Sample records for radiation induces p53-independent

  1. Interferons alpha and gamma induce p53-dependent and p53-independent apoptosis, respectively.

    PubMed

    Porta, Chiara; Hadj-Slimane, Reda; Nejmeddine, Mohamed; Pampin, Mathieu; Tovey, Michael G; Espert, Lucile; Alvarez, Sandra; Chelbi-Alix, Mounira K

    2005-01-20

    Type I interferon (IFN) enhances the transcription of the tumor suppressor gene p53. To elucidate the molecular mechanism mediating IFN-induced apoptosis, we analysed programmed cell death in response to type I (IFNalpha) or type II (IFNgamma) treatment in relation to p53 status. In two cell lines (MCF-7, SKNSH), IFNalpha, but not IFNgamma, enhanced apoptosis in a p53-dependent manner. Furthermore, only IFNalpha upregulated p53 as well as p53 target genes (Noxa, Mdm2 and CD95). The apoptotic response to IFNalpha decreased in the presence of ZB4, an anti-CD95 antibody, suggesting that CD95 is involved in this process. When p53 was inactivated by the E6 viral protein or the expression of a p53 mutant, IFNalpha-induced apoptosis and p53 target genes upregulation were abrogated. Altogether these results demonstrate that p53 plays a pivotal role in the IFNalpha-induced apoptotic response. IFNalpha-induced PML was unable to recruit p53 into nuclear bodies and its downregulation by siRNA did not alter CD95 expression. In contrast, IFNgamma-induced apoptosis is p53-independent. CD95 and IFN-regulatory factor 1 (IRF1) are directly upregulated by this cytokine. Apoptotic response to IFNgamma is decreased in the presence of ZB4 and strongly diminished by IRF1 siRNA, implicating both CD95 and IRF1 in IFNgamma-induced apoptotic response. Taken together, these results show that in two different cell lines, IFNalpha and IFNgamma, induce p53-dependent -independent apoptosis, respectively.

  2. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakagawa, Yosuke; Takahashi, Akihisa; Kajihara, Atsuhisa

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggestedmore » that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling

  3. Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy

    2009-02-01

    Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glandsmore » of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.« less

  4. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    PubMed

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥ 1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤ 19%). These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a

  5. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway

    PubMed Central

    2014-01-01

    Background The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. Methods A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Results Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53mutated cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p < 0.001 and p = 0.034, respectively) and nutlin3a increased the level of p53 and p53 targets in a p53-dependent manner. Finally, we showed that a nutlin3a-induced DR5 increase (≥1.2-fold increase) was a specific and sensitive marker (p < 0.001) for a weak incidence of 17p deletion within the samples (≤19%). Conclusion These data show that RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be

  6. CDC25B and p53 are independently implicated in radiation sensitivity for human esophageal cancers.

    PubMed

    Miyata, H; Doki, Y; Shiozaki, H; Inoue, M; Yano, M; Fujiwara, Y; Yamamoto, H; Nishioka, K; Kishi, K; Monden, M

    2000-12-01

    Ionized radiation leads to G1 arrest and apoptosis by a p53-dependent pathway and G2-M arrest through a p53-independent pathway. In this study, we evaluated the role of cell cycle-regulating molecules in the sensitivity of cancer cells for radiation therapy. Forty-seven patients with squamous cell carcinomas of the esophagus had undergone radiation therapy, followed by surgical resection. They were classified as sensitive to radiation (SR, 14 cases) with no residual tumor in the surgical specimen or as resistant to radiation (RR, 33 cases) with viable residual tumors. Their preradiation biopsy samples were immunohistochemically investigated for the expressions of cell cycle-related molecules, including p53, CDC25A, CDC25B, cyclin D1, cyclin B1, and Ki-67. p53 expression was negative in 71% (10 of 14) of SR and positive in 91% (30 of 33) of RR. The association was strong between high radiation sensitivity and negative p53 expression (P < 0.0001). CDC25B, which is not expressed in normal epithelium but is in the cytoplasm of esophageal cancers, was strongly expressed (2+) in 46% (6 of 14) of SR and in 6% (2 of 23) of RR. Thus, the sensitivity for radiation therapy was significantly correlated with CDC25B overexpression. With respect to CDC25A, cyclin D1, cyclin B1, and Ki-67, no statistically significant differences were found in their expressions between SR and RR tumors. p53 and CDC25B expressions showed no significant associations, and multivariate analysis revealed that both p53 and CDC25B are significant independent markers for predicting radiation sensitivity. CDC25B was revealed to be a novel predictor of radiation sensitivity in esophageal cancers. Because CDC25B is an oncogene, which affects G2-M progression, these results suggest the importance of a p53-independent G2-M checkpoint in radiation therapy.

  7. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  8. Mitoguazone induces apoptosis via a p53-independent mechanism.

    PubMed

    Davidson, K; Petit, T; Izbicka, E; Koester, S; Von Hoff, D D

    1998-08-01

    Mitoguazone (methylglyoxal bisguanylhydrazone, methyl-GAG or MGBG) is a synthetic polycarbonyl derivative with activity in patients with Hodgkin's and non-Hodgkin's lymphoma, head and neck cancer, prostate cancer, and esophageal cancer. Mitoguazone has also recently been documented to have activity in patients with AIDS-related lymphoma. Among anticancer drugs, mitoguazone has a unique mechanism of action via interference with the polyamine biosynthetic pathway. Polyamines stabilize DNA structure by non-covalent cross-bridging between phosphate groups on opposite strands. In addition, mitoguazone causes uncoupling of oxidative phosphorylation. In this study, the ability of mitoguazone to induce apoptosis by inhibiting the polyamine pathway was assessed in three Burkitt's lymphoma cell lines (Raji, Ramos and Daudi) and one prostate carcinoma cell line (MPC 3). Additional evaluations were performed in two human breast cancer cell lines (MCF7 with wild-type p53 and VM4K with mutated p53) to determine whether the p53 tumor suppressor gene was required for efficient apoptosis induction. The present study demonstrated that mitoguazone induces apoptosis in all the different human cancer cell lines tested in a concentration- and time-dependent way, and triggers a p53-independent programmed cell death in the human breast cancer MCF7 cell line.

  9. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  10. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  11. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  12. p53 -Dependent and -Independent Nucleolar Stress Responses

    PubMed Central

    Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

    2012-01-01

    The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

  13. Nutlin-3 induces HO-1 expression by activating JNK in a transcription-independent manner of p53.

    PubMed

    Choe, Yun-Jeong; Lee, Sun-Young; Ko, Kyung Won; Shin, Seok Joon; Kim, Ho-Shik

    2014-03-01

    A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1 in a transcription-independent manner of p53. Nutlin-3 induced HO-1 expression at the level of transcription in human cancer cells such as U2OS and RKO cells. This induction of HO-1 did not occur in SAOS cells in which p53 was mutated and was prevented by knocking down the p53 protein using p53 siRNA transfection, but not by PFT-α, an inhibitor of the transcriptional activity of p53. Accompanying HO-1 expression, nutlin-3 stimulated the accumulation of ROS and the phosphorylation of MAPKs such as JNK, p38 MAPK and ERK1/2. Nutlin-3-induced HO-1 expression was suppressed by TEMPO, a ROS scavenger, and chemical inhibitors of JNK and p38 MAPK but not ERK1/2. In addition, nutlin‑3-induced phosphorylation of JNK but not p38 MAPK was inhibited by TEMPO. Notably, the levels of nutlin-3-induced ROS were correlated with the mitochondrial translocation of p53 and this induction was prevented by PFT-μ, an inhibitor of the mitochondrial translocation of p53. Consistent with the effect of the ROS scavenger and MAPK inhibitors, PFT-μ reduced HO-1 expression and the phosphorylation of JNK induced by nutlin-3. In the experiments of analyzing cell death, the knockdown of HO-1 augmented nutlin-3-induced apoptosis. Collectively, these results suggest that nutlin-3 induces HO-1 expression via the activation of both JNK which is dependent on ROS generated by p53 translocated to the mitochondria and p38 MAPK which appears to be stimulated by a ROS-independent mechanism, and this HO-1 induction may inhibit nutlin-3-induced apoptosis, constituting a negative feedback loop of p53-induced apoptosis.

  14. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wan, Chunhua; Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu; Ma, Xa

    2014-12-15

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleavedmore » PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is

  15. Etoposide radiosensitizes p53-defective cholangiocarcinoma cell lines independent of their G2 checkpoint efficacies

    PubMed Central

    Hematulin, Arunee; Meethang, Sutiwan; Utapom, Kitsana; Wongkham, Sopit; Sagan, Daniel

    2018-01-01

    Radiotherapy has been accounted as the most comprehensive cancer treatment modality over the past few decades. However, failure of this treatment modality occurs in several malignancies due to the resistance of cancer cells to radiation. It was previously reported by the present authors that defective cell cycle checkpoints could be used as biomarkers for predicting the responsiveness to radiation in individual patients with cholangiocarcinoma (CCA). However, identification of functional defective cell cycle checkpoints from cells from a patient's tissues is cumbersome and not applicable in the clinic. The present study evaluated the radiosensitization potential of etoposide in p53-defective CCA KKU-M055 and KKU-M214 cell lines. Treatment with etoposide enhanced the responsiveness of two p53-defective CCA cell lines to radiation independent of G2 checkpoint function. In addition, etoposide treatment increased radiation-induced cell death without altering the dominant mode of cell death of the two cell lines. These findings indicate that etoposide could be used as a radiation sensitizer for p53-defective tumors, independent of the function of G2 checkpoint. PMID:29541168

  16. 2-Phenylacetylenesulfonamide (PAS) induces p53-independent apoptotic killing of B-chronic lymphocytic leukemia (CLL) cells.

    PubMed

    Steele, Andrew J; Prentice, Archibald G; Hoffbrand, A Victor; Yogashangary, Birunthini C; Hart, Stephen M; Lowdell, Mark W; Samuel, Edward R; North, Janet M; Nacheva, Elisabeth P; Chanalaris, Anastasios; Kottaridis, Panagiotis; Cwynarski, Kate; Wickremasinghe, R Gitendra

    2009-08-06

    We studied the actions of 2-phenylacetylenesulfonamide (PAS) on B-chronic lymphocytic leukemia (CLL) cells. PAS (5-20 microM) initiated apoptosis within 24 hours, with maximal death at 48 hours asassessed by morphology, cleavage of poly(ADP-ribose) polymerase (PARP), caspase 3 activation, and annexin V staining. PAS treatment induced Bax proapoptotic conformational change, Bax movement from the cytosol to the mitochondria, and cytochrome c release, indicating that PAS induced apoptosis via the mitochondrial pathway. PAS induced approximately 3-fold up-regulation of proapoptotic Noxa protein and mRNA levels. In addition, Noxa was found unexpectedly to be bound to Bcl-2 in PAS-treated cells. PAS treatment of CLL cells failed to up-regulate p53, suggesting that PAS induced apoptosis independently of p53. Furthermore, PAS induced apoptosis in CLL isolates with p53 gene deletion in more than 97% of cells. Normal B lymphocytes were as sensitive to PAS-induced Noxa up-regulation and apoptosis as were CLL cells. However, both T lymphocytes and bone marrow hematopoietic progenitor cells were relatively resistant to PAS. Our data suggest that PAS may represent a novel class of drug that induces apoptosis in CLL cells independently of p53 status by a mechanism involving Noxa up-regulation.

  17. Undecylprodigiosin selectively induces apoptosis in human breast carcinoma cells independent of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, T.-F.; Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan; Department of Medical Technology, Central Taiwan University of Science and Technology, Taichung 40605, Taiwan

    2007-12-15

    Undecylprodigiosin (UP) is a bacterial bioactive metabolite produced by Streptomyces and Serratia. In this study, we explored the anticancer effect of UP. Human breast carcinoma cell lines BT-20, MCF-7, MDA-MB-231 and T47D and one nonmalignant human breast epithelial cell line, MCF-10A, were tested in this study. We found that UP exerted a potent cytotoxicity against all breast carcinoma cell lines in a dose- and time-dependent manner. In contrast, UP showed limited toxicity to MCF-10A cells, indicating UP's cytotoxic effect is selective for malignant cells. UP's cytotoxic effect was due to apoptosis, as confirmed by positive TUNEL signals, annexin V-binding, caspasemore » 9 activation and PARP cleavage. Notably, UP-induced apoptosis was blocked by the pan-caspase inhibitor z-VAD.fmk, further indicating the involvement of caspase activity. Moreover, UP caused a marked decrease of the levels of antiapoptotic BCL-X{sub L}, Survivin and XIAP while enhancing the levels of proapoptotic BIK, BIM, MCL-1S and NOXA, consequently favoring induction of apoptosis. Additionally, we found that cells with functional p53 (MCF-7, T47D) or mutant p53 (BT-20, MDA-MB-231) were both susceptible to UP's cytotoxicity. Importantly, UP was able to induce apoptosis in MCF-7 cells with p53 knockdown by RNA interference, confirming the dispensability of p53 in UP-induced apoptosis. Overall, our results establish that UP induces p53-independent apoptosis in breast carcinoma cells with no marked toxicity to nonmalignant cells, raising the possibility of its use as a new chemotherapeutic drug for breast cancer irrespective of p53 status.« less

  18. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less

  19. Combined radiation and p53 gene therapy of malignant glioma cells.

    PubMed

    Badie, B; Goh, C S; Klaver, J; Herweijer, H; Boothman, D A

    1999-01-01

    More than half of malignant gliomas reportedly have alterations in the p53 tumor suppressor gene. Because p53 plays a key role in the cellular response to DNA-damaging agents, we investigated the role of p53 gene therapy before ionizing radiation in cultured human glioma cells containing normal or mutated p53. Three established human glioma cell lines expressing the wild-type (U87 MG, p53wt) or mutant (A172 and U373 MG, p53mut) p53 gene were transduced by recombinant adenoviral vectors bearing human p53 (Adp53) and Escherichia coli beta-galactosidase genes (AdLacZ, control virus) before radiation (0-20 Gy). Changes in p53, p21, and Bax expression were studied by Western immunoblotting, whereas cell cycle alterations and apoptosis were investigated by flow cytometry and nuclear staining. Survival was assessed by clonogenic assays. Within 48 hours of Adp53 exposure, all three cell lines demonstrated p53 expression at a viral multiplicity of infection of 100. p21, which is a p53-inducible downstream effector gene, was overexpressed, and cells were arrested in the G1 phase. Bax expression, which is thought to play a role in p53-induced apoptosis, did not change with either radiation or Adp53. Apoptosis and survival after p53 gene therapy varied. U87 MG (p53wt) cells showed minimal apoptosis after Adp53, irradiation, or combined treatments. U373 MG (p53mut) cells underwent massive apoptosis and died within 48 hours of Adp53 treatment, independent of irradiation. Surprisingly, A172 (p53mut) cells demonstrated minimal apoptosis after Adp53 exposure; however, unlike U373 MG cells, apoptosis increased with radiation dose. Survival of all three cell lines was reduced dramatically after >10 Gy. Although Adp53 transduction significantly reduced the survival of U373 MG cells and inhibited A172 growth, it had no effect on the U87 MG cell line. Transduction with AdLacZ did not affect apoptosis or cell cycle progression and only minimally affected survival in all cell lines. We

  20. HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R.

    2001-01-01

    Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals.

  1. Adenovirus-mediated p53 gene delivery potentiates the radiation-induced growth inhibition of experimental brain tumors.

    PubMed

    Badie, B; Kramar, M H; Lau, R; Boothman, D A; Economou, J S; Black, K L

    1998-05-01

    Patients with malignant gliomas continue to have very poor prognosis even after surgical resection, radiation and chemotherapy. Because these tumors often have alterations in the p53 tumor suppressor gene, which plays a key role in the cellular response to DNA damaging agents, we investigated the role of p53 gene therapy in conjunction with ionizing radiation in a rat brain tumor model. Exposure of cultured rat 9L gliosarcoma cells, which contain a mutant p53 gene, to a recombinant adenovirus-vector bearing the wild-type p53 gene (Adp53), induced apoptosis within 24 hours. Although ionizing radiation had no additional effect on apoptosis within this time frame, it caused G1 arrest in non-apoptotic cells after Adp53 therapy. In contrast, wild-type 9L cells demonstrated little G1 arrest after X-irradiation. When animals bearing brain tumors were irradiated after intratumoral Adp53 injections, more than 85% reduction in tumor size was noted. Moreover, the group of rats receiving both radiation and Adp53 therapy had a significant increase in survival as compared to animals receiving either therapy alone. These results support the use of p53 gene therapy as an adjunct to radiation in treatment of malignant brain tumors.

  2. UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53{sup Ser-15} phosphorylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader

    2009-06-12

    Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser{sup 15}. Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not preventmore » Dubca cell apoptosis, suggesting that p53{sup Ser-15} phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.« less

  3. Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

    PubMed Central

    Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

    2013-01-01

    Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

  4. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

    PubMed

    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-10-01

    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  5. Thrombocytopenia induced by the histone deacetylase inhibitor abexinostat involves p53-dependent and -independent mechanisms.

    PubMed

    Ali, A; Bluteau, O; Messaoudi, K; Palazzo, A; Boukour, S; Lordier, L; Lecluse, Y; Rameau, P; Kraus-Berthier, L; Jacquet-Bescond, A; Lelièvre, H; Depil, S; Dessen, P; Solary, E; Raslova, H; Vainchenker, W; Plo, I; Debili, N

    2013-07-25

    Abexinostat is a pan histone deacetylase inhibitor (HDACi) that demonstrates efficacy in malignancy treatment. Like other HDACi, this drug induces a profound thrombocytopenia whose mechanism is only partially understood. We have analyzed its effect at doses reached in patient plasma on in vitro megakaryopoiesis derived from human CD34(+) cells. When added at day 0 in culture, abexinostat inhibited CFU-MK growth, megakaryocyte (MK) proliferation and differentiation. These effects required only a short incubation period. Decreased proliferation was due to induction of apoptosis and was not related to a defect in TPO/MPL/JAK2/STAT signaling. When added later (day 8), the compound induced a dose-dependent decrease (up to 10-fold) in proplatelet (PPT) formation. Gene profiling from MK revealed a silencing in the expression of DNA repair genes with a marked RAD51 decrease at protein level. DNA double-strand breaks were increased as attested by elevated γH2AX phosphorylation level. Moreover, ATM was phosphorylated leading to p53 stabilization and increased BAX and p21 expression. The use of a p53 shRNA rescued apoptosis, and only partially the defect in PPT formation. These results suggest that HDACi induces a thrombocytopenia by a p53-dependent mechanism along MK differentiation and a p53-dependent and -independent mechanism for PPT formation.

  6. p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

    2001-01-01

    Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

  7. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it; Stefanelli, C.; Malucelli, E.

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of themore » cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.« less

  8. Glycogen synthase kinase 3β inhibitors protect hippocampal neurons from radiation-induced apoptosis by regulating MDM2-p53 pathway.

    PubMed

    Thotala, D K; Hallahan, D E; Yazlovitskaya, E M

    2012-03-01

    Exposure of the brain to ionizing radiation can cause neurocognitive deficiencies. The pathophysiology of these neurological changes is complex and includes radiation-induced apoptosis in the subgranular zone of the hippocampus. We have recently found that inhibition of glycogen synthase kinase 3β (GSK-3β) resulted in significant protection from radiation-induced apoptosis in hippocampal neurons. The molecular mechanisms of this cytoprotection include abrogation of radiation-induced accumulation of p53. Here we show that pretreatment of irradiated HT-22 hippocampal-derived neurons with small molecule inhibitors of GSK-3β SB216763 or SB415286, or with GSK-3β-specific shRNA resulted in accumulation of the p53-specific E3 ubiquitin ligase MDM2. Knockdown of MDM2 using specific shRNA or chemical inhibition of MDM2-p53 interaction prevented the protective changes triggered by GSK-3β inhibition in irradiated HT-22 neurons and restored radiation cytotoxicity. We found that this could be due to regulation of apoptosis by subcellular localization and interaction of GSK-3β, p53 and MDM2. These data suggest that the mechanisms of radioprotection by GSK-3β inhibitors in hippocampal neurons involve regulation of MDM2-dependent p53 accumulation and interactions between GSK-3β, MDM2 and p53.

  9. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    PubMed

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  10. Bim directly antagonizes Bcl-xl in doxorubicin-induced prostate cancer cell apoptosis independently of p53.

    PubMed

    Yang, Min-Chi; Lin, Ru-Wei; Huang, Shih-Bo; Huang, Shin-Yuan; Chen, Wen-Jie; Wang, Shiaw; Hong, Yi-Ren; Wang, Chihuei

    2016-01-01

    Doxorubicin and other anthracycline compounds exert their anti-cancer effects by causing DNA damage and initiating cell cycle arrest in cancer cells, followed by apoptosis. DNA damage generally activates a p53-mediated pathway to initiate apoptosis by increasing the level of the BH3-only protein, Puma. However, p53-mediated apoptosis in response to DNA damage has not yet been validated in prostate cancers. In the current study, we used LNCaP and PC3 prostate cancer cells, representing wild type p53 and a p53-null model, to determine if DNA damage activates p53-mediated apoptosis in prostate cancers. Our results revealed that PC3 cells were 4 to 8-fold less sensitive than LNCaP cells to doxorubicin-inuced apoptosis. We proved that the differential response of LNCaP and PC3 to doxorubicin was p53-independent by introducing wild-type or dominant negative p53 into PC3 or LNCaP cells, respectively. By comparing several apoptosis-related proteins in both cell lines, we found that Bcl-xl proteins were much more abundant in PC3 cells than in LNCaP cells. We further demonstrated that Bcl-xl protects LNCaP and PC3 cells from doxorubicin-induced apoptosis by using ABT-263, an inhibitor of Bcl-xl, as a single agent or in combination with doxorubicin to treat LNCaP or PC3 cells. Bcl-xl rather than p53, likely contributes to the differential response of LNCaP and PC3 to doxorubicin in apoptosis. Finally, co-immunoprecipitation and siRNA analysis revealed that a BH3-only protein, Bim, is involved in doxorubicin-induced apoptosis by directly counteracting Bcl-xl.

  11. The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

    PubMed Central

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

  12. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro

    PubMed Central

    Xing, Fuqiang; Zhan, Qiuqiang; He, Yiduo; Cui, Jiesheng; He, Sailing; Wang, Guanyu

    2016-01-01

    Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR) at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS) generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant). Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor) and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis. PMID:27689798

  13. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

    PubMed

    Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

    2010-11-01

    Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway.

    PubMed

    Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W

    2003-02-01

    Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.

  15. p53-independent p21 induction by MELK inhibition.

    PubMed

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-08-29

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

  16. p53-independent p21 induction by MELK inhibition

    PubMed Central

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-01-01

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

  17. The influence of TRP53 in the dose response of radiation-induced apoptosis, DNA repair and genomic stability in murine haematopoietic cells

    DOE PAGES

    Lemon, Jennifer A.; Taylor, Kristina; Verdecchia, Kyle; ...

    2014-01-01

    Apoptotic and DNA damage endpoints are frequently used as surrogate markers of cancer risk, and have been well-studied in the Trp53+/- mouse model. We report the effect of differing Trp53 gene status on the dose response of ionizing radiation exposures (0.01-2 Gy), with the unique perspective of determining if effects of gene status remain at extended time points. Here we report no difference in the dose response for radiation-induced DNA double-strand breaks in bone marrow and genomic instability (MN-RET levels) in peripheral blood, between wild-type ( Trp53+/+) and heterozygous ( Trp53+/-) mice. The dose response for Trp53+/+ mice showed highermore » initial levels of radiation-induced lymphocyte apoptosis relative to Trp53+/- between 0 and 1 Gy. Although this trend was observed up to 12 hours post-irradiation, both genotypes ultimately reached the same level of apoptosis at 14 hours, suggesting the importance of late-onset p53-independent apoptotic responses in this mouse model. Expected radiation-induced G1 cell cycle delay was observed in Trp53+/+ but not Trp53+/-. Although p53 has an important role in cancer risk, we have shown its influence on radiation dose response can be temporally variable. This research highlights the importance of caution when using haematopoietic endpoints as surrogates to extrapolate radiation-induced cancer risk estimation.« less

  18. Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Hong Shik; Department of Life Science, College of Natural Sciences, Hanyang University, Seoul 133-791; Baek, Jeong-Hwa

    2014-07-11

    Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates themore » radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells.« less

  19. Wasabi 6-(methylsulfinyl)hexyl isothiocyanate induces apoptosis in human colorectal cancer cells through p53-independent mitochondrial dysfunction pathway.

    PubMed

    Yano, Satoshi; Wu, Shusong; Sakao, Kozue; Hou, De-Xing

    2018-05-14

    6-(Methylsulfinyl)hexyl isothiocyanate (6-MSITC), a major bioactive compound in Wasabi [Wasabia japonica (Miq.) Matsum.], has revealed the inhibitory effect on colon carcinogenesis in rat cancer model although the underlying mechanism is unclear. In this study, we used two types of human colorectal cancer cells (HCT116 p53 +/+ and HCT116 p53 -/- ) to investigate the anticancer activity and molecular mechanisms of 6-MSITC. Interestingly, 6-MSITC inhibited the cell proliferation in both types of cells with similar IC 50 value although a light increase in the phosphorylation and accumulation of P53 protein was observed in HCT116 p53 +/+ cells at 24 h after treatment. In addition, 6-MSITC increased the ratio of proapoptotic cells in both types of cells with the same fashion in a p53-independent manner. The data from mitochondrial analysis revealed that 6-MSITC enhanced the ratio of proapoptotic B-cell lymphoma-2-associated X protein/antiapoptotic myeloid cell leukemia 1, and sequentially caused mitochondrial membrane potential (ΔΨ m ) loss, cytochrome c release, and caspase-3 activation in both types of cells. Taken together, Wasabi 6-MSITC induced apoptosis of human colorectal cancer cells in p53-independent mitochondrial dysfunction pathway. These findings suggest that 6-MSITC might be a potential agent for colon cancer chemoprevention although with p53 mutation. © 2018 BioFactors, 2018. © 2018 International Union of Biochemistry and Molecular Biology.

  20. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  1. Differentiation-induced skin cancer suppression by FOS, p53, and TACE/ADAM17

    PubMed Central

    Guinea-Viniegra, Juan; Zenz, Rainer; Scheuch, Harald; Jiménez, María; Bakiri, Latifa; Petzelbauer, Peter; Wagner, Erwin F.

    2012-01-01

    Squamous cell carcinomas (SCCs) are heterogeneous and aggressive skin tumors for which innovative, targeted therapies are needed. Here, we identify a p53/TACE pathway that is negatively regulated by FOS and show that the FOS/p53/TACE axis suppresses SCC by inducing differentiation. We found that epidermal Fos deletion in mouse tumor models or pharmacological FOS/AP-1 inhibition in human SCC cell lines induced p53 expression. Epidermal cell differentiation and skin tumor suppression were caused by a p53-dependent transcriptional activation of the metalloprotease TACE/ADAM17 (TNF-α–converting enzyme), a previously unknown p53 target gene that was required for NOTCH1 activation. Although half of cutaneous human SCCs display p53-inactivating mutations, restoring p53/TACE activity in mouse and human skin SCCs induced tumor cell differentiation independently of the p53 status. We propose FOS/AP-1 inhibition or p53/TACE reactivating strategies as differentiation-inducing therapies for SCCs. PMID:22772468

  2. Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

    PubMed

    Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

    2017-01-01

    Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  3. Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

    PubMed Central

    Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

    2017-01-01

    Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

  4. Doxorubicin-induced necrosis is mediated by poly-(ADP-ribose) polymerase 1 (PARP1) but is independent of p53.

    PubMed

    Shin, Hyeon-Jun; Kwon, Hyuk-Kwon; Lee, Jae-Hyeok; Gui, Xiangai; Achek, Asma; Kim, Jae-Ho; Choi, Sangdun

    2015-11-02

    Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is thought to mediate necrosis by inducing DNA damage, although this remains unconfirmed. In this study, we examined the mechanisms of PARP1-mediated necrosis following doxorubicin (DOX)-induced DNA damage in human kidney proximal tubular (HK-2) cells. DOX initiated DNA damage response (DDR) and upregulated PARP1 and p53 expression, resulting in morphological changes similar to those observed during necrosis. Additionally, DOX induced mitochondrial hyper-activation, as evidenced by increased mitochondrial respiration and cytosolic ATP (cATP) production. However, DOX affected mitochondrial mass. DOX-induced DNA damage, cytosolic reactive oxygen species (cROS) generation, and mitochondrial hyper-activation decreased in cells with inhibited PARP1 expression, while generation of nitric oxide (NO) and mitochondrial ROS (mROS) remained unaffected. Moreover, DOX-induced DNA damage, cell cycle changes, and oxidative stress were not affected by p53 inhibition. These findings suggest that DNA damage induced necrosis through a PARP1-dependent and p53-independent pathway.

  5. Doxorubicin-induced necrosis is mediated by poly-(ADP-ribose) polymerase 1 (PARP1) but is independent of p53

    PubMed Central

    Shin, Hyeon-Jun; Kwon, Hyuk-Kwon; Lee, Jae-Hyeok; Gui, Xiangai; Achek, Asma; Kim, Jae-Ho; Choi, Sangdun

    2015-01-01

    Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is thought to mediate necrosis by inducing DNA damage, although this remains unconfirmed. In this study, we examined the mechanisms of PARP1-mediated necrosis following doxorubicin (DOX)-induced DNA damage in human kidney proximal tubular (HK-2) cells. DOX initiated DNA damage response (DDR) and upregulated PARP1 and p53 expression, resulting in morphological changes similar to those observed during necrosis. Additionally, DOX induced mitochondrial hyper-activation, as evidenced by increased mitochondrial respiration and cytosolic ATP (cATP) production. However, DOX affected mitochondrial mass. DOX-induced DNA damage, cytosolic reactive oxygen species (cROS) generation, and mitochondrial hyper-activation decreased in cells with inhibited PARP1 expression, while generation of nitric oxide (NO) and mitochondrial ROS (mROS) remained unaffected. Moreover, DOX-induced DNA damage, cell cycle changes, and oxidative stress were not affected by p53 inhibition. These findings suggest that DNA damage induced necrosis through a PARP1-dependent and p53-independent pathway. PMID:26522181

  6. Radiation-induced hyperproliferation of intestinal crypts results in elevated genome instability with inactive p53-related genomic surveillance.

    PubMed

    Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong

    2015-12-15

    Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    PubMed

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Histone deacetylase inhibitors prevent p53-dependent and p53-independent Bax-mediated neuronal apoptosis through two distinct mechanisms.

    PubMed

    Uo, Takuma; Veenstra, Timothy D; Morrison, Richard S

    2009-03-04

    Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and p53-independent intrinsic apoptotic programs require the proapoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing postmitochondrial events including cleavage of caspase-9 and caspase-3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions.

  9. Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

    PubMed Central

    Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

    2013-01-01

    Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

  10. p53 independent epigenetic-differentiation treatment in xenotransplant models of acute myeloid leukemia

    PubMed Central

    Ng, Kwok Peng; Ebrahem, Quteba; Negrotto, Soledad; Mahfouz, Reda Z.; Link, Kevin A.; Hu, Zhenbo; Gu, Xiaorong; Advani, Anjali; Kalaycio, Matt; Sobecks, Ronald; Sekeres, Mikkael; Copelan, Edward; Radivoyevitch, Tomas; Maciejewski, Jaroslaw; Mulloy, James C.; Saunthararajah, Yogen

    2013-01-01

    Suppression of apoptosis by TP53 mutation contributes to resistance of acute myeloid leukemia (AML) to conventional cytotoxic treatment. Using differentiation to induce irreversible cell cycle exit in AML cells could be a p53-independent treatment alternative, however, this possibility requires evaluation. In vitro and in vivo regimens of the deoxycytidine analogue decitabine that deplete the chromatin modifying enzyme DNA methyl-transferase 1 (DNMT1) without phosphorylating p53 or inducing early apoptosis were determined. These decitabine regimens but not equimolar DNA-damaging cytarabine up regulated the key late differentiation factors CEBPε and p27/CDKN1B, induced cellular differentiation, and terminated AML cell-cycle, even in cytarabine-resistant p53- and p16/CDKN2A-null AML cells. Leukemia initiation by xeno-transplanted AML cells was abrogated but normal hematopoietic stem cell (HSC) engraftment was preserved. In vivo, the low toxicity allowed frequent drug administration to increase exposure, an important consideration for S-phase specific decitabine therapy. In xeno-transplant models of p53-null and relapsed/refractory AML, the non-cytotoxic regimen significantly extended survival compared to conventional cytotoxic cytarabine. Modifying in vivo dose and schedule to emphasize this pathway of decitabine action can bypass a mechanism of resistance to standard therapy. PMID:21701495

  11. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  12. Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53

    PubMed Central

    Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex

    2014-01-01

    Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697

  13. Enhanced radiosensitization of p53 mutant cells by oleamide.

    PubMed

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil

    2006-04-01

    Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  14. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  15. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  16. Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

    PubMed

    Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

    2017-03-01

    Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

  17. Transcriptional and post-transcriptional regulation of the ionizing radiation response by ATM and p53

    PubMed Central

    Venkata Narayanan, Ishwarya; Paulsen, Michelle T.; Bedi, Karan; Berg, Nathan; Ljungman, Emily A.; Francia, Sofia; Veloso, Artur; Magnuson, Brian; di Fagagna, Fabrizio d’Adda; Wilson, Thomas E.; Ljungman, Mats

    2017-01-01

    In response to ionizing radiation (IR), cells activate a DNA damage response (DDR) pathway to re-program gene expression. Previous studies using total cellular RNA analyses have shown that the stress kinase ATM and the transcription factor p53 are integral components required for induction of IR-induced gene expression. These studies did not distinguish between changes in RNA synthesis and RNA turnover and did not address the role of enhancer elements in DDR-mediated transcriptional regulation. To determine the contribution of synthesis and degradation of RNA and monitor the activity of enhancer elements following exposure to IR, we used the recently developed Bru-seq, BruChase-seq and BruUV-seq techniques. Our results show that ATM and p53 regulate both RNA synthesis and stability as well as enhancer element activity following exposure to IR. Importantly, many genes in the p53-signaling pathway were coordinately up-regulated by both increased synthesis and RNA stability while down-regulated genes were suppressed either by reduced synthesis or stability. Our study is the first of its kind that independently assessed the effects of ionizing radiation on transcription and post-transcriptional regulation in normal human cells. PMID:28256581

  18. Neem oil limonoids induces p53-independent apoptosis and autophagy

    PubMed Central

    Chandra, Dhyan

    2012-01-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  19. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    PubMed

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  20. Expression of P53 protein after exposure to ionizing radiation

    NASA Astrophysics Data System (ADS)

    Salazar, A. M.; Salvador, C.; Ruiz-Trejo, C.; Ostrosky, P.; Brandan, M. E.

    2001-10-01

    One of the most important tumor suppressor genes is p53 gene, which is involved in apoptotic cell death, cell differentiation and cell cycle arrest. The expression of p53 gene can be evaluated by determining the presence of P53 protein in cells using Western Blot assay with a chemiluminescent method. This technique has shown variabilities that are due to biological factors. Film developing process can influence the quality of the p53 bands obtained. We irradiated tumor cell lines and human peripheral lymphocytes with 137Cs and 60Co gamma rays to standardize irradiation conditions, to compare ionizing radiation with actinomycin D and to reduce the observed variability of P53 protein induction levels. We found that increasing radiation doses increase P53 protein induction while it decreases viability. We also conclude that ionizing radiation could serve as a positive control for Western Blot analysis of protein P53. In addition, our results show that the developing process may play an important role in the quality of P53 protein bands and data interpretation.

  1. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    PubMed

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  2. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang Xin; Xu Ke; Xu Yufang

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report heremore » that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P{sub 2} promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research Highlights: > B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. > B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. > B1 induced significant increase of p53 binding to Bcl-2 P{sub 2} promoter TATA box.« less

  3. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    PubMed

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Human papillomavirus type 16 E6 inhibits p21{sup WAF1} transcription independently of p53 by inactivating p150{sup Sal2}

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parroche, Peggy; Institut Federatif de Recherche 128 BioSciences Gerland-Lyon Sud; Touka, Majid

    2011-09-01

    HPV16 E6 deregulates G1/S cell cycle progression through p53 degradation preventing transcription of the CDK inhibitor p21{sup WAF1}. However, additional mechanisms independent of p53 inactivation appear to exist. Here, we report that HPV16 E6 targets the cellular factor p150{sup Sal2}, which positively regulates p21{sup WAF1} transcription. HPV16 E6 associates with p150{sup Sal2}, inducing its functional inhibition by preventing its binding to cis elements on the p21{sup WAF1} promoter. A HPV16 E6 mutant, L110Q, which was unable to bind p150{sup Sal2}, did not affect the ability of the cellular protein to bind p21{sup WAF1} promoter, underlining the linkage between these events.more » These data describe a novel mechanism by which HPV16 E6 induces cell cycle deregulation with a p53-independent pathway. The viral oncoprotein targets p150{sup Sal2}, a positive transcription regulator of p21{sup WAF1} gene, preventing G1/S arrest and allowing cellular proliferation and efficient viral DNA replication.« less

  5. Emodin protects mice against radiation-induced mortality and intestinal injury via inhibition of apoptosis and modulation of p53.

    PubMed

    Wang, Jing; Zhang, Yue; Zhu, Qiuzhen; Liu, Yulan; Cheng, Hao; Zhang, Yuefan; Li, Tiejun

    2016-09-01

    The aim of this study was to explore the protective effect of emodin, a plant-derived anthraquinone, against gamma radiation-induced mortality and intestinal injury in mice, and to investigate the radioprotective molecular mechanism. C57BL/6 male mice were pre-treated with emodin for 7days via oral gavage before gamma radiation. We found that pretreatment with emodin prolonged mice survival time after 9Gy total body irradiation (TBI). Mice were sacrificed at 1 week after 7Gy TBI, we found that emodin attenuated intestinal morphological changes and increased villus height, crypt numbers, and reduced villus and crypt apoptosis as well as inhibited the expression of p53. MTT assay, flow cytometry, Hoechst 33258 staining, real-time PCR, and Western blotting indicated that emodin pretreatment can effectively increase human umbilical venous endothelial cells (HUVECs) viability and attenuate cell apoptosis; it also inhibited the expression of p53, Bax, and Caspase3 in HUVECs after irradiation. In summary, these results suggest the potential of emodin as an effective radioprotectant against radiation-induced intestinal injury. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

    PubMed Central

    Meng, X; Carlson, NR; Dong, J; Zhang, Y

    2016-01-01

    The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly similar paces with median survival around 10 and 11 weeks, respectively, compared to 20 weeks for Eμ-myc transgenic mice. Because p19Arf can inhibit ribosomal biogenesis through its interaction with nucleophosmin (NPM/B23), RNA helicase DDX5 and RNA polymerase I transcription termination factor (TTF-I), it has been speculated that the p19Arf–Mdm2–p53 and the RP–Mdm2–p53 pathways might be a single p19Arf–RP–Mdm2–p53 pathway, in which p19Arf activates p53 by inhibiting RP biosynthesis; thus, p19Arf deletion or Mdm2C305F mutation would result in similar consequences. Here, we generated mice with concurrent p19Arf deletion and Mdm2C305F mutation and investigated the compound mice for tumorigenesis in the absence and the presence of oncogenic c-Myc overexpression. In the absence of Eμ-myc transgene, the Mdm2C305F mutation did not elicit spontaneous tumors in mice, nor did it accelerate spontaneous tumors in mice with p19Arf deletion. In the presence of Eμ-myc transgene, however, Mdm2C305F mutation significantly accelerated p19Arf deletion-induced lymphomagenesis and promoted rapid metastasis. We found that when p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways are independently disrupted, oncogenic c-Myc-induced p53 stabilization and activation is only partially attenuated. When both pathways are concurrently disrupted, however, c-Myc-induced p53 stabilization and activation are essentially obliterated. Thus, the p19Arf–Mdm2–p53 and the RP–Mdm2–p53

  7. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

    PubMed

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

    2016-01-07

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  9. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  10. p53 independent induction of PUMA mediates intestinal apoptosis in response to ischaemia–reperfusion

    PubMed Central

    Wu, Bin; Qiu, Wei; Wang, Peng; Yu, Hui; Cheng, Tao; Zambetti, Gerard P; Zhang, Lin; Yu, Jian

    2007-01-01

    type mice. I/R induced caspase 3 activation, cytochrome c release, Bax mitochondrial translocation and Bak multimerisation were also inhibited in PUMA knockout mice. SOD or L‐NAME significantly blunted I/R induced PUMA expression and apoptosis. Furthermore, I/R induced PUMA expression and apoptosis in the small intestine were not affected in the p53 knockout mice. Conclusions Our data demonstrated that PUMA is activated by oxidative stress in response to I/R to promote p53 independent apoptosis in the small intestine through the mitochondrial pathway. Inhibition of PUMA is potentially useful for protecting against I/R induced intestinal injury and apoptosis. PMID:17127703

  11. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    PubMed Central

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  12. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  13. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  14. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT.

    PubMed

    Leszczynska, Katarzyna B; Foskolou, Iosifina P; Abraham, Aswin G; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N; O'Neill, Eric E; Buffa, Francesca M; Hammond, Ester M

    2015-06-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage-induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain-containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors.

  15. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    PubMed Central

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  16. AS-2, a novel inhibitor of p53-dependent apoptosis, prevents apoptotic mitochondrial dysfunction in a transcription-independent manner and protects mice from a lethal dose of ionizing radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morita, Akinori, E-mail: morita@tokushima-u.ac.jp; Ariyasu, Shinya; Wang, Bing

    2014-08-08

    Highlights: • A bidentate HQ derivative, AS-2, suppresses p53-dependent apoptosis by DNA damage. • AS-2 does not significantly affect nuclear p53 response. • UV-excited blue emission of AS-2 clearly showed its extranuclear localization. • AS-2 prevents mitochondrial dysfunction despite the increase of mitochondrial p53. • AS-2 protects mice from a radiation dose that causes lethal hematopoietic syndrome. - Abstract: In a previous study, we reported that some tetradentate zinc(II) chelators inhibit p53 through the denaturation of its zinc-requiring structure but a chelator, Bispicen, a potent inhibitor of in vitro apoptosis, failed to show any efficient radioprotective effect against irradiated micemore » because the toxicity of the chelator to mice. The unsuitability of using tetradentate chelators as radioprotectors prompted us to undertake a more extensive search for p53-inhibiting agents that are weaker zinc(II) chelators and therefore less toxic. Here, we show that an 8-hydroxyquinoline (8HQ) derivative, AS-2, suppresses p53-dependent apoptosis through a transcription-independent mechanism. A mechanistic study using cells with different p53 characteristics revealed that the suppressive effect of AS-2 on apoptosis is specifically mediated through p53. In addition, AS-2 was less effective in preventing p53-mediated transcription-dependent events than pifithrin-μ (PFTμ), an inhibitor of transcription-independent apoptosis by p53. Fluorescence visualization of the extranuclear distribution of AS-2 also supports that it is ineffective on the transcription-dependent pathway. Further investigations revealed that AS-2 suppressed mitochondrial apoptotic events, such as the mitochondrial release of intermembrane proteins and the loss of mitochondrial membrane potential, although AS-2 resulted in an increase in the mitochondrial translocation of p53 as opposed to the decrease of cytosolic p53, and did not affect the apoptotic interaction of p53 with Bcl-2

  17. The UbL-UBA Ubiquilin4 protein functions as a tumor suppressor in gastric cancer by p53-dependent and p53-independent regulation of p21.

    PubMed

    Huang, Shengkai; Li, Yan; Yuan, Xinghua; Zhao, Mei; Wang, Jia; Li, You; Li, Yuan; Lin, Hong; Zhang, Qiao; Wang, Wenjie; Li, Dongdong; Dong, Xin; Li, Lanfen; Liu, Min; Huang, Weiyan; Huang, Changzhi

    2018-06-13

    Ubiquilin4 (Ubqln4), a member of the UbL-UBA protein family, serves as an adaptor in the degradation of specific substrates via the proteasomal pathway. However, the biological function of Ubqln4 remains largely unknown, especially in cancer. Here, we reported that Ubqln4 was downregulated in gastric cancer tissues and functioned as a tumor suppressor by inhibiting gastric cancer cell proliferation in vivo and in vitro. Overexpression of Ubqln4-induced cellular senescence and G1-S cell cycle arrest in gastric cancer cells and activated the p53/p21 axis. Moreover, Ubqln4 regulated p21 through both p53-dependent and p53-independent manners. Ubqln4 interacted with RNF114, an E3 ubiquitin ligase of p21, and negatively regulated its expression level, which in turn stabilized p21 by attenuating proteasomal degradation of p21. These effects of Ubqln4 were partly abrogated in gastric cancer cells upon silencing of p21. Our findings not only establish the anti-tumor potential of Ubqln4 in gastric cancer but also reveal a role for Ubqln4 in regulation of the cell cycle and cellular senescence via stabilizing p21.

  18. Defective Autophagosome Formation in p53-Null Colorectal Cancer Reinforces Crocin-Induced Apoptosis

    PubMed Central

    Amin, Amr; Bajbouj, Khuloud; Koch, Adrian; Gandesiri, Muktheshwar; Schneider-Stock, Regine

    2015-01-01

    Crocin, a bioactive molecule of saffron, inhibited proliferation of both HCT116 wild-type and HCT116 p53−/− cell lines at a concentration of 10 mM. Flow cytometric analysis of cell cycle distribution revealed that there was an accumulation of HCT116 wild-type cells in G1 (55.9%, 56.1%) compared to the control (30.4%) after 24 and 48 h of crocin treatment, respectively. However, crocin induced only mild G2 arrest in HCT116 p53−/− after 24 h. Crocin induced inefficient autophagy in HCT116 p53−/− cells, where crocin induced the formation of LC3-II, which was combined with a decrease in the protein levels of Beclin 1 and Atg7 and no clear p62 degradation. Autophagosome formation was not detected in HCT116 p53−/− after crocin treatment predicting a nonfunctional autophagosome formation. There was a significant increase of p62 after treating the cells with Bafilomycin A1 (Baf) and crocin compared to crocin exposure alone. Annexin V staining showed that Baf-pretreatment enhanced the induction of apoptosis in HCT116 wild-type cells. Baf-exposed HCT116 p53−/− cells did not, however, show any enhancement of apoptosis induction despite an increase in the DNA damage-sensor accumulation, γH2AX indicating that crocin induced an autophagy-independent classical programmed cell death. PMID:25584615

  19. RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.

    PubMed

    Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh

    2011-07-01

    The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.

  20. Phosphorylation of p53 modifies sensitivity to ionizing radiation.

    PubMed

    Okaichi, Kumio; Nose, Kanako; Kotake, Takako; Izumi, Nanaka; Kudo, Takashi

    2011-06-01

    Phosphorylation is an important modification involved in the control of p53 activity. We examined the relationship between p53 phosphorylation and cell radiosensitivity. We prepared H1299 cells (p53-null) with various mutations of p53 at three sites (serine 15, 20 and 46) and examined the radiosensitivity of the cells. In three mutant forms of p53--S15A, S20A and S46A--serine was converted to alanine at these sites to prevent phosphorylation, and in two other mutant forms, S15D and S20D, serine was converted to aspartic acid to mimic phosphorylation. H1299 cells were more radioresistant than cells with wild-type p53. Cells with the S15A and S46A mutant forms of p53 were radiosensitive, whereas those with the S15D, S20A and S20D forms showed medium radiosensitivity. Thus the sensitivity of cells to ionizing radiation varies according to the site of phosphorylation of p53.

  1. Stabilisation of p53 enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation.

    PubMed

    Pan, D; Pan, L-Z; Hill, R; Marcato, P; Shmulevitz, M; Vassilev, L T; Lee, P W K

    2011-09-27

    Naturally oncolytic reovirus preferentially kills cancer cells, making it a promising cancer therapeutic. Mutations in tumour suppressor p53 are prevalent in cancers, yet the role of p53 in reovirus oncolysis is relatively unexplored. Human cancer cell lines were exposed to Nutlin-3a, reovirus or a combination of the two and cells were processed for reovirus titration, western blot, real-time PCR and apoptosis assay using Annexin V and 7-AAD staining. Confocal microscopy was used to determine translocation of the NF-κB p65 subunit. We show that despite similar reovirus replication in p53(+/+) and p53(-/-) cells, stabilisation of p53 by Nutlin-3a significantly enhanced reovirus-induced apoptosis and hence virus release and dissemination while having no direct effect on virus replication. Enhanced apoptosis by Nutlin-3a was not observed in p53(-/-) or p53 knockdown cells; however, increased expression of Bax and p21 are required. Moreover, elevated NF-κB activation in reovirus-infected cells following Nutlin-3a treatment was necessary for enhanced reovirus-induced apoptosis, as synergistic cytotoxicity was overcome by specific NF-κB inhibitors. Nutlin-3a treatment enhances reovirus-induced apoptosis and virus spread through p53-dependent NF-κB activation, and combination of reovirus and Nutlin-3a might represent an improved therapy against cancers harbouring wild-type p53.

  2. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  3. A novel alkaloid, evodiamine causes nuclear localization of cytochrome-c and induces apoptosis independent of p53 in human lung cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mohan, Vijay; Agarwal, Rajesh; Singh, Rana P., E-mail: ranaps@hotmail.com

    Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survivalmore » of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer

  4. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    PubMed Central

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  5. Pleurotus ostreatus inhibits proliferation of human breast and colon cancer cells through p53-dependent as well as p53-independent pathway

    PubMed Central

    JEDINAK, ANDREJ; SLIVA, DANIEL

    2009-01-01

    In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765

  6. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    PubMed

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  7. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation

    PubMed Central

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-01-01

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14–Cre–ERT2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14–Cre–ERT2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte–stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn. PMID:28878021

  8. Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

    PubMed Central

    Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

    2010-01-01

    Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

  9. Relative biological effectiveness of light ions in human tumoural cell lines: role of protein p53

    NASA Technical Reports Server (NTRS)

    Baggio, L.; Cavinato, M.; Cherubini, R.; Conzato, M.; Cucinotta, F.; Favaretto, S.; Gerardi, S.; Lora, S.; Stoppa, P.; Williams, J. R.

    2002-01-01

    Protons and alpha particles of high linear energy transfer (LET) have shown an increased relative biological effectiveness (RBE) with respect to X/gamma rays for several cellular and molecular endpoints in different in vitro cell systems. To contribute to understanding the biochemical mechanisms involved in the increased effectiveness of high LET radiation, an extensive study has been designed. The present work reports the preliminary result of this study on two human tumoural cell lines, DLD1 and HCT116, (with different p53 status), which indicate that for these cell lines, p53 does not appear to take a part in the response to radiation induced DNA damage, suggesting an alternative p53-independent pathway and a cell biochemical mechanism dependent on the cell type.

  10. RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

    PubMed Central

    Herold, Marco J.

    2016-01-01

    Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

  11. Ionizing Radiation-Induced Responses in Human Cells with Differing TP53 Status

    PubMed Central

    Mirzayans, Razmik; Andrais, Bonnie; Scott, April; Wang, Ying W.; Murray, David

    2013-01-01

    Ionizing radiation triggers diverse responses in human cells encompassing apoptosis, necrosis, stress-induced premature senescence (SIPS), autophagy, and endopolyploidy (e.g., multinucleation). Most of these responses result in loss of colony-forming ability in the clonogenic survival assay. However, not all modes of so-called clonogenic cell “death” are necessarily advantageous for therapeutic outcome in cancer radiotherapy. For example, the crosstalk between SIPS and autophagy is considered to influence the capacity of the tumor cells to maintain a prolonged state of growth inhibition that unfortunately can be succeeded by tumor regrowth and disease recurrence. Likewise, endopolyploid giant cells are able to segregate into near diploid descendants that continue mitotic activities. Herein we review the current knowledge on the roles that the p53 and p21WAF1 tumor suppressors play in determining the fate of human fibroblasts (normal and Li-Fraumeni syndrome) and solid tumor-derived cells after exposure to ionizing radiation. In addition, we discuss the important role of WIP1, a p53-regulated oncogene, in the temporal regulation of the DNA damage response and its contribution to p53 dynamics post-irradiation. This article highlights the complexity of the DNA damage response and provides an impetus for rethinking the nature of cancer cell resistance to therapeutic agents. PMID:24232458

  12. Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tommaso, Anne di; Hagen, Jussara; Tompkins, Van

    2009-04-15

    The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less

  13. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    PubMed

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  14. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Dehua; Fan, Wufang; Liu, Guohong

    2006-04-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

  15. Data for a proteomic analysis of p53-independent induction of apoptosis by bortezomib

    PubMed Central

    Yerlikaya, Azmi; Okur, Emrah; Tarık Baykal, Ahmet; Acılan, Ceyda; Boyacı, İhsan; Ulukaya, Engin

    2014-01-01

    This data article contains data related to the research article entitled, “A proteomic analysis of p53-independent induction of apoptosis by bortezomib in 4T1 breast cancer cell line” by Yerlikaya et al. [1]. The research article presented 2-DE and nLC-MS/MS based proteomic analysis of proteasome inhibitor bortezomib-induced changes in the expression of cellular proteins. The report showed that GRP78 and TCEB2 were over-expressed in response to treatment with bortezomib for 24 h. In addition, the report demonstrated that Hsp70, the 26S proteasome non-ATPase regulatory subunit 14 and sequestosome 1 were increased at least 2 fold in p53-deficient 4T1 cells. The data here show for the first time the increased expressions of Card10, Dffb, Traf3 and Trp53bp2 in response to inhibition of the 26S proteasome. The information presented here also shows that both Traf1 and Xiap (a member of IAPs) are also downregulated simultaneously upon proteasomal inhibition. The increases in the level of Card10 and Trp53bp2 proteins were verified by Western blot analysis in response to varying concentrations of bortezomib for 24 h. PMID:26217687

  16. Histone Deacetylase Inhibitors Prevent p53-dependent and Independent Bax-Mediated Neuronal Apoptosis Through Two Distinct Mechanisms

    PubMed Central

    Uo, Takuma; Veenstra, Timothy D.; Morrison, Richard S.

    2009-01-01

    Pharmacological manipulation of protein acetylation levels by histone deacetylase (HDAC) inhibitors represents a novel therapeutic strategy to treat neurodegeneration as well as cancer. However, the molecular mechanisms that determine how HDAC inhibition exerts a protective effect in neurons as opposed to a cytotoxic action in tumor cells has not been elucidated. We addressed this issue in cultured postnatal mouse cortical neurons whose p53-dependent and —independent intrinsic apoptotic programs require the pro-apoptotic multidomain protein, Bax. Despite promoting nuclear p53 accumulation, Class I/II HDAC inhibitors (HDACIs) protected neurons from p53-dependent cell death induced by camptothecin, etoposide, heterologous p53 expression or the MDM2 inhibitor, nutlin-3a. HDACIs suppressed p53-dependent PUMA expression, a critical signaling intermediate linking p53 to Bax activation, thus preventing post-mitochondrial events including cleavage of caspase-9 and -3. In human SH-SY5Y neuroblastoma cells, however, HDACIs were not able to prevent p53-dependent cell death. Moreover, HDACIs also prevented caspase-3 cleavage in postnatal cortical neurons treated with staurosporine, 3-nitropropionic acid and a Bcl-2 inhibitor, all of which require the presence of Bax but not p53 to promote apoptosis. Although these three toxic agents displayed a requirement for Bax, they did not promote PUMA induction. These results demonstrate that HDACIs block Bax-dependent cell death by two distinct mechanisms to prevent neuronal apoptosis, thus identifying for the first time a defined molecular target for their neuroprotective actions. PMID:19261878

  17. p53 activation by Ni(II) is a HIF-1α independent response causing caspases 9/3-mediated apoptosis in human lung cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, Victor C.; Morse, Jessica L.; Zhitkovich, Anatoly, E-mail: anatoly_zhitkovich@brown.edu

    2013-06-15

    Hypoxia mimic nickel(II) is a human respiratory carcinogen with a suspected epigenetic mode of action. We examined whether Ni(II) elicits a toxicologically significant activation of the tumor suppressor p53, which is typically associated with genotoxic responses. We found that treatments of H460 human lung epithelial cells with NiCl{sub 2} caused activating phosphorylation at p53-Ser15, accumulation of p53 protein and depletion of its inhibitor MDM4 (HDMX). Confirming the activation of p53, its knockdown suppressed the ability of Ni(II) to upregulate MDM2 and p21 (CDKN1A). Unlike DNA damage, induction of GADD45A by Ni(II) was p53-independent. Ni(II) also increased p53-Ser15 phosphorylation and p21more » expression in normal human lung fibroblasts. Although Ni(II)-induced stabilization of HIF-1α occurred earlier, it had no effect on p53 accumulation and Ser15 phosphorylation. Ni(II)-treated H460 cells showed no evidence of necrosis and their apoptosis and clonogenic death were suppressed by p53 knockdown. The apoptotic role of p53 involved a transcription-dependent program triggering the initiator caspase 9 and its downstream executioner caspase 3. Two most prominently upregulated proapoptotic genes by Ni(II) were PUMA and NOXA but only PUMA induction required p53. Knockdown of p53 also led to derepression of antiapoptotic MCL1 in Ni(II)-treated cells. Overall, our results indicate that p53 plays a major role in apoptotic death of human lung cells by Ni(II). Chronic exposure to Ni(II) may promote selection of resistant cells with inactivated p53, providing an explanation for the origin of p53 mutations by this epigenetic carcinogen. - Highlights: • Ni(II) is a strong activator of the transcription factor p53. • Apoptosis is a principal form of death by Ni(II) in human lung epithelial cells. • Ni(II)-activated p53 triggers caspases 9/3-mediated apoptotic program. • NOXA and PUMA are two main proapoptotic genes induced by Ni(II). • HIF-1α and p53 are

  18. [6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

    PubMed Central

    Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

    2006-01-01

    [6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

  19. Epigallocatechin-3-Gallate Prevents Autoimmune-Associated Down-Regulation of p21 in Salivary Gland Cells Through a p53-Independent Pathway

    PubMed Central

    Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen

    2015-01-01

    The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914

  20. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  1. Human rpL3 induces G₁/S arrest or apoptosis by modulating p21waf1/cip1 levels in a p53-independent manner

    PubMed Central

    Russo, Annapina; Esposito, Davide; Catillo, Morena; Pietropaolo, Concetta; Crescenzi, Elvira; Russo, Giulia

    2013-01-01

    It is now largely accepted that ribosomal proteins may be implicated in a variety of biological functions besides that of components of the translation machinery. Many evidences show that a subset of ribosomal proteins are involved in the regulation of the cell cycle and apoptosis through modulation of p53 activity. In addition, p53-independent mechanisms of cell cycle arrest in response to alterations of ribosomal proteins availability have been described. Here, we identify human rpL3 as a new regulator of cell cycle and apoptosis through positive regulation of p21 expression in a p53-independent system. We demonstrate that the rpL3-mediated p21 upregulation requires the specific interaction between rpL3 and Sp1. Furthermore, in our experimental system, p21 overexpression leads to a dual outcome, activating the G₁/S arrest of the cell cycle or the apoptotic pathway through mitochondria, depending on its intracellular levels. It is noteworthy that depletion of p21 abrogates both effects. Taken together, our findings unravel a novel extraribosomal function of rpL3 and reinforce the proapoptotic role of p21 in addition to its widely reported ability as an inhibitor of cell proliferation. PMID:23255119

  2. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    PubMed

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  3. Exercise-induced mitochondrial p53 repairs mtDNA mutations in mutator mice.

    PubMed

    Safdar, Adeel; Khrapko, Konstantin; Flynn, James M; Saleem, Ayesha; De Lisio, Michael; Johnston, Adam P W; Kratysberg, Yevgenya; Samjoo, Imtiaz A; Kitaoka, Yu; Ogborn, Daniel I; Little, Jonathan P; Raha, Sandeep; Parise, Gianni; Akhtar, Mahmood; Hettinga, Bart P; Rowe, Glenn C; Arany, Zoltan; Prolla, Tomas A; Tarnopolsky, Mark A

    2016-01-01

    Human genetic disorders and transgenic mouse models have shown that mitochondrial DNA (mtDNA) mutations and telomere dysfunction instigate the aging process. Epidemiologically, exercise is associated with greater life expectancy and reduced risk of chronic diseases. While the beneficial effects of exercise are well established, the molecular mechanisms instigating these observations remain unclear. Endurance exercise reduces mtDNA mutation burden, alleviates multisystem pathology, and increases lifespan of the mutator mice, with proofreading deficient mitochondrial polymerase gamma (POLG1). We report evidence for a POLG1-independent mtDNA repair pathway mediated by exercise, a surprising notion as POLG1 is canonically considered to be the sole mtDNA repair enzyme. Here, we show that the tumor suppressor protein p53 translocates to mitochondria and facilitates mtDNA mutation repair and mitochondrial biogenesis in response to endurance exercise. Indeed, in mutator mice with muscle-specific deletion of p53, exercise failed to prevent mtDNA mutations, induce mitochondrial biogenesis, preserve mitochondrial morphology, reverse sarcopenia, or mitigate premature mortality. Our data establish a new role for p53 in exercise-mediated maintenance of the mtDNA genome and present mitochondrially targeted p53 as a novel therapeutic modality for diseases of mitochondrial etiology.

  4. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

    PubMed

    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

    2005-12-08

    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  5. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  6. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy

  7. WNT activation by lithium abrogates TP53 mutation associated radiation resistance in medulloblastoma.

    PubMed

    Zhukova, Nataliya; Ramaswamy, Vijay; Remke, Marc; Martin, Dianna C; Castelo-Branco, Pedro; Zhang, Cindy H; Fraser, Michael; Tse, Ken; Poon, Raymond; Shih, David J H; Baskin, Berivan; Ray, Peter N; Bouffet, Eric; Dirks, Peter; von Bueren, Andre O; Pfaff, Elke; Korshunov, Andrey; Jones, David T W; Northcott, Paul A; Kool, Marcel; Pugh, Trevor J; Pomeroy, Scott L; Cho, Yoon-Jae; Pietsch, Torsten; Gessi, Marco; Rutkowski, Stefan; Bognár, Laszlo; Cho, Byung-Kyu; Eberhart, Charles G; Conter, Cecile Faure; Fouladi, Maryam; French, Pim J; Grajkowska, Wieslawa A; Gupta, Nalin; Hauser, Peter; Jabado, Nada; Vasiljevic, Alexandre; Jung, Shin; Kim, Seung-Ki; Klekner, Almos; Kumabe, Toshihiro; Lach, Boleslaw; Leonard, Jeffrey R; Liau, Linda M; Massimi, Luca; Pollack, Ian F; Ra, Young Shin; Rubin, Joshua B; Van Meir, Erwin G; Wang, Kyu-Chang; Weiss, William A; Zitterbart, Karel; Bristow, Robert G; Alman, Benjamin; Hawkins, Cynthia E; Malkin, David; Clifford, Steven C; Pfister, Stefan M; Taylor, Michael D; Tabori, Uri

    2014-12-24

    TP53 mutations confer subgroup specific poor survival for children with medulloblastoma. We hypothesized that WNT activation which is associated with improved survival for such children abrogates TP53 related radioresistance and can be used to sensitize TP53 mutant tumors for radiation. We examined the subgroup-specific role of TP53 mutations in a cohort of 314 patients treated with radiation. TP53 wild-type or mutant human medulloblastoma cell-lines and normal neural stem cells were used to test radioresistance of TP53 mutations and the radiosensitizing effect of WNT activation on tumors and the developing brain. Children with WNT/TP53 mutant medulloblastoma had higher 5-year survival than those with SHH/TP53 mutant tumours (100% and 36.6%±8.7%, respectively (p<0.001)). Introduction of TP53 mutation into medulloblastoma cells induced radioresistance (survival fractions at 2Gy (SF2) of 89%±2% vs. 57.4%±1.8% (p<0.01)). In contrast, β-catenin mutation sensitized TP53 mutant cells to radiation (p<0.05). Lithium, an activator of the WNT pathway, sensitized TP53 mutant medulloblastoma to radiation (SF2 of 43.5%±1.5% in lithium treated cells vs. 56.6±3% (p<0.01)) accompanied by increased number of γH2AX foci. Normal neural stem cells were protected from lithium induced radiation damage (SF2 of 33%±8% for lithium treated cells vs. 27%±3% for untreated controls (p=0.05). Poor survival of patients with TP53 mutant medulloblastoma may be related to radiation resistance. Since constitutive activation of the WNT pathway by lithium sensitizes TP53 mutant medulloblastoma cells and protect normal neural stem cells from radiation, this oral drug may represent an attractive novel therapy for high-risk medulloblastomas.

  8. p53 as a retrovirus-induced oxidative stress modulator.

    PubMed

    Kim, Soo Jin; Wong, Paul K Y

    2015-01-01

    Infection of astrocytes by the neuropathogenic mutant of Moloney murine leukemia virus, ts1, exhibits increased levels of reactive oxygen species (ROS) and signs of oxidative stress compared with uninfected astrocytes. Previously, we have demonstrated that ts1 infection caused two separate events of ROS upregulation. The first upregulation occurs during early viral establishment in host cells and the second during the virus-mediated apoptotic process. In this study, we show that virus-mediated ROS upregulation activates the protein kinase, ataxia telangiectasia mutated, which in turn phosphorylates serine 15 on p53. This activation of p53 however, is unlikely associated with ts1-induced cell death. Rather p53 appears to be involved in suppressing intracellular ROS levels in astrocytes under oxidative stress. The activated p53 appears to delay retroviral gene expression by suppressing NADPH oxidase, a superoxide-producing enzyme. These results suggest that p53 plays a role as a retrovirus-mediated oxidative stress modulator. © 2015 The Authors.

  9. C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19(Arf).

    PubMed

    Ewing, S J; Zhu, S; Zhu, F; House, J S; Smart, R C

    2008-11-01

    CCAAT/enhancer-binding protein-beta (C/EBPbeta) is a mediator of cell survival and tumorigenesis. When C/EBPbeta(-/-) mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19(Arf) and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19(Arf) is dramatically elevated in C/EBPbeta(-/-) epidermis and that C/EBPbeta represses a p19(Arf) promoter reporter. To determine whether p19(Arf) is responsible for the proapoptotic phenotype in C/EBPbeta(-/-) mice, C/EBPbeta(-/-);p19(Arf-/-) mice were generated. C/EBPbeta(-/-);p19(Arf-/-) mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19(Arf) is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPbeta(-/-) epidermis, we generated K14-ER:Ras;C/EBPbeta(-/-) mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPbeta(-/-) mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPbeta represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPbeta may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents.

  10. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies

    PubMed Central

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O.; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E.; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C.; Orlowski, Robert; Sarbassov, Dos D.; Lorenzi, Philip L.; Huang, Xuelin; Neelapu, Sattva S.; McDonnell, Timothy; Miranda, Roberto N.; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R. Eric.; Andreeff, Michael

    2016-01-01

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. PMID:26884599

  11. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies.

    PubMed

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael

    2016-02-16

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.

  12. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  13. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  14. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    PubMed Central

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

    2013-01-01

    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  15. Microbubble-assisted p53, RB, and p130 gene transfer in combination with radiation therapy in prostate cancer.

    PubMed

    Nande, Rounak; Greco, Adelaide; Gossman, Michael S; Lopez, Jeffrey P; Claudio, Luigi; Salvatore, Marco; Brunetti, Arturo; Denvir, James; Howard, Candace M; Claudio, Pier Paolo

    2013-06-01

    Combining radiation therapy and direct intratumoral (IT) injection of adenoviral vectors has been explored as a means to enhance the therapeutic potential of gene transfer. A major challenge for gene transfer is systemic delivery of nucleic acids directly into an affected tissue. Ultrasound (US) contrast agents (microbubbles) are viable candidates to enhance targeted delivery of systemically administered genes. Here we show that p53, pRB, and p130 gene transfer mediated by US cavitation of microbubbles at the tumor site resulted in targeted gene transduction and increased reduction in tumor growth compared to DU-145 prostate cancer cell xenografts treated intratumorally with adenovirus (Ad) or radiation alone. Microbubble-assisted/US-mediated Ad.p53 and Ad.RB treated tumors showed significant reduction in tumor volume compared to Ad.p130 treated tumors (p<0.05). Additionally, US mediated microbubble delivery of p53 and RB combined with external beam radiation resulted in the most profound tumor reduction in DU-145 xenografted nude mice (p<0.05) compared to radiation alone. These findings highlight the potential therapeutic applications of this novel image-guided gene transfer technology in combination with external beam radiation for prostate cancer patients with therapy resistant disease.

  16. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    PubMed

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  17. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  18. Apoptosis of haematopoietic cells upon thymidylate synthase inhibition is independent of p53 accumulation and CD95-CD95 ligand interaction.

    PubMed Central

    Muñoz-Pinedo, C; Oliver, F J; López-Rivas, A

    2001-01-01

    Treatment of haematopoietic BA/F3 cells with the thymidylate synthase inhibitor 5-fluoro-2'-deoxyuridine (FUdR) activated apoptosis through a mechanism that required continuous protein synthesis and was inhibited by Bcl-2 over-expression. Analysis of p53 levels in cells treated with FUdR indicated a marked accumulation of this protein. Accumulation of p53 was also observed in cells over-expressing Bcl-2. In BA/F3 cells transfected with a cDNA coding for the human papilloma virus protein E6, p53 accumulation after FUdR treatment was inhibited markedly. However, apoptosis was induced in both control and E6 cells to a similar extent. The role of the CD95/CD95 ligand (CD95L) system in FUdR-induced apoptosis was also assessed. As determined by reverse transcriptase PCR, BA/F3 expressed a low constitutive level of CD95L mRNA, which decreased following FUdR treatment. Moreover, blocking CD95-CD95L interactions with antagonistic CD95 monoclonal antibody did not prevent drug-induced apoptosis. Furthermore, analysis of caspase involvement showed important differences in apoptosis induced by CD95-triggering or FUdR treatment. In summary, these results suggest that apoptosis induced by thymineless stress in haematopoietic BA/F3 cells occurs by a mechanism that does not require accumulation of p53 and which is independent of CD95-CD95L interactions. PMID:11115403

  19. The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

  20. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity

    PubMed Central

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ. PMID:21911363

  1. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    PubMed

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  2. Inhibition of autophagy enhances DENSpm-induced apoptosis in human colon cancer cells in a p53 independent manner.

    PubMed

    Gurkan, Ajda Coker; Arisan, Elif Damla; Yerlikaya, Pinar Obakan; Ilhan, Halime; Unsal, Narcin Palavan

    2018-06-01

    One of the recently developed polyamine (PA) analogues, N 1 ,N 11 -diethylnorspermine (DENSpm), has been found to act as an apoptotic inducer in melanoma, breast, prostate and colon cancer cells. Also, its potential to induce autophagy has been established. Unfolded protein responses and starvation of amino acids are known to trigger autophagy. As yet, however, the molecular mechanism underlying PA deficiency-induced autophagy is not fully clarified. Here, we aimed to determine the apoptotic effect of DENSpm after autophagy inhibition by 3-methyladenine (3-MA) or siRNA-mediated Beclin-1 silencing in colon cancer cells. The apoptotic effects of DENSpm after 3-MA treatment or Beclin-1 silencing were determined by PI and AnnexinV/PI staining in conjunction with flow cytometry. Intracellular PA levels were measured by HPLC, whereas autophagy and the expression profiles of PA key players were determined in HCT116, SW480 and HT29 colon cancer cells by Western blotting. We found that DENSpm-induced autophagy was inhibited by 3-MA treatment and Beclin-1 silencing, and that apoptotic cell death was increased by PA depletion and spermidine/spermine N 1 -acetyltransferase (SSAT) upregulation. We also found that autophagy inhibition led to DENSpm-induced apoptosis through Atg5 down-regulation, p62 degradation and LC3 lipidation in both HCT116 and SW480 cells. p53 deficiency did not alter the response of the colon cancer cells to DENSpm-induced apoptotic cell death under autophagy suppression conditions. From our results we conclude that DENSpm-induced apoptotic cell death is increased when autophagy is inhibited by 3-MA or Beclin-1 siRNA through PA depletion and PA catabolic activation in colon cancer cells, regardless p53 mutation status.

  3. Photodynamic injury of isolated crayfish neuron and surrounding glial cells: the role of p53

    NASA Astrophysics Data System (ADS)

    Sharifulina, S. A.; Uzdensky, A. B.

    2015-03-01

    The pro-apoptotic transcription factor p53 is involved in cell responses to injurious impacts. Using its inhibitor pifithrin- α and activators tenovin-1, RITA and WR-1065, we studied its potential participation in inactivation and death of isolated crayfish mechanoreceptor neuron and satellite glial cells induced by photodynamic treatment, a strong inducer of oxidative stress. In dark, p53 activation by tenovin-1 or WR-1065 shortened activity of isolated neurons. Tenovin-1 and WR-1065 induced apoptosis of glial cells, whereas pifithrin-α was anti-apoptotic. Therefore, p53 mediated glial apoptosis and suppression of neuronal activity after axotomy. Tenovin-1 but not other p53 modulators induced necrosis of axotomized neurons and surrounding glia, possibly, through p53-independent pathway. Under photodynamic treatment, p53 activators tenovin-1 and RITA enhanced glial apoptosis indicating the pro-apoptotic activity of p53. Photoinduced necrosis of neurons and glia was suppressed by tenovin-1 and, paradoxically, by pifithrin-α. Modulation of photoinduced changes in the neuronal activity and necrosis of neurons and glia was possibly p53-independent. The different effects of p53 modulators on neuronal and glial responses to axotomy and photodynamic impact were apparently associated with different signaling pathways in neurons and glial cells.

  4. Depletion of Securin Induces Senescence After Irradiation and Enhances Radiosensitivity in Human Cancer Cells Regardless of Functional p53 Expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen Wenshu; Yu Yichu; Lee Yijang

    2010-06-01

    Purpose: Radiotherapy is one of the best choices for cancer treatment. However, various tumor cells exhibit resistance to irradiation-induced apoptosis. The development of new strategies to trigger cancer cell death besides apoptosis is necessary. This study investigated the role of securin in radiation-induced apoptosis and senescence in human cancer cells. Methods and Materials: Cell survival was determined using clonogenic assays. Western blot analysis was used to analyze levels of securin, caspase-3, PARP, p53, p21, Rb, gamma-H2AX, and phospho-Chk2. Senescent cells were analyzed using a beta-galactosidase staining assay. A securin-expressed vector (pcDNA-securin) was stably transfected into securin-null HCT116 cells. Securin genemore » knockdown was performed by small interfering RNA and small hairpin RNA in HCT116 and MDA-MB-231 cells, respectively. Results: Radiation was found to induce apoptosis in securin wild type HCT116 cells but induced senescence in securin-null cells. Restoration of securin reduced senescence and increased cell survival in securin-null HCT116 cells after irradiation. Radiation-induced gamma-H2AX and Chk2 phosphorylation were induced transiently in securin-wild-type cells but exhibited sustained activation in securin-null cells. Securin gene knockdown switches irradiation-induced apoptosis to senescence in both HCT116 p53-null and MDA-MB-231 cells. Conclusions: Our results demonstrated that the level of securin expression plays a determining role in the radiosensitivity and fate of cells. Depletion of securin impairs DNA repair after irradiation, increasing DNA damage and promoting senescence in the residual surviving cells regardless of functional p53 expression. The knockdown of securin may contribute to a novel radiotherapy protocol for the treatment of human cancer cells that are resistant to irradiation.« less

  5. hCLCA2 is a p53-inducible inhibitor of breast cancer cell proliferation

    PubMed Central

    Walia, Vijay; Ding, Ming; Kumar, Sumit; Nie, Daotai; Premkumar, Louis; Elble, Randolph C.

    2009-01-01

    hCLCA2 is frequently downregulated in breast cancer and is a candidate tumor suppressor gene. We show here that the hCLCA2 gene is strongly induced by p53 in response to DNA damage. Adenoviral expression of p53 induces hCLCA2 in a variety of breast cell lines. Further, we find that p53 binds to consensus elements in the hCLCA2 promoter and mutation of these sites abolishes p53-responsiveness and induction by DNA damage. Adenoviral transduction of hCLCA2 into immortalized cells induces p53, CDK inhibitors p21 and p27, and cell cycle arrest by 24 hours, and caspase induction and apoptosis by 40 hours post-infection. Transduction of the malignant tumor cell line BT549 on the other hand does not induce p53, p21, or p27 but instead induces apoptosis directly and more rapidly. Knockout and knockdown studies indicate that growth inhibition and apoptosis are signaled via multiple pathways. Conversely, suppression of hCLCA2 by RNA interference enhances proliferation of MCF10A and reduces sensitivity to doxorubicin. Gene expression profiles indicate that hCLCA2 levels are strongly predictive of tumor cell sensitivity to doxorubicin and other chemotherapeutics. Because certain Cl- channels are proposed to promote apoptosis by reducing intracellular pH, we tested whether, and established that, hCLCA2 enhances Cl- current in breast cancer cells and reduces pH to ∼6.7. These results reveal hCLCA2 as a novel p53-inducible growth inhibitor, explain how its downregulation confers a survival advantage to tumor cells, and suggest both prognostic and therapeutic applications. PMID:19654313

  6. Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

    PubMed

    Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

    2009-04-15

    The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

  7. Real-space analysis of radiation-induced specific changes with independent component analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borek, Dominika; Bromberg, Raquel; Hattne, Johan

    A method of analysis is presented that allows for the separation of specific radiation-induced changes into distinct components in real space. The method relies on independent component analysis (ICA) and can be effectively applied to electron density maps and other types of maps, provided that they can be represented as sets of numbers on a grid. Here, for glucose isomerase crystals, ICA was used in a proof-of-concept analysis to separate temperature-dependent and temperature-independent components of specific radiation-induced changes for data sets acquired from multiple crystals across multiple temperatures. ICA identified two components, with the temperature-independent component being responsible for themore » majority of specific radiation-induced changes at temperatures below 130 K. The patterns of specific temperature-independent radiation-induced changes suggest a contribution from the tunnelling of electron holes as a possible explanation. In the second case, where a group of 22 data sets was collected on a single thaumatin crystal, ICA was used in another type of analysis to separate specific radiation-induced effects happening on different exposure-level scales. Here, ICA identified two components of specific radiation-induced changes that likely result from radiation-induced chemical reactions progressing with different rates at different locations in the structure. In addition, ICA unexpectedly identified the radiation-damage state corresponding to reduced disulfide bridges rather than the zero-dose extrapolated state as the highest contrast structure. The application of ICA to the analysis of specific radiation-induced changes in real space and the data pre-processing for ICA that relies on singular value decomposition, which was used previously in data space to validate a two-component physical model of X-ray radiation-induced changes, are discussed in detail. This work lays a foundation for a better understanding of protein-specific radiation

  8. Expression of p53, p21 and cyclin D1 in penile cancer: p53 predicts poor prognosis.

    PubMed

    Gunia, Sven; Kakies, Christoph; Erbersdobler, Andreas; Hakenberg, Oliver W; Koch, Stefan; May, Matthias

    2012-03-01

    To evaluate the role of p53, p21 and cyclin D1 expression in patients with penile cancer (PC). Paraffin-embedded tissues from PC specimens from six pathology departments were subjected to a central histopathological review performed by one pathologist. The tissue microarray technique was used for immunostaining which was evaluated by two independent pathologists and correlated with cancer-specific survival (CSS). κ-statistics were used to assess interobserver variability. Uni- and multivariable Cox proportional hazards analysis was applied to assess the independent effects of several prognostic factors on CSS over a median of 32 months (IQR 6-66 months). Specimens and clinical data from 110 men treated surgically for primary PC were collected. p53 staining was positive in 30 and negative in 62 specimens. κ-statistics showed substantial interobserver reproducibility of p53 staining evaluation (κ=0.73; p<0.001). The 5-year CSS rate for the entire study cohort was 74%. Five-year CSS was 84% in p53-negative and 51% in p53-positive PC patients (p=0.003). Multivariable analysis showed p53 (HR=3.20; p=0.041) and pT-stage (HR=4.29; p<0.001) as independent significant prognostic factors for CSS. Cyclin D1 and p21 expression were not correlated with survival. However, incorporating p21 into a multivariable Cox model did contribute to improved model quality for predicting CSS. In patients with PC, the expression of p53 in the primary tumour specimen can be reproducibly assessed and is negatively associated with cancer specific survival.

  9. Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Sang Eun; Min, Yong Ki; Ha, Jae Du

    2007-07-06

    Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser{sup 6}, Ser{sup 15}, and Ser{sup 20}, which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21{sup WAF1/CIP}. Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular targetmore » of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent.« less

  10. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    PubMed

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  11. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    PubMed

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  12. p53 Loss synergizes with estrogen and papillomaviral oncogenes to induce cervical and breast cancers.

    PubMed

    Shai, Anny; Pitot, Henry C; Lambert, Paul F

    2008-04-15

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53(f/f) mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6(WT)p53(f/f) mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53(f/f) mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor alpha. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract.

  13. Proton induces apoptosis of hypoxic tumor cells by the p53-dependent and p38/JNK MAPK signaling pathways.

    PubMed

    Lee, Kheun Byeol; Kim, Kye-Ryung; Huh, Tae-Lin; Lee, You Mie

    2008-12-01

    Tumor hypoxia is a main obstacle for radiation therapy. To investigate whether exposure to a proton beam can overcome radioresistance in hypoxic tumor cells, three kinds of cancer cells, Lewis lung carcinoma (LLC) cells, hepatoma HepG2 and Molt-4 leukemia cells, were treated with a proton beam (35 MeV, 1, 2, 5, 10 Gy) in the presence or absence of hypoxia. Cell death rates were determined 72 h after irradiation. Hypoxic cells exposed to the proton beam underwent a typical apoptotic program, showing condensed nuclei, fragmented DNA ladders, and poly-ADP-ribose polymerase (PARP) cleavage. Fluorescence-activated cell sorter analysis revealed a significant increase in Annexin-V-positive cells. Cells treated with the proton beam and hypoxia displayed increased expression of p53, p21 and Bax, but decreased levels of phospho-Rb, Bcl-2 and XIAP, as well as activated caspase-9 and -3. The proton beam with hypoxia induced cell death in wild-type HCT116 cells, but not in a p53 knockout cell line, demonstrating a requirement for p53. As reactive oxygen species (ROS) were also significantly increased, apoptosis could also be abolished by treatment with the anti-oxidant N-acetyl cysteine (NAC). P38 mitogen-activated protein kinase (MAPK) and c-Jun N-terminal kinase (JNK) were activated by the treatment, and their respective DN mutants restored the cell death induced by either proton therapy alone or with hypoxia. In conclusion, proton beam treatment did not differently regulate cancer cell apoptosis either in normoxic or hypoxic conditions via a p53-dependent mechanism and by the activation of p38/JNK MAPK pathways through ROS.

  14. Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.

    2009-09-07

    The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expressionmore » levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.« less

  15. p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

    PubMed Central

    Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

  16. A stapled p53 helix overcomes HDMX-mediated suppression of p53.

    PubMed

    Bernal, Federico; Wade, Mark; Godes, Marina; Davis, Tina N; Whitehead, David G; Kung, Andrew L; Wahl, Geoffrey M; Walensky, Loren D

    2010-11-16

    Cancer cells neutralize p53 by deletion, mutation, proteasomal degradation, or sequestration to achieve a pathologic survival advantage. Targeting the E3 ubiquitin ligase HDM2 can lead to a therapeutic surge in p53 levels. However, the efficacy of HDM2 inhibition can be compromised by overexpression of HDMX, an HDM2 homolog that binds and sequesters p53. Here, we report that a stapled p53 helix preferentially targets HDMX, blocks the formation of inhibitory p53-HDMX complexes, induces p53-dependent transcriptional upregulation, and thereby overcomes HDMX-mediated cancer resistance in vitro and in vivo. Importantly, our analysis of p53 interaction dynamics provides a blueprint for reactivating the p53 pathway in cancer by matching HDM2, HDMX, or dual inhibitors to the appropriate cellular context. Copyright © 2010 Elsevier Inc. All rights reserved.

  17. Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Panta, Sushil; Yamakuchi, Munekazu; Kagoshima University Hospital, Kagoshima

    In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclearmore » localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β{sub 3}-integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β{sub 3}-integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β{sub 3}-integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β{sub 3}-integrin pathway in endothelial cells.« less

  18. Notch1 Signaling Sensitizes Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis in Human Hepatocellular Carcinoma Cells by Inhibiting Akt/Hdm2-mediated p53 Degradation and Up-regulating p53-dependent DR5 Expression*

    PubMed Central

    Wang, Chunmei; Qi, Runzi; Li, Nan; Wang, Zhengxin; An, Huazhang; Zhang, Qinghua; Yu, Yizhi; Cao, Xuetao

    2009-01-01

    Notch signaling plays a critical role in regulating cell proliferation, differentiation, and apoptosis. Our previous study showed that overexpression of Notch1 could inhibit human hepatocellular carcinoma (HCC) cell growth by arresting the cell cycle and inducing apoptosis. HCC cells are resistant to apoptotic induction by tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), so new therapeutic approaches have been explored to sensitize HCC cells to TRAIL-induced apoptosis. We are wondering whether and how Notch1 signaling can enhance the sensitivity of HCC cells to TRAIL-induced apoptosis. In this study, we found that overexpression of ICN, the constitutive activated form of Notch1, up-regulated p53 protein expression in HCC cells by inhibiting proteasome degradation. p53 up-regulation was further observed in human primary hepatocellular carcinoma cells after activation of Notch signaling. Inhibition of the Akt/Hdm2 pathway by Notch1 signaling was responsible for the suppression of p53 proteasomal degradation, thus contributing to the Notch1 signaling-mediated up-regulation of p53 expression. Accordingly, Notch1 signaling could make HCC cells more sensitive to TRAIL-induced apoptosis, whereas Notch1 signaling lost the synergistic promotion of TRAIL-induced apoptosis in p53-silenced HepG2 HCC cells and p53-defective Hep3B HCC cells. The data suggest that enhancement of TRAIL-induced apoptosis by Notch1 signaling is dependent upon p53 up-regulation. Furthermore, Notch1 signaling could enhance DR5 expression in a p53-dependent manner. Taken together, Notch1 signaling sensitizes TRAIL-induced apoptosis in HCC cells by inhibiting Akt/Hdm2-mediated p53 degradation and up-regulating p53-dependent DR5 expression. Thus, our results suggest that activation of Notch1 signaling may be a promising approach to improve the therapeutic efficacy of TRAIL-resistant HCC. PMID:19376776

  19. Insulin Protects Hepatic Lipotoxicity by Regulating ER Stress through the PI3K/Akt/p53 Involved Pathway Independently of Autophagy Inhibition.

    PubMed

    Ning, Hua; Sun, Zongxiang; Liu, Yunyun; Liu, Lei; Hao, Liuyi; Ye, Yaxin; Feng, Rennan; Li, Jie; Li, Ying; Chu, Xia; Li, Songtao; Sun, Changhao

    2016-04-19

    The detrimental role of hepatic lipotoxicity has been well-implicated in the pathogenesis of NAFLD. Previously, we reported that inhibiting autophagy aggravated saturated fatty acid (SFA)-induced hepatotoxicity. Insulin, a physiological inhibitor of autophagy, is commonly increased within NAFLD mainly caused by insulin resistance. We therefore hypothesized that insulin augments the sensitivity of hepatocyte to SFA-induced lipotoxicity. The present study was conducted via employing human and mouse hepatocytes, which were exposed to SFAs, insulin, or their combination. Unexpectedly, our results indicated that insulin protected hepatocytes against SFA-induced lipotoxicity, based on the LDH, MTT, and nuclear morphological measurements, and the detection from cleaved-Parp-1 and -caspase-3 expressions. We subsequently clarified that insulin led to a rapid and short-period inhibition of autophagy, which was gradually recovered after 1 h incubation in hepatocytes, and such extent of inhibition was insufficient to aggravate SFA-induced lipotoxicity. The mechanistic study revealed that insulin-induced alleviation of ER stress contributed to its hepatoprotective role. Pre-treating hepatocytes with insulin significantly stimulated phosphorylated-Akt and reversed SFA-induced up-regulation of p53. Chemical inhibition of p53 by pifithrin-α robustly prevented palmitate-induced cell death. The PI3K/Akt pathway blockade by its special antagonist abolished the protective role of insulin against SFA-induced lipotoxicity and p53 up-regulation. Furthermore, we observed that insulin promoted intracellular TG deposits in hepatocytes in the present of palmitate. However, blocking TG accumulation via genetically silencing DGAT-2 did not prevent insulin-protected lipotoxicity. Our study demonstrated that insulin strongly protected against SFA-induced lipotoxicity in hepatocytes mechanistically through alleviating ER stress via a PI3K/Akt/p53 involved pathway but independently from autophagy.

  20. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    PubMed

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    PubMed

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  2. Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells.

    PubMed

    Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae

    2014-02-14

    Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.

  3. Rosiglitazone enhances the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chiu, Shu-Jun, E-mail: chiusj@mail.tcu.edu.tw; Institute of Radiation Sciences, Tzu Chi Technology College, Hualien, Taiwan; Hsaio, Ching-Hui

    2010-04-09

    Combined-modality treatment has improved the outcome in cases of various solid tumors, and radiosensitizers are used to enhance the radiotherapeutic efficiency. Rosiglitazone, a synthetic ligand of peroxisome proliferator-activated receptors {gamma} used in the treatment of type-2 diabetes, has been shown to reduce tumor growth and metastasis in human cancer cells, and may have the potential to be used as a radiosensitizer in radiotherapy for human colorectal cancer cells. In this study, rosiglitazone treatment significantly reduced the cell viability of p53-wild type HCT116 cells but not p53-mutant HT-29 cells. Interestingly, rosiglitazone pretreatment enhanced radiosensitivity in p53-mutant HT-29 cells but not HCT116more » cells, and prolonged radiation-induced G{sub 2}/M arrest and enhanced radiation-induced cell growth inhibition in HT-29 cells. Pretreatment with rosiglitazone also suppressed radiation-induced H2AX phosphorylation in response to DNA damage and AKT activation for cell survival; on the contrary, rosiglitazone pretreatment enhanced radiation-induced caspase-8, -9, and -3 activation and PARP cleavage in HT-29 cells. In addition, pretreatment with a pan-caspase inhibitor, zVAD-fmk, attenuated the levels of caspase-3 activation and PARP cleavage in radiation-exposed cancer cells in combination with rosiglitazone pretreatment. Our results provide proof for the first time that rosiglitazone suppresses radiation-induced survival signals and DNA damage response, and enhances the radiation-induced apoptosis signaling cascade. These findings can assist in the development of rosiglitazone as a novel radiosensitizer.« less

  4. Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells

    PubMed Central

    2011-01-01

    Background Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. Results We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. Conclusions we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by

  5. Essential role of caspase-8 in p53/p73-dependent apoptosis induced by etoposide in head and neck carcinoma cells.

    PubMed

    Liu, Juan; Uematsu, Hiroshi; Tsuchida, Nobuo; Ikeda, Masa-Aki

    2011-07-31

    Caspase-8 is a key upstream mediator in death receptor-mediated apoptosis and also participates in mitochondria-mediated apoptosis via cleavage of proapoptotic Bid. However, the role of caspase-8 in p53- and p73-dependent apoptosis induced by genotoxic drugs remains unclear. We recently reported that the reconstitution of procaspase-8 is sufficient for sensitizing cisplatin- but not etoposide-induced apoptosis, in chemoresistant and caspase-8 deficient HOC313 head and neck squamous cell carcinoma (HNSCC) cells. We show that p53/p73-dependent caspase-8 activation is required for sensitizing etoposide-induced apoptosis by utilizing HOC313 cells carrying a temperature-sensitive p53G285K mutant. Restoration of wild-type p53 function under the permissive conditions, together with etoposide treatment, led to substantial transcriptional activation of proapoptotic Noxa and PUMA, but failed to induce apoptosis. In addition to p53 restoration, caspase-8 reconstitution was needed for sensitization to etoposide-induced apoptosis, mitochondria depolarization, and cleavage of the procaspases-3, and -9. In etoposide-sensitive Ca9-22 cells carrying a temperature-insensitive mutant p53, siRNA-based p73 knockdown blocked etoposide-induced apoptosis and procaspase-8 cleavage. However, induction of p73 protein and up-regulation of Noxa and PUMA, although observed in Ca9-22 cells, were hardly detected in etoposide-treated HOC313 cells under non-permissive conditions, suggesting a contribution of p73 reduction to etoposide resistance in HOC313 cells. Finally, the caspase-9 inhibitor Ac-LEHD-CHO or caspase-9 siRNA blocked etoposide-induced caspase-8 activation, Bid cleavage, and apoptosis in both cell lines, indicating that p53/p73-dependent caspase-8 activation lies downstream of mitochondria. we conclude that p53 and p73 can act as upstream regulators of caspase-8, and that caspase-8 is an essential mediator of the p53/p73-dependent apoptosis induced by etoposide in HNSCC cells. Our

  6. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  7. Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.

    PubMed

    Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang

    2016-08-01

    Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.

    PubMed

    Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand

    2017-09-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.

  9. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis

    PubMed Central

    Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli

    2017-01-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745

  10. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest

    PubMed Central

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-01-01

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest. PMID:26512957

  11. A p53-independent damage-sensing mechanism that functions as a checkpoint at the G1/S transition in Chinese hamster ovary cells

    PubMed Central

    Lee, Hoyun; Larner, James M.; Hamlin, Joyce L.

    1997-01-01

    In response to a moderate dose of radiation, asynchronous mammalian cell populations rapidly and transiently down-regulate the rate of DNA synthesis to ≈50% of preirradiation values. We show here that only half of the reduction in overall replication rate can be accounted for by direct inhibition of initiation at origins in S-phase cells. The other half results from the operation of a newly defined cell cycle checkpoint that functions at the G1/S transition. This checkpoint senses damage incurred at any time during the last 2 hr of G1 and effectively prevents entry into the S period. The G1/S and S-phase checkpoints are both p53-independent and, unlike the p53-mediated G1 checkpoint, respond rapidly to radiation, suggesting that they may represent major damage-sensing mechanisms connecting the replication machinery with DNA repair pathways. PMID:9012817

  12. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Metformin and Resveratrol Inhibited High Glucose-Induced Metabolic Memory of Endothelial Senescence through SIRT1/p300/p53/p21 Pathway

    PubMed Central

    Gao, Haiyang; Xu, Ruixia; Teng, Siyong; Wu, Yongjian

    2015-01-01

    Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as “metabolic memory.” Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and how “metabolic memory” would affect endothelial senescence through SIRT1 signaling remains largely unknown. In this study, we investigated the involvement of SIRT1 axis as well as the protective effects of resveratrol (RSV) and metformin (MET), two potent SIRT1 activators, during the occurrence of “metabolic memory” of cellular senescence (senescent “memory”). Human umbilical vascular endothelial cells (HUVECs) were cultured in either normal glucose (NG)/high glucose (HG) media for 6 days, or 3 days of HG followed by 3 days of NG (HN), with or without RSV or MET treatment. It was shown that HN incubation triggered persistent downregulation of deacetylase SIRT1 and upregulation of acetyltransferase p300, leading to sustained hyperacetylation (at K382) and activation of p53, and subsequent p53/p21-mediated senescent “memory.” In contrast, senescent “memory” was abrogated by overexpression of SIRT1 or knockdown of p300. Interestingly, we found that SIRT1 and p300 could regulate each other in response to HN stimulation, suggesting that a delicate balance between acetyltransferases and deacetylases may be particularly important for sustained acetylation and activation of non-histone proteins (such as p53), and eventually the occurrence of “metabolic memory.” Furthermore, we found that RSV or MET treatment prevented senescent “memory” by modulating SIRT1/p300/p53/p21 pathway. Notably, early and continuous treatment of MET, but not RSV, was particularly important for preventing senescent “memory.” In conclusion, short-term high glucose stimulation could induce sustained endothelial senescence via SIRT

  14. p53 adenoviral vector (Ad-CMV-p53) induced prostatic growth inhibition of primary cultures of human prostate and an experimental rat model.

    PubMed

    Shirakawa, T; Gotoh, A; Gardner, T A; Kao, C; Zhang, Z J; Matsubara, S; Wada, Y; Hinata, N; Fujisawa, M; Hanioka, K; Matsuo, M; Kamidono, S

    2000-01-01

    Benign prostatic hyperplasia (BPH) is the most common proliferative disease affecting men. Numerous minimally invasive technologies are being developed or are currently in use to obviate the need for transurethral surgery. The goal of the present study was to develop a novel molecular based approach for the treatment of BPH using recombinant p53 adenoviral vector. The over-expression of wt-p53 can cause cell apoptosis or cell growth arrest, thus preventing the uncontrolled cell proliferation underlying BPH pathophysiology. Ad-CMV-p53, a replication-deficient recombinant adenovirus containing cytomegalovirus promoter driving p53 gene, was used. Human prostate stromal (PS) cells were evaluated for apoptosis (TUNEL assay), mRNA levels of key cell cycle regulators influencing apoptosis (p-53, Bax and Bcl-2) using quantitative RT-PCR and cytotoxicity after Ad-CMV-p53. Ad-CMV-p53 was unilaterally injected into rat ventral prostates and growth inhibition was measured by prostate weight 3 weeks after injection. In vitro exposure to Ad-CMV-p53 significantly inhibited the proliferation of PS cells, induced mRNA over-expression of both wt-p53 and Bax, and increased the proportion of apoptotic cells. A 30% decrease in average prostate weight was demonstrated in rodents after Ad-CMV-p53 injection. The results suggest that further investigation of molecular gene therapy with recombinant wt-p53 adenovirus for the treatment of BPH is warranted.

  15. Depletion of histone N-terminal-acetyltransferase Naa40 induces p53-independent apoptosis in colorectal cancer cells via the mitochondrial pathway.

    PubMed

    Pavlou, Demetria; Kirmizis, Antonis

    2016-03-01

    Protein N-terminal acetylation is an abundant post-translational modification in eukaryotes implicated in various fundamental cellular and biochemical processes. This modification is catalysed by evolutionarily conserved N-terminal acetyltransferases (NATs) whose deregulation has been linked to cancer development and thus, are emerging as useful diagnostic and therapeutic targets. Naa40 is a highly selective NAT that acetylates the amino-termini of histones H4 and H2A and acts as a sensor of cell growth in yeast. In the present study, we examine the role of Naa40 in cancer cell survival. We demonstrate that depletion of Naa40 in HCT116 and HT-29 colorectal cancer cells decreases cell survival by enhancing apoptosis, whereas Naa40 reduction in non-cancerous mouse embryonic fibroblasts has no effect on cell viability. Specifically, Naa40 knockdown in colon cancer cells activates the mitochondrial caspase-9-mediated apoptotic cascade. Consistent with this, we show that caspase-9 activation is required for the induced apoptosis because treatment of cells with an irreversible caspase-9 inhibitor impedes apoptosis when Naa40 is depleted. Furthermore, the effect of Naa40-depletion on cell-death is mediated through a p53-independent mechanism since p53-null HCT116 cells still undergo apoptosis upon reduction of the acetyltransferase. Altogether, these findings reveal an anti-apoptotic role for Naa40 and exhibit its potential as a therapeutic target in colorectal cancers.

  16. p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

    PubMed

    Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

    2018-03-06

    Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

  17. Enhancement of P53-Mutant Human Colorectal Cancer Cells Radiosensitivity by Flavonoid Fisetin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen Wenshu; Lee Yijang; Yu Yichu

    Purpose: The aim of this study was to investigate whether fisetin is a potential radiosensitizer for human colorectal cancer cells, which are relatively resistant to radiotherapy. Methods and Materials: Cell survival was examined by clonogenic survival assay, and DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay. The effects of treatments on cell cycle distribution and apoptosis were examined by flow cytometry. Western blot analysis was performed to ascertain the protein levels of {gamma}-H2AX, phospho-Chk2, active caspase-3, PARP cleavage, phospho-p38, phospho-AKT, and phospho-ERK1/2. Results: Fisetin pretreatment enhanced the radiosensitivity of p53-mutant HT-29 human colorectal cancer cellsmore » but not human keratocyte HaCaT cells; it also prolonged radiation-induced G{sub 2}/M arrest, enhanced radiation-induced cell growth arrest in HT-29 cells, and suppressed radiation-induced phospho-H2AX (Ser-139) and phospho-Chk2 (Thr-68) in p53-mutant HT-29 cells. Pretreatment with fisetin enhanced radiation-induced caspase-dependent apoptosis in HT-29 cells. Fisetin pretreatment augmented radiation-induced phosphorylation of p38 mitogen-activated protein kinase, which is involved in caspase-mediated apoptosis, and SB202190 significantly reduced apoptosis and radiosensitivity in fisetin-pretreated HT-29 cells. By contrast, both phospho-AKT and phospho-ERK1/2, which are involved in cell proliferation and antiapoptotic pathways, were suppressed after irradiation combined with fisetin pretreatment. Conclusions: To our knowledge, this study is the first to provide evidence that fisetin exerts a radiosensitizing effect in p53-mutant HT-29 cells. Fisetin could potentially be developed as a novel radiosensitizer against radioresistant human cancer cells.« less

  18. Disruption of NAD(P)H:quinone oxidoreductase 1 gene in mice leads to radiation induced myeloproliferative disease

    PubMed Central

    Iskander, Karim; Barrios, Roberto J.; Jaiswal, Anil K.

    2008-01-01

    NAD(P)H:quinone oxidoreductase1-null (NQO1-/-) mice exposed to 3 grays of γ-radiation demonstrated an increase in neutrophils, bone marrow hypercellularity, and enlarged lymph nodes and spleen. The spleen showed disrupted follicular structure, loss of red pulp, and granulocyte and megakarocyte invasion. Blood and histological analysis did not show any sign of infection in mice. These results suggested that exposure of NQO1-/- mice to γ-radiation led to myeloproliferative disease. Radiation-induced myeloproliferative disease was observed in 74% of NQO1-/- mice as compared to none in wild type mice. NQO1-/- mice exposed to γ-radiation also demonstrated tissues lymphoma (32%) and lung adenocarcinoma (84%). In contrast, only 11% wild type mice showed lymphoma and none showed lung adenocarcinoma. Exposure of NQO1-/- mice to γ-radiation resulted in reduced apoptosis in granulocytes and lack of induction of p53, p21, and Bax. NQO1-/- mice also demonstrated increased expression of myeloid differentiation factors C/EBPα and Pu.1. Intriguingly, exposure of NQO1-/- mice to γ-radiation failed to induce C/EBPα and Pu.1, as was observed in wild type mice. These results suggest that decreased p53/apoptosis and increased Pu.1 and C/EBPα led to myeloid hyperplasia in NQO1-/- mice. The lack of induction of apoptosis and differentiation contributed to radiation-induced myeloproliferative disease in NQO1-/- mice. PMID:18829548

  19. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    PubMed

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 <3.0 μmol/l) were identified within established (4/9) and primary patient-derived (2/5) CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC

  20. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    PubMed

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  1. Epigenetic inactivation of the p53-induced long noncoding RNA TP53 target 1 in human cancer

    PubMed Central

    Diaz-Lagares, Angel; Crujeiras, Ana B.; Lopez-Serra, Paula; Soler, Marta; Setien, Fernando; Goyal, Ashish; Sandoval, Juan; Hashimoto, Yutaka; Martinez-Cardús, Anna; Gomez, Antonio; Heyn, Holger; Moutinho, Catia; Espada, Jesús; Vidal, August; Paúles, Maria; Galán, Maica; Sala, Núria; Akiyama, Yoshimitsu; Martínez-Iniesta, María; Farré, Lourdes; Villanueva, Alberto; Gross, Matthias; Diederichs, Sven; Guil, Sonia; Esteller, Manel

    2016-01-01

    Long noncoding RNAs (lncRNAs) are important regulators of cellular homeostasis. However, their contribution to the cancer phenotype still needs to be established. Herein, we have identified a p53-induced lncRNA, TP53TG1, that undergoes cancer-specific promoter hypermethylation-associated silencing. In vitro and in vivo assays identify a tumor-suppressor activity for TP53TG1 and a role in the p53 response to DNA damage. Importantly, we show that TP53TG1 binds to the multifaceted DNA/RNA binding protein YBX1 to prevent its nuclear localization and thus the YBX1-mediated activation of oncogenes. TP53TG1 epigenetic inactivation in cancer cells releases the transcriptional repression of YBX1-targeted growth-promoting genes and creates a chemoresistant tumor. TP53TG1 hypermethylation in primary tumors is shown to be associated with poor outcome. The epigenetic loss of TP53TG1 therefore represents an altered event in an lncRNA that is linked to classical tumoral pathways, such as p53 signaling, but is also connected to regulatory networks of the cancer cell. PMID:27821766

  2. p53-Regulated Apoptosis Is Differentiation Dependent in Ultraviolet B-Irradiated Mouse Keratinocytes

    PubMed Central

    Tron, Victor A.; Trotter, Martin J.; Tang, Liren; Krajewska, Maryla; Reed, John C.; Ho, Vincent C.; Li, Gang

    1998-01-01

    Previous studies from our laboratory, using p53 transgenic mice, have suggested that ultraviolet (UV) light-induced keratinocyte apoptosis in the skin is not affected by overexpression of mutant p53 protein. To further elucidate a possible role for p53 in UV-induced keratinocyte cell death, we now examine apoptosis in skin and isolated keratinocytes from p53 null (−/−) mice and assess the influence of cell differentiation on this process. In vivo, using this knockout model, epidermal keratinocytes in p53−/− mice exhibited only a 5.2-fold increase in apoptosis after 2000 J/m2 UVB irradiation compared with a 26.3-fold increase in normal control animals. If this p53-dependent apoptosis is important in elimination of precancerous, UV-damaged keratinocytes, then it should be active in the undifferentiated cells of the epidermal basal layer. To test this hypothesis, we examined the effect of differentiation on UV-induced apoptosis in primary cultures of murine and human keratinocytes. Apoptosis was p53-independent in undifferentiated murine keratinocytes, which exhibited relative resistance to UVB-induced killing with only a 1.5-fold increase in apoptosis in p53+/+ cells and a 1.4-fold increase in p53−/− cells. Differentiated keratinocytes, in contrast, showed a 9.4-fold UVB induction of apoptosis in p53+/+ cells, almost three times the induction observed in p53−/− cells. This UV-induced difference in apoptosis was observed when keratinocytes were cultured on type IV collagen substrate, but not on plastic alone. Western blotting of UV-irradiated, differentiated keratinocytes did not support a role for either Bax or Bcl-2 in this process. In support of these findings in mice, cell death in human cultured keratinocytes also occurred in a differentiation-associated fashion. We conclude that p53-induced apoptosis eliminates damaged keratinocytes in the differentiated cell compartment, but this mechanism is not active in the basal, undifferentiated cells and

  3. Novel MDM2 inhibitor SAR405838 (MI-773) induces p53-mediated apoptosis in neuroblastoma

    PubMed Central

    Lu, Jiaxiong; Guan, Shan; Zhao, Yanling; Yu, Yang; Wang, Yongfeng; Shi, Yonghua; Mao, Xinfang; Yang, Kristine L.; Sun, Wenjing; Xu, Xin; Yi, Joanna S.; Yang, Tianshu; Yang, Jianhua; Nuchtern, Jed G.

    2016-01-01

    Neuroblastoma (NB), which accounts for about 15% of cancer-related mortality in children, is the most common childhood extracranial malignant tumor. In NB, somatic mutations of the tumor suppressor, p53, are exceedingly rare. Unlike in adult tumors, the majority of p53 downstream functions are still intact in NB cells with wild-type p53. Thus, restoring p53 function by blocking its interaction with p53 suppressors such as MDM2 is a viable therapeutic strategy for NB treatment. Herein, we show that MDM2 inhibitor SAR405838 is a potent therapeutic drug for NB. SAR405838 caused significantly decreased cell viability of p53 wild-type NB cells and induced p53-mediated apoptosis, as well as augmenting the cytotoxic effects of doxorubicin (Dox). In an in vivo orthotopic NB mouse model, SAR405838 induced apoptosis in NB tumor cells. In summary, our data strongly suggest that MDM2-specific inhibitors like SAR405838 may serve not only as a stand-alone therapy, but also as an effective adjunct to current chemotherapeutic regimens for treating NB with an intact MDM2-p53 axis. PMID:27764791

  4. Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

    PubMed Central

    2012-01-01

    Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

  5. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    PubMed

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

    PubMed

    Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

    2015-03-01

    Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

  7. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    PubMed

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  8. INGN 201: Ad-p53, Ad5CMV-p53, adenoviral p53, p53 gene therapy--introgen, RPR/INGN 201.

    PubMed

    2007-01-01

    programme to eligible LFS patients who have relapsed after standard treatment as part of physician-sponsored protocols at qualifying institutions in the US.A worldwide, exclusive license to a family of US patents covering a combination therapy comprised of INGN 201 in combination with several inhibitors of epidermal growth factor receptors (EGFr) such as Erbituxtrade mark Vectibixtrade mark and Tarcevatrade mark was granted to Introgen by The University of Texas MD Anderson Cancer Center in November 2006. In February 2006, Introgen exclusively licenced a broad patent (US Patent No. 6 989 375), originally issued to to the Board of Regents of The University of Texas System; the patent covers any therapeutic gene-based therapy when applied in combination with conventional cancer therapy such as radiation or chemotherapy. Introgen Therapeutics was awarded a patent from the US Patent and Trademark Office in June 2005 that directly covers many of the special features of its INGN 201 molecular therapy. US Patent No. 6,905,873 is one of a family of patents that cover INGN 201 that have been issued to the Board of Regents of The University of Texas System and exclusively licensed to Introgen. To date, Introgen controls 30 issued patents relevant to the product covering compositions, therapeutic methods of administering the product in virtually any form, alone and in conjunction with the most widely used chemotherapeutic and radiation treatments, as well as its production, and has a large number of pending patent applications in the US and in foreign countries relating to its ADVEXIN((R)) therapy. In December 2004, the US Patent and Trademark Office issued Patent No. 6,830,749 entitled Recombinant p53 Adenovirus Methods and Compositions. Importantly, the patent is the broadest adenoviral p53 patent to date, covering any adenovirus carrying the p53 gene under the control of any promoter. Previously, Patent No. 6,805,858 covering methods for the administration of INGN 201 to cancer

  9. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  10. Regulation of autophagy by cytoplasmic p53

    PubMed Central

    Tasdemir, Ezgi; Maiuri, M. Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M.; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2009-01-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that knockout, knockdown or pharmacological inhibition of p53 can induce autophagy in human, mouse and nematode cells. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53-/- cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53. PMID:18454141

  11. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    PubMed

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  12. Aciculatin Induces p53-Dependent Apoptosis via MDM2 Depletion in Human Cancer Cells In Vitro and In Vivo

    PubMed Central

    Lai, Chin-Yu; Tsai, An-Chi; Chen, Mei-Chuan; Chang, Li-Hsun; Sun, Hui-Lung; Chang, Ya-Ling; Chen, Chien-Chih

    2012-01-01

    Aciculatin, a natural compound extracted from the medicinal herb Chrysopogon aciculatus, shows potent anti-cancer potency. This study is the first to prove that aciculatin induces cell death in human cancer cells and HCT116 mouse xenografts due to G1 arrest and subsequent apoptosis. The primary reason for cell cycle arrest and cell death was p53 accumulation followed by increased p21 level, dephosphorylation of Rb protein, PUMA expression, and induction of apoptotic signals such as cleavage of caspase-9, caspase-3, and PARP. We demonstrated that p53 allele-null (−/−) (p53-KO) HCT116 cells were more resistant to aciculatin than cells with wild-type p53 (+/+). The same result was achieved by knocking down p53 with siRNA in p53 wild-type cells, indicating that p53 plays a crucial role in aciculatin-induced apoptosis. Although DNA damage is the most common event leading to p53 activation, we found only weak evidence of DNA damage after aciculatin treatment. Interestingly, the aciculatin-induced downregulation of MDM2, an important negative regulator of p53, contributed to p53 accumulation. The anti-cancer activity and importance of p53 after aciculatin treatment were also confirmed in the HCT116 xenograft models. Collectively, these results indicate that aciculatin treatment induces cell cycle arrest and apoptosis via inhibition of MDM2 expression, thereby inducing p53 accumulation without significant DNA damage and genome toxicity. PMID:22912688

  13. Regulation of autophagy by cytoplasmic p53.

    PubMed

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  14. Caspase-independent cell death mediated by apoptosis-inducing factor (AIF) nuclear translocation is involved in ionizing radiation induced HepG2 cell death

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Hengwen; Yang, Shana; Li, Jianhua

    Hepatocellular carcinoma (HCC) is the fifth most common cancer in the world. The aim of radiotherapy is to eradicate cancer cells with ionizing radiation. Except for the caspase-dependent mechanism, several lines of evidence demonstrated that caspase-independent mechanism is directly involved in the cell death responding to irradiation. For this reason, defining the contribution of caspase-independent molecular mechanisms represents the main goal in radiotherapy. In this study, we focused on the role of apoptosis-inducing factor (AIF), the caspase-independent molecular, in ionizing radiation induced hepatocellular carcinoma cell line (HepG2) cell death. We found that ionizing radiation has no function on AIF expressionmore » in HepG2 cells, but could induce AIF release from the mitochondria and translocate into nuclei. Inhibition of AIF could reduce ionizing radiation induced HepG2 cell death. These studies strongly support a direct relationship between AIF nuclear translocation and radiation induced cell death. What's more, AIF nuclear translocation is caspase-independent manner, but not caspase-dependent manner, in this process. These new findings add a further attractive point of investigation to better define the complex interplay between caspase-independent cell death and radiation therapy. - Highlights: • AIF nuclear translocation is involved in ionizing radiation induced hepatocellular carcinoma cell line HepG2 cell death. • AIF mediated cell death induced by ionizing radiation is caspase-independent. • Caspase-independent pathway is involved in ionzing radiation induced HepG2 cell death.« less

  15. Effects of p53 on aldosterone-induced mesangial cell apoptosis in vivo and in vitro.

    PubMed

    Shi, Huimin; Zhang, Aiqing; He, Yanfang; Yang, Min; Gan, Weihua

    2016-06-01

    Aldosterone (ALD) is a well‑known hormone, which may initiate renal injury by inducing mesangial cell (MC) injury in chronic kidney disease (CKD); however, the molecular mechanism remains unknown. The aim of the present study was to investigate the effects of p53 on ALD‑induced MC apoptosis and elucidate the underlying molecular mechanism. For the in vivo studies, rats were randomly assigned to receive normal saline or ALD for 4 weeks. The ratio of MC apoptosis was analysed by terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay. In addition, the expression level and localisation of p53, a well-known cell apoptosis-associated key protein, were detected by immunofluorescence. For the in vitro studies, rat MCs were incubated in medium containing either buffer (control) or ALD (10‑6 M) for 24 h. The cell apoptosis ratio was assessed by flow cytometry, and the expression level of p53 was assessed by reverse transcription quantitative polymerase chain reaction and western blotting. In order to confirm the role of p53 in ALD‑regulated cell apoptosis, a rescue experiment was performed using targeted small interfering (si)RNA to downregulate the expression of p53. The ALD‑treated rats exhibited greater numbers of TUNEL‑positive MCs and higher expression levels of p53 when compared with the control group. Furthermore, the ratio of MC apoptosis and the p53 expression level were significantly increased following ALD exposure, compared with the control group. Additionally, in the rescue experiment, the effects of ALD on MC were blocked by downregulating the expression level of p53 in MCs. The present study hypothesized that ALD may directly contribute to the occurrence of MC apoptosis via p53, which may participate in ALD-induced renal injury.

  16. Stimulation of autophagy by the p53 target gene Sestrin2.

    PubMed

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  17. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR

    PubMed Central

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2010-01-01

    Summary The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca2+-independent-phospholipase A2 (iPLA2). We previously reported that inhibition of iPLA2 arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA2 induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA2. The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA2-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway. PMID:18032786

  18. The increase of cell-membranous phosphatidylcholines containing polyunsaturated fatty acid residues induces phosphorylation of p53 through activation of ATR.

    PubMed

    Zhang, Xu Hannah; Zhao, Chunying; Ma, Zhongmin Alex

    2007-12-01

    The G1 phase of the cell cycle is marked by the rapid turnover of phospholipids. This turnover is regulated by CTP:phosphocholine-cytidylyltransferase (CCT) and group VIA Ca(2+)-independent-phospholipase A(2) (iPLA(2)). We previously reported that inhibition of iPLA(2) arrests cells in G1 phase of the cell cycle by activating the p53-p21 checkpoint. Here we further characterize the mechanism of p53 activation. We show that specific inhibition of iPLA(2) induces a time dependent phosphorylation of Ser15 in p53 in the absence of DNA damage. This phosphorylation requires the kinase ataxia-telangiectasia and Rad-3-related (ATR) but not the ataxia-telangiectasia-mutated (ATM) kinase. Moreover, we identify in cell membranes a significant increase of phosphatidylcholines (PCs) containing chains of polyunsaturated fatty acids and a decrease of PCs containing saturated fatty acids in response to inhibition of iPLA(2). The time course of phosphorylation of Ser15 in p53 correlates with increasing levels of PCs containing polyunsaturated fatty acids. We further demonstrate that the PCs with linoleic acid in their sn-2 position (18:2n6) induce phosphorylation of Ser15 in p53 in an ATR-dependent manner. Our findings establish that cells can regulate the levels of polyunsaturated fatty acids in phospholipids through iPLA(2)-mediated deacylation of PCs. Disruption of this regulation increases the proportions of PCs containing polyunsaturated fatty acids and activates the ATR-p53 signalling pathway.

  19. p53 Involvement in the Control of Murine Hair Follicle Regression

    PubMed Central

    Botchkarev, Vladimir A.; Komarova, Elena A.; Siebenhaar, Frank; Botchkareva, Natalia V.; Sharov, Andrei A.; Komarov, Pavel G.; Maurer, Marcus; Gudkov, Andrei V.; Gilchrest, Barbara A.

    2001-01-01

    p53 is a transcription factor mediating a variety of biological responses including apoptotic cell death. p53 was recently shown to control apoptosis in the hair follicle induced by ionizing radiation and chemotherapy, but its role in the apoptosis-driven physiological hair follicle regression (catagen) remains to be elucidated. Here, we show that p53 protein is strongly expressed and co-localized with apoptotic markers in the regressing hair follicle compartments during catagen. In contrast to wild-type mice, p53 knockout mice show significant retardation of catagen accompanied by significant decrease in the number of apoptotic cells in the hair matrix. Furthermore, p53 null hair follicles are characterized by alterations in the expression of markers that are encoded by p53 target genes and are implicated in the control of catagen (Bax, Bcl-2, insulin-like growth factor binding protein-3). These data suggest that p53 is involved in the control of apoptosis in the hair follicle during physiological regression and imply that p53 antagonists may be useful for the management of hair growth disorders characterized by premature entry into catagen, such as androgenetic alopecia, alopecia areata, and telogen effluvium. PMID:11395365

  20. A butyrolactone derivative suppressed lipopolysaccharide-induced autophagic injury through inhibiting the autoregulatory loop of p8 and p53 in vascular endothelial cells.

    PubMed

    Meng, Ning; Zhao, Jing; Su, Le; Zhao, Baoxiang; Zhang, Yun; Zhang, Shangli; Miao, Junying

    2012-02-01

    Lipopolysaccharide (LPS)-induced vascular endothelial cell (VEC) dysfunction is an important contributing factor in vascular diseases. Recently, we found that LPS impaired VEC by inducing autophagy. Our previous researches showed that a butyrolactone derivative, 3-benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one (3BDO) selectively protected VEC function. The objective of the present study is to investigate whether and how 3BDO inhibits LPS-induced VEC autophagic injury. Our results showed that LPS induced autophagy and led to increase of reactive oxygen species (ROS) and decrease of mitochondrial membrane potential (MMP) in Human umbilical vein vascular endothelial cells (HUVECs). Furthermore, LPS significantly increased p8 and p53 protein levels and the nuclear translocation of p53. All of these effects of LPS on HUVECs were strongly inhibited by 3BDO. Importantly, the ROS scavenger N-acetylcysteine (NAC) could inhibited LPS-induced autophagy and knockdown of p8 by RNA interference inhibited the autophagy, p53 protein level increase, the translocation of p53 into nuclei and the ROS level increase induced by LPS in HUVECs. The data suggested that 3BDO inhibited LPS-induced autophagy in HUVECs through inhibiting the ROS overproduction, the increase of p8 and p53 expression and the nuclear translocation of p53. Our findings provide a potential tool for understanding the mechanism underlying LPS-induced autophagy in HUVECs and open the door to a novel therapeutic drug for LPS-induced vascular diseases. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  2. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    PubMed Central

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  3. AAVPG: A vigilant vector where transgene expression is induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

  4. TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ding, Li; College of Life Sciences, Hainan Normal University, Haikou, Hainan 571158; Huang, Yong

    2014-03-07

    Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressedmore » cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence.« less

  5. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    PubMed Central

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  6. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

    2011-01-01

    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

  7. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    PubMed

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  8. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    PubMed

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  9. Low dose arsenite confers resistance to UV induced apoptosis via p53-MDM2 pathway in ketatinocytes

    PubMed Central

    Zhou, Y; Zeng, W; Qi, M; Duan, Y; Su, J; Zhao, S; Zhong, W; Gao, M; Li, F; He, Y; Hu, X; Xu, X; Chen, X; Peng, C; Zhang, J

    2017-01-01

    Chronic arsenite and ultraviolet (UV) exposure are associated with skin tumor. To investigate the details by low concentrations of arsenite and UV induced carcinogenesis in skin, hTERT-immortalized human keratinocytes were used as a cellular model with exposure to low concentrations of sodium arsenite and UV. The effect of NaAsO2 on UV treatment-induced apoptosis was measured by flow cytometry and Hoechst staining. We found that the cell apoptosis induced by UV exposure was significantly attenuated after exposure to low-dose arsenite, and knockdown of p53 could block UV-induced apoptosis indicating that this phenomenon depended on p53. Interestingly, the expression of murine double minute 2 (MDM2), including its protein and transcriptional levels, was remarkably high after exposure to low-dose arsenite. Moreover, low-dose arsenite treatment dramatically decreased the MDM2 gene promoter activity, suggesting that this effect has been mediated through transcription. In addition, treatment of PD98059 reversed low-dose arsenite-induced MDM2 expression, and the inhibition of ERK2 expression could significantly block MDM2 expression as a consequence, and p53 expression automatically was increased. To validate the role of p53 in exposure to low-dose arsenite, the expression of p53 was examined by immunohistochemistry in the skin of Sprague−Dawley rats model by chronic arsenite exposure for 6 months and in patients with arsenic keratosis, and the results showed that the expression of p53 was decreased in those samples. Taken together, our results demonstrated that low-dose arsenite-induced resistance to apoptosis through p53 mediated by MDM2 in keratinocytes. PMID:28785074

  10. Enzastaurin inhibits ABCB1-mediated drug efflux independently of effects on protein kinase C signalling and the cellular p53 status.

    PubMed

    Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich

    2015-07-10

    The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.

  11. 3-MCPD 1-Palmitate Induced Tubular Cell Apoptosis In Vivo via JNK/p53 Pathways

    PubMed Central

    Liu, Man; Huang, Guoren; Wang, Thomas T.Y.; Sun, Xiangjun; Yu, Liangli (Lucy)

    2016-01-01

    Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing induced food contaminants with nephrotoxicity but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD esters using 3-MCPD 1-palmitate (MPE) as a probe compound in Sprague Dawley rats. Microarray analysis of the kidney from the Sprague Dawley rats treated with MPE, using Gene Ontology categories and KEGG pathways, revealed that MPE altered mRNA expressions of the genes involved in the mitogen-activated protein kinase (JNK and ERK), p53, and apoptotic signal transduction pathways. The changes in the mRNA expressions were confirmed by qRT-PCR and Western blot analyses and were consistent with the induction of tubular cell apoptosis as determined by histopathological, TUNEL, and immunohistochemistry analyses in the kidneys of the Sprague Dawley rats. Additionally, p53 knockout attenuated the apoptosis, and the apoptosis-related protein bax expression and cleaved caspase-3 activation induced by MPE in the p53 knockout C57BL/6 mice, whereas JNK inhibitor SP600125 but not ERK inhibitor U0126 inhibited MPE-induced apoptosis, supporting the conclusion that JNK/p53 might play a critical role in the tubular cell apoptosis induced by MPE and other 3-MCPD fatty acid esters. PMID:27008853

  12. Caspase-2-mediated cleavage of Mdm2 creates p53-induced positive feedback loop

    PubMed Central

    Oliver, Trudy G.; Meylan, Etienne; Chang, Gregory P.; Xue, Wen; Burke, James R.; Humpton, Timothy J.; Hubbard, Diana; Bhutkar, Arjun; Jacks, Tyler

    2011-01-01

    SUMMARY Caspase-2 is an evolutionarily conserved caspase, yet its biological function and cleavage targets are poorly understood. Caspase-2 is activated by the p53 target gene product PIDD (also known as LRDD) in a complex called the Caspase-2-PIDDosome. We show that PIDD expression promotes growth arrest and chemotherapy resistance by a mechanism that depends on Caspase-2 and wild-type p53. PIDD-induced Caspase-2 directly cleaves the E3 ubiquitin ligase Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance. These data establish Mdm2 as a cleavage target of Caspase-2 and provide insight into a mechanism of Mdm2 inhibition that impacts p53 dynamics upon genotoxic stress. PMID:21726810

  13. Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.

    PubMed

    Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing

    2017-08-01

    Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Two major pathways of penile carcinogenesis: HPV-induced penile cancers overexpress p16ink4a, HPV-negative cancers associated with dermatoses express p53, but lack p16ink4a overexpression.

    PubMed

    Mannweiler, Sebastian; Sygulla, Stephan; Winter, Elke; Regauer, Sigrid

    2013-07-01

    Penile squamous cell carcinomas (SCC) arise either through transforming infections with human papillomavirus (HPV) or independent of HPV, often in the background of lichen sclerosus (LS) and lichen planus (LP). Despite impact on therapy and prognosis, etiologic stratifications are missing in most histological diagnoses and publications about penile cancers/precursors. Classification of penile lesions into HPV-induced or HPV-negative via immunohistochemical demonstration of p16(ink4a) overexpression, a surrogate marker for transforming HPV-high-risk infections, and p53 expression in the absence of p16(ink4a) overexpression. Archival formalin-fixed material of 123 invasive penile cancers and 43 pre-invasive lesions was evaluated for the presence of LS, LP, 28 HPV genotypes, and expression of p53 and p16(ink4a). Seventy-two of 123 SCCs and 33 of 43 pre-invasive lesions showed p16(ink4a) overexpression independent of HPV-HR genotypes involved; 66 of 72 SCCs and 29 of 43 precursor lesions revealed a single HPV-high-risk-genotype (HPV-HR16 in 76% followed by HPV33, HPV31, HPV45, HPV18, HPV56); 5 of 72 SCCs and 4 of 43 precursor lesions revealed multiple HPV-HR-genotypes. One SCC revealed HPV-LR and HR-DNA. Fifty-one of 123 SCCs and 10 precursor lesions were p16(ink4a) negative, but showed nuclear p53 expression in tumor cells and basal keratinocytes. Forty-nine of 51 SCCs and 10 of 10 precursor lesions lacked HPV DNA. Two of 51 SCCs contained HPV18 and HPV45 DNA, respectively, but p16(ink4a) negativity classified them as non-HPV-induced. Twenty-seven of 51 SCCs showed peritumoral LS, 13 of 51 SCCs showed peritumoral LP, and 11 SCCs revealed no peritumoral tissue. Histologically, HPV-negative precursors showed hyperkeratotic, verrucous, atrophic, and basaloid differentiation. This was a retrospective study. p16(ink4a) overexpression identifies HPV-HR-induced penile carcinogenesis independent of HPV-HR genotype. p53 expression along with p16(ink4a) negativity identifies

  15. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    PubMed

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  16. Phosphorylation and gene expression of p53 are not affected in human cells exposed to 2.1425 GHz band CW or W-CDMA modulated radiation allocated to mobile radio base stations.

    PubMed

    Hirose, H; Sakuma, N; Kaji, N; Suhara, T; Sekijima, M; Nojima, T; Miyakoshi, J

    2006-09-01

    A large-scale in vitro study focusing on low-level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system was conducted to test the hypothesis that modulated RF fields induce apoptosis or other cellular stress response that activate p53 or the p53-signaling pathway. First, we evaluated the response of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole-body SAR for general public exposure defined as a basic restriction by the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and wideband code division multiple access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced apoptosis or any signs of stress. Human glioblastoma A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg, and CW radiation at 80 mW/kg for 24 or 48 h. Human IMR-90 fibroblasts from fetal lungs were exposed to both W-CDMA and CW radiation at a SAR of 80 mW/kg for 28 h. Under the RF field exposure conditions described above, no significant differences in the percentage of apoptotic cells were observed between the test groups exposed to RF signals and the sham-exposed negative controls, as evaluated by the Annexin V affinity assay. No significant differences in expression levels of phosphorylated p53 at serine 15 or total p53 were observed between the test groups and the negative controls by the bead-based multiplex assay. Moreover, microarray hybridization and real-time RT-PCR analysis showed no noticeable differences in gene expression of the subsequent downstream targets of p53 signaling involved in apoptosis between the test groups and the negative controls. Our results confirm that exposure to low-level RF signals up to 800 mW/kg does not induce p53-dependent apoptosis, DNA damage, or other stress response in human

  17. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  18. The Role of JMY in p53 Regulation.

    PubMed

    Adighibe, Omanma; Pezzella, Francesco

    2018-05-31

    Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

  19. Metformin Restores Parkin-Mediated Mitophagy, Suppressed by Cytosolic p53

    PubMed Central

    Song, Young Mi; Lee, Woo Kyung; Lee, Yong-ho; Kang, Eun Seok; Cha, Bong-Soo; Lee, Byung-Wan

    2016-01-01

    Metformin is known to alleviate hepatosteatosis by inducing 5’ adenosine monophosphate (AMP)-kinase-independent, sirtuin 1 (SIRT1)-mediated autophagy. Dysfunctional mitophagy in response to glucolipotoxicities might play an important role in hepatosteatosis. Here, we investigated the mechanism by which metformin induces mitophagy through restoration of the suppressed Parkin-mediated mitophagy. To this end, our ob/ob mice were divided into three groups: (1) ad libitum feeding of a standard chow diet; (2) intraperitoneal injections of metformin 300 mg/kg; and (3) 3 g/day caloric restriction (CR). HepG2 cells were treated with palmitate (PA) plus high glucose in the absence or presence of metformin. We detected enhanced mitophagy in ob/ob mice treated with metformin or CR, whereas mitochondrial spheroids were observed in mice fed ad libitum. Metabolically stressed ob/ob mice and PA-treated HepG2 cells showed an increase in expression of endoplasmic reticulum (ER) stress markers and cytosolic p53. Cytosolic p53 inhibited mitophagy by disturbing the mitochondrial translocation of Parkin, as demonstrated by immunoprecipitation. However, metformin decreased ER stress and p53 expression, resulting in induction of Parkin-mediated mitophagy. Furthermore, pifithrin-α, a specific inhibitor of p53, increased mitochondrial incorporation into autophagosomes. Taken together, these results indicate that metformin treatment facilitates Parkin-mediated mitophagy rather than mitochondrial spheroid formation by decreasing the inhibitory interaction with cytosolic p53 and increasing degradation of mitofusins. PMID:26784190

  20. Hyper-O-GlcNAcylation induces cisplatin resistance via regulation of p53 and c-Myc in human lung carcinoma.

    PubMed

    Luanpitpong, Sudjit; Angsutararux, Paweorn; Samart, Parinya; Chanthra, Nawin; Chanvorachote, Pithi; Issaragrisil, Surapol

    2017-09-06

    Aberrant metabolism in hexosamine biosynthetic pathway (HBP) has been observed in several cancers, affecting cellular signaling and tumor progression. However, the role of O-GlcNAcylation, a post-translational modification through HBP flux, in apoptosis remains unclear. Here, we found that hyper-O-GlcNAcylation in lung carcinoma cells by O-GlcNAcase inhibition renders the cells to apoptosis resistance to cisplatin (CDDP). Profiling of various key regulatory proteins revealed an implication of either p53 or c-Myc in the apoptosis regulation by O-GlcNAcylation, independent of p53 status. Using co-immunoprecipitation and correlation analyses, we found that O-GlcNAcylation of p53 under certain cellular contexts, i.e. high p53 activation, promotes its ubiquitin-mediated proteasomal degradation, resulting in a gain of oncogenic and anti-apoptotic functions. By contrast, O-GlcNAcylation of c-Myc inhibits its ubiquitination and subsequent proteasomal degradation. Gene manipulation studies revealed that O-GlcNAcylation of p53/c-Myc is in part a regulator of CDDP-induced apoptosis. Accordingly, we classified CDDP resistance by hyper-O-GlcNAcylation in lung carcinoma cells as either p53 or c-Myc dependence based on their molecular targets. Together, our findings provide novel mechanisms for the regulation of lung cancer cell apoptosis that could be important in understanding clinical drug resistance and suggest O-GlcNAcylation as a potential target for cancer therapy.

  1. Amelioration of radiation-induced hematopoietic and gastrointestinal damage by Ex-RAD® in mice

    PubMed Central

    Ghosh, Sanchita P.; Kulkarni, Shilpa; Perkins, Michael W.; Hieber, Kevin; Pessu, Roli L.; Gambles, Kristen; Maniar, Manoj; Kao, Tzu-Cheg; Seed, Thomas M.; Kumar, K. Sree

    2012-01-01

    The aim of the present study was to assess recovery from hematopoietic and gastrointestinal damage by Ex-RAD®, also known as ON01210.Na (4-carboxystyryl-4-chlorobenzylsulfone, sodium salt), after total body radiation. In our previous study, we reported that Ex-RAD, a small-molecule radioprotectant, enhances survival of mice exposed to gamma radiation, and prevents radiation-induced apoptosis as measured by the inhibition of radiation-induced protein 53 (p53) expression in cultured cells. We have expanded this study to determine best effective dose, dose-reduction factor (DRF), hematological and gastrointestinal protection, and in vivo inhibition of p53 signaling. A total of 500 mg/kg of Ex-RAD administered at 24 h and 15 min before radiation resulted in a DRF of 1.16. Ex-RAD ameliorated radiation-induced hematopoietic damage as monitored by the accelerated recovery of peripheral blood cells, and protection of granulocyte macrophage colony-forming units (GM-CFU) in bone marrow. Western blot analysis on spleen indicated that Ex-RAD treatment inhibited p53 phosphorylation. Ex-RAD treatment reduces terminal deoxynucleotidyl transferase mediated dUTP nick end labeling assay (TUNEL)-positive cells in jejunum compared with vehicle-treated mice after radiation injury. Finally, Ex-RAD preserved intestinal crypt cells compared with the vehicle control at 13 and 14 Gy. The results demonstrated that Ex-RAD ameliorates radiation-induced peripheral blood cell depletion, promotes bone marrow recovery, reduces p53 signaling in spleen and protects intestine from radiation injury. PMID:22843617

  2. Loss of p53-inducible long non-coding RNA LINC01021 increases chemosensitivity

    PubMed Central

    Kaller, Markus; Götz, Ursula; Hermeking, Heiko

    2017-01-01

    We have previously identified the long non-coding RNA LINC01021 as a direct p53 target (Hünten et al. Mol Cell Proteomics. 2015; 14:2609-2629). Here, we show that LINC01021 is up-regulated in colorectal cancer (CRC) cell lines upon various p53-activating treatments. The LINC01021 promoter and the p53 binding site lie within a MER61C LTR, which originated from insertion of endogenous retrovirus 1 (ERV1) sequences. Deletion of this MER61C element by a CRISPR/Cas9 approach, as well as siRNA-mediated knockdown of LINC01021 RNA significantly enhanced the sensitivity of the CRC cell line HCT116 towards the chemotherapeutic drugs doxorubicin and 5-FU, suggesting that LINC01021 is an integral part of the p53-mediated response to DNA damage. Inactivation of LINC01021 and also its ectopic expression did not affect p53 protein expression and transcriptional activity, implying that LINC01021 does not feedback to p53. Furthermore, in CRC patient samples LINC01021 expression positively correlated with a wild-type p53-associated gene expression signature. LINC01021 expression was increased in primary colorectal tumors and displayed a bimodal distribution that was particularly pronounced in the mesenchymal CMS4 consensus molecular subtype of CRCs. CMS4 tumors with low LINC01021 expression were associated with poor patient survival. Our results suggest that the genomic redistribution of ERV1-derived p53 response elements and generation of novel p53-inducible lncRNA-encoding genes was selected for during primate evolution as integral part of the cellular response to various forms of genotoxic stress. PMID:29262524

  3. Curcumin induces apoptosis and cell cycle arrest via the activation of reactive oxygen species-independent mitochondrial apoptotic pathway in Smad4 and p53 mutated colon adenocarcinoma HT29 cells.

    PubMed

    Agarwal, Ayushi; Kasinathan, Akiladdevi; Ganesan, Ramamoorthi; Balasubramanian, Akhila; Bhaskaran, Jahnavi; Suresh, Samyuktha; Srinivasan, Revanth; Aravind, K B; Sivalingam, Nageswaran

    2018-03-01

    Curcumin is a natural dietary polyphenol compound that has various pharmacological activities such as antiproliferative and cancer-preventive activities on tumor cells. Indeed, the role reactive oxygen species (ROS) generated by curcumin on cell death and cell proliferation inhibition in colon cancer is poorly understood. In the present study, we hypothesized that curcumin-induced ROS may promote apoptosis and cell cycle arrest in colon cancer. To test this hypothesis, the apoptosis-inducing potential and cell cycle inhibition effect of ROS induced by curcumin was investigated in Smd4 and p53 mutated HT-29 colon adenocarcinoma cells. We found that curcumin treatment significantly increased the level of ROS in HT-29 cells in a dose- and time-dependent manner. Furthermore, curcumin treatment markedly decreased the cell viability and proliferation potential of HT-29 cells in a dose- and time-dependent manner. Conversely, generation of ROS and inhibitory effect of curcumin on HT-29 cells were abrogated by N-acetylcysteine treatment. In addition, curcumin treatment did not show any cytotoxic effects on HT-29 cells. Furthermore, curcumin-induced ROS generation caused the DNA fragmentation, chromatin condensation, and cell nuclear shrinkage and significantly increased apoptotic cells in a dose- and time-dependent manner in HT-29 cells. However, pretreatment of N-acetylcysteine inhibited the apoptosis-triggering effect of curcumin-induced ROS in HT-29 cells. In addition, curcumin-induced ROS effectively mediated cell cycle inhibition in HT-29 cells. In conclusion, our data provide the first evidence that curcumin induces ROS independent apoptosis and cell cycle arrest in colon cancer cells that carry mutation on Smad4 and p53. Copyright © 2018. Published by Elsevier Inc.

  4. Sequential mutations in Notch1, Fbxw7, and Tp53 in radiation-induced mouse thymic lymphomas.

    PubMed

    Jen, Kuang-Yu; Song, Ihn Young; Banta, Karl Luke; Wu, Di; Mao, Jian-Hua; Balmain, Allan

    2012-01-19

    T-cell acute lymphoblastic lymphomas commonly demonstrate activating Notch1 mutations as well as mutations or deletions in Fbxw7. However, because Fbxw7 targets Notch1 for degradation, genetic alterations in these genes are expected to be mutually exclusive events in lymphomagenesis. Previously, by using a radiation-induced Tp53-deficient mouse model for T-cell acute lymphoblastic lymphoma, we reported that loss of heterozygosity at the Fbxw7 locus occurs frequently in a Tp53-dependent manner. In the current study, we show that these thymic lymphomas also commonly exhibit activating Notch1 mutations in the proline-glutamic acid-serine-threonine (PEST) domain. Moreover, concurrent activating Notch1 PEST domain mutations and single-copy deletions at the Fbxw7 locus occur with high frequency in the same individual tumors, indicating that these changes are not mutually exclusive events. We further demonstrate that although Notch1 PEST domain mutations are independent of Tp53 status, they are completely abolished in mice with germline Fbxw7 haploinsufficiency. Therefore, Notch1 PEST domain mutations only occur when Fbxw7 expression levels are intact. These data suggest a temporal sequence of mutational events involving these important cancer-related genes, with Notch1 PEST domain mutations occurring first, followed by Fbxw7 deletion, and eventually by complete loss of Tp53.

  5. Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

    PubMed

    Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

    2018-03-09

    The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Phosphorylation of the Mdm2 oncoprotein by the c-Abl tyrosine kinase regulates p53 tumor suppression and the radiosensitivity of mice.

    PubMed

    Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N

    2016-12-27

    The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.

  7. Phosphorylation of the Mdm2 oncoprotein by the c-Abl tyrosine kinase regulates p53 tumor suppression and the radiosensitivity of mice

    PubMed Central

    Carr, Michael I.; Roderick, Justine E.; Zhang, Hong; Woda, Bruce A.; Kelliher, Michelle A.; Jones, Stephen N.

    2016-01-01

    The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2Y393F) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2Y393F/S394A mice and Mdm2S394A mice display similar phenotypes. PMID:27956626

  8. Glucocorticoid receptor activation inhibits p53-induced apoptosis of MCF10Amyc cells via induction of protein kinase Cε.

    PubMed

    Aziz, Moammir H; Shen, Hong; Maki, Carl G

    2012-08-24

    Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCε. Knockdown of PKCε via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCε.

  9. Human papilloma virus type16 E6 deregulates CHK1 and sensitizes human fibroblasts to environmental carcinogens independently of its effect on p53

    PubMed Central

    Chen, Bo; Simpson, Dennis A.; Zhou, Yingchun; Mitra, Amritava; Mitchell, David L.; Cordeiro-Stone, Marila; Kaufmann, William K.

    2015-01-01

    After treatment with ultraviolet radiation (UV), human fibroblasts that express the HPV type 16 E6 oncoprotein display defects in repair of cyclobutane pyrimidine dimers, hypersensitivity to inactivation of clonogenic survival and an inability to sustain DNA replication. To determine whether these effects are specific to depletion of p53 or inactivation of its function, fibroblast lines were constructed with ectopic expression of a dominant-negative p53 allele (p53-H179Q) to inactivate function or a short-hairpin RNA (p53-RNAi) to deplete expression of p53. Only the expression of HPV16E6 sensitized fibroblasts to UV or the chemical carcinogen, benzo[a]pyrene diolepoxide I (BPDE). Carcinogen-treated cells expressing p53-H179Q or p53-RNAi were resistant to inactivation of colony formation and did not suffer replication arrest. CHK1 is a key checkpoint kinase in the response to carcinogen-induced DNA damage. Control and p53-RNAi-expressing fibroblasts displayed phosphorylation of Ser345 on CHK1 45–120 min after carcinogen treatment with a return to near baseline phosphorylation by 6 h after treatment. HPV16E6-expressing fibroblasts displayed enhanced and sustained phosphorylation of CHK1. This was associated with enhanced phosphorylation of Thr68 on CHK2 and Ser139 on H2AX, both markers of severe replication stress and DNA double strand breaks. Incubation with the phosphatase inhibitor okadaic acid produced more phosphorylation of CHK1 in UV-treated HPV16E6-expressing cells than in p53-H179Q-expressing cells suggesting that HPV16E6 may interfere with the recovery of coupled DNA replication at replication forks that are stalled at [6-4]pyrimidine-pyrimidone photoproducts and BPDE-DNA adducts. The results indicate that HPV16E6 targets a protein or proteins other than p53 to deregulate the activity of CHK1 in carcinogen-damaged cells. PMID:19411857

  10. A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hwa-Ryeon; Roe, Jae-Seok; Lee, Ji-Eun

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer p53 downregulates IMPDH. Black-Right-Pointing-Pointer p53-dependent miR-34a transactivation inhibits IMPDH transcription. Black-Right-Pointing-Pointer miR-34a-mediated inhibition of IMPDH downregulates GTP-dependent Ras signal. -- Abstract: p53 is a well-known transcription factor that controls cell cycle arrest and cell death in response to a wide range of stresses. Moreover, p53 regulates glucose metabolism and its mutation results in the metabolic switch to the Warburg effect found in cancer cells. Nucleotide biosynthesis is also critical for cell proliferation and the cell division cycle. Nonetheless, little is known about whether p53 regulates nucleotide biosynthesis. Here we demonstrated that p53-inducible microRNA-34a (miR-34a) repressed inosine 5 Primemore » -monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme of de novo GTP biosynthesis. Treatment with anti-miR-34a inhibitor relieved the expression of IMPDH upon DNA damage. Ultimately, miR-34a-mediated inhibition of IMPDH resulted in repressed activation of the GTP-dependent Ras signaling pathway. In summary, we suggest that p53 has a novel function in regulating purine biosynthesis, aided by miR-34a-dependent IMPDH repression.« less

  11. Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

    PubMed

    La Perle, K M; Jhiang, S M; Capen, C C

    2000-08-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice p53-/- mice p53-/- mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas.

  12. Phosphorylation of p53 by LRRK2 induces microglial tumor necrosis factor α-mediated neurotoxicity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, Dong Hwan, E-mail: ethan2887@gmail.com; Seol, Wongi; Eun, Jin Hwan

    Leucine-rich repeat kinase (LRRK2), a major causal gene of Parkinson's disease (PD), functions as a kinase. The most prevalent mutation of LRRK2 is G2019S. It exhibits increased kinase activity compared to the wildtype LRRK2. Previous studies have shown that LRRK2 can phosphorylate p53 at T304 and T377 of threonine-X-arginine (TXR) motif in neurons. Reduction of LRRK2 expression or inhibition of LRRK2 kinase activity has been shown to be able to alleviate LPS-induced neuroinflammation in microglia cells. In this study, we found that LRRK2 could also phosphorylate p53 in microglia model BV2 cells. Transfection of BV2 with phosphomimetic p53 T304/377D significantlymore » increased the secretion of pro-inflammatory cytokine TNFα compared to BV2 transfected with p53 wild type after LPS treatment. In addition, conditioned media from these transfected cells increased the death of dopaminergic neuronal SN4741 cells. Moreover, such neurotoxic effect was rescued by co-treatment with the conditioned media and etanercept, a TNFα blocking antibody. Furthermore, TNFα secretion was significantly increased in primary microglia derived from G2019S transgenic mice treated with LPS compared to that in cells derived from their littermates. These results suggest that LRRK2 kinase activity in microglia can contribute to neuroinflammation in PD via phosphorylating p53 at T304 and T377 site. - Highlights: • LPS stimulates LRRK2-mediated p53 phosphorylation and its nuclear localization. • Phosphorylation of p53 by LRRK2 in microglia enhances TNFα expression. • Microglial TNFα via LRRK2-induced p53 phosphorylation decreases neuronal survival.« less

  13. Loss of P53 regresses cardiac remodeling induced by pressure overload partially through inhibiting HIF1α signaling in mice.

    PubMed

    Li, Jiming; Zeng, Jingjing; Wu, Lianpin; Tao, Luyuan; Liao, Zhiyong; Chu, Maoping; Li, Lei

    2018-06-22

    The tumor suppressor p53 is recognized as the guardian of the genome in cell cycle and cell death. P53 expression increases as cardiac hypertrophy worsens to heart failure, suggesting that p53 may play important role in cardiac remodeling. In the present study, deletion of p53 in the mice heart would ameliorate cardiac hypertrophy induced by pressure overload. The role of p53 on heart was investigated using in vivo models. Cardiac hypertrophy in mice was induced by transverse aortic banding surgery. The extent of cardiac hypertrophy was examined by echocardiography, as well as pathological and molecular analyses of heart tissue. Global knockout of p53 in the mice reduced the hypertrophic response and markedly reduced cardiac apoptosis, and fibrosis. Ejection fraction of heart was also improved in hearts without p53 in response to pressure overload. Protein determination further suggested loss of p53 expression markedly increased Hypoxia-inducible factor 1-alpha (HIF1α) and vascular endothelial growth factor (VEGF) expression. The study indicated p53 deteriorated cardiac functions and cardiac hypertrophy, apoptosis, and fibrosis by partially inhibition of HIF1α and VEGF. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

  15. Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

    PubMed

    Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

    1999-06-01

    The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

  16. Evaluation of radiation effects against C6 glioma in combination with vaccinia virus-p53 gene therapy

    NASA Technical Reports Server (NTRS)

    Gridley, D. S.; Andres, M. L.; Li, J.; Timiryasova, T.; Chen, B.; Fodor, I.; Nelson, G. A. (Principal Investigator)

    1998-01-01

    The primary objective of this study was to evaluate the antitumor effects of recombinant vaccinia virus-p53 (rVV-p53) in combination with radiation therapy against the C6 rat glioma, a p53 deficient tumor that is relatively radioresistant. VV-LIVP, the parental virus (Lister strain), was used as a control. Localized treatment of subcutaneous C6 tumors in athymic mice with either rVV-p53 or VV-LIVP together with tumor irradiation resulted in low tumor incidence and significantly slower tumor progression compared to the agents given as single modalities. Assays of blood and spleen indicated that immune system activation may account, at least partly, for the enhance tumor inhibition seen with combined treatment. No overt signs of treatment-related toxicity were noted.

  17. Gamma-ray irradiation promotes premature meiosis of spontaneously differentiating testis–ova in the testis of p53-deficient medaka (Oryzias latipes)

    PubMed Central

    Yasuda, T; Oda, S; Li, Z; Kimori, Y; Kamei, Y; Ishikawa, T; Todo, T; Mitani, H

    2012-01-01

    In this study, the roles of p53 in impaired spermatogenic male germ cells of p53-deficient medaka were investigated by analyzing histological changes, and gene expressions of 42Sp50, Oct 4 and vitellogenin (VTG2) by RT-PCR or in situ hybridization in the testes. We found that a small number of oocyte-like cells (testis–ova) differentiated spontaneously in the cysts of type A and early type B spermatogonia in the p53-deficient testes, in contrast to the wild-type (wt) testes in which testis–ova were never found. Furthermore, ionizing radiation (IR) irradiation increased the number of testis–ova in p53-deficient testes, increased testis–ova size and proceeded up to the zygotene or pachytene stages of premature meiosis within 14 days after irradiation. However, 28 days after irradiation, almost all the testis–ova were eliminated presumably by p53-independent apoptosis, and spermatogenesis was restored completely. In the wt testis, IR never induced testis–ova differentiation. This is the first study to demonstrate the pivotal role of the p53 gene in the elimination of spontaneous testis–ova in testes, and that p53 is not indispensable for the restoration of spermatogenesis in the impaired testes in which cell cycle regulation is disturbed by IR irradiation. PMID:23034330

  18. Modulation of Radiation-Induced Apoptosis by Thiolamines

    NASA Technical Reports Server (NTRS)

    Warters, R. L.; Roberts, J. C.; Wilmore, B. H.; Kelley, L. L.

    1997-01-01

    Exposure to the thiolamine radioprotector N-(2-mercaptoethyl)-1,3-propanediamine (WR-1065) induced apoptosis in the mouse TB8-3 hybridoma after 60-minute (LD(sub50) = 4.5mM) or during a 20-hour (LD(sub50) = 0.15 mM) exposure. In contrast, a 20-hour exposure to 17 mM L-cysteine or 10 mM cysteamine was required to induce 50 percent apoptosis within 20 hours. Apoptosis was not induced by either a 60-minute or 20-hour exposure to 10 mM of the thiazolidime prodrugs ribose-cysteine (RibCys) or ribose-cysteamine (RibCyst). Thiolamine-induced apoptosis appeared to be a p53-independent process since it was induced by WR-1065 exposure in human HL60 cells. Exposure to WR-1065 (4mM for 15 minutes) or cysteine (10mM for 60 minutes) before and during irradiation protected cells against the induction of both DNA double-strand breaks and apoptosis, while exposure to RibCys (10 mM for 3 hours) did not. Treatment with either WR-1065, cysteine, RibCys or RibCyst for 60 minutes beginning 60 minutes after irradiation did not affect the level of radiation-induced apoptosis. In contrast, treatment with either cysteine, cysteamine or RibCys for 20 hours beginning 60 minutes after irradiation enhanced radiation-induced apoptosis. Similar experiments could not be conducted with WR-1065 because of its extreme toxicity. Our results indicate that thiolamine enhancement of radiation-induced apoptosis is not involved in their previously reported capacity to reduce radiation-induced mutations.

  19. Disruption of the RP-MDM2-p53 pathway accelerates APC loss-induced colorectal tumorigenesis.

    PubMed

    Liu, S; Tackmann, N R; Yang, J; Zhang, Y

    2017-03-01

    Inactivation of the adenomatous polyposis coli (APC) tumor suppressor is frequently found in colorectal cancer. Loss of APC function results in deregulation of the Wnt/β-catenin signaling pathway causing overexpression of the c-MYC oncogene. In lymphoma, both p19ARF and ribosomal proteins RPL11 and RPL5 respond to c-MYC activation to induce p53. Their role in c-MYC-driven colorectal carcinogenesis is unclear, as p19ARF deletion does not accelerate APC loss-triggered intestinal tumorigenesis. To determine the contribution of the ribosomal protein (RP)-murine double minute 2 (MDM2)-p53 pathway to APC loss-induced tumorigenesis, we crossed mice bearing MDM2 C305F mutation, which disrupts RPL11- and RPL5-MDM2 binding, with Apc min/+ mice, which are prone to intestinal tumor formation. Interestingly, loss of RP-MDM2 binding significantly accelerated colorectal tumor formation while having no discernable effect on small intestinal tumor formation. Mechanistically, APC loss leads to overexpression of c-MYC, RPL11 and RPL5 in mouse colonic tumor cells irrespective of MDM2 C305F mutation. However, notable p53 stabilization and activation were observed only in Apc min/+ ;Mdm2 +/+ but not Apc min/+ ;Mdm2 C305F/C305F colon tumors. These data establish that the RP-MDM2-p53 pathway, in contrast to the p19ARF-MDM2-p53 pathway, is a critical mediator of colorectal tumorigenesis following APC loss.

  20. Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

    PubMed Central

    Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

    2000-01-01

    p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

  1. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  2. Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

    PubMed Central

    La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

    2000-01-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

  3. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  4. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    PubMed

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  5. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  6. Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells.

    PubMed

    McNaughton, Melissa; Pitman, Melissa; Pitson, Stuart M; Pyne, Nigel J; Pyne, Susan

    2016-03-29

    Sphingosine kinases (two isoforms termed SK1 and SK2) catalyse the formation of the bioactive lipid sphingosine 1-phosphate. We demonstrate here that the SK2 inhibitor, ABC294640 (3-(4-chlorophenyl)-adamantane-1-carboxylic acid (pyridin-4-ylmethyl)amide) or the SK1/SK2 inhibitor, SKi (2-(p-hydroxyanilino)-4-(p-chlorophenyl)thiazole)) induce the proteasomal degradation of SK1a (Mr = 42 kDa) and inhibit DNA synthesis in androgen-independent LNCaP-AI prostate cancer cells. These effects are recapitulated by the dihydroceramide desaturase (Des1) inhibitor, fenretinide. Moreover, SKi or ABC294640 reduce Des1 activity in Jurkat cells and ABC294640 induces the proteasomal degradation of Des1 (Mr = 38 kDa) in LNCaP-AI prostate cancer cells. Furthermore, SKi or ABC294640 or fenretinide increase the expression of the senescence markers, p53 and p21 in LNCaP-AI prostate cancer cells. The siRNA knockdown of SK1 or SK2 failed to increase p53 and p21 expression, but the former did reduce DNA synthesis in LNCaP-AI prostate cancer cells. Moreover, N-acetylcysteine (reactive oxygen species scavenger) blocked the SK inhibitor-induced increase in p21 and p53 expression but had no effect on the proteasomal degradation of SK1a. In addition, siRNA knockdown of Des1 increased p53 expression while a combination of Des1/SK1 siRNA increased the expression of p21. Therefore, Des1 and SK1 participate in regulating LNCaP-AI prostate cancer cell growth and this involves p53/p21-dependent and -independent pathways. Therefore, we propose targeting androgen-independent prostate cancer cells with compounds that affect Des1/SK1 to modulate both de novo and sphingolipid rheostat pathways in order to induce growth arrest.

  7. Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

    PubMed

    Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

    2009-07-01

    p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

  8. 7 CFR 1216.53 - Independent evaluation.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Independent evaluation. 1216.53 Section 1216.53 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... otherwise available to the Board, an independent evaluation of the effectiveness of the Order and other...

  9. Augmented BMP signaling in the neural crest inhibits nasal cartilage morphogenesis by inducing p53-mediated apoptosis.

    PubMed

    Hayano, Satoru; Komatsu, Yoshihiro; Pan, Haichun; Mishina, Yuji

    2015-04-01

    Bone morphogenetic protein (BMP) signaling plays many roles in skull morphogenesis. We have previously reported that enhanced BMP signaling through the BMP type IA receptor (BMPR1A) in cranial neural crest cells causes craniosynostosis during postnatal development. Additionally, we observed that 55% of Bmpr1a mutant mice show neonatal lethality characterized by a distended gastrointestinal tract. Here, we show that severely affected mutants exhibit defective nasal cartilage, failure of fusion between the nasal septum and the secondary palate, and higher levels of phosphorylated SMAD1 and SMAD5 in the nasal tissue. TUNEL demonstrated an increase in apoptosis in both condensing mesenchymal tissues and cartilage of the nasal region in mutants. The levels of p53 (TRP53) tumor suppressor protein were also increased in the same tissue. Injection of pifithrin-α, a chemical inhibitor of p53, into pregnant mice prevented neonatal lethality while concomitantly reducing apoptosis in nasal cartilage primordia, suggesting that enhanced BMP signaling induces p53-mediated apoptosis in the nasal cartilage. The expression of Bax and caspase 3, downstream targets of p53, was increased in the mutants; however, the p53 expression level was unchanged. It has been reported that MDM2 interacts with p53 to promote degradation. We found that the amount of MDM2-p53 complex was decreased in all mutants, and the most severely affected mutants had the largest decrease. Our previous finding that the BMP signaling component SMAD1 prevents MDM2-mediated p53 degradation coupled with our new data indicate that augmented BMP signaling induces p53-mediated apoptosis by prevention of p53 degradation in developing nasal cartilage. Thus, an appropriate level of BMP signaling is required for proper craniofacial morphogenesis. © 2015. Published by The Company of Biologists Ltd.

  10. Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Denamur, Sophie; Boland, Lidvine

    Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasomemore » by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.« less

  11. Deubiquitinating enzyme regulation of the p53 pathway: A lesson from Otub1

    PubMed Central

    Sun, Xiao-Xin; Dai, Mu-Shui

    2014-01-01

    Deubiquitination has emerged as an important mechanism of p53 regulation. A number of deubiquitinating enzymes (DUBs) from the ubiquitin-specific protease family have been shown to regulate the p53-MDM2-MDMX networks. We recently reported that Otub1, a DUB from the OTU-domain containing protease family, is a novel p53 regulator. Interestingly, Otub1 abrogates p53 ubiquitination and stabilizes and activates p53 in cells independently of its deubiquitinating enzyme activity. Instead, it does so by inhibiting the MDM2 cognate ubiquitin-conjugating enzyme (E2) UbcH5. Otub1 also regulates other biological signaling through this non-canonical mechanism, suppression of E2, including the inhibition of DNA-damage-induced chromatin ubiquitination. Thus, Otub1 evolves as a unique DUB that mainly suppresses E2 to regulate substrates. Here we review the current progress made towards the understanding of the complex regulation of the p53 tumor suppressor pathway by DUBs, the biological function of Otub1 including its positive regulation of p53, and the mechanistic insights into how Otub1 suppresses E2. PMID:24920999

  12. A dual role of p53 in the control of autophagy.

    PubMed

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  13. UV-B radiation-induced oxidative stress and p38 signaling pathway involvement in the benthic copepod Tigriopus japonicus.

    PubMed

    Kim, Bo-Mi; Rhee, Jae-Sung; Lee, Kyun-Woo; Kim, Min-Jung; Shin, Kyung-Hoon; Lee, Su-Jae; Lee, Young-Mi; Lee, Jae-Seong

    2015-01-01

    Ultraviolet B (UV-B) radiation presents an environmental hazard to aquatic organisms. To understand the molecular responses of the intertidal copepod Tigriopus japonicus to UV-B radiation, we measured the acute toxicity response to 96 h of UV-B radiation, and we also assessed the intracellular reactive oxygen species (ROS) levels, glutathione (GSH) content, and antioxidant enzyme (GST, GR, GPx, and SOD) activities after 24 h of exposure to UV-B with LD50 and half LD50 values. Also, expression patterns of p53 and hsp gene families with phosphorylation of p38 MAPK were investigated in UV-B-exposed copepods. We found that the ROS level, GSH content, and antioxidant enzyme activity levels were increased with the transcriptional upregulation of antioxidant-related genes, indicating that UV-B induces oxidative stress by generating ROS and stimulating antioxidant enzymatic activity as a defense mechanism. Additionally, we found that p53 expression was significantly increased after UV-B irradiation due to increases in the phosphorylation of the stress-responsive p38 MAPK, indicating that UV-B may be responsible for inducing DNA damage in T. japonicus. Of the hsp family genes, transcriptional levels of hsp20, hsp20.7, hsp70, and hsp90 were elevated in response to a low dose of UV-B radiation (9 kJ m(-2)), suggesting that these hsp genes may be involved in cellular protection against UV-B radiation. In this paper, we performed a pathway-oriented mechanistic analysis in response to UV-B radiation, and this analysis provides a better understanding of the effects of UV-B in the intertidal benthic copepod T. japonicus. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  15. Increased expression of p53 and p21 (Waf1/Cip1) in the lesional skin of bleomycin-induced scleroderma.

    PubMed

    Yamamoto, Toshiyuki; Nishioka, Kiyoshi

    2005-05-01

    Systemic sclerosis (SSc) is a connective tissue disorder characterized by excessive deposition of extracellular matrix in the affected skin as well as various internal organs, vascular injury and immune abnormality; however, the etiology of SSc remains still unknown. We previously established an experimental mouse model for scleroderma by repeated local injections of bleomycin, a DNA damaging agent. In this study, we examined the induction of apoptosis and the expression of p53, p21 (Waf1/Cip1), and proliferating cell nuclear antigen (PCNA) in the lesional skin following bleomycin exposure in this model. Dermal sclerosis was induced by alternate day's injections of bleomycin for 4 weeks. TUNEL assay showed that apoptotic cells began to appear at 1 week after bleomycin exposure, and were prominently detected at 3-4 weeks. Immunohistochemical examination showed increased expression of p53 and p21 mainly in the infiltrating mononuclear cells at 2 weeks after bleomycin treatment. Bleomycin treatment markedly enhanced PCNA expression at 1-2 weeks, mainly in mesenchyme, as compared with control phosphate buffered saline treatment. Reverse transcriptase-polymerase chain reaction analysis showed that the expression of p53 and p21 mRNA was concurrently upregulated at 1-2 weeks after bleomycin treatment. Taken together, coordinate increased levels of p53 and p21 preceded the maximal induction of apoptosis and dermal sclerosis. Our findings suggest that apoptotic processes are involved in the pathophysiology of bleomycin-induced scleroderma, which may be mediated, in part, by the upregulation of p53 and p21.

  16. Blockade of TLR3 protects mice from lethal radiation-induced gastrointestinal syndrome

    PubMed Central

    Takemura, Naoki; Kawasaki, Takumi; Kunisawa, Jun; Sato, Shintaro; Lamichhane, Aayam; Kobiyama, Kouji; Aoshi, Taiki; Ito, Junichi; Mizuguchi, Kenji; Karuppuchamy, Thangaraj; Matsunaga, Kouta; Miyatake, Shoichiro; Mori, Nobuko; Tsujimura, Tohru; Satoh, Takashi; Kumagai, Yutaro; Kawai, Taro; Standley, Daron M.; Ishii, Ken J.; Kiyono, Hiroshi; Akira, Shizuo; Uematsu, Satoshi

    2014-01-01

    High-dose ionizing radiation induces severe DNA damage in the epithelial stem cells in small intestinal crypts and causes gastrointestinal syndrome (GIS). Although the tumour suppressor p53 is a primary factor inducing death of crypt cells with DNA damage, its essential role in maintaining genome stability means inhibiting p53 to prevent GIS is not a viable strategy. Here we show that the innate immune receptor Toll-like receptor 3 (TLR3) is critical for the pathogenesis of GIS. Tlr3−/− mice show substantial resistance to GIS owing to significantly reduced radiation-induced crypt cell death. Despite showing reduced crypt cell death, p53-dependent crypt cell death is not impaired in Tlr3−/− mice. p53-dependent crypt cell death causes leakage of cellular RNA, which induces extensive cell death via TLR3. An inhibitor of TLR3–RNA binding ameliorates GIS by reducing crypt cell death. Thus, we propose blocking TLR3 activation as a novel approach to treat GIS. PMID:24637670

  17. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

    PubMed Central

    Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

    2011-01-01

    We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

  18. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.

    2015-03-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acutemore » and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new

  19. Expressions of p53 and p21 in primary gastric lymphomas.

    PubMed Central

    Go, J. H.; Yang, W. I.

    2001-01-01

    The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

  20. MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

    PubMed

    Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

    2017-01-01

    The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

  1. Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

    PubMed

    Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

    2011-11-01

    Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

  2. Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65.

    PubMed

    Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S; Kaneki, Masao

    2014-11-11

    Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson's disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. Copyright © 2014, American Association for the Advancement of Science.

  3. Inflammatory stimuli induce inhibitory S-nitrosylation of the deacetylase SIRT1 to increase acetylation and activation of p53 and p65

    PubMed Central

    Shinozaki, Shohei; Chang, Kyungho; Sakai, Michihiro; Shimizu, Nobuyuki; Yamada, Marina; Tanaka, Tomokazu; Nakazawa, Harumasa; Ichinose, Fumito; Yamada, Yoshitsugu; Ishigami, Akihito; Ito, Hideki; Ouchi, Yasuyoshi; Starr, Marlene E.; Saito, Hiroshi; Shimokado, Kentaro; Stamler, Jonathan S.; Kaneki, Masao

    2015-01-01

    Inflammation increases the abundance of inducible nitric oxide synthase (iNOS), leading to enhanced production of nitric oxide (NO), which can modify proteins by S-nitrosylation. Enhanced NO production increases the activities of the transcription factors p53 and nuclear factor κB (NF-κB) in several models of disease-associated inflammation. S-Nitrosylation inhibits the activity of the protein deacetylase SIRT1. SIRT1 limits apoptosis and inflammation by deacetylating p53 and p65 (also known as RelA), a subunit of NF-κB. We showed in multiple cultured mammalian cell lines that NO donors or inflammatory stimuli induced S-nitrosylation of SIRT1 within CXXC motifs, which inhibited SIRT1 by disrupting its ability to bind zinc. Inhibition of SIRT1 reduced deacetylation and promoted activation of p53 and p65, leading to apoptosis and increased expression of proinflammatory genes. In rodent models of systemic inflammation, Parkinson’s disease, or aging-related muscular atrophy, S-nitrosylation of SIRT1 correlated with increased acetylation of p53 and p65 and activation of p53 and NF-κB target genes, suggesting that S-nitrosylation of SIRT1 may represent a proinflammatory switch common to many diseases and aging. PMID:25389371

  4. Pokemon enhances proliferation, cell cycle progression and anti-apoptosis activity of colorectal cancer independently of p14ARF-MDM2-p53 pathway.

    PubMed

    Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong

    2014-12-01

    Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.

  5. Cyclophilin B induces chemoresistance by degrading wild type p53 via interaction with MDM2 in colorectal cancer.

    PubMed

    Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo

    2018-06-06

    Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  6. Arsenite promotes centrosome abnormalities under a p53 compromised status induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liao, W.-T.; Center of Excellence for Environmental Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan; Graduate Institute of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan

    2010-02-15

    Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus an interaction between arsenite and cigarette smoking in lung carcinogenesis was suspected. In the present study, we investigated the interactions of a tobacco-specific carcinogen 4- (methylnitrosamino)-1-(3-pyridyl)-1-butanone (nicotine-derived nitrosamine ketone, NNK) and arsenite on lung cell transformation. BEAS-2B, an immortalized human lung epithelial cell line, was selected to test the centrosomal abnormalities and colony formation by NNK and arsenite. We found that NNK, alone, could enhance BEAS-2B cell growth at 1-5 muM. Under NNK exposure, arsenite wasmore » able to increase centrosomal abnormality as compared with NNK or arsenite treatment alone. NNK treatment could also reduce arsenite-induced G2/M cell cycle arrest and apoptosis, these cellular effects were found to be correlated with p53 dysfunction. Increased anchorage-independent growth (colony formation) of BEAS-2B cells cotreated with NNK and arsenite was also observed in soft agar. Our present investigation demonstrated that NNK could provide a p53 compromised status. Arsenite would act specifically on this p53 compromised status to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenite under tobacco-specific carcinogen co-exposure.« less

  7. β2-AR activation induces chemoresistance by modulating p53 acetylation through upregulating Sirt1 in cervical cancer cells.

    PubMed

    Chen, Hongyu; Zhang, Wei; Cheng, Xiang; Guo, Liang; Xie, Shuai; Ma, Yuanfang; Guo, Ning; Shi, Ming

    2017-07-01

    It has been suggested that β2-adrenergic receptor (β2-AR)-mediated signaling induced by catecholamines regulates the degradation of p53. However, the underlying molecular mechanisms were not known. In the present study, we demonstrated that catecholamines upregulated the expression of silent information regulator 1 (Sirt1) through activating β2-AR-mediated signaling pathway, since selective β2-AR antagonist ICI 118, 551 and non-selective β-blocker proprenolol effectively repressed isoproterenol (ISO)-induced Sirt1 expression. Catecholamines inhibited doxorubicin (DOX)-induced p53 acetylation and transcription-activation activities by inducing the expression of Sirt1. Knockdown of the Sirt1 expression by the specific siRNA remarkably blocked the inhibitory effects of ISO on DOX-induced p53 acetylation. In addition, we demonstrated that catecholamines induced resistance of cervical cancer cells to chemotherapeutics both in vitro and in vivo and that β2-AR was overexpressed in cervical cancer tissues. Our data suggest that the p53-dependent, chemotherapeutics-induced cytotoxicity in cervical cancer cells may be compromised by catecholamines-induced upregulation of the Sirt1 expression through activating the β2-AR signaling. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  8. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    PubMed

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  9. Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

    PubMed Central

    Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

    2017-01-01

    Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

  10. Protective mechanisms of p53-p21-pRb proteins against DNA damage-induced cell death.

    PubMed

    Garner, Elizabeth; Raj, Kenneth

    2008-02-01

    There have been innumerate demonstrations of p53's activity as a tumour suppressor protein with the ability to stimulate cell signalling that can lead to cell cycle arrest and cell death in the event of DNA damage. Despite the solid body of evidence to support these properties of p53, reports have emerged that suggest a role for p53 in protecting cells from cell death. Our recent report highlighted a mechanism by which p53 activity can promote cell survival in the event of DNA damage. Here we present the various mechanisms that are activated by p53 signalling that can confer protection to cells with damaged DNA and emphasise the practical and clinical implications of a more balanced and context-dependent understanding of p53's pro-apoptotic and pro-survival activities.

  11. The small molecule 2-phenylethynesulfonamide induces covalent modification of p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jamil, Sarwat; Hojabrpour, Payman; Duronio, Vincent

    p53 is a tumor suppressor protein which is either lost or inactivated in a large majority of tumors. The small molecule 2-phenylethynesulfonamide (PES) was originally identified as the inhibitor of p53 effects on the mitochondrial death pathway. In this report we demonstrate that p53 protein from PES-treated cells was detected in reduced mobility bands between molecular weights 95–220 kDa. Resolution of p53 aggregates on urea gel was unable to reduce the high molecular weight p53 aggregates, which were shown to be primarily located in the nucleus. Therefore, our data suggest that PES exerts its effects through covalent cross-linking and nuclear retentionmore » of p53. - Highlights: • p53 protein is in high molecular weight complexes in the nucleus of PES-treated cells. • PES is a drug that inhibits pro-apoptotic p53 action at the mitochondria. • We propose that PES action involves cross-linking and nuclear retention of p53.« less

  12. Posttranslational Modifications of p53 in Replicative Senescence Overlapping but Distinct from Those Induced by DNA Damage

    PubMed Central

    Webley, Katherine; Bond, Jane A.; Jones, Christopher J.; Blaydes, Jeremy P.; Craig, Ashley; Hupp, Ted; Wynford-Thomas, David

    2000-01-01

    Replicative senescence in human fibroblasts is absolutely dependent on the function of the phosphoprotein p53 and correlates with activation of p53-dependent transcription. However, no evidence for posttranslational modification of p53 in senescence has been presented, raising the possibility that changes in transcriptional activity result from upregulation of a coactivator. Using a series of antibodies with phosphorylation-sensitive epitopes, we now show that senescence is associated with major changes at putative regulatory sites in the N and C termini of p53 consistent with increased phosphorylation at serine-15, threonine-18, and serine-376 and decreased phosphorylation at serine-392. Ionizing and UV radiation generated overlapping but distinct profiles of response, with increased serine-15 phosphorylation being the only common change. These results support a direct role for p53 in signaling replicative senescence and are consistent with the generation by telomere erosion of a signal which shares some but not all of the features of DNA double-strand breaks. PMID:10733583

  13. Identification of a small molecule that overcomes HdmX-mediated suppression of p53

    PubMed Central

    Chakrabarti, Amit; Karan, Sukanya; Liu, Zhigang; Xia, Zhiqiang; Gundluru, Mahesh; Moreton, Stephen; Saunthararajah, Yogen; Jackson, Mark W; Agarwal, Mukesh K; Wald, David N

    2016-01-01

    Inactivation of the p53 tumor suppressor by mutation or overexpression of negative regulators occurs frequently in cancer. Since p53 plays a key role in regulating proliferation or apoptosis in response to DNA damaging chemotherapies, strategies aimed at reactivating p53 are increasingly being sought. Strategies to reactivate wild-type p53 include the use of small molecules capable of releasing wild-type p53 from key, cellular negative regulators, such as Hdm2 and HdmX. Derivatives of the Hdm2 antagonist Nutlin-3 are in clinical trials. However, Nutlin-3 specifically disrupts Hdm2-p53, leaving tumors harboring high levels of HdmX resistant to Nutlin-3 treatment. Here we identify CTX1, a novel small molecule that overcomes HdmX-mediated p53 repression. CTX1 binds directly to HdmX to prevent p53-HdmX complex formation, resulting in the rapidly induction of p53 in a DNA damage-independent manner. Treatment of a panel of cancer cells with CTX1 induced apoptosis or suppressed proliferation and importantly, CTX1 demonstrates promising activity as a single agent in a mouse model of circulating primary human leukemia. CTX1 is a small molecule HdmX inhibitor that demonstrates promise as a cancer therapeutic candidate. PMID:26883273

  14. Characterization and role of p53 family members in the symbiont-induced morphogenesis of the Euprymna scolopes light organ.

    PubMed

    Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J

    2006-08-01

    Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.

  15. The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

    PubMed

    Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

    2018-05-01

    In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. The tumour suppressor CYLD regulates the p53 DNA damage response

    PubMed Central

    Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

    2016-01-01

    The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

  17. P53 alters the cytotoxicity and genotoxicity for oxidized graphene in human B-lymphoblastoid cells

    NASA Astrophysics Data System (ADS)

    Petibone, Dayton Matthew

    Widespread use of oxidized graphene nanomaterials in industry, medicine, and consumer products raises concern about potential adverse impacts on human health. The p53 tumor suppressor protein is crucial to maintaining cellular and genetic stability to prevent carcinogenesis. Here, we show that oxygen functionalized graphene (f-G) absorption and p53 functional status correlate with cytotoxicity and genotoxicity in human B-lymphoblastoid cells. Trends in f-G absorption by were dose-dependent. Cells with functional p53 exposed to f-G arrested in G0/G1 phase of the cell cycle, suppressed f-G induced reactive oxygen species (ROS), and had elevated apoptosis. While compared to p53 competent cells, the p53 deficient cells exposed to f-G accumulated in S-phase of the cell cycle, had elevated ROS levels, and evaded apoptosis. The f-G genotoxicity was evident as increased loss-of-heterozygosity mutants independent of p53 status, and structural chromosome damage in p53 deficient cells. These findings have broad implications for the safety and efficacy of oxidized graphene nanomaterials in industrial, consumer products and biomedical applications.

  18. Emulsified isoflurane treatment inhibits the cell cycle and respiration of human bronchial epithelial 16HBE cells in a p53-independent manner.

    PubMed

    Yang, Hui; Deng, Jia; Jiang, Yingying; Chen, Jiao; Zeng, Xianzheng; He, Zhiyang; Jiang, Xiaojuan; Li, Zhuoning; Jiang, Chunling

    2016-07-01

    Emulsified isoflurane (EIso), as a result of its rapid anesthetic induction, recovery and convenience, is widely used as a novel intravenous general anesthetic. Treatment with EIso can reduce injuries caused by ischemia/reperfusion (I/R) to organs, including the heart, lung and liver, without knowing understanding the molecular mechanism. The present study hypothesized that treatment with EIso can affect the physiological processes of human lung bronchial epithelial cells (16HBE) prior to I/R. To test this hypothesis, the present study first constructed stable p53 knockdown and synthesis of cytochrome c oxidase (SCO)2 knockdown 16HBE cells. The above cells were subsequently treated with EIso at a concentration of 0.1 and 0.2% for 24 h. The relevant concentration of fat emulsion was used as a negative control. The expression levels of p53, p21, SCO1, SCO2 and Tp53induced glycolysis and apoptosis regulator (TIGAR) were detected by reverse transcription‑quantitative polymerase chain reaction and western blotting. Subsequently, the cell proliferation, respiration and glycolysis were investigated. The results revealed that EIso treatment significantly decreased the transcription of TIGAR, SCO1 and SCO2, and increased the transcription of p21, which are all p53 target genes, in a p53-independent manner. The cell cycle was inhibited by arresting cells at the G0/G1 phase. Respiration was reduced, which caused a decrease in oxygen consumption and the accumulation of lactate and reactive oxygen species. Taken together, EIso treatment inhibited the proliferation and respiration, and promoted glycolysis in 16HBE cells. This regulatory pathway may represent a protective mechanism of EIso treatment by inhibiting cell growth and decreasing the oxygen consumption from I/R.

  19. Heme oxygenase-1-mediated apoptosis under cadmium-induced oxidative stress is regulated by autophagy, which is sensitized by tumor suppressor p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    So, Keum-Young; Oh, Seon-Hee

    Heme oxygenase-1 (HO-1) is a stress-inducible cytoprotective enzyme. It is often overexpressed in different types of cancers and promotes cell survival. However, the role of HO-1 and the underlying molecular mechanism of cadmium (Cd)-induced oxidative stress in cancer cells remain undefined. Here we show that the role of HO-1 under Cd-induced oxidative stress is dependent upon autophagy, which is sensitized by the tumor suppressor p53. The sensitivity to Cd was 3.5- and 14-fold higher in p53-expressing YD8 and H460 cells than in p53-null YD10B and H1299 cells, respectively. The levels of p53 in YD8 and H460 cells decreased in a Cd concentration-dependent manner,more » which was inhibited by pretreatment with N-acetylcysteine. In both cell lines, Cd exposure resulted in caspase-3-mediated PARP-1 cleavage and the induction of CHOP, LC3-II, and HO-1, which were limited in YD10B and H1299 cells exposed to high concentrations of Cd. Cd exposure to p53-overexpressing YD10B cells enhanced Cd-induced HO-1 and LC3-II levels, whereas genetic knockdown of p53 in YD8 cells resulted in the suppression of Cd-induced levels of HO-1 and LC3-II, indicating that p53 is required in the sensing of HO-1 and induction of autophagy. The inhibition of autophagy using small interfering RNA (siRNA) for the autophagy-related gene atg5 enhanced HO-1, CHOP, and PARP-1 cleavage induced by Cd. However, transfection with HO-1 siRNA increased Cd-induced LC3-II, and suppressed the expression of CHOP and cleavage of PARP-1. Collectively, the role of HO-1 in apoptosis could be modulated by autophagy, which is sensitized by p53 expression in human cancer cell lines. - Highlights: • Cadmium exposure decreased p53 level, and induced HO-1, apoptosis, and autophagy. • p53 sensitized Cadmium-induced HO-1 and autophagy induction. • Cadmium induced HO-1 under autophagy impairment and increased apoptosis. • Cadmium-induced autophagy was enhanced under HO-1 impaired conditions. • The role of HO

  20. p53-Independent Roles of MDM2 in NF-κB Signaling: Implications for Cancer Therapy, Wound Healing, and Autoimmune Diseases1

    PubMed Central

    Thomasova, Dana; Mulay, Shrikant R; Bruns, Hauke; Anders, Hans-Joachim

    2012-01-01

    Murine double minute-2 (MDM2) is an intracellular molecule with multiple biologic functions. It serves as a negative regulator of p53 and thereby limits cell cycle arrest and apoptosis. Because MDM2 blockade suppresses tumor cell growth in vitro and in vivo, respective MDM2 inhibition is currently evaluated as anti-cancer therapy in clinical trials. However, the anti-proliferative effects of MDM2 inhibition also impair regenerative cell growth upon tissue injury. This was so far documented for tubular repair upon postischemic acute kidney injury and might apply to wound healing responses in general. Furthermore, MDM2 has numerous p53-independent effects. As a new entry, MDM2 was identified to act as a co-transcription factor for nuclear factor-kappa-light-enhancer of activated B cells (NF-κB) at cytokine promoters. This explains the potent anti-inflammatory effects of MDM2 inhibitors in vitro and in vivo. For example, the NF-κB-antagonistic and p53-agonistic activities of MDM2 inhibitors elicit potent therapeutic effects on experimental lymphoproliferative autoimmune disorders such as systemic lupus erythematosus. In this review, we discuss the classic p53-dependent, the recently discovered p53-independent, and the NF-κB-agonistic biologic functions of MDM2. We describe its complex regulatory role on p53 and NF-κB signaling and name areas of research that may help to foresee previously unexpected effects or potential alternative indications of therapeutic MDM2 blockade. PMID:23308042

  1. Cholesterol Secosterol Aldehydes Induce Amyloidogenesis and Dysfunction of Wild Type Tumor Protein p53

    PubMed Central

    Nieva, Jorge; Song, Byeong-Doo; Rogel, Joseph K.; Kujawara, David; Altobel, Lawrence; Izharrudin, Alicia; Boldt, Grant E.; Grover, Rajesh K.; Wentworth, Anita D.; Wentworth, Paul

    2011-01-01

    SUMMARY Epidemiologic and clinical evidence points to an increased risk of cancer when coupled with chronic inflammation. However, the molecular mechanisms that underpin this interrelationship remain largely unresolved. Herein we show that the inflammation-derived cholesterol 5,6-secosterol aldehydes, atheronal-A (KA) and –B (ALD), but not the PUFA-derived aldehydes 4-hydroxynonenal (HNE) and 4-hydroxyhexenal (HHE), induce misfolding of wild-type p53 into an amyloidogenic form that binds thioflavin T and Congo Red dyes but cannot bind to a consensus DNA sequence. Treatment of lung carcinoma cells with KA and ALD leads to a loss of function of extracted p53, as determined by analysis of extracted nuclear protein and in activation of p21. Our results uncover a plausible chemical link between inflammation and cancer and expands the already pivotal role of p53 dysfunction and cancer risk. PMID:21802012

  2. Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells.

    PubMed

    Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu

    2017-08-02

    Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

  3. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  4. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  5. A novel P53/POMC/Gαs/SASH1 autoregulatory feedback loop activates mutated SASH1 to cause pathologic hyperpigmentation.

    PubMed

    Zhou, Ding'an; Wei, Zhiyun; Kuang, Zhongshu; Luo, Huangchao; Ma, Jiangshu; Zeng, Xing; Wang, Ke; Liu, Beizhong; Gong, Fang; Wang, Jing; Lei, Shanchuan; Wang, Dongsheng; Zeng, Jiawei; Wang, Teng; He, Yong; Yuan, Yongqiang; Dai, Hongying; He, Lin; Xing, Qinghe

    2017-04-01

    p53-Transcriptional-regulated proteins interact with a large number of other signal transduction pathways in the cell, and a number of positive and negative autoregulatory feedback loops act upon the p53 response. P53 directly controls the POMC/α-MSH productions induced by ultraviolet (UV) and is associated with UV-independent pathological pigmentation. When identifying the causative gene of dyschromatosis universalis hereditaria (DUH), we found three mutations encoding amino acid substitutions in the gene SAM and SH3 domain containing 1 (SASH1), and SASH1 was associated with guanine nucleotide-binding protein subunit-alpha isoforms short (Gαs). However, the pathological gene and pathological mechanism of DUH remain unknown for about 90 years. We demonstrate that SASH1 is physiologically induced by p53 upon UV stimulation and SASH and p53 is reciprocally induced at physiological and pathophysiological conditions. SASH1 is regulated by a novel p53/POMC/α-MSH/Gαs/SASH1 cascade to mediate melanogenesis. A novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. Our study demonstrates that a novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  6. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Zhendong, E-mail: zdyu@hotmail.com; Wang, Hao; Zhang, Libin

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrugmore » system.« less

  7. Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin

    PubMed Central

    Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

    2011-01-01

    Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment. PMID:22011578

  8. RITA enhances irradiation-induced apoptosis in p53-defective cervical cancer cells via upregulation of IRE1α/XBP1 signaling.

    PubMed

    Zhu, Hong; Abulimiti, Muyasha; Liu, Huan; Su, Xiang-Jiang; Liu, Cai-Hong; Pei, Hai-Ping

    2015-09-01

    Radiation therapy is the most widely used treatment for patients with cervical cancer. Recent studies have shown that endoplasmic reticulum (ER) stress induces apoptosis and sensitizes tumor cells to radiotherapy, which reportedly induces ER stress in cells. Classical key tumor suppressor p53 is involved in the response to a variety of cellular stresses, including those incurred by ionizing irradiation. A recent study demonstrated that small-molecule RITA (reactivation of p53 and induction of tumor cell apoptosis) increased the radiosensitivity of tumor cells expressing mutant p53 (mtp53). In the present study, we explored the effects and the underlying mechanisms of RITA in regards to the radiosensitivity and ER stress in mtp53-expressing human cervix cancer cells. Treatment with 1 µM of RITA for 24 h before irradiation markedly decreased survival and increased apoptosis in C-33A and HT-3 cells; the effects were not significantly altered by knockdown of p53. In the irradiated C-33A and HT-3 cells, RITA significantly increased the expression of IRE1α, the spliced XBP1 mRNA level, as well as apoptosis; the effects were abolished by knockdown of IRE1α. Transcriptional pulse-chase assays revealed that RITA significantly increased the stability of IRE1α mRNA in the irradiated C-33A and HT-3 cells. In contrast, the same RITA treatment did not show any significant effect on sham-irradiated cells. In conclusion, the present study provides initial evidence that RITA upregulates the expression level of IRE1α by increasing the stability of IRE1α mRNA in irradiated mtp53-expressing cervical cancer cells; the effect leads to enhanced IRE1α/XBP1 ER stress signaling and increased apoptosis in the cells. The present study offers novel insight into the pharmacological potential of RITA in the radiotherapy for cervical cancer.

  9. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Depletion of hepatoma-derived growth factor-related protein-3 induces apoptotic sensitization of radioresistant A549 cells via reactive oxygen species-dependent p53 activation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Hong Shik; Hong, Eun-Hee; Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791

    2013-09-27

    Highlights: •HRP-3 is a radiation- and anticancer drug-responsive protein in A549 cells. •Depletion of HRP-3 induces apoptosis of radio- and chemoresistant A549 cells. •Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. •Depletion of HRP-3 enhances ROS-dependent p53 activation and PUMA expression. -- Abstract: Biomarkers based on functional signaling have the potential to provide greater insight into the pathogenesis of cancer and may offer additional targets for anticancer therapeutics. Here, we identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistance-related gene and characterized the molecular mechanism by which its encoded protein regulates the radio- and chemoresistant phenotypemore » of lung cancer-derived A549 cells. Knockdown of HRP-3 promoted apoptosis of A549 cells and potentiated the apoptosis-inducing action of radio- and chemotherapy. This increase in apoptosis was associated with a substantial generation of reactive oxygen species (ROS) that was attributable to inhibition of the Nrf2/HO-1 antioxidant pathway and resulted in enhanced ROS-dependent p53 activation and p53-dependent expression of PUMA (p53 upregulated modulator of apoptosis). Therefore, the HRP-3/Nrf2/HO-1/ROS/p53/PUMA cascade is an essential feature of the A549 cell phenotype and a potential radiotherapy target, extending the range of targets in multimodal therapies against lung cancer.« less

  11. Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

    PubMed Central

    Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

    2014-01-01

    Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

  12. Hypoxia induces p53 accumulation in the S-phase and accumulation of hypophosphorylated retinoblastoma protein in all cell cycle phases of human melanoma cells.

    PubMed Central

    Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.

    1998-01-01

    Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563

  13. Chromium (VI)-induced oxidative stress, apoptotic cell death and modulation of p53 tumor suppressor gene.

    PubMed

    Bagchi, D; Bagchi, M; Stohs, S J

    2001-06-01

    single oral LD50 dose of chromium (VI) on female C57BL/6Ntac and p53-deficient C57BL/6TSG p53 mice on enhanced production of superoxide anion, lipid peroxidation and DNA fragmentation in the hepatic and brain tissues. Chromium (VI)-induced more pronounced oxidative damage in p53 deficient mice. This in vivo study highlighted that apoptotic regulatory protein p53 may play a major role in chromium (VI)-induced oxidative stress and toxicity. Taken together, oxidative stress and oxidative tissue damage, and a cascade of cellular events including modulation of apoptotic regulatory gene p53 are involved in chromium (VI)-induced toxicity and carcinogenesis.

  14. CUL4B impedes stress-induced cellular senescence by dampening a p53-reactive oxygen species positive feedback loop.

    PubMed

    Wei, Zhao; Guo, Haiyang; Liu, Zhaojian; Zhang, Xiyu; Liu, Qiao; Qian, Yanyan; Gong, Yaoqin; Shao, Changshun

    2015-02-01

    Tumor suppressor p53 is known to regulate the level of intracellular reactive oxygen species (ROS). It can either alleviate oxidative stress under physiological and mildly stressed conditions or exacerbate oxidative stress under highly stressed conditions. We here report that a p53-ROS positive feedback loop drives a senescence program in normal human fibroblasts (NHFs) and this senescence-driving loop is negatively regulated by CUL4B. CUL4B, which can assemble various ubiquitin E3 ligases, was found to be downregulated in stress-induced senescent cells, but not in replicative senescent cells. We observed that p53-dependent ROS production was significantly augmented and stress-induced senescence was greatly enhanced when CUL4B was absent or depleted. Ectopic expression of CUL4B, on the other hand, blunted p53 activation, reduced ROS production, and attenuated cellular senescence in cells treated with H2O2. CUL4B was shown to promote p53 ubiquitination and proteosomal degradation in NHFs exposed to oxidative stress, thus dampening the p53-dependent cellular senescence. Together, our results established a critical role of CUL4B in negatively regulating the p53-ROS positive feedback loop that drives cellular senescence. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. p53 represses autophagy in a cell cycle-dependent fashion.

    PubMed

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  16. Zn(II)-curc targets p53 in thyroid cancer cells.

    PubMed

    Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

    2015-10-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

  17. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation

    PubMed Central

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types—MDM2, Pirh2, and COP1—and the HECT-domain type—ARF-BP1—have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G1 phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation. PMID:19509332

  18. JFK, a Kelch domain-containing F-box protein, links the SCF complex to p53 regulation.

    PubMed

    Sun, Luyang; Shi, Lei; Li, Wenqian; Yu, Wenhua; Liang, Jing; Zhang, Hua; Yang, Xiaohan; Wang, Yan; Li, Ruifang; Yao, Xingrong; Yi, Xia; Shang, Yongfeng

    2009-06-23

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Currently, several ubiquitin ligases, including the single-subunit RING-finger types--MDM2, Pirh2, and COP1--and the HECT-domain type--ARF-BP1--have been reported to target p53 for degradation. Here, we report the identification of a human Kelch domain-containing F-box protein, JFK. We showed that JFK promotes ubiquitination and degradation of p53. But unlike MDM2, Pirh2, COP1, and ARF-BP1, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Significantly, JFK inhibits p53-dependent transcription, and depletion of JFK stabilizes p53, promotes cell apoptosis, arrests cells in the G(1) phase, and sensitizes cells to ionizing radiation-induced cell death. These data indicate that JFK is a critical negative regulator of p53 and represents a pathway for the maintenance of p53 levels in unstressed cells. Our experiments link the Skp1-Cul1-F-box system to p53 regulation.

  19. Simvastatin rises reactive oxygen species levels and induces senescence in human melanoma cells by activation of p53/p21 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guterres, Fernanda Augusta de Lima Barbosa; Martinez, Glaucia Regina; Rocha, Maria Eliane Merlin

    2013-11-15

    Recent studies demonstrated that simvastatin has antitumor properties in several types of cancer cells, mainly by inducing apoptosis and inhibiting growth. The arrest of proliferation is a feature of cellular senescence; however, the occurrence of senescence in melanoma cells upon simvastatin treatment has not been investigated until now. Our results demonstrated that exposure of human metastatic melanoma cells (WM9) to simvastatin induces a senescent phenotype, characterized by G1 arrest, positive staining for senescence-associated β-galactosidase assay, and morphological changes. Also, the main pathways leading to cell senescence were examined in simvastatin-treated human melanoma cells, and the expression levels of phospho-p53 andmore » p21 were upregulated by simvastatin, suggesting that cell cycle regulators and DNA damage pathways are involved in the onset of senescence. Since simvastatin can act as a pro-oxidant agent, and oxidative stress may be related to senescence, we measured the intracellular ROS levels in WM9 cells upon simvastatin treatment. Interestingly, we found an increased amount of intracellular ROS in these cells, which was accompanied by elevated expression of catalase and peroxiredoxin-1. Collectively, our results demonstrated that simvastatin can induce senescence in human melanoma cells by activation of p53/p21 pathway, and that oxidative stress may be related to this process. - Highlights: • Lower concentrations of simvastatin can induce senescent phenotype in melanoma cells. • Simvastatin induces senescence in human melanoma cells via p53/p21 pathway. • Senescent phenotype is related with increased intracellular ROS. • Partial detoxification of ROS by catalase/peroxiredoxin-1 could lead cells to senescence rather than apoptosis.« less

  20. The BCL2 selective inhibitor venetoclax induces rapid onset apoptosis of CLL cells in patients via a TP53-independent mechanism

    PubMed Central

    Anderson, Mary Ann; Deng, Jing; Seymour, John F.; Tam, Constantine; Kim, Su Young; Fein, Joshua; Yu, Lijian; Brown, Jennifer R.; Westerman, David; Si, Eric G.; Majewski, Ian J.; Segal, David; Heitner Enschede, Sari L.; Huang, David C. S.; Davids, Matthew S.; Letai, Anthony

    2016-01-01

    BCL2 blunts activation of the mitochondrial pathway to apoptosis, and high-level expression is required for chronic lymphocytic leukemia (CLL) survival. Venetoclax (ABT-199) is a small-molecule selective inhibitor of BCL2 currently in clinical trials for CLL and other malignancies. In conjunction with the phase 1 first-in-human clinical trial of venetoclax in patients with relapsed or refractory CLL (M12-175), we investigated the mechanism of action of venetoclax in vivo, explored whether in vitro sensitivity assays or BH3 profiling correlated with in vivo responses in patients, and determined whether loss of TP53 function affected responses in vitro and in vivo. In all samples tested, venetoclax induced death of CLL cells in vitro at concentrations achievable in vivo, with cell death evident within 4 hours. Apoptotic CLL cells were detected in vivo 6 or 24 hours after a single 20-mg or 50-mg dose in some patients. The extent of mitochondrial depolarization by a BIM BH3 peptide in vitro was correlated with percentage reduction of CLL in the blood and bone marrow in vivo, whereas the half lethal concentration derived from standard cytotoxicity assays was not. CLL cell death in vitro and the depth of clinical responses were independent of deletion of chromosome 17p, TP53 mutation, and TP53 function. These data provide direct evidence that venetoclax kills CLL cells in a TP53-independent fashion by inhibition of BCL2 in patients and support further assessment of BH3 profiling as a predictive biomarker for this drug. PMID:27069256

  1. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  2. A minimally invasive assay for individual assessment of the ATM/CHEK2/p53 pathway activity.

    PubMed

    Kabacik, Sylwia; Ortega-Molina, Ana; Efeyan, Alejo; Finnon, Paul; Bouffler, Simon; Serrano, Manuel; Badie, Christophe

    2011-04-01

    Ionizing radiation induces DNA Double-Strand Breaks (DSBs) which activate the ATM/CHEK2/p53 pathway leading to cell cycle arrest and apoptosis through transcription of genes including CDKN1A (p21) and BBC3 (PUMA). This pathway prevents genomic instability and tumorigenesis as demonstrated in heritable syndromes [e.g. Ataxia Telangiectasia (AT); Li-Fraumeni syndrome (LFS)]. Here, a simple assay based on gene expression in peripheral blood to measure accurately ATM/CHEK2/p53 pathway activity is described. The expression of p21, Puma and Sesn2 was determined in blood from mice with different gene copy numbers of Atm, Trp53 (p53), Chek2 or Arf and in human blood and mitogen stimulated T-lymphocyte (MSTL) cultures from AT, AT carriers, LFS patients, and controls, both before and after ex vivo ionizing irradiation. Mouse Atm/Chek2/p53 activity was highly dependent on the copy number of each gene except Arf. In human MSTL, an AT case, AT carriers and LFS patients showed responses distinct from healthy donors. The relationship between gene copy number and transcriptional induction upon radiation was linear for p21 and Puma and correlated well with cancer incidence in p53 variant mice. This reliable blood test provides an assay to determine ATM/CHEK2/p53 pathway activity and demonstrates the feasibility of assessing the activity of this essential cancer protection pathway in simple assays. These findings may have implications for the individualized prediction of cancer susceptibility.

  3. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2015-01-01

    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  4. L'effet de p53 sur la radiosensibilité des cellules humaines normales et cancéreuses

    NASA Astrophysics Data System (ADS)

    Little, J. B.; Li, C. Y.; Nagasawa, H.; Huang, H.

    1998-04-01

    The radiosensitivity of normal human fibroblasts in p53 dependent and associated with the loss of cells from the cycling population as the result of an irreversible G1 arrest; cells lacking normal p53 function show no arrest and are more radioresistant. Under conditions in which the repair potentially lethal radiation damage is facilitated, the fraction of cells arrested in G1 is reduced and survival is enhanced. The response of human tumor cells differs significantly. The radiation-induced G1 arrest is minimal or absent in p53+ tumor cells, and loss of normal p53 function has no consistent effect on their radiosensitivity. These results suggest that p53 status may not be a useful predictive marker for the response of human solid tumors to radiation therapy. La radiosensibilité des fibroblastes diploïdes humains est liée à l'expression de p53, et à la perte de cellules en cycle résultant d'un arrêt irréversible en phase G1 ; dans les cellules n'ayant pas une fonction p53 normale, on ne constate aucun arrêt, et elles sont plus radio-résistantes. Dans des conditions favorables à la réparation de lésions potentiellement léthales dues à l'irradiation, la proportion de cellules bloquées en phase G1 baisse, et les chances de survie sont accrues. Bien différente est la réaction des cellules cancéreuses humaines. Le blocage par irradiation en phase G1 est minime ou inexistant dans les cellules cancéreuses p53^+, et la perte de la fonction normale p53 n'a pas d'effet constant sur leur radiosensibilité. Ces résultats laissent penser que l'expression de p53 n'est pas un indice fiable permettant de prévoir la réaction des tumeurs solides à la radiothérapie.

  5. Mechanisms that enhance sustainability of p53 pulses.

    PubMed

    Kim, Jae Kyoung; Jackson, Trachette L

    2013-01-01

    The tumor suppressor p53 protein shows various dynamic responses depending on the types and extent of cellular stresses. In particular, in response to DNA damage induced by γ-irradiation, cells generate a series of p53 pulses. Recent research has shown the importance of sustaining repeated p53 pulses for recovery from DNA damage. However, far too little attention has been paid to understanding how cells can sustain p53 pulses given the complexities of genetic heterogeneity and intrinsic noise. Here, we explore potential molecular mechanisms that enhance the sustainability of p53 pulses by developing a new mathematical model of the p53 regulatory system. This model can reproduce many experimental results that describe the dynamics of p53 pulses. By simulating the model both deterministically and stochastically, we found three potential mechanisms that improve the sustainability of p53 pulses: 1) the recently identified positive feedback loop between p53 and Rorα allows cells to sustain p53 pulses with high amplitude over a wide range of conditions, 2) intrinsic noise can often prevent the dampening of p53 pulses even after mutations, and 3) coupling of p53 pulses in neighboring cells via cytochrome-c significantly reduces the chance of failure in sustaining p53 pulses in the presence of heterogeneity among cells. Finally, in light of these results, we propose testable experiments that can reveal important mechanisms underlying p53 dynamics.

  6. Sod1 Loss Induces Intrinsic Superoxide Accumulation Leading to p53-Mediated Growth Arrest and Apoptosis

    PubMed Central

    Watanabe, Kenji; Shibuya, Shuichi; Koyama, Hirofumi; Ozawa, Yusuke; Toda, Toshihiko; Yokote, Koutaro; Shimizu, Takahiko

    2013-01-01

    Oxidative damages induced by a redox imbalance cause age-related changes in cells and tissues. Superoxide dismutase (SOD) enzymes play a major role in the antioxidant system and they also catalyze superoxide radicals (O2•−). Since the loss of cytoplasmic SOD (SOD1) resulted in aging-like phenotypes in several types of mouse tissue, SOD1 is essential for the maintenance of tissue homeostasis. To clarify the cellular function of SOD1, we investigated the cellular phenotypes of Sod1-deficient fibroblasts. We demonstrated that Sod1 deficiency impaired proliferation and induced apoptosis associated with O2•− accumulation in the cytoplasm and mitochondria in fibroblasts. Sod1 loss also decreased the mitochondrial membrane potential and led to DNA damage-mediated p53 activation. Antioxidant treatments effectively improved the cellular phenotypes through suppression of both intracellular O2•− accumulation and p53 activation in Sod1-deficient fibroblasts. In vivo experiments revealed that transdermal treatment with a vitamin C derivative significantly reversed the skin thinning commonly associated with the upregulated p53 action in the skin. Our findings revealed that intrinsic O2•− accumulation promoted p53-mediated growth arrest and apoptosis as well as mitochondrial disfunction in the fibroblasts. PMID:23708100

  7. 29 CFR 1926.53 - Ionizing radiation.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 29 Labor 8 2011-07-01 2011-07-01 false Ionizing radiation. 1926.53 Section 1926.53 Labor... § 1926.53 Ionizing radiation. (a) In construction and related activities involving the use of sources of ionizing radiation, the pertinent provisions of the Nuclear Regulatory Commission's Standards for...

  8. 29 CFR 1926.53 - Ionizing radiation.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 29 Labor 8 2012-07-01 2012-07-01 false Ionizing radiation. 1926.53 Section 1926.53 Labor... § 1926.53 Ionizing radiation. (a) In construction and related activities involving the use of sources of ionizing radiation, the pertinent provisions of the Nuclear Regulatory Commission's Standards for...

  9. 29 CFR 1926.53 - Ionizing radiation.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 29 Labor 8 2014-07-01 2014-07-01 false Ionizing radiation. 1926.53 Section 1926.53 Labor... § 1926.53 Ionizing radiation. (a) In construction and related activities involving the use of sources of ionizing radiation, the pertinent provisions of the Nuclear Regulatory Commission's Standards for...

  10. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype.

    PubMed

    Waraya, Mina; Yamashita, Keishi; Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways.

  11. Quercetin Enhances the Antitumor Activity of Trichostatin A through Upregulation of p53 Protein Expression In Vitro and In Vivo

    PubMed Central

    Chan, Shu-Ting; Yang, Nae-Cherng; Huang, Chin-Shiu; Liao, Jiunn-Wang; Yeh, Shu-Lan

    2013-01-01

    This study investigated the effects of quercetin on the anti-tumor effect of trichostatin A (TSA), a novel anticancer drug, in vitro and in vivo and the possible mechanisms of these effects in human lung cancer cells. We first showed that quercetin (5 µM) significantly increased the growth arrest and apoptosis in A549 cells (expressing wild-type p53) induced by 25 ng/mL of (82.5 nM) TSA at 48 h by about 25% and 101%, respectively. However, such enhancing effects of quercetin (5 µM) were not significant in TSA-exposed H1299 cells (a p53 null mutant) or were much lower than in A549 cells. In addition, quercetin significantly increased TSA-induced p53 expression in A549 cells. Transfection of p53 siRNA into A549 cells significantly but not completely diminished the enhancing effects of quercetin on TSA-induced apoptosis. Furthermore, we demonstrated that quercetin enhanced TSA-induced apoptosis through the mitochondrial pathway. Transfection of p53 siRNA abolished such enhancing effects of quercetin. However, quercetin increased the acetylation of histones H3 and H4 induced by TSA in A549 cells, even with p53 siRNA transfection as well as in H1299 cells. In a xenograft mouse model of lung cancer, quercetin enhanced the antitumor effect of TSA. Tumors from mice treated with TSA in combination with quercetin had higher p53 and apoptosis levels than did those from control and TSA-treated mice. These data indicate that regulation of the expression of p53 by quercetin plays an important role in enhancing TSA-induced apoptosis in A549 cells. However, p53-independent mechanisms may also contribute to the enhancing effect of quercetin. PMID:23342112

  12. E2 Proteins from High- and Low-Risk Human Papillomavirus Types Differ in Their Ability To Bind p53 and Induce Apoptotic Cell Death

    PubMed Central

    Parish, Joanna L.; Kowalczyk, Anna; Chen, Hsin-Tien; Roeder, Geraldine E.; Sessions, Richard; Buckle, Malcolm; Gaston, Kevin

    2006-01-01

    The E2 proteins from oncogenic (high-risk) human papillomaviruses (HPVs) can induce apoptotic cell death in both HPV-transformed and non-HPV-transformed cells. Here we show that the E2 proteins from HPV type 6 (HPV6) and HPV11, two nononcogenic (low-risk) HPV types, fail to induce apoptosis. Unlike the high-risk HPV16 E2 protein, these low-risk E2 proteins fail to bind p53 and fail to induce p53-dependent transcription activation. Interestingly, neither the ability of p53 to activate transcription nor the ability of p53 to bind DNA, are required for HPV16 E2-induced apoptosis in non-HPV-transformed cells. However, mutations that reduce the binding of the HPV16 E2 protein to p53 inhibit E2-induced apoptosis in non-HPV-transformed cells. In contrast, the interaction between HPV16 E2 and p53 is not required for this E2 protein to induce apoptosis in HPV-transformed cells. Thus, our data suggest that this high-risk HPV E2 protein induces apoptosis via two pathways. One pathway involves the binding of E2 to p53 and can operate in both HPV-transformed and non-HPV-transformed cells. The second pathway requires the binding of E2 to the viral genome and can only operate in HPV-transformed cells. PMID:16611918

  13. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  14. SAR405838: An optimized inhibitor of MDM2-p53 interaction that induces complete and durable tumor regression

    DOE PAGES

    Wang, Shaomeng; Sun, Wei; Zhao, Yujun; ...

    2014-08-21

    Blocking the MDM2-p53 protein-protein interaction has long been considered to offer a broad cancer therapeutic strategy, despite the potential risks of selecting tumors harboring p53 mutations that escape MDM2 control. In this study, we report a novel small molecule inhibitor of the MDM2-p53 interaction, SAR405838 (MI-77301) that has been advanced into Phase I clinical trials. SAR405838 binds to MDM2 with K i = 0.88 nM and has high specificity over other proteins. A co-crystal structure of the SAR405838:MDM2 complex shows that in addition to mimicking three key p53 amino acid residues, the inhibitor captures additional interactions not observed in themore » p53-MDM2 complex and induces refolding of the short, unstructured MDM2 N-terminal region to achieve its high affinity. SAR405838 effectively activates wild-type p53 in vitro and in xenograft tumor tissue of leukemia and solid tumors, leading to p53-dependent cell cycle arrest and/or apoptosis. At well-tolerated dose schedules, SAR405838 achieves either durable tumor regression or complete tumor growth inhibition in mouse xenograft models of SJSA-1 osteosarcoma, RS4;11 acute leukemia, LNCaP prostate cancer and HCT-116 colon cancer. Remarkably, a single oral dose of SAR405838 is sufficient to achieve complete tumor regression in the SJSA-1 model. Mechanistically, robust transcriptional up-regulation of PUMA induced by SAR405838 results in strong apoptosis in tumor tissue, leading to complete tumor regression. Lastly, our findings provide a preclinical basis upon which to evaluate SAR405838 as a therapeutic agent in patients whose tumors retain wild-type p53.« less

  15. p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

    PubMed

    Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

    2009-04-01

    Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

  16. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa; Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192; Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21more » and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.« less

  17. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  18. Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    PubMed Central

    Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

    2015-01-01

    ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine

  19. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

  20. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  1. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  2. Fluoride induces apoptosis via inhibiting SIRT1 activity to activate mitochondrial p53 pathway in human neuroblastoma SH-SY5Y cells.

    PubMed

    Tu, Wei; Zhang, Qian; Liu, Yin; Han, Lianyong; Wang, Qin; Chen, Panpan; Zhang, Shun; Wang, Aiguo; Zhou, Xue

    2018-05-15

    There has been a great concern about the neurotoxicity of fluoride since it can pass through the blood-brain barrier and accumulate in the brain. It has been suggested that apoptosis plays a vital role in neurotoxicity of fluoride. However, whether p53-mediated apoptotic pathway is involved is still unclear. Our results showed that apoptosis was induced after treatment with 40 and 60 mg/L of NaF for 24 h in human neuroblastoma SH-SY5Y cells. Exposure to 60 mg/L of NaF for 24 h significantly upregulated the levels of p53 and apoptosis-related proteins including PUMA, cytochrome c (cyto c), cleaved caspase-3 and cleaved PARP, whereas downregulated Bcl-2 in SH-SY5Y cells. Meanwhile, fluoride increased p53 nuclear translocation, cyto c release from mitochondria to cytoplasm and mitochondrial translocation of Bax in SH-SY5Y cells. Fluoride-induced increases of apoptotic rates and apoptosis-related protein levels were significantly attenuated by inhibiting p53 transcriptional activity with pifithrin-α. In addition, fluoride inhibited the deacetylase activity of SIRT1 and increased p53 (acetyl K382) level in SH-SY5Y cells. Apoptosis and upregulation of cleaved caspase-3, cleaved PARP and p53 (acetyl K382) induced by fluoride could be ameliorated by SIRT1 overexpression or its activator resveratrol in SH-SY5Y cells. Taken together, our study demonstrates that fluoride induces apoptosis by inhibiting the deacetylase activity of SIRT1 to activate mitochondrial p53 pathway in SH-SY5Y cells, which depends on p53 transcriptional activity. Thus, SIRT1 may be a promising target to protect against neurotoxicity induced by fluoride. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Anti-cancer peptides from ras-p21 and p53 proteins.

    PubMed

    Pincus, Matthew R; Fenelus, Maly; Sarafraz-Yazdi, Ehsan; Adler, Victor; Bowne, Wilbur; Michl, Josef

    2011-01-01

    We have employed computer-based molecular modeling approaches to design peptides from the ras-p21 and p53 proteins that either induce tumor cell reversion to the untransformed phenotype or induce tumor cell necrosis without affecting normal cells. For rasp21, we have computed and superimposed the average low energy structures for the wild-type protein and oncogenic forms of this protein and found that specific domains change conformation in the oncogenic proteins. We have synthesized peptides corresponding to these and found that ras peptides, 35-47 (PNC-7) and 96-110 (PNC-2), block oncogenic ras-p21-induced oocyte maturation but have no effect on insulin-induced oocyte maturation that requires activation of endogenous wild-type ras-p21. These results show signal transduction pathway differences between oncogenic and activated wild-type ras-p21. Both peptides, attached to a membrane-penetrating peptide (membrane residency peptide or MRP), either induce phenotypic reversion to the untransformed phenotype or tumor cell necrosis of several ras-transformed cell lines, but have no effect on the growth of normal cells. Using other computational methods, we have designed two peptides, PNC-27 and 28, containing HDM-2-protein-binding domain sequences from p53 linked on their C-termini to the MRP that induce pore formation in the membranes of a wide range of cancer cells but not any normal cells tested. This is due to the expression of HDM-2 in the cancer cell membrane that does not occur in normal cells. These peptides eradicate a highly malignant tumor in nude mice with no apparent side effects. Both ras and p53 peptides show promise as anti-tumor agents in humans.

  4. miR-300 regulates cellular radiosensitivity through targeting p53 and apaf1 in human lung cancer cells.

    PubMed

    He, Jinpeng; Feng, Xiu; Hua, Junrui; Wei, Li; Lu, Zhiwei; Wei, Wenjun; Cai, Hui; Wang, Bing; Shi, Wengui; Ding, Nan; Li, He; Zhang, Yanan; Wang, Jufang

    2017-10-18

    microRNAs (miRNAs) play a crucial role in mediation of the cellular sensitivity to ionizing radiation (IR). Previous studies revealed that miR-300 was involved in the cellular response to IR or chemotherapy drug. However, whether miR-300 could regulate the DNA damage responses induced by extrinsic genotoxic stress in human lung cancer and the underlying mechanism remain unknown. In this study, the expression of miR-300 was examined in lung cancer cells treated with IR, and the effects of miR-300 on DNA damage repair, cell cycle arrest, apoptosis and senescence induced by IR were investigated. It was found that IR induced upregulation of endogenous miR-300, and ectopic expression of miR-300 by transfected with miR-300 mimics not only greatly enhanced the cellular DNA damage repair ability but also substantially abrogated the G2 cell cycle arrest and apoptosis induced by IR. Bioinformatic analysis predicted that p53 and apaf1 were potential targets of miR-300, and the luciferase reporter assay showed that miR-300 significantly suppressed the luciferase activity through binding to the 3'-UTR of p53 or apaf1 mRNA. In addition, overexpression of miR-300 significantly reduced p53/apaf1 and/or IR-induced p53/apaf1 protein expression levels. Flow cytomertry analysis and colony formation assay showed that miR-300 desensitized lung cancer cells to IR by suppressing p53-dependent G2 cell cycle arrest, apoptosis and senescence. These data demonstrate that miR-300 regulates the cellular sensitivity to IR through targeting p53 and apaf1 in lung cancer cells.

  5. The BCL2 selective inhibitor venetoclax induces rapid onset apoptosis of CLL cells in patients via a TP53-independent mechanism.

    PubMed

    Anderson, Mary Ann; Deng, Jing; Seymour, John F; Tam, Constantine; Kim, Su Young; Fein, Joshua; Yu, Lijian; Brown, Jennifer R; Westerman, David; Si, Eric G; Majewski, Ian J; Segal, David; Heitner Enschede, Sari L; Huang, David C S; Davids, Matthew S; Letai, Anthony; Roberts, Andrew W

    2016-06-23

    BCL2 blunts activation of the mitochondrial pathway to apoptosis, and high-level expression is required for chronic lymphocytic leukemia (CLL) survival. Venetoclax (ABT-199) is a small-molecule selective inhibitor of BCL2 currently in clinical trials for CLL and other malignancies. In conjunction with the phase 1 first-in-human clinical trial of venetoclax in patients with relapsed or refractory CLL (M12-175), we investigated the mechanism of action of venetoclax in vivo, explored whether in vitro sensitivity assays or BH3 profiling correlated with in vivo responses in patients, and determined whether loss of TP53 function affected responses in vitro and in vivo. In all samples tested, venetoclax induced death of CLL cells in vitro at concentrations achievable in vivo, with cell death evident within 4 hours. Apoptotic CLL cells were detected in vivo 6 or 24 hours after a single 20-mg or 50-mg dose in some patients. The extent of mitochondrial depolarization by a BIM BH3 peptide in vitro was correlated with percentage reduction of CLL in the blood and bone marrow in vivo, whereas the half lethal concentration derived from standard cytotoxicity assays was not. CLL cell death in vitro and the depth of clinical responses were independent of deletion of chromosome 17p, TP53 mutation, and TP53 function. These data provide direct evidence that venetoclax kills CLL cells in a TP53-independent fashion by inhibition of BCL2 in patients and support further assessment of BH3 profiling as a predictive biomarker for this drug. © 2016 by The American Society of Hematology.

  6. Pomegranate protects against arsenic-induced p53-dependent ROS-mediated inflammation and apoptosis in liver cells.

    PubMed

    Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya

    2016-12-01

    Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright

  7. 7-Chloro-6-piperidin-1-yl-quinoline-5,8-dione (PT-262), a novel synthetic compound induces lung carcinoma cell death associated with inhibiting ERK and CDC2 phosphorylation via a p53-independent pathway.

    PubMed

    Hsu, Tzu-Sheng; Chen, Chinpiao; Lee, Pei-Ting; Chiu, Shu-Jun; Liu, Huei-Fang; Tsai, Chih-Chien; Chao, Jui-I

    2008-10-01

    The derivatives of 5,8-quinolinedione have been shown to exert anticancer activities. A new synthetic compound 7-chloro-6-piperidin-1-yl-quinoline-5,8-dione (designed as PT-262) derived from 6,7-dichloroquinoline-5,8-dione on its anticancer activity was investigated in this study. PT-262 was synthesized as the following: triethylamine (0.56 ml, 5.1 mmol) was added dropwise to a solution of 6,7-dichloroquinoline-5,8-dione (1.00 g, 4.4 mmol) and piperidine (0.50 ml, 5.1 mmol) in 150 ml of benzene with stirring at room temperature for 5 min, and the solvent was removed using rotary evaporator to give a dark brown solid. PT-262 was purified by flash chromatography using 50% ethyl acetate/hexanes to elute that displayed as brown solids. To examine the induction of apoptosis following PT-262 treatment, the lung cancer cells were subjected to apoptotic cell observation, caspase activation, and mitochondrial functional assays. The protein levels of phosphorylated ERK and CDC2 after treatment with PT-262 were analyzed by Western blot. Treatment with 1-20 microM PT-262 for 24 h induced cytotoxicity via a concentration-dependent manner in human lung cancer cells. PT-262 induced the loss of mitochondrial membrane potential and elevated the caspase-3 activation and apoptosis. Interestingly, the phosphorylation of ERK was inhibited by PT-262. The IC50 value of ERK phosphorylation inhibition was approximate around 5 microM. Treatment with a specific MEK1/2 (the upstream of ERK) inhibitor, PD98059, increased the PT-262-induced cytotoxicity in lung cancer cells. Moreover, PT-262 did not alter the protein expression of tumor suppressor p53. PT-262 elicited the cytotoxicity and accumulated the G2/M fractions in both the p53-wild type and p53-null lung cancer cells. The mitosis-regulated protein levels of cyclin B1 and phospho-CDC2 at Thr14, Tyr15, and Thr161 were repressed by PT-262 in these cells. PT-262 suppresses the phosphorylation of ERK and CDC2 associated with proliferation

  8. The impact of p53 protein core domain structural alteration on ovarian cancer survival.

    PubMed

    Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E

    2003-09-15

    Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.

  9. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

    PubMed Central

    Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

    2017-01-01

    Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

  11. Evaluation of bax, bcl-2, p21 and p53 genes expression variations on cerebellum of BALB/c mice before and after birth under mobile phone radiation exposure.

    PubMed

    Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein

    2017-09-01

    The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P <0.05). From the obtained data it could be concluded that the mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.

  12. IKK is a therapeutic target in KRAS-Induced lung cancer with disrupted p53 activity.

    PubMed

    Bassères, Daniela S; Ebbs, Aaron; Cogswell, Patricia C; Baldwin, Albert S

    2014-04-01

    Activating mutations in KRAS are prevalent in cancer, but therapies targeted to oncogenic RAS have been ineffective to date. These results argue that targeting downstream effectors of RAS will be an alternative route for blocking RAS-driven oncogenic pathways. We and others have shown that oncogenic RAS activates the NF-κB transcription factor pathway and that KRAS-induced lung tumorigenesis is suppressed by expression of a degradation-resistant form of the IκBα inhibitor or by genetic deletion of IKKβ or the RELA/p65 subunit of NF-κB. Here, genetic and pharmacological approaches were utilized to inactivate IKK in human primary lung epithelial cells transformed by KRAS, as well as KRAS mutant lung cancer cell lines. Administration of the highly specific IKKβ inhibitor Compound A (CmpdA) led to NF-κB inhibition in different KRAS mutant lung cells and siRNA-mediated knockdown of IKKα or IKKβ reduced activity of the NF-κB canonical pathway. Next, we determined that both IKKα and IKKβ contribute to oncogenic properties of KRAS mutant lung cells, particularly when p53 activity is disrupted. Based on these results, CmpdA was tested for potential therapeutic intervention in the Kras-induced lung cancer mouse model (LSL-Kras (G12D)) combined with loss of p53 (LSL-Kras (G12D)/p53 (fl/fl)). CmpdA treatment was well tolerated and mice treated with this IKKβ inhibitor presented smaller and lower grade tumors than mice treated with placebo. Additionally, IKKβ inhibition reduced inflammation and angiogenesis. These results support the concept of targeting IKK as a therapeutic approach for oncogenic RAS-driven tumors with altered p53 activity.

  13. The nucleolus directly regulates p53 export and degradation.

    PubMed

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  14. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    PubMed

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  15. p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

    PubMed

    Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

    2009-11-01

    Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

  16. Silibinin enhances the repair of ultraviolet B-induced DNA damage by activating p53-dependent nucleotide excision repair mechanism in human dermal fibroblasts

    PubMed Central

    Guillermo-Lagae, Ruth; Deep, Gagan; Ting, Harold; Agarwal, Chapla; Agarwal, Rajesh

    2015-01-01

    Ultraviolet radiation B (UVB) is the main cause of DNA damage in epidermal cells; and if not repaired, this DNA damage leads to skin cancer. In earlier studies, we have reported that natural flavonolignan silibinin exerts strong chemopreventive efficacy against UVB-induced skin damage and carcinogenesis; however mechanistic studies are still being actively pursued. Here, we investigated the role of nucleotide excision repair (NER) pathway in silibinin's efficacy to repair UVB-induced DNA damage. Normal human dermal fibroblasts (NHDFs) were exposed to UVB (1 mJ/cm2) with pre- or post- silibinin (100 μM) treatment, and cyclobutane pyrimidine dimers (CPDs) formation/repair was measured. Results showed that post-UVB silibinin treatment accelerates DNA repair via activating the NER pathway including the expression of XPA (xeroderma pigmentosum complementation group A), XPB, XPC, and XPG. In UVB exposed fibroblasts, silibinin treatment also increased p53 and GADD45α expression; the key regulators of the NER pathway and DNA repair. Consistently, post-UVB silibinin treatment increased the mRNA transcripts of XPA and GADD45α. Importantly, silibinin showed no effect on UVB-induced DNA damage repair in XPA- and XPB-deficient human dermal fibroblasts suggesting their key role in silibinin-mediated DNA damage repair. Moreover, in the presence of pifithrin-α, an inhibitor of p53, the DNA repair efficacy of silibinin was compromised associated with a reduction in XPA and GADD45α transcripts. Together, these findings suggest that silibinin's efficacy against UVB-induced photodamage is primarily by inhibiting NER and p53; and these findings further support silibinin's usage as a potential inexpensive, effective, and non-toxic agent for skin cancer chemoprevention. PMID:26447614

  17. Silibinin enhances the repair of ultraviolet B-induced DNA damage by activating p53-dependent nucleotide excision repair mechanism in human dermal fibroblasts.

    PubMed

    Guillermo-Lagae, Ruth; Deep, Gagan; Ting, Harold; Agarwal, Chapla; Agarwal, Rajesh

    2015-11-24

    Ultraviolet radiation B (UVB) is the main cause of DNA damage in epidermal cells; and if not repaired, this DNA damage leads to skin cancer. In earlier studies, we have reported that natural flavonolignan silibinin exerts strong chemopreventive efficacy against UVB-induced skin damage and carcinogenesis; however mechanistic studies are still being actively pursued. Here, we investigated the role of nucleotide excision repair (NER) pathway in silibinin's efficacy to repair UVB-induced DNA damage. Normal human dermal fibroblasts (NHDFs) were exposed to UVB (1 mJ/cm2) with pre- or post- silibinin (100 μM) treatment, and cyclobutane pyrimidine dimers (CPDs) formation/repair was measured. Results showed that post-UVB silibinin treatment accelerates DNA repair via activating the NER pathway including the expression of XPA (xeroderma pigmentosum complementation group A), XPB, XPC, and XPG. In UVB exposed fibroblasts, silibinin treatment also increased p53 and GADD45α expression; the key regulators of the NER pathway and DNA repair. Consistently, post-UVB silibinin treatment increased the mRNA transcripts of XPA and GADD45α. Importantly, silibinin showed no effect on UVB-induced DNA damage repair in XPA- and XPB-deficient human dermal fibroblasts suggesting their key role in silibinin-mediated DNA damage repair. Moreover, in the presence of pifithrin-α, an inhibitor of p53, the DNA repair efficacy of silibinin was compromised associated with a reduction in XPA and GADD45α transcripts. Together, these findings suggest that silibinin's efficacy against UVB-induced photodamage is primarily by inhibiting NER and p53; and these findings further support silibinin's usage as a potential inexpensive, effective, and non-toxic agent for skin cancer chemoprevention.

  18. p53 predictive value for pT1-2 N0 disease at radical cystectomy.

    PubMed

    Shariat, Shahrokh F; Lotan, Yair; Karakiewicz, Pierre I; Ashfaq, Raheela; Isbarn, Hendrik; Fradet, Yves; Bastian, Patrick J; Nielsen, Matthew E; Capitanio, Umberto; Jeldres, Claudio; Montorsi, Francesco; Müller, Stefan C; Karam, Jose A; Heukamp, Lukas C; Netto, George; Lerner, Seth P; Sagalowsky, Arthur I; Cote, Richard J

    2009-09-01

    Approximately 15% to 30% of patients with pT1-2N0M0 urothelial carcinoma of the bladder experience disease progression despite radical cystectomy with curative intent. We determined whether p53 expression would improve the prediction of disease progression after radical cystectomy for pT1-2N0M0 UCB. In a multi-institutional retrospective cohort we identified 324 patients with pT1-2N0M0 urothelial carcinoma of the bladder who underwent radical cystectomy. Analysis focused on a testing cohort of 272 patients and an external validation of 52. Competing risks regression models were used to test the association of variables with cancer specific mortality after accounting for nonbladder cancer caused mortality. In the testing cohort 91 patients (33.5%) had altered p53 expression (p53alt). On multivariate competing risks regression analysis altered p53 achieved independent status for predicting disease recurrence and cancer specific mortality (each p <0.001). Adding p53 increased the accuracy of multivariate competing risks regression models predicting recurrence and cancer specific mortality by 5.7% (62.0% vs 67.7%) and 5.4% (61.6% vs 67.0%), respectively. Alterations in p53 represent a highly promising marker of disease recurrence and cancer specific mortality after radical cystectomy for urothelial carcinoma of the bladder. Analysis confirmed previous findings and showed that considering p53 can result in substantial accuracy gains relative to the use of standard predictors. The value and the level of the current evidence clearly exceed previous proof of the independent predictor status of p53 for predicting recurrence and cancer specific mortality.

  19. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    PubMed

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  20. Negative feedback regulation of wild-type p53 biosynthesis.

    PubMed Central

    Mosner, J; Mummenbrauer, T; Bauer, C; Sczakiel, G; Grosse, F; Deppert, W

    1995-01-01

    When growth-arrested mouse fibroblasts re-entered the cell-cycle, the rise in tumour suppressor p53 mRNA level markedly preceded the rise in expression of the p53 protein. Furthermore, gamma-irradiation of such cells led to a rapid increase in p53 protein biosynthesis even in the presence of the transcription inhibitor actinomycin D. Both findings strongly suggest that p53 biosynthesis in these cells is regulated at the translational level. We present evidence for an autoregulatory control of p53 expression by a negative feed-back loop: p53 mRNA has a predicted tendency to form a stable stem-loop structure that involves the 5'-untranslated region (5'-UTR) plus some 280 nucleotides of the coding sequence. p53 binds tightly to the 5'-UTR region and inhibits the translation of its own mRNA, most likely mediated by the p53-intrinsic RNA re-annealing activity. The inhibition of p53 biosynthesis requires wild-type p53, as it is not observed with MethA mutant p53, p53-catalysed translational inhibition is selective; it might be restricted to p53 mRNA and a few other mRNAs that are able to form extensive stem-loop structures. Release from negative feed-back regulation of p53 biosynthesis, e.g. after damage-induced nuclear transport of p53, might provide a means for rapidly increasing p53 protein levels when p53 is required to act as a cell-cycle checkpoint determinant after DNA damage. Images PMID:7556087

  1. Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

    PubMed

    Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

    1998-05-01

    Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

  2. Alterations of p53 in tumorigenic human bronchial epithelial cells correlate with metastatic potential

    NASA Technical Reports Server (NTRS)

    Piao, C. Q.; Willey, J. C.; Hei, T. K.; Hall, E. J. (Principal Investigator)

    1999-01-01

    The cellular and molecular mechanisms of radiation-induced lung cancer are not known. In the present study, alterations of p53 in tumorigenic human papillomavirus-immortalized human bronchial epithelial (BEP2D) cells induced by a single low dose of either alpha-particles or 1 GeV/nucleon (56)Fe were analyzed by PCR-single-stranded conformation polymorphism (SSCP) coupled with sequencing analysis and immunoprecipitation assay. A total of nine primary and four secondary tumor cell lines, three of which were metastatic, together with the parental BEP2D and primary human bronchial epithelial (NHBE) cells were studied. The immunoprecipitation assay showed overexpression of mutant p53 proteins in all the tumor lines but not in NHBE and BEP2D cells. PCR-SSCP and sequencing analysis found band shifts and gene mutations in all four of the secondary tumors. A G-->T transversion in codon 139 in exon 5 that replaced Lys with Asn was detected in two tumor lines. One mutation each, involving a G-->T transversion in codon 215 in exon 6 (Ser-->lle) and a G-->A transition in codon 373 in exon 8 (Arg-->His), was identified in the remaining two secondary tumors. These results suggest that p53 alterations correlate with tumorigenesis in the BEP2D cell model and that mutations in the p53 gene may be indicative of metastatic potential.

  3. Curcumin Enhances the Efficacy of Chemotherapy by Tailoring p65NFκB-p300 Cross-talk in Favor of p53-p300 in Breast Cancer*

    PubMed Central

    Sen, Gouri Sankar; Mohanty, Suchismita; Hossain, Dewan Md Sakib; Bhattacharyya, Sankar; Banerjee, Shuvomoy; Chakraborty, Juni; Saha, Shilpi; Ray, Pallab; Bhattacharjee, Pushpak; Mandal, Debaprasad; Bhattacharya, Arindam; Chattopadhyay, Samit; Das, Tanya; Sa, Gaurisankar

    2011-01-01

    Breast cancer cells often develop multiple mechanisms of drug resistance during tumor progression, which is the major reason for the failure of breast cancer therapy. High constitutive activation of NFκB has been found in different cancers, creating an environment conducive for chemotherapeutic resistance. Here we report that doxorubicin-induced SMAR1-dependent transcriptional repression and SMAR1-independent degradation of IkBα resulted in nuclear translocation of p65NFκB and its association with p300 histone acetylase and subsequent transcription of Bcl-2 to impart protective response in drug-resistant cells. Consistently SMAR1-silenced drug-resistant cells exhibited IkBα-mediated inhibition of p65NFκB and induction of p53-dependent apoptosis. Interestingly, curcumin pretreatment of drug-resistant cells alleviated SMAR1-mediated p65NFκB activation and hence restored doxorubicin sensitivity. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic death cascade. Importantly, promyelocyte leukemia-mediated SMAR1 sequestration that relieved the repression of apoptosis-inducing genes was indispensable for such chemo-sensitizing ability of curcumin. A simultaneous decrease in drug-induced systemic toxicity by curcumin might also have enhanced the efficacy of doxorubicin by improving the intrinsic defense machineries of the tumor-bearer. Overall, the findings of this preclinical study clearly demonstrate the effectiveness of curcumin to combat doxorubicin-resistance. We, therefore, suggest curcumin as a potent chemo-sensitizer to improve the therapeutic index of this widely used anti-cancer drug. Taken together, these results suggest that curcumin can be developed into an adjuvant chemotherapeutic drug. PMID:22013068

  4. Difference of protein 53 expression based on radiation therapy response in cervical cancer

    NASA Astrophysics Data System (ADS)

    Pasaribu, H. P.; Lubis, L. I.; Dina, S.; Simanjuntak, R. Y.; Siregar, H. S.; Rivany, R.

    2018-03-01

    Cervical cancer is one of most common gynecological cancer in women and the leading cause of death in developing countries. An analytic study with the case-control design was conducted to determine the difference of p53 expression based on radiation therapy response in cervical cancer. The study was performed in Obstetric and Gynecology Department and Pathology Department of Adam Malik General Hospital Medan from January to February 2017. 15 paraffin blocks of acervical cancer patient with incomplete response were obtained as study samples, and 15 paraffin blocks of acervical cancer patient with complete response were obtained as control samples, The samples were collected by consecutive sampling, andan immunohistochemical assessment of p53 expression was done to assessapoptosis count and radiation response. Data were analyzed using Kruskal-Wallis with confidence interval 83.5% and p<0.05 was considered statistically significant. The study found that an increase of p53 expressionin samples with abundant apoptosis (≥5 apoptosis cells/5 HPF), p=0.033, and in incomplete response group, p=0.046. It means that p53 expression before radiation therapy can be used as an early marker for radiation therapy response in cervical cancer.

  5. Combination of metformin and curcumin targets breast cancer in mice by angiogenesis inhibition, immune system modulation and induction of p53 independent apoptosis

    PubMed Central

    Falah, Rabah Rashad; Talib, Wamidh H.; Shbailat, Seba Jamal

    2017-01-01

    Background: The effects of metformin (MET) and curcumin (CUR) single treatments have been tested against breast cancer; however, their combination has not been explored. Here, we evaluated the antitumor activity of MET and CUR combination against breast cancer in mice. Materials and methods: The antiproliferative activity of single and combined treatments against breast cancer cell lines was determined. Vascular endothelial growth factor (VEGF) and Trp53 expression was examined in EMT6/P cells. In vivo studies were carried out by inoculating BALB/c mice with EMT6/P cells and examining tumor growth and apoptosis induction in tumor sections. Furthermore, serum levels of different cytokines and transaminases and creatinine were measured to detect the immune response and toxicity, respectively. Results: The combination treatment exhibited the highest effects against tumor proliferation and growth. It significantly reduced VEGF expression, induced Trp53 independent apoptosis, triggered Th2 immune response and showed no toxicity. Conclusion: The combination can be a potential therapeutic option to treat breast cancer. However, further testing is needed to measure the exact serum levels of MET and CUR and to further explain the obtained results. PMID:28491145

  6. Radiation-induced instability and its relation to radiation carcinogenesis

    NASA Technical Reports Server (NTRS)

    Ullrich, R. L.; Ponnaiya, B.

    1998-01-01

    PURPOSE: A model that identifies radiation-induced genetic instability as the earliest cellular event in the multi-step sequence leading to radiation-induced cancer was previously proposed. In this paper ongoing experiments are discussed which are designed to test this model and its predictions in mouse mammary epithelial cells. RESULTS: Several lines of evidence are presented that appear to support this model: first, the development of delayed mutations in p53 following irradiation in altered growth variants; secondly, the high frequencies for the induction of both instability and transformation following irradiation in mammary epithelial cells; and finally, the demonstration that susceptibility to the induction of cytogenetic instability is a heritable trait that correlates with susceptibility to transformation and radiation-induced mammary cancer. Mice resistant to transformation and mammary cancer development are also resistant to the development of instability after irradiation. In contrast, mice sensitive to transformation and cancer are also sensitive to the development of cytogenetic instability. CONCLUSIONS: Data from this laboratory and from the studies cited above suggest a specific, and perhaps unique, role for radiation-induced instability as a critical early event associated with initiation of the carcinogenic process.

  7. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  8. Cross Talk between PML and p53 during Poliovirus Infection: Implications for Antiviral Defense

    PubMed Central

    Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K.

    2006-01-01

    PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation. PMID:16912307

  9. Cross talk between PML and p53 during poliovirus infection: implications for antiviral defense.

    PubMed

    Pampin, Mathieu; Simonin, Yannick; Blondel, Bruno; Percherancier, Yann; Chelbi-Alix, Mounira K

    2006-09-01

    PML nuclear bodies (NBs) are dynamic intranuclear structures harboring numerous transiently or permanently localized proteins. PML, the NBs' organizer, is directly induced by interferon, and its expression is critical for antiviral host defense. We describe herein the molecular events following poliovirus infection that lead to PML-dependent p53 activation and protection against virus infection. Poliovirus infection induces PML phosphorylation through the extracellular signal-regulated kinase pathway, increases PML SUMOylation, and induces its transfer from the nucleoplasm to the nuclear matrix. These events result in the recruitment of p53 to PML NBs, p53 phosphorylation on Ser15, and activation of p53 target genes leading to the induction of apoptosis. Moreover, the knock-down of p53 by small interfering RNA results in higher poliovirus replication, suggesting that p53 participates in antiviral defense. This effect, which requires the presence of PML, is transient since poliovirus targets p53 by inducing its degradation in a proteasome- and MDM2-dependent manner. Our results provide evidence of how poliovirus counteracts p53 antiviral activity by regulating PML and NBs, thus leading to p53 degradation.

  10. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.

    PubMed

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D

    2016-10-01

    TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.

  11. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma

    PubMed Central

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie

    2016-01-01

    Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of

  12. HIPK2 modulates p53 activity towards pro-apoptotic transcription.

    PubMed

    Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

    2009-10-14

    Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co

  13. Apoptosis of Lewis Lung Carcinoma Cells Induced by Microwave via p53 and Proapoptotic Proteins In vivo

    PubMed Central

    Zhang, Kou-Dong; Tong, Lin-Rong; Wang, Shui-Ming; Peng, Rui-Yun; Huang, Hai-Dong; Dong, Yu-Chao; Zhang, Xing-Xing; Li, Qiang; Bai, Chong

    2017-01-01

    Background: Microwave therapy is a minimal invasive procedure and has been employed in clinical practice for the treatment of various types of cancers. However, its therapeutic application in non-small-cell lung cancer and the underlying mechanism remains to be investigated. This study aimed to investigate its effect on Lewis lung carcinoma (LLC) tumor in vivo. Methods: Fifty LLC tumor-bearing C57BL/6 mice were adopted to assess the effect of microwave radiation on the growth and apoptosis of LLC tumor in vivo. These mice were randomly assigned to 10 groups with 5 mice in each group. Five groups were treated by single pulse microwave at different doses for different time, and the other five groups were radiated by multiple-pulse treatment of a single dose. Apoptosis of cancer cells was determined by terminal deoxynucleotidyl transferase dUTP nick-end labeling assay. Western blotting was applied to detect the expression of proteins. Results: Single pulse of microwave radiation for 5 min had little effect on the mice. Only 15-min microwave radiation at 30 mW/cm2 significantly increased the mice body temperature (2.20 ± 0.82)°C as compared with the other groups (0.78 ± 0.29 °C, 1.24 ± 0.52 °C, 0.78 ± 0.42 °C, respectively), but it did not affect the apoptosis of LLC tumor cells significantly. Continous microwave radiation exposure, single dose microwave radiation once per day for up to seven days, inhibited cell division and induced apoptosis of LLC tumor cells in a dose- and duration-dependent manner. It upregulated the protein levels of p53, Caspase 3, Bax and downregulated Bcl-2 protein. Conclusions: Multiple exposures of LLC-bearing mice to microwave radiation effectively induced tumor cell apoptosis at least partly by upregulating proapoptotic proteins and downregulating antiapoptotic proteins. Continuous radiation at low microwave intensity for a short time per day is promising in treating non-small-cell lung cancer. PMID:28051018

  14. Apoptosis of Lewis Lung Carcinoma Cells Induced by Microwave via p53 and Proapoptotic Proteins In vivo.

    PubMed

    Zhang, Kou-Dong; Tong, Lin-Rong; Wang, Shui-Ming; Peng, Rui-Yun; Huang, Hai-Dong; Dong, Yu-Chao; Zhang, Xing-Xing; Li, Qiang; Bai, Chong

    Microwave therapy is a minimal invasive procedure and has been employed in clinical practice for the treatment of various types of cancers. However, its therapeutic application in non-small-cell lung cancer and the underlying mechanism remains to be investigated. This study aimed to investigate its effect on Lewis lung carcinoma (LLC) tumor in vivo. Fifty LLC tumor-bearing C57BL/6 mice were adopted to assess the effect of microwave radiation on the growth and apoptosis of LLC tumor in vivo. These mice were randomly assigned to 10 groups with 5 mice in each group. Five groups were treated by single pulse microwave at different doses for different time, and the other five groups were radiated by multiple-pulse treatment of a single dose. Apoptosis of cancer cells was determined by terminal deoxynucleotidyl transferase dUTP nick-end labeling assay. Western blotting was applied to detect the expression of proteins. Single pulse of microwave radiation for 5 min had little effect on the mice. Only 15-min microwave radiation at 30 mW/cm2 significantly increased the mice body temperature (2.20 ± 0.82)°C as compared with the other groups (0.78 ± 0.29 °C, 1.24 ± 0.52 °C, 0.78 ± 0.42 °C, respectively), but it did not affect the apoptosis of LLC tumor cells significantly. Continous microwave radiation exposure, single dose microwave radiation once per day for up to seven days, inhibited cell division and induced apoptosis of LLC tumor cells in a dose- and duration-dependent manner. It upregulated the protein levels of p53, Caspase 3, Bax and downregulated Bcl-2 protein. Multiple exposures of LLC-bearing mice to microwave radiation effectively induced tumor cell apoptosis at least partly by upregulating proapoptotic proteins and downregulating antiapoptotic proteins. Continuous radiation at low microwave intensity for a short time per day is promising in treating non-small-cell lung cancer.

  15. MicroRNA-125b is a novel negative regulator of p53.

    PubMed

    Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

    2009-04-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

  16. MicroRNA-125b is a novel negative regulator of p53

    PubMed Central

    Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

    2009-01-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

  17. Non-Thermal Atmospheric Pressure Plasma Preferentially Induces Apoptosis in p53-Mutated Cancer Cells by Activating ROS Stress-Response Pathways

    PubMed Central

    Ma, Yonghao; Ha, Chang Seung; Hwang, Seok Won; Lee, Hae June; Kim, Gyoo Cheon; Lee, Kyo-Won; Song, Kiwon

    2014-01-01

    Non-thermal atmospheric pressure plasma (NTAPP) is an ionized gas at room temperature and has potential as a new apoptosis-promoting cancer therapy that acts by generating reactive oxygen species (ROS). However, it is imperative to determine its selectivity and standardize the components and composition of NTAPP. Here, we designed an NTAPP-generating apparatus combined with a He gas feeding system and demonstrated its high selectivity toward p53-mutated cancer cells. We first determined the proper conditions for NTAPP exposure to selectively induce apoptosis in cancer cells. The apoptotic effect of NTAPP was greater for p53-mutated cancer cells; artificial p53 expression in p53-negative HT29 cells decreased the pro-apoptotic effect of NTAPP. We also examined extra- and intracellular ROS levels in NTAPP-treated cells to deduce the mechanism of NTAPP action. While NTAPP-mediated increases in extracellular nitric oxide (NO) did not affect cell viability, intracellular ROS increased under NTAPP exposure and induced apoptotic cell death. This effect was dose-dependently reduced following treatment with ROS scavengers. NTAPP induced apoptosis even in doxorubicin-resistant cancer cell lines, demonstrating the feasibility of NTAPP as a potent cancer therapy. Collectively, these results strongly support the potential of NTAPP as a selective anticancer treatment, especially for p53-mutated cancer cells. PMID:24759730

  18. Sulphur alters NFκB-p300 cross-talk in favour of p53-p300 to induce apoptosis in non-small cell lung carcinoma.

    PubMed

    Saha, Shilpi; Bhattacharjee, Pushpak; Guha, Deblina; Kajal, Kirti; Khan, Poulami; Chakraborty, Sreeparna; Mukherjee, Shravanti; Paul, Shrutarshi; Manchanda, Rajkumar; Khurana, Anil; Nayak, Debadatta; Chakrabarty, Rathin; Sa, Gaurisankar; Das, Tanya

    2015-08-01

    Adverse side effects of chemotherapy during cancer treatment have shifted considerable focus towards therapies that are not only targeted but are also devoid of toxic side effects. We evaluated the antitumorigenic activity of sulphur, and delineated the molecular mechanisms underlying sulphur-induced apoptosis in non-small cell lung carcinoma (NSCLC) cells. A search for the underlying mechanism revealed that the choice between the two cellular processes, NFκBp65-mediated survival and p53-mediated apoptosis, was decided by the competition for a limited pool of transcriptional coactivator protein p300 in NSCLC cells. In contrast, sulphur inhibited otherwise upregulated survival signaling in NSCLC cells by perturbing the nuclear translocation of p65NFκB, its association with p300 histone acetylase, and subsequent transcription of Bcl-2. Under such anti-survival condition, induction of p53-p300 cross-talk enhanced the transcriptional activity of p53 and intrinsic mitochondrial death cascade. Overall, the findings of this preclinical study clearly delineated the molecular mechanism underlying the apoptogenic effect of the non-toxic homeopathic remedy, sulphur, in NSCLC cells.

  19. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    PubMed

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  20. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  1. Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Chien-Ju

    Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- andmore » time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS

  2. Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

    PubMed Central

    Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

    2011-01-01

    We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

  3. Fusaric Acid Induces DNA Damage and Post-Translational Modifications of p53 in Human Hepatocellular Carcinoma (HepG2 ) Cells.

    PubMed

    Ghazi, Terisha; Nagiah, Savania; Tiloke, Charlette; Sheik Abdul, Naeem; Chuturgoon, Anil A

    2017-11-01

    Fusaric acid (FA), a common fungal contaminant of maize, is known to mediate toxicity in plants and animals; however, its mechanism of action is unclear. p53 is a tumor suppressor protein that is activated in response to cellular stress. The function of p53 is regulated by post-translational modifications-ubiquitination, phosphorylation, and acetylation. This study investigated a possible mechanism of FA induced toxicity in the human hepatocellular carcinoma (HepG 2 ) cell line. The effect of FA on DNA integrity and post-translational modifications of p53 were investigated. Methods included: (a) culture and treatment of HepG 2 cells with FA (IC 50 : 580.32 μM, 24 h); (b) comet assay (DNA damage); (c) Western blots (protein expression of p53, MDM2, p-Ser-15-p53, a-K382-p53, a-CBP (K1535)/p300 (K1499), HDAC1 and p-Ser-47-Sirt1); and (d) Hoechst 33342 assay (apoptosis analysis). FA caused DNA damage in HepG 2 cells relative to the control (P < 0.0001). FA decreased the protein expression of p53 (0.24-fold, P = 0.0004) and increased the expression of p-Ser-15-p53 (12.74-fold, P = 0.0126) and a-K382-p53 (2.24-fold, P = 0.0096). This occurred despite the significant decrease in the histone acetyltransferase, a-CBP (K1535)/p300 (K1499) (0.42-fold, P = 0.0023) and increase in the histone deacetylase, p-Ser-47-Sirt1 (1.22-fold, P = 0.0020). The expression of MDM2, a negative regulator of p53, was elevated in the FA treatment compared to the control (1.83-fold, P < 0.0001). FA also inhibited cell proliferation and induced apoptosis in HepG 2 cells as evidenced by the Hoechst assay. Together, these results indicate that FA is genotoxic and post-translationally modified p53 leading to HepG 2 cell death. J. Cell. Biochem. 118: 3866-3874, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  4. RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

    2010-11-01

    Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

  5. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    PubMed

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  6. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Jiawen; Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg; Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involvedmore » in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response

  7. Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

    PubMed

    Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

    2002-08-15

    Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

  8. Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells

    PubMed Central

    Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J

    2011-01-01

    Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099

  9. Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

    PubMed

    Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

    2007-11-07

    Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

  10. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  11. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

    PubMed

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

    2012-06-01

    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  12. 6-mercaptopurine (6-MP) induces p53-mediated apoptosis of neural progenitor cells in the developing fetal rodent brain.

    PubMed

    Kanemitsu, H; Yamauchi, H; Komatsu, M; Yamamoto, S; Okazaki, S; Uchida, K; Nakayama, H

    2009-01-01

    6-mercaptopurine (6-MP), a DNA-damaging agent, induces apoptosis of neural progenitor cells, and causes malformation in the fetal brain. The aim of the present study is to clarify the molecular pathway of 6-MP-induced apoptosis of neural progenitor cells in the fetal telencephalon of rats and mice. p53 protein is activated by DNA damage and induces apoptosis through either the intrinsic pathway involving the mitochondria or the extrinsic pathway triggered by death receptors. In this study, the expression of puma and cleaved caspase-9 proteins, which are specific intrinsic pathway factors, increased in the rat telencephalon after 6-MP treatment. 6-MP-induced apoptosis of neural progenitor cells was completely absent in p53-deficient mice. On the other hand, the expression of Fas protein, an extrinsic pathway factor, did not change throughout the experimental period in the rat telencephalon treated with 6-MP. The number of apoptotic neural progenitor cells was similar among Fas-mutated lpr/lpr and wild-type mice, suggesting that the Fas pathway does not play a significant role in 6-MP-induced apoptosis of neural progenitor cells. These results may suggest that the p53-mediated intrinsic pathway is essential for 6-MP-induced apoptosis of neural progenitor cells in the developing telencephalon of rats and mice.

  13. Hydroquinone-induced malignant transformation of TK6 cells by facilitating SIRT1-mediated p53 degradation and up-regulating KRAS.

    PubMed

    Chen, Yuting; Chen, Jiajia; Yun, Lin; Xu, Longmei; Liu, Jiaxian; Xu, Yongchun; Yang, Hui; Liang, Hairong; Tang, Huanwen

    2016-09-30

    Hydroquinone (HQ), known as one of the metabolic products of benzene, causes a number of hematologic malignancies. The study evaluated the potential mechanism of Sirtuin 1 (SIRT1) in HQ-induced TK6 cell malignant transformation. The data of our study show that short term exposure of TK6 cells to HQ led to a decrease expression of SIRT1. Knockdown of SIRT1 sensitized to the HQ-induced apoptosis in vitro and increased the expression of p53, p21 and γ-H2AX. Furthermore, chronic HQ-treated (20μM once a week for 19 weeks) caused carcinogenic transformation and was confirmed by abnormal cell proliferation, matrix metalloproteinase 9(MMP9) and subcutaneous tumor formation in nude mice. SIRT1 increased KRAS expression, and decreased H3K9 and H3K18 acetylation, inhibited p53 signaling and the level of caspase-3 in HQ-induced transformation cells. Taken together, these data suggest that SIRT1 is involved in HQ-induced malignant transformation associated with suppressing p53 signaling and activation of KRAS. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. Inactivation of p16INK4a, with retention of pRB and p53/p21cip1 function, in human MRC5 fibroblasts that overcome a telomere-independent crisis during immortalization.

    PubMed

    Taylor, Lisa M; James, Alexander; Schuller, Christine E; Brce, Jesena; Lock, Richard B; Mackenzie, Karen L

    2004-10-15

    Recent investigations, including our own, have shown that specific strains of fibroblasts expressing telomerase reverse transcriptase (hTERT) have an extended lifespan, but are not immortal. We previously demonstrated that hTERT-transduced MRC5 fetal lung fibroblasts (MRC5hTERTs) bypassed senescence but eventually succumbed to a second mortality barrier (crisis). In the present study, 67 MRC5hTERT clones were established by limiting dilution of a mass culture. Whereas 39/67 clones had an extended lifespan, all 39 extended lifespan clones underwent crisis. 11 of 39 clones escaped crisis and were immortalized. There was no apparent relationship between the fate of clones at crisis and the level of telomerase activity. Telomeres were hyperextended in the majority of the clones analyzed. There was no difference in telomere length of pre-crisis compared with post-crisis and immortal clones, indicating that hyperextended telomeres were conducive for immortalization and confirming that crisis was independent of telomere length. Immortalization of MRC5hTERT cells was associated with repression of the cyclin-dependent kinase inhibitor p16INK4a and up-regulation of pRB. However, the regulation of pRB phosphorylation and the response of the p53/p21cip1/waf1 pathway were normal in immortal cells subject to genotoxic stress. Overexpression of oncogenic ras failed to de-repress p16INK4a in immortal cells. Furthermore, expression of ras enforced senescent-like growth arrest in p16INK4a-positive, but not p16INK4a-negative MRC5hTERT cells. Immortal cells expressing ras formed small, infrequent colonies in soft agarose, but were non-tumorigenic. Overall, these results implicate the inactivation of p16INK4a as a critical event for overcoming telomere-independent crisis, immortalizing MRC5 fibroblasts and overcoming ras-induced premature senescence.

  15. p53 Is a Key Regulator for Osthole-Triggered Cancer Pathogenesis

    PubMed Central

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Wang, Min-Ying

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development. PMID:25013761

  16. p53 is a key regulator for osthole-triggered cancer pathogenesis.

    PubMed

    Huang, Ssu-Ming; Tsai, Cheng-Fang; Chen, Dar-Ren; Wang, Min-Ying; Yeh, Wei-Lan

    2014-01-01

    Osthole has been reported to have antitumor activities via the induction of apoptosis and inhibition of cancer cell growth and metastasis. However, the detailed molecular mechanisms underlying the anticancer effects of osthole in human colon cancer remain unclear. In the present study, we have assessed osthole-induced cell death in two different human colon cancer cell lines, HCT116 and SW480. Our results also showed that osthole activated proapoptotic signaling pathways in human colon cancer cells. By using cell culture insert system, osthole reduced cell motility in both human colon cancer cell lines. This study also provides evidence supporting the potential of osthole in p53 activation. Expression of p53, an apoptotic protein, was remarkably upregulated in cells treated with osthole. Importantly, the levels of phosphorylation of p53 on Ser15 (p-p53) and acetylation of p53 on Lys379 (acetyl-p53) were increased under osthole treatment. Our results also demonstrated that p53 was activated followed by generation of reactive oxygen species (ROS) and activation of c-Jun N-terminal kinase (JNK). Our study provides novel insights of p53-mediated responses under osthole treatment. Taken together, we concluded that osthole induces cancer cell death and inhibits migratory activity in a controlled manner and is a promising candidate for antitumor drug development.

  17. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hongling; Huang, Yong; Du, Qian

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells inmore » a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.« less

  18. Sedanolide induces autophagy through the PI3K, p53 and NF-κB signaling pathways in human liver cancer cells.

    PubMed

    Hsieh, Shu-Ling; Chen, Chi-Tsai; Wang, Jyh-Jye; Kuo, Yu-Hao; Li, Chien-Chun; Hsieh, Lan-Chi; Wu, Chih-Chung

    2015-12-01

    Sedanolide (SN), a phthalide-like compound from celery seed oil, possesses antioxidant effects. However, the effect of SN on cell death in human liver cancer cells has yet to be determined. In this study, cell viability determination, monodansylcadaverine (MDC) fluorescent staining and immunoblot analysis were performed to determine autophagy induction and autophagy-induced protein expression changes via molecular examination after human liver cancer (J5) cells were treated with SN. Our studies demonstrate that SN suppressed J5 cell viability by inducing autophagy. Phosphoinositide 3-kinase (PI3K)-I, mammalian target of rapamycin (mTOR) and Akt protein levels decreased, whereas PI3K-III, LC3-II and Beclin-1 protein levels increased following SN treatment in J5 cells. In addition, SN treatment upregulated nuclear p53 and damage-regulated autophagy modulator (DRAM) and downregulated cytosolic p53 and Tp53-induced glycolysis and apoptosis regulator (TIGAR) expression in J5 cells. Furthermore, the cytosolic phosphorylation of inhibitor of kappa B (IκB) and nuclear p65 and the DNA-binding activity of NF-κB increased after SN treatment. These results suggest that SN induces J5 cell autophagy by regulating PI3K, p53 and NF-κB autophagy-associated signaling pathways in J5 cells.

  19. Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro by inhibiting the p53-dependent mitochondrial apoptotic pathway.

    PubMed

    Lee, Yoon-Jin; Kim, Soo A; Lee, Sang-Han

    2016-05-01

    Intra-articular injection of local anesthetics (LAs) is a common procedure for therapeutic purposes. However, LAs have been found toxic to articular cartilage, and hyaluronan may attenuate this toxicity. In this study we investigated whether hyaluronan attenuated lidocaine-induced chondrotoxicity, and if so, to elucidate the underlying mechanisms. Human chondrocyte cell line SW1353 and newly isolated murine chondrocytes were incubated in culture medium containing hyaluronan and/or lidocaine for 72 h. Cell viability was evaluated using MTT assay. Cell apoptosis was detected with DAPI staining, caspase 3/7 activity assay and flow cytometry. Cell cycle distributions, ROS levels and mitochondrial membrane potential (ΔΨm) were determined using flow cytometry. The expression of p53 and p53-regulated gene products was measured with Western blotting. Lidocaine (0.005%-0.03%) dose-dependently decreased the viability of SW1353 cells. This local anesthetic (0.015%, 0.025%) induced apoptosis, G2/M phase arrest and loss of ΔΨm, and markedly increased ROS production in SW1353 cells. Hyaluronan (50-800 μg/mL) alone did not affect the cell viability, but co-treatment with hyaluronan (200 μg/mL) significantly attenuated lidocaine-induced apoptosis and other abnormalities in SW1353 cells. Furthermore, co-treatment with lidocaine and hyaluronan significantly decreased the levels of p53 and its transcription targets Bax and p21 in SW1353 cells, although treatment with lidocaine alone did not significantly change these proteins. Similar results were obtained in ex vivo cultured murine chondrocytes. Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro through inhibiting the p53-dependent mitochondrial apoptotic pathway.

  20. Mechanism of p53-Dependent Apoptosis and its Role in Breast Cancer Therapy

    DTIC Science & Technology

    1999-07-01

    inducibly express p53 as previously described (Chen et a!., 1996). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A62-91)-l, -5, and -6 cells...1994) was used as template, ( a ) Levels of p53, p21 and actin in p53-3 and p53(gln22-ser23/A62-91)-2 and -14 cells were assayed by Western blot...CGG TAC CCC TGT CAT CTT CTG TC; and reverse primer C393 as used for generating p53(A62-91). ( a ) Levels of p53, p21, and actin in p53-3, and p53(A74

  1. High LET Radiation Can Enhance TGF(Beta) Induced EMT and Cross-Talk with ATM Pathways

    NASA Technical Reports Server (NTRS)

    Wang, Minli; Hada, Megumi; Huff, Janice; Pluth, Janice M.; Anderson, Janniffer; ONeill, Peter; Cucinotta, Francis A.

    2010-01-01

    The TGF(Beta) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation in mammary epithelial cells. We investigated possible interactions between the TGF(Beta) and ATM pathways following simulated space radiation using hTERT immortalized human esophageal epithelial cells (EPC-hTERT), mink lung epithelial cells (Mv1lu), and several human fibroblast cell lines. TGF(Beta) is a key modulator of the Epithelial-Mesenchymal Transition (EMT), important in cancer progression and metastasis. The implication of EMT by radiation also has several lines of developing evidence, however is poorly understood. The identification of TGF(Beta) induced EMT can be shown in changes to morphology, related gene over expression or down regulation, which can be detected by RT-PCR, and immunostaining and western blotting. In this study, we have observed morphologic and molecular alternations consistent with EMT after Mv1lu cells were treated with TGF(Beta) High LET radiation enhanced TGF(Beta) mediated EMT with a dose as low as 0.1Gy. In order to consider the TGF(Beta) interaction with ATM we used a potent ATM inhibitor Ku55933 and investigated gene expression changes and Smad signaling kinetics. Ku559933 was observed to reverse TGF(Beta) induced EMT, while this was not observed in dual treated cells (radiation+TGF(Beta)). In EPC-hTERT cells, TGF(Beta) alone was not able to induce EMT after 3 days of application. A combined treatment with high LET, however, significantly caused the alteration of EMT markers. To study the function of p53 in the process of EMT, we knocked down P53 through RNA interference. Morphology changes associated with EMT were observed in epithelial cells with silenced p53. Our study indicates: high LET radiation can enhance TGF(Beta) induced EMT; while ATM is triggering the process of TGF(Beta)-induced EMT, p53 might be an essential repressor for EMT phenotypes.

  2. Dihydroptychantol A, a macrocyclic bisbibenzyl derivative, induces autophagy and following apoptosis associated with p53 pathway in human osteosarcoma U2OS cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li Xia; School of Ocean, Shandong University, Weihai 264209; Wu, William K.K.

    2011-03-01

    Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G{sub 2}/M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine,more » suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21{sup Waf1/Cip1}. In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B{sub 1}, a cyclin required for progression through the G{sub 2}/M phase. Taken together, DHA induces G{sub 2}/M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.« less

  3. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  4. Modulation of p53β and p53γ expression by regulating the alternative splicing of TP53 gene modifies cellular response

    PubMed Central

    Marcel, V; Fernandes, K; Terrier, O; Lane, D P; Bourdon, J-C

    2014-01-01

    In addition to the tumor suppressor p53 protein, also termed p53α, the TP53 gene produces p53β and p53γ through alternative splicing of exons 9β and 9γ located within TP53 intron 9. Here we report that both TG003, a specific inhibitor of Cdc2-like kinases (Clk) that regulates the alternative splicing pre-mRNA pathway, and knockdown of SFRS1 increase expression of endogenous p53β and p53γ at mRNA and protein levels. Development of a TP53 intron 9 minigene shows that TG003 treatment and knockdown of SFRS1 promote inclusion of TP53 exons 9β/9γ. In a series of 85 primary breast tumors, a significant association was observed between expression of SFRS1 and α variant, supporting our experimental data. Using siRNA specifically targeting exons 9β/9γ, we demonstrate that cell growth can be driven by modulating p53β and p53γ expression in an opposite manner, depending on the cellular context. In MCF7 cells, p53β and p53γ promote apoptosis, thus inhibiting cell growth. By transient transfection, we show that p53β enhanced p53α transcriptional activity on the p21 and Bax promoters, while p53γ increased p53α transcriptional activity on the Bax promoter only. Moreover, p53β and p53γ co-immunoprecipitate with p53α only in the presence of p53-responsive promoter. Interestingly, although p53β and p53γ promote apoptosis in MCF7 cells, p53β and p53γ maintain cell growth in response to TG003 in a p53α-dependent manner. The dual activities of p53β and p53γ isoforms observed in non-treated and TG003-treated cells may result from the impact of TG003 on both expression and activities of p53 isoforms. Overall, our data suggest that p53β and p53γ regulate cellular response to modulation of alternative splicing pre-mRNA pathway by a small drug inhibitor. The development of novel drugs targeting alternative splicing process could be used as a novel therapeutic approach in human cancers. PMID:24926616

  5. InP/Ga0.47In0.53As monolithic, two-junction, three-terminal tandem solar cells

    NASA Technical Reports Server (NTRS)

    Wanlaas, M. W.; Gessert, T. A.; Horner, G. S.; Emery, K. A.; Coutts, T. J.

    1991-01-01

    The work presented has focussed on increasing the efficiency of InP-based solar cells through the development of a high-performance InP/Ga(0.47)In(0.53)As two-junction, three-terminal monolithic tandem cell. Such a tandem is particularly suited to space applications where a radiation-hard top cell (i.e., InP) is required. Furthermore, the InP/Ga(0.47)In(0.53)As materials system is lattice matched and offers a top cell/bottom cell bandgap differential (0.60 eV at 300 K) suitable for high tandem cell efficiencies under AMO illumination. A three-terminal configuration was chosen since it allows for independent power collection from each subcell in the monolithic stack, thus minimizing the adverse impact of radiation damage on the overall tandem efficiency. Realistic computer modeling calculations predict an efficiency boost of 7 to 11 percent from the Ga(0.47)In(0.53)As bottom cell under AMO illumination (25 C) for concentration ratios in the 1 to 1000 range. Thus, practical AMO efficiencies of 25 to 32 percent appear possible with the InP/Ga(0.47)In(0.53)As tandem cell. Prototype n/p/n InP/Ga(0.47)In(0.53)As monolithic tandem cells were fabricated and tested successfully. Using an aperture to define the illuminated areas, efficiency measurements performed on a non-optimized device under standard global illumination conditions (25 C) with no antireflection coating (ARC) give 12.2 percent for the InP top cell and 3.2 percent for the Ga(0.47)In(0.53)As bottom cell, yielding an overall tandem efficiency of 15.4 percent. With an ARC, the tandem efficiency could reach approximately 22 percent global and approximately 20 percent AMO. Additional details regarding the performance of individual InP and Ga(0.47)In(0.53)As component cells, fabrication and operation of complete tandem cells and methods for improving the tandem cell performance, are also discussed.

  6. p53: traffic cop at the crossroads of DNA repair and recombination.

    PubMed

    Sengupta, Sagar; Harris, Curtis C

    2005-01-01

    p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

  7. Identification of TP53-induced glycolysis and apoptosis regulator (TIGAR) as the phosphoglycolate-independent 2,3-bisphosphoglycerate phosphatase.

    PubMed

    Gerin, Isabelle; Noël, Gaëtane; Bolsée, Jennifer; Haumont, Olivier; Van Schaftingen, Emile; Bommer, Guido T

    2014-03-15

    The p53-induced protein TIGAR [TP53 (tumour protein 53)-induced glycolysis and apoptosis regulator] is considered to be a F26BPase (fructose-2,6-bisphosphatase) with an important role in cancer cell metabolism. The reported catalytic efficiency of TIGAR as an F26BPase is several orders of magnitude lower than that of the F26BPase component of liver or muscle PFK2 (phosphofructokinase 2), suggesting that F26BP (fructose 2,6-bisphosphate) might not be the physiological substrate of TIGAR. We therefore set out to re-evaluate the biochemical function of TIGAR. Phosphatase activity of recombinant human TIGAR protein was tested on a series of physiological phosphate esters. The best substrate was 23BPG (2,3-bisphosphoglycerate), followed by 2PG (2-phosphoglycerate), 2-phosphoglycolate and PEP (phosphoenolpyruvate). In contrast the catalytic efficiency for F26BP was approximately 400-fold lower than that for 23BPG. Using genetic and shRNA-based cell culture models, we show that loss of TIGAR consistently leads to an up to 5-fold increase in the levels of 23BPG. Increases in F26BP levels were also observed, albeit in a more limited and cell-type dependent manner. The results of the present study challenge the concept that TIGAR acts primarily on F26BP. This has significant implications for our understanding of the metabolic changes downstream of p53 as well as for cancer cell metabolism in general. It also suggests that 23BPG might play an unrecognized function in metabolic control.

  8. Mieap, a p53-Inducible Protein, Controls Mitochondrial Quality by Repairing or Eliminating Unhealthy Mitochondria

    PubMed Central

    Kitamura, Noriaki; Nakamura, Yasuyuki; Miyamoto, Yuji; Miyamoto, Takafumi; Kabu, Koki; Yoshida, Masaki; Futamura, Manabu; Ichinose, Shizuko; Arakawa, Hirofumi

    2011-01-01

    Maintenance of healthy mitochondria prevents aging, cancer, and a variety of degenerative diseases that are due to the result of defective mitochondrial quality control (MQC). Recently, we discovered a novel mechanism for MQC, in which Mieap induces intramitochondrial lysosome-like organella that plays a critical role in the elimination of oxidized mitochondrial proteins (designated MALM for Mieap-induced accumulation of lysosome-like organelles within mitochondria). However, a large part of the mechanisms for MQC remains unknown. Here, we report additional mechanisms for Mieap-regulated MQC. Reactive oxygen species (ROS) scavengers completely inhibited MALM. A mitochondrial outer membrane protein NIX interacted with Mieap in a ROS-dependent manner via the BH3 domain of NIX and the coiled-coil domain of Mieap. Deficiency of NIX also completely impaired MALM. When MALM was inhibited, Mieap induced vacuole-like structures (designated as MIV for Mieap-induced vacuole), which engulfed and degraded the unhealthy mitochondria by accumulating lysosomes. The inactivation of p53 severely impaired both MALM and MIV generation, leading to accumulation of unhealthy mitochondria. These results suggest that (1) mitochondrial ROS and NIX are essential factors for MALM, (2) MIV is a novel mechanism for lysosomal degradation of mitochondria, and (3) the p53-Mieap pathway plays a pivotal role in MQC by repairing or eliminating unhealthy mitochondria via MALM or MIV generation, respectively. PMID:21264228

  9. Progesterone Prevents High-Grade Serous Ovarian Cancer by Inducing Necroptosis of p53-Defective Fallopian Tube Epithelial Cells.

    PubMed

    Wu, Na-Yiyuan; Huang, Hsuan-Shun; Chao, Tung Hui; Chou, Hsien Ming; Fang, Chao; Qin, Chong-Zhen; Lin, Chueh-Yu; Chu, Tang-Yuan; Zhou, Hong Hao

    2017-03-14

    High-grade serous ovarian carcinoma (HGSOC) originates mainly from the fallopian tube (FT) epithelium and always carries early TP53 mutations. We previously reported that tumors initiate in the FT fimbria epithelium because of apoptotic failure and the expansion of cells with DNA double-strand breaks (DSB) caused by bathing of the FT epithelial cells in reactive oxygen species (ROSs) and hemoglobin-rich follicular fluid (FF) after ovulation. Because ovulation is frequent and HGSOC is rare, we hypothesized that luteal-phase progesterone (P4) could eliminate p53-defective FT cells. Here we show that P4, via P4 receptors (PRs), induces necroptosis in Trp53 -/- mouse oviduct epithelium and in immortalized human p53-defective fimbrial epithelium through the TNF-α/RIPK1/RIPK3/MLKL pathway. Necroptosis occurs specifically at diestrus, recovers at the proestrus phase of the estrus cycle, and can be augmented with P4 supplementation. These results reveal the mechanism of the well-known ability of progesterone to prevent ovarian cancer. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  10. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.

    PubMed

    Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R

    1999-05-01

    The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.

  11. Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro by inhibiting the p53-dependent mitochondrial apoptotic pathway

    PubMed Central

    Lee, Yoon-Jin; Kim, Soo A; Lee, Sang-Han

    2016-01-01

    Aim: Intra-articular injection of local anesthetics (LAs) is a common procedure for therapeutic purposes. However, LAs have been found toxic to articular cartilage, and hyaluronan may attenuate this toxicity. In this study we investigated whether hyaluronan attenuated lidocaine-induced chondrotoxicity, and if so, to elucidate the underlying mechanisms. Methods: Human chondrocyte cell line SW1353 and newly isolated murine chondrocytes were incubated in culture medium containing hyaluronan and/or lidocaine for 72 h. Cell viability was evaluated using MTT assay. Cell apoptosis was detected with DAPI staining, caspase 3/7 activity assay and flow cytometry. Cell cycle distributions, ROS levels and mitochondrial membrane potential (ΔΨm) were determined using flow cytometry. The expression of p53 and p53-regulated gene products was measured with Western blotting. Results: Lidocaine (0.005%−0.03%) dose-dependently decreased the viability of SW1353 cells. This local anesthetic (0.015%, 0.025%) induced apoptosis, G2/M phase arrest and loss of ΔΨm, and markedly increased ROS production in SW1353 cells. Hyaluronan (50−800 μg/mL) alone did not affect the cell viability, but co-treatment with hyaluronan (200 μg/mL) significantly attenuated lidocaine-induced apoptosis and other abnormalities in SW1353 cells. Furthermore, co-treatment with lidocaine and hyaluronan significantly decreased the levels of p53 and its transcription targets Bax and p21 in SW1353 cells, although treatment with lidocaine alone did not significantly change these proteins. Similar results were obtained in ex vivo cultured murine chondrocytes. Conclusion: Hyaluronan suppresses lidocaine-induced apoptosis of human chondrocytes in vitro through inhibiting the p53-dependent mitochondrial apoptotic pathway. PMID:27041463

  12. Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

    PubMed

    Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

    1995-04-15

    The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic

  13. G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.

    PubMed

    Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi

    2018-01-01

    Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.

  14. Initiation of autoimmunity to the p53 tumor suppressor protein by complexes of p53 and SV40 large T antigen

    PubMed Central

    1994-01-01

    Antinuclear antibodies (ANAs) reactive with a limited spectrum of nuclear antigens are characteristic of systemic lupus erythematosus (SLE) and other collagen vascular diseases, and are also associated with certain viral infections. The factors that initiate ANA production and determine ANA specificity are not well understood. In this study, high titer ANAs specific for the p53 tumor suppressor protein were induced in mice immunized with purified complexes of murine p53 and the Simian virus 40 large T antigen (SVT), but not in mice immunized with either protein separately. The autoantibodies to p53 in these mice were primarily of the IgG1 isotype, were not cross-reactive with SVT, and were produced at titers up to 1:25,000, without the appearance of other autoantibodies. The high levels of autoantibodies to p53 in mice immunized with p53/SVT complexes were transient, but low levels of the autoantibodies persisted. The latter may have been maintained by self antigen, since the anti-p53, but not the SVT, response in these mice could be boosted by immunizing with murine p53. Thus, once autoimmunity to p53 was established by immunizing with p53/SVT complexes, it could be maintained without a requirement for SVT. These data may be explained in at least two ways. First, altered antigen processing resulting from the formation of p53/SVT complexes might activate autoreactive T helper cells specific for cryptic epitopes of murine p53, driving anti-p53 autoantibody production. Alternatively, SVT- responsive T cells may provide intermolecular-intrastructural help to B cells specific for murine p53. In a second stage, these activated B cells might themselves process self p53, generating p53-responsive autoreactive T cells. The induction of autoantibodies during the course of an immune response directed against this naturally occurring complex of self and nonself antigens may be relevant to the generation of specific autoantibodies in viral infections, and may also have

  15. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

    NASA Astrophysics Data System (ADS)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  16. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    PubMed

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  17. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region.

  18. Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

    PubMed Central

    Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

    2014-01-01

    The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

  19. Spontaneous and radiation-induced genomic instability in human cell lines differing in cellular TP53 status.

    PubMed

    Moore, Stephen R; Ritter, Linda E; Gibbons, Catherine F; Grosovsky, Andrew J

    2005-10-01

    Structural chromosomal rearrangements are commonly observed in tumor karyotypes and in radiation-induced genomic instability. Here we report the effects of TP53 deficiency on karyotypic stability before and after irradiation using related cells and clones differing in cellular TP53 status. The parental cell line, TK6, is a TP53 wild-type human B-lymphoblastoid line with a highly stable karyotype. In the two TK6 derivatives used here, TP53 has been inactivated by biochemical means (expression of HPV16 E6; TK6-5E) or genetic means (allelic inactivation; NH32). Biochemical inactivation of TP53 (TK6-5E) had little effect on the spontaneous karyotype, whereas allelic inactivation of TP53 (NH32) resulted in a modest increase in spontaneous karyotypic instability. After 2 Gy gamma irradiation, the number of unstable clones derived from TP53-deficient cells was significantly elevated compared to the TP53 wild-type counterpart. Extensively destabilized clones were common after irradiation in the set of clones derived from NH32 cells, and one was observed in the set of TK6-5E clones; however, they were never observed in TK6-derived clones. In two of the irradiated NH32 clones, whole chromosomes or chromosome bands were preferentially involved in alterations. These results suggest that genomic instability may differ both quantitatively and qualitatively as a consequence of altered TP53 expression. Some of the results showing repeated and preferential chromosome involvement in aberrations support a model in which instability may be driven by cis mechanisms.

  20. The p53 Isoform Δ133p53β Promotes Cancer Stem Cell Potential

    PubMed Central

    Arsic, Nikola; Gadea, Gilles; Lagerqvist, E. Louise; Busson, Muriel; Cahuzac, Nathalie; Brock, Carsten; Hollande, Frederic; Gire, Veronique; Pannequin, Julie; Roux, Pierre

    2015-01-01

    Summary Cancer stem cells (CSC) are responsible for cancer chemoresistance and metastasis formation. Here we report that Δ133p53β, a TP53 splice variant, enhanced cancer cell stemness in MCF-7 breast cancer cells, while its depletion reduced it. Δ133p53β stimulated the expression of the key pluripotency factors SOX2, OCT3/4, and NANOG. Similarly, in highly metastatic breast cancer cells, aggressiveness was coupled with enhanced CSC potential and Δ133p53β expression. Like in MCF-7 cells, SOX2, OCT3/4, and NANOG expression were positively regulated by Δ133p53β in these cells. Finally, treatment of MCF-7 cells with etoposide, a cytotoxic anti-cancer drug, increased CSC formation and SOX2, OCT3/4, and NANOG expression via Δ133p53, thus potentially increasing the risk of cancer recurrence. Our findings show that Δ133p53β supports CSC potential. Moreover, they indicate that the TP53 gene, which is considered a major tumor suppressor gene, also acts as an oncogene via the Δ133p53β isoform. PMID:25754205

  1. Ursodeoxycholic acid protects cardiomyocytes against cobalt chloride induced hypoxia by regulating transcriptional mediator of cells stress hypoxia inducible factor 1α and p53 protein.

    PubMed

    Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah

    2017-10-01

    In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile

  2. Mutational signatures reveal the role of RAD52 in p53-independent p21-driven genomic instability.

    PubMed

    Galanos, Panagiotis; Pappas, George; Polyzos, Alexander; Kotsinas, Athanassios; Svolaki, Ioanna; Giakoumakis, Nickolaos N; Glytsou, Christina; Pateras, Ioannis S; Swain, Umakanta; Souliotis, Vassilis L; Georgakilas, Alexandros G; Geacintov, Nicholas; Scorrano, Luca; Lukas, Claudia; Lukas, Jiri; Livneh, Zvi; Lygerou, Zoi; Chowdhury, Dipanjan; Sørensen, Claus Storgaard; Bartek, Jiri; Gorgoulis, Vassilis G

    2018-03-16

    Genomic instability promotes evolution and heterogeneity of tumors. Unraveling its mechanistic basis is essential for the design of appropriate therapeutic strategies. In a previous study, we reported an unexpected oncogenic property of p21 WAF1/Cip1 , showing that its chronic expression in a p53-deficient environment causes genomic instability by deregulation of the replication licensing machinery. We now demonstrate that p21 WAF1/Cip1 can further fuel genomic instability by suppressing the repair capacity of low- and high-fidelity pathways that deal with nucleotide abnormalities. Consequently, fewer single nucleotide substitutions (SNSs) occur, while formation of highly deleterious DNA double-strand breaks (DSBs) is enhanced, crafting a characteristic mutational signature landscape. Guided by the mutational signatures formed, we find that the DSBs are repaired by Rad52-dependent break-induced replication (BIR) and single-strand annealing (SSA) repair pathways. Conversely, the error-free synthesis-dependent strand annealing (SDSA) repair route is deficient. Surprisingly, Rad52 is activated transcriptionally in an E2F1-dependent manner, rather than post-translationally as is common for DNA repair factor activation. Our results signify the importance of mutational signatures as guides to disclose the repair history leading to genomic instability. We unveil how chronic p21 WAF1/Cip1 expression rewires the repair process and identifies Rad52 as a source of genomic instability and a candidate therapeutic target.

  3. Opposite Roles for p38MAPK-Driven Responses and Reactive Oxygen Species in the Persistence and Resolution of Radiation-Induced Genomic Instability

    PubMed Central

    Werner, Erica; Wang, Huichen; Doetsch, Paul W.

    2014-01-01

    We report the functional and temporal relationship between cellular phenotypes such as oxidative stress, p38MAPK-dependent responses and genomic instability persisting in the progeny of cells exposed to sparsely ionizing low-Linear Energy Transfer (LET) radiation such as X-rays or high-charge and high-energy (HZE) particle high-LET radiation such as 56Fe ions. We found that exposure to low and high-LET radiation increased reactive oxygen species (ROS) levels as a threshold-like response induced independently of radiation quality and dose. This response was sustained for two weeks, which is the period of time when genomic instability is evidenced by increased micronucleus formation frequency and DNA damage associated foci. Indicators for another persisting response sharing phenotypes with stress-induced senescence, including beta galactosidase induction, increased nuclear size, p38MAPK activation and IL-8 production, were induced in the absence of cell proliferation arrest during the first, but not the second week following exposure to high-LET radiation. This response was driven by a p38MAPK-dependent mechanism and was affected by radiation quality and dose. This stress response and elevation of ROS affected genomic instability by distinct pathways. Through interference with p38MAPK activity, we show that radiation-induced stress phenotypes promote genomic instability. In contrast, exposure to physiologically relevant doses of hydrogen peroxide or increasing endogenous ROS levels with a catalase inhibitor reduced the level of genomic instability. Our results implicate persistently elevated ROS following exposure to radiation as a factor contributing to genome stabilization. PMID:25271419

  4. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  5. Electron-irradiated two-terminal, monolithic InP/Ga0.47In0.53As tandem solar cells and annealing of radiation damage

    NASA Technical Reports Server (NTRS)

    Cotal, H. L.; Walters, Robert J.; Summers, Geoffrey P.; Messenger, Scott R.

    1994-01-01

    Radiation damage results from two-terminal monolithic InP/Ga(0.47)In(0.53)As tandem solar cells subject to 1 MeV electron irradiation are presented. Efficiencies greater than 22 percent have been measured by the National Renewable Energy Laboratory from 2x2 sq cm cells at 1 sun, AMO (25 C). The short circuit current density, open circuit voltage and fill factor are found to tolerate the same amount of radiation at low fluences. At high fluence levels, slight differences are observed. Decreasing the base amount of radiation at the Ga(0.47)In(0.53)As bottomcell improved the radiation resistance of J(sub sc) dramatically. This is turn, extended the series current flow through the subcell substantially up to a fluence of 3x10(exp 15) cm(exp -2) compared to 3x10(exp 14) cm(exp -2), as observed previously. The degradation of the maximum power output form tandem device is comparable to that from shallow homojunction (SHJ) InP solar cells, and the mechanism responsible for such degradation is explained in terms of the radiation response of the component cells. Annealing studies revealed that the recovery of the tandem cell response is dictated by the annealing characteristics exhibited by SHJ InP solar cells.

  6. KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

    PubMed Central

    Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

    2017-01-01

    Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

  7. Robustness of the p53 network and biological hackers.

    PubMed

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  8. Sirtuin7 is involved in protecting neurons against oxygen-glucose deprivation and reoxygenation-induced injury through regulation of the p53 signaling pathway.

    PubMed

    Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing

    2017-10-01

    Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.

  9. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    PubMed

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  10. Targeting p53 via JNK Pathway: A Novel Role of RITA for Apoptotic Signaling in Multiple Myeloma

    PubMed Central

    Saha, Manujendra N.; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D.; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  11. Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

    PubMed

    Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

    2017-08-01

    Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. 3-MCPD 1-palmitate induced renal tubular cell apoptosis in vivo via JNK/p53 pathway

    USDA-ARS?s Scientific Manuscript database

    Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing-induced food contaminants with nephrotoxicity, but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD este...

  13. Development of an adenoviral vector with robust expression driven by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

    2008-02-05

    Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

  14. Induction of differentiation in human promyelocytic HL-60 leukemia cells activates p21, WAF1/CIP1, expression in the absence of p53.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, H.; Lin, J.; Su, Z.-Z.

    The melanoma differentiation associated gene, mda-6, which is identical to the P53-inducible gene WAF1/CIP1, encodes an M(r) 21,000 protein (p21) that can directly inhibit cell growth by repressing cyclin dependent kinases. mda-6 was identified using subtraction hybridization by virtue of its enhanced expression in human melanoma cells induced to terminally differentiate by treatment with human fibroblast interferon and the anti-leukemic compound mezerein (Jiang and Fisher, 1993). In the present study, we demonstrate that mda-6 (WAF1/CIP1) is an immediate early response gene induced during differentiation of the promyelocytic HL-60 leukemia cell line along the granulocytic or macrophage/monocyte pathway. mda-6 gene expressionmore » in HL-60 cells is induced within 1 to 3 h during differentiation along the macrophage/monocyte pathway evoked by 12-0-tetradecanoyl phorbol-13-acetate (TPA) or 1,25-dihydroxyvitamin D3 (Vit D3) or the granulocytic pathway produced by retinoic acid (RA) or dimethylsulfoxide (DMSO). Immunoprecipitation analyses using an anti-p21 antibody indicate a temporal induction of p21 protein following treatment with TPA, DMSO or RA. A relationship between rapid induction of mda-6 gene expression and differentiation is indicated by a delay in this expression in an HL-60 cell variant resistant to TPA-induced growth arrest and differentiation. A similar delay in mda-6 gene expression is not observed in Vit D3 treated TPA-resistant variant cells that are also sensitive to induction of monocytic differentiation. Since HL-60 cells have a null-p53 phenotype, these results demonstrate that p21 induction occurs during initiation of terminal differentiation in a p53-independent manner. In this context, p21 may play a more global role in growth control and differentiation than originally envisioned.« less

  15. p53 AND MDM2 PROTEIN EXPRESSION IN ACTINIC CHEILITIS

    PubMed Central

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

    2008-01-01

    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia. PMID:19082401

  16. p53 and MDM2 protein expression in actinic cheilitis.

    PubMed

    de Freitas, Maria da Conceição Andrade; Ramalho, Luciana Maria Pedreira; Xavier, Flávia Caló Aquino; Moreira, André Luis Gomes; Reis, Sílvia Regina Almeida

    2008-01-01

    Actinic cheilitis is a potentially malignant lip lesion caused by excessive and prolonged exposure to ultraviolet radiation, which can lead to histomorphological alterations indicative of abnormal cell differentiation. In this pathology, varying degrees of epithelial dysplasia may be found. There are few published studies regarding the p53 and MDM2 proteins in actinic cheilitis. Fifty-eight cases diagnosed with actinic cheilitis were histologically evaluated using Banóczy and Csiba (1976) parameters, and were subjected to immunohistochemical analysis using the streptavidin-biotin method in order to assess p53 and MDM2 protein expression. All studied cases expressed p53 proteins in basal and suprabasal layers. In the basal layer, the nuclei testing positive for p53 were stained intensely, while in the suprabasal layer, cells with slightly stained nuclei were predominant. All cases also tested positive for the MDM2 protein, but with varying degrees of nuclear expression and a predominance of slightly stained cells. A statistically significant correlation between the percentage of p53 and MDM2-positive cells was established, regardless of the degree of epithelial dysplasia. The expression of p53 and MDM2 proteins in actinic cheilitis can be an important indicator in lip carcinogenesis, regardless of the degree of epithelial dysplasia.

  17. PML is a ROS sensor activating p53 upon oxidative stress

    PubMed Central

    Soilihi, Hassane

    2017-01-01

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml−/− cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml−/− embryos survive acute glutathione depletion. Moreover, Pml−/− animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml−/− animals fail to properly activate oxidative stress–responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress–prone background, Pml−/− animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress–induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. PMID:28931625

  18. PML is a ROS sensor activating p53 upon oxidative stress.

    PubMed

    Niwa-Kawakita, Michiko; Ferhi, Omar; Soilihi, Hassane; Le Bras, Morgane; Lallemand-Breitenbach, Valérie; de Thé, Hugues

    2017-11-06

    Promyelocytic leukemia (PML) nuclear bodies (NBs) recruit partner proteins, including p53 and its regulators, thereby controlling their abundance or function. Investigating arsenic sensitivity of acute promyelocytic leukemia, we proposed that PML oxidation promotes NB biogenesis. However, physiological links between PML and oxidative stress response in vivo remain unexplored. Here, we identify PML as a reactive oxygen species (ROS) sensor. Pml -/- cells accumulate ROS, whereas PML expression decreases ROS levels. Unexpectedly, Pml -/- embryos survive acute glutathione depletion. Moreover, Pml -/- animals are resistant to acetaminophen hepatotoxicity or fasting-induced steatosis. Molecularly, Pml -/- animals fail to properly activate oxidative stress-responsive p53 targets, whereas the NRF2 response is amplified and accelerated. Finally, in an oxidative stress-prone background, Pml -/- animals display a longevity phenotype, likely reflecting decreased basal p53 activation. Thus, similar to p53, PML exerts basal antioxidant properties but also drives oxidative stress-induced changes in cell survival/proliferation or metabolism in vivo. Through NB biogenesis, PML therefore couples ROS sensing to p53 responses, shedding a new light on the role of PML in senescence or stem cell biology. © 2017 Niwa-Kawakita et al.

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  20. Nuclear NF-κB contributes to chlorpyrifos-induced apoptosis through p53 signaling in human neural precursor cells.

    PubMed

    Lee, Jeong Eun; Lim, Mi Sun; Park, Jae Hyeon; Park, Chang Hwan; Koh, Hyun Chul

    2014-05-01

    Chlorpyrifos (CPF) is one of the most widely used organophosphate insecticides with several harmful effects, including neurotoxicity. Although many studies have addressed the neurotoxicity induced by CPF, most data on neurodevelopmental damage was obtained from animal models. We are the first group to use human neural precursor cells (hNPCs) derived from human embryonic stem cells (hESCs) as a developing neuron model to evaluate the mechanisms involved in CPF-induced neurotoxicity. CPF was cytotoxic to these cells in a concentration-dependent manner, as shown by decreased cell viability and increased lactate dehydrogenase release. Furthermore, CPF reduced the expression of AKT and ERK proteins which are involved in intracellular survival pathways. Exposure of hNPCs to CPF led to the production of reactive oxygen species (ROS), and the antioxidant N-acetyl-cystein (NAC) attenuated ROS production induced by CPF. In addition, CPF increased cytochrome c release into the cytosol and activated caspase-9 and -3, indicating that cell death induced by CPF was due to apoptosis in hNPCs. Consistent with these findings, CPF treatment reduced the level of Bcl-2 protein and increased the level of Bax protein. Especially, CPF increased the translocation of BAX into the mitochondria. CPF also induced nuclear accumulation of NF-κB and p53 proteins in a concentration-dependent manner, and their inhibitors attenuated CPF-induced cytotoxicity. In addition, an inhibitor of NF-κB nuclear translocation blocked the increase of p53 in CPF-treated hNPCs. These findings show that CPF induced hNPCs death in part through NF-κB activation via ROS generation, enabling the interaction of p53 with Bcl-2 and Bax and subsequent release of cytochrome c. Collectively, these results represent a unique molecular characterization of CPF-induced cytotoxicity in hNPCs. These data suggest that CPF may affect neurodevelopment in a manner similar to that of several known and suspected neurotoxicants. Crown

  1. Serum p53 antibody as a potential tumor marker in extrahepatic cholangiocarcinoma.

    PubMed

    Okada, Rei; Shimada, Hideaki; Otsuka, Yuichiro; Tsuchiya, Masaru; Ishii, Jun; Katagiri, Toshio; Maeda, Tetsuya; Kubota, Yoshihisa; Nemoto, Tetsuo; Kaneko, Hironori

    2017-12-01

    Only a few studies have evaluated the clinicopathological significance of the p53 protein expression and s-p53-Abs level in patients with cholangiocarcinoma. We therefore analyzed the clinicopathological and prognostic significance of s-p53-Abs in patients with extrahepatic cholangiocarcinoma. We prospectively evaluated s-p53-Abs levels before and after surgery in 61 patients with extrahepatic cholangiocarcinoma to determine the relationship between clinicopathological factors and the prognostic significance of s-p53-Abs. Among a total of 61 primary extrahepatic cholangiocarcinoma cases, 23% were positive for s-p53-Abs. Combination of s-p53-Abs with the conventional serum markers carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA19-9) significantly increased the rate of positive extrahepatic cholangiocarcinoma cases (57% for CEA and/or CA19-9 vs. 75% for CEA and/or CA19-9 and/or s-p53-Abs, P = 0.035). There were no significant differences in clinicopathological factors between the p53-seropositive and p53-seronegative patients. An immunohistochemical analysis showed the presence of significant associations between the intensity (P = 0.003) and extent (P = 0.001) of p53 immunoreactivity and p53-seropositivitly. Although s-p53-Abs was not a significant prognostic factor for the survival in either univariate or multivariate analyses, p53 immunoreactivity was independently associated with a poor survival. Among patients positive for s-p53-Abs before surgery, the s-p53-Abs levels were reduced after surgery in most. These findings suggested that s-p53-Abs might be associated with p53 immunoreactivity. In addition, s-p53-Abs may be useful for a diagnosis, but was not useful for predicting tumor recurrence or the survival. This study was registered as UMIN000014530.

  2. Phosphorylated Hsp27 activates ATM-dependent p53 signaling and mediates the resistance of MCF-7 cells to doxorubicin-induced apoptosis.

    PubMed

    Xu, Yimiao; Diao, Ying; Qi, Shimei; Pan, Xiaolong; Wang, Qi; Xin, Yinqiang; Cao, Xiang; Ruan, Jie; Zhao, Zhihui; Luo, Lan; Liu, Chang; Yin, Zhimin

    2013-05-01

    DNA damage activates p53 and its downstream target genes, which further leads to apoptosis or survival either by the cell cycle arrest or by DNA repair. In many tumors, the heat shock protein 27 (Hsp27) is expressed at high levels to provide protection against anticancer drugs. However, the roles of Hsp27 in p53-mediated cellular responses to DNA damage are controversial. Here, we investigated the interplay between the phosphorylation status of Hsp27 and p53 in kidney 293A (HEK293A) cells and found that over-expressing phosphorylated Hsp27 mimics (Hsp27-3D) activated p53/p21 in an ATM-dependent manner. In addition, incubation with doxorubicin (Dox), an anticancer drug, induced Hsp27 phosphorylation in human adenocarcinoma cells (MCF-7). In contrast, inhibition of Hsp27 phosphorylation retarded both p53 induction and p21 accumulation, and led to cell apoptosis. Furthermore, phosphorylated Hsp27 increased p53 nuclear importing and its downstream target gene expression such as p21 and MDM2, while de-phosphorylated Hsp27 impeded this procession. Taken together, our data suggest that Hsp27, in its phosphorylated or de-phosphorylated status, plays different roles in regulating p53 pathway and cell survival. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. B-DIM impairs radiation-induced survival pathways independently of androgen receptor expression and augments radiation efficacy in prostate cancer.

    PubMed

    Singh-Gupta, Vinita; Banerjee, Sanjeev; Yunker, Christopher K; Rakowski, Joseph T; Joiner, Michael C; Konski, Andre A; Sarkar, Fazlul H; Hillman, Gilda G

    2012-05-01

    Increased consumption of cruciferous vegetables is associated with decreased risk in prostate cancer (PCa). The active compound in cruciferous vegetables appears to be the self dimerized product [3,3'-diindolylmethane (DIM)] of indole-3-carbinol (I3C). Nutritional grade B-DIM (absorption-enhanced) has proven safe in a Phase I trial in PCa. We investigated the anti-cancer activity of B-DIM as a new biological approach to improve the effects of radiotherapy for hormone refractory prostate cancer cells, which were either positive or negative for androgen receptor (AR) expression. B-DIM inhibited cell growth in a dose-dependent manner in both PC-3 (AR-) and C4-2B (AR+) cell lines. B-DIM was effective at increasing radiation-induced cell killing in both cell lines, independently of AR expression. B-DIM inhibited NF-κB and HIF-1α DNA activities and blocked radiation-induced activation of these transcription factors in both PC-3 and C4-2B cells. In C4-2B (AR+) cells, AR expression and nuclear localization were significantly increased by radiation. However, B-DIM abrogated the radiation-induced AR increased expression and trafficking to the nucleus, which was consistent with decreased PSA secretion. In vivo, treatment of PC-3 prostate tumors in nude mice with B-DIM and radiation resulted in significant primary tumor growth inhibition and control of metastasis to para-aortic lymph nodes. These studies demonstrate that B-DIM augments radiation-induced cell killing and tumor growth inhibition. B-DIM impairs critical survival signaling pathways activated by radiation, leading to enhanced cell killing. These novel observations suggest that B-DIM could be used as a safe compound to enhance the efficacy of radiotherapy for castrate-resistant PCa. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  4. Downregulation of LRRC8A protects human ovarian and alveolar carcinoma cells against Cisplatin-induced expression of p53, MDM2, p21Waf1/Cip1, and Caspase-9/-3 activation

    PubMed Central

    Sørensen, Belinda Halling; Nielsen, Dorthe; Thorsteinsdottir, Unnur Arna; Hoffmann, Else Kay

    2016-01-01

    The leucine-rich repeat containing 8A (LRRC8A) protein is an essential component of the volume-sensitive organic anion channel (VSOAC), and using pharmacological anion channel inhibitors (NS3728, DIDS) and LRRC8A siRNA we have investigated its role in development of Cisplatin resistance in human ovarian (A2780) and alveolar (A549) carcinoma cells. In Cisplatin-sensitive cells Cisplatin treatment increases p53-protein level as well as downstream signaling, e.g., expression of p21Waf1/Cip1, Bax, Noxa, MDM2, and activation of Caspase-9/-3. In contrast, Cisplatin-resistant cells do not enter apoptosis, i.e., their p53 and downstream signaling are reduced and caspase activity unaltered following Cisplatin exposure. Reduced LRRC8A expression and VSOAC activity are previously shown to correlate with Cisplatin resistance, and here we demonstrate that pharmacological inhibition and transient knockdown of LRRC8A reduce the protein level of p53, MDM2, and p21Waf1/Cip1 as well as Caspase-9/-3 activation in Cisplatin-sensitive cells. Cisplatin resistance is accompanied by reduction in total LRRC8A expression (A2780) or LRRC8A expression in the plasma membrane (A549). Activation of Caspase-3 dependent apoptosis by TNFα-exposure or hyperosmotic cell shrinkage is almost unaffected by pharmacological anion channel inhibition. Our data indicate 1) that expression/activity of LRRC8A is essential for Cisplatin-induced increase in p53 protein level and its downstream signaling, i.e., Caspase-9/-3 activation, expression of p21Waf1/Cip1 and MDM2; and 2) that downregulation of LRRC8A-dependent osmolyte transporters contributes to acquirement of Cisplatin resistance in ovarian and lung carcinoma cells. Activation of LRRC8A-containing channels is upstream to apoptotic volume decrease as hypertonic cell shrinkage induces apoptosis independent of the presence of LRRC8A. PMID:26984736

  5. Simultaneous activation of p53 and inhibition of XIAP enhance the activation of apoptosis signaling pathways in AML

    PubMed Central

    Carter, Bing Z.; Mak, Duncan H.; Schober, Wendy D.; Koller, Erich; Pinilla, Clemencia; Vassilev, Lyubomir T.; Reed, John C.

    2010-01-01

    Activation of p53 by murine double minute (MDM2) antagonist nutlin-3a or inhibition of X-linked inhibitor of apoptosis (XIAP) induces apoptosis in acute myeloid leukemia (AML) cells. We demonstrate that concomitant inhibition of MDM2 by nutlin-3a and of XIAP by small molecule antagonists synergistically induced apoptosis in p53 wild-type OCI-AML3 and Molm13 cells. Knockdown of p53 by shRNA blunted the synergy, and down-regulation of XIAP by antisense oligonucleotide (ASO) enhanced nutlin-3a–induced apoptosis, suggesting that the synergy was mediated by p53 activation and XIAP inhibition. This is supported by data showing that inhibition of both MDM2 and XIAP by their respective ASOs induced significantly more cell death than either ASO alone. Importantly, p53 activation and XIAP inhibition enhanced apoptosis in blasts from patients with primary AML, even when the cells were protected by stromal cells. Mechanistic studies demonstrated that XIAP inhibition potentiates p53-induced apoptosis by decreasing p53-induced p21 and that p53 activation enhances XIAP inhibition-induced cell death by promoting mitochondrial release of second mitochondria-derived activator of caspases (SMAC) and by inducing the expression of caspase-6. Because both XIAP and p53 are presently being targeted in ongoing clinical trials in leukemia, the combination strategy holds promise for expedited translation into the clinic. PMID:19897582

  6. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

    PubMed Central

    2012-01-01

    Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the

  7. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    PubMed

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  8. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    PubMed Central

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  9. Three-dimensional Structure and Enzymatic Function of Proapoptotic Human p53-inducible Quinone Oxidoreductase PIG3*

    PubMed Central

    Porté, Sergio; Valencia, Eva; Yakovtseva, Evgenia A.; Borràs, Emma; Shafqat, Naeem; Debreczeny, Judit É.; Pike, Ashley C. W.; Oppermann, Udo; Farrés, Jaume; Fita, Ignacio; Parés, Xavier

    2009-01-01

    Tumor suppressor p53 regulates the expression of p53-induced genes (PIG) that trigger apoptosis. PIG3 or TP53I3 is the only known member of the medium chain dehydrogenase/reductase superfamily induced by p53 and is used as a proapoptotic marker. Although the participation of PIG3 in the apoptotic pathway is proven, the protein and its mechanism of action were never characterized. We analyzed human PIG3 enzymatic function and found NADPH-dependent reductase activity with ortho-quinones, which is consistent with the classification of PIG3 in the quinone oxidoreductase family. However, the activity is much lower than that of ζ-crystallin, a better known quinone oxidoreductase. In addition, we report the crystallographic structure of PIG3, which allowed the identification of substrate- and cofactor-binding sites, with residues fully conserved from bacteria to human. Tyr-59 in ζ-crystallin (Tyr-51 in PIG3) was suggested to participate in the catalysis of quinone reduction. However, kinetics of Tyr/Phe and Tyr/Ala mutants of both enzymes demonstrated that the active site Tyr is not catalytic but may participate in substrate binding, consistent with a mechanism based on propinquity effects. It has been proposed that PIG3 contribution to apoptosis would be through oxidative stress generation. We found that in vitro activity and in vivo overexpression of PIG3 accumulate reactive oxygen species. Accordingly, an inactive PIG3 mutant (S151V) did not produce reactive oxygen species in cells, indicating that enzymatically active protein is necessary for this function. This supports that PIG3 action is through oxidative stress produced by its enzymatic activity and provides essential knowledge for eventual control of apoptosis. PMID:19349281

  10. Scriptaid overcomes hypoxia-induced cisplatin resistance in both wild-type and mutant p53 lung cancer cells

    PubMed Central

    Pradhan, Shrikant; Mahajan, Divyank; Kaur, Prabhjot; Pandey, Namita; Sharma, Chandresh; Srivastava, Tapasya

    2016-01-01

    Non-small cell lung cancer (NSCLC), comprising 85% of lung cancer cases, has been associated with resistance to chemo/radiotherapy. The hypoxic tumor micro-environment, where insufficient vasculature results in poor drug penetrance and sub-optimal chemotherapy in the tumor interiors contributes heavily to this resistance. Additionally, epigenetic changes in tumorigenic cells also change their response to different forms of therapy. In our study, we have investigated the effectiveness of a combination of cisplatin with scriptaid [a pan-Histone Deacetylase inhibitor (HDACi)] in a model that mimics the tumor microenvironment of hypoxia and sub-lethal chemotherapy. Scriptaid synergistically increases the efficacy of cisplatin in normoxia as well as hypoxia, accompanied with reduced metastasis and enhanced DNA damage. Addition of scriptaid also overcomes the cisplatin resistance exhibited in lung cancer cells with stabilized hypoxia inducible factor 1 (HIF1)-α (mutant) and mutant p53. Molecular studies showed that the combination treatment increased apoptotic cell death in both normoxia and hypoxia with a dual role of p38MAPK. Together, our results suggest that the combination of low dose cisplatin and scriptaid is cytotoxic to NSCLC lines, can overcome hypoxia induced resistance and mutant p53- induced instability often associated with this cancer, and has the potential to be an effective therapeutic modality. PMID:27708247

  11. Downregulation of VRK1 by p53 in Response to DNA Damage Is Mediated by the Autophagic Pathway

    PubMed Central

    Valbuena, Alberto; Castro-Obregón, Susana; Lazo, Pedro A.

    2011-01-01

    Human VRK1 induces a stabilization and accumulation of p53 by specific phosphorylation in Thr18. This p53 accumulation is reversed by its downregulation mediated by Hdm2, requiring a dephosphorylated p53 and therefore also needs the removal of VRK1 as stabilizer. This process requires export of VRK1 to the cytosol and is inhibited by leptomycin B. We have identified that downregulation of VRK1 protein levels requires DRAM expression, a p53-induced gene. DRAM is located in the endosomal-lysosomal compartment. Induction of DNA damage by UV, IR, etoposide and doxorubicin stabilizes p53 and induces DRAM expression, followed by VRK1 downregulation and a reduction in p53 Thr18 phosphorylation. DRAM expression is induced by wild-type p53, but not by common human p53 mutants, R175H, R248W and R273H. Overexpression of DRAM induces VRK1 downregulation and the opposite effect was observed by its knockdown. LC3 and p62 were also downregulated, like VRK1, in response to UV-induced DNA damage. The implication of the autophagic pathway was confirmed by its requirement for Beclin1. We propose a model with a double regulatory loop in response to DNA damage, the accumulated p53 is removed by induction of Hdm2 and degradation in the proteasome, and the p53-stabilizer VRK1 is eliminated by the induction of DRAM that leads to its lysosomal degradation in the autophagic pathway, and thus permitting p53 degradation by Hdm2. This VRK1 downregulation is necessary to modulate the block in cell cycle progression induced by p53 as part of its DNA damage response. PMID:21386980

  12. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    PubMed

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  13. CDIP, a novel pro-apoptotic gene, regulates TNFalpha-mediated apoptosis in a p53-dependent manner.

    PubMed

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-07-25

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-alpha expression tightly correlates with CDIP expression, and that inhibition of TNF-alpha signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-alpha is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-alpha impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 --> CDIP --> TNF-alpha apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy.

  14. Modulation of the cyclin-dependent kinase inhibitor p21(WAF1/Cip1) gene by Zac1 through the antagonistic regulators p53 and histone deacetylase 1 in HeLa Cells.

    PubMed

    Liu, Pei-Yao; Chan, James Yi-Hsin; Lin, Hsiu-Chen; Wang, Sung-Ling; Liu, Shu-Ting; Ho, Ching-Liang; Chang, Li-Chien; Huang, Shih-Ming

    2008-07-01

    Zac1 is a novel seven-zinc finger protein which possesses the ability to bind specifically to GC-rich DNA elements. Zac1 not only promotes apoptosis and cell cycle arrest but also acts as a transcriptional cofactor for p53 and a number of nuclear receptors. Our previous study indicated that the enhancement of p53 activity by Zac1 is much more pronounced in HeLa cells compared with other cell lines tested. This phenomenon might be due to the coactivator effect of Zac1 on p53 and the ability of Zac1 to reverse E6 inhibition of p53. In the present study, we showed that Zac1 acted synergistically with either p53 or a histone deacetylase inhibitor, trichostatin A, to enhance p21(WAF1/Cip1) promoter activity. We showed that Zac1 physically interacted with some nuclear receptor corepressors such as histone deacetylase 1 (HDAC1) and mSin3a, and the induction of p21(WAF1/Cip1) gene and protein by Zac1 was suppressed by either overexpressing HDAC1 or its deacetylase-dead mutant. In addition, our data suggest that trichostatin A-induced p21(WAF1/Cip1) protein expression might be mediated through a p53-independent and HDAC deacetylase-independent pathway. Taken together, our data suggest that Zac1 might be involved in regulating the p21(WAF1/Cip1) gene and protein expression through its protein-protein interaction with p53 and HDAC1 in HeLa cells.

  15. p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

    PubMed

    Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

    1998-09-01

    The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

  16. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  17. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    PubMed Central

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  18. NF-kappaB and p53 are the dominant apoptosis-inducing transcription factors elicited by the HIV-1 envelope.

    PubMed

    Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido

    2004-03-01

    The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.

  19. IRSp53 is colocalised with WAVE2 at the tips of protruding lamellipodia and filopodia independently of Mena.

    PubMed

    Nakagawa, Hiroyuki; Miki, Hiroaki; Nozumi, Motohiro; Takenawa, Tadaomi; Miyamoto, Shigeaki; Wehland, Jürgen; Small, J Victor

    2003-06-15

    The insulin receptor tyrosine kinase substrate p53 (IRSp53) links Rac and WAVE2 and has been implicated in lamellipodia protrusion. Recently, however, IRSp53 has been reported to bind to both Cdc42 and Mena to induce filopodia. To shed independent light on IRSp53 function we determined the localisations and dynamics of IRSp53 and WAVE2 in B16 melanoma cells. In cells spread well on a laminin substrate, IRSp53 was localised by antibody labelling at the tips of both lamellipodia and filopodia. The same localisation was observed in living cells with IRSp53 tagged with enhanced green florescence protein (EGFP-IRSp53), but only during protrusion. From the transfection of deletion mutants the N-terminal region of IRSp53, which binds active Rac, was shown to be responsible for its localisation. Although IRSp53 has been reported to regulate filopodia formation with Mena, EGFP-IRSp53 showed the same localisation in MVD7 Ena/VASP (vasodilator stimulated phosphoprotein) family deficient cells. WAVE2 tagged with DsRed1 colocalised with EGFP-IRSp53 at the tips of protruding lamellipodia and filopodia and, in double-transfected cells, the IRSp53 signal in filopodia decreased before that of WAVE2 during retraction. These results suggest an alternative modulatory role for IRSp53 in the extension of both filopodia and lamellipodia, through WAVE2.

  20. Toosendanin Exerts an Anti-Cancer Effect in Glioblastoma by Inducing Estrogen Receptor β- and p53-Mediated Apoptosis

    PubMed Central

    Cao, Liang; Qu, Dingding; Wang, Huan; Zhang, Sha; Jia, Chenming; Shi, Zixuan; Wang, Zongren; Zhang, Jian; Ma, Jing

    2016-01-01

    Glioblastoma (GBM) is the most common primary brain tumor with median survival of approximately one year. This dismal poor prognosis is due to resistance to currently available chemotherapeutics; therefore, new cytotoxic agents are urgently needed. In the present study, we reported the cytotoxicity of toosendanin (TSN) in the GBM U87 and C6 cell lines in vitro and in vivo. By using the MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide) assay, flow cytometry analysis, and Western blot, we found that TSN inhibited U87 and C6 cell proliferation and induced apoptosis at a concentration as low as 10 nM. Administration of TSN also reduced tumor burden in a xenograft model of athymic nude mice. Pharmacological and molecular studies suggested that estrogen receptor β (ERβ) and p53 were prominent targets for TSN. GBM cell apoptosis induced by TSN was a stepwise biological event involving the upregulation of ERβ and contextual activation of functional p53. Collectively, our study indicates, for the first time, that TSN is a candidate of novel anti-cancer drugs for GBM. Furthermore, ERβ and p53 could act as predictive biomarkers for the sensitivity of cancer to TSN. PMID:27869737

  1. Loss of Parkin reduces inflammatory arthritis by inhibiting p53 degradation.

    PubMed

    Jung, Yu Yeon; Son, Dong Ju; Lee, Hye Lim; Kim, Dae Hwan; Song, Min Jong; Ham, Young Wan; Kim, Youngsoo; Han, Sang Bae; Park, Mi Hee; Hong, Jin Tae

    2017-08-01

    Parkin is associated with various inflammatory diseases, including Parkinson's disease (PD) and rheumatoid arthritis (RA). However, the precise role of Parkin in RA is unclear. The present study addressed this issue by comparing the development of RA between non-transgenic (non-Tg) mice and PARK2 knockout (KO) mice. We found that cyclooxygenase-2 and inducible nitric oxide synthase expression and nuclear factor-κB activity were reduced but p53 activation was increased in PARK2 KO as compared to non-Tg mice. These effects were associated with reduced p53 degradation. Parkin was found to interact with p53; however, this was abolished in Parkin KO mice, which prevented p53 degradation. Treatment of PARK2 KO mice with p53 inhibitor increased Parkin expression as well as inflammation and RA development while decreasing nuclear p53 translocation, demonstrating that PARK2 deficiency inhibits inflammation in RA via suppression of p53 degradation. These results suggest that RA development may be reduced in PD patients. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

    1997-01-01

    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  3. Genomic structure and chromosomal localization of GML (GPI-anchored molecule-like protein), a gene induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kimura, Yasutoshi; Furuhata, Tomohisa; Nakamura, Yusuke

    1997-05-01

    Among its known functions, tumor suppressor gene p53 serves as a transcriptional regulator and mediates various signals through activation of downstream genes. We recently identified a novel gene, GML (glycosylphosphatidylinositol (GPI)-anchored molecule-like protein), whose expression is specifically induced by wildtype p53. To characterize the GML gene further, we determined 35.8 kb of DNA sequence that included a consensus binding sequence for p53 and the entire GML gene. The GML gene consists of four exons, and the p53-binding sequence is present in the 5{prime}-flanking region. In genomic organization this gene resembles genes encoding murine Ly-6 glycoproteins, a human homologue of themore » Ly-6 family called RIG-E, and CD59; products of these genes, known as GPI-anchored proteins, are variously involved in signal transduction, cell-cell adhesion, and cell-matrix attachment. FISH analysis revealed that the GML gene is located on human chromosome 8q24.3. Genes encoding at least two other GPI-anchored molecules, E48 and RIG-E, are also located in this region. 20 refs., 2 figs., 1 tab.« less

  4. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

    PubMed Central

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-01-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

  5. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Selenoprotein P Inhibits Radiation-Induced Late Reactive Oxygen Species Accumulation and Normal Cell Injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eckers, Jaimee C.; Kalen, Amanda L.; Xiao, Wusheng

    2013-11-01

    Purpose: Radiation is a common mode of cancer therapy whose outcome is often limited because of normal tissue toxicity. We have shown previously that the accumulation of radiation-induced late reactive oxygen species (ROS) precedes cell death, suggesting that metabolic oxidative stress could regulate cellular radiation response. The purpose of this study was to investigate whether selenoprotein P (SEPP1), a major supplier of selenium to tissues and an antioxidant, regulates late ROS accumulation and toxicity in irradiated normal human fibroblasts (NHFs). Methods and Materials: Flow cytometry analysis of cell viability, cell cycle phase distribution, and dihydroethidium oxidation, along with clonogenic assays,more » were used to measure oxidative stress and toxicity. Human antioxidant mechanisms array and quantitative real-time polymerase chain reaction assays were used to measure gene expression during late ROS accumulation in irradiated NHFs. Sodium selenite addition and SEPP1 overexpression were used to determine the causality of SEPP1 regulating late ROS accumulation and toxicity in irradiated NHFs. Results: Irradiated NHFs showed late ROS accumulation (4.5-fold increase from control; P<.05) that occurs after activation of the cell cycle checkpoint pathways and precedes cell death. The mRNA levels of CuZn- and Mn-superoxide dismutase, catalase, peroxiredoxin 3, and thioredoxin reductase 1 increased approximately 2- to 3-fold, whereas mRNA levels of cold shock domain containing E1 and SEPP1 increased more than 6-fold (P<.05). The addition of sodium selenite before the radiation treatment suppressed toxicity (45%; P<.05). SEPP1 overexpression suppressed radiation-induced late ROS accumulation (35%; P<.05) and protected NHFs from radiation-induced toxicity (58%; P<.05). Conclusion: SEPP1 mitigates radiation-induced late ROS accumulation and normal cell injury.« less

  7. Increased Arf/p53 activity in stem cells, aging and cancer.

    PubMed

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  8. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  9. p53 and metabolism: from mechanism to therapeutics

    PubMed Central

    Simabuco, Fernando M.; Morale, Mirian G.; Pavan, Isadora C.B.; Morelli, Ana P.; Silva, Fernando R.; Tamura, Rodrigo E.

    2018-01-01

    The tumor cell changes itself and its microenvironment to adapt to different situations, including action of drugs and other agents targeting tumor control. Therefore, metabolism plays an important role in the activation of survival mechanisms to keep the cell proliferative potential. The Warburg effect directs the cellular metabolism towards an aerobic glycolytic pathway, despite the fact that it generates less adenosine triphosphate than oxidative phosphorylation; because it creates the building blocks necessary for cell proliferation. The transcription factor p53 is the master tumor suppressor; it binds to more than 4,000 sites in the genome and regulates the expression of more than 500 genes. Among these genes are important regulators of metabolism, affecting glucose, lipids and amino acids metabolism, oxidative phosphorylation, reactive oxygen species (ROS) generation and growth factors signaling. Wild-type and mutant p53 may have opposing effects in the expression of these metabolic genes. Therefore, depending on the p53 status of the cell, drugs that target metabolism may have different outcomes and metabolism may modulate drug resistance. Conversely, induction of p53 expression may regulate differently the tumor cell metabolism, inducing senescence, autophagy and apoptosis, which are dependent on the regulation of the PI3K/AKT/mTOR pathway and/or ROS induction. The interplay between p53 and metabolism is essential in the decision of cell fate and for cancer therapeutics. PMID:29805774

  10. The TP53 dependence of radiation-induced chromosome instability in human lymphoblastoid cells

    NASA Technical Reports Server (NTRS)

    Schwartz, Jeffrey L.; Jordan, Robert; Evans, Helen H.; Lenarczyk, Marek; Liber, Howard

    2003-01-01

    The dose and TP53 dependence for the induction of chromosome instability were examined in cells of three human lymphoblastoid cell lines derived from WIL2 cells: TK6, a TP53-normal cell line, NH32, a TP53-knockout created from TK6, and WTK1, a WIL2-derived cell line that spontaneously developed a TP53 mutation. Cells of each cell line were exposed to (137)Cs gamma rays, and then surviving clones were isolated and expanded in culture for approximately 35 generations before the frequency and characteristics of the instability were analyzed. The presence of dicentric chromosomes, formed by end-to-end fusions, served as a marker of chromosomal instability. Unexposed TK6 cells had low levels of chromosomal instability (0.002 +/- 0.001 dicentrics/cell). Exposure of TK6 cells to doses as low as 5 cGy gamma rays increased chromosome instability levels nearly 10-fold to 0.019 +/- 0.008 dicentrics/cell. There was no further increase in instability levels beyond 5 cGy. In contrast to TK6 cells, unexposed cultures of WTK1 and NH32 cells had much higher levels of chromosome instability of 0.034 +/- 0.007 and 0.041 +/- 0.009, respectively, but showed little if any effect of radiation on levels of chromosome instability. The results suggest that radiation exposure alters the normal TP53-dependent cell cycle checkpoint controls that recognize alterations in telomere structure and activate apoptosis.

  11. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    PubMed Central

    Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M

    2018-01-01

    Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous

  12. Mulberry leaf polyphenol extract induced apoptosis involving regulation of adenosine monophosphate-activated protein kinase/fatty acid synthase in a p53-negative hepatocellular carcinoma cell.

    PubMed

    Yang, Tzi-Peng; Lee, Huei-Jane; Ou, Ting-Tsz; Chang, Ya-Ju; Wang, Chau-Jong

    2012-07-11

    The polyphenols in mulberry leaf possess the ability to inhibit cell proliferation, invasion, and metastasis of tumors. It was reported that the p53 status plays an important role in switching apoptosis and the cell cycle following adenosine monophosphate-activated protein kinase (AMPK) activation. In this study, we aimed to detect the effect of the mulberry leaf polyphenol extract (MLPE) on inducing cell death in p53-negative (Hep3B) and p53-positive (Hep3B with transfected p53) hepatocellular carcinoma cells and also to clarify the role of p53 in MLPE-treated cells. After treatment of the Hep3B cells with MLPE, apoptosis was induced via the AMPK/PI3K/Akt and Bcl-2 family pathways. Transient transfection of p53 into Hep3B cells led to switching autophagy instead of apoptosis by MLPE treatment. We demonstrated that acridine orange staining and protein expressions of LC-3 and beclin-1 were increased in p53-transfected cells. These results implied induction of apoptosis or autophagy in MLPE-treated hepatocellular carcinoma cells can be due to the p53 status. We also found MLPE can not only activate AMPK but also diminish fatty acid synthase, a molecular target for cancer inhibition. At present, our results indicate MLPE can play an active role in mediating the cell death of hepatocellular carcinoma cells and the p53 might play an important role in regulating the death mechanisms.

  13. p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.

    PubMed

    Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar

    2017-06-23

    Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. P53 protein in proliferation, repair and apoptosis of cells.

    PubMed

    Wawryk-Gawda, Ewelina; Chylińska-Wrzos, Patrycja; Lis-Sochocka, Marta; Chłapek, Katarzyna; Bulak, Kamila; Jędrych, Marian; Jodłowska-Jędrych, Barbara

    2014-05-01

    The p53 protein is an important factor of many intra- and extracellular processes. This protein regulates the repair of cellular DNA and induces apoptosis. It is also responsible for the regulation of the senescence and the cell entering the subsequent stages of the cellular cycle. The protein p53 is also involved in inhibiting angiogenesis and the induction of oxidative shock. In our study, we examined the activity of p53 protein in the uterine epithelial cells in rats treated with cladribine. Its action is mainly based on apoptosis induction. We compared the activity of p53 protein in cells with a high apoptosis index and in cells with active repair mechanisms and high proliferation index. We observed stronger p53 protein expression in the epithelial cells of the materials taken 24 h after the last dose of 2-CdA associated with the active process of apoptosis and inhibition of proliferation. After 4 weeks from the last dose of cladribine, the stronger expression of p53 protein was associated with both the existing changes in the cell's genome, the effects of the ongoing repair mechanisms, as well as the high proliferation activity.

  15. p53/PUMA expression in human pulmonary fibroblasts mediates cell activation and migration in silicosis.

    PubMed

    Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie

    2015-11-18

    Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.

  16. CDIP, a novel pro-apoptotic gene, regulates TNFα-mediated apoptosis in a p53-dependent manner

    PubMed Central

    Brown, Lauren; Ongusaha, Pat P; Kim, Hyung-Gu; Nuti, Shanthy; Mandinova, Anna; Lee, Ji Won; Khosravi-Far, Roya; Aaronson, Stuart A; Lee, Sam W

    2007-01-01

    We have identified a novel pro-apoptotic p53 target gene named CDIP (Cell Death Involved p53-target). Inhibition of CDIP abrogates p53-mediated apoptotic responses, demonstrating that CDIP is an important p53 apoptotic effector. CDIP itself potently induces apoptosis that is associated with caspase-8 cleavage, implicating the extrinsic cell death pathway in apoptosis mediated by CDIP. siRNA-directed knockdown of caspase-8 results in a severe impairment of CDIP-dependent cell death. In investigating the potential involvement of extrinsic cell death pathway in CDIP-mediated apoptosis, we found that TNF-α expression tightly correlates with CDIP expression, and that inhibition of TNF-α signaling attenuates CDIP-dependent apoptosis. We also demonstrate that TNF-α is upregulated in response to p53 and p53 inducing genotoxic stress, in a CDIP-dependent manner. Consistently, knockdown of TNF-α impairs p53-mediated stress-induced apoptosis. Together, these findings support a novel p53 → CDIP → TNF-α apoptotic pathway that directs apoptosis after exposure of cells to genotoxic stress. Thus, CDIP provides a new link between p53-mediated intrinsic and death receptor-mediated extrinsic apoptotic signaling, providing a novel target for cancer therapeutics aimed at maximizing the p53 apoptotic response of cancer cells to drug therapy. PMID:17599062

  17. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    PubMed Central

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-01-01

    To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol−1 (15.1 kJ mol−1). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

  18. Synthesis of cytochrome C oxidase 2: a p53-dependent metabolic regulator that promotes respiratory function and protects glioma and colon cancer cells from hypoxia-induced cell death.

    PubMed

    Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J

    2012-08-16

    P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in

  19. Exposure to cigarette smoke increases apoptosis in the rat gastric mucosa through a reactive oxygen species-mediated and p53-independent pathway.

    PubMed

    Wang, H; Ma, L; Li, Y; Cho, C H

    2000-04-01

    Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.

  20. The Chinese Herb Isolate Yuanhuacine (YHL-14) Induces G2/M Arrest in Human Cancer Cells by Up-regulating p21 Protein Expression through an p53 Protein-independent Cascade*

    PubMed Central

    Zhang, Ruowen; Wang, Yulei; Li, Jingxia; Jin, Honglei; Song, Shaojiang; Huang, Chuanshu

    2014-01-01

    Yuanhuacine (YHL-14), the major component of daphnane diterpene ester isolated from the flower buds of Daphne genkwa, has been reported to have activity against cell proliferation in various cancer cell lines. Nevertheless, the potential mechanism has not been explored yet. Here we demonstrate that YHL-14 inhibits bladder and colon cancer cell growth through up-regulation of p21 expression in an Sp1-dependent manner. We found that YHL-14 treatment resulted in up-regulation of p21 expression and a significant G2/M phase arrest in T24T and HCT116 cells without affecting p53 protein expression and activation. Further studies indicate that p21 induction by YHL-14 occurs at the transcriptional level via up-regulation of Sp1 protein expression. Moreover, our results show that p38 is essential for YHL-14-mediated Sp1 protein stabilization, G2/M growth arrest induction, and anchorage-independent growth inhibition of cancer cells. Taken together, our studies demonstrate a novel mechanism of YHL-14 against cancer cell growth in bladder and colon cancer cell lines, which provides valuable information for the design and synthesis of other new conformation-constrained derivatives on the basis of the structure of YHL-14 for cancer therapy. PMID:24451377

  1. TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

    PubMed

    Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

    2017-12-01

    Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  2. p53 regulates ERK1/2/CREB cascade via a novel SASH1/MAP2K2 crosstalk to induce hyperpigmentation.

    PubMed

    Zhou, Ding'an; Kuang, Zhongshu; Zeng, Xing; Wang, Ke; Ma, Jiangshu; Luo, Huangchao; Chen, Mei; Li, Yan; Zeng, Jiawei; Li, Shu; Luan, Fujun; He, Yong; Dai, Hongying; Liu, Beizhong; Li, Hui; He, Lin; Xing, Qinghe

    2017-10-01

    We previously reported that three point mutations in SASH1 and mutated SASH1 promote melanocyte migration in dyschromatosis universalis hereditaria (DUH) and a novel p53/POMC/Gαs/SASH1 autoregulatory positive feedback loop is regulated by SASH1 mutations to induce pathological hyperpigmentation phenotype. However, the underlying mechanism of molecular regulation to cause this hyperpigmentation disorder still remains unclear. In this study, we aimed to investigate the molecular mechanism undergirding hyperpigmentation in the dyschromatosis disorder. Our results revealed that SASH1 binds with MAP2K2 and is induced by p53-POMC-MC1R signal cascade to enhance the phosphorylation level of ERK1/2 and CREB. Moreover, increase in phosphorylated ERK1/2 and CREB levels and melanogenesis-specific molecules is induced by mutated SASH1 alleles. Together, our results suggest that a novel SASH1/MAP2K2 crosstalk connects ERK1/2/CREB cascade with p53-POMC-MC1R cascade to cause hyperpigmentation phenotype of DUH. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  3. Molecular Insights into SIRT1 Protection Against UVB-Induced Skin Fibroblast Senescence by Suppression of Oxidative Stress and p53 Acetylation.

    PubMed

    Chung, Ki Wung; Choi, Yeon Ja; Park, Min Hi; Jang, Eun Ji; Kim, Dae Hyun; Park, Byung Hyun; Yu, Byung Pal; Chung, Hae Young

    2015-08-01

    Stresses, such as exposure to ultraviolet radiation and those associated with aging, are known to cause premature cellular senescence that is characterized by growth arrest and morphological and gene expression changes. This study was designed to investigate the protective effect of Sirtuin1 (SIRT1) on the UVB-induced premature senescence. Under in vitro experimental conditions, exposure to a subcytotoxic dose of UVB enhanced human skin fibroblasts senescence, as characterized by increased β-galactosidase activity and increased levels of senescence-associated proteins. However, adenovirus-mediated SIRT1 overexpression significantly protected fibroblasts from UVB-induced cellular deterioration. Exposure to UVB-induced cell senescence was associated with oxidative stress and p38 mitogen-activated protein kinase activation. Molecular analysis demonstrated that deacetylation of Forkhead box O3α (FOXO3α) by SIRT1 changed the transcriptional activity of FOXO3α and increased resistance to the oxidative stress. In addition, SIRT1 suppressed UVB-induced p53 acetylation and its transcriptional activity, which directly affected the cell cycle arrest induced by UVB. Further study demonstrated that SIRT1 activation inhibited cell senescence in the skin of the HR1 hairless mouse exposed to UVB. The study identifies a new role for SIRT1 in the UVB-induced senescence of skin fibroblats and provides a potential target for skin protection through molecuar insights into the mechanisms responsible for UVB-induced photoaging. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. p21 is Responsible for Ionizing Radiation-induced Bypass of Mitosis.

    PubMed

    Zhang, Xu Rui; Liu, Yong Ai; Sun, Fang; Li, He; Lei, Su Wen; Wang, Ju Fang

    2016-07-01

    To explore the role of p21 in ionizing radiation-induced changes in protein levels during the G2/M transition and long-term G2 arrest. Protein expression levels were assessed by western blot in the human uveal melanoma 92-1 cells after treatment with ionizing radiation. Depletion of p21 was carried out by employing the siRNA technique. Cell cycle distribution was determined by flow cytometry combined with histone H3 phosphorylation at Ser28, an M-phase marker. Senescence was assessed by senescence- associated-β-galactosidase (SA-β-gal) staining combined with Ki67 staining, a cell proliferation marker. Accompanying increased p21, the protein levels of G2/M transition genes declined significantly in 92-1 cells irradiated with 5 Gy of X-rays. Furthermore, these irradiated cells were blocked at the G2 phase followed by cellular senescence. Depletion of p21 rescued radiation-induced G2 arrest as demonstrated by the upregulation of G2/M transition kinases, as well as the high expression of histone H3 phosphorylated at Ser28. Knockdown of p21 resulted in entry into mitosis of irradiated 92-1 cells. However, cells with serious DNA damage failed to undergo cytokinesis, leading to the accumulation of multinucleated cells. Our results indicated that p21 was responsible for the downregulation of G2/M transition regulatory proteins and the bypass of mitosis induced by irradiation. Downregulation of p21 by siRNA resulted in G2-arrested cells entering into mitosis with serious DNA damage. This is the first report on elucidating the role of p21 in the bypass of mitosis. Copyright © 2016 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  5. Novel Pactamycin Analogs Induce p53 Dependent Cell-Cycle Arrest at S-Phase in Human Head and Neck Squamous Cell Carcinoma (HNSCC) Cells

    PubMed Central

    Guha, Gunjan; Liang, Xiaobo; Kulesz-Martin, Molly F.; Mahmud, Taifo; Indra, Arup Kumar; Ganguli-Indra, Gitali

    2015-01-01

    Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and 7-demethyl-7-deoxypactamycin (TM-026), in head and neck squamous cell carcinoma (HNSCC) cell lines SCC25 and SCC104. Both TM-025 and TM-026 exert growth inhibitory effects on HNSCC cells by inhibiting cell proliferation. Interestingly, unlike their parent compound pactamycin, the analogs do not inhibit synthesis of nascent protein in a cell-based assay. Furthermore, they do not induce apoptosis or autophagy in a dose- or a time-dependent manner, but induce mild senescence in the tested cell lines. Cell cycle analysis demonstrated that both analogs significantly induce cell cycle arrest of the HNSCC cells at S-phase resulting in reduced accumulation of G2/M-phase cells. The pactamycin analogs induce expression of cell cycle regulatory proteins including master regulator p53, its downstream target p21Cip1/WAF1, p27kip21, p19, cyclin E, total and phospho Cdc2 (Tyr15) and Cdc25C. Besides, the analogs mildly reduce cyclin D1 expression without affecting expression of cyclin B, Cdk2 and Cdk4. Specific inhibition of p53 by pifithrin-α reduces the percentage of cells accumulated in S-phase, suggesting contribution of p53 to S-phase increase. Altogether, our results demonstrate that Pactamycin analogs TM-025 and TM-026 induce senescence and inhibit proliferation of HNSCC cells via accumulation in S-phase through possible contribution of p53. The two PCT analogs can be widely used as research tools for cell cycle inhibition studies in proliferating cancer cells with specific mechanisms of action. PMID:25938491

  6. Roles of HAUSP-mediated p53 regulation in central nervous system development.

    PubMed

    Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W

    2011-08-01

    The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.

  7. GUCY2C Signaling Opposes the Acute Radiation-Induced GI Syndrome.

    PubMed

    Li, Peng; Wuthrick, Evan; Rappaport, Jeff A; Kraft, Crystal; Lin, Jieru E; Marszalowicz, Glen; Snook, Adam E; Zhan, Tingting; Hyslop, Terry M; Waldman, Scott A

    2017-09-15

    High doses of ionizing radiation induce acute damage to epithelial cells of the gastrointestinal (GI) tract, mediating toxicities restricting the therapeutic efficacy of radiation in cancer and morbidity and mortality in nuclear disasters. No approved prophylaxis or therapy exists for these toxicities, in part reflecting an incomplete understanding of mechanisms contributing to the acute radiation-induced GI syndrome (RIGS). Guanylate cyclase C (GUCY2C) and its hormones guanylin and uroguanylin have recently emerged as one paracrine axis defending intestinal mucosal integrity against mutational, chemical, and inflammatory injury. Here, we reveal a role for the GUCY2C paracrine axis in compensatory mechanisms opposing RIGS. Eliminating GUCY2C signaling exacerbated RIGS, amplifying radiation-induced mortality, weight loss, mucosal bleeding, debilitation, and intestinal dysfunction. Durable expression of GUCY2C, guanylin, and uroguanylin mRNA and protein by intestinal epithelial cells was preserved following lethal irradiation inducing RIGS. Oral delivery of the heat-stable enterotoxin (ST), an exogenous GUCY2C ligand, opposed RIGS, a process requiring p53 activation mediated by dissociation from MDM2. In turn, p53 activation prevented cell death by selectively limiting mitotic catastrophe, but not apoptosis. These studies reveal a role for the GUCY2C paracrine hormone axis as a novel compensatory mechanism opposing RIGS, and they highlight the potential of oral GUCY2C agonists (Linzess; Trulance) to prevent and treat RIGS in cancer therapy and nuclear disasters. Cancer Res; 77(18); 5095-106. ©2017 AACR . ©2017 American Association for Cancer Research.

  8. Synergy between Prkdc and Trp53 regulates stem cell proliferation and GI-ARS after irradiation.

    PubMed

    Gurley, Kay E; Ashley, Amanda K; Moser, Russell D; Kemp, Christopher J

    2017-11-01

    Ionizing radiation (IR) is one of the most widely used treatments for cancer. However, acute damage to the gastrointestinal tract or gastrointestinal acute radiation syndrome (GI-ARS) is a major dose-limiting side effect, and the mechanisms that underlie this remain unclear. Here we use mouse models to explore the relative roles of DNA repair, apoptosis, and cell cycle arrest in radiation response. IR induces DNA double strand breaks and DNA-PK mutant Prkdc scid/scid mice are sensitive to GI-ARS due to an inability to repair these breaks. IR also activates the tumor suppressor p53 to trigger apoptotic cell death within intestinal crypt cells and p53 deficient mice are resistant to apoptosis. To determine if DNA-PK and p53 interact to govern radiosensitivity, we compared the response of single and compound mutant mice to 8 Gy IR. Compound mutant Prkdc scid/scid /Trp53 -/- mice died earliest due to severe GI-ARS. While both Prkdc scid/scid and Prkdc scid/scid /Trp53 -/- mutant mice had higher levels of IR-induced DNA damage, particularly within the stem cell compartment of the intestinal crypt, in Prkdc scid/scid /Trp53 -/- mice these damaged cells abnormally progressed through the cell cycle resulting in mitotic cell death. This led to a loss of Paneth cells and a failure to regenerate the differentiated epithelial cells required for intestinal function. IR-induced apoptosis did not correlate with radiosensitivity. Overall, these data reveal that DNA repair, mediated by DNA-PK, and cell cycle arrest, mediated by p53, cooperate to protect the stem cell niche after DNA damage, suggesting combination approaches to modulate both pathways may be beneficial to reduce GI-ARS. As many cancers harbor p53 mutations, this also suggests targeting DNA-PK may be effective to enhance sensitivity of p53 mutant tumors to radiation.

  9. Hydroquinone induces TK6 cell growth arrest and apoptosis through PARP-1/p53 regulatory pathway.

    PubMed

    Luo, Hao; Liang, Hairong; Chen, Jiajia; Xu, Yongchun; Chen, Yuting; Xu, Longmei; Yun, Lin; Liu, Jiaxian; Yang, Hui; Liu, Linhua; Peng, Jianming; Liu, Zhidong; Tang, Lin; Chen, Wen; Tang, Huanwen

    2017-09-01

    Hydroquinone (HQ), one of the most important metabolites derived from benzene, induces cell cycle arrest and apoptosis. Poly(ADP-ribose) polymerase-1 (PARP-1) participates in various biological processes, including DNA repair and cell cycle regulation. To explore whether PARP-1 regulatory pathway mediated HQ-induced cell cycle arrest and apoptosis, we assessed the effect of PARP-1 suppression on induction of apoptosis analyzed by FACSCalibur flow cytometer in PARP-1 deficientTK6 cells (TK6-shPARP-1). We observed an increase in the fraction of cells in G1 phase by 7.6% and increased apoptosis by 4.5% in PARP-1-deficient TK6 cells (TK6-shPARP-1) compared to those negative control cells (TK6-shNC cells) in response to HQ treatment. Furthermore, HQ might activate the extrinsic pathways of apoptosis via up-regulation of Fas expression, followed by caspase-3 activation, apoptotic body, and sub G1 accumulation. Enhanced p53 expression was observed in TK6-shPARP-1 cells than in TK6-shNC cells after HQ treatment. In contrast, Fas expression was lower in TK6-shPARP-1 cells than in TK6-shNC cells. Therefore, we conclude that HQ may activate apoptotic signals via Fas up-regulation and p53-mediated apoptosis in TK6-shNC cells. The reduction of PARP-1 expression further intensified up-regulation of p53 in TK6-shPARP-1 cells, resulting in an increased G1→S phase cell arrest and apoptosis in TK6-shPARP-1 cells compared to TK6-shNC cells. © 2017 Wiley Periodicals, Inc.

  10. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

  11. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  12. SCO2 induces p53-mediated apoptosis by Thr845 phosphorylation of ASK-1 and dissociation of the ASK-1-Trx complex.

    PubMed

    Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam

    2013-04-01

    p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.

  13. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

  14. Expression of the p53 target CDIP correlates with sensitivity to TNFα-induced apoptosis in cancer cells.

    PubMed

    Brown-Endres, Lauren; Schoenfeld, David; Tian, Fang; Kim, Hyung-Gu; Namba, Takushi; Muñoz-Fontela, César; Mandinova, Anna; Aaronson, Stuart A; Lee, Sam W

    2012-05-01

    TNFα is a pleiotropic cytokine that signals for both survival and apoptotic cell fates. It is still unclear that the dual role of TNFα can be regulated in cancer cells. We previously described an apoptotic pathway involving p53→CDIP→TNFα that was activated in response to genotoxic stress. This pathway operated in the presence of JNK activation; therefore, we postulated that CDIP itself could sensitize cells to a TNFα apoptotic cell fate, survival, or death. We show that CDIP mediates sensitivity to TNFα-induced apoptosis and that cancer cells with endogenous CDIP expression are inherently sensitive to the growth-suppressive effects of TNFα in vitro and in vivo. Thus, CDIP expression correlates with sensitivity of cancer cells with TNFα, and CDIP seems to be a regulator of the p53-mediated death versus survival response of cells to TNFα. This CDIP-mediated sensitivity to TNFα-induced apoptosis favors pro- over antiapoptotic program in cancer cells, and CDIP may serve as a predictive biomarker for such sensitivity. ©2012 AACR

  15. Flavonoids in Ginkgo biloba fallen leaves induce apoptosis through modulation of p53 activation in melanoma cells.

    PubMed

    Park, Hye-Jung; Kim, Moon-Moo

    2015-01-01

    The aim of the present study was to examine the apoptotic effect of flavonoids in methanol extracts of Ginkgo biloba fallen leaves (MEGFL) on melanoma cells. Ginkgo biloba is a deciduous castle chaplain and its leaves include various types of flavonoids such as flavonol-O-glycosides. Ginkgo biloba is known to have therapeutic properties against a number of diseases such as cerebrovascular diseases, blood circulation disease and hypertension. In the present study MEGFL exhibited a higher cytotoxic effect on melanoma cells than Ginkgo biloba leaves (MEGL). It was also found that MEGFL induced apoptotic cell death which was characterized by DNA fragmentation. During the cell death process following treatment with MEGFL, the expression of a variety of death-associated proteins including p53, caspase-3, caspase-9, cytochrome c and Bax were analyzed in the cytosol of melanoma cells. MEGFL significantly increased the expression levels of caspase-3, caspase-9 and p53 in a dose-dependent manner. Our results indicate that MEGFL induced apoptotic cell death by increasing the expression of cell death-associated proteins in melanoma cells.

  16. Radiation induces premature chromatid separation via the miR-142-3p/Bod1 pathway in carcinoma cells.

    PubMed

    Pan, Dong; Du, Yarong; Ren, Zhenxin; Chen, Yaxiong; Li, Xiaoman; Wang, Jufang; Hu, Burong

    2016-09-13

    Radiation-induced genomic instability plays a vital role in carcinogenesis. Bod1 is required for proper chromosome biorientation, and Bod1 depletion increases premature chromatid separation. MiR-142-3p influences cell cycle progression and inhibits proliferation and invasion in cervical carcinoma cells. We found that radiation induced premature chromatid separation and altered miR-142-3p and Bod1 expression in 786-O and A549 cells. Overexpression of miR-142-3p increased premature chromatid separation and G2/M cell cycle arrest in 786-O cells by suppressing Bod1 expression. We also found that either overexpression of miR-142-3p or knockdown of Bod1 sensitized 786-O and A549 cells to X-ray radiation. Overexpression of Bod1 inhibited radiation- and miR-142-3p-induced premature chromatid separation and increased resistance to radiation in 786-O and A549 cells. Taken together, these results suggest that radiation alters miR-142-3p and Bod1 expression in carcinoma cells, and thus contributes to early stages of radiation-induced genomic instability. Combining ionizing radiation with epigenetic regulation may help improve cancer therapies.

  17. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    PubMed

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  18. The Isoforms of the p53 Protein

    PubMed Central

    Khoury, Marie P.; Bourdon, Jean-Christophe

    2010-01-01

    p53 is a transcription factor with a key role in the maintenance of genetic stability and therefore preventing cancer formation. It belongs to a family of genes composed of p53, p63, and p73. The p63 and p73 genes have a dual gene structure with an internal promoter in intron-3 and together with alternative splicing, can express 6 and 29 mRNA variants, respectively. Such a complex expression pattern had not been previously described for the p53 gene, which was not consistent with our understanding of the evolution of the p53 gene family. Consequently, we revisited the human p53 gene structure and established that it encodes nine different p53 protein isoforms because of alternative splicing, alternative promoter usage, and alternative initiation sites of translation. Therefore, the human p53 gene family (p53, p63, and p73) has a dual gene structure. We determined that the dual gene structure is conserved in Drosophila and in zebrafish p53 genes. The conservation through evolution of the dual gene structure suggests that the p53 isoforms play an important role in p53 tumor-suppressor activity. We and others have established that the p53 isoforms can regulate cell-fate outcome in response to stress, by modulating p53 transcriptional activity in a promoter and stress-dependent manner. We have also shown that the p53 isoforms are abnormally expressed in several types of human cancers, suggesting that they play an important role in cancer formation. The determination of p53 isoforms' expression may help to link clinical outcome to p53 status and to improve cancer patient treatment. PMID:20300206

  19. Dietary eicosapentaenoic acid prevents systemic immunosuppression in mice induced by UVB radiation.

    PubMed

    Moison, R M; Beijersbergen Van Henegouwen, G M

    2001-07-01

    Moison, R. M. W. and Beijersbergen van Henegouwen, G. M. J. Dietary Eicosapentaenoic Acid Prevents Systemic Immunosuppression in Mice Induced by UVB Radiation. Radiat. Res. 156, 36-44 (2001). Reactive oxygen species (ROS) contribute to the immunosuppression induced by UVB radiation. Omega-3 fatty acids in fish oil, e.g. eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), can modulate immunoresponsiveness, but because of their susceptibility to ROS-induced damage, they can also challenge the epidermal antioxidant defense system. The influence of dietary supplementation with different omega-3 fatty acids on systemic immunosuppression induced in mice by UVB radiation was studied using the contact hypersensitivity response to trinitrochlorobenzene. In an attempt to study the mechanisms involved, UVB-radiation-induced changes in epidermal antioxidant status were also studied. Mice received high-fat (25% w/w) diets enriched with either oleic acid (control diet), EPA, DHA, or EPA + DHA (MaxEPA). Immunosuppression induced by UVB radiation was 53% in mice fed the oleic acid diet and 69% in mice fed the DHA diet. In contrast, immunosuppression was only 4% and 24% in mice fed the EPA and MaxEPA diets, respectively. Increased lipid peroxidation and decreased vitamin E levels (P < 0.05) were found in unirradiated mice fed the MaxEPA and DHA diets. For all diets, exposure to UVB radiation increased lipid peroxidation (P < 0.05), but levels of glutathione (P < 0.05) and vitamin C (P > 0.05) decreased only in the mice given fish oil. UVB irradiation did not influence vitamin E levels. In conclusion, dietary EPA, but not DHA, protects against UVB-radiation-induced immunosuppression in mice. The degree of protection appears to be related to the amount of EPA incorporated and the ability of the epidermis to maintain an adequate antioxidant level after irradiation.

  20. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

    PubMed

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-09-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

  1. p53 activated by AND gate genetic circuit under radiation and hypoxia for targeted cancer gene therapy

    PubMed Central

    Ding, Miao; Li, Rong; He, Rong; Wang, Xingyong; Yi, Qijian; Wang, Weidong

    2015-01-01

    Radio-activated gene therapy has been developed as a novel therapeutic strategy against cancer; however, expression of therapeutic gene in peritumoral tissues will result in unacceptable toxicity to normal cells. To restrict gene expression in targeted tumor mass, we used hypoxia and radiation tolerance features of tumor cells to develop a synthetic AND gate genetic circuit through connecting radiation sensitivity promoter cArG6, heat shock response elements SNF1, HSF1 and HSE4 with retroviral vector plxsn. Their construction and dynamic activity process were identified through downstream enhanced green fluorescent protein and wtp53 expression in non-small cell lung cancer A549 cells and in a nude mice model. The result showed that AND gate genetic circuit could be activated by lower required radiation dose (6 Gy) and after activated, AND gate could induce significant apoptosis effects and growth inhibition of cancer cells in vitro and in vivo. The radiation- and hypoxia-activated AND gate genetic circuit, which could lead to more powerful target tumoricidal activity represented a promising strategy for both targeted and effective gene therapy of human lung adenocarcinoma and low dose activation character of the AND gate genetic circuit implied that this model could be further exploited to decrease side-effects of clinical radiation therapy. PMID:26177264

  2. p53 activated by AND gate genetic circuit under radiation and hypoxia for targeted cancer gene therapy.

    PubMed

    Ding, Miao; Li, Rong; He, Rong; Wang, Xingyong; Yi, Qijian; Wang, Weidong

    2015-09-01

    Radio-activated gene therapy has been developed as a novel therapeutic strategy against cancer; however, expression of therapeutic gene in peritumoral tissues will result in unacceptable toxicity to normal cells. To restrict gene expression in targeted tumor mass, we used hypoxia and radiation tolerance features of tumor cells to develop a synthetic AND gate genetic circuit through connecting radiation sensitivity promoter cArG6 , heat shock response elements SNF1, HSF1 and HSE4 with retroviral vector plxsn. Their construction and dynamic activity process were identified through downstream enhanced green fluorescent protein and wtp53 expression in non-small cell lung cancer A549 cells and in a nude mice model. The result showed that AND gate genetic circuit could be activated by lower required radiation dose (6 Gy) and after activated, AND gate could induce significant apoptosis effects and growth inhibition of cancer cells in vitro and in vivo. The radiation- and hypoxia-activated AND gate genetic circuit, which could lead to more powerful target tumoricidal activity represented a promising strategy for both targeted and effective gene therapy of human lung adenocarcinoma and low dose activation character of the AND gate genetic circuit implied that this model could be further exploited to decrease side-effects of clinical radiation therapy. © 2015 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

  3. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    PubMed Central

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  4. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  5. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed Central

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar

    2017-01-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941

  6. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

    PubMed Central

    Rubbi, Carlos P.; Milner, Jo

    2003-01-01

    p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

  7. Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

    PubMed Central

    Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

    2011-01-01

    Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

  8. Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes

    PubMed Central

    Chang, Jae Won; Park, Keun Hyung; HWANG, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

    2014-01-01

    Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways. PMID:24078877

  9. Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes.

    PubMed

    Chang, Jae Won; Park, Keun Hyung; Hwang, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

    2014-03-01

    Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways.

  10. p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

    PubMed

    Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

    2001-11-09

    Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

  11. Ultraviolet radiation accelerates BRAF-driven melanomagenesis by targeting TP53

    PubMed Central

    Rae, Joel; Hogan, Kate; Ejiama, Sarah; Girotti, Maria Romina; Cook, Martin; Dhomen, Nathalie; Marais, Richard

    2014-01-01

    Cutaneous melanoma is epidemiologically linked to ultraviolet radiation (UVR), but the molecular mechanisms by which UVR drives melanomagenesis remain unclear1,2. The most common somatic mutation in melanoma is a V600E substitution in BRAF, which is an early event3. To investigate how UVR accelerates oncogenic BRAF-driven melanomagenesis, we used a V600EBRAF mouse model. In mice expressing V600EBRAF in their melanocytes, a single dose of UVR that mimicked mild sunburn in humans induced clonal expansion of the melanocytes, and repeated doses of UVR increased melanoma burden. We show that sunscreen (UVA superior: UVB SPF50) delayed the onset of UVR-driven melanoma, but only provided partial protection. The UVR-exposed tumours presented increased numbers of single nucleotide variants (SNVs) and we observed mutations (H39Y, S124F, R245C, R270C, C272G) in the Trp53 tumour suppressor in ~40% of cases. TP53 is an accepted UVR target in non-melanoma skin cancer, but is not thought to play a major role in melanoma4. However, we show that mutant Trp53 accelerated V600EBRAF-driven melanomagenesis and that TP53 mutations are linked to evidence of UVR-induced DNA damage in human melanoma. Thus, we provide mechanistic insight into epidemiological data linking UVR to acquired naevi in humans5. We identify TP53/Trp53 as a UVR-target gene that cooperates with V600EBRAF to induce melanoma, providing molecular insight into how UVR accelerates melanomagenesis. Our study validates public health campaigns that promote sunscreen protection for individuals at risk of melanoma. PMID:24919155

  12. Selective activation of p53-mediated tumour suppression in high-grade tumours.

    PubMed

    Junttila, Melissa R; Karnezis, Anthony N; Garcia, Daniel; Madriles, Francesc; Kortlever, Roderik M; Rostker, Fanya; Brown Swigart, Lamorna; Pham, David M; Seo, Youngho; Evan, Gerard I; Martins, Carla P

    2010-11-25

    Non-small cell lung carcinoma (NSCLC) is the leading cause of cancer-related death worldwide, with an overall 5-year survival rate of only 10-15%. Deregulation of the Ras pathway is a frequent hallmark of NSCLC, often through mutations that directly activate Kras. p53 is also frequently inactivated in NSCLC and, because oncogenic Ras can be a potent trigger of p53 (ref. 3), it seems likely that oncogenic Ras signalling has a major and persistent role in driving the selection against p53. Hence, pharmacological restoration of p53 is an appealing therapeutic strategy for treating this disease. Here we model the probable therapeutic impact of p53 restoration in a spontaneously evolving mouse model of NSCLC initiated by sporadic oncogenic activation of endogenous Kras. Surprisingly, p53 restoration failed to induce significant regression of established tumours, although it did result in a significant decrease in the relative proportion of high-grade tumours. This is due to selective activation of p53 only in the more aggressive tumour cells within each tumour. Such selective activation of p53 correlates with marked upregulation in Ras signal intensity and induction of the oncogenic signalling sensor p19(ARF)( )(ref. 6). Our data indicate that p53-mediated tumour suppression is triggered only when oncogenic Ras signal flux exceeds a critical threshold. Importantly, the failure of low-level oncogenic Kras to engage p53 reveals inherent limits in the capacity of p53 to restrain early tumour evolution and in the efficacy of therapeutic p53 restoration to eradicate cancers.

  13. Bax/Bak activation in the absence of Bid, Bim, Puma, and p53

    PubMed Central

    Zhang, J; Huang, K; O'Neill, K L; Pang, X; Luo, X

    2016-01-01

    How BH3-only proteins activate Bax/Bak, the two gateway proteins of the mitochondria-dependent apoptotic pathway, remains incompletely understood. Although all pro-apoptotic BH3-only proteins are known to bind/neutralize the anti-apoptotic Bcl-2 proteins, the three most potent ones, Bid (tBid), Bim, and Puma, possess an additional activity of directly activating Bax/Bak in vitro. This latter activity has been proposed to be responsible for triggering Bax/Bak activation following apoptotic stimulation. To test this hypothesis, we generated Bid−/−Bim−/−Puma−/− (TKO), TKO/Bax−/−/Bak−/− (PentaKO), and PentaKO/Mcl-1−/− (HexaKO) HCT116 cells through gene editing. Surprisingly, although the TKO cells were resistant to several apoptotic stimuli, robust apoptosis was induced upon the simultaneous inactivation of Bcl-xL and Mcl-1, two anti-apoptotic Bcl-2 proteins known to suppress Bax/Bak activation and activity. Importantly, such apoptotic activity was completely abolished in the PentaKO cells. In addition, ABT-737, a BH3 mimetic that inhibits Bcl-xL/Bcl-w/Bcl-2, induced Bax activation in HexaKO cells reconstituted with endogenous level of GFP-Bax. Further, by generating TKO/p53−/− (QKO) cells, we demonstrated that p53, a tumor suppressor postulated to directly activate Bax, is not required for Bid/Bim/Puma-independent Bax/Bak activation. Together, these results strongly suggest that the direct activation activities of Bid (tBid), Bim, Puma, and p53 are not essential for activating Bax/Bak once the anti-apoptotic Bcl-2 proteins are neutralized. PMID:27310874

  14. MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

    PubMed

    Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

    2018-04-17

    The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

  15. β-Sitosterol targets Trx/Trx1 reductase to induce apoptosis in A549 cells via ROS mediated mitochondrial dysregulation and p53 activation.

    PubMed

    Rajavel, Tamilselvam; Packiyaraj, Pandian; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar; Ruckmani, Kandasamy; Pandima Devi, Kasi

    2018-02-01

    β-Sitosterol (BS), a major bioactive constituent present in plants and vegetables has shown potent anticancer effect against many human cancer cells, but the underlying mechanism remain elusive on NSCLC cancers. We found that BS significantly inhibited the growth of A549 cells without harming normal human lung and PBMC cells. Further, BS treatment triggered apoptosis via ROS mediated mitochondrial dysregulation as evidenced by caspase-3 & 9 activation, Annexin-V/PI positive cells, PARP inactivation, loss of MMP, Bcl-2-Bax ratio alteration and cytochrome c release. Moreover, generation of ROS species and subsequent DNA stand break were found upon BS treatment which was reversed by addition of ROS scavenger (NAC). Indeed BS treatment increased p53 expression and its phosphorylation at Ser15, while silencing the p53 expression by pifithrin-α, BS induced apoptosis was reduced in A549 cells. Furthermore, BS induced apoptosis was also observed in NCI-H460 cells (p53 wild) but not in the NCI-H23 cells (p53 mutant). Down-regulation of Trx/Trx1 reductase contributed to the BS induced ROS accumulation and mitochondrial mediated apoptotic cell death in A549 and NCI-H460 cells. Taken together, our findings provide evidence for the novel anti-cancer mechanism of BS which could be developed as a promising chemotherapeutic drug against NSCLC cancers.

  16. Mutations in TP53 and JAK2 are independent prognostic biomarkers in B-cell precursor acute lymphoblastic leukaemia.

    PubMed

    Forero-Castro, Maribel; Robledo, Cristina; Benito, Rocío; Bodega-Mayor, Irene; Rapado, Inmaculada; Hernández-Sánchez, María; Abáigar, María; Maria Hernández-Sánchez, Jesús; Quijada-Álamo, Miguel; María Sánchez-Pina, José; Sala-Valdés, Mónica; Araujo-Silva, Fernanda; Kohlmann, Alexander; Luis Fuster, José; Arefi, Maryam; de Las Heras, Natalia; Riesco, Susana; Rodríguez, Juan N; Hermosín, Lourdes; Ribera, Jordi; Camos Guijosa, Mireia; Ramírez, Manuel; de Heredia Rubio, Cristina Díaz; Barragán, Eva; Martínez, Joaquín; Ribera, José M; Fernández-Ruiz, Elena; Hernández-Rivas, Jesús-María

    2017-07-11

    In B-cell precursor acute lymphoblastic leukaemia (B-ALL), the identification of additional genetic alterations associated with poor prognosis is still of importance. We determined the frequency and prognostic impact of somatic mutations in children and adult cases with B-ALL treated with Spanish PETHEMA and SEHOP protocols. Mutational status of hotspot regions of TP53, JAK2, PAX5, LEF1, CRLF2 and IL7R genes was determined by next-generation deep sequencing in 340 B-ALL patients (211 children and 129 adults). The associations between mutation status and clinicopathological features at the time of diagnosis, treatment outcome and survival were assessed. Univariate and multivariate survival analyses were performed to identify independent prognostic factors associated with overall survival (OS), event-free survival (EFS) and relapse rate (RR). A mutation rate of 12.4% was identified. The frequency of adult mutations was higher (20.2% vs 7.6%, P=0.001). TP53 was the most frequently mutated gene (4.1%), followed by JAK2 (3.8%), CRLF2 (2.9%), PAX5 (2.4%), LEF1 (0.6%) and IL7R (0.3%). All mutations were observed in B-ALL without ETV6-RUNX1 (P=0.047) or BCR-ABL1 fusions (P<0.0001). In children, TP53mut was associated with lower OS (5-year OS: 50% vs 86%, P=0.002) and EFS rates (5-year EFS: 50% vs 78.3%, P=0.009) and higher RR (5-year RR: 33.3% vs 18.6% P=0.037), and was independently associated with higher RR (hazard ratio (HR)=4.5; P=0.04). In adults, TP53mut was associated with a lower OS (5-year OS: 0% vs 43.3%, P=0.019) and a higher RR (5-year RR: 100% vs 61.4%, P=0.029), whereas JAK2mut was associated with a lower EFS (5-year EFS: 0% vs 30.6%, P=0.035) and a higher RR (5-year RR: 100% vs 60.4%, P=0.002). TP53mut was an independent risk factor for shorter OS (HR=2.3; P=0.035) and, together with JAK2mut, also were independent markers of poor prognosis for RR (TP53mut: HR=5.9; P=0.027 and JAK2mut: HR=5.6; P=0.036). TP53mut and JAK2mut are potential biomarkers associated

  17. BTK blocks the inhibitory effects of MDM2 on p53 activity

    PubMed Central

    Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

    2017-01-01

    p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

  18. Nucleophosmin regulates the stability and transcriptional activity of p53.

    PubMed

    Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

    2002-07-01

    Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

  19. The Parkinson disease-related protein DJ-1 counteracts mitochondrial impairment induced by the tumour suppressor protein p53 by enhancing endoplasmic reticulum-mitochondria tethering.

    PubMed

    Ottolini, Denis; Calì, Tito; Negro, Alessandro; Brini, Marisa

    2013-06-01

    DJ-1 was first identified as an oncogene. More recently, mutations in its gene have been found causative for autosomal recessive familial Parkinson disease. Numerous studies support the DJ-1 role in the protection against oxidative stress and maintenance of mitochondria structure; however, the mechanism of its protective function remains largely unknown. We investigated whether mitochondrial Ca(2+) homeostasis, a key parameter in cell physiology, could be a target for DJ-1 action. Here, we show that DJ-1 modulates mitochondrial Ca(2+) transients induced upon cell stimulation with an 1,4,5-inositol-tris-phosphate agonist by favouring the endoplasmic reticulum (ER)-mitochondria tethering. A reduction of DJ-1 levels results in mitochondria fragmentation and decreased mitochondrial Ca(2+) uptake in stimulated cells. To functionally couple these effects with the well-recognized cytoprotective role of DJ-1, we investigated its action in respect to the tumour suppressor p53. p53 overexpression in HeLa cells impairs their ability to accumulate Ca(2+) in the mitochondrial matrix, causes alteration of the mitochondrial morphology and reduces ER-mitochondria contact sites. Mitochondrial impairments are independent from Drp1 activation, since the co-expression of the dominant negative mutant of Drp1 failed to abolish them. DJ-1 overexpression prevents these alterations by re-establishing the ER-mitochondria tethering. Similarly, the co-expression of the pro-fusion protein Mitofusin 2 blocks the effects induced by p53 on mitochondria, confirming that the modulation of the ER-mitochondria contact sites is critical to mitochondria integrity. Thus, the impairment of ER-mitochondria communication, as a consequence of DJ-1 loss-of-function, may be detrimental for mitochondria-related processes and be at the basis of mitochondrial dysfunction observed in Parkinson disease.

  20. Wee1 Kinase Inhibitor AZD1775 Radiosensitizes Hepatocellular Carcinoma Regardless of TP53 Mutational Status Through Induction of Replication Stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuneo, Kyle C., E-mail: kcuneo@umich.edu; Morgan, Meredith A.; Davis, Mary A.

    2016-06-01

    Purpose: Wee1 kinase inhibitors are effective radiosensitizers in cells lacking a G{sub 1} checkpoint. In this study we examined the potential effect of Wee1 kinase inhibition on inducing replication stress in hepatocellular carcinoma (HCC). Methods and Materials: Five independent datasets from the Oncomine database comparing gene expression in HCC compared to normal tissue were combined and specific markers associated with Wee1 sensitivity were analyzed. We then performed a series of in vitro experiments to study the effect of Wee1 inhibition on irradiated HCC cell lines with varying p53 mutational status. Clonogenic survival assays and flow cytometry using anti-γH2AX and phospho-histone H3more » antibodies with propidium iodide were performed to study the effect of AZD1775 on survival, cell cycle, and DNA repair. Additionally, nucleoside enriched medium was used to examine the effect of altering nucleotide pools on Wee1 targeted radiation sensitization. Results: Our analysis of the Oncomine database found high levels of CDK1 and other cell cycle regulators indicative of Wee1 sensitivity in HCC. In our in vitro experiments, treatment with AZD1775 radiosensitized and chemosensitized Hep3B, Huh7, and HepG2 cell lines and was associated with delayed resolution of γH2AX foci and the induction of pan-nuclear γH2AX staining. Wee1 inhibition attenuated radiation-induced G{sub 2} arrest in the Hep3B (TP53 null) and Huh7 (TP53 mutant) cell lines but not in the TP53 wild-type cell line HepG2. Supplementation with nucleosides reversed the radiation-sensitizing effect of AZD1775 and reduced the amount of cells with pan-nuclear γH2AX staining after radiation. Conclusions: Radiation sensitization with Wee1 inhibition occurs in cells regardless of their p53 mutational status. In this study we show for the first time that replication stress via the overconsumption of nucleotides plays an important role in AZD1775-induced radiation sensitization.« less

  1. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae.

    PubMed

    Rhee, Jae-Sung; Kim, Bo-Mi; Kim, Ryeo-Ok; Seo, Jung Soo; Kim, Il-Chan; Lee, Young-Mi; Lee, Jae-Seong

    2013-09-15

    To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4Gy of radiation, and biochemical and molecular damage became substantial from 8Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

    PubMed

    Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

    1996-12-20

    In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

  3. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zonesmore » in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.« less

  4. Effects of the Kava Chalcone Flavokawain A Differ in Bladder Cancer Cells with Wild-type versus Mutant p53

    PubMed Central

    Tang, Yaxiong; Simoneau, Anne R.; Xie, Jun; Shahandeh, Babbak; Zi, Xiaolin

    2010-01-01

    Flavokawain A is the predominant chalcone from kava extract. We have assessed the mechanisms of flavokawain A's action on cell cycle regulation. In a p53 wild-type, low-grade, and papillary bladder cancer cell line (RT4), flavokawain A increased p21/WAF1 and p27/KIP1, which resulted in a decrease in cyclin-dependent kinase-2 (CDK2) kinase activity and subsequent G1 arrest. The increase of p21/WAF1 protein corresponded to an increased mRNA level, whereas p27/KIP1 accumulation was associated with the down-regulation of SKP2 and then increased the stability of the p27/KIP1 protein. The accumulation of p21/WAF1 and p27/KIP1 was independent of cell cycle position and thus not a result of the cell cycle arrest. In contrast, flavokawain A induced a G2-M arrest in six p53 mutant-type, high-grade bladder cancer cell lines (T24, UMUC3, TCCSUP, 5637, HT1376, and HT1197). Flavokawain A significantly reduced the expression of CDK1-inhibitory kinases, Myt1 and Wee1, and caused cyclin B1 protein accumulation leading to CDK1 activation in T24 cells. Suppression of p53 expression by small interfering RNA in RT4 cells restored Cdc25C expression and down-regulated p21/WAF1 expression, which allowed Cdc25C and CDK1 activation and then led to a G2-M arrest and an enhanced growth-inhibitory effect by flavokawain A. Consistently, flavokawain A also caused a pronounced CDK1 activation and G2-M arrest in p53 knockout but not in p53 wild-type HCT116 cells. This selectivity of flavokawain A for inducing a G2-M arrest in p53-defective cells deserves further investigation as a new mechanism for the prevention and treatment of bladder cancer. PMID:19138991

  5. p53-Based Strategy for Protection of Bone Marrow From Y-90 Ibritumomab Tiuxetan

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Su, Hang, E-mail: suh3@uthscsa.edu; Ganapathy, Suthakar; Li, Xiaolei

    Purpose: The main drawbacks of radioimmunotherapy have been severe hematological toxicity and potential development of myelodysplastic syndrome and secondary leukemia. Activation of p53 follows a major pathway by which normal tissues respond to DNA-damaging agents, such as chemotherapy and radiation therapy, that result in injuries and pathological consequences. This pathway is separate from the tumor suppressor pathway of p53. We have previously reported that use of low-dose arsenic (LDA) temporarily and reversibly suppresses p53 activation, thereby ameliorating normal tissue toxicity from exposure to 5-fluorouracil and X rays. We have also demonstrated that LDA-mediated protection requires functional p53 and thus ismore » selective to normal tissues, as essentially every cancer cell has dysfunctional p53. Here we tested the protective efficacy of LDA for bone marrow tissue against radioimmunotherapy through animal experiments. Methods and Materials: Mice were subjected to LDA pretreatment for 3 days, followed by treatment with Y-90 ibritumomab tiuxetan. Both dose course (10, 25, 50, 100, and 200 μCi) and time course (6, 24, and 72 hours and 1 and 2 weeks) experiments were performed. The response of bone marrow cells to LDA was determined by examining the expression of NFκB, Glut1, and Glut3. Staining with hematoxylin and eosin, γ-H2AX, and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) was used to examine morphology, DNA damage response, and apoptotic cell populations. Results: Elevated levels of NFκB, Glut1, and Glut3 were observed in bone marrow cells after LDA treatment. Bone marrow damage levels induced by Y-90 ibritumomab tiuxetan were greatly reduced by LDA pretreatment. Consistent with this observation, significantly less DNA damage and fewer apoptotic cells were accumulated after Y-90 ibritumomab tiuxetan treatment in LDA-pretreated mice. Furthermore, in the mouse xenograft model implanted with human Karpas-422 lymphoma

  6. Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

    PubMed

    Donehower, Lawrence A

    2014-06-01

    Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

  7. Acidic polysaccharide of Panax ginseng regulates the mitochondria/caspase-dependent apoptotic pathway in radiation-induced damage to the jejunum in mice.

    PubMed

    Bing, So Jin; Kim, Min Ju; Ahn, Ginnae; Im, Jaehak; Kim, Dae Seung; Ha, Danbee; Cho, Jinhee; Kim, Areum; Jee, Youngheun

    2014-04-01

    Owing to its susceptibility to radiation, the small intestine of mice is valuable for studying radioprotective effects. When exposed to radiation, intestinal crypt cells immediately go through apoptosis, which impairs swift differentiation necessary for the regeneration of intestinal villi. Our previous studies have elucidated that acidic polysaccharide of Panax ginseng (APG) protects the mouse small intestine from radiation-induced damage by lengthening villi with proliferation and repopulation of crypt cells. In the present study, we identified the molecular mechanism involved. C57BL/6 mice were irradiated with gamma-rays with or without APG and the expression levels of apoptosis-related molecules in the jejunum were investigated using immunohistochemistry. APG pretreatment strongly decreased the radiation-induced apoptosis in the jejunum. It increased the expression levels of anti-apoptotic proteins (Bcl-2 and Bcl-XS/L) and dramatically reduced the expression levels of pro-apoptotic proteins (p53, BAX, cytochrome c and caspase-3). Therefore, APG attenuated the apoptosis through the intrinsic pathway, which is controlled by p53 and Bcl-2 family members. Results presented in this study suggest that APG protects the mouse small intestine from irradiation-induced apoptosis through inhibition of the p53-dependent pathway and the mitochondria/caspase pathway. Thus, APG may be a potential agent for preventing radiation induced injuries in intestinal cells during radio-therapy such as in cancer treatment. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    PubMed

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  9. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together

  10. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  11. Drug Resistance to Inhibitors of the Human Double Minute-2 E3 Ligase is Mediated by Point Mutations of p53, but can be Overcome with the p53 Targeting Agent RITA

    PubMed Central

    Jones, Richard J.; Bjorklund, Chad C.; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J.; Orlowski, Robert Z.

    2012-01-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover, and has been validated pre-clinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, while Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA. HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor non-genotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G2/M arrest, up-regulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared to RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation. PMID:22933706

  12. Local activation of p53 in the tumor microenvironment overcomes immune suppression and enhances antitumor immunity

    PubMed Central

    Guo, Gang; Yu, Miao; Xiao, Wei; Celis, Esteban; Cui, Yan

    2017-01-01

    Mutations in tumor suppressor p53 remain a vital mechanism of tumor escape from apoptosis and senescence. Emerging evidence suggests that p53 dysfunction also fuels inflammation and supports tumor immune evasion, thereby serving as an immunological driver of tumorigenesis. Therefore, targeting p53 in the tumor microenvironment (TME) also represents an immunologically desirable strategy for reversing immunosuppression and enhancing antitumor immunity. Using a pharmacological p53 activator nutlin-3a, we show that local p53 activation in TME comprising overt tumor infiltrating leukocytes (TILeus) induces systemic antitumor immunity and tumor regression, but not in TME with scarce TILeus, such as B16 melanoma. Maneuvers that recruit leukocytes to TME, such as TLR3 ligand in B16 tumors, greatly enhanced nutlin-induced antitumor immunity and tumor control. Mechanistically, nutlin-3a-induced antitumor immunity was contingent on two non-redundant but immunologically synergistic p53-dependent processes: reversal of immunosuppression in TME and induction of tumor immunogenic cell death (ICD), leading to activation and expansion of polyfunctional CD8 CTLs and tumor regression. Our study demonstrates that unlike conventional tumoricidal therapies, which rely on effective p53 targeting in each tumor cell and often associate with systemic toxicity, this immune-based strategy requires only limited local p53 activation to alter the immune landscape of TME and subsequently amplify immune response to systemic antitumor immunity. Hence, targeting the p53 pathway in TME can be exploited to reverse immunosuppression and augment therapeutic benefits beyond tumoricidal effects to harness tumor-specific, durable, and systemic antitumor immunity with minimal toxicity. PMID:28280037

  13. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

    2016-10-15

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

  14. p53, Bcl-2 and cox-2 are involved in berberine hydrochloride-induced apoptosis of HeLa229 cells.

    PubMed

    Wang, Hai-Yan; Yu, Hai-Zhong; Huang, Sheng-Mou; Zheng, Yu-Lan

    2016-10-01

    The present study aimed to investigate the effects of berberine hydrochloride on the proliferation and apoptosis of HeLa229 human cervical cancer cells. A 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed to examine the cytotoxicity of berberine hydrochloride against HeLa229 cells. The effects of berberine hydrochloride on the apoptosis of HeLa229 cells was detected by immunofluorescence and flow cytometry, and the mRNA expression levels of p53, B‑cell lymphoma 2 (Bcl‑2) and cyclooxygenase‑2 (cox‑2) were analyzed by reverse transcription-quantitative polymerase chain reaction. Berberine hydrochloride inhibited the proliferation of HeLa229 cells in a dose‑dependent manner; minimum cell viability (3.61%) was detected following treatment with 215.164 µmol/l berberine hydrochloride and the half maximal inhibitory concentration value was 42.93 µmol/l following treatment for 72 h. In addition, berberine hydrochloride induced apoptosis in HeLa229 cells in a dose‑ and time‑dependent manner. Berberine hydrochloride upregulated the mRNA expression levels of p53, and downregulated mRNA expression levels of Bcl‑2 and cox‑2, in a dose‑dependent manner. In conclusion, berberine hydrochloride inhibited the proliferation and induced apoptosis of HeLa229 cells, potentially via the upregulation of p53 and the downregulation of Bcl‑2 and cox‑2 mRNA expression levels.

  15. Hsp70- and p53-reponses after heat treatment and/or X-irradiation mediate the susceptibility of hematopoietic cells to undergo apoptosis.

    PubMed

    Nijhuis, E H A; Poot, A A; Feijen, J; Vermes, I

    2008-02-01

    The effect of heat treatment in combination with X-irradiation was examined with regard to expression of p53, a tumor suppressor gene product, and Hsp70, a heat-shock protein, in association with the occurrence of programmed cell death (apoptosis). Three hematopoietic cell lines (HSB2, HL60 and Kasumi-1), which differ in p53 status, were exposed to 42.5 degrees C during one hour and/or X-radiation (total dose 8 Gy). After exposure, both mRNA and protein expression levels of Hsp70 and p53 were investigated by real-time PCR (polymerase chain reaction) and Western blotting. Apoptosis was simultaneously analyzed by observation of cell morphology as well as flowcytometric determination of Annexin V binding to phosphatidylserine and propidium iodide exclusion. Both HL60 and HSB2 cell lines with a low p53 status and a quick response to heat treatment with Hsp70 over-expression are less susceptible to heat-induced apoptosis compared to Kasumi-1 cells with wild-type p53 protein and no Hsp70 response. The combination of first applying X-irradiation followed by heat treatment resulted in the most effective induction of apoptosis due to impairment of the Hsp70 response in all three cell lines. These results indicate that the Hsp70 response and p53 status mediate the susceptibility of hematopoietic cells to undergo heat-induced apoptosis. Therefore, these parameters can be used as markers to predict the effectiveness of hyperthermia in cancer treatment.

  16. The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth

    PubMed Central

    Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V

    2007-01-01

    Somatotrophs are the only pituitary cells that express Ret, GFRα1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCδ, JNK, c/EBPα and CREB induced by a complex of Ret, caspase 3 and PKCδ. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas. PMID:17380130

  17. The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth.

    PubMed

    Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V

    2007-04-18

    Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.

  18. Expression of the p53 target CDIP correlates with sensitivity to TNF-alpha induced apoptosis in cancer cells

    PubMed Central

    Brown-Endres, Lauren; Schoenfeld, David; Tian, Fang; Kim, Hyung-Gu; Namba, Takushi; Muñoz-Fontela, César; Mandinova, Anna; Aaronson, Stuart A.; Lee, Sam W.

    2012-01-01

    TNFα is a pleiotropic cytokine that signals for both survival and apoptotic cell fates. It is still unclear that the dual role of TNFα can be regulated in cancer cells. We previously described an apoptotic pathway involving p53→CDIP→TNFα that was activated in response to genotoxic stress. This pathway operated in the presence of JNK activation; therefore, we postulated that CDIP itself could sensitize cells to a TNFα apoptotic cell fate, survival or death. We show that CDIP mediates sensitivity to TNFα-induced apoptosis, and that cancer cells with endogenous CDIP expression are inherently sensitive to the growth suppressive effects of TNFα in vitro and in vivo. Thus, CDIP expression correlates with sensitivity of cancer cells with TNFα, and CDIP appears to be a regulator of the p53-mediated death versus survival response of cells to TNFα. This CDIP-mediated sensitivity to TNFα-induced apoptosis favors pro-over anti-apoptotic program in cancer cells and CDIP may serve as a predictive biomarker for such sensitivity. PMID:22549949

  19. Chronic inflammation and cancer: potential chemoprevention through nuclear factor kappa B and p53 mutual antagonism

    PubMed Central

    2014-01-01

    Activation of nuclear factor-kappa B (NF- κB) as a mechanism of host defense against infection and stress is the central mediator of inflammatory responses. A normal (acute) inflammatory response is activated on urgent basis and is auto-regulated. Chronic inflammation that results due to failure in the regulatory mechanism, however, is largely considered as a critical determinant in the initiation and progression of various forms of cancer. Mechanistically, NF- κB favors this process by inducing various genes responsible for cell survival, proliferation, migration, invasion while at the same time antagonizing growth regulators including tumor suppressor p53. It has been shown by various independent investigations that a down regulation of NF- κB activity directly, or indirectly through the activation of the p53 pathway reduces tumor growth substantially. Therefore, there is a huge effort driven by many laboratories to understand the NF- κB signaling pathways to intervene the function of this crucial player in inflammation and tumorigenesis in order to find an effective inhibitor directly, or through the p53 tumor suppressor. We discuss here on the role of NF- κB in chronic inflammation and cancer, highlighting mutual antagonism between NF- κB and p53 pathways in the process. We also discuss prospective pharmacological modulators of these two pathways, including those that were already tested to affect this mutual antagonism. PMID:25152696

  20. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and