyama, K.; Yamada, T.

    1981-09-01

    A pulsed superconducting magnet with a stored energy of 375 KJ has been developed. The central field is 6 T at 2510 amp. The conductor is a compacted strand cable which is composed of 23 strands. Each copper-stabilized filament in the strand is separated by a hexagonal cupronickel wall. The cable is not solder filled and thus not mechanically rigid. The winding inner and outer and axial length of the magnet are respectively 220 mm, 399 mm, and 345 mm. The magnet bobbin is made of epoxy glass-fiber material. The magnet was charged up to 2600 amp after having experienced training three times. At that current the stored energy was about 402 KJ. The first quench occurred at 2460 amp, a little lower current than the design current. In pulse operations, the magnet was successfully charged up to 6 T at a ramping rate of about 1.5 T/sec and up to 5.4 T at about 3.5 T/sec and discharged to zero at a ramping rate of about 3.1 T/sec without quenching. Noticeable evaporation of liquid helium due to ac losses did not occur. The faster ramping rates were limited by the power supply, not by the coil performance. During the charges, no major conductor motions were observed. 6 refs.

  9. Elevated cAMP increases aquaporin-3 plasma membrane diffusion.

    PubMed

    Marlar, Saw; Arnspang, Eva C; Koffman, Jennifer S; Løcke, Else-Merete; Christensen, Birgitte M; Nejsum, Lene N

    2014-03-15

    Regulated urine concentration takes place in the renal collecting duct upon arginine vasopressin (AVP) stimulation, where subapical vesicles containing aquaporin-2 (AQP2) are inserted into the apical membrane instantly increasing water reabsorption and urine concentration. The reabsorped water exits via basolateral AQP3 and AQP4. Upon long-term stimulation with AVP or during thirst, expression levels of both AQP2 and AQP3 are increased; however, there is so far no evidence for short-term AVP regulation of AQP3 or AQP4. To facilitate the increase in transepithelial water transport, AQP3 may be short-term regulated via changes in protein-protein interactions, incorporation into lipid rafts, and/or changes in steady-state turnover, which could result in changes in the diffusion behavior of AQP3. Thus we measured AQP3 diffusion coefficients upon stimulation with the AVP mimic forskolin to reveal if AQP3 could be short-term regulated by AVP. k-Space image correlation spectroscopy (kICS) analysis of time-lapse image sequences of basolateral enhanced green fluorescent protein-tagged AQP3 (AQP3-EGFP) revealed that the forskolin-mediated elevation of cAMP increased the diffusion coefficient by 58% from 0.0147 ± 0.0082 μm(2)/s (control) to 0.0232 ± 0.0085 μm(2)/s (forskolin, P < 0.05). Quantum dot-conjugated antibody labeling also revealed a significant increase in AQP3 diffusion upon forskolin treatment by 44% [0.0104 ± 0.0040 μm(2)/s (control) vs. 0.0150 ± 0.0016 μm(2)/s (forskolin, P < 0.05)]. Immunoelectron microscopy showed no obvious difference in AQP3-EGFP expression levels or localization in the plasma membrane upon forskolin stimulation. Thus AQP3-EGFP diffusion is altered upon increased cAMP, which may correspond to basolateral adaptations in response to the increased apical water readsorption. PMID:24452376

  10. Atrazine acts as an endocrine disrupter by inhibiting cAMP-specific phosphodiesterase-4

    SciTech Connect

    Kucka, Marek; Pogrmic-Majkic, Kristina; Fa, Svetlana; Stojilkovic, Stanko S.; Kovacevic, Radmila

    2012-11-15

    Atrazine, one of the most commonly used herbicides worldwide, acts as an endocrine disruptor, but the mechanism of its action has not been characterized. In this study, we show that atrazine rapidly increases cAMP levels in cultured rat pituitary and testicular Leydig cells in a concentration-dependent manner, but less effectively than 3-isobutyl-1-methylxanthine, a competitive non-specific inhibitor of phosphodiesterases (PDEs). In forskolin (an activator of adenylyl cyclase)- and probenecid (an inhibitor of cyclic nucleotide transporters)-treated cells, but not in 3-isobutyl-1-methylxanthine-treated cells, atrazine further increased cAMP levels, indicating that inhibition of PDEs accounts for accumulation of cAMP. In contrast to cAMP, atrazine did not alter cGMP levels, further indicating that it inhibits cAMP-specific PDEs. Atrazine-induced changes in cAMP levels were sufficient to stimulate prolactin release in pituitary cells and androgen production in Leydig cells, indicating that it acts as an endocrine disrupter both in cells that secrete by exocytosis of prestored hormones and in cells that secrete by de novo hormone synthesis. Rolipram abolished the stimulatory effect of atrazine on cAMP release in both cell types, suggesting that it acts as an inhibitor of PDE4s, isoforms whose mRNA transcripts dominate in pituitary and Leydig cells together with mRNA for PDE8A. In contrast, immortalized lacto-somatotrophs showed low expression of these mRNA transcripts and several fold higher cAMP levels compared to normal pituitary cells, and atrazine was unable to further increase cAMP levels. These results indicate that atrazine acts as a general endocrine disrupter by inhibiting cAMP-specific PDE4s. -- Highlights: ► Atrazine stimulates cAMP accumulation in pituitary and Leydig cells. ► Atrazine also stimulates PRL and androgens secretion. ► Stimulatory effects of atrazine were abolished in cells with IBMX-inhibited PDEs. ► Atrazine specificity toward cAMP

  11. Numerically Modeling Pulsed-Current, Kinked Wire Experiments

    NASA Astrophysics Data System (ADS)

    Filbey, Gordon; Kingman, Pat

    1999-06-01

    The U.S. Army Research Laboratory (ARL) has embarked on a program to provide far-term land fighting vehicles with electromagnetic armor protection. Part of this work seeks to establish robust simulations of magneto-solid-mechanics phenomena. Whether describing violent rupture of a fuse link resulting from a large current pulse or the complete disruption of a copper shaped-charge jet subjected to high current densities, the simulations must include effects of intense Lorentz body forces and rapid Ohmic heating. Material models are required that describe plasticity, flow and fracture, conductivity, and equation of state (EOS) parameters for media in solid, liquid, and vapor phases. An extended version of the Eulerian wave code CTH has been used to predict the apex motion of a V-shaped (``kinked'') copper wire 3mm in diameter during a 400 kilo-amp pulse. These predictions, utilizing available material, EOS, and conductivity data for copper and the known characteristics of an existing capacitor-bank pulsed power supply, were then used to configure an experiment. The experiments were in excellent agreement with the prior simulations. Both computational and experimental results (including electrical data and flash X-rays) will be presented.

  12. ELECTRONIC PULSE SCALING CIRCUITS

    DOEpatents

    Cooke-Yarborough, E.H.

    1958-11-18

    Electronic pulse scaling circults of the klnd comprlsing a serles of bi- stable elements connected ln sequence, usually in the form of a rlng so as to be cycllcally repetitive at the highest scallng factor, are described. The scaling circuit comprises a ring system of bi-stable elements each arranged on turn-off to cause, a succeeding element of the ring to be turned-on, and one being arranged on turn-off to cause a further element of the ring to be turned-on. In addition, separate means are provided for applying a turn-off pulse to all the elements simultaneously, and for resetting the elements to a starting condition at the end of each cycle.

  13. Computationally intelligent pulsed photoacoustics

    NASA Astrophysics Data System (ADS)

    Lukić, Mladena; Ćojbašić, Žarko; Rabasović, Mihailo D.; Markushev, Dragan D.

    2014-12-01

    In this paper, the application of computational intelligence in pulsed photoacoustics is discussed. Feedforward multilayer perception networks are applied for real-time simultaneous determination of the laser beam spatial profile and vibrational-to-translational relaxation time of the polyatomic molecules in gases. Networks are trained and tested with theoretical data adjusted for a given experimental set-up. Genetic optimization has been used for calculation of the same parameters, fitting the photoacoustic signals with a different number of generations. Observed benefits from the application of computational intelligence in pulsed photoacoustics and advantages over previously developed methods are discussed, such as real-time operation, high precision and the possibility of finding solutions in a wide range of parameters, similar to in experimental conditions. In addition, the applicability for practical uses, such as the real-time in situ measurements of atmospheric pollutants, along with possible further developments of obtained results, is argued.

  14. Laser pulse detector

    DOEpatents

    Mashburn, D.N.; Akerman, M.A.

    1979-08-13

    A laser pulse detector is provided which is small and inexpensive and has the capability of detecting laser light of any wavelength with fast response (less than 5 nanoseconds rise time). The laser beam is focused onto the receiving end of a graphite rod coaxially mounted within a close-fitting conductive, open-end cylindrical housing so that ablation and electric field breakdown of the resulting plasma occurs due to a bias potential applied between the graphite rod and housing. The pulse produced by the breakdown is transmitted through a matched impedance coaxial cable to a recording device. The cable is connected with its central lead to the graphite rod and its outer conductor to the housing.

  15. Laser pulse detector

    DOEpatents

    Mashburn, Douglas N.; Akerman, M. Alfred

    1981-01-01

    A laser pulse detector is provided which is small and inexpensive and has the capability of detecting laser light of any wavelength with fast response (less than 5 nanoseconds rise time). The laser beam is focused onto the receiving end of a graphite rod coaxially mounted within a close-fitting conductive, open-end cylindrical housing so that ablation and electric field breakdown of the resulting plasma occurs due to a bias potential applied between the graphite rod and housing. The pulse produced by the breakdown is transmitted through a matched impedance coaxial cable to a recording device. The cable is connected with its central lead to the graphite rod and its outer conductor to the housing.

  16. Noisy homoclinic pulse dynamics

    NASA Astrophysics Data System (ADS)

    Eaves, T. S.; Balmforth, Neil J.

    2016-04-01

    The effect of stochastic perturbations on nearly homoclinic pulse trains is considered for three model systems: a Duffing oscillator, the Lorenz-like Shimizu-Morioka model, and a co-dimension-three normal form. Using the Duffing model as an example, it is demonstrated that the main effect of noise does not originate from the neighbourhood of the fixed point, as is commonly assumed, but due to the perturbation of the trajectory outside that region. Singular perturbation theory is used to quantify this noise effect and is applied to construct maps of pulse spacing for the Shimizu-Morioka and normal form models. The dynamics of these stochastic maps is then explored to examine how noise influences the sequence of bifurcations that take place adjacent to homoclinic connections in Lorenz-like and Shilnikov-type flows.

  17. CW-pulsed laser

    SciTech Connect

    Wert, J. C.

    1981-09-01

    An apparatus for generating a spatially coherent laser beam having both CW and pulsed modes is disclosed. The modes are generated in differing volumetric regions of a single gain medium excited by a continuous energy pump. The CW portion of the output beam passes from the gain medium through a partially transmissive output coupling. The pulsed modes in the output beam are created in the respective region of the gain medium when transition materials from a selected group are stimulated to undergo an abrupt change between their reflective and transmissive states. Either cavity dumped or Q-switched configurations can be created by selective and patterned location of the transition materials at the ends of the gain medium. Symmetric organization of the volumetric regions within the gain medium allows temporal superposition of the two modes while maintaining spatial distinctiveness within the laser beam generated.

  18. Pulsed electron beam precharger

    SciTech Connect

    Finney, W.C.; Shelton, W.N.

    1989-01-01

    This is the fifth in a series of contracts and grants exploring the advanced particulate pollution control technology of electron beam precipitation. The chief goal of the current contract is to develop a laboratory scale electron beam precharger using a pulsed electric field to the proof-of-concept stage. Contract tasks leading to the achievement of this goal are generally divided up into two categories: tasks required to bring the Electron Beam Precipitator (EBP) test system up to an operational level for the contract work, and tasks concerning the actual experimental and analytical phase of the study. Not unexpectedly, the early portion of the contract duration will be devoted to the commissioning of the EBP and its many subsystems, while the latter portion will devote itself to testing the new pulsed electron beam precharger.

  19. Micro pulse laser radar

    NASA Technical Reports Server (NTRS)

    Spinhirne, James D. (Inventor)

    1993-01-01

    An eye safe, compact, solid state lidar for profiling atmospheric cloud and aerosol scattering is disclosed. The transmitter of the micro pulse lidar is a diode pumped micro-J pulse energy, high repetition rate Nd:YLF laser. Eye safety is obtained through beam expansion. The receiver employs a photon counting solid state Geiger mode avalanche photodiode detector. Data acquisition is by a single card multichannel scaler. Daytime background induced quantum noise is controlled by a narrow receiver field-of-view and a narrow bandwidth temperature controlled interference filter. Dynamic range of the signal is limited to optical geometric signal compression. Signal simulations and initial atmospheric measurements indicate that micropulse lider systems are capable of detecting and profiling all significant cloud and aerosol scattering through the troposphere and into the stratosphere. The intended applications are scientific studies and environmental monitoring which require full time, unattended measurements of the cloud and aerosol height structure.

  20. Short pulse neutron generator

    DOEpatents

    Elizondo-Decanini, Juan M.

    2016-08-02

    Short pulse neutron generators are described herein. In a general embodiment, the short pulse neutron generator includes a Blumlein structure. The Blumlein structure includes a first conductive plate, a second conductive plate, a third conductive plate, at least one of an inductor or a resistor, a switch, and a dielectric material. The first conductive plate is positioned relative to the second conductive plate such that a gap separates these plates. A vacuum chamber is positioned in the gap, and an ion source is positioned to emit ions in the vacuum chamber. The third conductive plate is electrically grounded, and the switch is operable to electrically connect and disconnect the second conductive plate and the third conductive plate. The at least one of the resistor or the inductor is coupled to the first conductive plate and the second conductive plate.

  1. Noisy homoclinic pulse dynamics.

    PubMed

    Eaves, T S; Balmforth, Neil J

    2016-04-01

    The effect of stochastic perturbations on nearly homoclinic pulse trains is considered for three model systems: a Duffing oscillator, the Lorenz-like Shimizu-Morioka model, and a co-dimension-three normal form. Using the Duffing model as an example, it is demonstrated that the main effect of noise does not originate from the neighbourhood of the fixed point, as is commonly assumed, but due to the perturbation of the trajectory outside that region. Singular perturbation theory is used to quantify this noise effect and is applied to construct maps of pulse spacing for the Shimizu-Morioka and normal form models. The dynamics of these stochastic maps is then explored to examine how noise influences the sequence of bifurcations that take place adjacent to homoclinic connections in Lorenz-like and Shilnikov-type flows. PMID:27131483

  2. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation.

    PubMed

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation. PMID:27621729

  3. Central role of soluble adenylyl cyclase and cAMP in sperm physiology

    PubMed Central

    Buffone, Mariano G.; Wertheimer, Eva V.; Visconti, Pablo E.; Krapf, Dario

    2014-01-01

    Cyclic adenosine 3′,5′-monophosphate (cAMP), the first second messenger to be described, plays a central role in cell signaling in a wide variety of cell types. Over the last decades, a wide body of literature addressed the different roles of cAMP in cell physiology, mainly in response to neurotransmitters and hormones. cAMP is synthesized by a wide variety of adenylyl cylases that can generally be grouped in two types: transmembrane adenylyl cyclase and soluble adenylyl cyclases. In particular, several aspects of sperm physiology are regulated by cAMP produced by a single atypical adenylyl cyclase (Adcy10, aka sAC, SACY). The signature that identifies sAC among other ACs, is their direct stimulation by bicarbonate. The essential nature of cAMP in sperm function has been demonstrated using gain of function as well as loss of function approaches. This review unifies state of the art knowledge of the role of cAMP and those enzymes involved in cAMP signaling pathways required for the acquisition of fertilizing capacity of mammalian sperm. PMID:25066614

  4. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation

    PubMed Central

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  5. Second Messenger Signaling in Bacillus subtilis: Accumulation of Cyclic di-AMP Inhibits Biofilm Formation.

    PubMed

    Gundlach, Jan; Rath, Hermann; Herzberg, Christina; Mäder, Ulrike; Stülke, Jörg

    2016-01-01

    The Gram-positive model organism Bacillus subtilis produces the essential second messenger signaling nucleotide cyclic di-AMP. In B. subtilis and other bacteria, c-di-AMP has been implicated in diverse functions such as control of metabolism, cell division and cell wall synthesis, and potassium transport. To enhance our understanding of the multiple functions of this second messenger, we have studied the consequences of c-di-AMP accumulation at a global level by a transcriptome analysis. C-di-AMP accumulation affected the expression of about 700 genes, among them the two major operons required for biofilm formation. The expression of both operons was severely reduced both in the laboratory and a non-domesticated strain upon accumulation of c-di-AMP. In excellent agreement, the corresponding strain was unable to form complex colonies. In B. subtilis, the transcription factor SinR controls the expression of biofilm genes by binding to their promoter regions resulting in transcription repression. Inactivation of the sinR gene restored biofilm formation even at high intracellular c-di-AMP concentrations suggesting that the second messenger acts upstream of SinR in the signal transduction pathway. As c-di-AMP accumulation did not affect the intracellular levels of SinR, we conclude that the nucleotide affects the activity of SinR. PMID:27252699

  6. Cyclic AMP Represents a Crucial Component of Treg Cell-Mediated Immune Regulation

    PubMed Central

    Klein, Matthias; Bopp, Tobias

    2016-01-01

    T regulatory (Treg) cells are one of the key players in the immune tolerance network, and a plethora of manuscripts have described their development and function in the course of the last two decades. Nevertheless, it is still a matter of debate as to which mechanisms and agents are employed by Treg cells, providing the basis of their suppressive potency. One of the important candidates is cyclic AMP (cAMP), which is long known as a potent suppressor at least of T cell activation and function. While this suppressive function by itself is widely accepted, the source and the mechanism of action of cAMP are less clear, and a multitude of seemingly contradictory data allow for, in principle, two different scenarios of cAMP-mediated suppression. In one scenario, Treg cells contain high amounts of cAMP and convey this small molecule via gap junction intercellular communication directly to the effector T cells (Teff) leading to their suppression. Alternatively, it was shown that Treg cells represent the origin of considerable amounts of adenosine, which trigger the adenylate cyclases in Teff cells via A2A and A2B receptors, thus strongly increasing intracellular cAMP. This review will present and discuss initial findings and recent developments concerning the function of cAMP for Treg cells and its impact on immune regulation.

  7. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA.

    PubMed

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-11-18

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  8. Sustained exposure to catecholamines affects cAMP/PKA compartmentalised signalling in adult rat ventricular myocytes.

    PubMed

    Fields, Laura A; Koschinski, Andreas; Zaccolo, Manuela

    2016-07-01

    In the heart compartmentalisation of cAMP/protein kinase A (PKA) signalling is necessary to achieve a specific functional outcome in response to different hormonal stimuli. Chronic exposure to catecholamines is known to be detrimental to the heart and disrupted compartmentalisation of cAMP signalling has been associated to heart disease. However, in most cases it remains unclear whether altered local cAMP signalling is an adaptive response, a consequence of the disease or whether it contributes to the pathogenetic process. We have previously demonstrated that isoforms of PKA expressed in cardiac myocytes, PKA-I and PKA-II, localise to different subcellular compartments and are selectively activated by spatially confined pools of cAMP, resulting in phosphorylation of distinct downstream targets. Here we investigate cAMP signalling in an in vitro model of hypertrophy in primary adult rat ventricular myocytes. By using a real time imaging approach and targeted reporters we find that that sustained exposure to catecholamines can directly affect cAMP/PKA compartmentalisation. This appears to involve a complex mechanism including both changes in the subcellular localisation of individual phosphodiesterase (PDE) isoforms as well as the relocalisation of PKA isoforms. As a result, the preferential coupling of PKA subsets with different PDEs is altered resulting in a significant difference in the level of cAMP the kinase is exposed to, with potential impact on phosphorylation of downstream targets. PMID:26475678

  9. Cyclic AMP Signaling through Epac Axis Modulates Human Hemogenic Endothelium and Enhances Hematopoietic Cell Generation.

    PubMed

    Saxena, Shobhit; Rönn, Roger E; Guibentif, Carolina; Moraghebi, Roksana; Woods, Niels-Bjarne

    2016-05-10

    Hematopoietic cells emerge from hemogenic endothelium in the developing embryo. Mechanisms behind human hematopoietic stem and progenitor cell development remain unclear. Using a human pluripotent stem cell differentiation model, we report that cyclic AMP (cAMP) induction dramatically increases HSC-like cell frequencies. We show that hematopoietic cell generation requires cAMP signaling through the Exchange proteins activated by cAMP (cAMP-Epac) axis; Epac signaling inhibition decreased both hemogenic and non-hemogenic endothelium, and abrogated hematopoietic cell generation. Furthermore, in hematopoietic progenitor and stem-like cells, cAMP induction mitigated oxidative stress, created a redox-state balance, and enhanced C-X-C chemokine receptor type 4 (CXCR4) expression, benefiting the maintenance of these primitive cells. Collectively, our study provides insights and mechanistic details on the previously unrecognized role of cAMP signaling in regulating human hematopoietic development. These findings advance the mechanistic understanding of hematopoietic development toward the development of transplantable human hematopoietic cells for therapeutic needs. PMID:27117782

  10. Role of coronary endothelium in cyclic AMP formation by the heart

    SciTech Connect

    Kroll, K.; Schrader, J.

    1986-03-01

    In order to quantify the activation of adenylate cyclase of the coronary endothelium in vivo, endothelial adenine nucleotides of isolated guinea pig hearts were selectively pre-labeled by intracoronary infusion of tritiated (H3)-adenosine, and the coronary efflux of H3-cAMP was measured. The adenosine receptor agonist, NECA (12 ..mu..M), increased total cAMP release 4 fold, and raised H3-cAMP release 22 fold. Several classes of coronary vasodilators (adenosine, L-PIA, D-PIA, the beta 2-adrenergic agonist procaterol, and PGE1) caused dose-dependent increases in endothelial-derived H3-cAMP release. These increases were accompanied by decreases in vascular resistance, at agonist doses without positive intropic effects. Hypoxic perfusion also raised H3-cAMP release, and this was antagonized by theophylline. It is concluded: (1) cyclic AMP formation by coronary endothelium can dominate total cAMP production by the heart; (2) coronary endothelial adenylate cyclase-coupled receptors for adenosine (A2), catecholamines (beta2) and prostaglandins are activated in parallel with coronary vasodilation; (3) endothelial adenylate cyclase can be activated by endogenous adenosine.

  11. Crystal structure of a c-di-AMP riboswitch reveals an internally pseudo-dimeric RNA

    PubMed Central

    Jones, Christopher P; Ferré-D'Amaré, Adrian R

    2014-01-01

    Cyclic diadenosine monophosphate (c-di-AMP) is a second messenger that is essential for growth and homeostasis in bacteria. A recently discovered c-di-AMP-responsive riboswitch controls the expression of genes in a variety of bacteria, including important pathogens. To elucidate the molecular basis for specific binding of c-di-AMP by a gene-regulatory mRNA domain, we have determined the co-crystal structure of this riboswitch. Unexpectedly, the structure reveals an internally pseudo-symmetric RNA in which two similar three-helix-junction elements associate head-to-tail, creating a trough that cradles two c-di-AMP molecules making quasi-equivalent contacts with the riboswitch. The riboswitch selectively binds c-di-AMP and discriminates exquisitely against other cyclic dinucleotides, such as c-di-GMP and cyclic-AMP-GMP, via interactions with both the backbone and bases of its cognate second messenger. Small-angle X-ray scattering experiments indicate that global folding of the riboswitch is induced by the two bound cyclic dinucleotides, which bridge the two symmetric three-helix domains. This structural reorganization likely couples c-di-AMP binding to gene expression. PMID:25271255

  12. Detection of plasmid-mediated AmpC β-lactamase in Escherichia coli

    PubMed Central

    LIU, XIANGQUN; LIU, YONGRUI

    2016-01-01

    Escherichia coli (E. coli) is a common opportunistic pathogen for nosocomial infection. The aim of the study was to examine the phenotype, genotype and epidemiology of plasmid-mediated AmpC β-lactamases in E. coli. In total, 96 clinical isolates of repeated E. coli were collected from different hospitals between August and October 2012. Using a cefoxitin disk diffusion method to identify the phenotype of AmpC β-lactamases in E. coli, the plasmid was extracted, and multiplex polymerase chain reaction (PCR) was used to determine the amp gene. The PCR products were purified and sequenced. Of the 96 isolates strains, 43 strains were cefoxitin-resistant. Twelve (12.5%) isolates were detected to produce AmpC β-lactamases with multiplex PCR, 11 strains carried DHA type ampC-resistant genes, and one strain carried ACC type ampC-resistant genes. In conclusion, the incidence of producing a plasmid-mediated AmpC enzyme of E. coli strains was relatively high. Therefore, antibiotics such as imipenem, a carbapenem, potentially serve as the treatment of choice for the infection. PMID:27284407

  13. Osteoblast differentiation is functionally associated with decreased AMP kinase activity.

    PubMed

    Kasai, Takayuki; Bandow, Kenjiro; Suzuki, Hiraku; Chiba, Norika; Kakimoto, Kyoko; Ohnishi, Tomokazu; Kawamoto, Shin-ichiro; Nagaoka, Eiichi; Matsuguchi, Tetsuya

    2009-12-01

    Osteoblasts, originating from mesenchymal stem cells, play a pivotal role in bone formation and mineralization. Several transcription factors including runt-related transcription factor 2 (Runx2) have been reported to be essential for osteoblast differentiation, whereas the cytoplasmic signal transduction pathways controlling the differentiation process have not been fully elucidated. AMP-activated protein kinase (AMPK) is a serine-threonine kinase generally regarded as a key regulator of cellular energy homeostasis, polarity, and division. Recent lines of evidence have indicated that the activity of the catalytic alpha subunit of AMPK is regulated through its phosphorylation by upstream AMPK kinases (AMPKKs) including LKB1. Here, we explored the role of AMPK in osteoblast differentiation using in vitro culture models. Phosphorylation of AMPKalpha was significantly decreased during osteoblastic differentiation in both primary osteoblasts and MC3T3-E1, a mouse osteoblastic cell line. Conversely, the terminal differentiation of primary osteoblasts and MC3T3-E1 cells, represented by matrix mineralization, was significantly inhibited by glucose restriction and stimulation with metformin, both of which are known activators of AMPK. Matrix mineralization of MC3T3-E1 cells was also inhibited by the forced expression of a constitutively active form of AMPKalpha. Metformin significantly inhibited gene expression of Runx2 along with osteoblast differentiation markers including osteocalcin (Ocn), bone sialo protein (Bsp), and osteopontin (Opn). Thus, our present data indicate that differentiation of osteoblasts is functionally associated with decreased AMPK activity. PMID:19725053

  14. Activating AMP-activated protein kinase (AMPK) slows renal cystogenesis.

    PubMed

    Takiar, Vinita; Nishio, Saori; Seo-Mayer, Patricia; King, J Darwin; Li, Hui; Zhang, Li; Karihaloo, Anil; Hallows, Kenneth R; Somlo, Stefan; Caplan, Michael J

    2011-02-01

    Renal cyst development and expansion in autosomal dominant polycystic kidney disease (ADPKD) involves both fluid secretion and abnormal proliferation of cyst-lining epithelial cells. The chloride channel of the cystic fibrosis transmembrane conductance regulator (CFTR) participates in secretion of cyst fluid, and the mammalian target of rapamycin (mTOR) pathway may drive proliferation of cyst epithelial cells. CFTR and mTOR are both negatively regulated by AMP-activated protein kinase (AMPK). Metformin, a drug in wide clinical use, is a pharmacological activator of AMPK. We find that metformin stimulates AMPK, resulting in inhibition of both CFTR and the mTOR pathways. Metformin induces significant arrest of cystic growth in both in vitro and ex vivo models of renal cystogenesis. In addition, metformin administration produces a significant decrease in the cystic index in two mouse models of ADPKD. Our results suggest a possible role for AMPK activation in slowing renal cystogenesis as well as the potential for therapeutic application of metformin in the context of ADPKD. PMID:21262823

  15. Perivascular fat, AMP-activated protein kinase and vascular diseases

    PubMed Central

    Almabrouk, T A M; Ewart, M A; Salt, I P; Kennedy, S

    2014-01-01

    Perivascular adipose tissue (PVAT) is an active endocrine and paracrine organ that modulates vascular function, with implications for the pathophysiology of cardiovascular disease (CVD). Adipocytes and stromal cells contained within PVAT produce mediators (adipokines, cytokines, reactive oxygen species and gaseous compounds) with a range of paracrine effects modulating vascular smooth muscle cell contraction, proliferation and migration. However, the modulatory effect of PVAT on the vascular system in diseases, such as obesity, hypertension and atherosclerosis, remains poorly characterized. AMP-activated protein kinase (AMPK) regulates adipocyte metabolism, adipose biology and vascular function, and hence may be a potential therapeutic target for metabolic disorders such as type 2 diabetes mellitus (T2DM) and the vascular complications associated with obesity and T2DM. The role of AMPK in PVAT or the actions of PVAT have yet to be established, however. Activation of AMPK by pharmacological agents, such as metformin and thiazolidinediones, may modulate the activity of PVAT surrounding blood vessels and thereby contribute to their beneficial effect in cardiometabolic diseases. This review will provide a current perspective on how PVAT may influence vascular function via AMPK. We will also attempt to demonstrate how modulating AMPK activity using pharmacological agents could be exploited therapeutically to treat cardiometabolic diseases. PMID:24490856

  16. Energy pulse bonding

    NASA Technical Reports Server (NTRS)

    Smith, G. C.

    1972-01-01

    To eliminate many of the present termination problems a technique called energy pulse bonding (EPB) was developed. The process demonstrated the capability of: (1) joining conductors without prior removal of insulations, (2) joining conductors without danger of brittle intermetallics, (3) increased joint temperature capability, (4) simultaneous formation of several bonds, (5) capability of higher joint density, and (6) a production oriented process. The following metals were successfully bonded in the solid state: copper, beryllium copper, phosphor bronze, aluminum, brass, and Kovar.

  17. International magnetic pulse compression

    SciTech Connect

    Kirbie, H.C.; Newton, M.A.; Siemens, P.D.

    1991-04-01

    Although pulsed-power engineering traditionally has been practiced by a fairly small, close community in the areas of defense and energy research, it is becoming more common in high-power, high-energy commercial pursuits such as material processing and lasers. This paper is a synopsis of the Feb. 12--14, 1990 workshop on magnetic switching as it applies primarily to pulse compression (power transformation). During the course of the Workshop at Granlibakken, a great deal of information was amassed and a keen insight into both the problems and opportunities as to the use of this switching approach was developed. The segmented workshop format proved ideal for identifying key aspects affecting optimum performance in a variety of applications. Individual groups of experts addressed network and system modeling, magnetic materials, power conditioning, core cooling and dielectrics, and finally circuits and application. At the end, they came together to consolidate their input and formulate the workshop's conclusions, identifying roadblocks or suggesting research projects, particularly as they apply to magnetic switching's trump card -- its high-average-power-handling capability (at least on a burst-mode basis). The workshop was especially productive both in the quality and quantity of information transfer in an environment conducive to a free and open exchange of ideas. We will not delve into the organization proper of this meeting, rather we wish to commend to the interested reader this volume, which provides the definitive and most up-to-date compilation on the subject of magnetic pulse compression from underlying principles to current state of the art as well as the prognosis for the future of magnetic pulse compression as a consensus of the workshop's organizers and participants.

  18. Pulsed laser microtomograph

    NASA Astrophysics Data System (ADS)

    Antonov, V. B.; Bonch-Bruevich, A. M.; Vasil'Ev, V. I.; Ionov, L. N.; Nikolaev, S. D.; Starobogatov, I. O.

    1994-12-01

    This paper describes a pulsed laser tomographic apparatus that has been implemented in practice and has a spatial resolution of 2-5 microns in the transverse direction and approximately 70 microns in the probe-radiation propagation direction. Experiments have been performed with model objects. Results have been obtained that confirm the possibility of early diagnosis of skin mycoses that cannot be diagnosed by existing methods.

  19. International magnetic pulse compression

    NASA Astrophysics Data System (ADS)

    Kirbie, H. C.; Newton, M. A.; Siemens, P. D.

    1991-04-01

    Although pulsed-power engineering traditionally has been practiced by a fairly small, close community in the areas of defense and energy research, it is becoming more common in high-power, high-energy commercial pursuits such as material processing and lasers. This paper is a synopsis of the Feb. 12-14, 1990 workshop on magnetic switching as it applies primarily to pulse compression (power transformation). During the course of the Workshop at Granlibakken, a great deal of information was amassed and a keen insight into both the problems and opportunities as to the use of this switching approach was developed. The segmented workshop format proved ideal for identifying key aspects affecting optimum performance in a variety of applications. Individual groups of experts addressed network and system modeling, magnetic materials, power conditioning, core cooling and dielectrics, and finally circuits and application. At the end, they came together to consolidate their input and formulate the workshop's conclusions, identifying roadblocks or suggesting research projects, particularly as they apply to magnetic switching's trump card - its high-average-power-handling capability (at least on a burst-mode basis). The workshop was especially productive both in the quality and quantity of information transfer in an environment conducive to a free and open exchange of ideas. We will not delve into the organization proper of this meeting, rather we wish to commend to the interested reader this volume, which provides the definitive and most up-to-date compilation on the subject of magnetic pulse compression from underlying principles to current state of the art as well as the prognosis for the future of magnetic pulse compression as a consensus of the workshop's organizers and participants.

  20. Downhole pulse radar

    DOEpatents

    Chang, Hsi-Tien

    1989-01-01

    A borehole logging tool generates a fast rise-time, short duration, high peak-power radar pulse having broad energy distribution between 30 MHz and 300 MHz through a directional transmitting and receiving antennas having barium titanate in the electromagnetically active region to reduce the wavelength to within an order of magnitude of the diameter of the antenna. Radar returns from geological discontinuities are sampled for transmission uphole.

  1. Downhole pulse radar

    DOEpatents

    Chang, Hsi-Tien

    1987-09-28

    A borehole logging tool generates a fast rise-time, short duration, high peak-power radar pulse having broad energy distribution between 30 MHz and 300 MHz through a directional transmitting and receiving antennas having barium titanate in the electromagnetically active region to reduce the wavelength to within an order of magnitude of the diameter of the antenna. Radar returns from geological discontinuities are sampled for transmission uphole. 7 figs.

  2. Pulse Portraiture: Pulsar timing

    NASA Astrophysics Data System (ADS)

    Pennucci, Timothy T.; Demorest, Paul B.; Ransom, Scott M.

    2016-06-01

    Pulse Portraiture is a wideband pulsar timing code written in python. It uses an extension of the FFTFIT algorithm (Taylor 1992) to simultaneously measure a phase (TOA) and dispersion measure (DM). The code includes a Gaussian-component-based portrait modeling routine. The code uses the python interface to the pulsar data analysis package PSRCHIVE (ascl:1105.014) and also requires the non-linear least-squares minimization package lmfit (ascl:1606.014).

  3. Pulsed gas laser

    DOEpatents

    Anderson, Louis W.; Fitzsimmons, William A.

    1978-01-01

    A pulsed gas laser is constituted by Blumlein circuits wherein space metal plates function both as capacitors and transmission lines coupling high frequency oscillations to a gas filled laser tube. The tube itself is formed by spaced metal side walls which function as connections to the electrodes to provide for a high frequency, high voltage discharge in the tube to cause the gas to lase. Also shown is a spark gap switch having structural features permitting a long life.

  4. Activation of Exchange Protein Activated by Cyclic-AMP Enhances Long-Lasting Synaptic Potentiation in the Hippocampus

    ERIC Educational Resources Information Center

    Gelinas, Jennifer N.; Banko, Jessica L.; Peters, Melinda M.; Klann, Eric; Weeber, Edwin J.; Nguyen, Peter V.

    2008-01-01

    cAMP is a critical second messenger implicated in synaptic plasticity and memory in the mammalian brain. Substantial evidence links increases in intracellular cAMP to activation of cAMP-dependent protein kinase (PKA) and subsequent phosphorylation of downstream effectors (transcription factors, receptors, protein kinases) necessary for long-term…

  5. Rethinking the roles of CRP, cAMP, and sugar-mediated global regulation in the Vibrionaceae.

    PubMed

    Colton, Deanna M; Stabb, Eric V

    2016-02-01

    Many proteobacteria modulate a suite of catabolic genes using the second messenger cyclic 3', 5'-AMP (cAMP) and the cAMP receptor protein (CRP). Together, the cAMP-CRP complex regulates target promoters, usually by activating transcription. In the canonical model, the phosphotransferase system (PTS), and in particular the EIIA(Glc) component for glucose uptake, provides a mechanistic link that modulates cAMP levels depending on glucose availability, resulting in more cAMP and activation of alternative catabolic pathways when glucose is unavailable. Within the Vibrionaceae, cAMP-CRP appears to play the classical role in modulating metabolic pathways; however, it also controls functions involved in natural competence, bioluminescence, pheromone signaling, and colonization of animal hosts. For this group of marine bacteria, chitin is an ecologically relevant resource, and chitin's monomeric sugar N-acetylglucosamine (NAG) supports robust growth while also triggering regulatory responses. Recent studies with Vibrio fischeri indicate that NAG and glucose uptake share EIIA(Glc), yet the responses of cAMP-CRP to these two carbon sources are starkly different. Moreover, control of cAMP levels appears to be more dominantly controlled by export and degradation. Perhaps more surprisingly, although CRP may require cAMP, its activity can be controlled in response to glucose by a mechanism independent of cAMP levels. Future studies in this area promise to shed new light on the role of cAMP and CRP. PMID:26215147

  6. STIRAP with XFEL pulses

    NASA Astrophysics Data System (ADS)

    Picon, Antonio; Southworth, Stephen

    2015-05-01

    The development of the laser in the optical-IR regime stimulated completely new schemes for controlling quantum systems by resorting to the coherence of the light-matter interaction. Along this line, it is interesting to explore these schemes or new ones in the x-ray regime, especially with the advent of x-ray free-electron lasers (XFELs) which deliver spatio-temporal coherent pulses in the femtosecond timescale. The new factor in the x-ray regime with respect to the optical regime is the unavoidable creation and ultrafast decay of core-excited states driven by strong electron correlations that one needs to consider. Hence, X-Ray Quantum Optics opens an interesting field in order to explore strongly correlated systems driven by x-ray pulses, and definitely it will play a crucial role in the development of characterization methods for x-ray pulses at XFELs. Here, we propose a theoretical scheme for STIRAP (Stimulated Raman Adiabatic Passage) in Ne gas for the soft x-ray regime. Experimental feasibility will be discussed. This work is funded by the Office of Basic Energy Sciences, Office of Science, U.S. Department of Energy, under Contract No. DE-AC02-06CH11357.

  7. Pulsed thermionic converter study

    NASA Technical Reports Server (NTRS)

    1976-01-01

    A nuclear electric propulsion concept using a thermionic reactor inductively coupled to a magnetoplasmadynamic accelerator (MPD arc jet) is described, and the results of preliminary analyses are presented. In this system, the MPD thruster operates intermittently at higher voltages and power levels than the thermionic generating unit. A typical thrust pulse from the MPD arc jet is characterized by power levels of 1 to 4 MWe, a duration of 1 msec, and a duty cycle of approximately 20%. The thermionic generating unit operates continuously but with a lower power level of approximately 0.4 MWe. Energy storage between thrust pulses is provided by building up a large current in an inductor using the output of the thermionic converter array. Periodically, the charging current is interrupted, and the energy stored in the magnetic field of the inductor is utilized for a short duration thrust pulse. The results of the preliminary analysis show that a coupling effectiveness of approximately 85 to 90% is feasible for a nominal 400 KWe system with an inductive unit suitable for a flight vehicle.

  8. A cardiac mitochondrial cAMP signaling pathway regulates calcium accumulation, permeability transition and cell death

    PubMed Central

    Wang, Z; Liu, D; Varin, A; Nicolas, V; Courilleau, D; Mateo, P; Caubere, C; Rouet, P; Gomez, A-M; Vandecasteele, G; Fischmeister, R; Brenner, C

    2016-01-01

    Although cardiac cytosolic cyclic 3′,5′-adenosine monophosphate (cAMP) regulates multiple processes, such as beating, contractility, metabolism and apoptosis, little is known yet on the role of this second messenger within cardiac mitochondria. Using cellular and subcellular approaches, we demonstrate here the local expression of several actors of cAMP signaling within cardiac mitochondria, namely a truncated form of soluble AC (sACt) and the exchange protein directly activated by cAMP 1 (Epac1), and show a protective role for sACt against cell death, apoptosis as well as necrosis in primary cardiomyocytes. Upon stimulation with bicarbonate (HCO3−) and Ca2+, sACt produces cAMP, which in turn stimulates oxygen consumption, increases the mitochondrial membrane potential (ΔΨm) and ATP production. cAMP is rate limiting for matrix Ca2+ entry via Epac1 and the mitochondrial calcium uniporter and, as a consequence, prevents mitochondrial permeability transition (MPT). The mitochondrial cAMP effects involve neither protein kinase A, Epac2 nor the mitochondrial Na+/Ca2+ exchanger. In addition, in mitochondria isolated from failing rat hearts, stimulation of the mitochondrial cAMP pathway by HCO3− rescued the sensitization of mitochondria to Ca2+-induced MPT. Thus, our study identifies a link between mitochondrial cAMP, mitochondrial metabolism and cell death in the heart, which is independent of cytosolic cAMP signaling. Our results might have implications for therapeutic prevention of cell death in cardiac pathologies. PMID:27100892

  9. Characteristic analysis of the ampC gene encoding beta-lactamase from Photobacterium phosphoreum.

    PubMed

    Lin, Juey-Wen; Weng, Shu-Fen; Chao, Yuh-Fen; Chung, Yi-Ting

    2005-01-21

    The ampC gene of Photobacterium phosphoreum ATCC 11040 was cloned and identified. Nucleotide sequence of the regulatory region R&R and the ampC gene (GenBank Accession No. AY787792) from P. phosphoreum has been determined, and the encoded beta-lactamase is deduced. The beta-lactamase encoded by the ampC gene has a calculated M(r) 31,198 and comprises 285 amino acid residues (pI 7.35). There is a signal peptide of 20 amino acid residues MKLRFIASTLLLSFSQLASA to lead the beta-lactamase secretion, and the cleavage site is between ASA-Q; thus, the matured protein only has M(r) 29,019 and comprises 265 amino acid residues (pI 6.21). The specific amino acid residues STFK (65th to 68th), SDN (125th to 127th), and D (158th) located 33 residues downstream from the SDN loop of the class A beta-lactamases are highly conserved, but the KTG is not found. The gene order of the ampC is <--ufo-R&R-ampC-->, the genes running in the opposite directions. Functional analysis elicits that R&R([ampC]) does function to lead to the gene expression. Primer extension assay elicits that the ampC gene's transcriptional initiation +1 is -26 C upstream of the start codon; the P([I])-promoter should be the promoter response for the gene expression. Analysis of the R&R([ampC]) elicits that the upstream activator binding sequence Sigma UAS TGTTTAAATACGCTTTGAACA is like the two-component regulator binding sequence TGT-N(8-12)-ACA. It implies that P. phosphoreum ampC gene could be under-regulated by the specific two-component regulator. PMID:15596133

  10. Phosphodiesterase inhibition by a gastroprotective agent irsogladine: preferential blockade of cAMP hydrolysis.

    PubMed

    Kyoi, Takashi; Oka, Michiko; Noda, Kumiko; Ukai, Yojiro

    2004-08-27

    The effect of irsogladine [2,4-diamino-6-(2,5-dichlorophenyl)-s-triazine maleate], an antiulcer drug, on contents of cyclic nucleotides including cAMP and cGMP was investigated in rat stomachs. Irsogladine concentration-dependently increased cAMP content in rat glandula stomach. However, irsogladine at higher concentration (10(-5) M) was unable to further increase cAMP level in the presence of non-selective phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine, although 3-isobutyl-1-methylxanthine by itself increased cAMP level. On the other hand, irsogladine had no effect on the glandula cGMP content. Subsequently, the effect of irsogladine on the cyclic nucleotide degradation by purified bovine brain and heart PDEs was investigated. The cAMP degradation by purified bovine brain PDE was partially suppressed by PDE1 inhibitor vinpocetin, PDE2 inhibitor erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride and PDE4 inhibitor rolipram but not by PDE3 inhibitor cilostamide, and completely inhibited by 3-isobutyl-1-methylxanthine, suggesting that is attributed almost exclusively to PDE1, PDE2 and PDE4. Meanwhile, cGMP degradation by purified bovine brain PDE was partially suppressed by erythro-9-(2-hydroxy-3-nonyl)adenine hydrochloride. Irsogladine preferentially inhibited the response to cAMP degradation compared with cGMP degradation by this brain PDE. The cAMP degradation by bovine heart PDE was almost completely inhibited by the combination with vinpocetine and cilostamide, indicating that is mediated almost exclusively by PDE1 and PDE3. Irsogladine suppressed this cAMP degradation measured in the presence of vinpocetine to almost the same extent as that determined in the presence of cilostamide. These results indicate that irsogladine produces the increase of intracellular cAMP content via non-selective inhibition of PDE isozymes, which may be a key mechanism involved in its gastroprotective actions. PMID:15302227

  11. cAMP controls rod photoreceptor sensitivity via multiple targets in the phototransduction cascade

    PubMed Central

    Astakhova, Luba A.; Samoiliuk, Evgeniia V.; Govardovskii, Victor I.

    2012-01-01

    In early studies, both cyclic AMP (cAMP) and cGMP were considered as potential secondary messengers regulating the conductivity of the vertebrate photoreceptor plasma membrane. Later discovery of the cGMP specificity of cyclic nucleotide–gated channels has shifted attention to cGMP as the only secondary messenger in the phototransduction cascade, and cAMP is not considered in modern schemes of phototransduction. Here, we report evidence that cAMP may also be involved in regulation of the phototransduction cascade. Using a suction pipette technique, we recorded light responses of isolated solitary rods from the frog retina in normal solution and in the medium containing 2 µM of adenylate cyclase activator forskolin. Under forskolin action, flash sensitivity rose more than twofold because of a retarded photoresponse turn-off. The same concentration of forskolin lead to a 2.5-fold increase in the rod outer segment cAMP, which is close to earlier reported natural day/night cAMP variations. Detailed analysis of cAMP action on the phototransduction cascade suggests that several targets are affected by cAMP increase: (a) basal dark phosphodiesterase (PDE) activity decreases; (b) at the same intensity of light background, steady background-induced PDE activity increases; (c) at light backgrounds, guanylate cyclase activity at a given fraction of open channels is reduced; and (d) the magnitude of the Ca2+ exchanger current rises 1.6-fold, which would correspond to a 1.6-fold elevation of [Ca2+]in. Analysis by a complete model of rod phototransduction suggests that an increase of [Ca2+]in might also explain effects (b) and (c). The mechanism(s) by which cAMP could regulate [Ca2+]in and PDE basal activity is unclear. We suggest that these regulations may have adaptive significance and improve the performance of the visual system when it switches between day and night light conditions. PMID:23008435

  12. Long-range signaling in growing neurons after local elevation of cyclic AMP-dependent activity

    PubMed Central

    1994-01-01

    Cyclic AMP-dependent activity at the growth cone or the soma of cultured Xenopus spinal neurons was elevated by local extracellular perfusion of the neuron with culture medium containing 8-bromoadenosine 3',5'-cyclic monophosphate (8-br-cAMP) or forskolin. During local perfusion of one of the growth cones of multipolar neurons with these drugs, the perfused growth cone showed further extension, while the distant, unperfused growth cones were inhibited in their growth. Local perfusion of the growth cone with culture medium or local perfusion with 8-br-cAMP at a cell-free region 100 microns away from the growth cone did not produce any effect on the extension of the growth cone. Reduced extension of all growth cones was observed when the perfusion with 8-br-cAMP was restricted to the soma. The distant inhibitory effect does not depend on the growth of the perfused growth cone since local coperfusion of the growth cone with 8-br-cAMP and colchicine inhibited growth on both perfused and unperfused growth cones, while local perfusion with colchicine alone inhibited only the perfused growth cone. The distant inhibitory effect was abolished when the perfusion of 8-br-cAMP was carried out together with kinase inhibitor H- 8, suggesting the involvement of cAMP-dependent protein kinase and/or its downstream factors in the long-range inhibitory signaling. Uniform exposure of the entire neuron to bath-applied 8-br-cAMP, however, led to enhanced growth activity at all growth cones. Thus, local elevation of cAMP-dependent activity produces long-range and opposite effects on distant parts of the neuron, and a cytosolic gradient of second messengers may produce effects distinctly different from those following uniform global elevation of the messenger, leading to differential growth regulation at different regions of the same neuron. PMID:7798321

  13. Influence of cAMP and protein kinase A on neurite length from spiral ganglion neurons

    PubMed Central

    Xu, Ningyong; Engbers, Jonathan; Khaja, Sobia; Xu, Linjing; Clark, J. Jason; Hansen, Marlan R.

    2011-01-01

    Regrowth of peripheral spiral ganglion neuron (SGN) fibers is a primary objective in efforts to improve cochlear implant outcomes and to potentially reinnervate regenerated hair cells. Cyclic adenosine monophosphate (cAMP) regulates neurite growth and guidance via activation of protein kinase A (PKA) and Exchange Protein directly Activated by Cylic AMP (Epac). Here we explored the effects of cAMP signaling on SGN neurite length in vitro. We find that the cAMP analog, cpt-cAMP, exerts a biphasic effect on neurite length; increasing length at lower concentrations and reducing length at higher concentrations. This biphasic response occurs in cultures plated on laminin, fibronectin, or tenascin C suggesting that it is not substrate dependent. cpt-cAMP also reduces SGN neurite branching. The Epac-specific agonist, 8-pCPT-2’-O-Me-cAMP, does not alter SGN neurite length. Constitutively active PKA isoforms strongly inhibit SGN neurite length similar to higher levels of cAMP. Chronic membrane depolarization activates PKA in SGNs and also inhibits SGN neurite length. However, inhibition of PKA fails to rescue neurite length in depolarized cultures implying that activation of PKA is not necessary for the inhibition of SGN neurite length by chronic depolarization. Expression of constitutively active phosphatidylinositol 3-kinase, but not c-Jun N-terminal kinase, isoforms partially rescues SGN neurite length in the presence of activated PKA. Taken together, these results suggest that activation of cAMP/PKA represents a potential strategy to enhance SGN fiber elongation following deafness; however such therapies will likely require careful titration so as to simultaneously promote rather than inhibit nerve fiber regeneration. PMID:22154930

  14. MULTICHANNEL PULSE-HEIGHT ANALYZER

    DOEpatents

    Russell, J.T.; Lefevre, H.W.

    1958-01-21

    This patent deals with electronic computing circuits and more particularly to pulse-height analyzers used for classifying variable amplitude pulses into groups of different amplitudes. The device accomplishes this pulse allocation by by converting the pulses into frequencies corresponding to the amplitudes of the pulses, which frequencies are filtered in channels individually pretuned to a particular frequency and then detected and recorded in the responsive channel. This circuit substantially overcomes the disadvantages of prior annlyzers incorporating discriminators pre-set to respond to certain voltage levels, since small variation in component values is not as critical to satisfactory circuit operation.

  15. Petawatt pulsed-power accelerator

    DOEpatents

    Stygar, William A.; Cuneo, Michael E.; Headley, Daniel I.; Ives, Harry C.; Ives, legal representative; Berry Cottrell; Leeper, Ramon J.; Mazarakis, Michael G.; Olson, Craig L.; Porter, John L.; Wagoner; Tim C.

    2010-03-16

    A petawatt pulsed-power accelerator can be driven by various types of electrical-pulse generators, including conventional Marx generators and linear-transformer drivers. The pulsed-power accelerator can be configured to drive an electrical load from one- or two-sides. Various types of loads can be driven; for example, the accelerator can be used to drive a high-current z-pinch load. When driven by slow-pulse generators (e.g., conventional Marx generators), the accelerator comprises an oil section comprising at least one pulse-generator level having a plurality of pulse generators; a water section comprising a pulse-forming circuit for each pulse generator and a level of monolithic triplate radial-transmission-line impedance transformers, that have variable impedance profiles, for each pulse-generator level; and a vacuum section comprising triplate magnetically insulated transmission lines that feed an electrical load. When driven by LTD generators or other fast-pulse generators, the need for the pulse-forming circuits in the water section can be eliminated.

  16. Band-selective radiofrequency pulses

    NASA Astrophysics Data System (ADS)

    Geen, Helen; Freeman, Ray

    A theoretical treatment is given of the general problem of designing amplitude-modulated radiofrequency pulses that will excite a specified band of frequencies within a high-resolution NMR spectrum with uniform intensity and phase but with negligible excitation elsewhere. First a trial pulse envelope is defined in terms of a finite Fourier series and its frequency-domain profile calculated through the Bloch equations. The result is compared with the desired target profile to give a multidimensional error surface. The method of simulated annealing is then used to find the global minimum on this surface and the result refined by standard gradient-descent optimization. In this manner, a family of new shaped radio-frequency pulses, known as BURP ( band-selective, uniform response, pure-phase) pulses, has been created. These are of two classes—pulses that excite or invert z magnetization and those that act as general-rotation πr/2 or π pulses irrespective of the initial condition of the nuclear magnetization. It was found convenient to design the latter class as amplitude-modulated time-symmetric pulses. Tables of Fourier coefficients and pulse-shape ordinates are given for practical implementation of BURP pulses, together with the calculated frequency-domain responses and experimental verifications. Examples of the application of band-selective pulses in conventional and multidimensional spectroscopy are given. Pure-phase pulses of this type should also find applications in magnetic resonance imaging where refocusing schemes are undesirable.

  17. Analysis of Advanced Modular Power Systems (AMPS) for Deep Space Exploration

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard; Soeder, James F.; Beach, Ray

    2014-01-01

    The Advanced Modular Power Systems (AMPS) project is developing a modular approach to spacecraft power systems for exploration beyond Earth orbit. AMPS is intended to meet the need of reducing the cost of design development, test and integration and also reducing the operational logistics cost of supporting exploration missions. AMPS seeks to establish modular power building blocks with standardized electrical, mechanical, thermal and data interfaces that can be applied across multiple exploration vehicles. The presentation discusses the results of a cost analysis that compares the cost of the modular approach against a traditional non-modular approach.

  18. Compartmentation of cAMP signalling in cardiomyocytes in health and disease.

    PubMed

    Perera, R K; Nikolaev, V O

    2013-04-01

    3',5'-cyclic adenosine monophosphate (cAMP) is a ubiquitous second messenger critically involved in the regulation of heart function. It has been shown to act in discrete subcellular signalling compartments formed by differentially localized receptors, phosphodiesterases and protein kinases. Cardiac diseases such as hypertrophy or heart failure are associated with structural and functional remodelling of these microdomains which leads to changes in cAMP compartmentation. In this review, we will discuss recent key findings which provided new insights into cAMP compartmentation in cardiomyocytes with a particular focus on its alterations in heart disease. PMID:23383621

  19. Cyclic AMP induces maturation of trout sperm axoneme to initiate motility

    NASA Astrophysics Data System (ADS)

    Morisawa, Masaaki

    1982-02-01

    Cyclic AMP has long been implicated as an activator of sperm motility1-5. From more recent experiments using demembranated mammalian and sea urchin spermatozoa6,7, it was concluded that cyclic AMP only increases the motility of the axoneme after it has been initiated by MgATP2-. We have now carried out similar experiments using spermatozoa collected from the rainbow trout and demembranated by treatment with the detergent Triton X-100. Our results suggest that in this species, cyclic AMP is required before MgATP2- to trigger maturation of the nonmotile axoneme. Subsequent addition of an energy source then induces motility.

  20. The cAMP Pathway as Therapeutic Target in Autoimmune and Inflammatory Diseases

    PubMed Central

    Raker, Verena Katharina; Becker, Christian; Steinbrink, Kerstin

    2016-01-01

    Nucleotide signaling molecules contribute to the regulation of cellular pathways. In the immune system, cyclic adenosine monophosphate (cAMP) is well established as a potent regulator of innate and adaptive immune cell functions. Therapeutic strategies to interrupt or enhance cAMP generation or effects have immunoregulatory potential in autoimmune and inflammatory disorders. Here, we provide an overview of the cyclic AMP axis and its role as a regulator of immune functions and discuss the clinical and translational relevance of interventions with these processes. PMID:27065076

  1. Phase A conceptual design study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload

    NASA Technical Reports Server (NTRS)

    1974-01-01

    The 12 month Phase A Conceptual Design Study of the Atmospheric, Magnetospheric and Plasmas in Space (AMPS) payload performed within the Program Development Directorate of the Marshall Space Flight Center is presented. The AMPS payload makes use of the Spacelab pressurized module and pallet, is launched by the space shuttle, and will have initial flight durations of 7 days. Scientific instruments including particle accelerators, high power transmitters, optical instruments, and chemical release devices are mounted externally on the Spacelab pallet and are controlled by the experimenters from within the pressurized module. The capability of real-time scientist interaction on-orbit with the experiment is a major characteristic of AMPS.

  2. Pulsed power packs a punch

    NASA Astrophysics Data System (ADS)

    Weldon, W. F.

    1985-03-01

    Utilities supply electric power routinely in a continuous flow, while in certain cases power must be delivered in short, huge bursts, taking into account applications such as thermonuclear-fusion research, high-energy particle accelerators, lasers, and electromagnetic launchers. For the delivery of this 'pulsed power', it is necessary to collect energy at low power, store it, and release it almost instantaneously. During the last decade, pulsed-power technology has become a recognized engineering discipline. Pulsed-power systems can now deliver gigajoules of energy, megamperes of current, or terawatts of power, while pulse widths range from microseconds to several seconds. Attention is given to capacitors as one of the oldest storage devices for electric energy, inductors, the linking of capacitors and inductors, pulse creation, the use of explosives to generate pulsed power, limitations regarding the effectiveness of batteries, low-cost energy storage provided by flywheels, dc machines, ac machines, and new applications for pulsed power.

  3. Laser beam pulse formatting method

    DOEpatents

    Daly, Thomas P.; Moses, Edward I.; Patterson, Ralph W.; Sawicki, Richard H.

    1994-01-01

    A method for formatting a laser beam pulse (20) using one or more delay loops (10). The delay loops (10) have a partially reflective beam splitter (12) and a plurality of highly reflective mirrors (14) arranged such that the laser beam pulse (20) enters into the delay loop (10) through the beam splitter (12) and circulates therein along a delay loop length (24) defined by the mirrors (14). As the laser beam pulse (20) circulates within the delay loop (10) a portion thereof is emitted upon each completed circuit when the laser beam pulse (20) strikes the beam splitter (12). The laser beam pulse (20) is thereby formatted into a plurality of sub-pulses (50, 52, 54 and 56). The delay loops (10) are used in combination to produce complex waveforms by combining the sub-pulses (50, 52, 54 and 56) using additive waveform synthesis.

  4. Laser beam pulse formatting method

    DOEpatents

    Daly, T.P.; Moses, E.I.; Patterson, R.W.; Sawicki, R.H.

    1994-08-09

    A method for formatting a laser beam pulse using one or more delay loops is disclosed. The delay loops have a partially reflective beam splitter and a plurality of highly reflective mirrors arranged such that the laser beam pulse enters into the delay loop through the beam splitter and circulates therein along a delay loop length defined by the mirrors. As the laser beam pulse circulates within the delay loop a portion thereof is emitted upon each completed circuit when the laser beam pulse strikes the beam splitter. The laser beam pulse is thereby formatted into a plurality of sub-pulses. The delay loops are used in combination to produce complex waveforms by combining the sub-pulses using additive waveform synthesis. 8 figs.

  5. Quarter-wave pulse tube

    NASA Astrophysics Data System (ADS)

    Swift, G. W.; Gardner, D. L.; Backhaus, S. N.

    2011-10-01

    In high-power pulse-tube refrigerators, the pulse tube itself can be very long without too much dissipation of acoustic power on its walls. The pressure amplitude, the volume-flow-rate amplitude, and the time phase between them evolve significantly along a pulse tube that is about a quarter-wavelength long. Proper choice of length and area makes the oscillations at the ambient end of the long pulse tube optimal for driving a second, smaller pulse-tube refrigerator, thereby utilizing the acoustic power that would typically have been dissipated in the first pulse-tube refrigerator's orifice. Experiments show that little heat is carried from the ambient heat exchanger to the cold heat exchanger in such a long pulse tube, even though the oscillations are turbulent and even when the tube is compactly coiled.

  6. High-speed pulse-shape generator, pulse multiplexer

    DOEpatents

    Burkhart, Scott C.

    2002-01-01

    The invention combines arbitrary amplitude high-speed pulses for precision pulse shaping for the National Ignition Facility (NIF). The circuitry combines arbitrary height pulses which are generated by replicating scaled versions of a trigger pulse and summing them delayed in time on a pulse line. The combined electrical pulses are connected to an electro-optic modulator which modulates a laser beam. The circuit can also be adapted to combine multiple channels of high speed data into a single train of electrical pulses which generates the optical pulses for very high speed optical communication. The invention has application in laser pulse shaping for inertial confinement fusion, in optical data links for computers, telecommunications, and in laser pulse shaping for atomic excitation studies. The invention can be used to effect at least a 10.times. increase in all fiber communication lines. It allows a greatly increased data transfer rate between high-performance computers. The invention is inexpensive enough to bring high-speed video and data services to homes through a super modem.

  7. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. PMID:27137358

  8. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  9. Activation of f-channels by cAMP analogues in macropatches from rabbit sino-atrial node myocytes.

    PubMed Central

    Bois, P; Renaudon, B; Baruscotti, M; Lenfant, J; DiFrancesco, D

    1997-01-01

    1. The action of the two diastereometric phosphorothioate derivatives of cAMP, Rp-cAMPs and Sp-cAMPs, was investigated on hyperpolarization-activated 'pacemaker' current (i(f)) recorded in inside-out macropatches from rabbit sino-atrial (SA) node myocytes. 2. When superfused on the intracellular side of f-channels at the concentration of 10 microM, both cAMP derivatives accelerated i(f) activation; their action was moderately less pronounced than that due to the same concentration of cAMP. 3. The measurement of the i(f) conductance-voltage relation by voltage ramp protocols indicated that both cAMP analogues shift the activation curve of i(f) to more positive voltages with no change in maximal (fully activated) conductance. 4. Dose-response relationships of the shift of the i(f) activation curve showed that both Rp-cAMPs and Sp-cAMPs act as agonists in the cAMP-dependent direct f-channel activation. Fitting data to the Hill equation resulted in maximal shifts of 9.6 and 9.5 mV, apparent dissociation constants of 0.82 and 5.4 microM, and Hill coefficients of 0.82 and 1.12 for Sp-cAMPs and Rp-cAMPs, respectively. 5. The activating action of Rp-cAMPs, a known antagonist of cAMP in the activation of cAMP-dependent protein kinase, confirms previously established evidence that f-channel activation does not involve phosphorylation. These results also suggest that the cAMP binding site of f-channels may be structurally similar to the cyclic nucleotide binding site of olfactory receptor channels. PMID:9218217

  10. Coiled transmission line pulse generators

    DOEpatents

    McDonald, Kenneth Fox

    2010-11-09

    Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

  11. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, technical summary document

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    Some 60 instrument candidates and 80 possible science investigations were evaluated. The early analysis emphasized the science aspect in terms of the functional requirements for each of the potential experiments identified by the AMPS science working group. These requirements were then used for the grouping of instruments into practical payloads which would fit the capabilities of the Shuttle/Spacelab. This analysis resulted in the definition of eleven different AMPS configurations. The data were then used to define a typical set of requirements for a flexible AMPS laboratory. The data gathered to this point showed that a planned sequential buildup of the laboratory would be necessary to meet both physical and funding limitations. This led to the definition of five strawman payloads by the science working group, which were used to establish a conceptual laboratory and to define preliminary design of a configuration which could satisfy AMPS needs during the early program period.

  12. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  13. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  14. DOE/NEAMS AMP CAMP I 2010 - multi species transport in metal fuels

    SciTech Connect

    Dilts, Gary A

    2011-01-21

    Essential aspects from the literature of metal nuclear fuel alloys and modeling the transport of constituents therein are discussed. The essential mathematical problem is described along with relevant issues for implementation of solution algorithms in the AMP nuclear fuel code.

  15. c-di-AMP recognition by Staphylococcus aureus PstA.

    PubMed

    Müller, Martina; Hopfner, Karl-Peter; Witte, Gregor

    2015-01-01

    Cyclic-di-AMP (c-di-AMP) is a bacterial secondary messenger involved in various processes, including sensing of DNA-integrity, cell wall metabolism and potassium transport. A number of c-di-AMP receptor proteins have recently been identified in Staphylococcus aureus. One of them - PstA - possesses a ferredoxin-like fold and is structurally related to the class of PII signal-transduction proteins. PII proteins are involved in a large number of pathways, most of them associated with nitrogen metabolism. In this study we describe the mode of c-di-AMP binding and subsequent structural changes of S. aureus PstA. An altered architecture in PstA compared to canonical PII proteins results in differences in ligand coordination. PMID:25435171

  16. Is a decrease in cyclic AMP a necessary and sufficient signal for maturation of amphibian oocytes

    SciTech Connect

    Gelerstein, S.; Shapira, H.; Dascal, N.; Yekuel, R.; Oron, Y.

    1988-05-01

    Acetylcholine rapidly lowered the intracellular levels of cyclic AMP in stage 5 and 6 Xenopus laevis oocytes. Acetylcholine alone did not induce oocyte maturation, though it did accelerate maturation induced by progesterone. The effect of acetylcholine on oocyte maturation was independent of extracellular calcium concentration. Adenosine increased cyclic AMP and abolished the progesterone-induced decrease in cyclic AMP levels in follicles and in denuded oocytes. This effect of adenosine was blocked by the Ra purinergic receptor antagonist, theophylline. Despite those effects, adenosine alone induced maturation in stage 6 oocytes and accelerated progesterone-induced maturation in both stage 5 and 6 cells. Adenosine also induced a significant increase in the rate of /sup 45/Ca efflux from oocytes in the presence and the absence of external calcium. We suggest that the activation of cell surface receptors involved in the release of calcium from cellular stores may induce or accelerate oocyte maturation independently of small changes in intracellular cyclic AMP concentration.

  17. A new traveling wave phenomenon of Dictyostelium in the presence of cAMP

    NASA Astrophysics Data System (ADS)

    Ševčíková, Hana; Čejková, Jitka; Krausová, Lenka; Přibyl, Michal; Štěpánek, František; Marek, Miloš

    2010-06-01

    The emergence of wave patterns in chemical and biological systems is of interest for the understanding of development, differentiation, signaling, and other phenomena. In this work we report a new type of wave pattern - called the “global wave” - which was observed in populations of Dictyostelium discoideum cells exposed to an excess of cyclic adenosine- 3‧, 5‧- monophosphate (cAMP) added to the supporting agar. It has been found that the addition of different amounts of cAMP to the agar leads to important deviations from the standard course of aggregation: (i) the formation and propagation of a global wave that has not been observed before; (ii) the delayed onset or absence of cAMP waves patterning; (iii) an atypical mechanism of cells clustering; and (iv) a faster or incomplete developmental cycle. We suggest that the global wave is a chemotactic response of the Dictyostelium cells to a wave of the cAMP concentration.

  18. Atmospheric, Magnetospheric, and Plasmas in Space (AMPS) spacelab payload definition study, appendixes

    NASA Technical Reports Server (NTRS)

    Keeley, J. T.

    1976-01-01

    An equipment list, instrument baseline data, engineering drawings, mass properties computer printouts, electrical energy management, and control and display functional analysis pertinent to the AMPS (Satellite Payload) are presented.

  19. AMP: a science-driven web-based application for the TeraGrid

    NASA Astrophysics Data System (ADS)

    Woitaszek, M.; Metcalfe, T.; Shorrock, I.

    The Asteroseismic Modeling Portal (AMP) provides a web-based interface for astronomers to run and view simulations that derive the properties of Sun-like stars from observations of their pulsation frequencies. In this paper, we describe the architecture and implementation of AMP, highlighting the lightweight design principles and tools used to produce a functional fully-custom web-based science application in less than a year. Targeted as a TeraGrid science gateway, AMP's architecture and implementation are intended to simplify its orchestration of TeraGrid computational resources. AMP's web-based interface was developed as a traditional standalone database-backed web application using the Python-based Django web development framework, allowing us to leverage the Django framework's capabilities while cleanly separating the user interface development from the grid interface development. We have found this combination of tools flexible and effective for rapid gateway development and deployment.

  20. Selective Phosphonylation of 5'-Adenosine Monophosphate (5'-AMP) via Pyrophosphite [PPi(III)

    NASA Astrophysics Data System (ADS)

    Kaye, Karl; Bryant, David E.; Marriott, Katie E. R.; Ohara, Shohei; Fishwick, Colin W. G.; Kee, Terence P.

    2016-05-01

    We describe here experiments which demonstrate the selective phospho-transfer from a plausibly prebiotic condensed phosphorus (P) salt, pyrophosphite [H2P2O5 2-; PPi(III)], to the phosphate group of 5'-adenosine mono phosphate (5'-AMP). We show further that this P-transfer process is accelerated both by divalent metal ions (M2+) and by organic co-factors such as acetate (AcO-). In this specific case of P-transfer from PPi(III) to 5'-AMP, we show a synergistic enhancement of transfer in the combined presence of M2+ & AcO-. Isotopic labelling studies demonstrate that hydrolysis of the phosphonylated 5'-AMP, [P(III)P(V)-5'-AMP], proceeds via nuceophilic attack of water at the Pi(III) terminus.