Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

PubMed

Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

2007-06-01

The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

Normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1997-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1997-06-10

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Transduction of human IL-9 receptor cDNA into TF1 cells induces IL-9 dependency and erythroid differentiation.

PubMed

Xiao, M; Luo, Z; Mantel, C; Broxmeyer, H E; Lu, L

2000-02-01

Human growth factor-dependent cell line TF1, which lacks interleukin (IL)-9 receptors (R) and does not grow in IL-9, was transduced with a retroviral vector containing human IL-9R cDNA and a selection marker. An IL-9-dependent TF1 cell line, which could also grow in other cytokines, was established after selection in G418 and could produce mature RBC in response to cytokine stimulation. TF1 cells transduced with the same viral vector without the IL-9R insert cDNA (mock control) and then selected responded the same as nontransduced TF1 cells. They failed to grow in response to IL-9 and did not generate RBC. An increased number and size of burst-forming units-erythroid (BFU-E)-like colonies were detected from IL-9R-transduced TF1 cells, compared with mock-transduced cells, in response to erythropoietin (EPO) and IL-9. To evaluate self-renewal and differentiation capacity, colony-replating assays were performed in the presence of IL-3, GM-CSF, IL-9, and EPO. After four replatings, the cloning efficiency of IL-9R-transduced TF1 cells decreased from 98% to 38%, most likely due to terminal erythroid cell differentiation. In contrast, no change in replating efficiency was detected in mock-transduced cells. TF1 cells stably expressing IL-9R and responding to IL-9 can serve as a cell line model to study the intracellular signals mediating IL-9-induced erythroid cell proliferation and differentiation.

Fabrication of high quality cDNA microarray using a small amount of cDNA.

PubMed

Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young

2004-05-01

DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.

T-cell receptor accessory and co-receptor molecules in channel catfish

USDA-ARS?s Scientific Manuscript database

T cell receptor (TCR) associated invariant chains CD3gamma/delta,epsilon, and zeta as well as TCR co-receptors CD8alpha and CD8beta were isolated from the channel catfish, Ictalurus punctatus, at both the gene and cDNA levels. All of catfish CD3 sequences encode for proteins that resemble their resp...

Amino acid substitutions in the hormone-binding domain of the human androgen receptor alter the stability of the hormone receptor complex.

PubMed Central

Marcelli, M; Zoppi, S; Wilson, C M; Griffin, J E; McPhaul, M J

1994-01-01

We have investigated the basis of androgen resistance in seven unrelated individuals with complete testicular feminization or Reifenstein syndrome caused by single amino acid substitutions in the hormone-binding domain of the androgen receptor. Monolayer-binding assays of cultured genital skin fibroblasts demonstrated absent ligand binding, qualitative abnormalities of androgen binding, or a decreased amount of qualitatively normal receptor. The consequences of these mutations were examined by introducing the mutations by site-directed mutagenesis into the androgen receptor cDNA sequence and expressing the mutant cDNAs in mammalian cells. The effects of the amino acid substitutions on the binding of different androgens and on the capacity of the ligand-bound receptors to activate a reporter gene were investigated. Substantial differences were found in the responses of the mutant androgen receptors to incubation with testosterone, 5 alpha-dihydrotestosterone, and mibolerone. In several instances, increased doses of hormone or increased frequency of hormone addition to the incubation medium resulted in normal or near normal activation of a reporter gene by cells expressing the mutant androgen receptors. These studies suggest that the stability of the hormone receptor complex is a major determinant of receptor function in vivo. Images PMID:7929841

[Effects of adenoviral vector containing human angiotensin II type 1 receptor antisense cDNA on biological action of human pulmonary artery smooth muscle cells].

PubMed

Tu, Ming-li; Wang, Han-qin; Lei, Huai-ding; Luo, Guo-shi; Liu, Xian-jun; Liu, Wei-shun; Xiong, Chang; Liu, Yu-quan; Ren, Si-qun

2005-04-01

To investigate the effect of human angiotensin II (AngII) type 1 receptor (AT(1)R) antisense cDNA (ahAT(1)) on migration, proliferation, and apoptosis of cultured human pulmonary artery smooth muscle cells (PASMC). Two recombinant adenoviral vectors, AdCMVahAT(1) containing full length antisense cDNA targeting to human AT(1)R mRNA, and AdCMVLacZ containing LacZ, were constructed by orientation clone technology and homologous recombination. The PASMC was divided into 3 groups (DMEM, AdCMVLacZ, AdCMVahAT(1)) and different interventions were given to different groups. AT(1)R expression was detected by RT-PCR and immunohistochemistry method; migration of PASMC was measured by Boyden's Chamer method. Other PASMC was divided into 4 groups (DMEM, AngII, AdCMVLacZ + AngII and AdCMVahAT(1) + AngII), and only the last 2 groups were respectively transfected with AdCMVLacZ and AdCMVahAT(1) before administration of AngII. From 6 h to 96 h after stimulation by AngII (10(-7) mol/L), proliferation index (PI) and apoptosis of PASMC were determined by flow cytometry. At the 48 h the level of AT(1)R mRNA was significantly less in PASMC transfected AdCMVahAT(1) than that in group DMEM and in group AdCMVLacZ. The protein level showed a same difference (P < 0.01). At 24 h the migration distance of PASMC also was significantly less in group AdCMVahAT(1) than that in group DMEM and Group AdCMVLacZ (P < 0.01). Stimulated by AngII for 48 h, in group AngII the PI of PASMC markedly increased (P < 0.01 vs group DMEM). But in Group AdCMVahAT(1) + AngII PI of PASMC clearly decreased (P < 0.01 vs group AngII and group DMEM respectively). There was no statistic difference of PI between group AdCMVLacZ + AngII and group AngII. Moreover, apoptosis peak emerged only in group AdCMVahAT(1) + AngII. The rate of apoptosis in those PASMC used AdCMVahAT(1) and AngII was 24.70 +/- 4.04 (P < 0.01 vs the other 3 groups respectively). These results indicate that AngII stimulates proliferation via AT(1

APPLICATION OF CDNA MICROARRAY TO THE STUDY OF ARSENIC TOXICOLOGY AND CARCINOGENESIS

EPA Science Inventory

Arsenic (As) is a common environmental toxicant and known human carcinogen. Epidemiological studies link As exposure to various disorders and cancers. However, the molecular mechanisms for As toxicity and carcinogenicity are not completely known. The cDNA microarray, a high-th...

A substitutional mutation in the DNA binding domain of the androgen receptor causes complete androgen insensitivity syndrome.

PubMed

Komori, S; Sakata, K; Kasumi, H; Tsuji, Y; Hamada, K; Koyama, K

1999-10-01

DNA analysis of the androgen receptor gene in a patient with complete androgen insensitivity syndrome identified a substitutional mutation (tyrosine converted to cysteine at position 571) in the DNA binding domain. In vitro transfection experiments with the patients' androgen receptor gene, indicated normal expression of the androgen receptor in transfected COS-7 cells compared to the wild type gene. There was also no evidence of impaired thermal stability of the 5 alpha-dihydrotestosterone-androgen receptor complex. However, the capacity of the androgen receptor to activate target gene transcription was found to be completely disrupted in a luciferase assay. These results confirmed that only one substitutional mutation in the DNA binding domain was related to the pathogenesis of the complete androgen insensitivity syndrome.

Identification and expression analysis of peroxisome proliferator-activated receptors cDNA in a reptile, the leopard gecko (Eublepharis macularius).

PubMed

Kato, Keisuke; Oka, Yoshitaka; Park, Min Kyun

2008-05-01

Despite the physiological and evolutionary significance of lipid metabolism in amniotes, the molecular mechanisms involved have been unclear in reptiles. To elucidate this, we investigated peroxisome proliferators-activated receptors (PPARs) in the leopard gecko (Eublepharis macularius). PPARs belong to a nuclear hormone-receptor family mainly involved in lipid metabolism. Although PPARs have been widely studied in mammals, little information about them is yet available from reptiles. We identified in the leopard gecko partial cDNA sequences of PPARalpha and beta, and full sequences of two isoforms of PPARgamma. This is the first report of reptilian PPARgamma mRNA isoforms. We also evaluated the organ distribution of expression of these genes by using RT-PCR and competitive PCR. The expression level of PPARalpha mRNA was highest in the large intestine, and moderate in the liver and kidney. The expression level of PPARbeta mRNA was highest in the kidney and large intestine, and moderate in the liver. Similarly to the expression of human PPARgamma isoforms, PPARgammaa was expressed ubiquitously, whereas the expression of PPARgammab was restricted. The highest levels of their expression, however, were observed in the large intestine, rather than in the adipose tissue as in mammals. Taken together, these results showed that the profile of PPARbeta mRNA expression in the leopard gecko is similar to that in mammals, and that those of PPAR alpha and gamma are species specific. This may reflect adaptation to annual changes in lipid storage due to seasonal food availability.

Formation of functional asialoglycoprotein receptor after transfection with cDNAs encoding the receptor proteins.

PubMed Central

McPhaul, M; Berg, P

1986-01-01

The rat asialoglycoprotein receptor (ASGP-R) has been expressed in cultured rat hepatoma cells (HTC cells) after transfection with cloned cDNAs. Fluorescence-activated cell sorting of transfected cells was used to identify the functional cDNA clones and to isolate cells expressing the ASGP-R. Simultaneous or sequential transfections with two cloned cDNAs that encode related but distinctive polypeptide chains were needed to obtain ASGP-R activity; transfection with either cDNA alone failed to produce detectable ASGP-R. The affinity of transduced ASGP-R for asialo orosomucoid is less than that of the native rat ASGP-R, and the number of surface receptors in clones expressing ASGP-R is about one-fifth that found on rat hepatocytes. Images PMID:3466162

Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

cDNA cloning and characterization of an aryl hydrocarbon receptor from the harbor seal (Phoca vitulina): a biomarker of dioxin susceptibility?

PubMed

Kim, Eun-Young; Hahn, Mark E

2002-07-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related planar halogenated aromatic hydrocarbons (PHAHs) are found at high concentrations in some marine mammals. Species differences in sensitivity to TCDD and PHAHs are a major limitation in assessing the ecological risk to these animals. Harbor seals accumulate high levels of PHAHs and are thought to be highly sensitive to the toxic effects of these compounds. To investigate the mechanistic basis for PHAH toxicity in harbor seals (Phoca vitulina), we sought to characterize the aryl hydrocarbon receptor (AHR), an intracellular protein that is responsible for PHAH effects. Here we report the cDNA cloning and characterization of a harbor seal AHR. The harbor seal AHR cDNA has an open reading frame of 2529 nucleotides that encodes a protein of 843 amino acids with a predicted molecular mass of 94.6 kDa. The harbor seal AHR protein possesses basic helix-loop-helix (bHLH) and Per-ARNT-Sim (PAS) domains. It is most closely related to the beluga AHR (82%) and human AHR (79%) in overall amino acid identity, indicating a high degree of conservation of AHR structure between terrestrial and some marine mammals. The ligand binding properties of the harbor seal AHR were determined using protein synthesized by in vitro transcription and translation from the cloned cDNA. Velocity sedimentation analysis on sucrose gradients showed that the harbor seal AHR exhibits specific binding of [(3)H]TCDD. The [(3)H]TCDD-binding affinity of the harbor seal AHR was compared with that of the AHR from a dioxin-sensitive mouse strain (C57BL/6) using a hydroxylapatite assay. The equilibrium dissociation constants of seal and mouse AHRs were 0.93+/-0.19 and 1.70+/-0.26 nM, respectively. Thus, the harbor seal AHR bound TCDD with an affinity that was at least as high as that of the mouse AHR, suggesting that this seal species may be sensitive to PHAH effects. The characteristics of the AHR potentially can be used as a biomarker of susceptibility to

Molecular identification and functional expression of mu 3, a novel alternatively spliced variant of the human mu opiate receptor gene.

PubMed

Cadet, Patrick; Mantione, Kirk J; Stefano, George B

2003-05-15

Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

Interaction of Mimetic Analogs of Insect Kinin Neuropeptides with Arthropod Receptors

DTIC Science & Technology

2010-01-01

stagnalis.20 The amino acid sequence of the B. microplus receptor showed most similarity to the CG10626 Drosophila melanogaster gene product and to the...25 The A. aegypti cDNA encodes a 584 amino acid residue protein of predicted molecular mass of 65.2 kDa. The mosquito kinin receptor cDNA was...charged acid moiety.36,37 Within the core pentapeptide, the aromatic residues Phe1 and Trp4 are the most important for activity whereas a wide range

Complete Reversible Refolding of a G-Protein Coupled Receptor on a Solid Support

PubMed Central

Di Bartolo, Natalie; Compton, Emma L. R.; Warne, Tony; Edwards, Patricia C.; Tate, Christopher G.; Schertler, Gebhard F. X.; Booth, Paula J.

2016-01-01

The factors defining the correct folding and stability of integral membrane proteins are poorly understood. Folding of only a few select membrane proteins has been scrutinised, leaving considerable deficiencies in knowledge for large protein families, such as G protein coupled receptors (GPCRs). Complete reversible folding, which is problematic for any membrane protein, has eluded this dominant receptor family. Moreover, attempts to recover receptors from denatured states are inefficient, yielding at best 40–70% functional protein. We present a method for the reversible unfolding of an archetypal family member, the β1-adrenergic receptor, and attain 100% recovery of the folded, functional state, in terms of ligand binding, compared to receptor which has not been subject to any unfolding and retains its original, folded structure. We exploit refolding on a solid support, which could avoid unwanted interactions and aggregation that occur in bulk solution. We determine the changes in structure and function upon unfolding and refolding. Additionally, we employ a method that is relatively new to membrane protein folding; pulse proteolysis. Complete refolding of β1-adrenergic receptor occurs in n-decyl-β-D-maltoside (DM) micelles from a urea-denatured state, as shown by regain of its original helical structure, ligand binding and protein fluorescence. The successful refolding strategy on a solid support offers a defined method for the controlled refolding and recovery of functional GPCRs and other membrane proteins that suffer from instability and irreversible denaturation once isolated from their native membranes. PMID:26982879

Analysis of beta-carotene hydroxylase gene cDNA isolated from the American oil-palm (Elaeis oleifera) mesocarp tissue cDNA library

PubMed Central

Bhore, Subhash J; Kassim, Amelia; Loh, Chye Ying; Shah, Farida H

2010-01-01

It is well known that the nutritional quality of the American oil-palm (Elaeis oleifera) mesocarp oil is superior to that of African oil-palm (Elaeis guineensis Jacq. Tenera) mesocarp oil. Therefore, it is of important to identify the genetic features for its superior value. This could be achieved through the genome sequencing of the oil-palm. However, the genome sequence is not available in the public domain due to commercial secrecy. Hence, we constructed a cDNA library and generated expressed sequence tags (3,205) from the mesocarp tissue of the American oil-palm. We continued to annotate each of these cDNAs after submitting to GenBank/DDBJ/EMBL. A rough analysis turned our attention to the beta-carotene hydroxylase (Chyb) enzyme encoding cDNA. Then, we completed the full sequencing of cDNA clone for its both strands using M13 forward and reverse primers. The full nucleotide and protein sequence was further analyzed and annotated using various Bioinformatics tools. The analysis results showed the presence of fatty acid hydroxylase superfamily domain in the protein sequence. The multiple sequence alignment of selected Chyb amino acid sequences from other plant species and algal members with E. oleifera Chyb using ClustalW and its phylogenetic analysis suggest that Chyb from monocotyledonous plant species, Lilium hubrid, Crocus sativus and Zea mays are the most evolutionary related with E. oleifera Chyb. This study reports the annotation of E. oleifera Chyb. Abbreviations ESTs - expressed sequence tags, EoChyb - Elaeis oleifera beta-carotene hydroxylase, MC - main cluster PMID:21364789

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1998-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1998-11-03

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

Complete cDNA sequence of SAP-like pentraxin from Limulus polyphemus: implications for pentraxin evolution.

PubMed

Tharia, Hazel A; Shrive, Annette K; Mills, John D; Arme, Chris; Williams, Gwyn T; Greenhough, Trevor J

2002-02-22

The serum amyloid P component (SAP)-like pentraxin Limulus polyphemus SAP is a recently discovered, distinct pentraxin species, of known structure, which does not bind phosphocholine and whose N-terminal sequence has been shown to differ markedly from the highly conserved N terminus of all other known horseshoe crab pentraxins. The complete cDNA sequence of Limulus SAP, and the derived amino acid sequence, the first invertebrate SAP-like pentraxin sequence, have been determined. Two sequences were identified that differed only in the length of the 3' untranslated region. Limulus SAP is synthesised as a precursor protein of 234 amino acid residues, the first 17 residues encoding a signal peptide that is absent from the mature protein. Phylogenetic analysis clusters Limulus SAP pentraxin with the horseshoe crab C-reactive proteins (CRPs) rather than the mammalian SAPs, which are clustered with mammalian CRPs. The deduced amino acid sequence shares 22% identity with both human SAP and CRP, which are 51% identical, and 31-35% with horseshoe crab CRPs. These analyses indicate that gene duplication of CRP (or SAP), followed by sequence divergence and the evolution of CRP and/or SAP function, occurred independently along the chordate and arthropod evolutionary lines rather than in a common ancestor. They further indicate that the CRP/SAP gene duplication event in Limulus occurred before both the emergence of the Limulus CRP variants and the mammalian CRP/SAP gene duplication. Limulus SAP, which does not exhibit the CRP characteristic of calcium-dependent binding to phosphocholine, is established as a pentraxin species distinct from all other known horseshoe crab pentraxins that exist in many variant forms sharing a high level of sequence homology. Copyright 2002 Elsevier Science Ltd.

Molecular characterization of a family of ligands for eph-related tyrosine kinase receptors.

PubMed Central

Beckmann, M P; Cerretti, D P; Baum, P; Vanden Bos, T; James, L; Farrah, T; Kozlosky, C; Hollingsworth, T; Shilling, H; Maraskovsky, E

1994-01-01

A family of tyrosine kinase receptors related to the product of the eph gene has been described recently. One of these receptors, elk, has been shown to be expressed only in brain and testes. Using a direct expression cloning technique, a ligand for the elk receptor has been isolated by screening a human placenta cDNA library with a fusion protein containing the extracellular domain of the receptor. This isolated cDNA encodes a transmembrane protein. While the sequence of the ligand cDNA is unique, it is related to a previously described sequence known as B61. Northern blot analysis of human tissue mRNA showed that the elk ligand's mRNA is 3.5 kb long and is found in placenta, heart, lung, liver, skeletal muscle, kidney and pancreas. Southern blot analysis showed that the gene is highly conserved in a wide variety of species. Both elk ligand and B61 mRNAs are inducible by tumour necrosis factor in human umbilical vein endothelial cells. In addition, both proteins show promiscuity in binding to the elk and the related hek receptors. Since these two ligand sequences are similar, and since elk and hek are members of a larger family of eph-related receptor molecules, we refer to these ligands as LERKs (ligands for eph-related kinases). Images PMID:8070404

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

PubMed

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Rapid isolation of novel FK506 binding proteins from multiple organisms using gDNA and cDNA T7 phage display.

PubMed

Piggott, Andrew M; Kriegel, Alison M; Willows, Robert D; Karuso, Peter

2009-10-01

Reverse chemical proteomics using T7 phage display is a powerful technique for identifying cellular receptors of biologically active small molecules. However, to date this method has generally been limited to cDNA libraries constructed from mRNA isolated from eukaryotes. In this paper, we describe the construction of the first prokaryotic T7 phage display libraries from randomly digested Pseudomonas stutzeri and Vibrio fischeri gDNA, as well as a plant cDNA library from Arabidopsis thaliana. We also describe the use of T7 phage display to identify novel proteins from environmental DNA samples using biotinylated FK506 as a model affinity probe.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Pharmacological Intervention of Hippocampal CA3 NMDA Receptors Impairs Acquisition and Long-Term Memory Retrieval of Spatial Pattern Completion Task

ERIC Educational Resources Information Center

Fellini, Laetitia; Florian, Cedrick; Courtey, Julie; Roullet, Pascal

2009-01-01

Pattern completion is the ability to retrieve complete information on the basis of incomplete retrieval cues. Although it has been demonstrated that this cognitive capacity depends on the NMDA receptors (NMDA-Rs) of the hippocampal CA3 region, the role played by these glutamatergic receptors in the pattern completion process has not yet been…

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, Marcelo B.; Efstratiadis, Argiris

1996-01-01

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

Method for construction of normalized cDNA libraries

DOEpatents

Soares, M.B.; Efstratiadis, A.

1996-01-09

This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Deletions of fetal and adult muscle cDNA in Duchenne and Becker muscular dystrophy patients.

PubMed Central

Cross, G S; Speer, A; Rosenthal, A; Forrest, S M; Smith, T J; Edwards, Y; Flint, T; Hill, D; Davies, K E

1987-01-01

We have isolated a cDNA molecule from a human adult muscle cDNA library which is deleted in several Duchenne muscular dystrophy patients. Patient deletions have been used to map the exons across the Xp21 region of the short arm of the X chromosome. We demonstrate that a very mildly affected 61 year old patient is deleted for at least nine exons of the adult cDNA. We find no evidence for differential exon usage between adult and fetal muscle in this region of the gene. There must therefore be less essential domains of the protein structure which can be removed without complete loss of function. The sequence of 2.0 kb of the adult cDNA shows no homology to any previously described protein listed in the data banks although sequence comparison at the amino acid level suggests that the protein has a structure not dissimilar to rod structures of cytoskeletal proteins such as lamin and myosin. There are single nucleotide differences in the DNA sequence between the adult and fetal cDNAs which result in amino acid changes but none that would be predicted to change the structure of the protein dramatically. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 7. PMID:3428261

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

PubMed

Ares, Manuel

2014-01-01

This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

Constructing and detecting a cDNA library for mites.

PubMed

Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

2015-10-01

RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

PubMed Central

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

PubMed

Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

2010-01-01

A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

cDNA library construction of two human Demodexspecies.

PubMed

Niu, DongLing; Wang, RuiLing; Zhao, YaE; Yang, Rui; Hu, Li; Lei, YuYang; Dan, WeiChao

2017-06-01

The research of Demodex, a type of pathogen causing various dermatoses in animals and human beings, is lacking at RNA level. This study aims at extracting RNA and constructing cDNA library for Demodex. First, P. cuniculiand D. farinaewere mixed to establish homogenization method for RNA extraction. Second, D. folliculorumand D. breviswere collected and preserved in Trizol, which were mixed with D. farinaerespectively to extract RNA. Finally, cDNA library was constructed and its quality was assessed. The results indicated that for D. folliculorum& D. farinae, the recombination rate of cDNA library was 90.67% and the library titer was 7.50 × 104 pfu/ml. 17 of the 59 positive clones were predicted to be of D. folliculorum; For D. brevis& D. farinae, the recombination rate was 90.96% and the library titer was 7.85 x104 pfu/ml. 40 of the 59 positive clones were predicted to be of D. brevis. Further detection by specific primers demonstrated that mtDNA cox1, cox3and ATP6 detected from cDNA libraries had 96.52%-99.73% identities with the corresponding sequences in GenBank. In conclusion, the cDNA libraries constructed for Demodexmixed with D. farinaewere successful and could satisfy the requirements for functional genes detection.

Kainate Receptors in the Striatum: Implications for Excitotoxicity in Huntington’s Disease

DTIC Science & Technology

2005-08-01

called ionotropic glutamate receptors. Using specific antibodies and glutamate-related compounds, we have achieved successfully a series of studies of the...them from AMPA receptors. However, the recent development of specific antibodies and selective AMPA receptor antagonists allowed various groups to...highly specific antibodies and/or cDNA probes allowed the better characterization of the cellular localization of various GABA and glutamate receptor

Molecular and characterization of NnPPO cDNA from lotus (Nelumbo nucifera) in rhizome browning.

PubMed

Dong, C; Yu, A Q; Yang, M G; Zhou, M Q; Hu, Z L

2016-04-30

The complete cDNA (NnPPO) of polyphenol oxidase in Nelumbo nucifera was successfully isolated, using Rapid amplification cDNA end (RACE) assays. The full-length cDNA of NnPPO was 2069 bp in size, containing a 1791 bp open reading frame coding 597 amino acids. The putative NnPPO possessed the conserved active sites and domains for PPO function. Phylogenetic analysis revealed that NnPPO shared high homology with PPO of high plants, and the homology modeling proved that NnPPO had the typical structure of PPO family. In order to characterize the role of NnPPO, Real-time PCR assay demonstrated that NnPPO mRNA was expressed in different tissues of N. nucifera including young leave, rhizome, flower, root and leafstalk, with the highest expression in rhizome. Patterns of NnPPO expression in rhizome illustrated its mRNA level was significantly elevated, which was consistent with the change of NnPPO activity during rhizome browning. Therefore, transcriptional activation of NnPPO was probably the main reason causing rhizome browning.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Cloning and Expression of cDNA for Rat Heme Oxygenase

NASA Astrophysics Data System (ADS)

Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

1985-12-01

Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed Central

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-01-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-12-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

The human mu opioid receptor: modulation of functional desensitization by calcium/calmodulin-dependent protein kinase and protein kinase C.

PubMed

Mestek, A; Hurley, J H; Bye, L S; Campbell, A D; Chen, Y; Tian, M; Liu, J; Schulman, H; Yu, L

1995-03-01

Opioids are some of the most efficacious analgesics used in humans. Prolonged administration of opioids, however, often causes the development of drug tolerance, thus limiting their effectiveness. To explore the molecular basis of those mechanisms that may contribute to opioid tolerance, we have isolated a cDNA for the human mu opioid receptor, the target of such opioid narcotics as morphine, codeine, methadone, and fentanyl. The receptor encoded by this cDNA is 400 amino acids long with 94% sequence similarity to the rat mu opioid receptor. Transient expression of this cDNA in COS-7 cells produced high-affinity binding sites to mu-selective agonists and antagonists. This receptor displays functional coupling to a recently cloned G-protein-activated K+ channel. When both proteins were expressed in Xenopus oocytes, functional desensitization developed upon repeated stimulation of the mu opioid receptor, as observed by a reduction in K+ current induced by the second mu receptor activation relative to that induced by the first. The extent of desensitization was potentiated by both the multifunctional calcium/calmodulin-dependent protein kinase and protein kinase C. These results demonstrate that kinase modulation is a molecular mechanism by which the desensitization of mu receptor signaling may be regulated at the cellular level, suggesting that this cellular mechanism may contribute to opioid tolerance in humans.

cDNA Microarray Screening in Food Safety

PubMed Central

ROY, SASHWATI; SEN, CHANDAN K

2009-01-01

The cDNA microarray technology and related bioinformatics tools presents a wide range of novel application opportunities. The technology may be productively applied to address food safety. In this mini-review article, we present an update highlighting the late breaking discoveries that demonstrate the vitality of cDNA microarray technology as a tool to analyze food safety with reference to microbial pathogens and genetically modified foods. In order to bring the microarray technology to mainstream food safety, it is important to develop robust user-friendly tools that may be applied in a field setting. In addition, there needs to be a standardized process for regulatory agencies to interpret and act upon microarray-based data. The cDNA microarray approach is an emergent technology in diagnostics. Its values lie in being able to provide complimentary molecular insight when employed in addition to traditional tests for food safety, as part of a more comprehensive battery of tests. PMID:16466843

Characterization and simulation of cDNA microarray spots using a novel mathematical model

PubMed Central

Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

2007-01-01

Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications

Molecular cloning of a novel receptor tyrosine kinase, tif, highly expressed in human ovary and testis.

PubMed

Dai, W; Pan, H; Hassanain, H; Gupta, S L; Murphy, M J

1994-03-01

Using a combination of polymerase chain reaction and conventional cDNA library screening approaches, we have cloned and characterized a putative receptor tyrosine kinase termed tif. The extracellular domain of tif has an immunoglobulin-like loop and a fibronectin type III structure. The intracellular domain contains a tyrosine kinase domain. Compared with ryk, a ubiquitously expressed receptor tyrosine kinase, tif expression is tissue-specific with human ovary and testis containing the highest amount of tif mRNA. Many other tested human tissues such as heart, liver, pancreas and thymus do not contain detectable levels of tif mRNA. The molecular cloning and characterization of tif cDNA will facilitate the identification of a potential ligand(s) for the putative receptor and the study of its biological role.

cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Codina, J.; Olate, J.; Abramowitz, J.

1988-05-15

cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

Infectious Maize rayado fino virus from cloned cDNA

USDA-ARS?s Scientific Manuscript database

Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

Molecular and functional characterization of the first tick CAP2b (periviscerokinin) receptor from Rhipicephalus (Boophilus) microplus

USDA-ARS?s Scientific Manuscript database

The cDNA of the receptor for CAP2b/periviscerokinin (PVK) neuropeptides, designated Rhimi-CAP2b-R, was cloned from synganglia of tick Rhipicephalus (Boophilus) microplus. This receptor is the ortholog of the insect CAP2b/PVK receptor, as concluded from analyses of the predicted protein sequence, ph...

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, N.V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon. .

Lectin cDNA and transgenic plants derived therefrom

DOEpatents

Raikhel, Natasha V.

1994-01-04

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties. GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA

Cloning and functional characterization of the DA2 receptor gene in Chinese mitten crab (Eriocheir sinensis)

PubMed Central

Xu, Min-jie; Zhang, Cong; Yang, Zhigang

2018-01-01

Dopamine (DA) plays a modulatory role in numerous physiological processes such as light adaptation and food intake, and exerts these functions through DA receptors (DARs). This study presents, for the first time, isolation and characterization of the dopamine receptor 2(DA2 receptor) cDNA from the intestinal tissue of Eriocheir sinensis, an economically important freshwater aquaculture species in China. The DA2 receptor cDNA sequence, which was obtained by rapid amplification of cDNA ends, is 2369bp long, encode peptide of 589 amino acid, and is highly homologous to related sequences in crustaceans. Analysis of the deduced amino acid sequence and the structure of the DA2 indicated that this receptor is a member of the family of G protein-coupled receptors (GPCRs), as it contains seven transmembrane domains and other common signatures of GPCRs. RT-PCR showed that the expression of the DA2 receptor gene was distributed in various tissues, and high expression levels were observed in the cranial ganglia and the thoracic ganglia. Further study of the effect of photoperiod on DA2 expression showed that constant darkness induced a significant increase in DA2 expression in the cranial ganglia. Finally, analysis of DA2 receptor expression under different feeding statuses showed that there was significantly greater expression in the hepatopancreas and intestines after feeding than before feeding, but there were no differences in expression between the before feeding and during feeding periods in either tissue. Our results indicate that the DA2 receptor structurally belongs to the family of G protein-coupled receptors, and that the cranial ganglia are the main tissues in which the DA2 receptor participates in light adaptation during dark hours. In addition, the DA2 receptor in E. sinensis may be involved in the physiological regulation of the hepatopancreas and digestive tract after the ingestion of food. This study provides a foundation for further exploration of the light

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

RICD: a rice indica cDNA database resource for rice functional genomics.

PubMed

Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

2008-11-26

The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Molecular structure of P2X receptors.

PubMed

Egan, Terrance M; Cox, Jane A; Voigt, Mark M

2004-01-01

P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.

Isolation, expression analysis and functional characterization of the first anti-diuretic hormone receptor in insects

USDA-ARS?s Scientific Manuscript database

Diuresis following blood-gorging in Rhodnius prolixus is the major process leading to the transmission of Chagas' disease. We have cloned the cDNA of the first receptor known to be involved in an antidiuretic strategy in insects; a strategy that prevents diuresis. This receptor belongs to the insect...

A simplified approach to construct infectious cDNA clones of a tobamovirus in a binary vector.

PubMed

Junqueira, Bruna Rayane Teodoro; Nicolini, Cícero; Lucinda, Natalia; Orílio, Anelise Franco; Nagata, Tatsuya

2014-03-01

Infectious cDNA clones of RNA viruses are important tools to study molecular processes such as replication and host-virus interactions. However, the cloning steps necessary for construction of cDNAs of viral RNA genomes in binary vectors are generally laborious. In this study, a simplified method of producing an agro-infectious Pepper mild mottle virus (PMMoV) clone is described in detail. Initially, the complete genome of PMMoV was amplified by a single-step RT-PCR, cloned, and subcloned into a small plasmid vector under the T7 RNA polymerase promoter to confirm the infectivity of the cDNA clone through transcript inoculation. The complete genome was then transferred to a binary vector using a single-step, overlap-extension PCR. The selected clones were agro-infiltrated to Nicotiana benthamiana plants and showed to be infectious, causing typical PMMoV symptoms. No differences in host responses were observed when the wild-type PMMoV isolate, the T7 RNA polymerase-derived transcripts and the agroinfiltration-derived viruses were inoculated to N. benthamiana, Capsicum chinense PI 159236 and Capsicum annuum plants. Copyright © 2013 Elsevier B.V. All rights reserved.

Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

PubMed

Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

2017-09-01

DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, C.F. Jr.; Clancy, T.E.; Quan, R.

1995-04-10

The human oxytocin receptor regulates parturition and myometrial contractility, breast milk let-down, and reproductive behaviors in the mammalian central nervous system. Kimura et al. recently identified a human oxytocin receptor cDNA by means of expression cloning from a human myometrial cDNA library. To elucidate further the molecular mechanisms that regulate oxytocin receptor gene expression and to define the expected Mendelian inheritance of possible human disease states, we must determine the number of genes, their localization, and their organization and structure. We summarize below our data indicating that the human oxytocin receptor gene is localized to 3p25 and exists as amore » single copy in the haploid genome. 9 refs., 2 figs.« less

Functional expression of Squalus acanthias melanocortin-5 receptor in CHO cells: ligand selectivity and interaction with MRAP.

PubMed

Reinick, Christina L; Liang, Liang; Angleson, Josepha K; Dores, Robert M

2012-04-05

The melanocortin-5 receptor (MC(5)) of the dogfish Squalus acanthias (SacMC(5) receptor) can be functionally expressed in CHO cells in the absence of the co-expression of an exogenous MRAP cDNA. Both human ACTH(1-24) and dogfish ACTH(1-25) were much better stimulators of the SacMC(5) receptor than any of the mammalian or dogfish MSH ligands that were tested. The order of ligand selectivity for the dogfish melanocortins was ACTH(1-25)>αMSH>γ-MSH=δ-MSH>β-MSH. Unlike mammalian MC(5) receptors, the functional expression of the SacMC(5) receptor was not negatively impacted when the receptor was co-expressed with a cartilaginous fish (Callorhinchus milii) MRAP2 cDNA. However, co-expression with either mouse mMRAP1 or zebrafish zfMRAP1 increased the sensitivity of SacMC(5) receptor for hACTH(1-24) by at least one order of magnitude. Hence, SacMC(5) receptor has the potential to interact with MRAP1 orthologs and in this regard behaved more like a melanocortin MC(2) receptor ortholog than a melanocortin MC(5) receptor ortholog. These observations are discussed in light of the evolution of the melanocortin receptor gene family in cartilaginous fish, and the physiological implications of these observations are considered. Copyright © 2012 Elsevier B.V. All rights reserved.

Increase in the levels of chaperone proteins by exposure to beta-estradiol, bisphenol A and 4-methoxyphenol in human cells transfected with estrogen receptor alpha cDNA.

PubMed

Kita, Kazuko; Jin, Yuan-Hu; Sun, Zhuo; Chen, Shi-Ping; Sumiya, Yoko; Hongo, Toshio; Suzuki, Nobuo

2009-06-01

We examined changes in the levels of chaperone proteins to evaluate the toxic effects of environmental chemicals in human cells in vitro. Some chaperones are up-regulated by estrogenic chemicals, but the effect is not necessarily dependent on the receptor. Thus we also investigated whether a chemical-induced change in chaperone protein expression is human estrogen receptor (hER)-dependent or not, using cultured human cell lines transfected with hERalpha cDNA or an empty vector. In the hERalpha-expressed cells, the protein levels of the heat shock protein 27 (HSP27), the glucose-regulated protein 78 (GRP78/BiP), and GRP94 increased after exposure to beta-estradiol (E(2)) (from 10(-9)M to 10(-6)M) and bisphenol A (BPA) (from 10(-6)M to 10(-5)M). On the other hand, the increase was not observed in the cells without hERalpha expression. These results suggest that the E(2)- and BPA-induced increase in the protein levels were hERalpha dependent. We next examined the effect of four phenolic chemicals similar in structure to BPA, and found that among them, 4-methoxyphenol (from 10(-6)M to 10(-5)M) increased the levels of the chaperone proteins with hERalpha dependency. Thus the human cultured cells would be suitable for evaluating whether an increase in chaperone proteins occurs upon exposure to environmental chemicals and whether the effect is ER-dependent.

Newly identified allatostatin Bs and their receptor in the two-spotted cricket, Gryllus bimaculatus.

PubMed

Tsukamoto, Yusuke; Nagata, Shinji

2016-06-01

A cDNA encoding allatostatin Bs (ASTBs) containing the W(X)6W motif was identified using a database generated by a next generation sequencer (NGS) in the two-spotted cricket, Gryllus bimaculatus. The contig sequence revealed the presence of five novel putative ASTBs (GbASTBs) in addition to GbASTBs previously identified in G. bimaculatus. MALDI-TOF MS analyses revealed the presence of these novel and previously identified GbASTBs with three missing GbASTBs. We also identified a cDNA encoding G. bimaculatus GbASTB receptor (GbASTBR) in the NGS data. Phylogenetic analysis demonstrated that this receptor was highly conserved with other insect ASTBRs, including the sex peptide receptor of Drosophila melanogaster. Calcium imaging analyses indicated that the GbASTBR heterologously expressed in HEK293 cells exhibited responses to all identified GbASTBs at a concentration range of 10(-10)-10(-5)M. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning and characterization of two novel zebrafish P2X receptor subunits.

PubMed

Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

2002-07-26

In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

Annexin VI is a mannose-6-phosphate-independent endocytic receptor for bovine β-glucuronidase.

PubMed

Ramírez-Mata, Alberto; Michalak, Colette; Mendoza-Hernández, Guillermo; León-Del-Río, Alfonso; González-Noriega, Alfonso

2011-10-01

Endocytosis and transport of bovine liver β-glucuronidase to lysosomes in human fibroblasts are mediated by two receptors: the well-characterized cation-independent mannose 6-phosphate receptor (IGF-II/Man6PR) and an IGF-II/Man6PR-independent receptor, which recognizes a Ser-Trp*-Ser sequence present on the ligand. The latter receptor was detergent extracted from bovine liver membranes and purified. LC/ESI-MS/MS analysis revealed that this endocytic receptor was annexin VI (AnxA6). Several approaches were used to confirm this finding. First, the binding of bovine β-glucuronidase to the purified receptor from bovine liver membranes and His-tagged recombinant human AnxA6 protein was confirmed using ligand-blotting assays. Second, western blot analysis using antibodies raised against IGF-II/Man6PR-independent receptor as well as commercial antibodies against AnxA6 confirmed that the receptor and AnxA6 were indeed the same protein. Third, double immunofluorescence experiments in human fibroblasts confirmed a complete colocalization of the bovine β-glucuronidase and the AnxA6 receptor on the plasma membrane. Lastly, two cell lines were stably transfected with a plasmid containing the cDNA for human AnxA6. In both transfected cell lines, an increase in cell surface AnxA6 and in mannose 6-phosphate-independent endocytosis of bovine β-glucuronidase was detected. These results indicate that AnxA6 is a novel receptor that mediates the endocytosis of the bovine β-glucuronidase. Copyright © 2011 Elsevier Inc. All rights reserved.

Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

PubMed Central

Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

1989-01-01

We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

Inverse agonist and neutral antagonist actions of synthetic compounds at an insect 5-HT1 receptor.

PubMed

Troppmann, B; Balfanz, S; Baumann, A; Blenau, W

2010-04-01

5-Hydroxytryptamine (5-HT) has been shown to control and modulate many physiological and behavioural functions in insects. In this study, we report the cloning and pharmacological properties of a 5-HT(1) receptor of an insect model for neurobiology, physiology and pharmacology. A cDNA encoding for the Periplaneta americana 5-HT(1) receptor was amplified from brain cDNA. The receptor was stably expressed in HEK 293 cells, and the functional and pharmacological properties were determined in cAMP assays. Receptor distribution was investigated by RT-PCR and by immunocytochemistry using an affinity-purified polyclonal antiserum. The P. americana 5-HT(1) receptor (Pea5-HT(1)) shares pronounced sequence and functional similarity with mammalian 5-HT(1) receptors. Activation with 5-HT reduced adenylyl cyclase activity in a dose-dependent manner. Pea5-HT(1) was expressed as a constitutively active receptor with methiothepin acting as a neutral antagonist, and WAY 100635 as an inverse agonist. Receptor mRNA was present in various tissues including brain, salivary glands and midgut. Receptor-specific antibodies showed that the native protein was expressed in a glycosylated form in membrane samples of brain and salivary glands. This study marks the first pharmacological identification of an inverse agonist and a neutral antagonist at an insect 5-HT(1) receptor. The results presented here should facilitate further analyses of 5-HT(1) receptors in mediating central and peripheral effects of 5-HT in insects.

Cloning and expression of cDNA coding for bouganin.

PubMed

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

A candidate pheromone receptor and two odorant receptors of the hawkmoth Manduca sexta.

PubMed

Patch, Harland M; Velarde, Rodrigo A; Walden, Kimberly K O; Robertson, Hugh M

2009-05-01

In this study, we cloned and characterized three Manduca sexta odorant receptors (ORs). One receptor is a putative pheromone receptor expressed exclusively in a cell associated with male-specific type-I trichoid sensilla. We describe the results of real-time PCR (RT-PCR) and quantitative real-time PCR (qRT-PCR) experiments that show MsextaOR1 is expressed only in male antennae. In situ hybridization labels a single cell associated with type-1 trichoid sensilla, which houses two neurons that have been previously determined to respond to the major components of the pheromone blend. The second receptor, MsextaOR2, was discovered using degenerate primers designed to conserved motifs of a unique group ORs that share as much as 88% identity. Comparison of RT-PCR, qRT-PCR, and in situ hybridization results with those of ORs in the Drosophila melanogaster Or83b subfamily shows a strong sequence and expression pattern similarity. The third receptor, MsextaOR3, was found by 5'-end sequencing of a normalized and subtracted cDNA library from male M. sexta antennae. RT-PCR and qRT-PCR show that this receptor is expressed only in male and female antennae. These are the first ORs, including a putative pheromone receptor, to be described from M. sexta.

Functional Expression of Two Neuronal Nicotinic Acetylcholine Receptors from cDNA Clones Identifies a Gene Family

NASA Astrophysics Data System (ADS)

Boulter, Jim; Connolly, John; Deneris, Evan; Goldman, Dan; Heinemann, Steven; Patrick, Jim

1987-11-01

A family of genes coding for proteins homologous to the α subunit of the muscle nicotinic acetylcholine receptor has been identified in the rat genome. These genes are transcribed in the central and peripheral nervous systems in areas known to contain functional nicotinic receptors. In this paper, we demonstrate that three of these genes, which we call alpha3, alpha4, and beta2, encode proteins that form functional nicotinic acetylcholine receptors when expressed in Xenopus oocytes. Oocytes expressing either alpha3 or alpha4 protein in combination with the beta2 protein produced a strong response to acetylcholine. Oocytes expressing only the alpha4 protein gave a weak response to acetylcholine. These receptors are activated by acetylcholine and nicotine and are blocked by Bungarus toxin 3.1. They are not blocked by α -bungarotoxin, which blocks the muscle nicotinic acetylcholine receptor. Thus, the receptors formed by the alpha3, alpha4, and beta2 subunits are pharmacologically similar to the ganglionic-type neuronal nicotinic acetylcholine receptor. These results indicate that the alpha3, alpha4, and beta2 genes encode functional nicotinic acetylcholine receptor subunits that are expressed in the brain and peripheral nervous system.

LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

PubMed

Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

2017-09-15

Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

PubMed Central

Dumont, Yvan; Quirion, Rémi

2000-01-01

GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

Activation-induced proteolysis of cytoplasmic domain of zeta in T cell receptors and Fc receptors.

PubMed

Taupin, J L; Anderson, P

1994-12-01

The CD3-T cell receptor (TCR) complex on T cells and the Fc gamma receptor type III (Fc gamma RIII)-zeta-gamma complex on natural killer cells are functionally analogous activation receptors that associate with a family of disulfide-linked dimers composed of the related subunits zeta and gamma. Immunochemical analysis of receptor complexes separated on two-dimensional diagonal gels allowed the identification of a previously uncharacterized zeta-p14 heterodimer. zeta-p14 is a component of both CD3-TCR and Fc gamma RIII-zeta-gamma. Peptide mapping analysis shows that p14 is structurally related to zeta, suggesting that it is either: (i) derived from zeta proteolytically or (ii) the product of an alternatively spliced mRNA. The observation that COS cells transformed with a cDNA encoding zeta express zeta-p14 supports the former possibility. The expression of CD3-TCR complexes including zeta-p14 increases following activation with phorbol 12-myristate 13-acetate or concanavalin A, suggesting that proteolysis of zeta may contribute to receptor modulation or desensitization.

Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

PubMed Central

Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

1991-01-01

Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

Equus caballus Major Histocompatibility Complex Class I Is an Entry Receptor for Equine Herpesvirus Type 1▿

PubMed Central

Kurtz, Brian M.; Singletary, Lauren B.; Kelly, Sean D.; Frampton, Arthur R.

2010-01-01

In this study, Equus caballus major histocompatibility complex class I (MHC-I) was identified as a cellular entry receptor for the alphaherpesvirus equine herpesvirus type 1 (EHV-1). This novel EHV-1 receptor was discovered using a cDNA library from equine macrophages. cDNAs from this EHV-1-susceptible cell type were inserted into EHV-1-resistant B78H1 murine melanoma cells, these cells were infected with an EHV-1 lacZ reporter virus, and cells that supported virus infection were identified by X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) staining. Positive cells were subjected to several rounds of purification to obtain homogeneous cell populations that were shown to be uniformly infected with EHV-1. cDNAs from these cell populations were amplified by PCR and then sequenced. The sequence data revealed that the EHV-1-susceptible cells had acquired an E. caballus MHC-I cDNA. Cell surface expression of this receptor was verified by confocal immunofluorescence microscopy. The MHC-I cDNA was cloned into a mammalian expression vector, and stable B78H1 cell lines were generated that express this receptor. These cell lines were susceptible to EHV-1 infection while the parental B78H1 cells remained resistant to infection. In addition, EHV-1 infection of the B78H1 MHC-I-expressing cell lines was inhibited in a dose-dependent manner by an anti-MHC-I antibody. PMID:20610718

Complete sequence of HLA-B27 cDNA identified through the characterization of structural markers unique to the HLA-A, -B, and -C allelic series

DOE Office of Scientific and Technical Information (OSTI.GOV)

Szoets, H.; Reithmueller, G.; Weiss, E.

1986-03-01

Antigen HLA-B27 is a high-risk genetic factor with respect to a group of rheumatoid disorders, especially ankylosing spondylitis. A cDNA library was constructed from an autozygous B-cell line expressing HLA-B27, HLA-Cw1, and the previously cloned HLA-A2 antigen. Clones detected with an HLA probe were isolated and sorted into homology groups by differential hybridization and restriction maps. Nucleotide sequencing allowed the unambiguous assignment of cDNAs to HLA-A, -B, and -C loci. The HLA-B27 mRNA has the structure features and the codon variability typical of an HLA class I transcript but it specifies two uncommon amino acid replacements: a cysteine in positionmore » 67 and a serine in position 131. The latter substitution may have functional consequences, because it occurs in a conserved region and at a position invariably occupied by a species-specific arginine in humans and lysine in mice. The availability of the complete sequence of HLA-B27 and of the partial sequence of HLA-Cw1 allows the recognition of locus-specific sequence markers, particularly, but not exclusively, in the transmembrane and cytoplasmic domains.« less

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

The effect of column purification on cDNA indirect labelling for microarrays

PubMed Central

Molas, M Lia; Kiss, John Z

2007-01-01

Background The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. Results We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Conclusion Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays. PMID:17597522

The effect of column purification on cDNA indirect labelling for microarrays.

PubMed

Molas, M Lia; Kiss, John Z

2007-06-27

The success of the microarray reproducibility is dependent upon the performance of standardized procedures. Since the introduction of microarray technology for the analysis of global gene expression, reproducibility of results among different laboratories has been a major problem. Two of the main contributors to this variability are the use of different microarray platforms and different laboratory practices. In this paper, we address the latter question in terms of how variation in one of the steps of a labelling procedure affects the cDNA product prior to microarray hybridization. We used a standard procedure to label cDNA for microarray hybridization and employed different types of column chromatography for cDNA purification. After purifying labelled cDNA, we used the Agilent 2100 Bioanalyzer and agarose gel electrophoresis to assess the quality of the labelled cDNA before its hybridization onto a microarray platform. There were major differences in the cDNA profile (i.e. cDNA fragment lengths and abundance) as a result of using four different columns for purification. In addition, different columns have different efficiencies to remove rRNA contamination. This study indicates that the appropriate column to use in this type of protocol has to be experimentally determined. Finally, we present new evidence establishing the importance of testing the method of purification used during an indirect labelling procedure. Our results confirm the importance of assessing the quality of the sample in the labelling procedure prior to hybridization onto a microarray platform. Standardization of column purification systems to be used in labelling procedures will improve the reproducibility of microarray results among different laboratories. In addition, implementation of a quality control check point of the labelled samples prior to microarray hybridization will prevent hybridizing a poor quality sample to expensive micorarrays.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Expression of CCK Receptors in Carcinoma Gallbladder and Cholelithiasis: A Pilot Study.

PubMed

Faridi, Mohammad Shazib; Jaiswal, Mahabir Saran Das; Goel, Sudhir K

2015-07-01

Gastrin and cholecystokinin (CCK) receptors are trophic for various gastrointestinal malignancies. Their role in gallbladder cancer has not been widely studied. To identify expression of CCK-A and CCK-B receptors in the tissue and blood of patients suffering from carcinoma (CA) gallbladder and gallstone disease and to compare expression of CCK A and B receptors in the gall bladder tissue and blood of healthy individuals and patients of CA gallbladder, and gallstone diseases. Forty nine subjects of both genders were recruited, comprising of 22 patients of CA gall bladder, 19 cases of cholelithiasis and, 8 normal gallbladders obtained from patients operated for trauma of the biliary system or Whipple's procedure. RNA extraction and cDNA formation for CCK-A and CCK-B receptors were carried out. Real Time PCR was performed on cDNA and threshold cycle (Ct) value of each sample was obtained and ΔCt was calculated. Chi-square test for comparing two groups and ANOVA test for comparing multiple groups were applied and if p<0.05 then Dunnett-C test was performed. Both CCK-A and CCK-B receptors were expressed irrespective of its origin in all tissues and blood samples studied; be it normal, Cholelithiasis or CA gallbladder and there was no difference among them (p>0.05). This preliminary study showed higher expression of CCK-A receptors in patients of cholelithiasis and decreased expression of CCK-A receptors in patients of CA gallbladder as compared to normal gallbladder although it did not rise to statistical significance.

Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

PubMed

Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

2016-08-02

Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

CDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

[Complete nucleotide sequences and genome structure of two Chinese tobacco mosaic virus isolates deduced from full-length infectious cDNA clones].

PubMed

Yang, G; Liu, X G; Qiu, B S

2000-07-01

The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.

A receptor autoradiographic and in situ hybridization analysis of the distribution of the 5-ht7 receptor in rat brain.

PubMed Central

Gustafson, E. L.; Durkin, M. M.; Bard, J. A.; Zgombick, J.; Branchek, T. A.

1996-01-01

1. Receptor autoradiography and in situ hybridization histochemistry have been used to delineate the distribution of the 5-ht7 receptor and its mRNA in rat brain. Receptor autoradiographic studies were performed using [3H]-5-carboxamidotryptamine (5-CT) as the radioligand. The binding characteristics of the masking compounds were determined in Cos-7 cells transfected with a panel of 5-HT receptor subtype cDNAs, including the rat 5-ht7 cDNA. In situ hybridization studies were carried out with 35S-labelled oligonucleotide probes to the rat 5-ht7 mRNA. 2. Specific binding of [3H]-5-CT was observed in many areas of the rat brain. Following co-incubation with 1 microM ergotamine, this binding was completely eliminated. After addition of the masking ligands, [3H]-5-CT binding remained in layers 1-3 of cortex, septum, globus pallidus, thalamus, hypothalamus, centromedial amygdala, substantia nigra, periaquaductal gray, and superior colliculus. Addition of the antagonist, methiothepin, to the incubation regimen eliminated most of the remaining [3H]-5-CT binding in the brain, with the exception of the globus pallidus and substantia nigra. 3. The 5-ht7 mRNA was discretely localized in rat brain. The most intense hybridization signals were observed over the thalamus, the anterior hippocampal rudiment, and over the CA3 region of the hippocampus. Other regions containing hybridization signals included the septum, the hypothalamus, the centromedial amygdala and the periaquaductal gray. The regions exhibiting a modest receptor binding signal after methiothepin incubation, the globus pallidus and the substantia nigra, contained no 5-ht7 hybridization signals, suggesting a non-5-ht7 subtype in these two related structures. 4. The distribution of the 5-ht7 receptor and its mRNA is suggestive of multiple roles for this novel 5-HT receptor, within several brain systems. The limbic system (centromedial amygdala, anterior hippocampal rudiment, hypothalamus) is particularly well

A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

PubMed Central

Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

1989-01-01

Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

PubMed

Hargreaves, Adam D; Mulley, John F

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

PubMed Central

Hargreaves, Adam D.

2015-01-01

Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

Molecular and functional characterization of the first tick CAP2b (periviscerokinin) receptor from Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).

PubMed

Yang, Yunlong; Bajracharya, Prati; Castillo, Paula; Nachman, Ronald J; Pietrantonio, Patricia V

2013-12-01

The cDNA of the receptor for CAP(2b)/periviscerokinin (PVK) neuropeptides, designated Rhimi-CAP(2b)-R, was cloned from synganglia of tick Rhipicephalus (Boophilus) microplus. This receptor is the ortholog of the insect CAP(2b)/PVK receptor, as concluded from analyses of the predicted protein sequence, phylogenetics and functional expression. Expression analyses of synganglion, salivary gland, Malpighian tubule, and ovary revealed Rhimi-CAP(2b)-R transcripts. The expression in mammalian cells of the open reading frame of Rhimi-CAP(2b)-R cDNA fused with a hemagglutinin tag at the receptor N-terminus was confirmed by immunocytochemistry. In a calcium bioluminescence assay the recombinant receptor was activated by the tick Ixodes scapularis CAP(2b)/PVK and a PVK analog with EC₅₀s of 64 nM and 249 nM, respectively. Tick pyrokinins were not active. This is the first report on the functional characterization of the CAP(2b)/PVK receptor from any tick species which will now permit the discovery of the physiological roles of these neuropeptides in ticks, as neurohormones, neuromodulators and/or neurotransmitters. Copyright © 2013 Elsevier Inc. All rights reserved.

Inverse agonist and neutral antagonist actions of synthetic compounds at an insect 5-HT1 receptor

PubMed Central

Troppmann, B; Balfanz, S; Baumann, A; Blenau, W

2010-01-01

Background and purpose: 5-Hydroxytryptamine (5-HT) has been shown to control and modulate many physiological and behavioural functions in insects. In this study, we report the cloning and pharmacological properties of a 5-HT1 receptor of an insect model for neurobiology, physiology and pharmacology. Experimental approach: A cDNA encoding for the Periplaneta americana 5-HT1 receptor was amplified from brain cDNA. The receptor was stably expressed in HEK 293 cells, and the functional and pharmacological properties were determined in cAMP assays. Receptor distribution was investigated by RT-PCR and by immunocytochemistry using an affinity-purified polyclonal antiserum. Key results: The P. americana 5-HT1 receptor (Pea5-HT1) shares pronounced sequence and functional similarity with mammalian 5-HT1 receptors. Activation with 5-HT reduced adenylyl cyclase activity in a dose-dependent manner. Pea5-HT1 was expressed as a constitutively active receptor with methiothepin acting as a neutral antagonist, and WAY 100635 as an inverse agonist. Receptor mRNA was present in various tissues including brain, salivary glands and midgut. Receptor-specific antibodies showed that the native protein was expressed in a glycosylated form in membrane samples of brain and salivary glands. Conclusions and implications: This study marks the first pharmacological identification of an inverse agonist and a neutral antagonist at an insect 5-HT1 receptor. The results presented here should facilitate further analyses of 5-HT1 receptors in mediating central and peripheral effects of 5-HT in insects. PMID:20233210

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Characterization of tumor differentiation factor (TDF) and its receptor (TDF-R).

PubMed

Sokolowska, Izabela; Woods, Alisa G; Gawinowicz, Mary Ann; Roy, Urmi; Darie, Costel C

2013-08-01

Tumor differentiation factor (TDF) is an under-investigated protein produced by the pituitary with no definitive function. TDF is secreted into the bloodstream and targets the breast and prostate, suggesting that it has an endocrine function. Initially, TDF was indirectly discovered based on the differentiation effect of alkaline pituitary extracts of the mammosomatotropic tumor MtTWlO on MTW9/PI rat mammary tumor cells. Years later, the cDNA clone responsible for this differentiation activity was isolated from a human pituitary cDNA library using expression cloning. The cDNA encoded a 108-amino-acid polypeptide that had differentiation activity on MCF7 breast cancer cells and on DU145 prostate cancer cells in vitro and in vivo. Recently, our group focused on identification of the TDF receptor (TDF-R). As potential TDF-R candidates, we identified the members of the Heat Shock 70-kDa family of proteins (HSP70) in both MCF7 and BT-549 human breast cancer cells (HBCC) and PC3, DU145, and LNCaP human prostate cancer cells (HPCC), but not in HeLa cells, NG108 neuroblastoma, or HDF-a and BLK CL.4 cells fibroblasts or fibroblast-like cells. Here we review the current advances on TDF, with particular focus on the structural investigation of its receptor and on its functional effects on breast and prostate cells.

Non-biased and efficient global amplification of a single-cell cDNA library

PubMed Central

Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki

2014-01-01

Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095

Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

PubMed

Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

2007-06-01

As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

The relationship between the agonist-induced activation and desensitization of the human tachykinin NK2 receptor expressed in Xenopus oocytes

PubMed Central

Maudsley, S; Gent, J P; Findlay, J B C; Donnelly, D

1998-01-01

Repeated applications of neurokinin A (NKA) to oocytes injected with 25 ng wild-type hNK2 receptor cRNA caused complete attenuation of second and subsequent NKA-induced responses while analogous experiments using repeated applications of GR64349 and [Nle10]NKA(4–10) resulted in no such desensitization. This behaviour has been previously attributed to the ability of the different ligands to stabilize different active conformations of the receptor that have differing susceptibilities to receptor kinases (Nemeth & Chollet, 1995).However, for Xenopus oocytes injected (into the nucleus) with 10 ng wild-type hNK2 receptor cDNA, a single 100 nM concentration of any of the three ligands resulted in complete desensitization to further concentrations.On the other hand, none of the ligands caused any desensitization in oocytes injected with 0.25 ng wild-type hNK2 receptor cRNA, even at concentrations up to 10 μM.The two N-terminally truncated analogues of neurokinin A have a lower efficacy than NKA and it is likely that it is this property which causes the observed differences in desensitization, rather than the formation of alternative active states of the receptor.The peak calcium-dependent chloride current is not a reliable measure of maximal receptor stimulation and efficacy is better measured in this system by studying agonist-induced desensitization.The specific adenylyl cyclase inhibitor SQ22536 can enhance NKA and GR64349-mediated desensitization which suggests that agonist-induced desensitization involves the inhibition of adenylyl cyclase and the subsequent down-regulation of the cyclic AMP-dependent protein kinase, possibly by cross-talk to a second signalling pathway. PMID:9690859

[Primary culture of cat intestinal epithelial cell and construction of its cDNA library].

PubMed

Ye, L; Gui-Hua, Z; Kun, Y; Hong-Fa, W; Ting, X; Gong-Zhen, L; Wei-Xia, Z; Yong, C

2017-04-12

Objective To establish the primary cat intestinal epithelial cells (IECs) culture methods and construct the cDNA library for the following yeast two-hybrid experiment, so as to screen the virulence interaction factors among the final host. Methods The primary cat IECs were cultured by the tissue cultivation and combined digestion with collagenase XI and dispase I separately. Then the cat IECs cultured was identified with the morphological observation and cyto-keratin detection, by using goat anti-cyto-keratin monoclonal antibodies. The mRNA of cat IECs was isolated and used as the template to synthesize the first strand cDNA by SMART™ technology, and then the double-strand cDNAs were acquired by LD-PCR, which were subsequently cloned into the plasmid PGADT7-Rec to construct yeast two-hybrid cDNA library in the yeast strain Y187 by homologous recombination. Matchmaker™ Insert Check PCR was used to detect the size distribution of cDNA fragments after the capacity calculation of the cDNA library. Results The comparison of the two cultivation methods indicated that the combined digestion of collagenase XI and dispase I was more effective than the tissue cultivation. The cat IECs system of continuous culture was established and the cat IECs with high purity were harvested for constructing the yeast two-hybrid cDNA library. The library contained 1.1×10 6 independent clones. The titer was 2.8×10 9 cfu/ml. The size of inserted fragments was among 0.5-2.0 kb. Conclusion The yeast two-hybrid cDNA library of cat IECs meets the requirements of further screen research, and this study lays the foundation of screening the Toxoplasma gondii virulence interaction factors among the cDNA libraries of its final hosts.

Expression of CCK Receptors in Carcinoma Gallbladder and Cholelithiasis: A Pilot Study

PubMed Central

Jaiswal, Mahabir Saran Das; Goel, Sudhir K.

2015-01-01

Background: Gastrin and cholecystokinin (CCK) receptors are trophic for various gastrointestinal malignancies. Their role in gallbladder cancer has not been widely studied. Objectives: To identify expression of CCK-A and CCK-B receptors in the tissue and blood of patients suffering from carcinoma (CA) gallbladder and gallstone disease and to compare expression of CCK A and B receptors in the gall bladder tissue and blood of healthy individuals and patients of CA gallbladder, and gallstone diseases. Materials and Methods: Forty nine subjects of both genders were recruited, comprising of 22 patients of CA gall bladder, 19 cases of cholelithiasis and, 8 normal gallbladders obtained from patients operated for trauma of the biliary system or Whipple’s procedure. RNA extraction and cDNA formation for CCK-A and CCK-B receptors were carried out. Real Time PCR was performed on cDNA and threshold cycle (Ct) value of each sample was obtained and ΔCt was calculated. Chi-square test for comparing two groups and ANOVA test for comparing multiple groups were applied and if p<0.05 then Dunnett-C test was performed. Observation and Results: Both CCK-A and CCK-B receptors were expressed irrespective of its origin in all tissues and blood samples studied; be it normal, Cholelithiasis or CA gallbladder and there was no difference among them (p>0.05). Conclusion: This preliminary study showed higher expression of CCK-A receptors in patients of cholelithiasis and decreased expression of CCK-A receptors in patients of CA gallbladder as compared to normal gallbladder although it did not rise to statistical significance. PMID:26393162

Differential cDNA cloning by enzymatic degrading subtraction (EDS).

PubMed Central

Zeng, J; Gorski, R A; Hamer, D

1994-01-01

We describe a new method, called enzymatic degrading subtraction (EDS), for the construction of subtractive libraries from PCR amplified cDNA. The novel features of this method are that i) the tester DNA is blocked by thionucleotide incorporation; ii) the rate of hybridization is accelerated by phenol-emulsion reassociation; and iii) the driver cDNA and hybrid molecules are enzymatically removed by digestion with exonucleases III and VII rather than by physical partitioning. We demonstrate the utility of EDS by constructing a subtractive library enriched for cDNAs expressed in adult but not in embryonic rat brains. Images PMID:7971268

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses.

PubMed

Kim, Unkyu; Siegel, Rachael; Ren, Xiaodi; Gunther, Cary S; Gaasterland, Terry; Roeder, Robert G

2003-07-22

The tissue-specific transcriptional coactivator OCA-B is required for antigen-dependent B cell differentiation events, including germinal center formation. However, the identity of OCA-B target genes involved in this process is unknown. This study has used large-scale cDNA arrays to monitor changes in gene expression patterns that accompany mature B cell differentiation. B cell receptor ligation alone induces many genes involved in B cell expansion, whereas B cell receptor and helper T cell costimulation induce genes associated with B cell effector function. OCA-B expression is induced by both B cell receptor ligation alone and helper T cell costimulation, suggesting that OCA-B is involved in B cell expansion as well as B cell function. Accordingly, several genes involved in cell proliferation and signaling, such as Lck, Kcnn4, Cdc37, cyclin D3, B4galt1, and Ms4a11, have been identified as OCA-B-dependent genes. Further studies on the roles played by these genes in B cells will contribute to an understanding of B cell differentiation.

Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor.

PubMed

Radford, Jonathan C; Terhzaz, Selim; Cabrero, Pablo; Davies, Shireen-A; Dow, Julian A T

2004-12-01

Identification of the Anopheles gambiae leucokinin gene from the completed A. gambiae genome revealed that this insect species contains three leucokinin peptides, named Anopheles leucokinin I-III. These peptides are similar to those identified in two other mosquito species, Aedes aegypti and Culex salinarius. Additionally, Anopheles leucokinin I displays sequence similarity to Drosophila melanogaster leucokinin. Using a combination of computational and molecular approaches, a full-length cDNA for a candidate leucokinin-like receptor was isolated from A. stephensi, a close relative of A. gambiae. Alignment of the known leucokinin receptors--all G protein-coupled receptors (GPCRs)--with this receptor, identified some key conserved regions within the receptors, notably transmembrane (TM) domains I, II, III, VI and VII. The Anopheles leucokinins and receptor were shown to be a functional receptor-ligand pair. All three Anopheles leucokinins caused a dose-dependent rise in intracellular calcium ([Ca2+]i) when applied to S2 cells co-expressing the receptor and an aequorin transgene, with a potency order of I>II>III. Drosophila leucokinin was also found to activate the Anopheles receptor with a similar EC50 value to Anopheles leucokinin I. However, when the Anopheles peptides were applied to the Drosophila receptor, only Anopheles leucokinin I and II elicited a rise in [Ca2+]i. This suggests that the Anopheles receptor has a broader specificity for leucokinin ligands than the Drosophila receptor. Antisera raised against the Anopheles receptor identified a doublet of approx. 65 and 72 kDa on western blots, consistent with the presence of four N-glycosylation sites within the receptor sequence, and the known glycosylation of the receptor in Drosophila. In Anopheles tubules, as in Drosophila, the receptor was localised to the stellate cells. Thus we provide the first identification of Anopheles mosquito leucokinins (Anopheles leucokinins) and a cognate leucokinin receptor

Design and screening of M13 phage display cDNA libraries.

PubMed

Georgieva, Yuliya; Konthur, Zoltán

2011-02-17

The last decade has seen a steady increase in screening of cDNA expression product libraries displayed on the surface of filamentous bacteriophage. At the same time, the range of applications extended from the identification of novel allergens over disease markers to protein-protein interaction studies. However, the generation and selection of cDNA phage display libraries is subjected to intrinsic biological limitations due to their complex nature and heterogeneity, as well as technical difficulties regarding protein presentation on the phage surface. Here, we review the latest developments in this field, discuss a number of strategies and improvements anticipated to overcome these challenges making cDNA and open reading frame (ORF) libraries more readily accessible for phage display. Furthermore, future trends combining phage display with next generation sequencing (NGS) will be presented.

Cloning, expression and functional role of a nociceptin/orphanin FQ receptor in the porcine gastrointestinal tract.

PubMed

Osinski, M A; Pampusch, M S; Murtaugh, M P; Brown, D R

1999-01-22

The heptadecapeptide nociceptin/orphanin FQ is the cognate ligand for the opioid receptor-like orphanin FQ (OFQ) receptor, a member of the G protein-coupled receptor superfamily. The gastrointestinal tract is a major site of opioid action, and preliminary evidence suggests that an OFQ receptor may be expressed in rat small intestine. We addressed the hypothesis that this receptor is expressed in the gastrointestinal tract of the pig, a model for the human digestive system. A 1205-bp cDNA was isolated from porcine forebrain which contained the 370 amino acid open reading frame encoding the OFQ receptor. The receptor mRNA is likely to arise from a single gene, as determined by Southern blotting of porcine genomic DNA restriction digests using a porcine OFQ receptor cDNA probe. A semi-nested reverse transcriptase-polymerase chain reaction survey of receptor mRNA indicates that it is expressed in the porcine cerebral cortex and kidney, and along the length of the gastrointestinal tract. OFQ decreased initial contractile responses of porcine ileal smooth muscle strips to trains of electrical field stimulation with an IC50 value of 1.3 nM; its effects were resistant to the opioid antagonist, naloxone. The peptide, at concentrations > or =3 nM, also attenuated Isc elevations evoked by electrical transmural stimulation of mucosa-submucosa sheets from porcine ileum. The actions of OFQ appeared to differ from those previously reported for opioid receptor agonists in these tissue preparations. These results indicate that an OFQ receptor is expressed in the porcine intestine which modulates the neural control of intestinal smooth muscle contractility and mucosal transport.

30 YEARS OF THE MINERALOCORTICOID RECEPTOR: Mineralocorticoid receptor antagonists: 60 years of research and development

PubMed Central

Bärfacker, Lars

2017-01-01

The cDNA of the mineralocorticoid receptor (MR) was cloned 30 years ago, in 1987. At that time, spirolactone, the first generation of synthetic steroid-based MR antagonists (MRAs), which was identified in preclinical in vivo models, had already been in clinical use for 30 years. Subsequent decades of research and development by Searle & Co., Ciba-Geigy, Roussel Uclaf and Schering AG toward identifying a second generation of much more specific steroidal MRAs were all based on the initial 17-spirolactone construct. The salient example is eplerenone, first described in 1987, coincidentally with the cloning of MR cDNA. Its launch on the market in 2003 paralleled intensive drug discovery programs for a new generation of non-steroidal MRAs. Now, 30 years after the cDNA cloning of MR and 60 years of clinical use of steroidal MRAs, novel non-steroidal MRAs such as apararenone, esaxerenone and finerenone are in late-stage clinical trials in patients with heart failure, chronic kidney disease (CKD), hypertension and liver disease. Finerenone has already been studied in over 2000 patients with heart failure plus chronic kidney disease and/or diabetes, and in patients with diabetic kidney disease, in five phase II clinical trials. Here, we reflect on the history of the various generations of MRAs and review characteristics of the most important steroidal and non-steroidal MRAs. PMID:28634268

Display of a maize cDNA library on baculovirus infected insect cells.

PubMed

Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

2008-08-12

Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

Identification of a second murine interleukin-11 receptor alpha-chain gene (IL11Ra2) with a restricted pattern of expression.

PubMed

Robb, L; Hilton, D J; Brook-Carter, P T; Begley, C G

1997-03-15

The interleukin-11 receptor alpha-chain, a member of the hematopoietin receptor superfamily, forms, together with gp130, a functional high-affinity receptor complex for interleukin 11. We, and others, reported the cloning of the murine interleukin 11 receptor alpha-chain cDNA (IL11Ra) and recently described the structure of the IL11Ra locus. We also described the presence of a second IL11Ra-like locus in some mouse strains. In this study we report that the second locus, designated IL11Ra2, encodes an mRNA species. The transcript was 99% identical to the IL11Ra transcript in the coding and 3'-untranslated region, but had a different 5'-untranslated region. The complete genomic organization of the IL11Ra2 locus is presented, and the two loci are shown to be located on a 200-kb NaeI genomic fragment. Comparison of the expression pattern of the IL11Ra and IL11Ra2 genes using an RT-PCR restriction fragment length polymorphism strategy revealed that while the expression of IL11Ra was widespread, expression of IL11Ra2 was restricted to testis, lymph node, and thymus.

Hibiscus latent Fort Pierce virus in Brazil and synthesis of its biologically active full-length cDNA clone.

PubMed

Gao, Ruimin; Niu, Shengniao; Dai, Weifang; Kitajima, Elliot; Wong, Sek-Man

2016-10-01

A Brazilian isolate of Hibiscus latent Fort Pierce virus (HLFPV-BR) was firstly found in a hibiscus plant in Limeira, SP, Brazil. RACE PCR was carried out to obtain the full-length sequences of HLFPV-BR which is 6453 nucleotides and has more than 99.15 % of complete genomic RNA nucleotide sequence identity with that of HLFPV Japanese isolate. The genomic structure of HLFPV-BR is similar to other tobamoviruses. It includes a 5' untranslated region (UTR), followed by open reading frames encoding for a 128-kDa protein and a 188-kDa readthrough protein, a 38-kDa movement protein, 18-kDa coat protein, and a 3' UTR. Interestingly, the unique feature of poly(A) tract is also found within its 3'-UTR. Furthermore, from the total RNA extracted from the local lesions of HLFPV-BR-infected Chenopodium quinoa leaves, a biologically active, full-length cDNA clone encompassing the genome of HLFPV-BR was amplified and placed adjacent to a T7 RNA polymerase promoter. The capped in vitro transcripts from the cloned cDNA were infectious when mechanically inoculated into C. quinoa and Nicotiana benthamiana plants. This is the first report of the presence of an isolate of HLFPV in Brazil and the successful synthesis of a biologically active HLFPV-BR full-length cDNA clone.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Functional domains of the poliovirus receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koike, Satoshi; Ise, Iku; Nomoto, Akio

1991-05-15

A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

Induction of an interleukin-1 receptor (IL-1R) on monocytic cells. Evidence that the receptor is not encoded by a T cell-type IL-1R mRNA.

PubMed

Spriggs, M K; Lioubin, P J; Slack, J; Dower, S K; Jonas, U; Cosman, D; Sims, J E; Bauer, J

1990-12-25

Primary human monocytes and the human monocytic cell line THP-1 were induced to express receptors for interleukin-1 alpha (IL-1 alpha) and IL-1 beta. Treatment of primary monocytes with dexamethasone resulted in a 10-fold increase in receptor number over untreated cells, to approximately 2,000 receptors/cell. Treatment of THP-1 cells with phorbol ester followed by prostaglandin E2 and dexamethasone resulted in the expression of approximately 30,000 receptors/cell. Competitive binding assays on THP-1 cells showed that both IL-1 alpha and IL-1 beta bind to the same receptor. The monocyte IL-1R is significantly smaller (63 kDa) than the T cell IL-1R (80 kDa) and is immunologically distinct. However, induction of monocytes and monocytic cell lines leads to the appearance of an abundant mRNA of approximately 5,000 bases which hybridizes to a cDNA probe from the T cell-type IL-1R. Sequence data obtained from a cDNA clone of this mRNA indicate that the message is identical to the T cell IL-1R mRNA throughout the coding region. A smaller mRNA, also homologous to the T cell IL-1R mRNA, accumulated in induced THP-1 cells and has a shorter 3'-untranslated region than the larger. Data are presented which suggest that neither form of this message encodes the 63-kDa IL-1R, but rather that this protein is the product of a separate nonhomologous mRNA.

The cDNA sequence of a neutral horseradish peroxidase.

PubMed

Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

1991-02-16

A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

Tissue Gene Expression Analysis Using Arrayed Normalized cDNA Libraries

PubMed Central

Eickhoff, Holger; Schuchhardt, Johannes; Ivanov, Igor; Meier-Ewert, Sebastian; O'Brien, John; Malik, Arif; Tandon, Neeraj; Wolski, Eryk-Witold; Rohlfs, Elke; Nyarsik, Lajos; Reinhardt, Richard; Nietfeld, Wilfried; Lehrach, Hans

2000-01-01

We have used oligonucleotide-fingerprinting data on 60,000 cDNA clones from two different mouse embryonic stages to establish a normalized cDNA clone set. The normalized set of 5,376 clones represents different clusters and therefore, in almost all cases, different genes. The inserts of the cDNA clones were amplified by PCR and spotted on glass slides. The resulting arrays were hybridized with mRNA probes prepared from six different adult mouse tissues. Expression profiles were analyzed by hierarchical clustering techniques. We have chosen radioactive detection because it combines robustness with sensitivity and allows the comparison of multiple normalized experiments. Sensitive detection combined with highly effective clustering algorithms allowed the identification of tissue-specific expression profiles and the detection of genes specifically expressed in the tissues investigated. The obtained results are publicly available (http://www.rzpd.de) and can be used by other researchers as a digital expression reference. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. AL360374–AL36537.] PMID:10958641

[Construction of fetal mesenchymal stem cell cDNA subtractive library].

PubMed

Yang, Li; Wang, Dong-Mei; Li, Liang; Bai, Ci-Xian; Cao, Hua; Li, Ting-Yu; Pei, Xue-Tao

2002-04-01

To identify differentially expressed genes between fetal mesenchymal stem cell (MSC) and adult MSC, especially specified genes expressed in fetal MSC, a cDNA subtractive library of fetal MSC was constructed using suppression subtractive hybridization (SSH) technique. At first, total RNA was isolated from fetal and adult MSC. Using SMART PCR synthesis method, single-strand and double-strand cDNAs were synthesized. After Rsa I digestion, fetal MSC cDNAs were divided into two groups and ligated to adaptor 1 and adaptor 2 respectively. Results showed that the amplified library contains 890 clones. Analysis of 890 clones with PCR demonstrated that 768 clones were positive. The positive rate is 86.3%. The size of inserted fragments in these positive clones was between 0.2 - 1 kb, with an average of 400 - 600 bp. SSH is a convenient and effective method for screening differentially expressed genes. The constructed cDNA subtractive library of fetal MSC cDNA lays solid foundation for screening and cloning new and specific function related genes of fetal MSC.

MASQOT: a method for cDNA microarray spot quality control

PubMed Central

Bylesjö, Max; Eriksson, Daniel; Sjödin, Andreas; Sjöström, Michael; Jansson, Stefan; Antti, Henrik; Trygg, Johan

2005-01-01

Background cDNA microarray technology has emerged as a major player in the parallel detection of biomolecules, but still suffers from fundamental technical problems. Identifying and removing unreliable data is crucial to prevent the risk of receiving illusive analysis results. Visual assessment of spot quality is still a common procedure, despite the time-consuming work of manually inspecting spots in the range of hundreds of thousands or more. Results A novel methodology for cDNA microarray spot quality control is outlined. Multivariate discriminant analysis was used to assess spot quality based on existing and novel descriptors. The presented methodology displays high reproducibility and was found superior in identifying unreliable data compared to other evaluated methodologies. Conclusion The proposed methodology for cDNA microarray spot quality control generates non-discrete values of spot quality which can be utilized as weights in subsequent analysis procedures as well as to discard spots of undesired quality using the suggested threshold values. The MASQOT approach provides a consistent assessment of spot quality and can be considered an alternative to the labor-intensive manual quality assessment process. PMID:16223442

3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

PubMed

Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

2004-01-01

The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

PubMed Central

Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

1992-01-01

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

Seabream ghrelin: cDNA cloning, genomic organization and promoter studies.

PubMed

Yeung, Chung-Man; Chan, Chi-Bun; Woo, Norman Y S; Cheng, Christopher H K

2006-05-01

Recent studies have indicated that ghrelin stimulates growth hormone release from the pituitary via the growth hormone secretagogue receptor (GHSR). We have previously isolated two GHSR subtypes from the pituitary of the black seabream Acanthopagrus schlegeli. In the present study, we have cloned and characterized ghrelin from the same fish species at both the cDNA and gene levels. The full-length seabream ghrelin cDNA, isolated from sea-bream stomach using a novel approach by exploiting a single conserved region in the coding region, was found to encode a prepropeptide of 107 amino acids, with the predicted mature ghrelin peptide consisting of 20 amino acids (GSSFLSPSQKPQNRGKSSRV). Embedded in this full-length cDNA is a putative fish orthologue of the recently reported mammalian obestatin peptide. The ghrelin gene in black seabream, obtained by genomic PCR, was found to encompass four exons and three introns, possessing the same structural organization as in tilapia and goldfish, but different from that in rainbow trout. In addition, a 2230-bp 5'-flanking region of the seabream ghrelin gene was obtained by genome walking. Sequence analysis revealed that, as in the case of the human ghrelin gene, there is neither a GC box nor a CAAT box present in the isolated 5'-flanking region. However, a number of putative transcription factor-binding sites different from the human counterpart were found in the 5'-flanking region of the seabream ghrelin gene, suggesting that different cis- and trans-acting elements are involved in controlling their gene expression. Functional activity of this 5'-flanking region was examined by cloning it into the pGL3-Basic vector upstream of the luciferase reporter gene and transfected into various cell lines. Positive promoter activity could only be recorded in the colon-derived Caco-2 cells, suggesting that the cloned 5'-flanking region represents the functional promoter of the seabream ghrelin gene, which exhibits tissue-specific promoter

Heterologous Array Analysis in Pinaceae: Hybridization of Pinus Taeda cDNA Arrays With cDNA From Needles and Embryogenic Cultures of P. Taeda, P. Sylvestris or Picea Abies

PubMed Central

van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov

2002-01-01

Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264

Fatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptor.

PubMed Central

Göttlicher, M; Widmark, E; Li, Q; Gustafsson, J A

1992-01-01

Peroxisome proliferators such as clofibric acid, nafenopin, and WY-14,643 have been shown to activate PPAR (peroxisome proliferator-activated receptor), a member of the steroid nuclear receptor superfamily. We have cloned the cDNA from the rat that is homologous to that from the mouse [Issemann, I. & Green, S. (1990) Nature (London) 347, 645-650], which encodes a 97% similar protein with a particularly well-conserved putative ligand-binding domain. To search for physiologically occurring activators, we established a transcriptional transactivation assay by stably expressing in CHO cells a chimera of rat PPAR and the human glucocorticoid receptor that activates expression of the placental alkaline phosphatase reporter gene under the control of the mouse mammary tumor virus promoter. Testing of compounds related to lipid metabolism or peroxisomal proliferation revealed that 150 microM concentrations of arachidonic or linoleic acid but not of dehydroepiandrosterone, cholesterol, or 25-hydroxy-cholesterol, activate the receptor chimera. In addition, saturated fatty acids induce the reporter gene. Shortening the chain length to n = 6 or introduction of an omega-terminal carboxylic group abolished the activation potential of the fatty acid. In conclusion, the present results indicate that fatty acids can regulate gene expression mediated by a member of the steroid nuclear receptor superfamily. Images PMID:1316614

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

PubMed

Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

2003-09-01

The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

PubMed

Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

2005-03-01

To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

PubMed

Liu, G; Gelboin, H V; Myers, M J

1991-02-01

The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

The Pekin duck programmed death-ligand 1: cDNA cloning, genomic structure, molecular characterization and mRNA expression analysis.

PubMed

Yao, Q; Fischer, K P; Tyrrell, D L; Gutfreund, K S

2015-04-01

Programmed death ligand-1 (PD-L1) plays an important role in the attenuation of adaptive immune responses in higher vertebrates. Here, we describe the identification of the Pekin duck PD-L1 orthologue (duPD-L1) and its gene structure. The duPD-L1 cDNA encodes a 311-amino acid protein that has an amino acid identity of 78% and 42% with chicken and human PD-L1, respectively. Mapping of the duPD-L1 cDNA with duck genomic sequences revealed an exonic structure of its coding sequence similar to those of other vertebrates but lacked a noncoding exon 1. Homology modelling of the duPD-L1 extracellular domain was compatible with the tandem IgV-like and IgC-like IgSF domain structure of human PD-L1 (PDB ID: 3BIS). Residues known to be important for receptor binding of human PD-L1 were mostly conserved in duPD-L1 within the N-terminus and the G sheet, and partially conserved within the F sheet but not within sheets C and C'. DuPD-L1 mRNA was constitutively expressed in all tissues examined with highest expression levels in lung and spleen and very low levels of expression in muscle, kidney and brain. Mitogen stimulation of duck peripheral blood mononuclear cells transiently increased duPD-L1 mRNA expression. Our observations demonstrate evolutionary conservation of the exonic structure of its coding sequence, the extracellular domain structure and residues implicated in receptor binding, but the role of the longer cytoplasmic tail in avian PD-L1 proteins remains to be determined. © 2014 John Wiley & Sons Ltd.

Type 1 angiotensin II receptor-associated protein ARAP1 binds and recycles the receptor to the plasma membrane.

PubMed

Guo, Deng-Fu; Chenier, Isabelle; Tardif, Valerie; Orlov, Sergei N; Inagami, Tadashi

2003-10-31

The carboxyl terminus of the type 1 angiotensin II receptor (AT(1)) plays an important role in receptor phosphorylation, desensitization, and internalization. The yeast two-hybrid system was employed to isolate proteins associated with the carboxyl terminal region of the AT(1A) receptor. In the present study, we report the isolation of a novel protein, ARAP1, which promotes recycling of AT(1A) to the plasma membrane in HEK-293 cells. ARAP1 cDNA encodes a 493-amino-acid protein and its mRNA is ubiquitously expressed in rat tissues. A complex of ARAP1 and AT(1A) was observed by immunoprecipitation and Western blotting in HEK-293 cells. In the presence of ARAP1, recycled AT(1A) showed a significant Ca(2+) release response to a second stimulation by Ang II 30 min after the first treatment. Immunocytochemical analysis revealed co-localization of recycled AT(1A) and ARAP1 in the plasma membrane 45 min after the initial exposure to Ang II. Taken together, these results indicate a role for ARAP1 in the recycling of the AT(1) receptor to the plasma membrane with presumable concomitant recovery of receptor signal functions.

Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

PubMed

Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

2003-10-01

A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

[Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

PubMed

Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

2003-07-01

Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

cDNA encoding a polypeptide including a hev ein sequence

DOEpatents

Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

β1,4-galactosyltransferase 1 is a novel receptor for IgA in human mesangial cells.

PubMed

Molyneux, Karen; Wimbury, David; Pawluczyk, Izabella; Muto, Masahiro; Bhachu, Jasraj; Mertens, Peter R; Feehally, John; Barratt, Jonathan

2017-12-01

IgA nephropathy is characterized by mesangial deposition of IgA, mesangial cell proliferation, and extracellular matrix production. Mesangial cells bind IgA, but the identity of all potential receptors involved remains incomplete. The transferrin receptor (CD71) acts as a mesangial cell IgA receptor and its expression is upregulated in many forms of glomerulonephritis, including IgA nephropathy. CD71 is not expressed in healthy glomeruli and blocking CD71 does not completely abrogate mesangial cell IgA binding. Previously we showed that mesangial cells express a receptor that binds the Fc portion of IgA and now report that this receptor is an isoform of β-1,4-galactosyltransferase. A human mesangial cell cDNA library was screened for IgA binding proteins and β-1,4-galactosyltransferase identified. Cell surface expression of the long isoform of β-1,4-galactosyltransferase was shown by flow cytometry and confocal microscopy and confirmed by immunoblotting. Glomerular β-1,4-galactosyltransferase expression was increased in IgA nephropathy. IgA binding and IgA-induced mesangial cell phosphorylation of spleen tyrosine kinase and IL-6 synthesis were inhibited by a panel of β-1,4-galactosyltransferase-specific antibodies, suggesting IgA binds to the catalytic domain of β-1,4-galactosyltransferase. Thus, β-1,4-galactosyltransferase is a constitutively expressed mesangial cell IgA receptor with an important role in both mesangial IgA clearance and the initial response to IgA deposition. Copyright © 2017 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

History of retinoic acid receptors.

PubMed

Benbrook, Doris M; Chambon, Pierre; Rochette-Egly, Cécile; Asson-Batres, Mary Ann

2014-01-01

The discovery of retinoic acid receptors arose from research into how vitamins are essential for life. Early studies indicated that Vitamin A was metabolized into an active factor, retinoic acid (RA), which regulates RNA and protein expression in cells. Each step forward in our understanding of retinoic acid in human health was accomplished by the development and application of new technologies. Development cDNA cloning techniques and discovery of nuclear receptors for steroid hormones provided the basis for identification of two classes of retinoic acid receptors, RARs and RXRs, each of which has three isoforms, α, β and ɣ. DNA manipulation and crystallographic studies revealed that the receptors contain discrete functional domains responsible for binding to DNA, ligands and cofactors. Ligand binding was shown to induce conformational changes in the receptors that cause release of corepressors and recruitment of coactivators to create functional complexes that are bound to consensus promoter DNA sequences called retinoic acid response elements (RAREs) and that cause opening of chromatin and transcription of adjacent genes. Homologous recombination technology allowed the development of mice lacking expression of retinoic acid receptors, individually or in various combinations, which demonstrated that the receptors exhibit vital, but redundant, functions in fetal development and in vision, reproduction, and other functions required for maintenance of adult life. More recent advancements in sequencing and proteomic technologies reveal the complexity of retinoic acid receptor involvement in cellular function through regulation of gene expression and kinase activity. Future directions will require systems biology approaches to decipher how these integrated networks affect human stem cells, health, and disease.

A BIOINFORMATIC STRATEGY TO RAPIDLY CHARACTERIZE CDNA LIBRARIES

EPA Science Inventory

A Bioinformatic Strategy to Rapidly Characterize cDNA Libraries

G. Charles Ostermeier1, David J. Dix2 and Stephen A. Krawetz1.
1Departments of Obstetrics and Gynecology, Center for Molecular Medicine and Genetics, & Institute for Scientific Computing, Wayne State Univer...

Cloning, in Vitro expression, and novel phylogenetic classification of a channel catfish estrogen receptor

USGS Publications Warehouse

Xia, Z.; Patino, R.; Gale, W.L.; Maule, A.G.; Densmore, L.D.

1999-01-01

We obtained two channel catfish estrogen receptor (ccER) cDNA from liver of female fish using RT–PCR. The two fragments were identical in sequence except that the smaller one had an out-of-frame deletion in the E domain, suggesting the existence of ccER splice variants. The larger fragment was used to screen a cDNA library from liver of a prepubescent female. A cDNA was obtained that encoded a 581-amino-acid ER with a deduced molecular weight of 63.8 kDa. Extracts of COS-7 cells transfected with ccER cDNA bound estrogen with high affinity (Kd = 4.7 nM) and specificity. Maximum parsimony and Neighbor Joining analyses were used to generate a phylogenetic classification of ccER on the basis of 18 full-length ER sequences. The tree suggested the existence of two major ER branches. One branch contained two clearly divergent clades which included all piscine ER (except Japanese eel ER) and all tetrapod ERα, respectively. The second major branch contained the eel ER and the mammalian ERβ. The high degree of divergence between the eel ER and mammalian ERβ suggested that they also represent distinct piscine and tetrapod ER. These data suggest that ERα and ERβ are present throughout vertebrates and that these two major ER types evolved by duplication of an ancestral ER gene. Sequence alignments with other members of the nuclear hormone receptor superfamily indicated the presence of 8 amino acids in the E domain that align exclusively among ER. Four of these amino acids have not received prior research attention and their function is unknown. The novel finding of putative ER splice variants in a nonmammalian vertebrate and the novel phylogenetic classification of ER offer new perspectives in understanding the diversification and function of ER.

Amino acid sequence of the human fibronectin receptor

PubMed Central

1987-01-01

The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481

Isolation, cDNA cloning and gene expression of an antibacterial protein from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros.

PubMed

Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M

1998-08-01

An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

Molecular identification and partial sequence analysis of an aryl hydrocarbon receptor from beluga (Delphinapterus leucas)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jensen, B.A.; Hahn, M.E.

1995-12-31

The aryl hydrocarbon receptor (AhR) mediates the effects of many common and potentially toxic organic hydrocarbons, including some polychlorinated biphenyls and dioxins. Since small cetaceans often inhabit industrially polluted coastal waters, comparison of the molecular structure and function of this protein in cetaeans with other marine and mammalian species is important for evaluating the sensitivity of cetaceans to these pollutants. An AhR protein has been identified in beluga liver by photoaffinity labeling. In the present study, the authors sought to clone and sequence an AhR cDNA from beluga as a prelude to studying its structure and function, using reverse-transcription polymerasemore » chain reaction (RT-PCR) and degenerate primers, a 515 base pair fragment was amplified, cloned and sequenced, revealing homology to the PAS domain (ligand binding and dimerization region) of AhRs from terrestrial mammals. This portion of the putative beluga AhR has 82% amino acid and 81% nucleotide sequence identity to the mouse AhR, and 63% amino acid and 64% nucleotide sequence identity to an AhR from the marine fish Fundulus heteroclitus. A beluga cDNA library was synthesized and is currently being screened with the PCR-generated fragment to obtain the complete coding sequence. This is the first molecular evidence of AhR presence in cetaceans.« less

Identification of a G protein coupled receptor induced in activated T cells.

PubMed

Kaplan, M H; Smith, D I; Sundick, R S

1993-07-15

Many genes are induced after T cell activation to make a cell competent for proliferation and ultimately, function. Many of these genes encode surface receptors for growth factors that signal a cell to proliferate. We have cloned a novel gene (clone 6H1) that codes for a member of the G protein-coupled receptor superfamily. This gene was isolated from a chicken activated T cell cDNA library by low level hybridization to mammalian IL-2 cDNA probes. The 308 amino acid open reading frame has seven hydrophobic, presumably transmembrane domains and a consensus site for interaction with G proteins. Tissue distribution studies suggest that gene expression is restricted to activated T cells. The message appears by 1 h after activation and is maintained for at least 45 h. Transcription of 6H1 is induced by a number of T cell stimuli and is inhibited by cyclosporin A, but not by cycloheximide. This is the first description of a member of this superfamily expressed specifically in activated T cells. The gene product may provide a link between T cell growth factors and G protein activation.

( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Branchek, T.; Adham, N.; Macchi, M.

1990-11-01

The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

V3 vasopressin receptor and corticotropic phenotype in pituitary and nonpituitary tumors.

PubMed

de Keyzer, Y; René, P; Lenne, F; Auzan, C; Clauser, E; Bertagna, X

1997-01-01

Pituitary corticotropic cells express a specific vasopressin receptor, called V1b or V3, through which vasopressin stimulates corticotropin secretion. We recently cloned a cDNA coding for this receptor and showed that it belongs to the G protein-coupled receptor family. V3 mRNA is readily detected by RT-PCR in normal human pituitaries and corticotropic pituitary adenomas but not in PRL or GH-secreting adenomas, thus demonstrating that, like POMC itself and the CRH receptor, V3 is a marker of the corticotropic phenotype. Nuclease protection experiments suggest that V3 is overexpressed in some corticotropic adenomas, and thus may play a role in tumor development by activating the phospholipase C-signalling pathway. In addition analysis of its expression in nonpituitary neuroendocrine tumors showed a striking association with carcinoids of the lung responsible for the ectopic ACTH syndrome.

Neuronal deletion of ghrelin receptor almost completely prevents diet-induced obesity

USDA-ARS?s Scientific Manuscript database

Ghrelin signaling has major effects on energy- and glucose-homeostasis, but it is unknown whether ghrelin's functions are centrally and/or peripherally mediated. The ghrelin receptor, Growth Hormone Secretagogue Receptor (GHS-R), is highly expressed in brain and detectable in some peripheral tissues...

The structure of the human interferon alpha/beta receptor gene.

PubMed

Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

1992-02-05

Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

Expression of bitter taste receptors of the T2R family in the gastrointestinal tract and enteroendocrine STC-1 cells.

PubMed

Wu, S Vincent; Rozengurt, Nora; Yang, Moon; Young, Steven H; Sinnett-Smith, James; Rozengurt, Enrique

2002-02-19

Although a role for the gastric and intestinal mucosa in molecular sensing has been known for decades, the initial molecular recognition events that sense the chemical composition of the luminal contents has remained elusive. Here we identified putative taste receptor gene transcripts in the gastrointestinal tract. Our results, using reverse transcriptase-PCR, demonstrate the presence of transcripts corresponding to multiple members of the T2R family of bitter taste receptors in the antral and fundic gastric mucosa as well as in the lining of the duodenum. In addition, cDNA clones of T2R receptors were detected in a rat gastric endocrine cell cDNA library, suggesting that these receptors are expressed, at least partly, in enteroendocrine cells. Accordingly, expression of multiple T2R receptors also was found in STC-1 cells, an enteroendocrine cell line. The expression of alpha subunits of G proteins implicated in intracellular taste signal transduction, namely Galpha(gust), and Galpha(t)-(2), also was demonstrated in the gastrointestinal mucosa as well as in STC-1 cells, as revealed by reverse transcriptase-PCR and DNA sequencing, immunohistochemistry, and Western blotting. Furthermore, addition of compounds widely used in bitter taste signaling (e.g., denatonium, phenylthiocarbamide, 6-n-propil-2-thiouracil, and cycloheximide) to STC-1 cells promoted a rapid increase in intracellular Ca(2+) concentration. These results demonstrate the expression of bitter taste receptors of the T2R family in the mouse and rat gastrointestinal tract.

NORMAL NASAL GENE EXPRESSION LEVELS USING CDNA ARRAY TECHNOLOGY

EPA Science Inventory

Normal Nasal Gene Expression Levels Using cDNA Array Technology.

The nasal epithelium is a target site for chemically-induced toxicity and carcinogenicity. To detect and analyze genetic events which contribute to nasal tumor development, we first defined the gene expressi...

Construction of a cDNA library for miniature pig mandibular deciduous molars

PubMed Central

2014-01-01

Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

HUNT: launch of a full-length cDNA database from the Helix Research Institute.

PubMed

Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

2001-01-01

The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.

PubMed

Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing

2016-02-02

Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

PubMed Central

Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

1987-01-01

Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

[Cloning and sequence analysis of full-length cDNA of secoisolariciresinol dehydrogenase of Dysosma versipellis].

PubMed

Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen

2009-06-01

To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.

Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

PubMed

Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

1999-12-01

An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

Impaired helix 12 dynamics due to proline 892 substitutions in the androgen receptor are associated with complete androgen insensitivity.

PubMed

Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A

2006-03-15

Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.

Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

PubMed

Sugimoto, H; Hayashi, H; Yamashita, S

1996-03-29

A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

Development and Application of a Salmonid EST Database and cDNA Microarray: Data Mining and Interspecific Hybridization Characteristics

PubMed Central

Rise, Matthew L.; von Schalburg, Kristian R.; Brown, Gordon D.; Mawer, Melanie A.; Devlin, Robert H.; Kuipers, Nathanael; Busby, Maura; Beetz-Sargent, Marianne; Alberto, Roberto; Gibbs, A. Ross; Hunt, Peter; Shukin, Robert; Zeznik, Jeffrey A.; Nelson, Colleen; Jones, Simon R.M.; Smailus, Duane E.; Jones, Steven J.M.; Schein, Jacqueline E.; Marra, Marco A.; Butterfield, Yaron S.N.; Stott, Jeff M.; Ng, Siemon H.S.; Davidson, William S.; Koop, Ben F.

2004-01-01

We report 80,388 ESTs from 23 Atlantic salmon (Salmo salar) cDNA libraries (61,819 ESTs), 6 rainbow trout (Oncorhynchus mykiss) cDNA libraries (14,544 ESTs), 2 chinook salmon (Oncorhynchus tshawytscha) cDNA libraries (1317 ESTs), 2 sockeye salmon (Oncorhynchus nerka) cDNA libraries (1243 ESTs), and 2 lake whitefish (Coregonus clupeaformis) cDNA libraries (1465 ESTs). The majority of these are 3′ sequences, allowing discrimination between paralogs arising from a recent genome duplication in the salmonid lineage. Sequence assembly reveals 28,710 different S. salar, 8981 O. mykiss, 1085 O. tshawytscha, 520 O. nerka, and 1176 C. clupeaformis putative transcripts. We annotate the submitted portion of our EST database by molecular function. Higher- and lower-molecular-weight fractions of libraries are shown to contain distinct gene sets, and higher rates of gene discovery are associated with higher-molecular weight libraries. Pyloric caecum library group annotations indicate this organ may function in redox control and as a barrier against systemic uptake of xenobiotics. A microarray is described, containing 7356 salmonid elements representing 3557 different cDNAs. Analyses of cross-species hybridizations to this cDNA microarray indicate that this resource may be used for studies involving all salmonids. PMID:14962987

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

PubMed Central

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

PubMed Central

Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

1998-01-01

The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

Isolation and characterization of a cDNA clone specific for avian vitellogenin II.

PubMed Central

Protter, A A; Wang, S Y; Shelness, G S; Ostapchuk, P; Williams, D L

1982-01-01

A clone for vitellogenin, a major avian, estrogen responsive egg yolk protein, was isolated from the cDNA library of estrogen-induced rooster liver. Two forms of plasma vitellogenin, vitellogenin I (VTG I) and vitellogenin II (VTG II), distinguishable on the basis of their unique partial proteolysis maps, have been characterized and their corresponding hepatic precursor forms identified. We have used this criterion to specifically characterize which vitellogenin protein had been cloned. Partial proteolysis maps of BTG I and VTG II standards, synthesized in vivo, were compared to maps of protein synthesized in vitro using RNA hybrid-selected by the vitellogenin plasmid. Eight major digest fragments were found common to the in vitro synthesized vitellogenin and the VTG II standard while no fragments were observed to correspond to the VTG I map. A restriction map of the VTG II cDNA clone permits comparison to previously described cDNA and genomic vitellogenin clones. Images PMID:6182527

Molecular characterization and expression analysis of osteopontin cDNA from lactating mammary gland in yak (Bos grunniens).

PubMed

Bai, W L; Yang, R J; Yin, R H; Jiang, W Q; Luo, G B; Yin, R L; Zhao, S J; Li, C; Zhao, Z H

2012-04-01

Osteopontin (OPN) is a secreted phosphorylated glycoprotein. It has an important role in mammary gland development and lactation, as well as, is thought to be a potential candidate gene for lactation traits. In the present work, we isolated and characterized a full-length open reading frame (ORF) of yak OPN cDNA from lactating mammary tissue, and examined its expression pattern in mammary gland during different stages of lactation, as well as, the recombinant OPN protein of yak was expressed successfully in E. coli. The sequencing results indicated that the isolated cDNA was 1132-bp in length containing a complete ORF of 837-bp. It encoded a precursor protein of yak OPN consisting of 278 amino acid with a signal peptide of 16 amino acids. Yak OPN has a predicted molecular mass of 29285.975 Da and an isoelectric point of 4.245. It had an identity of 65.50-99.16% in cDNA, identity of 52.06-98.56% and similarity of 65.40-98.56% in deduced amino acids with the corresponding sequences of cattle, buffalo, sheep, goat, pig, human, and rabbit. The phylogenetic analysis indicated that yak OPN had the closest evolutionary relationship with that of cattle, and next buffalo. In mammary gland, yak OPN was generally transcribed in a declining pattern from colostrum period to dry period with an apparent increase of OPN expression being present in the late period of lactation compared with peak period of lactation. Western blot analysis indicated that His-tagged yak OPN protein expressed in E. coli could be recognized not only by an anti-His-tag antibody but also by an anti-human OPN antibody. These results from the present work provided a foundation for further insight into the role of OPN gene in yak lactation.

Characterization of avian T-cell receptor γ genes

PubMed Central

Six, Adrien; Rast, Jonathan P.; McCormack, Wayne T.; Dunon, Dominique; Courtois, David; Li, Yue; Chen, Chen-lo H.; Cooper, Max D.

1996-01-01

In birds and mammals T cells develop along two discrete pathways characterized by expression of either the αβ or the γδ T-cell antigen receptors (TCRs). To gain further insight into the evolutionary significance of the γδ T-cell lineage, the present studies sought to define the chicken TCRγ locus. A splenic cDNA library was screened with two polymerase chain reaction products obtained from genomic DNA using primers for highly conserved regions of TCR and immunoglobulin genes. This strategy yielded cDNA clones with characteristics of mammalian TCR γ chains, including canonical residues considered important for proper folding and stability. Northern blot analysis with the TCRγ cDNA probe revealed 1.9-kb transcripts in the thymus, spleen, and a γδ T-cell line, but not in B or αβ T-cell lines. Three multimember Vγ subfamilies, three Jγ gene segments, and a single constant region Cγ gene were identified in the avian TCRγ locus. Members of each of the three Vγ subfamilies were found to undergo rearrangement in parallel during the first wave of thymocyte development. TCRγ repertoire diversification was initiated on embryonic day 10 by an apparently random pattern of V-Jγ recombination, nuclease activity, and P- and N-nucleotide additions to generate a diverse repertoire of avian TCRγ genes early in ontogeny. PMID:8986811

Human RON receptor tyrosine kinase induces complete epithelial-to-mesenchymal transition but causes cellular senescence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cote, Marceline; Miller, A. Dusty; Liu, Shan-Lu

2007-08-17

The RON receptor tyrosine kinase is a member of the MET proto-oncogene family and is important for cell proliferation, differentiation, and cancer development. Here, we created a series of Madin-Darby canine kidney (MDCK) epithelial cell clones that express different levels of RON, and have investigated their biological properties. While low levels of RON correlated with little morphological change in MDCK cells, high levels of RON expression constitutively led to morphological scattering or complete and stabilized epithelial-to-mesenchymal transition (EMT). Unexpectedly, MDCK clones expressing higher levels of RON exhibited retarded proliferation and senescence, despite increased motility and invasiveness. RON was constitutively tyrosine-phosphorylatedmore » in MDCK cells expressing high levels of RON and undergoing EMT, and the MAPK signaling pathway was activated. This study reveals for the first time that RON alone is sufficient to induce complete and stabilized EMT in MDCK cells, and overexpression of RON does not cause cell transformation but rather induces cell cycle arrest and senescence, leading to impaired cell proliferation.« less

Single-round selection yields a unique retroviral envelope utilizing GPR172A as its host receptor.

PubMed

Mazari, Peter M; Linder-Basso, Daniela; Sarangi, Anindita; Chang, Yehchung; Roth, Monica J

2009-04-07

The recognition by a viral envelope of its cognate host-cell receptor is the initial critical step in defining the viral host-range and tissue specificity. This study combines a single-round of selection of a random envelope library with a parallel cDNA screen for receptor function to identify a distinct retroviral envelope/receptor pair. The 11-aa targeting domain of the modified feline leukemia virus envelope consists of a constrained peptide. Critical to the binding of the constrained peptide envelope to its cellular receptor are a pair of internal cysteines and an essential Trp required for maintenance of titers >10(5) lacZ staining units per milliliter. The receptor used for viral entry is the human GPR172A protein, a G-protein-coupled receptor isolated from osteosarcoma cells. The ability to generate unique envelopes capable of using tissue- or disease-specific receptors marks an advance in the development of efficient gene-therapy vectors.

A Brassica oleracea gene expressed in a variety-specific manner may encode a novel plant transmembrane receptor.

PubMed

Palmer, J E; Dikeman, D A; Fujinuma, T; Kim, B; Jones, J I; Denda, M; Martínez-Zapater, J M; Cruz-Alvarez, M

2001-04-01

The species Brassica oleracea includes several agricultural varieties characterized by the proliferation of different types of meristems. Using a combination of subtractive hybridization and PCR (polymerase chain reaction) techniques we have identified several genes which are expressed in the reproductive meristems of the cauliflower curd (B. oleracea var. botrytis) but not in the vegetative meristems of Brussels sprouts (B. oleracea var. gemmifera) axillary buds. One of the cloned genes, termed CCE1 (CAULIFLOWER CURD EXPRESSION 1) shows specific expression in the botrytis variety. Preferential expression takes place in this variety in the meristems of the curd and in the stem throughout the vegetative and reproductive stages of plant growth. CCE1 transcripts are not detected in any of the organs of other B. oleracea varieties analyzed. Based on the nucleotide sequence of a cDNA encompassing the complete coding region, we predict that this gene encodes a transmembrane protein, with three transmembrane domains. The deduced amino acid sequence includes motifs conserved in G-protein-coupled receptors (GPCRs) from yeast and animal species. Our results suggest that the cloned gene encodes a protein belonging to a new, so far unidentified, family of transmembrane receptors in plants. The expression pattern of the gene suggests that the receptor may be involved in the control of meristem development/arrest that takes place in cauliflower.

Complete nucleotide and derived amino acid sequence of cDNA encoding the mitochondrial uncoupling protein of rat brown adipose tissue: lack of a mitochondrial targeting presequence.

PubMed Central

Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B

1986-01-01

A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461

Identification of a novel aminergic-like G protein-coupled receptor in the cnidarian Renilla koellikeri.

PubMed

Bouchard, Christelle; Ribeiro, Paula; Dubé, François; Demers, Christian; Anctil, Michel

2004-10-27

Biogenic amines exert various physiological effects in cnidarians, but the receptors involved in these responses are not known. We have cloned a novel G protein-coupled receptor cDNA from an anthozoan, the sea pansy Renilla koellikeri, that shows homology to mammalian catecholamine receptors and, to a lesser extent, to peptidergic receptors. This putative receptor, named Ren2, has a DRC pattern that replaces the well-conserved DRY motif on the cytoplasmic side of the transmembrane III and lacks the cysteine residues usually found in the second extracellular loop and C-terminus tail. Both the second extracellular loop and the N-terminal tail were seen to be short (six and three amino acids, respectively). Northern blot analysis suggests that the receptor gene codes for two transcripts. Localization of these transcripts by in situ hybridization demonstrated abundant expression in the epithelium of the pharyngeal wall, the oral disk and tentacles as well as in the endodermal epithelium lining the gastrovascular cavities.

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Molecular characterisation of the salmon louse, Lepeophtheirus salmonis salmonis (Krøyer, 1837), ecdysone receptor with emphasis on functional studies of female reproduction.

PubMed

Sandlund, Liv; Nilsen, Frank; Male, Rune; Grotmol, Sindre; Kongshaug, Heidi; Dalvin, Sussie

2015-02-01

The salmon louse Lepeophtheirus salmonis (Copepoda, Caligidae) is an important parasite in the salmon farming industry in the Northern Hemisphere causing annual losses of hundreds of millions of dollars (US) worldwide. To facilitate development of a vaccine or other novel measures to gain control of the parasite, knowledge about molecular biological functions of L. salmonis is vital. In arthropods, a nuclear receptor complex consisting of the ecdysone receptor and the retinoid X receptor, ultraspiracle, are well known to be involved in a variety of both developmental and reproductive processes. To investigate the role of the ecdysone receptor in the salmon louse, we isolated and characterised cDNA with the 5'untranslated region of the predicted L. salmonis EcR (LsEcR). The LsEcR cDNA was 1608 bp encoding a 536 amino acid sequence that demonstrated high sequence similarities to other arthropod ecdysone receptors including Tribolium castaneum and Locusta migratoria. Moreover, in situ analysis of adult female lice revealed that the LsEcR transcript is localised in a wide variety of tissues such as ovaries, sub-cuticula and oocytes. Knock-down studies of LsEcR using RNA interference terminated egg production, indicating that the LsEcR plays important roles in reproduction and oocyte maturation. We believe this is the first report on the ecdysone receptor in the economically important parasite L. salmonis. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

Primary culture of cat intestinal epithelial cells in vitro and the cDNA library construction.

PubMed

Zhao, Gui Hua; Liu, Ye; Cheng, Yun Tang; Zhao, Qing Song; Qiu, Xiao; Xu, Chao; Xiao, Ting; Zhu, Song; Liu, Gong Zhen; Yin, Kun

2018-06-26

Felids are the only definitive hosts of Toxoplasma gondii. To lay a foundation for screening the T. gondii-felids interaction factors, we have developed a reproducible primary culture method for cat intestinal epithelial cells (IECs). The primary IECs were isolated from a new born cat's small intestine jejunum region without food ingress, and respectively in vitro cultured by tissue cultivation and combined digestion method with collagenase XI and dispase I, then purified by trypsinization. After identification, the ds cDNA of cat IECs was synthesized for constructing pGADT7 homogenization three-frame plasmid, and transformed into the yeast Y187 for generating the cDNA library. Our results indicated that cultivation of primary cat IECs relays on combined digestion to form polarized and confluent monolayers within 3 days with typical features of normal epithelial cells. The purified cells cultured by digestion method were identified to be nature intestinal epithelial cells using immunohistochemical analysis and were able to maintain viability for at least 15 passages. The homogenizable ds cDNA, which is synthesized from the total RNA extracted from our cultured IECs, distributed among 0.5-2.0 kb, and generated satisfying three-frame cDNA library with the capacity of 1.2 × 106 and the titer of 5.2 × 107 pfu/mL. Our results established an optimal method for the culturing and passage of cat IECs model in vitro, and laid a cDNA library foundation for the subsequent interaction factors screening by yeast two-hybrid.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Purification and cDNA cloning of a protein derived from Flammulina velutipes that increases the permeability of the intestinal Caco-2 cell monolayer.

PubMed

Watanabe, H; Narai, A; Shimizu, M

1999-06-01

A new protein that decreases transepithelial electrical resistance (TEER) in the human intestinal Caco-2 cell monolayer was found in a water-soluble fraction of the mushroom Flammulina velutipes. This protein, termed TEER-decreasing protein (TDP), is not cytotoxic and does not induce cell detachment, but rapidly increases the tight junctional permeability for water-soluble marker substances such as Lucifer Yellow CH (Mr 457) through the paracellular pathway. TDP was isolated and purified from the aqueous extract of F. velutipes by chromatographic means. Purified TDP was found to be a simple, nonglycosylated protein without intermolecular disulfide bonds, and the apparent molecular mass as estimated by SDS/PAGE and gel filtration is 30 kDa. It was revealed that the N-terminal amino-acid sequence of purified TDP is identical to the recently reported N-terminal sequence of flammutoxin, a membrane-perturbing hemolytic protein, for which the complete primary structure has not yet been reported [Tomita, T., Ishikawa, D., Noguchi, T., Katayama, E., and Hashimoto, Y. (1998) Biochem. J. 333, 24794-24799]. The cDNA coding for TDP was cloned by 5' and 3' rapid amplification of cDNA ends. The ORF encodes a protein with 272 amino-acid residues showing no homology to known proteins. Relevant studies using TDP cDNA will provide insight into the structure-function relationships of membrane pore-forming toxins.

cDNA cloning and isolation of somatolactin in Mozambique tilapia and effects of seawater acclimation, confinement stress, and fasting on its pituitary expression.

PubMed

Uchida, Katsuhisa; Moriyama, Shunsuke; Breves, Jason P; Fox, Bradley K; Pierce, Andrew L; Borski, Russell J; Hirano, Tetsuya; Grau, E Gordon

2009-04-01

Somatolactin (SL) is a member of the growth hormone (GH)/prolactin (PRL) family of pituitary hormones, and is found in a variety of teleost species. Somatolactin is thought to be involved in a wide range of physiological actions, including reproduction, stress response, the regulation of Ca(2+) and acid-base balance, growth, metabolism, and immune response. We report here on the cDNA structure of SL from the pituitary of Mozambique tilapia, Oreochromis mossambicus, and its gene expression in response to seawater acclimation, stress, and fasting. Tilapia SL cDNA (1573bp long) encoded a prehormone of 230 amino acids. Sequence analysis of purified SL revealed that the prehormone is composed of a signal peptide of 23 amino acids and a mature protein of 207 amino acids, which has a possible N-glycosylation site at position 121 and seven Cys residues. Tilapia SL shows over 80% amino acid identity with SLalpha of advanced teleosts such as medaka and flounder, and around 50% identity with SLbeta of carp and goldfish. Acclimation to seawater had no effect on pituitary expression of SL or on hepatic expression of the putative tilapia SL receptor (GHR1). By contrast, seawater acclimation resulted in significant increases in pituitary GH expression and in hepatic expression of tilapia GH receptor (GHR2). Confinement stress had no effect on pituitary expression of either SL or GH, or on hepatic expression of GHR1, whereas a significant increase was seen in GHR2 expression in the liver. Fasting for 4 weeks resulted in significant reductions in SL transcripts both in fresh water and seawater. It is highly likely that SL is involved in metabolic processes in tilapia along with the GH/IGF-I axis.

Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

PubMed Central

Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

1998-01-01

Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

First complete genome sequence of an emerging cucumber green mottle mosaic virus isolate in North America

USDA-ARS?s Scientific Manuscript database

The complete genome sequence (6,423 nt) of an emerging Cucumber green mottle mosaic virus (CGMMV) isolate on cucumber in North America was determined through deep sequencing of sRNA and rapid amplification of cDNA ends. It shares 99% nucleotide sequence identity to the Asian genotype, but only 90% t...

MOLECULAR CHARACTERIZATION OF ENDOCRINE DISRUPTION IN FISH USING CDNA ARRAYS.

EPA Science Inventory

We are developing cDNA macroarrays to measure the induction of gene expression in sheepshead minnows and largemouth bass exposed to anthropogenic chemicals that can mimic the action of endogenous hormones. For sheepshead minnows exposed in aqua, we observed similar genetic profil...

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

HAVCR1 (CD365) and Its Mouse Ortholog Are Functional Hepatitis A Virus (HAV) Cellular Receptors That Mediate HAV Infection.

PubMed

Costafreda, Maria Isabel; Kaplan, Gerardo

2018-05-01

The hepatitis A virus (HAV) cellular receptor 1 (HAVCR1), classified as CD365, was initially discovered as an HAV cellular receptor using an expression cloning strategy. Due to the lack of HAV receptor-negative replication-competent cells, it was not possible to fully prove that HAVCR1 was a functional HAV receptor. However, biochemistry, classical virology, and epidemiology studies further supported the functional role of HAVCR1 as an HAV receptor. Here, we show that an anti-HAVCR1 monoclonal antibody that protected African green monkey kidney (AGMK) cells against HAV infection only partially protected monkey Vero E6 cells and human hepatoma Huh7 cells, indicating that these two cell lines express alternative yet unidentified HAV receptors. Therefore, we focused our work on AGMK cells to further characterize the function of HAVCR1 as an HAV receptor. Advances in clustered regularly interspaced short palindromic repeat/Cas9 technology allowed us to knock out the monkey ortholog of HAVCR1 in AGMK cells. The resulting AGMK HAVCR1 knockout (KO) cells lost susceptibility to HAV infection, including HAV-free viral particles (vpHAV) and exosomes purified from HAV-infected cells (exo-HAV). Transfection of HAVCR1 cDNA into AGMK HAVCR1 KO cells restored susceptibility to vpHAV and exo-HAV infection. Furthermore, transfection of the mouse ortholog of HAVCR1, mHavcr1, also restored the susceptibility of AGMK HAVCR1 KO cells to HAV infection. Taken together, our data clearly show that HAVCR1 and mHavcr1 are functional HAV receptors that mediate HAV infection. This work paves the way for the identification of alternative HAV receptors to gain a complete understanding of their interplay with HAVCR1 in the cell entry and pathogenic processes of HAV. IMPORTANCE HAVCR1, an HAV receptor, is expressed in different cell types, including regulatory immune cells and antigen-presenting cells. How HAV evades the immune response during a long incubation period of up to 4 weeks and the

FIELD VALIDATION OF A SHEEPSHEAD MINNOW ESTROGEN-RESPONSIVE CDNA MACROARRAY

EPA Science Inventory

Hemmer, Michael J., Iris Knoebl, Becky L. Hemmer, Patrick Larkin, Peggy S. Harris and Nancy D. Denslow. In press. Field Validation of a Sheepshead Minnow Estrogen-Responsive cDNA Macroarray (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portl...

An efficient and sensitive method for preparing cDNA libraries from scarce biological samples

PubMed Central

Sterling, Catherine H.; Veksler-Lublinsky, Isana; Ambros, Victor

2015-01-01

The preparation and high-throughput sequencing of cDNA libraries from samples of small RNA is a powerful tool to quantify known small RNAs (such as microRNAs) and to discover novel RNA species. Interest in identifying the small RNA repertoire present in tissues and in biofluids has grown substantially with the findings that small RNAs can serve as indicators of biological conditions and disease states. Here we describe a novel and straightforward method to clone cDNA libraries from small quantities of input RNA. This method permits the generation of cDNA libraries from sub-picogram quantities of RNA robustly, efficiently and reproducibly. We demonstrate that the method provides a significant improvement in sensitivity compared to previous cloning methods while maintaining reproducible identification of diverse small RNA species. This method should have widespread applications in a variety of contexts, including biomarker discovery from scarce samples of human tissue or body fluids. PMID:25056322

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Complete Disruption of the Kainate Receptor Gene Family Results in Corticostriatal Dysfunction in Mice.

PubMed

Xu, Jian; Marshall, John J; Fernandes, Herman B; Nomura, Toshihiro; Copits, Bryan A; Procissi, Daniele; Mori, Susumu; Wang, Lei; Zhu, Yongling; Swanson, Geoffrey T; Contractor, Anis

2017-02-21

Kainate receptors are members of the glutamate receptor family that regulate synaptic function in the brain. They modulate synaptic transmission and the excitability of neurons; however, their contributions to neural circuits that underlie behavior are unclear. To understand the net impact of kainate receptor signaling, we generated knockout mice in which all five kainate receptor subunits were ablated (5ko). These mice displayed compulsive and perseverative behaviors, including over-grooming, as well as motor problems, indicative of alterations in striatal circuits. There were deficits in corticostriatal input to spiny projection neurons (SPNs) in the dorsal striatum and correlated reductions in spine density. The behavioral alterations were not present in mice only lacking the primary receptor subunit expressed in adult striatum (GluK2 KO), suggesting that signaling through multiple receptor types is required for proper striatal function. This demonstrates that alterations in striatal function dominate the behavioral phenotype in mice without kainate receptors. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Vitamin D receptor FokI genotype may modify the susceptibility to schizophrenia and bipolar mood disorder by regulation of dopamine D1 receptor gene expression.

PubMed

Ahmadi, S; Mirzaei, K; Hossein-Nezhad, A; Shariati, G

2012-10-01

This study is designed to test association of FOKI polymorphism in Vitamin D receptor (VDR) gene and its potential effect on expression of dopamine D1 receptor in schizophrenia and bipolar mood disorder as well as in healthy individuals. In this case-control study 196 patient with schizophrenia, 119 patients with bipolar mood disorder and 192 healthy individuals as the control group were recruited. All psychiatric disorders were diagnosed according to DSM IV criteria. Healthy control group denied any family history of such disorders. FOKI was genotyped by means of PCR-RFLP method. The mRNA was extracted from the peripheral blood mononuclear cells (PBMC) and the cDNA was synthesized. Frequency of ff genotype was more common in patients with bipolar disorders compared to the healthy control group (Odds ratio=1.84, 95% CI; 0.81 to 4.17) with increased relative risk (Relative risk=1.31, CI 95%; 0.86 to 1.99). There were significant differences between relative expressions of dopamine D1 receptor gene in various genotypes. Our results indicated that the ff genotype was associated with lower expression of dopamine D1 receptor gene. VDR as a nuclear receptor may contribute to bipolar disorders via modification of the expression of the neurotransmitters receptor such as dopamine.

Cloning and characterization of transferrin cDNA and rapid detection of transferrin gene polymorphism in rainbow trout (Oncorhynchus mykiss).

PubMed

Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T

1997-12-01

A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

PubMed

D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

1995-09-01

Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations.

PubMed

Oikonomopoulos, Spyros; Wang, Yu Chang; Djambazian, Haig; Badescu, Dunarel; Ragoussis, Jiannis

2016-08-24

To assess the performance of the Oxford Nanopore Technologies MinION sequencing platform, cDNAs from the External RNA Controls Consortium (ERCC) RNA Spike-In mix were sequenced. This mix mimics mammalian mRNA species and consists of 92 polyadenylated transcripts with known concentration. cDNA libraries were generated using a template switching protocol to facilitate the direct comparison between different sequencing platforms. The MinION performance was assessed for its ability to sequence the cDNAs directly with good accuracy in terms of abundance and full length. The abundance of the ERCC cDNA molecules sequenced by MinION agreed with their expected concentration. No length or GC content bias was observed. The majority of cDNAs were sequenced as full length. Additionally, a complex cDNA population derived from a human HEK-293 cell line was sequenced on an Illumina HiSeq 2500, PacBio RS II and ONT MinION platforms. We observed that there was a good agreement in the measured cDNA abundance between PacBio RS II and ONT MinION (rpearson = 0.82, isoforms with length more than 700bp) and between Illumina HiSeq 2500 and ONT MinION (rpearson = 0.75). This indicates that the ONT MinION can sequence quantitatively both long and short full length cDNA molecules.

A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

PubMed

Gadkar, Vijay J; Filion, Martin

2013-06-01

In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

5' Rapid Amplification of cDNA Ends and Illumina MiSeq Reveals B Cell Receptor Features in Healthy Adults, Adults With Chronic HIV-1 Infection, Cord Blood, and Humanized Mice.

PubMed

Waltari, Eric; Jia, Manxue; Jiang, Caroline S; Lu, Hong; Huang, Jing; Fernandez, Cristina; Finzi, Andrés; Kaufmann, Daniel E; Markowitz, Martin; Tsuji, Moriya; Wu, Xueling

2018-01-01

Using 5' rapid amplification of cDNA ends, Illumina MiSeq, and basic flow cytometry, we systematically analyzed the expressed B cell receptor (BCR) repertoire in 14 healthy adult PBMCs, 5 HIV-1+ adult PBMCs, 5 cord blood samples, and 3 HIS-CD4/B mice, examining the full-length variable region of μ, γ, α, κ, and λ chains for V-gene usage, somatic hypermutation (SHM), and CDR3 length. Adding to the known repertoire of healthy adults, Illumina MiSeq consistently detected small fractions of reads with high mutation frequencies including hypermutated μ reads, and reads with long CDR3s. Additionally, the less studied IgA repertoire displayed similar characteristics to that of IgG. Compared to healthy adults, the five HIV-1 chronically infected adults displayed elevated mutation frequencies for all μ, γ, α, κ, and λ chains examined and slightly longer CDR3 lengths for γ, α, and λ. To evaluate the reconstituted human BCR sequences in a humanized mouse model, we analyzed cord blood and HIS-CD4/B mice, which all lacked the typical SHM seen in the adult reference. Furthermore, MiSeq revealed identical unmutated IgM sequences derived from separate cell aliquots, thus for the first time demonstrating rare clonal members of unmutated IgM B cells by sequencing.

Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

PubMed

Schuetz, J D; Guzelian, P S

1995-03-14

We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

CLONING AND CHARACTERIZATION OF CDNA ENCODING GIARDIA LAMBLIA d-GIARDIN

USDA-ARS?s Scientific Manuscript database

A cDNA coding for d-giardin was cloned from Giardia lamblia trophozoites in order to localize the protein and study its function in mediating surface attachment. Recombinant d-giardin antigen was produced in Escherichia coli as a poly-histidine fusion protein and was purified by affinity chromatogr...

Construction of C35 gene bait recombinants and T47D cell cDNA library.

PubMed

Yin, Kun; Xu, Chao; Zhao, Gui-Hua; Liu, Ye; Xiao, Ting; Zhu, Song; Yan, Ge

2017-11-20

C35 is a novel tumor biomarker associated with metastasis progression. To investigate the interaction factors of C35 in its high expressed breast cancer cell lines, we constructed bait recombinant plasmids of C35 gene and T47D cell cDNA library for yeast two-hybrid screening. Full length C35 sequences were subcloned using RT-PCR from cDNA template extracted from T47D cells. Based on functional domain analysis, the full-length C35 1-348bp was also truncated into two fragments C351-153bp and C35154-348bp to avoid auto-activation. The three kinds of C35 genes were successfully amplified and inserted into pGBKT7 to construct bait recombinant plasmids pGBKT7-C351-348bp, pGBKT7-C351-153bp and pGBKT7-C35154-348bp, then transformed into Y187 yeast cells by the lithium acetate method. Auto-activation and toxicity of C35 baits were detected using nutritional deficient medium and X-α-Gal assays. The T47D cell ds cDNA was generated by SMART TM technology and the library was constructed using in vivo recombination-mediated cloning in the AH109 yeast strain using a pGADT7-Rec plasmid. The transformed Y187/pGBKT7-C351-348bp line was intensively inhibited while the truncated Y187/pGBKT7-C35 lines had no auto-activation and toxicity in yeast cells. The titer of established cDNA library was 2 × 10 7 pfu/mL with high transformation efficiency of 1.4 × 10 6 , and the insert size of ds cDNA was distributed homogeneously between 0.5-2.0 kb. Our research generated a T47D cell cDNA library with high titer, and the constructed two C35 "baits" contained a respective functional immunoreceptor tyrosine based activation motif (ITAM) and the conserved last four amino acids Cys-Ile-Leu-Val (CILV) motif, and therefore laid a foundation for screening the C35 interaction factors in a BC cell line.

Acetylcholinesterase of the Sand Fly, Phlebotomus papatasi (Scopoli): cDNA Sequence, Baculovirus Expression, and Biochemical Properties

DTIC Science & Technology

2013-01-01

identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a...tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85...improve effectiveness of pesticide application for control of the new world sand fly Lutzomyia longipalpis in chicken sheds [13]. Attempts to control

Integrating De Novo Transcriptome Assembly and Cloning to Obtain Chicken Ovocleidin-17 Full-Length cDNA

PubMed Central

Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full

Integrating de novo transcriptome assembly and cloning to obtain chicken Ovocleidin-17 full-length cDNA.

PubMed

Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng

2014-01-01

Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full

Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

PubMed Central

Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

1982-01-01

We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

Cloning and characterization of cDNA encoding cardosin A, an RGD-containing plant aspartic proteinase.

PubMed

Faro, C; Ramalho-Santos, M; Vieira, M; Mendes, A; Simões, I; Andrade, R; Veríssimo, P; Lin, X; Tang, J; Pires, E

1999-10-01

Cardosin A is an abundant aspartic proteinase from pistils of Cynara cardunculus L. whose milk-clotting activity has been exploited for the manufacture of cheese. Here we report the cloning and characterization of cardosin A cDNA. The deduced amino acid sequence contains the conserved features of plant aspartic proteinases, including the plant-specific insertion (PSI), and revealed the presence of an Arg-Gly-Asp (RGD) motif, which is known to function in cell surface receptor binding by extracellular proteins. Cardosin A mRNA was detected predominantly in young flower buds but not in mature or senescent pistils, suggesting that its expression is likely to be developmentally regulated. Procardosin A, the single chain precursor, was found associated with microsomal membranes of flower buds, whereas the active two-chain enzyme generated upon removal of PSI is soluble. This result implies a role for PSI in promoting the association of plant aspartic proteinase precursors to cell membranes. To get further insights about cardosin A, the functional relevance of the RGD motif was also investigated. A 100-kDa protein that interacts specifically with the RGD sequence was isolated from octyl glucoside pollen extracts by affinity chromatography on cardosin A-Sepharose. This result suggests that the 100-kDa protein is a cardosin A receptor and indicates that the interaction between these two proteins is apparently mediated through RGD recognition. It is possible therefore that cardosin A may have a role in adhesion-mediated proteolytic mechanisms involved in pollen recognition and growth.

Identification and Characterization of an Insulin-Like Receptor Involved in Crustacean Reproduction.

PubMed

Sharabi, O; Manor, R; Weil, S; Aflalo, E D; Lezer, Y; Levy, T; Aizen, J; Ventura, T; Mather, P B; Khalaila, I; Sagi, A

2016-02-01

Sexual differentiation and maintenance of masculinity in crustaceans has been suggested as being regulated by a single androgenic gland (AG) insulin-like peptide (IAG). However, downstream elements involved in the signaling cascade remain unknown. Here we identified and characterized a gene encoding an insulin-like receptor in the prawn Macrobrachium rosenbergii (Mr-IR), the first such gene detected in a decapod crustacean. In mining for IRs and other insulin signaling-related genes, we constructed a comprehensive M. rosenbergii transcriptomic library from multiple sources. In parallel we sequenced the complete Mr-IR cDNA, confirmed in the wide transcriptomic library. Mr-IR expression was detected in most tissues in both males and females, including the AG and gonads. To study Mr-IR function, we performed long-term RNA interference (RNAi) silencing in young male prawns. Although having no effect on growth, Mr-IR silencing advanced the appearance of a male-specific secondary trait. The most noted effects of Mr-IR silencing were hypertrophy of the AG and the associated increased production of Mr-IAG, with an unusual abundance of immature sperm cells being seen in the distal sperm duct. A ligand blot assay using de novo recombinant Mr-IAG confirmed the existence of a ligand-receptor interaction. Whereas these results suggest a role for Mr-IR in the regulation of the AG, we did not see any sexual shift after silencing of Mr-IR, as occurred when the ligand-encoding Mr-IAG gene was silenced. This suggests that sexual differentiation in crustaceans involve more than a single Mr-IAG receptor, emphasizing the complexity of sexual differentiation and maintenance.

Expression of functional receptors by the human γ-aminobutyric acid A γ2 subunit

PubMed Central

Martínez-Torres, Ataúlfo; Miledi, Ricardo

2004-01-01

γ-Aminobutyric acid A (GABAA) receptors are heteromeric membrane proteins formed mainly by various combinations of α, β, and γ subunits; and it is commonly thought that the γ2 subunit alone does not form functional receptors. In contrast, we found that cDNA encoding the γ2L subunit of the human GABAA receptor, injected alone into Xenopus oocytes, expressed functional GABA receptors whose properties were investigated by using the two-microelectrode voltage-clamp technique. GABA elicited desensitizing membrane currents that recovered after a few minutes' wash. Repetitive applications of GABA induced a “run-up” of GABA currents that nearly doubled the amplitude of the first response. The GABA currents inverted direction at about -30 mV, indicating that they are carried mainly by Cl- ions. The homomeric γ2L receptors were also activated by β-alanine > taurine > glycine, and, like some types of heteromeric GABAA receptors, the γ2L receptors were blocked by bicuculline and were potentiated by pentobarbital and flunitrazepam. These results indicate that the human γ2L subunit is capable of forming fully functional GABA receptors by itself in Xenopus oocytes and suggest that the roles proposed for the various subunits that make up the heteromeric GABAA receptors in situ require further clarification. PMID:14981251

Distinct effects of loss of classical estrogen receptor signaling versus complete deletion of estrogen receptor alpha on bone

PubMed Central

Syed, Farhan A.; Fraser, Daniel G.; Monroe, David G.; Khosla, Sundeep

2011-01-01

Estrogen receptor (ER)α is a major regulator of bone metabolism which can modulate gene expression via a “classical” pathway involving direct DNA binding to estrogen-response elements (EREs) or via “non-classical” pathways involving protein-protein interactions. While the skeletal consequences of loss of ERE binding by ERα have been described, a significant unresolved question is how loss of ERE binding differs from complete loss of ERα. Thus, we compared the skeletal phenotype of wild-type (ERα+/+) and ERα knock out (ERα−/−) mice with that of mice in which the only ERα present had a knock-in mutation abolishing ERE binding (non-classical ERα knock-in [NERKI], ERα−/NERKI). All three groups were in the same genetic background (C57BL/6). As compared to both ERα+/+ and ERα−/− mice, ERα−/NERKI mice had significantly reduced cortical volumetric bone mineral density and thickness at the tibial diaphysis; this was accompanied by significant decreases in periosteal and endocortical mineral apposition rates. Colony forming unit (CFU)-fibroblast, CFU-alkaline phosphatase, and CFU-osteoblast numbers were all increased in ERα−/− compared to ERα+/+ mice, but reduced in ERα−/NERKI mice compared to the two other groups. Thus, using mice in identical genetic backgrounds, our data indicate that the presence of an ERα that cannot bind DNA but can function through protein-protein interactions may have more deleterious skeletal effects than complete loss of ERα. These findings suggest that shifting the balance of classical versus non-classical ERα signaling triggers pathways that impair bone formation. Further studies defining these pathways may lead to novel approaches to selectively modulate ER signaling for beneficial skeletal effects. PMID:21458604

Transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to gelatin.

PubMed

Kubo, Miyoko; Clark, Richard A F; Katz, Anne B; Taichman, Lorne B; Jin, Zaishun; Zhao, Ying; Moriguchi, Takahiko

2007-04-01

alphavbeta3 is a multiligand integrin receptor that interacts with fibrinogen (FG), fibrin (FB), fibronectin (FN), vitronectin (VN), and denatured collagen. We previously reported that cultured normal human keratinocytes, like in vivo keratinocytes, do not express alphavbeta3 on the cell surface, and do not adhere to and migrate on FG and FB. Furthermore, we reported that human keratinocytes transduced with beta3 integrin subunit cDNA by a retrovirus-mediated transduction method express alphavbeta3 on the cell surface and adhere to FG, FB, FN, and VN significantly compared with beta-galactosidase (beta-gal) cDNA-transduced keratinocytes (control). In this study, we determined whether these beta3 integrin subunit cDNA-transduced keratinocytes or normal human keratinocytes adhere to denatured collagen (gelatin) using a 1 h cell adhesion assay. beta3 cDNA-transduced keratinocytes adhered to gelatin, whereas no significant adhesion was observed with the control cells (beta-gal cDNA-transduced keratinocytes and normal human keratinocytes). The adhesion to gelatin was inhibited by LM609, a monoclonal antibody to alphavbeta3, and RGD peptides but not by normal mouse IgG1 nor RGE peptides. Thus, transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to denatured collagen (gelatin) as well as to FG, FB, VN, and FN. Otherwise, normal human keratinocytes do not adhere to gelatin. These data support the idea that beta3 cDNA-transduced human keratinocytes can be a good material for cultured epithelium to achieve better take rate with acute or chronic wounds, in which FG, FB, and denatured collagen are abundantly present.

Novel receptor-like protein kinases induced by Erwinia carotovora and short oligogalacturonides in potato.

PubMed

Montesano, M; Kõiv, V; Mäe, A; Palva, E T

2001-11-01

summary Identification of potato genes responsive to cell wall-degrading enzymes of Erwinia carotovora resulted in the isolation of cDNA clones for four related receptor-like protein kinases. One of the putative serine-threonine protein kinases might have arisen through alternative splicing. These potato receptor-like kinases (PRK1-4) were highly equivalent (91-99%), most likely constituting a family of related receptors. All PRKs and four other plant RLKs share in their extracellular domain a conserved bi-modular pattern of cysteine repeats distinct from that in previously characterized plant RLKs, suggesting that they represent a new class of receptors. The corresponding genes were rapidly induced by E. carotovora culture filtrate (CF), both in the leaves and tubers of potato. Furthermore, the genes were transiently induced by short oligogalacturonides. The structural identity of PRKs and their induction pattern suggested that they constitute part of the early response of potato to E. carotovora infection.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

The chromodomain of Tf1 integrase promotes binding to cDNA and mediates target site selection.

PubMed

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D; Levin, Henry L

2009-03-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDDelta, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDDelta caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting.

Bombyx neuropeptide G protein-coupled receptor A7 is the third cognate receptor for short neuropeptide F from silkworm.

PubMed

Ma, Qiang; Cao, Zheng; Yu, Yena; Yan, Lili; Zhang, Wenjuan; Shi, Ying; Zhou, Naiming; Huang, Haishan

2017-12-15

The short neuropeptide F (sNPF) neuropeptides, closely related to vertebrate neuropeptide Y (NPY), have been suggested to exert pleiotropic effects on many physiological processes in insects. In the silkworm ( Bombyx mori ) two orphan G protein-coupled receptors, Bombyx neuropeptide G protein-coupled receptor (BNGR) A10 and A11, have been identified as cognate receptors for sNPFs, but other sNPF receptors and their signaling mechanisms in B. mori remain unknown. Here, we cloned the full-length cDNA of the orphan receptor BNGR-A7 from the brain of B. mori larvae and identified it as a receptor for Bombyx sNPFs. Further characterization of signaling and internalization indicated that BNGR-A7, -A10, and -A11 are activated by direct interaction with synthetic Bombyx sNPF-1 and -3 peptides. This activation inhibited forskolin or adipokinetic hormone-induced adenylyl cyclase activity and intracellular Ca 2+ mobilization via a G i/o -dependent pathway. Upon activation by sNPFs, BNGR-A7, -A10, and -A11 evoked ERK1/2 phosphorylation and underwent internalization. On the basis of these findings, we designated the receptors BNGR-A7, -A10, and -A11 as Bommo -sNPFR-1, -2, and -3, respectively. Moreover, the results obtained with quantitative RT-PCR analysis revealed that the three Bombyx sNPF receptor subtypes exhibit differential spatial and temporal expression patterns, suggesting possible roles of sNPF signaling in the regulation of a wide range of biological processes. Our findings provide the first in-depth information on sNPF signaling for further elucidation of the roles of the Bombyx sNPF/sNPFR system in the regulation of physiological activities. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

EXPRESSION PROFILING OF ESTROGENIC COMPOUNDS USING A SHEEPSHEAD MINNOW CDNA MACROARRAY

EPA Science Inventory

Larkin, Patrick, Leroy C. Folmar, Michael J. Hemmer, Arianna J. Poston and Nancy D. Denslow. 2003. Expression Profiling of Estrogenic Compounds Using a Sheepshead Minnow cDNA Macroarray. Environ. Health Perspect. 111(6):839-846. (ERL,GB 1171).

A variety of anthropogenic c...

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Molecular cloning and expression of a unique receptor-like protein-tyrosine-phosphatase in the leucocyte-common-antigen-related phosphate family.

PubMed Central

Zhang, W R; Hashimoto, N; Ahmad, F; Ding, W; Goldstein, B J

1994-01-01

Protein-tyrosine-phosphatases (PTPases) have been implicated in the regulation of certain tyrosine kinase growth factor receptors in that they dephosphorylate the activated (autophosphorylated) form of the receptors. In order to identify PTPases that potentially act on receptor targets in liver, we used the human leucocyte common antigen-related PTPase (LAR) cDNA [Streuli, Krueger, Hall, Schlossman and Saito (1988) J. Exp. Med. 168, 1523-1530] and isolated two closely related transmembrane PTPase homologues from a rat hepatic cDNA library. Both PTPases had large extracellular domains that contained three immunoglobulin-like repeats and eight type-III fibronectin repeats. Both enzymes had tandem homologous PTPase domains following a single hydrophobic transmembrane domain. One sequence encoded the rat homologue of LAR. The second PTPase, designated LAR-PTP2, had 79 and 90% identity with rat LAR in the respective cytoplasmic PTPase domains, with only 57% sequence similarity in the extracellular domain. The catalytic domains of LAR and LAR-PTP2 prepared by bacterial expression were active in dephosphorylating a variety of phosphotyrosyl substrates but did not hydrolyse phosphoserine or phosphothreonine residues of labelled casein. Both enzymes exhibited rapid turnover numbers of 4-7 s-1 for myelin basic protein and 78-150 s-1 for derivatized lysozyme. LAR and LAR-PTP2 displayed similar PTPase activity towards the simultaneous dephosphorylation of receptors of intact insulin and epidermal growth factor from liver membranes. These data indicate that there is a family of LAR-related PTPases that may regulate the phosphorylation state of receptor tyrosine kinases in liver and other tissues. Images Figure 1 Figure 4 Figure 5 Figure 6 PMID:8068021

Complete structure of the cell surface polysaccharide of Streptococcus oralis ATCC 10557: A receptor for lectin-mediated interbacterial adherence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abeygunawardana, C.; Bush, C.A.; Cisar, J.O.

1991-07-02

Lectin-carbohydrate binding is known to play an important role in a number of different cell-cell interactions including those between certain species of oral streptococci and actinomyces that colonize teeth. The cell wall polysaccharides of Streptococcus oralis ATCC 10557, S. oralis 34, and Streptococcus mitis J22, although not identical antigenically, each function as a receptor molecule for the galactose and N-acetylgalactosamine reactive fimbrial lectins of Actinomyces viscosus and Actinomyces naeslundii. Carbohydrate analysis of the receptor polysaccharide isolated from S. oralis ATCC 10557 shows galactose (3 mol), glucose (1 mol), GalNAc (1 mol), and rhamnose (1 mol). {sup 1}H NMR spectra ofmore » the polysaccharide show that is partially O-acetylated. Analysis of the {sup 1}H NMR spectrum of the de-O-acetylated polysaccharide shows that it is composed of repeating subunits containing six monosaccharides and that the subunits are joined by a phosphodiester linkage. The {sup 1}H and {sup 13}C NMR spectra were completely assigned by two-dimensional homonuclear correlation methods and by {sup 1}H-detected heteronuclear multiple-quantum correlation ({sup 1}H({sup 13}C)HMQC). The complete {sup 1}H and {sup 13}C assignment of the native polysaccharide was carried out by the same techniques augmented by a {sup 13}C-coupled hybrid HMQC-COSY method, which is shown to be especially useful for carbohydrates in which strong coupling and overlapping peaks in the {sup 1}H spectrum pose difficulties.« less

Cloning of habutobin cDNA and antithrombotic activity of recombinant protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sunagawa, Masanori; Nakamura, Mariko; Kosugi, Tadayoshi

2007-11-03

The habutobin cDNA was cloned from total RNA extracted from venom glands of Trimeresurus flavoviridis (the habu snake). The conceptual translation of 1539 bp of habutobin cDNA consists of 236 amino acids and its molecular weight is 25.7 kDa. Histidine (His)-tagged recombinant habutobin fusion protein, pET-r-habutobin and AcNPV-r-habutobin, was purified by bacterial system and baculoviral system, respectively. After refolding pET-r-habutobin, there were two protein bands at about 32 kDa and 65 kDa, indicating that habutobin might be produced as a monomer protein and processed to form two concatenated protein. Purified AcNPV-r-habutobin dose-dependently increased fibrin forming activity and inhibited collagen-induced aggregationmore » of rabbit washed platelets. Thus, AcNPV-r-habutobin produced by baculoviral system is very useful for study on structure-function relationship, which is necessary for developing an antithrombotic drug from habutobin.« less

Neurotensin is an antagonist of the human neurotensin NT2 receptor expressed in Chinese hamster ovary cells.

PubMed

Vita, N; Oury-Donat, F; Chalon, P; Guillemot, M; Kaghad, M; Bachy, A; Thurneyssen, O; Garcia, S; Poinot-Chazel, C; Casellas, P; Keane, P; Le Fur, G; Maffrand, J P; Soubrie, P; Caput, D; Ferrara, P

1998-11-06

The human levocabastine-sensitive neurotensin NT2 receptor was cloned from a cortex cDNA library and stably expressed in Chinese hamster ovary (CHO) cells in order to study its binding and signalling characteristics. The receptor binds neurotensin as well as several other ligands already described for neurotensin NT1 receptor. It also binds levocabastine, a histamine H1 receptor antagonist that is not recognised by neurotensin NT1 receptor. Neurotensin binding to recombinant neurotensin NT2 receptor expressed in CHO cells does not elicit a biological response as determined by second messenger measurements. Levocabastine, and the peptides neuromedin N and xenin were also ineffective on neurotensin NT2 receptor activation. Experiments with the neurotensin NT1 receptor antagonists SR48692 and SR142948A, resulted in the unanticipated discovery that both molecules are potent agonists on neurotensin NT2 receptor. Both compounds, following binding to neurotensin NT2 receptor, enhance inositol phosphates (IP) formation with a subsequent [Ca2+]i mobilisation; induce arachidonic acid release; and stimulate mitogen-activated protein kinase (MAPK) activity. Interestingly, these activities are antagonised by neurotensin and levocabastine in a concentration-dependent manner. These activities suggest that the human neurotensin NT2 receptor may be of physiological importance and that a natural agonist for the receptor may exist.

Immunotherapy targeting folate receptor induces cell death associated with autophagy in ovarian cancer

PubMed Central

Wen, Yunfei; Graybill, Whitney S.; Previs, Rebecca A.; Hu, Wei; Ivan, Cristina; Mangala, Lingegowda S.; Zand, Behrouz; Nick, Alpa M.; Jennings, Nicholas B.; Dalton, Heather J.; Sehgal, Vasudha; Ram, Prahlad; Lee, Ju-Seog; Vivas-Mejia, Pablo E.; Coleman, Robert L.; Sood, Anil K.

2014-01-01

Purpose Cancer cells are highly dependent on folate metabolism, making them susceptible to drugs that inhibit folate receptor activities. Targeting overexpressed folate receptor alpha (FRα) in cancer cells offers a therapeutic opportunity. We investigated the functional mechanisms of MORAB-003 (farletuzumab), a humanized monoclonal antibody against FRα, in ovarian cancer models. Experimental Design We first examined FRα expression in an array of human ovarian cancer cell lines and then assessed the in vivo effect of MORAB-003 on tumor growth and progression in several orthotopic mouse models of ovarian cancer derived from these cell lines. Molecular mechanisms of tumor cell death induced by MORAB-003 were investigated by cDNA and protein expression profiling analysis. Mechanistic studies were performed to determine the role of autophagy in MORAB-003–induced cell death. Results MORAB-003 significantly decreased tumor growth in the high-FRα IGROV1 and SKOV3ip1 models but not in the low-FRα A2780 model. MORAB-003 reduced proliferation but had no significant effect on apoptosis. Protein expression and cDNA microarray analyses showed that MORAB-003 regulated an array of autophagy-related genes. It also significantly increased expression of LC3 isoform II and enriched autophagic vacuolization. Blocking autophagy with hydroxychloroquine or bafilomycin A1 reversed the growth inhibition induced by MORAB-003. In add, alteration of FOLR1 gene copy number significantly correlated with shorter disease-free survival in patients with ovarian serous cystadenocarcinoma. Conclusions MORAB-003 displays prominent antitumor activity in ovarian cancer models expressing FRα at high levels. Blockade of folate receptor by MORAB-003 induced sustained autophagy and suppressed cell proliferation. PMID:25416196

Function and distribution of 5-HT2 receptors in the honeybee (Apis mellifera).

PubMed

Thamm, Markus; Rolke, Daniel; Jordan, Nadine; Balfanz, Sabine; Schiffer, Christian; Baumann, Arnd; Blenau, Wolfgang

2013-01-01

Serotonin plays a pivotal role in regulating and modulating physiological and behavioral processes in both vertebrates and invertebrates. In the honeybee (Apis mellifera), serotonin has been implicated in division of labor, visual processing, and learning processes. Here, we present the cloning, heterologous expression, and detailed functional and pharmacological characterization of two honeybee 5-HT2 receptors. Honeybee 5-HT2 receptor cDNAs were amplified from brain cDNA. Recombinant cell lines were established constitutively expressing receptor variants. Pharmacological properties of the receptors were investigated by Ca(2+) imaging experiments. Quantitative PCR was applied to explore the expression patterns of receptor mRNAs. The honeybee 5-HT2 receptor class consists of two subtypes, Am5-HT2α and Am5-HT2β. Each receptor gene also gives rise to alternatively spliced mRNAs that possibly code for truncated receptors. Only activation of the full-length receptors with serotonin caused an increase in the intracellular Ca(2+) concentration. The effect was mimicked by the agonists 5-methoxytryptamine and 8-OH-DPAT at low micromolar concentrations. Receptor activities were blocked by established 5-HT receptor antagonists such as clozapine, methiothepin, or mianserin. High transcript numbers were detected in exocrine glands suggesting that 5-HT2 receptors participate in secretory processes in the honeybee. This study marks the first molecular and pharmacological characterization of two 5-HT2 receptor subtypes in the same insect species. The results presented should facilitate further attempts to unravel central and peripheral effects of serotonin mediated by these receptors.

Function and Distribution of 5-HT2 Receptors in the Honeybee (Apis mellifera)

PubMed Central

Thamm, Markus; Rolke, Daniel; Jordan, Nadine; Balfanz, Sabine; Schiffer, Christian; Baumann, Arnd; Blenau, Wolfgang

2013-01-01

Background Serotonin plays a pivotal role in regulating and modulating physiological and behavioral processes in both vertebrates and invertebrates. In the honeybee (Apis mellifera), serotonin has been implicated in division of labor, visual processing, and learning processes. Here, we present the cloning, heterologous expression, and detailed functional and pharmacological characterization of two honeybee 5-HT2 receptors. Methods Honeybee 5-HT2 receptor cDNAs were amplified from brain cDNA. Recombinant cell lines were established constitutively expressing receptor variants. Pharmacological properties of the receptors were investigated by Ca2+ imaging experiments. Quantitative PCR was applied to explore the expression patterns of receptor mRNAs. Results The honeybee 5-HT2 receptor class consists of two subtypes, Am5-HT2α and Am5-HT2β. Each receptor gene also gives rise to alternatively spliced mRNAs that possibly code for truncated receptors. Only activation of the full-length receptors with serotonin caused an increase in the intracellular Ca2+ concentration. The effect was mimicked by the agonists 5-methoxytryptamine and 8-OH-DPAT at low micromolar concentrations. Receptor activities were blocked by established 5-HT receptor antagonists such as clozapine, methiothepin, or mianserin. High transcript numbers were detected in exocrine glands suggesting that 5-HT2 receptors participate in secretory processes in the honeybee. Conclusions This study marks the first molecular and pharmacological characterization of two 5-HT2 receptor subtypes in the same insect species. The results presented should facilitate further attempts to unravel central and peripheral effects of serotonin mediated by these receptors. PMID:24324783

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-05-15

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

A cDNA clone highly expressed in ripe banana fruit shows homology to pectate lyases.

PubMed

Dominguez-Puigjaner, E; LLop, I; Vendrell, M; Prat, S

1997-07-01

A cDNA clone (Ban17), encoding a protein homologous to pectate lyase, has been isolated from a cDNA library from climacteric banana fruit by means of differential screening. Northern analysis showed that Ban17 mRNA is first detected in early climacteric fruit, reaches a steady-state maximum at the climacteric peak, and declines thereafter in overripe fruit. Accumulation of the Ban17 transcript can be induced in green banana fruit by exogenous application of ethylene. The demonstrates that expression of this gene is under hormonal control, its induction being regulated by the rapid increase in ethylene production at the onset of ripening. The deduced amino acid sequence derived from the Ban17 cDNA shares significant identity with pectate lyases from pollen and plant pathogenic bacteria of the genus Erwinia. Similarity to bacterial pectate lyases that were proven to break down the pectic substances of the plant cell wall suggest that Ban17 might play a role in the loss of mesocarp firmness during fruit ripening.

Characterization of an invertebrate-type dopamine receptor of the American cockroach, Periplaneta americana.

PubMed

Troppmann, Britta; Balfanz, Sabine; Krach, Christian; Baumann, Arnd; Blenau, Wolfgang

2014-01-06

We have isolated a cDNA coding for a putative invertebrate-type dopamine receptor (Peadop2) from P. americana brain by using a PCR-based strategy. The mRNA is present in samples from brain and salivary glands. We analyzed the distribution of the PeaDOP2 receptor protein with specific affinity-purified polyclonal antibodies. On Western blots, PeaDOP2 was detected in protein samples from brain, subesophageal ganglion, thoracic ganglia, and salivary glands. In immunocytochemical experiments, we detected PeaDOP2 in neurons with their somata being located at the anterior edge of the medulla bilaterally innervating the optic lobes and projecting to the ventro-lateral protocerebrum. In order to determine the functional and pharmacological properties of the cloned receptor, we generated a cell line constitutively expressing PeaDOP2. Activation of PeaDOP2-expressing cells with dopamine induced an increase in intracellular cAMP. In contrast, a C-terminally truncated splice variant of this receptor did not exhibit any functional property by itself. The molecular and pharmacological characterization of the first dopamine receptor from P. americana provides the basis for forthcoming studies focusing on the significance of the dopaminergic system in cockroach behavior and physiology.

The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection▿ †

PubMed Central

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D.; Levin, Henry L.

2009-01-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDΔ, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDΔ caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting. PMID:19109383

Mitotic stability and nuclear inheritance of integrated viral cDNA in engineered hypovirulent strains of the chestnut blight fungus.

PubMed Central

Chen, B; Choi, G H; Nuss, D L

1993-01-01

Transmissible hypovirulence is a novel form of biological control in which virulence of a fungal pathogen is attenuated by an endogenous RNA virus. The feasibility of engineering hypovirulence was recently demonstrated by transformation of the chestnut blight fungus, Cryphonectria parasitica, with a full-length cDNA copy of a hypovirulence-associated viral RNA. Engineered hypovirulent transformants were found to contain both a chromsomally integrated cDNA copy of the viral genome and a resurrected cytoplasmically replicating double-stranded RNA form. We now report stable maintenance of integrated viral cDNA through repeated rounds of asexual sporulation and passages on host plant tissue. We also demonstrate stable nuclear inheritance of the integrated viral cDNA and resurrection of the cytoplasmic viral double-stranded RNA form in progeny resulting from the mating of an engineered hypovirulent C. parasitica strain and a vegetatively incompatible virulent strain. Mitotic stability of the viral cDNA ensures highly efficient transmission of the hypovirulence phenotype through conidia. Meiotic transmission, a mode not observed for natural hypovirulent strains, introduces virus into ascospore progeny representing a spectrum of vegetative compatibility groups, thereby circumventing barriers to anastomosis-mediated transmission imposed by the fungal vegetative incompatibility system. These transmission properties significantly enhance the potential of engineered hypovirulent C. parasitica strains as effective biocontrol agents. Images PMID:8344241

A new approach for cloning hLIF cDNA from genomic DNA isolated from the oral mucous membrane.

PubMed

Cui, Y H; Zhu, G Q; Chen, Q J; Wang, Y F; Yang, M M; Song, Y X; Wang, J G; Cao, B Y

2011-11-25

Complementary DNA (cDNA) is valuable for investigating protein structure and function in the study of life science, but it is difficult to obtain by traditional reverse transcription. We employed a novel strategy to clone human leukemia inhibitory factor (hLIF) gene cDNA from genomic DNA, which was directly isolated from the mucous membrane of mouth. The hLIF sequence, which is 609 bp long and is composed of three exons, can be acquired within a few hours by amplifying each exon and splicing all of them using overlap-PCR. This new approach developed is simple, time- and cost-effective, without RNA preparation or cDNA synthesis, and is not limited to the specific tissues for a particular gene and the expression level of the gene.

Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

PubMed

Hu, B; Li, J; Yu, W; Fang, J

1993-01-01

Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

Molecular cloning, characterization, and expression profiles of androgen receptors in spotted scat (Scatophagus argus).

PubMed

Chen, H P; Deng, S P; Dai, M L; Zhu, C H; Li, G L

2016-04-07

Androgen plays critical roles in vertebrate reproductive systems via androgen receptors (ARs). In the present study, the full-length spotted scat (Scatophagus argus) androgen receptor (sAR) cDNA sequence was cloned from testis. The sAR cDNA measured 2448 bp in length with an open-reading frame of 2289 bp, encoding 763 amino acids. Amino acid alignment analyses showed that the sARs exhibited highly evolutionary conserved functional domains. Phylogenetically, the sARs clustered within the ARβ common vertebrate group. Real-time polymerase chain reaction (RT-PCR) revealed that sAR expression varied in level and distribution throughout the tissues of both females and males. sAR expression was detected during testicular development by quantitative RT-PCR. The results showed that the highest transcription of sARs was observed in the mid-testicular stage, and remained at a high expression level until the late-testicular stage. In addition, the effects of 17α-methyltestosterone (MT) and estrogen (E2) on the expression of sARs in ovaries were determined using quantitative RT-PCR. sAR expression increased at 12 and 24 h post-MT treatment and decreased with E2 treatment. The present study provides preliminary evidence indicating gonadal plasticity of spotted scat under exogenous steroidal hormone treatments. It also provides a theoretical basis for sex reversal and production of artificial pseudo-males for female monosex breeding.

Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.

PubMed

Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P

1995-07-01

Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.

Paramyosin from the parasitic mite Sarcoptes scabiei: cDNA cloning and heterologous expression.

PubMed

Mattsson, J G; Ljunggren, E L; Bergström, K

2001-05-01

The burrowing mite Sarcoptes scabiei is the causative agent of the highly contagious disease sarcoptic mange or scabies. So far, there is no in vitro propagation system for S. scabiei available, and mites used for various purposes must be isolated from infected hosts. Lack of parasite-derived material has limited the possibilities to study several aspects of scabies, including pathogenesis and immunity. It has also hampered the development of high performance serological assays. We have now constructed an S. scabiei cDNA expression library with mRNA purified from mites isolated from red foxes. Immunoscreening of the library enabled us to clone a full-length cDNA coding for a 102.5 kDa protein. Sequence similarity searches identified the protein as a paramyosin. Recombinant S. scabiei paramyosin expressed in Escherichia coli was recognized by sera from dogs and swine infected with S. scabiei. We also designed a small paramyosin construct of about 17 kDa that included the N-terminal part, an evolutionary variable part of the helical core, and the C-terminal part of the molecule. The miniaturized protein was efficiently expressed in E. coli and was recognized by sera from immunized rabbits. These data demonstrate that the cDNA library can assist in the isolation of important S. scabiei antigens and that recombinant proteins can be useful for the study of scabies.

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

PubMed

Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

2001-08-17

Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Functional Characterization of Soybean Glyma04g39610 as a Brassinosteroid Receptor Gene and Evolutionary Analysis of Soybean Brassinosteroid Receptors

PubMed Central

Peng, Suna; Tao, Ping; Xu, Feng; Wu, Aiping; Huo, Weige; Wang, Jinxiang

2016-01-01

Brassinosteroids (BR) play important roles in plant growth and development. Although BR receptors have been intensively studied in Arabidopsis, the BR receptors in soybean remain largely unknown. Here, in addition to the known receptor gene Glyma06g15270 (GmBRI1a), we identified five putative BR receptor genes in the soybean genome: GmBRI1b, GmBRL1a, GmBRL1b, GmBRL2a, and GmBRL2b. Analysis of their expression patterns by quantitative real-time PCR showed that they are ubiquitously expressed in primary roots, lateral roots, stems, leaves, and hypocotyls. We used rapid amplification of cDNA ends (RACE) to clone GmBRI1b (Glyma04g39160), and found that the predicted amino acid sequence of GmBRI1b showed high similarity to those of AtBRI1 and pea PsBRI1. Structural modeling of the ectodomain also demonstrated similarities between the BR receptors of soybean and Arabidopsis. GFP-fusion experiments verified that GmBRI1b localizes to the cell membrane. We also explored GmBRI1b function in Arabidopsis through complementation experiments. Ectopic over-expression of GmBRI1b in Arabidopsis BR receptor loss-of-function mutant (bri1-5 bak1-1D) restored hypocotyl growth in etiolated seedlings; increased the growth of stems, leaves, and siliques in light; and rescued the developmental defects in leaves of the bri1-6 mutant, and complemented the responses of BR biosynthesis-related genes in the bri1-5 bak1-D mutant grown in light. Bioinformatics analysis demonstrated that the six BR receptor genes in soybean resulted from three gene duplication events during evolution. Phylogenetic analysis classified the BR receptors in dicots and monocots into three subclades. Estimation of the synonymous (Ks) and the nonsynonymous substitution rate (Ka) and selection pressure (Ka/Ks) revealed that the Ka/Ks of BR receptor genes from dicots and monocots were less than 1.0, indicating that BR receptor genes in plants experienced purifying selection during evolution. PMID:27338344

20-Aminosteroids as a novel class of selective and complete androgen receptor antagonists and inhibitors of prostate cancer cell growth.

PubMed

Fousteris, Manolis A; Schubert, Undine; Roell, Daniela; Roediger, Julia; Bailis, Nikolaos; Nikolaropoulos, Sotiris S; Baniahmad, Aria; Giannis, Athanassios

2010-10-01

Here, the synthesis and the evaluation of novel 20-aminosteroids on androgen receptor (AR) activity is reported. Compounds 11 and 18 of the series inhibit both the wild type and the T877A mutant AR-mediated transactivation indicating AR antagonistic function. Interestingly, minor structural changes such as stereoisomers of the amino lactame moiety exhibit preferences for antagonism among wild type and mutant AR. Other tested nuclear receptors are only weakly or not affected. In line with this, the prostate cancer cell growth of androgen-dependent but not of cancer cells lacking expression of the AR is inhibited. Further, the expression of the prostate specific antigen used as a diagnostic marker is also repressed. Finally steroid 18 enhances cellular senescence that might explain in part the growth inhibition mediated by this derivative. Steroids 11 and 18 are the first steroids that act as complete AR antagonists and exhibit AR specificity. Copyright © 2010 Elsevier Ltd. All rights reserved.

Signaling pathways involved in the inhibition of epidermal growth factor receptor by erlotinib in hepatocellular cancer

PubMed Central

Huether, Alexander; Höpfner, Michael; Sutter, Andreas P; Baradari, Viola; Schuppan, Detlef; Scherübl, Hans

2006-01-01

AIM: To examine the underlying mechanisms of erlotinib-induced growth inhibition in hepatocellular carcinoma (HCC). METHODS: Erlotinib-induced alterations in gene expression were evaluated using cDNA array technology; changes in protein expression and/or protein activation due to erlotinib treatment as well as IGF-1-induced EGFR transactivation were investigated using Western blotting. RESULTS: Erlotinib treatment inhibited the mitogen activated protein (MAP)-kinase pathway and signal transducer of activation and transcription (STAT)-mediated signaling which led to an altered expression of apoptosis and cell cycle regulating genes as demonstrated by cDNA array technology. Overexpression of proapoptotic factors like caspases and gadds associated with a down-regulation of antiapoptotic factors like Bcl-2, Bcl-XL or jun D accounted for erlotinib's potency to induce apoptosis. Downregulation of cell cycle regulators promoting the G1/S-transition and overexpression of cyclin-dependent kinase inhibitors and gadds contributed to the induction of a G1/G0-arrest in response to erlotinib. Furthermore, we displayed the transactivation of EGFR-mediated signaling by the IGF-1-receptor and showed erlotinib’s inhibitory effects on the receptor-receptor cross talk. CONCLUSION: Our study sheds light on the under-standing of the mechanisms of action of EGFR-TK-inhibition in HCC-cells and thus might facilitate the design of combination therapies that act additively or synergistically. Moreover, our data on the pathways responding to erlotinib treatment could be helpful in predicting the responsiveness of tumors to EGFR-TKIs in the future. PMID:16937526

Isolation and characterization of a cDNA encoding a lipid transfer protein expressed in 'Valencia' orange during abscission.

PubMed

Wu, Zhencai; Burns, Jacqueline K

2003-04-01

The genetics and expression of a lipid transfer protein (LTP) gene was examined during abscission of mature fruit of 'Valencia' orange. A cDNA encoding an LTP, CsLTP, was isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-pyrazole (CMN-pyrazole). A full-length cDNA clone of 652 nucleotides was isolated using 5' and 3' RACE followed by cDNA library screening and PCR amplification. The cDNA clone encoded a protein of 155 amino acid residues with a molecular mass and isoelectric point of 9.18 kDa and 9.12, respectively. A partial genomic clone of 505 nucleotides containing one intron of 101 base pairs was amplified from leaf genomic DNA. Southern blot hybridization demonstrated that at least two closely related CsLTP genes are present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones were examined by northern hybridization. Increased expression of CsLTP mRNA was detected in RNA of mature fruit abscission zones 6, 24, 48, and 72 h after application of a non-specific abscission agent, ethephon. Low expression of CsLTP transcripts was observed after treatment of CMN-pyrazole until 24 h after application. After this time, expression markedly increased. The results suggest that CsLTP has a role in the abscission process, possibly by assisting transport of cutin monomers to the fracture plane of the abscission zone or through its anti-microbial activity by reducing the potential of microbial attack.

Molecular characterization and phylogenetic analysis of a yak (Bos grunniens) κ-casein cDNA from lactating mammary gland.

PubMed

Bai, W L; Yin, R H; Dou, Q L; Jiang, W Q; Zhao, S J; Ma, Z J; Luo, G B; Zhao, Z H

2011-04-01

κ-Casein is one of the major proteins in the milk of mammals. It plays an important role in determining the size and specific function of milk micelles. We have previously identified and characterized a genetic variant of yak κ-casein by evaluating genomic DNA. Here, we isolate and characterize a yak κ-casein cDNA harboring the full-length open reading frame (ORF) from lactating mammary gland. Total RNA was extracted from mammary tissue of lactating female yak, and the κ-casein cDNA were synthesized by RT-PCR technique, then cloned and sequenced. The obtained cDNA of 660-bp contained an ORF sufficient to encode the entire amino acid sequence of κ-casein precursor protein consisting of 190 amino acids with a signal peptide of 21 amino acids. Yak κ-casein has a predicted molecular mass of 19,006.588 Da with a calculated isoelectric point of 7.245. Compared with the corresponding sequences in GenBank of cattle, buffalo, sheep, goat, Arabian camel, horse, and rabbit, yak κ-casein sequence had identity of 64.76-98.78% in cDNA, and identity of 44.79-98.42% and similarity of 53.65-98.42% in deduced amino acids, revealing a high homology with the other livestock species. Based on κ-casein cDNA sequences, the phylogenetic analysis indicated that yak κ-casein had a close relationship with that of cattle. This work might be useful in the genetic engineering researches for yak κ-casein.

Single cell transcriptomics of hypothalamic warm sensitive neurons that control core body temperature and fever response Signaling asymmetry and an extension of chemical neuroanatomy.

PubMed

Eberwine, James; Bartfai, Tamas

2011-03-01

We report on an 'unbiased' molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs were confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme Gad1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitters, hormone receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor 2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform Gad1 expression, WSN transcriptomes show heterogeneity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. Copyright © 2010 Elsevier Inc. All rights reserved.

Single Cell Transcriptomics of Hypothalamic Warm Sensitive Neurons that Control Core Body Temperature and Fever Response

PubMed Central

Eberwine, James; Bartfai, Tamas

2011-01-01

We report on an ‘unbiased’ molecular characterization of individual, adult neurons, active in a central, anterior hypothalamic neuronal circuit, by establishing cDNA libraries from each individual, electrophysiologically identified warm sensitive neuron (WSN). The cDNA libraries were analyzed by Affymetrix microarray. The presence and frequency of cDNAs was confirmed and enhanced with Illumina sequencing of each single cell cDNA library. cDNAs encoding the GABA biosynthetic enzyme. GAD1 and of adrenomedullin, galanin, prodynorphin, somatostatin, and tachykinin were found in the WSNs. The functional cellular and in vivo studies on dozens of the more than 500 neurotransmitter -, hormone- receptors and ion channels, whose cDNA was identified and sequence confirmed, suggest little or no discrepancy between the transcriptional and functional data in WSNs; whenever agonists were available for a receptor whose cDNA was identified, a functional response was found.. Sequencing single neuron libraries permitted identification of rarely expressed receptors like the insulin receptor, adiponectin receptor2 and of receptor heterodimers; information that is lost when pooling cells leads to dilution of signals and mixing signals. Despite the common electrophysiological phenotype and uniform GAD1 expression, WSN- transcriptomes show heterogenity, suggesting strong epigenetic influence on the transcriptome. Our study suggests that it is well-worth interrogating the cDNA libraries of single neurons by sequencing and chipping. PMID:20970451

Human Hrs, a tyrosine kinase substrate in growth factor-stimulated cells: cDNA cloning and mapping of the gene to chromosome 17.

PubMed

Lu, L; Komada, M; Kitamura, N

1998-06-15

Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.

A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

PubMed

Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

2015-04-09

Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

Novel transcripts of the estrogen receptor α gene in channel catfish

USGS Publications Warehouse

Patino, Reynaldo; Xia, Zhenfang; Gale, William L.; Wu, Chunfa; Maule, Alec G.; Chang, Xiaotian

2000-01-01

Complementary DNA libraries from liver and ovary of an immature female channel catfish were screened with a homologous ERα cDNA probe. The hepatic library yielded two new channel catfish ER cDNAs that encode N-terminal ERα variants of different sizes. Relative to the catfish ERα (medium size; 581 residues) previously reported, these new cDNAs encode Long-ERα (36 residues longer) and Short-ERα (389 residues shorter). The 5′-end of Long-ERα cDNA is identical to that of Medium-ERα but has an additional 503-bp segment with an upstream, in-frame translation-start codon. Recombinant Long-ERα binds estrogen with high affinity (Kd = 3.4 nM), similar to that previously reported for Medium-ERα but lower than reported for catfish ERβ. Short-ERα cDNA encodes a protein that lacks most of the receptor protein and does not bind estrogen. Northern hybridization confirmed the existence of multiple hepatic ERα RNAs that include the size range of the ERα cDNAs obtained from the libraries as well as additional sizes. Using primers for RT-PCR that target locations internal to the protein-coding sequence, we also established the presence of several ERα cDNA variants with in-frame insertions in the ligand-binding and DNA-binding domains and in-frame or out-of-frame deletions in the ligand-binding domain. These internal variants showed patterns of expression that differed between the ovary and liver. Further, the ovarian library yielded a full-length, ERα antisense cDNA containing a poly(A) signal and tail. A limited survey of histological preparations from juvenile catfish by in situ hybridization using directionally synthesized cRNA probes also suggested the expression of ERα antisense RNA in a tissue-specific manner. In conclusion, channel catfish seemingly have three broad classes of ERα mRNA variants: those encoding N-terminal truncated variants, those encoding internal variants (including C-terminal truncated variants), and antisense mRNA. The sense variants may

Production, gene structure and characterization of two orthologs of leptin and a leptin receptor in tilapia.

PubMed

Shpilman, Michal; Hollander-Cohen, Lian; Ventura, Tomer; Gertler, Arieh; Levavi-Sivan, Berta

2014-10-01

Full-length cDNA encoding two leptin sequences (tLepA and tLepB) and one leptin receptor sequence (tLepR) were identified in tilapia (Oreochromis niloticus). The full-length cDNA of tLepR was 3423bp, encoding a protein of 1140 amino acid (aa) which contained all functionally important domains conserved among vertebrate leptin receptors. The cDNAs of tLepA and tLepB were 486bp and 459bp in length, encoding proteins of 161 aa and 152 aa, respectively. Modeling the three-dimensional structures of tLepA and tLepB predicted strong conservation of tertiary structure with that of human leptin, comprised of four helixes. Using synteny, the tLeps were found near common genes, such as IMPDH1 and LLRC4. The cDNA for tLepA and tLepB was cloned and synthetic cDNA optimized for expression in Escherichia coli was prepared according to the cloned sequence. The tLepA- and tLepB-expressing plasmids were transformed into E. coli and expressed as recombinant proteins upon induction with nalidixic acid, found almost entirely in insoluble inclusion bodies (IBs). The proteins were solubilized, refolded and purified to homogeneity by anion-exchange chromatography. In the case of tLepA, the fraction eluted contained a mixture of monomers and dimers. The purified tLepA and tLepB monomers and tLepA dimer showed a single band of ∼15kDa on an SDS-polyacrylamide gel in the presence of reducing agent, whereas the tLepA dimer showed one band of ∼30kDa in the absence of reducing agent, indicating its formation by S-S bonds. The three tLeps were biologically active in promoting proliferation of BAF/3 cells stably transfected with the long form of human leptin receptor (hLepR), but their activity was four orders of magnitude lower than that of mammalian leptin. Furthermore, the three tLeps were biologically active in promoting STAT-LUC activation in COS7 cells transfected with the identified tLepR but not in cells transfected with hLepR. tLepA was more active than tLepB. Low or no activity

Localization and regulation of glucagon receptors in the chick eye and preproglucagon and glucagon receptor expression in the mouse eye.

PubMed

Feldkaemper, Marita P; Burkhardt, Eva; Schaeffel, Frank

2004-09-01

Myopia is a condition in which the eye is too long for the focal length of cornea and lens. Analysis of the messengers that are released by the retina to control axial eye growth in the animal model of the chicken revealed that glucagon-immunoreactive amacrine cells are involved in the retinal image processing that controls the growth of the sclera. It was found that the amount of retinal glucagon mRNA increased during treatment with positive lenses and pharmacological studies supported the idea that glucagon may act as a stop signal for eye growth. Glucagon exerts its regulatory effects by binding to a single type of glucagon receptor. In this study, we have sequenced the chicken glucagon receptor and compared its DNA and amino acid sequence with the human and mouse homologues. After sequencing about 80% of the receptor, we found a homology between 79.4 and 75.6% on cDNA level. At the protein level, about 73% of the amino acids were identical. Moreover, the cellular localization and regulation of the glucagon receptor in the chick retina was studied. In situ hybridization studies showed that many cells in the ganglion cell layer and inner nuclear layer, and some cells in the outer nuclear layer, express the receptor mRNA. Injection of the glucagon agonist Lys17,18,Glu21-glucagon induced a down-regulation of glucagon receptor mRNA content. Since the mouse would be an attractive mammalian model to study the biochemical and genetic basis of myopia, and because recent studies have demonstrated that form deprivation myopia can be induced, the expression of preproglucagon and glucagon receptor genes were also studied in the mouse retina and were found to be expressed.

Platelet dysfunction associated with the novel Trp29Cys thromboxane A₂ receptor variant.

PubMed

Mumford, A D; Nisar, S; Darnige, L; Jones, M L; Bachelot-Loza, C; Gandrille, S; Zinzindohoue, F; Fischer, A-M; Mundell, S J; Gaussem, P

2013-03-01

Genetic variations that affect the structure of the thromboxane A2 receptor (TP receptor) provide insights into the function of this key platelet and vascular receptor, but are very rare in unselected populations. To determine the functional consequences of the TP receptor Trp29Cys (W29C) substitution. We performed a detailed phenotypic analysis of an index case (P1) with reduced platelet aggregation and secretion responses to TP receptor pathway activators, and a heterozygous TP receptor W29C substitution. An analysis of the variant W29C TP receptor expressed in heterologous cells was performed. Total TP receptor expression in platelets from P1 was similar to that of controls, but there was reduced maximum binding and reduced affinity of binding to the TP receptor antagonist [(3) H]SQ29548. HEK293 cells transfected with W29C TP receptor cDNA showed similar total TP receptor expression to wild-type (WT) controls. However, the TP receptor agonist U46619 was less potent at inducing rises in cytosolic free Ca(2+) in HEK293 cells expressing the W29C TP receptor than in WT controls, indicating reduced receptor function. Immunofluorescence microscopy and cell surface ELISA showed intracellular retention and reduced cell surface expression of the W29C TP receptor in HEK293 cells. Consistent with the platelet phenotype, both maximum binding and the affinity of binding of [(3) H]SQ29548 to the W29C TP receptor were reduced compared to WT controls. These findings extend the phenotypic description of the very rare disorder TP receptor deficiency, and show that the W29C substitution reduces TP receptor function by reducing surface receptor expression and by disrupting ligand binding. © 2012 International Society on Thrombosis and Haemostasis.

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

THE ROLE OF DELTA OPIOID RECEPTORS IN THE ANXIOLYTIC ACTIONS OF BENZODIAZEPINES

PubMed Central

Primeaux, Stefany D.; Wilson, Steven P.; McDonald, Alexander J.; Mascagni, Franco; Wilson, Marlene A.

2007-01-01

The anxiolytic effects of benzodiazepines appear to involve opioid processes in the amygdala. In previous experiments, overexpression of enkephalin in the amygdala enhanced the anxiolytic actions of the benzodiazepine agonist diazepam in the elevated plus maze. The effects of systemically administered diazepam are also blocked by injections of naltrexone into the central nucleus of the amygdala. The current studies investigated the role of delta opioid receptors in the anxiety-related effects of diazepam. Three days following bilateral stereotaxic injections of viral vectors containing cDNA encoding proenkephalin or β-galactosidase (control vector), the delta opioid receptor antagonist naltrindole (10 mg/kg, s.c.) attenuated the enhanced anxiolytic effects of 1–2 mg/kg diazepam in rats overexpressing preproenkephalin in the amygdala. Despite this effect, naltrindole failed to attenuate the anxiolytic action of higher diazepam doses (3 mg/kg) in animals with normal amygdalar enkephalin expression. Similarly, the mu opioid receptor antagonist, β-funaltrexamine (20mg/kg, sc), had no effect on the anxiolytic effect of diazepam alone. These data support a role for delta opioid receptors in the opioid-enhanced anxiolytic effects of diazepam. PMID:17109943

Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiktorowicz, J.E.; Whitman, J.M.

1986-05-01

Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

Molecular characterization and localization of the first tyramine receptor of the American cockroach (Periplaneta americana).

PubMed

Rotte, C; Krach, C; Balfanz, S; Baumann, A; Walz, B; Blenau, W

2009-09-15

The phenolamines octopamine and tyramine control, regulate, and modulate many physiological and behavioral processes in invertebrates. Vertebrates possess only small amounts of both substances, and thus, octopamine and tyramine, together with other biogenic amines, are referred to as "trace amines." Biogenic amines evoke cellular responses by activating G-protein-coupled receptors. We have isolated a complementary DNA (cDNA) that encodes a biogenic amine receptor from the American cockroach Periplaneta americana, viz., Peatyr1, which shares high sequence similarity to members of the invertebrate tyramine-receptor family. The PeaTYR1 receptor was stably expressed in human embryonic kidney (HEK) 293 cells, and its ligand response has been examined. Receptor activation with tyramine reduces adenylyl cyclase activity in a dose-dependent manner (EC(50) approximately 350 nM). The inhibitory effect of tyramine is abolished by co-incubation with either yohimbine or chlorpromazine. Receptor expression has been investigated by reverse transcription polymerase chain reaction and immunocytochemistry. The mRNA is present in various tissues including brain, salivary glands, midgut, Malpighian tubules, and leg muscles. The effect of tyramine on salivary gland acinar cells has been investigated by intracellular recordings, which have revealed excitatory presynaptic actions of tyramine. This study marks the first comprehensive molecular, pharmacological, and functional characterization of a tyramine receptor in the cockroach.

Expression of leukemia inhibitory factor and leukemia inhibitory factor receptor in the canine pituitary gland and corticotrope adenomas.

PubMed

Hanson, J M; Mol, J A; Meij, B P

2010-05-01

Leukemia inhibitory factor (LIF) is a pleiotropic cytokine of the IL-6 family that activates the hypothalamic-pituitary-adrenal axis and promotes corticotrope cell differentiation during development. The aim of this study was to investigate the expression of LIF and its receptor (LIFR) in the canine pituitary gland and in corticotrope adenomas, and to perform a mutation analysis of LIFR. Using immunohistochemistry, immunofluorescence, and quantitative expression analysis, LIF and LIFR expression were studied in pituitary glands of control dogs and in specimens of corticotrope adenoma tissue collected through hypophysectomy in dogs with pituitary-dependent hypercortisolism (PDH, Cushing's disease). Using sequence analysis, cDNA was screened for mutations in the LIFR. In the control pituitary tissues and corticotrope adenomas, there was a low magnitude of LIF expression. The LIFR, however, was highly expressed and co-localized with ACTH(1-24) expression. Cytoplasmatic immunoreactivity of LIFR was preserved in corticotrope adenomas and adjacent nontumorous cells of pars intermedia. No mutation was found on mutation analysis of the complete LIFR cDNA. Surprisingly, nuclear to perinuclear immunoreactivity for LIFR was present in nontumorous pituitary cells of the pars distalis in 10 of 12 tissue specimens from PDH dogs. These data show that LIFR is highly co-expressed with adrenocorticotropic hormone (ACTH) and alpha-melanocyte-stimulating hormone (alpha-MSH) in the canine pituitary gland and in corticotrope adenomas. Nuclear immunoreactivity for LIFR in nontumorous cells of the pars distalis may indicate the presence of a corticotrope adenoma. Copyright (c) 2009 Elsevier Inc. All rights reserved.

Brain distribution and molecular cloning of the bovine GABA rho1 receptor.

PubMed

Rosas-Arellano, Abraham; Ochoa-de la Paz, Lenin David; Miledi, Ricardo; Martínez-Torres, Ataúlfo

2007-03-01

GABA(C) receptors were originally found in the mammalian retina and recent evidence shows that they are also expressed in several areas of the brain, including caudate nucleus, brain stem, pons and corpus callosum. In this study, plasma membranes from the caudate nucleus were microinjected into X. laevis oocytes. This led the oocyte plasma membrane to incorporate functional bicuculline-resistant, Cl(-) conducting bovine GABA receptors, similar to those of the retina. Immunolocalization of the GABA rho1 subunit revealed its expression in bovine neurons in the head of the caudate as well as in the olive, cuneiform and reticular nuclei of the brain stem. The same antibodies failed to show expression in the callosum and pons, where the GABA rho1 mRNA was previously detected. The cloned GABA rho1 sequence predicts a protein with 473 amino acids and 74-93% similarity to other GABA rho1 subunits. Oocytes injected with the cDNA express a non-desensitizing, homomeric receptor with a GABA EC(50)=6.0 microM and a Hill coefficient of 1.8. The results confirm the presence of GABA(C) receptor mRNAs in several areas of the mammalian brain and show that some of these areas express functional GABA rho1 receptors that have the classic GABA(C) receptor characteristics.

Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomkinson, B.; Jonsson, A-K

1991-01-01

Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90{percent} of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5{prime} part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acidmore » residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56{percent} similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved.« less

Molecular cloning and pharmacological characterisation of a tyramine receptor from the rice stem borer, Chilo suppressalis (Walker).

PubMed

Wu, Shun-Fan; Huang, Jia; Ye, Gong-Yin

2013-01-01

Tyramine (TA) and octopamine (OA) are considered to be the invertebrate counterparts of the vertebrate adrenergic transmitters. Because these two phenolamines are the only biogenic amines whose physiological significance is presumably restricted to invertebrates, the attention of pharmacologists has been focused on the corresponding receptors, which are believed to represent promising targets for novel insecticides. For example, the formamidine pesticides, such as chlordimeform and amitraz, have been shown to activate OA receptors. A full-length cDNA (designated CsTyR1) from the rice stem borer, Chilo suppressalis (Walker), has been obtained through homology cloning in combination with rapid amplification of cDNA ends/polymerase chain reaction (RACE-PCR). The mRNA of CsTyR1 is present in various tissues, including hemocytes, fat body, midgut, Malpighian tubules, nerve cord and epidermis, and it is found predominantly in the larval nerve cord with 16-80-fold enrichment compared with other tissues. The authors generated a HEK 293 cell line stably expressing CsTyR1 in order to examine functional and pharmacological properties of this receptor. Both TA and OA at 0.01-100 µM can reduce forskolin-stimulated intracellular cAMP levels in a dose-dependent manner (TA, EC(50) = 369 nM; OA, EC(50) = 978 nM). In agonist assays, activation of CsTyR1 by clonidine and amitraz but not by naphazoline and chlordimeform can also significantly inhibit forskolin-stimulated cAMP production. The inhibitory effect of TA at 10 µM is eliminated by coincubation with yohimbine, phentolamine or chlorpromazine (each 10 µM). This study represents a comprehensive molecular and pharmacological characterisation of a tyramine receptor in the rice stem borer. Copyright © 2012 Society of Chemical Industry.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ethylene Receptor 1 (ETR1) Is Sufficient and Has the Predominant Role in Mediating Inhibition of Ethylene Responses by Silver in Arabidopsis thaliana*

PubMed Central

McDaniel, Brittany K.; Binder, Brad M.

2012-01-01

Ethylene influences many processes in Arabidopsis thaliana through the action of five receptor isoforms. All five isoforms use copper as a cofactor for binding ethylene. Previous research showed that silver can substitute for copper as a cofactor for ethylene binding activity in the ETR1 ethylene receptor yet also inhibit ethylene responses in plants. End-point and rapid kinetic analyses of dark-grown seedling growth revealed that the effects of silver are mostly dependent upon ETR1, and ETR1 alone is sufficient for the effects of silver. Ethylene responses in etr1-6 etr2-3 ein4-4 triple mutants were not blocked by silver. Transformation of these triple mutants with cDNA for each receptor isoform under the promoter control of ETR1 revealed that the cETR1 transgene completely rescued responses to silver while the cETR2 transgene failed to rescue these responses. The other three isoforms partially rescued responses to silver. Ethylene binding assays on the binding domains of the five receptor isoforms expressed in yeast showed that silver supports ethylene binding to ETR1 and ERS1 but not the other isoforms. Thus, silver may have an effect on ethylene signaling outside of the ethylene binding pocket of the receptors. Ethylene binding to ETR1 with silver was ∼30% of binding with copper. However, alterations in the Kd for ethylene binding to ETR1 and the half-time of ethylene dissociation from ETR1 do not underlie this lower binding. Thus, it is likely that the lower ethylene binding activity of ETR1 with silver is due to fewer ethylene binding sites generated with silver versus copper. PMID:22692214

Expression changes of serotonin receptor gene subtype 5HT3a in peripheral blood mononuclear cells from schizophrenic patients treated with haloperidol and Olanzapin.

PubMed

Shariati, Gholam Reza; Ahangari, Ghasem; Hossein-nezhad, Arash; Asadi, Seyed Mohammad; Pooyafard, Farzaneh; Ahmadkhaniha, Hamid Reza

2009-09-01

Serotonin receptors are involved in pathophysiology of schizophrenia and may mediate other neurotransmitter effects. We investigated serotonin receptors gene expression in peripheral blood mononuclear cells (PBMC) of naïve schizophrenic patients, before and after treatment. Also serotonin receptor gene expression was compared in two treatment groups including Haloperidol and Olanzapine. The PBMC was separated from whole blood by Ficoll-hypaque. The total cellular RNA was extracted and the cDNA was synthesized. This process was followed by real-time PCR using primer pairs specific for 5HT(3a) serotonin receptor mRNA and beta-actin as internal control. The results showed the presence of subtype of serotonin receptor in lymphocytes. Serotonin gene expression showed significant changes in Olanzapine treatment group which correlated with Clinical Global Impression (CGI) score improvement. In conclusion, the present study has shown that human PBMC express serotonin receptors 5HT(3a). Moreover, clinical symptom improvement of Olanzapin may be demonstrated by a change in serotonin receptor gene expression.

Cloning and identification of a cDNA that encodes a novel human protein with thrombospondin type I repeat domain, hPWTSR.

PubMed

Chen, Jin-Zhong; Wang, Shu; Tang, Rong; Yang, Quan-Sheng; Zhao, Enpeng; Chao, Yaoqiong; Ying, Kang; Xie, Yi; Mao, Yu-Min

2002-09-01

A cDNA was isolated from the fetal brain cDNA library by high throughput cDNA sequencing. The 2390 bp cDNA with an open reading fragment (ORF) of 816 bp encodes a 272 amino acids putative protein with a thrombospondin type I repeat (TSR) domain and a cysteine-rich region at the N-terminus, so it is named hPWTSR. We used Northern blot detected two bands with length of about 3 kb and 4 kb respectively, which expressed in human adult tissues with different intensities. The expression pattern was verified by RT-PCR, revealing that the transcripts were expressed ubiquitously in fetal tissues and human tumor tissues too. However, the transcript was detected neither in ovarian carcinoma GI-102 nor in lung carcinoma LX-1. Blast analysis against NCBI database revealed that the new gene contained at least 5 exons and located in human chromosome 6q22.33. Our results demonstrate that the gene is a novel member of TSR supergene family.

Chromosomal localization of the human V3 pituitary vasopressin receptor gene (AVPR3) to 1q32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rousseau-Merck, M.F.; Derre, J.; Berger, R.

1995-11-20

Vasopressin exerts its physiological effects on liver metabolism, fluid osmolarity, and corticotrophic response to stress through a set of at least three receptors, V1a, V2, and V3 (also called V1b), respectively. These receptors constitute a distinct group of the superfamily of G-protein-coupled cell surface receptors. When bound to vasopressin, they couple to G proteins activating phospholipase C for the V1a and V3 types and adenylate cyclase for the V2. The vasopressin receptor subfamily also includes the receptor for oxytocin, a structurally related hormone that signals through the activation of phospholipase C. The chromosomal position of the V2 receptor gene hasmore » been assigned to Xq28-qter by PCR-based screening of somatic cell hybrids, whereas the oxytocin receptor gene has been mapped to chromosome 3q26.2 by fluorescence in situ hybridization (FISH). The chromosomal location of the V1a gene is currently unknown. We recently cloned the cDNA and the gene coding for the human pituitary-specific V3 receptor (HGMW-approved symbol AVPR3). We report here the chromosomal localization of this gene by two distinct in situ hybridization techniques using radioactive and fluorescent probes. 11 refs., 1 fig.« less

The genomic structure of the human UFO receptor.

PubMed

Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W

1993-02-01

Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.

Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

PubMed Central

Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

1992-01-01

A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

1999-02-01

A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

Characterization of an Invertebrate-Type Dopamine Receptor of the American Cockroach, Periplaneta americana

PubMed Central

Troppmann, Britta; Balfanz, Sabine; Krach, Christian; Baumann, Arnd; Blenau, Wolfgang

2014-01-01

We have isolated a cDNA coding for a putative invertebrate-type dopamine receptor (Peadop2) from P. americana brain by using a PCR-based strategy. The mRNA is present in samples from brain and salivary glands. We analyzed the distribution of the PeaDOP2 receptor protein with specific affinity-purified polyclonal antibodies. On Western blots, PeaDOP2 was detected in protein samples from brain, subesophageal ganglion, thoracic ganglia, and salivary glands. In immunocytochemical experiments, we detected PeaDOP2 in neurons with their somata being located at the anterior edge of the medulla bilaterally innervating the optic lobes and projecting to the ventro-lateral protocerebrum. In order to determine the functional and pharmacological properties of the cloned receptor, we generated a cell line constitutively expressing PeaDOP2. Activation of PeaDOP2-expressing cells with dopamine induced an increase in intracellular cAMP. In contrast, a C-terminally truncated splice variant of this receptor did not exhibit any functional property by itself. The molecular and pharmacological characterization of the first dopamine receptor from P. americana provides the basis for forthcoming studies focusing on the significance of the dopaminergic system in cockroach behavior and physiology. PMID:24398985

Mass spectrometry-based cDNA profiling as a potential tool for human body fluid identification.

PubMed

Donfack, Joseph; Wiley, Anissa

2015-05-01

Several mRNA markers have been exhaustively evaluated for the identification of human venous blood, saliva, and semen in forensic genetics. As new candidate human body fluid specific markers are discovered, evaluated, and reported in the scientific literature, there is an increasing trend toward determining the ideal markers for cDNA profiling of body fluids of forensic interest. However, it has not been determined which molecular genetics-based technique(s) should be utilized to assess the performance of these markers. In recent years, only a few confirmatory, mRNA/cDNA-based methods have been evaluated for applications in body fluid identification. The most frequently described methods tested to date include quantitative polymerase chain reaction (qPCR) and capillary electrophoresis (CE). However these methods, in particular qPCR, often favor narrow multiplex PCR due to the availability of a limited number of fluorescent dyes/tags. In an attempt to address this technological constraint, this study explored matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF MS) for human body fluid identification via cDNA profiling of venous blood, saliva, and semen. Using cDNA samples at 20pg input phosphoglycerate kinase 1 (PGK1) amounts, body fluid specific markers for the candidate genes were amplified in their corresponding body fluid (i.e., venous blood, saliva, or semen) and absent in the remaining two (100% specificity). The results of this study provide an initial indication that MALDI-TOF MS is a potential fluorescent dye-free alternative method for body fluid identification in forensic casework. However, the inherent issues of low amounts of mRNA, and the damage caused to mRNA by environmental exposures, extraction processes, and storage conditions are important factors that significantly hinder the implementation of cDNA profiling into forensic casework. Published by Elsevier Ireland Ltd.

Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thiel, C.; Lanchbury, J.S.; Otting, N.

1996-06-01

Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less

Selective antagonism of AMPA receptors unmasks kainate receptor-mediated responses in hippocampal neurons.

PubMed

Paternain, A V; Morales, M; Lerma, J

1995-01-01

Although both protein and mRNAs for kainate receptor subunits are abundant in several brain regions, the responsiveness of AMPA receptors to kainate has made it difficult to demonstrate the presence of functional kainate-type receptors in native cells. Recently, however, we have shown that many hippocampal neurons in culture express glutamate receptors of the kainate type. The large nondesensitizing response that kainate induces at AMPA receptors precludes detection and analysis of smaller, rapidly desensitizing currents induced by kainate at kainate receptors. Consequently, the functional significance of these strongly desensitizing glutamate receptors remains enigmatic. We report here that the family of new noncompetitive antagonists of AMPA receptors (GYKI 52466 and 53655) minimally affects kainate-induced responses at kainate receptors while completely blocking AMPA receptor-mediated currents, making it possible to separate the responses mediated by each receptor. These compounds will allow determination of the role played by kainate receptors in synaptic transmission and plasticity in the mammalian brain, as well as evaluation of their involvement in neurotoxicity.

Characterization of the 5-HT1A receptor of the honeybee (Apis mellifera) and involvement of serotonin in phototactic behavior.

PubMed

Thamm, Markus; Balfanz, Sabine; Scheiner, Ricarda; Baumann, Arnd; Blenau, Wolfgang

2010-07-01

Serotonin plays a key role in modulating various physiological and behavioral processes in both protostomes and deuterostomes. The vast majority of serotonin receptors belong to the superfamily of G-protein-coupled receptors. We report the cloning of a cDNA from the honeybee (Am5-ht1A) sharing high similarity with members of the 5-HT(1) receptor class. Activation of Am5-HT(1A) by serotonin inhibited the production of cAMP in a dose-dependent manner (EC(50) = 16.9 nM). Am5-HT(1A) was highly expressed in brain regions known to be involved in visual information processing. Using in vivo pharmacology, we could demonstrate that Am5-HT(1A) receptor ligands had a strong impact on the phototactic behavior of individual bees. The data presented here mark the first comprehensive study-from gene to behavior-of a 5-HT(1A) receptor in the honeybee, paving the way for the eventual elucidation of additional roles of this receptor subtype in the physiology and behavior of this social insect.

Identification of Complete Repertoire of Apis florea Odorant Receptors Reveals Complex Orthologous Relationships with Apis mellifera

PubMed Central

Karpe, Snehal D.; Jain, Rikesh; Brockmann, Axel; Sowdhamini, Ramanathan

2016-01-01

Abstract We developed a computational pipeline for homology based identification of the complete repertoire of olfactory receptor (OR) genes in the Asian honey bee species, Apis florea. Apis florea is phylogenetically the most basal honey bee species and also the most distant sister species to the Western honey bee Apis mellifera, for which all OR genes had been identified before. Using our pipeline, we identified 180 OR genes in A. florea, which is very similar to the number of ORs identified in A. mellifera (177 ORs). Many characteristics of the ORs including gene structure, synteny of tandemly repeated ORs and basic phylogenetic clustering are highly conserved. The composite phylogenetic tree of A. florea and A. mellifera ORs could be divided into 21 clades which are in harmony with the existing Hymenopteran tree. However, we found a few nonorthologous OR relationships between both species as well as independent pseudogenization of ORs suggesting separate evolutionary changes. Particularly, a subgroup of the OR gene clade XI, which had been hypothesized to code cuticular hydrocarbon receptors showed a high number of species-specific ORs. RNAseq analysis detected a total number of 145 OR transcripts in male and 162 in female antennae. Most of the OR genes were highly expressed on the female antennae. However, we detected five distinct male-biased OR genes, out of which three genes (AfOr11, AfOr18, AfOr170P) were shown to be male-biased in A. mellifera, too, thus corroborating a behavioral function in sex-pheromone communication. PMID:27540087

Informatic selection of a neural crest-melanocyte cDNA set for microarray analysis

PubMed Central

Loftus, S. K.; Chen, Y.; Gooden, G.; Ryan, J. F.; Birznieks, G.; Hilliard, M.; Baxevanis, A. D.; Bittner, M.; Meltzer, P.; Trent, J.; Pavan, W.

1999-01-01

With cDNA microarrays, it is now possible to compare the expression of many genes simultaneously. To maximize the likelihood of finding genes whose expression is altered under the experimental conditions, it would be advantageous to be able to select clones for tissue-appropriate cDNA sets. We have taken advantage of the extensive sequence information in the dbEST expressed sequence tag (EST) database to identify a neural crest-derived melanocyte cDNA set for microarray analysis. Analysis of characterized genes with dbEST identified one library that contained ESTs representing 21 neural crest-expressed genes (library 198). The distribution of the ESTs corresponding to these genes was biased toward being derived from library 198. This is in contrast to the EST distribution profile for a set of control genes, characterized to be more ubiquitously expressed in multiple tissues (P < 1 × 10−9). From library 198, a subset of 852 clustered ESTs were selected that have a library distribution profile similar to that of the 21 neural crest-expressed genes. Microarray analysis demonstrated the majority of the neural crest-selected 852 ESTs (Mel1 array) were differentially expressed in melanoma cell lines compared with a non-neural crest kidney epithelial cell line (P < 1 × 10−8). This was not observed with an array of 1,238 ESTs that was selected without library origin bias (P = 0.204). This study presents an approach for selecting tissue-appropriate cDNAs that can be used to examine the expression profiles of developmental processes and diseases. PMID:10430933

Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

PubMed Central

Zhao, Hongjuan; Hastie, Trevor; Whitfield, Michael L; Børresen-Dale, Anne-Lise; Jeffrey, Stefanie S

2002-01-01

Background T7 based linear amplification of RNA is used to obtain sufficient antisense RNA for microarray expression profiling. We optimized and systematically evaluated the fidelity and reproducibility of different amplification protocols using total RNA obtained from primary human breast carcinomas and high-density cDNA microarrays. Results Using an optimized protocol, the average correlation coefficient of gene expression of 11,123 cDNA clones between amplified and unamplified samples is 0.82 (0.85 when a virtual array was created using repeatedly amplified samples to minimize experimental variation). Less than 4% of genes show changes in expression level by 2-fold or greater after amplification compared to unamplified samples. Most changes due to amplification are not systematic both within one tumor sample and between different tumors. Amplification appears to dampen the variation of gene expression for some genes when compared to unamplified poly(A)+ RNA. The reproducibility between repeatedly amplified samples is 0.97 when performed on the same day, but drops to 0.90 when performed weeks apart. The fidelity and reproducibility of amplification is not affected by decreasing the amount of input total RNA in the 0.3–3 micrograms range. Adding template-switching primer, DNA ligase, or column purification of double-stranded cDNA does not improve the fidelity of amplification. The correlation coefficient between amplified and unamplified samples is higher when total RNA is used as template for both experimental and reference RNA amplification. Conclusion T7 based linear amplification reproducibly generates amplified RNA that closely approximates original sample for gene expression profiling using cDNA microarrays. PMID:12445333

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

PubMed

Lassner, M W; Lardizabal, K; Metz, J G

1996-02-01

beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.

Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

Dual specificity of activin type II receptor ActRIIb in dorso-ventral patterning during zebrafish embryogenesis.

PubMed

Nagaso, H; Suzuki, A; Tada, M; Ueno, N

1999-04-01

Members of the transforming growth factor-beta (TGF-beta) superfamily are thought to regulate specification of a variety of tissue types in early embryogenesis. These effects are mediated through a cell surface receptor complex, consisting of two classes of ser/thr kinase receptor, type I and type II. In the present study, cDNA encoding zebrafish activin type II receptors, ActRIIa and ActRIIb was cloned and characterized. Overexpression of ActRIIb in zebrafish embryos caused dorsalization of embryos, as observed in activin-overexpressing embryos. However, in blastula stage embryos, ActRIIb induced formation of both dorsal and ventro-lateral mesoderm. It has been suggested that these inducing signals from ActRIIb are mediated through each specific type I receptor, TARAM-A and BMPRIA, depending on activin and bone morphogenetic protein (BMP), respectively. In addition, it was shown that a kinase-deleted form of ActRIIb (dnActRIIb) suppressed both activin- and BMP-like signaling pathways. These results suggest that ActRIIb at least has dual roles in both activin and BMP signaling pathways during zebrafish embryogenesis.

Cloning of the cDNA for a hematopoietic cell-specific protein related to CD20 and the {beta} subunit of the high-affinity IgE receptor: Evidence for a family of proteins with four membrane-spanning regions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adra, C.N.; Morrison, P.; Lim, B.

1994-10-11

The authors report the cloning of the cDNA for a human gene whose mRNA is expressed specifically in hematopoietic cells. A long open reading frame in the 1.7-kb mRNA encodes a 214-aa protein of 25 kDa with four hydrophobic regions consistent with a protein that traverses the membrane four times. To reflect the structure and expression of this gene in diverse hematopoietic lineages of lymphoid and myeloid origin, the authors named the gene HTm{sub 4}. The protein is about 20% homologous to two other {open_quotes}four-transmembrane{close_quotes} proteins; the B-cell-specific antigen CD20 and the {beta} subunit of the high-affinity receptor for IgE,more » Fc{sub {epsilon}}RI{beta}. The highest homologies among the three proteins are found in the transmembrane domains, but conserved residues are also recognized in the inter-transmembrane domains and in the N and C termini. Using fluorescence in situ hybridization, they localized HTm{sub 4} to human chromosome 11q12-13.1, where the CD20 and Fc{sub {epsilon}}RI{beta} genes are also located. Both the murine homologue for CD20, Ly-44, and the murine Fc{sub {epsilon}}RI{beta} gene map to the same region in murine chromosome 19. The authors propose that the HTm{sub 4}, CD20, and Fc{sub {epsilon}}RI{beta} genes evolved from the same ancestral gene to form a family of four-transmembrane proteins. It is possible that other related members exist. Similar to CD20 and Fc{sub {epsilon}}RI{beta}, it is likely that Htm{sub 4} has a role in signal transduction and, like Fc{sub {epsilon}}RI{beta}, might be a subunit associated with receptor complexes.« less

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

[Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

1997-02-01

The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15.

PubMed Central

Phaneuf, D; Labelle, Y; Bérubé, D; Arden, K; Cavenee, W; Gagné, R; Tanguay, R M

1991-01-01

Type 1 hereditary tyrosinemia (HT) is an autosomal recessive disease characterized by a deficiency of the enzyme fumarylacetoacetate hydrolase (FAH; E.C.3.7.1.2). We have isolated human FAH cDNA clones by screening a liver cDNA expression library using specific antibodies and plaque hybridization with a rat FAH cDNA probe. A 1,477-bp cDNA was sequenced and shown to code for FAH by an in vitro transcription-translation assay and sequence homology with tryptic fragments of purified FAH. Transient expression of this FAH cDNA in transfected CV-1 mammalian cells resulted in the synthesis of an immunoreactive protein comigrating with purified human liver FAH on SDS-PAGE and having enzymatic activity as shown by the hydrolysis of the natural substrate fumarylacetoacetate. This indicates that the single polypeptide chain encoded by the FAH gene contains all the genetic information required for functional activity, suggesting that the dimer found in vivo is a homodimer. The human FAH cDNA was used as a probe to determine the gene's chromosomal localization using somatic cell hybrids and in situ hybridization. The human FAH gene maps to the long arm of chromosome 15 in the region q23-q25. Images Figure 1 Figure 3 Figure 4 Figure 6 Figure 8 PMID:1998338

The Dopamine D2 Receptor Gene in Lamprey, Its Expression in the Striatum and Cellular Effects of D2 Receptor Activation

PubMed Central

Robertson, Brita; Huerta-Ocampo, Icnelia; Ericsson, Jesper; Stephenson-Jones, Marcus; Pérez-Fernández, Juan; Bolam, J. Paul; Diaz-Heijtz, Rochellys; Grillner, Sten

2012-01-01

All basal ganglia subnuclei have recently been identified in lampreys, the phylogenetically oldest group of vertebrates. Furthermore, the interconnectivity of these nuclei is similar to mammals and tyrosine hydroxylase-positive (dopaminergic) fibers have been detected within the input layer, the striatum. Striatal processing is critically dependent on the interplay with the dopamine system, and we explore here whether D2 receptors are expressed in the lamprey striatum and their potential role. We have identified a cDNA encoding the dopamine D2 receptor from the lamprey brain and the deduced protein sequence showed close phylogenetic relationship with other vertebrate D2 receptors, and an almost 100% identity within the transmembrane domains containing the amino acids essential for dopamine binding. There was a strong and distinct expression of D2 receptor mRNA in a subpopulation of striatal neurons, and in the same region tyrosine hydroxylase-immunoreactive synaptic terminals were identified at the ultrastructural level. The synaptic incidence of tyrosine hydroxylase-immunoreactive boutons was highest in a region ventrolateral to the compact layer of striatal neurons, a region where most striatal dendrites arborise. Application of a D2 receptor agonist modulates striatal neurons by causing a reduced spike discharge and a diminished post-inhibitory rebound. We conclude that the D2 receptor gene had already evolved in the earliest group of vertebrates, cyclostomes, when they diverged from the main vertebrate line of evolution (560 mya), and that it is expressed in striatum where it exerts similar cellular effects to that in other vertebrates. These results together with our previous published data (Stephenson-Jones et al. 2011, 2012) further emphasize the high degree of conservation of the basal ganglia, also with regard to the indirect loop, and its role as a basic mechanism for action selection in all vertebrates. PMID:22563388

Construction and application of a bovine immune-endocrine cDNA microarray.

PubMed

Tao, Wenjing; Mallard, Bonnie; Karrow, Niel; Bridle, Byram

2004-09-01

A variety of commercial DNA arrays specific for humans and rodents are widely available; however, microarrays containing well-characterized genes to study pathway-specific gene expression are not as accessible for domestic animals, such as cattle, sheep and pigs. Therefore, a small-scale application-targeted bovine immune-endocrine cDNA array was developed to evaluate genetic pathways involved in the immune-endocrine axis of cattle during periods of altered homeostasis provoked by physiological or environmental stressors, such as infection, vaccination or disease. For this purpose, 167 cDNA sequences corresponding to immune, endocrine and inflammatory response genes were collected and categorized. Positive controls included 5 housekeeping genes (glyceraldehydes-3-phosphate dehydrogenase, hypoxanthine phosphoribosyltransferase, ribosomal protein L19, beta-actin, beta2-microglobulin) and bovine genomic DNA. Negative controls were a bacterial gene (Rhodococcus equi 17-kDa virulence-associated protein) and a partial sequence of the plasmid pACYC177. In addition, RNA extracted from un-stimulated, as well as superantigen (Staphylococcus aureus enterotoxin-A, S. aureus Cowan Pansorbin Cells) and mitogen-stimulated (LPS, ConA) bovine blood leukocytes was mixed, reverse transcribed and PCR amplified using gene-specific primers. The endocrine-associated genes were amplified from cDNA derived from un-stimulated bovine hypothalamus, pituitary, adrenal and thyroid gland tissues. The array was constructed in 4 repeating grids of 180 duplicated spots by coupling the PCR amplified 213-630 bp gene fragments onto poly-l-lysine coated glass slides. The bovine immune-endocrine arrays were standardized and preliminary gene expression profiles generated using Cy3 and Cy5 labelled cDNA from un-stimulated and ConA (5 microg/ml) stimulated PBMC of 4 healthy Holstein cows (2-4 replicate arrays/cow) in a time course study. Mononuclear cell-derived cytokine and chemokine (IL-2, IL-1alpha

A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

PubMed Central

Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

2006-01-01

We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

PubMed Central

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

Expression map of a complete set of gustatory receptor genes in chemosensory organs of Bombyx mori.

PubMed

Guo, Huizhen; Cheng, Tingcai; Chen, Zhiwei; Jiang, Liang; Guo, Youbing; Liu, Jianqiu; Li, Shenglong; Taniai, Kiyoko; Asaoka, Kiyoshi; Kadono-Okuda, Keiko; Arunkumar, Kallare P; Wu, Jiaqi; Kishino, Hirohisa; Zhang, Huijie; Seth, Rakesh K; Gopinathan, Karumathil P; Montagné, Nicolas; Jacquin-Joly, Emmanuelle; Goldsmith, Marian R; Xia, Qingyou; Mita, Kazuei

2017-03-01

Most lepidopteran species are herbivores, and interaction with host plants affects their gene expression and behavior as well as their genome evolution. Gustatory receptors (Grs) are expected to mediate host plant selection, feeding, oviposition and courtship behavior. However, due to their high diversity, sequence divergence and extremely low level of expression it has been difficult to identify precisely a complete set of Grs in Lepidoptera. By manual annotation and BAC sequencing, we improved annotation of 43 gene sequences compared with previously reported Grs in the most studied lepidopteran model, the silkworm, Bombyx mori, and identified 7 new tandem copies of BmGr30 on chromosome 7, bringing the total number of BmGrs to 76. Among these, we mapped 68 genes to chromosomes in a newly constructed chromosome distribution map and 8 genes to scaffolds; we also found new evidence for large clusters of BmGrs, especially from the bitter receptor family. RNA-seq analysis of diverse BmGr expression patterns in chemosensory organs of larvae and adults enabled us to draw a precise organ specific map of BmGr expression. Interestingly, most of the clustered genes were expressed in the same tissues and more than half of the genes were expressed in larval maxillae, larval thoracic legs and adult legs. For example, BmGr63 showed high expression levels in all organs in both larval and adult stages. By contrast, some genes showed expression limited to specific developmental stages or organs and tissues. BmGr19 was highly expressed in larval chemosensory organs (especially antennae and thoracic legs), the single exon genes BmGr53 and BmGr67 were expressed exclusively in larval tissues, the BmGr27-BmGr31 gene cluster on chr7 displayed a high expression level limited to adult legs and the candidate CO 2 receptor BmGr2 was highly expressed in adult antennae, where few other Grs were expressed. Transcriptional analysis of the Grs in B. mori provides a valuable new reference for

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

NASA Technical Reports Server (NTRS)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.

PubMed

Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B

1997-06-05

We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.

Pentadecapeptide BPC 157 enhances the growth hormone receptor expression in tendon fibroblasts.

PubMed

Chang, Chung-Hsun; Tsai, Wen-Chung; Hsu, Ya-Hui; Pang, Jong-Hwei Su

2014-11-19

BPC 157, a pentadecapeptide derived from human gastric juice, has been demonstrated to promote the healing of different tissues, including skin, muscle, bone, ligament and tendon in many animal studies. However, the underlying mechanism has not been fully clarified. The present study aimed to explore the effect of BPC 157 on tendon fibroblasts isolated from Achilles tendon of male Sprague-Dawley rat. From the result of cDNA microarray analysis, growth hormone receptor was revealed as one of the most abundantly up-regulated genes in tendon fibroblasts by BPC 157. BPC 157 dose- and time-dependently increased the expression of growth hormone receptor in tendon fibroblasts at both the mRNA and protein levels as measured by RT/real-time PCR and Western blot, respectively. The addition of growth hormone to BPC 157-treated tendon fibroblasts dose- and time-dependently increased the cell proliferation as determined by MTT assay and PCNA expression by RT/real-time PCR. Janus kinase 2, the downstream signal pathway of growth hormone receptor, was activated time-dependently by stimulating the BPC 157-treated tendon fibroblasts with growth hormone. In conclusion, the BPC 157-induced increase of growth hormone receptor in tendon fibroblasts may potentiate the proliferation-promoting effect of growth hormone and contribute to the healing of tendon.

Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process

PubMed Central

Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana

2009-01-01

Purpose There are no selective antagonists for the metabotropic nucleotide P2Y2 receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y2 receptor (P2Y2-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Methods Rabbit P2Y2-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y2-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT–PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y2 agonist, 100 μM Ap4A (diadenosine tetraphosphate). Results The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y2-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y2-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y2-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap4A. In addition, both synthesized siRNAs exert a delay effect on the Ap4A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. Conclusions The application of P2Y2-R si

Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process.

PubMed

Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana; Pintor, Jesús

2009-06-11

There are no selective antagonists for the metabotropic nucleotide P2Y(2) receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y(2) receptor (P2Y(2)-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Rabbit P2Y(2)-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y(2)-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT-PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y(2) agonist, 100 muM Ap(4)A (diadenosine tetraphosphate). The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y(2)-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y(2)-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y(2)-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap(4)A. In addition, both synthesized siRNAs exert a delay effect on the Ap(4)A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. The application of P2Y(2)-R siRNA has

Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

PubMed

Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2015-02-02

Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

PubMed Central

Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

2010-01-01

In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

PubMed Central

Newsome, A L; McLean, J W; Lively, M O

1992-01-01

Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

Cloning and sequencing of the cDNA species for mammalian dimeric dihydrodiol dehydrogenases.

PubMed Central

Arimitsu, E; Aoki, S; Ishikura, S; Nakanishi, K; Matsuura, K; Hara, A

1999-01-01

Cynomolgus and Japanese monkey kidneys, dog and pig livers and rabbit lens contain dimeric dihydrodiol dehydrogenase (EC 1.3.1.20) associated with high carbonyl reductase activity. Here we have isolated cDNA species for the dimeric enzymes by reverse transcriptase-PCR from human intestine in addition to the above five animal tissues. The amino acid sequences deduced from the monkey, pig and dog cDNA species perfectly matched the partial sequences of peptides digested from the respective enzymes of these animal tissues, and active recombinant proteins were expressed in a bacterial system from the monkey and human cDNA species. Northern blot analysis revealed the existence of a single 1.3 kb mRNA species for the enzyme in these animal tissues. The human enzyme shared 94%, 85%, 84% and 82% amino acid identity with the enzymes of the two monkey strains (their sequences were identical), the dog, the pig and the rabbit respectively. The sequences of the primate enzymes consisted of 335 amino acid residues and lacked one amino acid compared with the other animal enzymes. In contrast with previous reports that other types of dihydrodiol dehydrogenase, carbonyl reductases and enzymes with either activity belong to the aldo-keto reductase family or the short-chain dehydrogenase/reductase family, dimeric dihydrodiol dehydrogenase showed no sequence similarity with the members of the two protein families. The dimeric enzyme aligned with low degrees of identity (14-25%) with several prokaryotic proteins, in which 47 residues are strictly or highly conserved. Thus dimeric dihydrodiol dehydrogenase has a primary structure distinct from the previously known mammalian enzymes and is suggested to constitute a novel protein family with the prokaryotic proteins. PMID:10477285

Molecular cloning, characterization, and expression analysis of an ecdysone receptor homolog in Teleogryllus emma (Orthoptera: Gryllidae).

PubMed

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5'-untranslated region of 555 bp and a 3'-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

Molecular Cloning, Characterization, and Expression Analysis of an Ecdysone Receptor Homolog in Teleogryllus emma (Orthoptera: Gryllidae)

PubMed Central

He, Hui; Xi, Gengsi; Lu, Xiao

2015-01-01

Ecdysteroids are steroid hormones that play important roles in the regulation of Arthropoda animal growth development, larvae ecdysis, and reproduction. The effect of ecdysteroids is mediated by ecdysteroid receptor (EcR). The ecdysone receptor (EcR) belongs to the superfamily of nuclear receptors (NRs) that are ligand-dependent transcription factors. Ecdysone receptor is present only in invertebrates and plays a critical role in regulating the expression of a series of genes during development and reproduction. Here, we isolated and characterized cDNA of the cricket Teleopgryllus emma (Ohmachi & Matsuura) (Orthoptera: Gryllidae) and studied mRNA expression pattern using real time-polymerase chain reaction. The full-length cDNA of T. emma EcR, termed TeEcR, is 2,558 bp and contains a 5′-untranslated region of 555 bp and a 3′-untranslated region of 407 bp. The open reading frame of TeEcR encodes deduced 531-amino acid peptides with a predicted molecular mass of 60.7 kDa. The amino acid sequence of T. emma EcR was similar to that of known EcR especially in the ligand-binding domain of insect EcR. Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare TeEcR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeEcR mRNA is differentially expressed during T. emma development, with the highest expression level in late-instar larvae of the body and lowest in third instar. The levels of TeEcR transcripts also vary among gonads development, and levels in ovaries were higher than in testes at every developmental stage. These results suggest that TeEcR may have potential significance to regulate the morphological structure and gonad development of T. emma, due to its expression in different developmental periods. PMID:25797799

Am5-HT7: molecular and pharmacological characterization of the first serotonin receptor of the honeybee (Apis mellifera).

PubMed

Schlenstedt, Jana; Balfanz, Sabine; Baumann, Arnd; Blenau, Wolfgang

2006-09-01

The biogenic amine serotonin (5-HT) plays a key role in the regulation and modulation of many physiological and behavioural processes in both vertebrates and invertebrates. These functions are mediated through the binding of serotonin to its receptors, of which 13 subtypes have been characterized in vertebrates. We have isolated a cDNA from the honeybee Apis mellifera (Am5-ht7) sharing high similarity to members of the 5-HT(7) receptor family. Expression of the Am5-HT(7) receptor in HEK293 cells results in an increase in basal cAMP levels, suggesting that Am5-HT(7) is expressed as a constitutively active receptor. Serotonin application to Am5-ht7-transfected cells elevates cyclic adenosine 3',5'-monophosphate (cAMP) levels in a dose-dependent manner (EC(50) = 1.1-1.8 nm). The Am5-HT(7) receptor is also activated by 5-carboxamidotryptamine, whereas methiothepin acts as an inverse agonist. Receptor expression has been investigated by RT-PCR, in situ hybridization, and western blotting experiments. Receptor mRNA is expressed in the perikarya of various brain neuropils, including intrinsic mushroom body neurons, and in peripheral organs. This study marks the first comprehensive characterization of a serotonin receptor in the honeybee and should facilitate further analysis of the role(s) of the receptor in mediating the various central and peripheral effects of 5-HT.

A jojoba beta-Ketoacyl-CoA synthase cDNA complements the canola fatty acid elongation mutation in transgenic plants.

PubMed Central

Lassner, M W; Lardizabal, K; Metz, J G

1996-01-01

beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils. PMID:8742713

Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

PubMed

Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

2016-03-01

Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

Mice with Inactivation of Aryl Hydrocarbon Receptor-Interacting Protein (Aip) Display Complete Penetrance of Pituitary Adenomas with Aberrant ARNT Expression

PubMed Central

Raitila, Anniina; Lehtonen, Heli J.; Arola, Johanna; Heliövaara, Elina; Ahlsten, Manuel; Georgitsi, Marianthi; Jalanko, Anu; Paetau, Anders; Aaltonen, Lauri A.; Karhu, Auli

2010-01-01

Mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene have been shown to predispose to pituitary adenoma predisposition, a condition characterized by growth hormone (GH)-secreting pituitary tumors. To study AIP-mediated tumorigenesis, we generated an Aip mouse model. Heterozygous mice developed normally but were prone to pituitary adenomas, in particular to those secreting GH. A complete loss of AIP was detected in these lesions, and full penetrance was reached at the age of 15 months. No excess of any other tumor type was found. Ki-67 analysis indicated that Aip-deficient tumors have higher proliferation rates compared with Aip-proficient tumors, suggesting a more aggressive disease. Similar to human AIP-deficient pituitary adenomas, immunohistochemical studies showed that expression of aryl hydrocarbon receptor nuclear translocator 1 or 2 (ARNT or ARNT2) protein was lost in the mouse tumors, suggesting that mechanisms of AIP-related tumorigenesis involve aberrant ARNT function. The Aip+/− mouse appears to be an excellent model for the respective human disease phenotype. This model constitutes a tool to further study AIP-associated pituitary tumorigenesis and may be potentially valuable in efforts to develop therapeutic strategies to treat pituitary adenomas. PMID:20709796

Identification and cloning of a glycoprotein hormone receptor from sea lamprey, Petromyzon marinus.

PubMed

Freamat, Mihael; Kawauchi, Hiroshi; Nozaki, Masumi; Sower, Stacia A

2006-08-01

A full-length transcript encoding a functional lamprey glycoprotein hormone receptor I (lGpH-R I, GenBank AY750688) was cloned from the testes of the sea lamprey, Petromyzon marinus, using the GpH-R protein fingerprint GLYCHORMONER from the PRINTS database. The present study is the first to identify a GpH-R transcript in an agnathan, which is one of the only two representatives of the oldest lineage of vertebrates. The 719-amino acid full-length cDNA encoding lGpH-R I is highly similar and is likely a homolog of the vertebrate GpH-Rs (including LH, FSH, and TSH receptors). The key motifs, sequence comparisons, and characteristics of the identified GpH-R reveal a mosaic of features common to all other classes of GpH-Rs in vertebrates. The lGpH-R I was shown to activate the cAMP signaling system using human chorionic gonadotropin in transiently transfected COS-7 cells. The highest expression of the receptor transcript was demonstrated in the testes using reverse transcriptase-PCR. Lower levels of the receptor transcript were also detected in brain, heart, intestine, kidney, liver, muscle, and thyroid. The high expression of lGpH-R I in the testis and the high similarity with gnathostome gonadotropin hormone receptors suggest that lGpH-R I functions as a receptor for lamprey gonadotropin hormones. We hypothesize from these data that there is lower specificity of gonadotropin and its receptor in agnathans and that during co-evolution of the ligand and its receptor in gnathostomes, there were increased specificities of interactions between each GpH (TSH, LH, and FSH) and its receptor.

Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

PubMed

Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

2017-02-16

Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

Yoctomole electrochemical genosensing of Ebola virus cDNA by rolling circle and circle to circle amplification.

PubMed

Carinelli, S; Kühnemund, M; Nilsson, M; Pividori, M I

2017-07-15

This work addresses the design of an Ebola diagnostic test involving a simple, rapid, specific and highly sensitive procedure based on isothermal amplification on magnetic particles with electrochemical readout. Ebola padlock probes were designed to detect a specific L-gene sequence present in the five most common Ebola species. Ebola cDNA was amplified by rolling circle amplification (RCA) on magnetic particles. Further re-amplification was performed by circle-to-circle amplification (C2CA) and the products were detected in a double-tagging approach using a biotinylated capture probe for immobilization on magnetic particles and a readout probe for electrochemical detection by square-wave voltammetry on commercial screen-printed electrodes. The electrochemical genosensor was able to detect as low as 200 ymol, corresponding to 120 cDNA molecules of L-gene Ebola virus with a limit of detection of 33 cDNA molecules. The isothermal double-amplification procedure by C2CA combined with the electrochemical readout and the magnetic actuation enables the high sensitivity, resulting in a rapid, inexpensive, robust and user-friendly sensing strategy that offers a promising approach for the primary care in low resource settings, especially in less developed countries. Copyright © 2016 Elsevier B.V. All rights reserved.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

PubMed

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR

PubMed Central

2013-01-01

Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071

Antagonistic effect of disulfide-rich peptide aptamers selected by cDNA display on interleukin-6-dependent cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemoto, Naoto, E-mail: nemoto@fms.saitama-u.ac.jp; Innovation Center for Startups, National Institute of Advanced Industrial Science and Technology, 2-2-2 Marunouchi, Chiyoda-ku, Tokyo 100-0005; Janusys Corporation, 508, Saitama Industrial Technology Center, Skip City, 3-12-18 Kami-Aoki, Kawaguchi, Saitama 333-0844

2012-04-27

Highlights: Black-Right-Pointing-Pointer Disulfide-rich peptide aptamer inhibits IL-6-dependent cell proliferation. Black-Right-Pointing-Pointer Disulfide bond of peptide aptamer is essential for its affinity to IL-6R. Black-Right-Pointing-Pointer Inhibitory effect of peptide depends on number and pattern of its disulfide bonds. -- Abstract: Several engineered protein scaffolds have been developed recently to circumvent particular disadvantages of antibodies such as their large size and complex composition, low stability, and high production costs. We previously identified peptide aptamers containing one or two disulfide-bonds as an alternative ligand to the interleukin-6 receptor (IL-6R). Peptide aptamers (32 amino acids in length) were screened from a random peptide library bymore » in vitro peptide selection using the evolutionary molecular engineering method 'cDNA display'. In this report, the antagonistic activity of the peptide aptamers were examined by an in vitro competition enzyme-linked immunosorbent assay (ELISA) and an IL-6-dependent cell proliferation assay. The results revealed that a disulfide-rich peptide aptamer inhibited IL-6-dependent cell proliferation with similar efficacy to an anti-IL-6R monoclonal antibody.« less

Synaptic Neurotransmitter-Gated Receptors

PubMed Central

Smart, Trevor G.; Paoletti, Pierre

2012-01-01

Since the discovery of the major excitatory and inhibitory neurotransmitters and their receptors in the brain, many have deliberated over their likely structures and how these may relate to function. This was initially satisfied by the determination of the first amino acid sequences of the Cys-loop receptors that recognized acetylcholine, serotonin, GABA, and glycine, followed later by similar determinations for the glutamate receptors, comprising non-NMDA and NMDA subtypes. The last decade has seen a rapid advance resulting in the first structures of Cys-loop receptors, related bacterial and molluscan homologs, and glutamate receptors, determined down to atomic resolution. This now provides a basis for determining not just the complete structures of these important receptor classes, but also for understanding how various domains and residues interact during agonist binding, receptor activation, and channel opening, including allosteric modulation. This article reviews our current understanding of these mechanisms for the Cys-loop and glutamate receptor families. PMID:22233560

Sharpening spots: correcting for bleedover in cDNA array images.

PubMed

Therneau, Terry; Tschumper, Renee C; Jelinek, Diane

2002-03-01

For cDNA array methods that depend on imaging of a radiolabel, we show that bleedover of one spot onto another, due to the gap between the array and the imaging media, can be a major problem. The images can be sharpened, however, using a blind convolution method based on the EM algorithm. The sharpened images look like a set of donuts, which concurs with our knowledge of the spotting process. Oversharpened images are actually useful as well, in locating the centers of each spot.

Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

PubMed

Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

2009-09-01

We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

Ligand-receptor assay for evaluation of functional activity of human recombinant VEGF and VEGFR-1 extracellular fragment.

PubMed

Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P

2012-04-01

cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.

Molecular cloning and characterization of a new basic peroxidase cDNA from soybean hypocotyls infected with Phytophthora sojae f.sp. glycines.

PubMed

Yi, S Y; Hwang, B K

1998-10-31

Differential display techniques were used to isolate cDNA clones corresponding to genes which were expressed in soybean hypocotyls by Phytophthora sojae f.sp. glycines infection. With a partial cDNA clone C20CI4 from the differential display PCR as a probe, a new basic peroxidase cDNA clone, designated GMIPER1, was isolated from a cDNA library of soybean hypocotyls infected with P. sojae f.sp. glycines. Sequence analysis revealed that the peroxidase clone encodes a mature protein of 35,813 Da with a putative signal peptide of 27 amino acids in its N-terminus. The amino acid sequence of the soybean peroxidase GMIPER1 is between 54-75% identical to other plant peroxidases including a soybean seed coat peroxidase. Southern blot analysis indicated that multiple copies of sequences related to GMIPER1 exist in the soybean genome. The mRNAs corresponding to the GMIPER1 cDNA accumulated predominantly in the soybean hypocotyls infected with the incompatible race of P. sojae f.sp. glycines, but were expressed at low levels in the compatible interaction. Soybean GMIPER1 mRNAs were not expressed in hypocotyls, leaves, stems, and roots of soybean seedlings. However, treatments with ethephon, salicylic acid or methyl jasmonate induced the accumulation of the GMIPER1 mRNAs in the different organs of soybean. These results suggest that the GMIPER1 gene encoding a putative pathogen-induced peroxidase may play an important role in induced resistance of soybean to P. sojae f.sp. glycines and in response to various external stresses.

Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

PubMed Central

Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

1993-01-01

Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism.

PubMed Central

Amselem, S; Sobrier, M L; Duquesnoy, P; Rappaport, R; Postel-Vinay, M C; Gourmelen, M; Dallapiccola, B; Goossens, M

1991-01-01

In addition to its classical effects on growth, growth hormone (GH) has been shown to have a number of other actions, all of which are initiated by an interaction with specific high affinity receptors present in a variety of tissues. Purification of a rabbit liver protein via its ability to bind GH has allowed the isolation of a cDNA encoding a putative human growth hormone receptor that belongs to a new class of transmembrane receptors. We have previously shown that this putative growth hormone receptor gene is genetically linked to Laron dwarfism, a rare autosomal recessive syndrome caused by target resistance to GH. Nevertheless, the inability to express the corresponding full-length coding sequence and the lack of a test for growth-promoting function have hampered a direct confirmation of its role in growth. We have now identified three nonsense mutations within this growth hormone receptor gene, lying at positions corresponding to the amino terminal extremity and causing a truncation of the molecule, thereby deleting a large portion of both the GH binding domain and the full transmembrane and intracellular domains. Three independent patients with Laron dwarfism born of consanguineous parents were homozygous for these defects. Two defects were identical and consisted of a CG to TG transition. Not only do these results confirm the growth-promoting activity of this receptor but they also suggest that CpG doublets may represent hot spots for mutations in the growth hormone receptor gene that are responsible for hereditary dwarfism. Images PMID:1999489

STUDIES OF NORMAL GENE EXPRESSION IN THE RAT NASAL EPITHELIUM USNG CDNA ARRAY TECHNOLOGY

EPA Science Inventory

Studies of Normal Gene Expression in the Rat Nasal Epithelium Using cDNA Array

The nasal epithelium is an important target site for chemically-induced toxicity and carcinogenicity .Gene expression data are being used increasingly for studies of such conditions. In or...

Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

PubMed

Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

1999-09-01

We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

PubMed

Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

2000-05-31

cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

PubMed

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

EST resources and establishment and validation of a 16k cDNA microarray from Atlantic cod (Gadus morhua).

PubMed

Edvardsen, Rolf B; Malde, Ketil; Mittelholzer, Christian; Taranger, Geir Lasse; Nilsen, Frank

2011-03-01

The Atlantic cod, Gadus morhua, is an important species both for traditional fishery and increasingly also in fish farming. The Atlantic cod is also under potential threat from various environmental changes such as pollution and climate change, but the biological impact of such changes are not well known, in particular when it comes to sublethal effects that can be difficult to assert. Modern molecular and genomic approaches have revolutionized biological research during the last decade, and offer new avenues to study biological functions and e.g. the impact of anthropogenic activities at different life-stages for a given organism. In order to develop genomic data and genomic tools for Atlantic cod we conducted a program were we constructed 20 cDNA libraries, and produced and analyzed 44006 expressed sequence tags (ESTs) from these. Several tissues are represented in the multiple cDNA libraries, that differ in either sexual maturation or immulogical stimulation. This approach allowed us to identify genes that are expressed in particular tissues, life-stages or in response to specific stimuli, and also gives us information about potential functions of the transcripts. The ESTs were used to construct a 16k cDNA microarray to further investigate the cod transcriptome. Microarray analyses were preformed on pylorus, pituitary gland, spleen and testis of sexually maturing male cod. The four different tissues displayed tissue specific transcriptomes demonstrating that the cDNA array is working as expected and will prove to be a powerful tool in further experiments. Copyright © 2010 Elsevier Inc. All rights reserved.

Expression cloning and chromosomal mapping of the leukocyte activation antigen CD97, a new seven-span transmembrane molecule of the secretin receptor superfamily with an unusual extracellular domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamann, J.; Hamann, D.; Lier, R.A.W.

1995-08-15

CD97 is a monomeric glycoprotein of 75 to 85 kDa that is induced rapidly on the surface of most leukocytes upon activation. We herein report the isolation of a cDNA encoding human CD97 by expression cloning in COS cells. The 3-kb cDNA clone encodes a mature polypeptide chain of 722 amino acids with a predicted molecular mass of 79 kDa. Within the C-terminal part of the protein, a region with seven hydrophobic segments was identified, suggesting that CD97 is a seven-span transmembrane molecule. Sequence comparison indicates that CD97 is the first leukocyte Ag in a recently described superfamily that includesmore » the receptors for secretin, calcitonin, and other mammalian and insect peptide hormones. Different from these receptors, CD97 has an extended extracellular region of 433 amino acids that possesses three N-terminal epidermal growth factor-like domains, two of them with a calcium-binding site, and single Arg-Gly-Asp (RGD) motif. The existence of structural elements characteristic for extracellular matrix proteins in a seven-span transmembrane molecule makes CD97 a receptor potentially involved in both adhesion and signaling processes early after leukocyte activation. The gene encoding CD97 is localized on chromosome 19 (19p13.12-13.2).« less

Thyroid hormone and retinoid X receptor function and expression during sea lamprey (Petromyzon marinus) metamorphosis.

PubMed

Manzon, Lori A; Youson, John H; Holzer, Guillaume; Staiano, Leopoldo; Laudet, Vincent; Manzon, Richard G

2014-08-01

Sea lampreys (Petromyzon marinus) are members of the ancient class Agnatha and undergo a metamorphosis that transforms blind, sedentary, filter-feeding larvae into free-swimming, parasitic juveniles. Thyroid hormones (THs) appear to be important for lamprey metamorphosis, however, serum TH concentrations are elevated in the larval phase, decline rapidly during early metamorphosis and remain low until metamorphosis is complete; these TH fluctuations are contrary to those of other metamorphosing vertebrates. Moreover, thyroid hormone synthesis inhibitors (goitrogens) induce precocious metamorphosis and exogenous TH treatments disrupt natural metamorphosis in P. marinus. Given that THs exert their effects by binding to TH nuclear receptors (TRs) that often act as heterodimers with retinoid X receptors (RXRs), we cloned and characterized these receptors from P. marinus and examined their expression during metamorphosis. Two TRs (PmTR1 and PmTR2) and three RXRs (PmRXRs) were isolated from P. marinus cDNA. Phylogenetic analyses group the PmTRs together on a branch prior to the gnathostome TRα/β split. The three RXRs also group together, but our data indicated that these transcripts are most likely either allelic variants of the same gene locus, or the products of a lamprey-specific duplication event. Importantly, these P. marinus receptors more closely resemble vertebrate as opposed to invertebrate chordate receptors. Functional analysis revealed that PmTR1 and PmTR2 can activate transcription of TH-responsive genes when treated with nanomolar concentrations of TH and they have distinct pharmacological profiles reminiscent of vertebrate TRβ and TRα, respectively. Also similar to other metamorphosing vertebrates, expression patterns of the PmTRs during lamprey metamorphosis suggest that PmTR1 has a dynamic, tissue-specific expression pattern that correlates with tissue morphogenesis and biochemical changes and PmTR2 has a more uniform expression pattern. This TR

Cloning and expression studies of the Dunaliella salina UDP-glucose dehydrogenase cDNA.

PubMed

Qinghua, He; Dairong, Qiao; Qinglian, Zhang; Shunji, He; Yin, Li; Linhan, Bai; Zhirong, Yang; Yi, Cao

2005-06-01

The enzyme UDP-glucose dehydrogenase (EC 1.1.1.22) converts UDP-glucose to UDP-glucuronate. Plant UDP-glucose dehydrogenase (UGDH) is an important enzyme in the formation of hemicellulose and pectin, the components of primary cell walls. A cDNA, named DsUGDH, (GeneBank accession number: AY795899) corresponding to UGDH was cloned by RT-PCR approach from Dunaliella salina. The cDNA is 1941-bp long and has an open reading frame encoded a protein of 483 amino acids with a calculated molecular weight of 53 kDa. The derived amino acids sequence shows high homology with reported plants UGDHs, and has highly conserved amino acids motifs believed to be NAD binding site and catalytic site. Although UDP-glucose dehydrogenase is a comparatively well characterized enzyme, the cloning and characterization of the green alga Dunaliella salina UDP-glucose dehydrogenase gene is very important to understand the salt tolerance mechanism of Dunaliella salina. Northern analyses indicate that NaCl can induce the expression the DsUGDH.

Construction and characterization of a normalized cDNA library of Nannochloropsis oculata (Eustigmatophyceae)

NASA Astrophysics Data System (ADS)

Yu, Jianzhong; Ma, Xiaolei; Pan, Kehou; Yang, Guanpin; Yu, Wengong

2010-07-01

We constructed and characterized a normalized cDNA library of Nannochloropsis oculata CS-179, and obtained 905 nonredundant sequences (NRSs) ranging from 431-1 756 bp in length. Among them, 496 were very similar to nonredundant ones in the GenBank ( E ≤1.0e-05), and 349 ESTs had significant hits with the clusters of eukaryotic orthologous groups (KOG). Bases G and/or C at the third position of codons of 14 amino acid residues suggested a strong bias in the conserved domain of 362 NRSs (>60%). We also identified the unigenes encoding phosphorus and nitrogen transporters, suggesting that N. oculata could efficiently transport and metabolize phosphorus and nitrogen, and recognized the unigenes that involved in biosynthesis and storage of both fatty acids and polyunsaturated fatty acids (PUFAs), which will facilitate the demonstration of eicosapentaenoic acid (EPA) biosynthesis pathway of N. oculata. In comparison with the original cDNA library, the normalized library significantly increased the efficiencies of random sequencing and rarely expressed genes discovering, and decreased the frequency of abundant gene sequences.

Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai

PubMed Central

Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

2016-01-01

An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His69, Asp117, and Ser216. The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5′ donor splice (GT) and 3′ acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai. PMID:27399771

Cloning a Chymotrypsin-Like 1 (CTRL-1) Protease cDNA from the Jellyfish Nemopilema nomurai.

PubMed

Heo, Yunwi; Kwon, Young Chul; Bae, Seong Kyeong; Hwang, Duhyeon; Yang, Hye Ryeon; Choudhary, Indu; Lee, Hyunkyoung; Yum, Seungshic; Shin, Kyoungsoon; Yoon, Won Duk; Kang, Changkeun; Kim, Euikyung

2016-07-05

An enzyme in a nematocyst extract of the Nemopilema nomurai jellyfish, caught off the coast of the Republic of Korea, catalyzed the cleavage of chymotrypsin substrate in an amidolytic kinetic assay, and this activity was inhibited by the serine protease inhibitor, phenylmethanesulfonyl fluoride. We isolated the full-length cDNA sequence of this enzyme, which contains 850 nucleotides, with an open reading frame of 801 encoding 266 amino acids. A blast analysis of the deduced amino acid sequence showed 41% identity with human chymotrypsin-like (CTRL) and the CTRL-1 precursor. Therefore, we designated this enzyme N. nomurai CTRL-1. The primary structure of N. nomurai CTRL-1 includes a leader peptide and a highly conserved catalytic triad of His(69), Asp(117), and Ser(216). The disulfide bonds of chymotrypsin and the substrate-binding sites are highly conserved compared with the CTRLs of other species, including mammalian species. Nemopilema nomurai CTRL-1 is evolutionarily more closely related to Actinopterygii than to Scyphozoan (Aurelia aurita) or Hydrozoan (Hydra vulgaris). The N. nomurai CTRL1 was amplified from the genomic DNA with PCR using specific primers designed based on the full-length cDNA, and then sequenced. The N. nomurai CTRL1 gene contains 2434 nucleotides and four distinct exons. The 5' donor splice (GT) and 3' acceptor splice sequences (AG) are wholly conserved. This is the first report of the CTRL1 gene and cDNA structures in the jellyfish N. nomurai.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Beta-ketoacyl-acyl carrier protein synthase III from pea (Pisum sativum L.): properties, inhibition by a novel thiolactomycin analogue and isolation of a cDNA clone encoding the enzyme.

PubMed

Jones, A Lesley; Gane, Andy M; Herbert, Derek; Willey, David L; Rutter, Andrew J; Kille, Peter; Dancer, Jane E; Harwood, John L

2003-03-01

A beta-ketoacyl-acyl carrier protein (ACP) synthase III (KAS III; short-chain condensing enzyme) has been partly purified from pea leaves. The enzyme, which had acetyl-CoA:ACP acyltransferase (ACAT) activity, was resolved from a second, specific, ACAT protein. The KAS III enzyme had a derived molecular mass of 42 kDa (from its cDNA sequence) and operated as a dimer. Its enzymological characteristics were similar to those of two other plant KAS III enzymes except for its inhibition by thiolactomycin. A derivative of thiolactomycin containing a longer (C8 saturated) hydrophobic side-chain (compound 332) was a more effective inhibitor of pea KAS III and showed competitive inhibition towards malonyl-ACP whereas thiolactomycin showed uncompetitive characteristics at high concentrations. This difference may be due to the better fit of compound 332 into a hydrophobic pocket at the active site. A full-length cDNA for the pea KAS III was isolated. This was expressed in Escherichia coli as a fusion protein with glutathione S-transferase in order to facilitate subsequent purification. Demonstrated activity in preparations from E. coli confirmed that the cDNA encoded a KAS III enzyme. Furthermore, the expressed KAS III had ACAT activity, showing that the latter was inherent. The derived amino acid sequence of the pea cDNA showed 81-87% similarity to that for other plant dicotyledon KAS IIIs, somewhat less for Allium porrum (leek, 71%) and for Porphyra spp. (62%), Synechocystis spp. (65%) and various bacteria (42-65%). The pea KAS III exhibited four areas of homology, three of which were around the active-site Cys(123), His(323) and Asn(353). In addition, a stretch of 23 amino acids (residues 207-229 in the pea KAS III) was almost completely conserved in the plant KAS IIIs. Modelling this stretch showed they belonged to a peptide fragment that fitted over the active site and contained segments suggested to be involved in substrate binding and in conformational changes during

Purification of a Jojoba Embryo Fatty Acyl-Coenzyme A Reductase and Expression of Its cDNA in High Erucic Acid Rapeseed

PubMed Central

Metz, James G.; Pollard, Michael R.; Anderson, Lana; Hayes, Thomas R.; Lassner, Michael W.

2000-01-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes. PMID:10712526

Purification of a jojoba embryo fatty acyl-coenzyme A reductase and expression of its cDNA in high erucic acid rapeseed.

PubMed

Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W

2000-03-01

The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Molecular Cloning, Characterization, and Expression Analysis of an Estrogen Receptor-Related Receptor Homologue in the Cricket, Teleogryllus emma

PubMed Central

He, Hui; Xi, Gengsi; Lu, Xiao

2010-01-01

The estrogen receptor-related receptors (ERRs) are a group of nuclear receptors that were originally identified on the basis of sequence similarity to estrogen receptors. The three mammalian ERR genes have been implicated in diverse physiological processes ranging from placental development to maintenance of bone density, but the function and regulation of ERRs in invertebrates are not well understood. A homologue of human ERR was isolated from the cricket Teleogryllus emma (Ohmachi and Matsumura) (Orthoptera: Gryllidae). The full-length cDNA of T. emma ERR, termed TeERR, has 1618 base pair (bp) and contains a 5′?-untranslated region of 140 bp and a 3′?-untranslated region of 272 bp. The open reading frame of TeERR encodes a deduced 401 amino acid peptide with a predicted molecular mass of 45.75 kilodaltons. The results of sequence alignments indicate that the TeERR protein shares an overall identity of 65%–82% with other known ERR homologues, and is most closely related to that of Nasonia vitripennis (Hymenoptera: Pteromalidae) and Apis mellifera (Apidae). Real-time quantitative reverse transcription-polymerase chain reaction was performed to compare the TeERR mRNA expression level at the whole body and gonad during T. emma development. The data revealed that TeERR mRNA is differentially expressed during T. emma development, with the highest expression level in embryos and the lowest in the body of late-instar larvae. The levels of TeERR transcripts also varied throughout gonad development; interestingly testicles had higher higher expression levels than ovaries at every development stage. These results suggest that TeERR has potential significance in the regulation of development in T. emma, due to its expression during different developmental periods. PMID:21265615

The mining of pearl formation genes in pearl oyster Pinctada fucata by cDNA suppression subtractive hybridization.

PubMed

Wang, Ning; Kinoshita, Shigeharu; Nomura, Naoko; Riho, Chihiro; Maeyama, Kaoru; Nagai, Kiyohito; Watabe, Shugo

2012-04-01

Recent researches revealed the regional preference of biomineralization gene transcription in the pearl oyster Pinctada fucata: it transcribed mainly the genes responsible for nacre secretion in mantle pallial, whereas the ones regulating calcite shells expressed in mantle edge. This study took use of this character and constructed the forward and reverse suppression subtractive hybridization (SSH) cDNA libraries. A total of 669 cDNA clones were sequenced and 360 expressed sequence tags (ESTs) greater than 100 bp were generated. Functional annotation associated 95 ESTs with specific functions, and 79 among them were identified from P. fucata at the first time. In the forward SSH cDNA library, it recognized mass amount of nacre protein genes, biomineralization genes dominantly expressed in the mantle pallial, calcium-ion-binding genes, and other biomineralization-related genes important for pearl formation. Real-time PCR showed that all the examined genes were distributed in oyster mantle tissues with a consistence to the SSH design. The detection of their RNA transcripts in pearl sac confirmed that the identified genes were certainly involved in pearl formation. Therefore, the data from this work will initiate a new round of pearl formation gene study and shed new insights into molluscan biomineralization.

Molecular characterization of human thyroid hormone receptor β isoform 4.

PubMed

Moriyama, Kenji; Yamamoto, Hiroyuki; Futawaka, Kumi; Atake, Asami; Kasahara, Masato; Tagami, Tetsuya

2016-01-01

Thyroid hormone exerts a pleiotropic effect on development, differentiation, and metabolism through thyroid hormone receptor (TR). A novel thyroid hormone receptor β isoform (TRβ4) was cloned using PCR from a human pituitary cDNA library as a template. We report here the characterization of TRβ4 from a molecular basis. Temporal expression of TRβ4 during the fetal period is abundant in the brain and kidney, comparable with the adult pattern. Western blot analysis revealed that TRs are ubiquitination labile proteins, while TRβ1 is potentially stable. TRβ1, peroxisome proliferator-activated receptors (PPAR), and vitamin D receptor (VDR), which belong to class II transcription factors that function via the formation of heterodimeric complexes with retinoid X receptor (RXR), were suppressed by TRβ4 in a dose-dependent manner. Thus, TRβ4 exhibits ligand-independent transcriptional silencing, possibly as a substitute for dimerized RXR. In this study, TRβ1 and TRβ4 transcripts were detected in several cell lines. Quantitative RT-PCR assay showed that the expression of TRβ4 in human embryonic carcinoma cells of the testis was suppressed by sex hormone in a reciprocal manner to TRβ1. In contrast, TRβ4 was expressed under a high dose of triiodothyronine (T3) in a reciprocal manner to TRβ1. Finally, in transiently transfected NIH-3T3 cells, green fluorescence protein (GFP)-tagged TRβ4 was mostly nuclear in both the absence and the presence of T3. By mutating defined regions of both TRβs, we found that both TRβ1 and TRβ4 had altered nuclear/cytoplasmic distribution as compared with wild-type, and different to T3 and the nuclear receptor corepressor (NCoR). Thus, site-specific DNA binding is not essential for maintaining TRβs within the nucleus.

Receptor-receptor interactions within receptor mosaics. Impact on neuropsychopharmacology.

PubMed

Fuxe, K; Marcellino, D; Rivera, A; Diaz-Cabiale, Z; Filip, M; Gago, B; Roberts, D C S; Langel, U; Genedani, S; Ferraro, L; de la Calle, A; Narvaez, J; Tanganelli, S; Woods, A; Agnati, L F

2008-08-01

representing a compensatory up-regulation to counteract the cocaine-induced increases in dopamine D(2) and D(3) signaling. Therefore, A(2A) agonists, through antagonizing D(2) and D(3) signaling within A(2A)/D(2) and A(2A)/D(3) RM heteromers in the nucleus accumbens, may be found useful as a treatment for cocaine dependence. Furthermore, antagonistic cannabinoid CB(1)/D(2) interactions requiring A(2A) receptors have also been discovered and possibly operate in CB(1)/D(2)/A(2A) RM located principally on striatal glutamate terminals but also on some ventral striato-pallidal GABA neurons, thereby opening up a new mechanism for the integration of endocannabinoid, DA and adenosine mediated signals. Thus, A(2A), mGluR5 and/or CB(1) receptors can form integrative units with D(2) receptors within RM displaying different compositions, topography and localization. Also galaninR/5-HT(1A) RM probably participates in the transmission of the ascending 5-hydroxytryptamine neurons, where galanin receptors antagonize 5-HT(1A) recognition and signaling. Subtype specific galanin receptor antagonists may therefore represent novel antidepressant drugs. These results suggest the importance of a complete understanding of the function of these RM with regard to disease. Ultimately receptor-receptor interactions within RM that modify dopaminergic and serotonergic signaling may give new strategies for treatment of a wide range of diseases associated with altered dopaminergic and serotonergic signaling.

Cloning of the cDNA for U1 small nuclear ribonucleoprotein particle 70K protein from Arabidopsis thaliana

NASA Technical Reports Server (NTRS)

Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.

1992-01-01

We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.

Molecular cloning of a catalase cDNA from Nicotiana glutinosa L. and its repression by tobacco mosaic virus infection.

PubMed

Yi, S Y; Yu, S H; Choi, D

1999-06-30

Recent reports revealed that catalase has a role in the plant defense mechanism against a broad range of pathogens through being inhibited by salicylic acid (SA). During an effort to clone disease resistance-responsive genes, a cDNA encoding catalase (Ngcat1; Nicotiana glutinosa cat1) was isolated from a tobacco cDNA library. In N. glutinosa, catalase is encoded by a small gene family. The deduced amino acid sequence of the Ngcat1 cDNA has 98% homology with the cat1 gene of N. plumbaginifolia. The Ngcat1 expression is controlled by the circadian clock, and its mRNA level is the most abundant in leaves. Both the expression of Ngcat1 mRNA and its enzyme activity in the tobacco plant undergoing a hypersensitive response (HR) to TMV infection were repressed. The repression of the mRNA level was also observed following treatment with SA. These results imply that SA may act as an inhibitor of catalase transcription during the HR of tobacco. Cloning and expression of the Ngcat1 in tobacco following pathogen infection and SA treatment are presented.

Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase

PubMed Central

Colby, Sheila M.; Crock, John; Dowdle-Rizzo, Barbara; Lemaux, Peggy G.; Croteau, Rodney

1998-01-01

Germacrene C was found by GC-MS and NMR analysis to be the most abundant sesquiterpene in the leaf oil of Lycopersicon esculentum cv. VFNT Cherry, with lesser amounts of germacrene A, guaia-6,9-diene, germacrene B, β-caryophyllene, α-humulene, and germacrene D. Soluble enzyme preparations from leaves catalyzed the divalent metal ion-dependent cyclization of [1-3H]farnesyl diphosphate to these same sesquiterpene olefins, as determined by radio-GC. To obtain a germacrene synthase cDNA, a set of degenerate primers was constructed based on conserved amino acid sequences of related terpenoid cyclases. With cDNA prepared from leaf epidermis-enriched mRNA, these primers amplified a 767-bp fragment that was used as a hybridization probe to screen the cDNA library. Thirty-one clones were evaluated for functional expression of terpenoid cyclase activity in Escherichia coli by using labeled geranyl, farnesyl, and geranylgeranyl diphosphates as substrates. Nine cDNA isolates expressed sesquiterpene synthase activity, and GC-MS analysis of the products identified germacrene C with smaller amounts of germacrene A, B, and D. None of the expressed proteins was active with geranylgeranyl diphosphate; however, one truncated protein converted geranyl diphosphate to the monoterpene limonene. The cDNA inserts specify a deduced polypeptide of 548 amino acids (Mr = 64,114), and sequence comparison with other plant sesquiterpene cyclases indicates that germacrene C synthase most closely resembles cotton δ-cadinene synthase (50% identity). PMID:9482865

Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

NASA Astrophysics Data System (ADS)

Qi, Fei; Guo, Huarong; Wang, Jian

2008-02-01

Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Comparison of the Predictive Accuracy of DNA Array-Based Multigene Classifiers across cDNA Arrays and Affymetrix GeneChips

PubMed Central

Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos

2005-01-01

We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308

The TGA codons are present in the open reading frame of selenoprotein P cDNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hill, K.E.; Lloyd, R.S.; Read, R.

1991-03-11

The TGA codon in DNA has been shown to direct incorporation of selenocysteine into protein. Several proteins from bacteria and animals contain selenocysteine in their primary structures. Each of the cDNA clones of these selenoproteins contains one TGA codon in the open reading frame which corresponds to the selenocysteine in the protein. A cDNA clone for selenoprotein P (SeP), obtained from a {gamma}ZAP rat liver library, was sequenced by the dideoxy termination method. The correct reading frame was determined by comparison of the deduced amino acid sequence with the amino acid sequence of several peptides from SeP. Using SeP labelledmore » with {sup 75}Se in vivo, the selenocysteine content of the peptides was verified by the collection of carboxymethylated {sup 77}Se-selenocysteine as it eluted from the amino acid analyzer and determination of the radioactivity contained in the collected samples. Ten TGA codons are present in the open reading frame of the cDNA. Peptide fragmentation studies and the deduced sequence indicate that selenium-rich regions are located close to the carboxy terminus. Nine of the 10 selenocysteines are located in the terminal 26% of the sequence with four in the terminal 15 amino acids. The deduced sequence codes for a protein of 385 amino acids. Cleavage of the signal peptide gives the mature protein with 366 amino acids and a calculated mol wt of 41,052 Da. Searches of PIR and SWISSPROT protein databases revealed no similarity with glutathione peroxidase or other selenoproteins.« less

A Linkage Map of the Asian Tiger Mosquito (Aedes albopictus) Based on cDNA Markers

PubMed Central

Sutherland, Ian W.; Mori, Akio; Montgomery, John; Fleming, Karen L.; Anderson, Jennifer M.; Valenzuela, Jesus G.; Severson, David W.

2011-01-01

The Asian tiger mosquito, Aedes (Stegomyia) albopictus (Skuse), is an important vector of a number of arboviruses, and populations exhibit extreme variation in adaptive traits such as egg diapause, cold hardiness, and autogeny (ability to mature a batch of eggs without blood feeding). The genetic basis of some of these traits has been established, but lack of a high-resolution linkage map has prevented in-depth genetic analyses of the genes underlying these complex traits. We report here on the breeding of 4 F1 intercross mapping families and the use of these to locate 35 cDNA markers to the A. albopictus linkage map. The present study increases the number of markers on the A. albopictus cDNA linkage map from 38 to 73 and the density of markers from 1 marker/5.7 cM to 1 marker/2.9 cM and adds 9, 16, and 10 markers to the 3 linkage groups, respectively. The overall lengths of the 3 linkage groups are 64.5, 76.5, and 71.6 cM, respectively, for a combined length of 212.6 cM. Despite conservation in the order of most genes among the 4 families and a previous mapping family, we found substantial heterogeneity in the amount of recombination among markers. This was most marked in linkage group I, which varied between 16.7 and 69.3 cM. A map integrating the results from these 4 families with an earlier cDNA linkage map is presented. PMID:21148282

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

In vivo modulation of androgen receptor by androgens.

PubMed

Kumar, V L; Majumder, P K; Kumar, V

2002-09-01

To study the effect of androgen and antiandrogen on the level of androgen receptor (AR) mRNA. The total RNA was extracted from the prostate and analyzed by slot blot analysis. The blots were hybridized with AR cDNA probe and 1A probe (internal control) and autoradiography was performed. The intensity of signal was measured with a densitometer and the ratio of AR RNA and 1A RNA was calculated. Androgenic deprivation produced by castration decreased the weight of the prostate and increased the levels of AR mRNA. Treatment of the castrated rats with testostrone increased the weight of prostate and decreased the levels of AR mRNA. Treatment of normal rats with flutamide decreased the weight of the gland and increased the levels of AR mRNA. Androgens produce proliferative effect on the prostate and negatively regulate the AR transcription.

Tick vitellogenin receptor reveals critical role in oocyte development and transovarial transmission of Babesia parasite.

PubMed

Boldbaatar, Damdinsuren; Battsetseg, Badgar; Matsuo, Tomohide; Hatta, Takeshi; Umemiya-Shirafuji, Rika; Xuan, Xuenan; Fujisaki, Kozo

2008-08-01

A cDNA encoding the vitellogenin receptor of the ixodid tick, Haemaphysalis longicornis Neumann (HlVgR) was cloned and characterized. The full-length cDNA is 5631 bp, including an intact ORF encoding an expected protein with 1782 amino acids. The deduced amino acid sequence of the HlVgR cDNA revealed two ligand-binding domains with four class A cysteine-rich repeats in the first domain and eight in the second domain similar to those of insect VgRs. The immunoblot analysis detected approximately 197 kDa protein in both tick ovary and egg. The developmental expression profile demonstrated that HlVgR mRNA exists throughout the ovarian development, and the transcriptional level is especially high in the previtellogenic period. Immuno electron microscopy analysis demonstrated that the localization of HlVgR is detected on the external surface of oocyte plasma membrane. RNAi showed that eggs of HlVgR dsRNA-injected adult ticks had not developed into fully mature oocytes and laid abnormal eggs. The Babesia parasite DNA was not detected in the eggs of HlVgR dsRNA-injected tick that fed on Babesia gibsoni infected dog, whereas it was detected in the eggs of PBS-injected ticks and noninjected ticks. Expression of HlVgR was increased by the vitellogenic hormone 20-hydroxyecdysone. These results indicate that HlVgR, which is produced by the developing oocytes, is essential for Vg uptake, egg development in the H. longicornis tick, and transovarial transmission of Babesia parasites.

Generation of cell lines for drug discovery through random activation of gene expression: application to the human histamine H3 receptor.

PubMed

Song, J; Doucette, C; Hanniford, D; Hunady, K; Wang, N; Sherf, B; Harrington, J J; Brunden, K R; Stricker-Krongrad, A

2005-06-01

Target-based high-throughput screening (HTS) plays an integral role in drug discovery. The implementation of HTS assays generally requires high expression levels of the target protein, and this is typically accomplished using recombinant cDNA methodologies. However, the isolated gene sequences to many drug targets have intellectual property claims that restrict the ability to implement drug discovery programs. The present study describes the pharmacological characterization of the human histamine H3 receptor that was expressed using random activation of gene expression (RAGE), a technology that over-expresses proteins by up-regulating endogenous genes rather than introducing cDNA expression vectors into the cell. Saturation binding analysis using [125I]iodoproxyfan and RAGE-H3 membranes revealed a single class of binding sites with a K(D) value of 0.77 nM and a B(max) equal to 756 fmol/mg of protein. Competition binding studies showed that the rank order of potency for H3 agonists was N(alpha)-methylhistamine approximately (R)-alpha- methylhistamine > histamine and that the rank order of potency for H3 antagonists was clobenpropit > iodophenpropit > thioperamide. The same rank order of potency for H3 agonists and antagonists was observed in the functional assays as in the binding assays. The Fluorometic Imaging Plate Reader assays in RAGE-H3 cells gave high Z' values for agonist and antagonist screening, respectively. These results reveal that the human H3 receptor expressed with the RAGE technology is pharmacologically comparable to that expressed through recombinant methods. Moreover, the level of expression of the H3 receptor in the RAGE-H3 cells is suitable for HTS and secondary assays.

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Molecular cloning and expression analysis of the canine chemokine receptor CCR9.

PubMed

Maeda, Shingo; Ohno, Koichi; Tsukamoto, Atsushi; Nakashima, Ko; Fukushima, Kenjiro; Goto-Koshino, Yuko; Fujino, Yasuhito; Tsujimoto, Hajime

2012-01-15

The chemokine receptor CCR9, which interacts with the thymus-expressed chemokine TECK/CCL25, contributes to the localization of lymphocytes to the small intestine, and is implicated in the development of human inflammatory bowel disease (IBD); however, their role in canine IBD is unknown. The objective of this study was to isolate cDNA encoding CCR9 and to investigate CCR9 expression in normal canine tissues and lymphoid cell lines. The complete open reading frame contained 1104 bp, encoding 367 amino acids, with 85% and 81% identity to human and mouse homologs, respectively. CCR9 mRNA was detected in all tissues investigated with the highest expression level in the small intestine. CCR9 mRNA was also expressed in GL-1, a canine B cell leukemia cell line, but not in CLBL-1, a canine B cell lymphoma cell line. Immunoblot and flow cytometry analyses of these cell lines using an anti-human CCR9 monoclonal antibody revealed that CCR9 protein expression was detected only in GL-1, indicating the cross-reactivity of the antibody. Using the antibody, flow cytometry showed that the proportions of CCR9(+) cells were small (mean, 4.88%; SD, 2.15%) in the normal canine PBMCs. This study will be useful in understanding canine intestinal immunity and the immunopathogenesis of canine IBD. Copyright © 2011 Elsevier B.V. All rights reserved.

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Development of infectious cDNA clones of citrus yellow vein clearing virus using a novel and rapid strategy.

PubMed

Cui, Tian Tian; Bin, Yu; Yan, Jian Hong; Mei, Peng Ying; Li, Zhong An; Zhou, Chang Yong; Song, Zhen

2018-05-04

Yellow vein clearing disease (YVCD) causes significant economic losses in lemon and other species of citrus. Usually, citrus yellow vein clearing virus (CYVCV) is considered to be the causal agent of YVCD. However, mixed infection of CYVCV and Indian citrus ringspot virus (ICRSV) or other pathogens is often detected in citrus plants with YVCD. In this study, we re-examined the causal agent of YVCD to fulfill Koch's postulates. First, the full-length genome of CYVCV isolate AY (CYVCV-AY) was amplified by long-distance RT-PCR from a Eureka lemon [Citrus limon (L) Brum. f.] tree with typical YVCD symptoms. The genomic cDNAs were then cloned into a ternary Yeast-Escherichia coli-Agrobacterium tumefaciens shuttle vector, pCY, using transformation-associated recombination (TAR) strategy, and 15 full-length cDNA clones of CYVCV-AY were obtained. Subsequently, four of these clones were selected randomly and inoculated on Jincheng [C. sinensis (L) Osbeck] seedlings through Agrobacterium-mediated vacuum-infiltration, and it was found that 80 to 100% of inoculated plants were infected with CYVCV by RT-PCR at 20 to 40 days post inoculation (dpi) and by direct tissue blot immunoassay at 60 dpi. The progeny of CYVCV-AY from cDNA clones caused typical symptoms of YVCD such as yellow vein clearing, leaf distortion, and chlorosis, which were the same as that elicited by wild-type virus. Finally, the regeneration of CYVCV-AY genome was confirmed by long-distance RT-PCR in lemon trees inoculated with the infectious cDNA clone. These results proved that CYVCV was the primary causal agent of YVCD. This is the first report on the development of infectious cDNA clones of CYVCV, which lays the foundation for further studies on viral gene functions and virus-host interactions.

Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

USDA-ARS?s Scientific Manuscript database

Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

(+)Lysergic acid diethylamide, but not its nonhallucinogenic congeners, is a potent serotonin 5HT1C receptor agonist

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burris, K.D.; Breeding, M.; Sanders-Bush, E.

Activation of central serotonin 5HT2 receptors is believed to be the primary mechanism whereby lysergic acid diethylamide (LSD) and other hallucinogens induce psychoactive effects. This hypothesis is based on extensive radioligand binding and electrophysiological and behavioral studies in laboratory animals. However, the pharmacological profiles of 5HT2 and 5HT1C receptors are similar, making it difficult to distinguish between effects due to activation of one or the other receptor. For this reason, it was of interest to investigate the interaction of LSD with 5HT1C receptors. Agonist-stimulated phosphoinositide hydrolysis in rat choroid plexus was used as a direct measure of 5HT1C receptor activation.more » (+)LSD potently stimulated phosphoinositide hydrolysis in intact choroid plexus and in cultures of choroid plexus epithelial cells, with EC50 values of 9 and 26 nM, respectively. The effect of (+)LSD in both systems was blocked by 5HT receptor antagonists with an order of activity consistent with interaction at 5HT1C receptors. Neither (+)-2-bromo-LSD nor lisuride, two nonhallucinogenic congeners of LSD, were able to stimulate 5HT1C receptors in cultured cells or intact choroid plexus. In contrast, lisuride, like (+)LSD, is a partial agonist at 5HT2 receptors in cerebral cortex slices and in NIH 3T3 cells transfected with 5HT2 receptor cDNA. The present finding that (+)LSD, but not its nonhallucinogenic congeners, is a 5HT1C receptor agonist suggests a possible role for these receptors in mediating the psychoactive effects of LSD.« less

Human retina-specific amine oxidase (RAO): cDNA cloning, tissue expression, and chromosomal mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Yutaka; Kubota, Ryo; Wang, Yimin

In search of candidate genes for hereditary retinal disease, we have employed a subtractive and differential cDNA cloning strategy and isolated a novel retina-specific cDNA. Nucleotide sequence analysis revealed an open reading frame of 2187 bp, which encodes a 729-amino-acid protein with a calculated molecular mass of 80,644 Da. The putative protein contained a conserved domain of copper amine oxidase, which is found in various species from bacteria to mammals. It showed the highest homology to bovine serum amine oxidase, which is believed to control the level of serum biogenic amines. Northern blot analysis of human adult and fetal tissuesmore » revealed that the protein is expressed abundantly and specifically in retina as a 2.7-kb transcript. Thus, we considered this protein a human retina-specific amine oxidase (RAO). The RAO gene (AOC2) was mapped by fluorescence in situ hybridization to human chromosome 17q21. We propose that AOC2 may be a candidate gene for hereditary ocular diseases. 38 refs., 4 figs.« less

[Differentially expressed genes of cell signal transduction associated with benzene poisoning by cDNA microarray].

PubMed

Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong

2005-08-01

To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.

cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

PubMed

Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

1999-02-01

A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

Microarray slide hybridization using fluorescently labeled cDNA.

PubMed

Ares, Manuel

2014-01-01

Microarray hybridization is used to determine the amount and genomic origins of RNA molecules in an experimental sample. Unlabeled probe sequences for each gene or gene region are printed in an array on the surface of a slide, and fluorescently labeled cDNA derived from the RNA target is hybridized to it. This protocol describes a blocking and hybridization protocol for microarray slides. The blocking step is particular to the chemistry of "CodeLink" slides, but it serves to remind us that almost every kind of microarray has a treatment step that occurs after printing but before hybridization. We recommend making sure of the precise treatment necessary for the particular chemistry used in the slides to be hybridized because the attachment chemistries differ significantly. Hybridization is similar to northern or Southern blots, but on a much smaller scale.

IDENTIFICATION OF THE ROLE OF APOPTOSIS PATHWAYS POTENTIALLY INVOLVED IN FORMALDEHYDE-INDUCED CARCINOGENESIS USING CDNA ARRAYS

EPA Science Inventory

Identification of the Role of Apoptosis Pathways Potentially Involved in Formaldehyde- Induced Carcinogenesis Using cDNA Arrays.

Formaldehyde (FA) is a genotoxic chemical found in household, medicinal, and industrial products. Although the major source of human exposure is...

Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Livi, G.P.; McHale, M.J.; Sathe, G.M.

1990-06-01

The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

[Cloning and expression regulation of 1-deoxy-D-xylulose-5-phosphate reductoisomerase cDNA from Alpinia officinarum].

PubMed

Zhang, Chun-Rong; Yang, Quan; Chen, Hu-Biao; Pang, Yu-Xin; Tang, Xiao-Min; Cheng, Xuan-Xuan; Wu, Wen-Ya; Chen, Shi-Min

2012-11-01

The rhizome of Alpinia officinarum is a widely used Chinese herbal medicine. The essential oil in A. officinarum rhizome is mainly composed of 1, 8-cineole and other monoterpenes, as the major bioactive ingredients. In plants, monoterpenes are synthesized through the methylerythritol phosphate (MEP) pathway in the plastids, and 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) is an enzyme catalyzing a committed step of the MEP pathway. In the present study, the full-length cDNA encoding DXR was cloned from the rhizome of A. officinarum, using homology-based RT-PCR and rapid amplification of cDNA ends (RACE) techniques. The new cDNA was designated as AoDXR and submitted to GenBank to be assigned with an accession number HQ874658. The full-length cDNA of AoDXR was 1 670 bp containing a 1 419 bp open reading frame encoding a polypeptide of 472 amino acids with a calculated molecular mass of 51.48 kDa and an isoelectric point of 6.15. Bioinformatic analyses revealed that AoDXR showed extensive homology with DXRs from other plant species and contained a conserved plastids transit peptide, a Pro-rich region and two highly conserved NADPH-binding motifs in its N-terminal region characterized by all plant DXRs. The phylogenetic analysis revealed that AoDXR belonged to angiosperm DXRs. The structural modeling of AoDXR showed that AoDXR had the typical V-shaped structure of DXR proteins. The tissue expression pattern analysis indicated that AoDXR expressed strongly in leaves, weak in rhizomes of A. officinarum. Exogenous methyl jasmonate (MeJA) could enhance the expression of AoDXR and the production of 1, 8-cineole in A. officinarum rhizomes. The cloning and characterization of AoDXR will be helpful to reveal the molecular regulation mechanism of monoterpene biosynthesis in A. officinarum and provides a candidate gene for metabolic engineering in improving the medicinal quality of A. officinarum rhizome.

Downregulation of Chicken Interleukin-17 Receptor A during Eimeria Infection

PubMed Central

Kim, Woo H.; Jeong, Jipseol; Park, Ae R.; Yim, Dongjean; Kim, Suk; Chang, Hong H.; Yang, Seung-Hak; Kim, Dong-Hee; Lillehoj, Hyun S.

2014-01-01

Both interleukin-17A (IL-17A) and IL-17F are proinflammatory cytokines that have an important role in intestinal homeostasis via receptor signaling. These cytokines have been characterized in chickens, but very little is known about their receptors and their functional activity. We provide here the first description of the sequence analysis, bioactivity, and comparative expression analysis of chicken IL-17RA (chIL-17RA) in chickens infected with Salmonella and Eimeria, two major infectious agents of gastrointestinal diseases of poultry of economic importance. A full-length chIL-17RA cDNA with a 2,568-bp coding region was identified from chicken thymus cDNA. chIL-17RA shares ca. 46% identity with mammalian homologues and 29.2 to 31.5% identity with its piscine counterparts. chIL-17RA transcript expression was relatively high in the thymus and in the chicken macrophage cell line HD11. The chIL-17RA-specific small interfering RNA inhibits interleukin-6 (IL-6), IL-8, and IL-1β mRNA expression in chicken embryo fibroblast cells (but not in DF-1 cells) stimulated with chIL-17A or chIL-17F. Interaction between chIL-17RA and chIL-17A was confirmed by coimmunoprecipitation. Downregulation of chIL-17RA occurred in concanavalin A- or lipopolysaccharide-activated splenic lymphocytes but not in poly(I·C)-activated splenic lymphocytes. In Salmonella- and Eimeria-infected chickens, the expression levels of the chIL-17RA transcript were downregulated in intestinal tissues from chickens infected with two Eimeria species, E. tenella or E. maxima, that preferentially infect the cecum and jejunum, respectively. However, chIL-17RA expression was generally unchanged in Salmonella infection. These results suggest that chIL-17RA has an important role in mucosal immunity to intestinal intracellular parasite infections such as Eimeria infection. PMID:24980970

MADGE: scalable distributed data management software for cDNA microarrays.

PubMed

McIndoe, Richard A; Lanzen, Aaron; Hurtz, Kimberly

2003-01-01

The human genome project and the development of new high-throughput technologies have created unparalleled opportunities to study the mechanism of diseases, monitor the disease progression and evaluate effective therapies. Gene expression profiling is a critical tool to accomplish these goals. The use of nucleic acid microarrays to assess the gene expression of thousands of genes simultaneously has seen phenomenal growth over the past five years. Although commercial sources of microarrays exist, investigators wanting more flexibility in the genes represented on the array will turn to in-house production. The creation and use of cDNA microarrays is a complicated process that generates an enormous amount of information. Effective data management of this information is essential to efficiently access, analyze, troubleshoot and evaluate the microarray experiments. We have developed a distributable software package designed to track and store the various pieces of data generated by a cDNA microarray facility. This includes the clone collection storage data, annotation data, workflow queues, microarray data, data repositories, sample submission information, and project/investigator information. This application was designed using a 3-tier client server model. The data access layer (1st tier) contains the relational database system tuned to support a large number of transactions. The data services layer (2nd tier) is a distributed COM server with full database transaction support. The application layer (3rd tier) is an internet based user interface that contains both client and server side code for dynamic interactions with the user. This software is freely available to academic institutions and non-profit organizations at http://www.genomics.mcg.edu/niddkbtc.

Characterization of Toll-like receptor 3 gene in large yellow croaker, Pseudosciaena crocea.

PubMed

Huang, Xue-Na; Wang, Zhi-Yong; Yao, Cui-Luan

2011-07-01

Toll-like receptor 3 (TLR3) plays an important role in innate immune responses. In this report, the full-length cDNA sequence and genomic structure of Pseudosciaena crocea TLR3 (PcTLR3) were identified and characterized. The full-length cDNA of PcTLR3 was of 3384 bp, including a 5'-terminal untranslated region (UTR) of 65 bp, a 3'-terminal UTR of 589 bp and an open reading frame (ORF) of 2730 bp encoding a polypeptide of 909 amino acid residues. The full-length genome sequence of PcTLR3 was composed of 5721 nucleotides, including five exons and four introns. The putative PcTLR3 protein contained a signal peptide sequence, 16 leucine-rich repeat (LRR) motifs, a transmembrane region and a Toll/interleukin-1 receptor (TIR) domain. Quantitative real-time reverse transcription PCR analysis revealed a broad expression of PcTLR3 in most tissues, with the predominant expression in liver, then intestine, and the weakest expression in blood cells. The expression of PcTLR3 after injection with poly inosinic:cytidylic (I:C) and Vibrio parahemolyticus was tested in spleen, blood cells and liver. The results indicated that PcTLR3 transcripts could be induced in the three tissues by injection with poly I:C. The highest expression was in the blood cells with 43.5 times (at 6h) greater expression than in the control (p<0.05). In addition, after V. parahemolyticus challenge, a moderate up-regulation and down-regulation of PcTLR3 was found in blood cells and liver, respectively. Our results suggested that PcTLR3 might play an important role in fish's defense against both viral and bacterial infection. Copyright © 2011 Elsevier Ltd. All rights reserved.

Genomic structure, promoter identification, and chromosomal mapping of a mouse nuclear orphan receptor expressed in embryos and adult testes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, C.H.; Wei, Li-Na; Copeland, N.G.

We have isolated and characterized overlapping genomic clones containing the complete transcribed region of a newly isolated mouse cDNA encoding an orphan receptor expressed specifically in midgestation embryos and adult testis. This gene spans a distance of more than 50 kb and is organized into 13 exons. The transcription initiation site is located at the 158th nucleotide upstream from the translation initiation codon. All the exon/intron junction sequences follow the GT/AG rule. Based upon Northern blot analysis and the size of the transcribed region of the gene, its transcript was determined to be approximately 2.5 kb. Within approximately 500 hpmore » upstream from the transcription initiation site, several immune response regulatory elements were identified but no TATA box was located. This gene was mapped to the distal region of mouse chromosome 10 and its locus has been designated Tr2-11. Immunohistochemical studies show that the Tr2-11 protein is present mainly in advanced germ cell populations of mature testes and that Tr2-11 gene expression is dramatically decreased in vitamin A-depleted animals. 23 refs., 7 figs.« less

Transcript variations, phylogenetic tree and chromosomal localization of porcine aryl hydrocarbon receptor (AhR) and AhR nuclear translocator (ARNT) genes.

PubMed

Sadowska, Agnieszka; Paukszto, Lukasz; Nynca, Anna; Szczerbal, Izabela; Orlowska, Karina; Swigonska, Sylwia; Ruszkowska, Monika; Molcan, Tomasz; Jastrzebski, Jan P; Panasiewicz, Grzegorz; Ciereszko, Renata E

2017-03-01

Aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor best known for mediating xenobiotic-induced toxicity. AhR requires aryl hydrocarbon receptor nuclear translocator (ARNT) to form an active transcription complex and promote the activation of genes which have dioxin responsive element in their regulatory regions. The present study was performed to determine the complete cDNA sequences of porcine AhR and ARNT genes and their chromosomal localization. Total RNA from porcine livers were used to obtain the sequence of the entire porcine transcriptome by next-generation sequencing (NGS; lllumina HiSeq2500). In addition, both, in silico analysis and fluorescence in situ hybridization (FISH) were used to determine chromosomal localization of porcine AhR and ARNT genes. In silico analysis of nucleotide sequences showed that there were two transcript variants of AhR and ARNT genes in the pig. In addition, computer analysis revealed that AhR gene in the pig is located on chromosome 9 and ARNT on chromosome 4. The results of FISH experiment confirmed the localization of porcine AhR and ARNT genes. In the present study, for the first time, the full cDNAs of AhR and ARNT were demonstrated in the pig. In future, it would be interesting to determine the tissue distribution of AhR and ARNT transcript variants in the pig and to test whether these variants are associated with different biological functions and/or different activation pathways.

DIFFERENTIATING THE TOXICITY OF CARCINOGENIC ALDEHYDES FROM NONCARCINOGENIC ALDEHYDES IN THE RAT NOSE USING CDNA ARRAYS

EPA Science Inventory

Differentiating the Toxicity of Carcinogenic Aldehydes from Noncarcinogenic Aldehydes in the Rat Nose Using cDNA Arrays.

Formaldehyde is a widely used aldehyde in many industrial settings, the tanning process, household products, and is a contaminant in cigarette smoke. H...

Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

PubMed Central

2011-01-01

Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot

Complete nucleotide sequence of spring beauty latent virus, a bromovirus infectious to Arabidopsis thaliana.

PubMed

Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T

2003-01-01

Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.

Persistence of Multiple Tumor-Specific T-Cell Clones Is Associated with Complete Tumor Regression in a Melanoma Patient Receiving Adoptive Cell Transfer Therapy

PubMed Central

Zhou, Juhua; Dudley, Mark E.; Rosenberg, Steven A.; Robbins, Paul F.

2007-01-01

Summary The authors recently reported that adoptive immunotherapy with autologous tumor-reactive tumor infiltrating lymphocytes (TILs) immediately following a conditioning nonmyeloablative chemotherapy regimen resulted in an enhanced clinical response rate in patients with metastatic melanoma. These observations led to the current studies, which are focused on a detailed analysis of the T-cell antigen reactivity as well as the in vivo persistence of T cells in melanoma patient 2098, who experienced a complete regression of all metastatic lesions in lungs and soft tissues following therapy. Screening of an autologous tumor cell cDNA library using transferred TILs resulted in the identification of novel mutated growth arrest-specific gene 7 (GAS7) and glyceral-dehyde-3-phosphate dehydrogenase (GAPDH) gene transcripts. Direct sequence analysis of the expressed T-cell receptor beta chain variable regions showed that the transferred TILs contained multiple T-cell clonotypes, at least six of which persisted in peripheral blood for a month or more following transfer. The persistent T cells recognized both the mutated GAS7 and GAPDH. These persistent tumor-reactive T-cell clones were detected in tumor cell samples obtained from the patient following adoptive cell transfer and appeared to be represented at higher levels in the tumor sample obtained 1 month following transfer than in the peripheral blood obtained at the same time. Overall, these results indicate that multiple tumor-reactive T cells can persist in the peripheral blood and at the tumor site for prolonged times following adoptive transfer and thus may be responsible for the complete tumor regression in this patient. PMID:15614045

Differentiation of respiratory syncytial virus subgroups with cDNA probes in a nucleic acid hybridization assay.

PubMed Central

Sullender, W M; Anderson, L J; Anderson, K; Wertz, G W

1990-01-01

A new approach to respiratory syncytial (RS) virus subgroup determination was developed by using a simple nucleic acid filter hybridization technique. By this method, virus-infected cells are bound and fixed in a single step, and the viral RNA in the fixed-cell preparation is characterized directly by its ability to hybridize to cDNA probes specific for either the A or B subgroups of RS virus. The subgroup-specific probes were constructed from cDNA clones that corresponded to a portion of the extracellular domain of the RS virus G protein of either a subgroup B RS virus (8/60) or a subgroup A RS virus (A2). The cDNA probes were labeled with 32P and used to analyze RS virus isolates collected over a period of three decades. Replicate templates of infected cell preparations were hybridized with either the subgroup A or B probe. The subgroup assignments of 40 viruses tested by nucleic acid hybridization were in agreement with the results of subgroup determinations based on their reactivities with monoclonal antibodies, which previously has been the only method available for determining the subgroup classification of RS virus isolates. The nucleic acid hybridization assay has the advantage of providing broad-based discrimination of the two subgroups on the basis of nucleic acid homology, irrespective of minor antigenic differences that are detected in assays in which monoclonal antibodies are used. The nucleic acid hybridization technique provides a reliable method for RS virus subgroup characterization. Images PMID:2118548

A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

PubMed

Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

1999-01-01

We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

Development of polymorphic genic-SSR markers by cDNA library sequencing in boxwood, Buxus spp. (Buxaceae)

USDA-ARS?s Scientific Manuscript database

Genic microsatellites or simple sequence repeat (genic-SSR) markers were developed in boxwood (Buxus taxa) for genetic diversity analysis, identification of taxa, and to facilitate breeding. cDNA libraries were developed from mRNA extracted from leaves of Buxus sempervirens ‘Vardar Valley’ and seque...

Sequence evaluation of four specific cDNA libraries for developmental genomics of sunflower.

PubMed

Tamborindeguy, C; Ben, C; Liboz, T; Gentzbittel, L

2004-04-01

Four different cDNA libraries were constructed from sunflower protoplasts growing under embryogenic and non-embryogenic conditions: one standard library from each condition and two subtractive libraries in opposite sense. A total of 22,876 cDNA clones were obtained and 4800 ESTs were sequenced, giving rise to 2479 high quality ESTs representing an unigene set of 1502 sequences. This set was compared with ESTs represented in public databases using the programs BLASTN and BLASTX, and its members were classified according to putative function using the catalog in the Kyoto Encyclopedia of Genes and Genomes (KEGG). Some 33% of sequences failed to align with existing plant ESTs and therefore represent putative novel genes. The libraries show a low level of redundancy and, on average, 50% of the present ESTs have not been previously reported for sunflower. Several potentially interesting genes were identified, based on their homology with genes involved in animal zygotic division or plant embryogenesis. We also identified two ESTs that show significantly different levels of expression under embryogenic and non-embryogenic conditions. The libraries described here represent an original and valuable resource for the discovery of yet unknown genes putatively involved in dicot embryogenesis and improving our knowledge of the mechanisms involved in polarity acquisition by plant embryos.

Molecular characterization, mRNA expression of prolactin receptor (PRLR) gene during pregnancy, nonpregnancy in the yak (Bos grunniens).

PubMed

Zi, Xiang-Dong; Chen, Da-Wen; Wang, Hong-Mei

2012-02-01

Prolactin (PRL) plays central roles in a wide range of body functions in mammals, and the actions are mediated by the specific cell surface receptor, the prolactin receptor (PRLR). To better understand the role of PRL in the yak (Bos grunniens), in the present study, we first cloned yak PRLR cDNA, and compared its mRNA expression in several tissues with cattle (Bos taurus). By reverse transcriptase-polymerase chain reaction (RT-PCR) strategy, we obtained full-length of yak PRLR cDNA sequence comprised of an open reading frame of 1746bp encoding a 581 amino acid protein, and contained a signal sequence and a transmembrane region. The intracellular domain had two pairs of cysteine residues and a WSXWS motif. The cytoplasmic domain comprised 323 residues and contained box 1 sequence. The yak PRLR shared 66.0-98.5% protein sequence identity with mammalian homologs. Real-time PCR analysis revealed that PRLR mRNA was higher in mammary tissue than in ovary and endometrium (P<0.01). During pregnancy, the ovary and mammary PRLR mRNA expression increased by 33- and 2.9-fold in yak, respectively, and increased by 46- and 3.8-fold in cattle, respectively. PRLR mRNA expression was higher (P<0.05) in mammary tissue and ovary of pregnant cow than that of pregnant yak. It is proposed that the increased ovarian and mammary PRLR mRNA expression during pregnancy may be associated with corpus luteum function for maintenance of pregnancy and mammary development for subsequent lactation. Copyright © 2011 Elsevier Inc. All rights reserved.

Characterization of a cDNA encoding a protein involved in formation of the skeleton during development of the sea urchin Lytechinus pictus.

PubMed

Livingston, B T; Shaw, R; Bailey, A; Wilt, F

1991-12-01

In order to investigate the role of proteins in the formation of mineralized tissues during development, we have isolated a cDNA that encodes a protein that is a component of the organic matrix of the skeletal spicule of the sea urchin, Lytechinus pictus. The expression of the RNA encoding this protein is regulated over development and is localized to the descendents of the micromere lineage. Comparison of the sequence of this cDNA to homologous cDNAs from other species of urchin reveal that the protein is basic and contains three conserved structural motifs: a signal peptide, a proline-rich region, and an unusual region composed of a series of direct repeats. Studies on the protein encoded by this cDNA confirm the predicted reading frame deduced from the nucleotide sequence and show that the protein is secreted and not glycosylated. Comparison of the amino acid sequence to databases reveal that the repeat domain is similar to proteins that form a unique beta-spiral supersecondary structure.

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

PubMed

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

The Ma Gene for Complete-Spectrum Resistance to Meloidogyne Species in Prunus Is a TNL with a Huge Repeated C-Terminal Post-LRR Region1[C][W

PubMed Central

Claverie, Michel; Dirlewanger, Elisabeth; Bosselut, Nathalie; Van Ghelder, Cyril; Voisin, Roger; Kleinhentz, Marc; Lafargue, Bernard; Abad, Pierre; Rosso, Marie-Noëlle; Chalhoub, Boulos; Esmenjaud, Daniel

2011-01-01

Root-knot nematode (RKN) Meloidogyne species are major polyphagous pests of most crops worldwide, and cultivars with durable resistance are urgently needed because of nematicide bans. The Ma gene from the Myrobalan plum (Prunus cerasifera) confers complete-spectrum, heat-stable, and high-level resistance to RKN, which is remarkable in comparison with the Mi-1 gene from tomato (Solanum lycopersicum), the sole RKN resistance gene cloned. We report here the positional cloning and the functional validation of the Ma locus present at the heterozygous state in the P.2175 accession. High-resolution mapping totaling over 3,000 segregants reduced the Ma locus interval to a 32-kb cluster of three Toll/Interleukin1 Receptor-Nucleotide Binding Site-Leucine-Rich Repeat (LRR) genes (TNL1–TNL3), including a pseudogene (TNL2) and a truncated gene (TNL3). The sole complete gene in this interval (TNL1) was validated as Ma, as it conferred the same complete-spectrum and high-level resistance (as in P.2175) using its genomic sequence and native promoter region in Agrobacterium rhizogenes-transformed hairy roots and composite plants. The full-length cDNA (2,048 amino acids) of Ma is the longest of all Resistance genes cloned to date. Its TNL structure is completed by a huge post-LRR (PL) sequence (1,088 amino acids) comprising five repeated carboxyl-terminal PL exons with two conserved motifs. The amino-terminal region (213 amino acids) of the LRR exon is conserved between alleles and contrasts with the high interallelic polymorphisms of its distal region (111 amino acids) and of PL domains. The Ma gene highlights the importance of these uncharacterized PL domains, which may be involved in pathogen recognition through the decoy hypothesis or in nuclear signaling. PMID:21482634

ALP gene expression in cDNA samples from bone tissue engineering using a HA/TCP/Chitosan scaffold

NASA Astrophysics Data System (ADS)

Stephanie, N.; Katarina, H.; Amir, L. R.; Gunawan, H. A.

2017-08-01

This study examined the potential use of hydroxyapatite (HA)/tricalcium phosphate (TCP)/Chitosan as a bone tissue engineering scaffold. The potential for using HA/TCP/chitosan as a scaffold was analyzed by measuring expression of the ALP osteogenic gene in cDNA from bone biopsies from four Macaque nemestrina. Experimental conditions included control (untreated), treatment with HA/TCP 70:30, HA/TCP 50:50, and HA/TCP/chitosan. cDNA samples were measured quantitively with Real-Time PCR (qPCR) and semi-quantitively by gel electrophoresis. There were no significant differences in ALP gene expression between treatment subjects after two weeks, but the HA/TCP/chitosan treatment gave the highest level of expression after four weeks. The scaffold using the HA/TCP/chitosan combination induced a higher level of expression of the osteogenic gene ALP than did scaffold without chitosan.

Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

PubMed

Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

2003-04-02

Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

A Recurrent Germline Mutation in the 5'UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation.

PubMed

Hornig, Nadine C; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

2016-01-01

A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5' untranslated region (5'-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5'UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5'UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general.

Isolation and functional identification of a novel cDNA for astaxanthin biosynthesis from Haematococcus pluvialis, and astaxanthin synthesis in Escherichia coli.

PubMed

Kajiwara, S; Kakizono, T; Saito, T; Kondo, K; Ohtani, T; Nishio, N; Nagai, S; Misawa, N

1995-10-01

We succeeded in isolating a novel cDNA involved in astaxanthin biosynthesis from the green alga Haematococcus pluvialis, by an expression cloning method using an Escherichia coli transformant as a host that synthesizes beta-carotene due to the Erwinia uredovora carotenoid biosynthesis genes. The cloned cDNA was shown to encode a novel enzyme, beta-carotene ketolase (beta-carotene oxygenase), which converted beta-carotene to canthaxanthin via echinenone, through chromatographic and spectroscopic analysis of the pigments accumulated in an E. coli transformant. This indicates that the encoded enzyme is responsible for the direct conversion of methylene to keto groups, a mechanism that usually requires two different enzymatic reactions proceeding via a hydroxy intermediate. Northern blot analysis showed that the mRNA was synthesized only in the cyst cells of H. pluvialis. E. coli carrying the H. pluvialis cDNA and the E. uredovora genes required for zeaxanthin biosynthesis was also found to synthesize astaxanthin (3S, 3'S), which was identified after purification by a variety of spectroscopic methods.

Characterization of a monoclonal antibody and a cDNA for polyubiquitin of Amoeba proteus.

PubMed

Lee, S Y; Kim, H J; Yoo, S Y; Ahn, T I

1998-01-01

A monoclonal antibody was obtained that reacts with many different proteins (14-200 kDa) of Amoeba proteus. By indirect immunofluorescence microscopy we found the antigens to be dispersed throughout the cytoplasm but were more concentrated in the nucleus. The antibody cross-reacted with proteins of Tetrahymena, Xenopus embryo, and mouse macrophages. Using the antibody as a probe we cloned a cDNA of 1.2 kb coding for ubiquitin in five repeats. Amino acid sequences of ameba's polyubiquitin showed the most variations among the nineteen polyubiquitins of other organisms compared. The well-conserved 20Ser and 55Thr residues were replaced with Gly and Ser, respectively. The 28Ala residue found in most organisms was replaced with Gln or Glu in the amoeba. Amoebae contained two ubiquitin-mRNAs that could be detected by Northern blot analysis using the cDNA as a probe. In an analysis for specificity, the antibody reacted with polyubiquitin and ubiquitin-fusion proteins larger than 14 kDa but not with monomeric ubiquitin. The antibody is a useful probe in the detection and characterization of proteins ubiquitinated in response to cellular stresses.

A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

PubMed Central

Walker, M D; Park, C W; Rosen, A; Aronheim, A

1990-01-01

Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Characterization of a full-length infectious cDNA clone and a GFP reporter derivative of the oncolytic picornavirus SVV-001.

PubMed

Poirier, John T; Reddy, P Seshidhar; Idamakanti, Neeraja; Li, Shawn S; Stump, Kristine L; Burroughs, Kevin D; Hallenbeck, Paul L; Rudin, Charles M

2012-12-01

Seneca Valley virus (SVV-001) is an oncolytic picornavirus with selective tropism for a subset of human cancers with neuroendocrine differentiation. To characterize further the specificity of SVV-001 and its patterns and kinetics of intratumoral spread, bacterial plasmids encoding a cDNA clone of the full-length wild-type virus and a derivative virus expressing GFP were generated. The full-length cDNA of the SVV-001 RNA genome was cloned into a bacterial plasmid under the control of the T7 core promoter sequence to create an infectious cDNA clone, pNTX-09. A GFP reporter virus cDNA clone, pNTX-11, was then generated by cloning a fusion protein of GFP and the 2A protein from foot-and-mouth disease virus immediately following the native SVV-001 2A sequence. Recombinant GFP-expressing reporter virus, SVV-GFP, was rescued from cells transfected with in vitro RNA transcripts from pNTX-11 and propagated in cell culture. The proliferation kinetics of SVV-001 and SVV-GFP were indistinguishable. The SVV-GFP reporter virus was used to determine that a subpopulation of permissive cells is present in small-cell lung cancer cell lines previously thought to lack permissivity to SVV-001. Finally, it was shown that SVV-GFP administered to tumour-bearing animals homes in to and infects tumours whilst having no detectable tropism for normal mouse tissues at 1×10(11) viral particles kg(-1), a dose equivalent to that administered in ongoing clinical trials. These infectious clones will be of substantial value in further characterizing the biology of this virus and as a backbone for the generation of additional oncolytic derivatives.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Purification, cDNA cloning, and characterization of LysM-containing plant chitinase from horsetail (Equisetum arvense).

PubMed

Inamine, Saki; Onaga, Shoko; Ohnuma, Takayuki; Fukamizo, Tamo; Taira, Toki

2015-01-01

Chitinase-A (EaChiA), molecular mass 36 kDa, was purified from the vegetative stems of a horsetail (Equisetum arvense) using a series of column chromatography. The N-terminal amino acid sequence of EaChiA was similar to the lysin motif (LysM). A cDNA encoding EaChiA was cloned by rapid amplification of cDNA ends and polymerase chain reaction. It consisted of 1320 nucleotides and encoded an open reading frame of 361 amino acid residues. The deduced amino acid sequence indicated that EaChiA is composed of a N-terminal LysM domain and a C-terminal plant class IIIb chitinase catalytic domain, belonging to the glycoside hydrolase family 18, linked by proline-rich regions. EaChiA has strong chitin-binding activity, however, no antifungal activity. This is the first report of a chitinase from Equisetopsida, a class of fern plants, and the second report of a LysM-containing chitinase from a plant.

Construction and biological activities of the first infectious cDNA clones of the genus Foveavirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meng, Baozhong, E-mail: bmeng@uoguelph.ca; Venkataraman, Srividhya; Li, Caihong

Grapevine rupestris stem pitting-associated virus (GRSPaV, genus Foveavirus, family Betaflexiviridae) is one of the most prevalent viruses in grapevines and is associated with three distinct diseases: rupestris stem pitting, vein necrosis and Syrah decline. Little is known about the biology and pathological properties of GRSPaV. In this work, we engineered a full-length infectious cDNA clone for GRSPaV and a GFP-tagged variant, both under the transcriptional control of Cauliflower mosaic virus 35 S promoter. We demonstrated that these cDNA clones were infectious in grapevines and Nicotiana benthamiana through fluorescence microscopy, RT-PCR, Western blotting and immuno electron microscopy. Interestingly, GRSPaV does notmore » cause systemic infection in four of the most commonly used herbaceous plants, even in the presence of the movement proteins of two other viruses which are known to complement numerous movement-defective viruses. These infectious clones are the first of members of Foveavirus which would allow further investigations into mechanisms governing different aspects of replication for GRSPaV and perhaps related viruses.« less

Cloning of a cDNA encoding rat aldehyde dehydrogenase with high activity for retinal oxidation.

PubMed

Bhat, P V; Labrecque, J; Boutin, J M; Lacroix, A; Yoshida, A

1995-12-12

Retinoic acid (RA), an important regulator of cell differentiation, is biosynthesized from retinol via retinal by a two-step oxidation process. We previously reported the purification and partial amino acid (aa) sequence of a rat kidney aldehyde dehydrogenase (ALDH) isozyme that catalyzed the oxidation of 9-cis and all-trans retinal to corresponding RA with high efficiency [Labrecque et al. Biochem. J. 305 (1995) 681-684]. A rat kidney cDNA library was screened using a 291-bp PCR product generated from total kidney RNA using a pair of oligodeoxyribonucleotide primers matched with the aa sequence. The full-length rat kidney ALDH cDNA contains a 2315-bp (501 aa) open reading frame (ORF). The aa sequence of rat kidney ALDH is 89, 96 and 87% identical to that of the rat cytosolic ALDH, the mouse cytosolic ALDH and human cytosolic ALDH, respectively. Northern blot and RT-PCR-mediated analysis demonstrated that rat kidney ALDH is strongly expressed in kidney, lung, testis, intestine, stomach and trachea, but weakly in the liver.

Investigation of free fatty acid associated recombinant membrane receptor protein expression in HEK293 cells using Raman spectroscopy, calcium imaging, and atomic force microscopy.

PubMed

Lin, Juqiang; Xu, Han; Wu, Yangzhe; Tang, Mingjie; McEwen, Gerald D; Liu, Pin; Hansen, Dane R; Gilbertson, Timothy A; Zhou, Anhong

2013-02-05

G-protein-coupled receptor 120 (GPR120) is a previously orphaned G-protein-coupled receptor that apparently functions as a sensor for dietary fat in the gustatory and digestive systems. In this study, a cDNA sequence encoding a doxycycline (Dox)-inducible mature peptide of GPR120 was inserted into an expression vector and transfected in HEK293 cells. We measured Raman spectra of single HEK293 cells as well as GPR120-expressing HEK293-GPR120 cells at a 48 h period following the additions of Dox at several concentrations. We found that the spectral intensity of HEK293-GPR120 cells is dependent upon the dose of Dox, which correlates with the accumulation of GPR120 protein in the cells. However, the amount of the fatty acid activated changes in intracellular calcium (Ca(2+)) as measured by ratiometric calcium imaging was not correlated with Dox concentration. Principal components analysis (PCA) of Raman spectra reveals that the spectra from different treatments of HEK293-GPR120 cells form distinct, completely separated clusters with the receiver operating characteristic (ROC) area of 1, while those spectra for the HEK293 cells form small overlap clusters with the ROC area of 0.836. It was also found that expression of GPR120 altered the physiochemical and biomechanical properties of the parental cell membrane surface, which was quantitated by atomic force microscopy (AFM). These findings demonstrate that the combination of Raman spectroscopy, calcium imaging, and AFM may provide new tools in noninvasive and quantitative monitoring of membrane receptor expression induced alterations in the biophysical and signaling properties of single living cells.

Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

PubMed Central

Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

2004-01-01

The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In

Evaluation of normalization methods for cDNA microarray data by k-NN classification

PubMed Central

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-01-01

Background Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Results Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Conclusion Using LOOCV error of k-NNs as the evaluation criterion, three

Evaluation of normalization methods for cDNA microarray data by k-NN classification.

PubMed

Wu, Wei; Xing, Eric P; Myers, Connie; Mian, I Saira; Bissell, Mina J

2005-07-26

Non-biological factors give rise to unwanted variations in cDNA microarray data. There are many normalization methods designed to remove such variations. However, to date there have been few published systematic evaluations of these techniques for removing variations arising from dye biases in the context of downstream, higher-order analytical tasks such as classification. Ten location normalization methods that adjust spatial- and/or intensity-dependent dye biases, and three scale methods that adjust scale differences were applied, individually and in combination, to five distinct, published, cancer biology-related cDNA microarray data sets. Leave-one-out cross-validation (LOOCV) classification error was employed as the quantitative end-point for assessing the effectiveness of a normalization method. In particular, a known classifier, k-nearest neighbor (k-NN), was estimated from data normalized using a given technique, and the LOOCV error rate of the ensuing model was computed. We found that k-NN classifiers are sensitive to dye biases in the data. Using NONRM and GMEDIAN as baseline methods, our results show that single-bias-removal techniques which remove either spatial-dependent dye bias (referred later as spatial effect) or intensity-dependent dye bias (referred later as intensity effect) moderately reduce LOOCV classification errors; whereas double-bias-removal techniques which remove both spatial- and intensity effect reduce LOOCV classification errors even further. Of the 41 different strategies examined, three two-step processes, IGLOESS-SLFILTERW7, ISTSPLINE-SLLOESS and IGLOESS-SLLOESS, all of which removed intensity effect globally and spatial effect locally, appear to reduce LOOCV classification errors most consistently and effectively across all data sets. We also found that the investigated scale normalization methods do not reduce LOOCV classification error. Using LOOCV error of k-NNs as the evaluation criterion, three double

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead

Gene expression profiles in chondrosarcoma cells subjected to cyclic stretching and hydrostatic pressure. A cDNA array study.

PubMed

Karjalainen, Hannu M; Sironen, Reijo K; Elo, Mika A; Kaarniranta, Kai; Takigawa, Masaharu; Helminen, Heikki J; Lammi, Mikko J

2003-01-01

Mechanical forces have a profound effect on cartilage tissue and chondrocyte metabolism. Strenuous loading inhibits the cellular metabolism, while optimal level of loading at correct frequency raises an anabolic response in chondrocytes. In this study, we used Atlas Human Cancer cDNA array to investigate mRNA expression profiles in human chondrosarcoma cells stretched 8% for 6 hours at a frequency of 0.5 Hz. In addition, cultures were exposed to continuous and cyclic (0.5 Hz) 5 MPa hydrostatic pressure. Cyclic stretch had a more profound effect on the gene expression profiles than 5 MPa hydrostatic pressure. Several genes involved with the regulation of cell cycle were increased in stretched cells, as well as mRNAs for PDGF-B, glucose-1-phosphate uridylyltransferase, Tiam1, cdc37 homolog, Gem, integrin alpha6, and matrix metalloproteinase-3. Among down-regulated genes were plakoglobin, TGF-alpha, retinoic acid receptor-alpha and Wnt8b. A smaller number of changes was detected after pressure treatments. Plakoglobin was increased under cyclic and continuous 5 MPa hydrostatic pressure, while mitogen-activated protein kinase-9, proliferating cell nuclear antigen, Rad6, CD9 antigen, integrins alphaE and beta8, and vimentin were decreased. Cyclic and continuous pressurization induces a number of specific changes. In conclusion, a different set of genes were affected by three different types of mechanical stimuli applied on chondrosarcoma cells.

cDNA cloning and characterization of a novel gene encoding the MLF1-interacting protein MLF1IP.

PubMed

Hanissian, Silva H; Akbar, Umar; Teng, Bin; Janjetovic, Zorica; Hoffmann, Anne; Hitzler, Johann K; Iscove, Norman; Hamre, Kristin; Du, Xiaoping; Tong, Yiai; Mukatira, Suraj; Robertson, Jon H; Morris, Stephan W

2004-04-29

Myelodysplasia/acute myeloid leukemia (MDS/AML) is characterized by a t(3;5)(q25.1;q34) chromosomal translocation that forms a fusion gene between nucleophosmin (NPM) and MDS/myeloid leukemia factor 1 (MLF1). We identified a novel protein, MLF1-interacting protein (MLF1IP), that specifically associates with MLF1 by yeast two-hybrid analysis and in pulldown assays, and colocalizes with it in both the nuclei and cytoplasm of cells. The MLF1IP gene locus is at chromosome 4q35.1 and is composed of 14 exons spanning 75.8 kb of genomic DNA. The MLF1IP cDNA encodes a 46-kDa protein that contains two bipartite and two classical nuclear localization signals, two nuclear receptor-binding motifs (LXXLL), two leucine zippers, two PEST residues and several potential phosphorylation sites. MLF1IP transcripts are expressed in a variety of tissues (e.g. fetal liver, bone marrow, thymus and testis). MLF1IP appears to be a lineage-specific gene whose expression is confined exclusively to the CFU-E erythroid precursor cells, but not in mature erythrocytes. These observations, together with previous data demonstrating a role for MLF1 in suppressing red cell maturation, suggest a possible role for MLF1IP and MLF1 deregulation in the genesis of erythroleukemias.

A galectin from Eriocheir sinensis functions as pattern recognition receptor enhancing microbe agglutination and haemocytes encapsulation.

PubMed

Wang, Mengqiang; Wang, Lingling; Huang, Mengmeng; Yi, Qilin; Guo, Ying; Gai, Yunchao; Wang, Hao; Zhang, Huan; Song, Linsheng

2016-08-01

Galectins are a family of β-galactoside binding lectins that function as pattern recognition receptors (PRRs) in innate immune system of both vertebrates and invertebrates. The cDNA of Chinese mitten crab Eriocheir sinensis galectin (designated as EsGal) was cloned via rapid amplification of cDNA ends (RACE) technique based on expressed sequence tags (ESTs) analysis. The full-length cDNA of EsGal was 999 bp. Its open reading frame encoded a polypeptide of 218 amino acids containing a GLECT/Gal-bind_lectin domain and a proline/glycine rich low complexity region. The deduced amino acid sequence and domain organization of EsGal were highly similar to those of crustacean galectins. The mRNA transcripts of EsGal were found to be constitutively expressed in a wide range of tissues and mainly in hepatopancreas, gill and haemocytes. The mRNA expression level of EsGal increased rapidly and significantly after crabs were stimulated by different microbes. The recombinant EsGal (rEsGal) could bind various pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (GLU), and exhibited strong activity to agglutinate Escherichia coli, Vibrio anguillarum, Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus and Pichia pastoris, and such agglutinating activity could be inhibited by both d-galactose and α-lactose. The in vitro encapsulation assay revealed that rEsGal could enhance the encapsulation of haemocytes towards agarose beads. These results collectively suggested that EsGal played crucial roles in the immune recognition and elimination of pathogens and contributed to the innate immune response against various microbes in crabs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Illumina sequencing of green stink bug nymph and adult cdna to identify potential rnai gene targets

USDA-ARS?s Scientific Manuscript database

Whole-body transcriptomes for nymphs and adults of the green stink bug, Acrosternum hilare (Say), were sequenced on an Illumina® Genome Analyzer IIx sequencer. The insects were collected from sites in North Carolina and Virginia, USA. The cDNA library for each sample was sequenced on one lane of an...

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

PubMed

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

FOX-superroots of Lotus corniculatus, overexpressing Arabidopsis full-length cDNA, show stable variations in morphological traits.

PubMed

Himuro, Yasuyo; Tanaka, Hidenori; Hashiguchi, Masatsugu; Ichikawa, Takanari; Nakazawa, Miki; Seki, Motoaki; Fujita, Miki; Shinozaki, Kazuo; Matsui, Minami; Akashi, Ryo; Hoffmann, Franz

2011-01-15

Using the full-length cDNA overexpressor (FOX) gene-hunting system, we have generated 130 Arabidopsis FOX-superroot lines in bird's-foot trefoil (Lotus corniculatus) for the systematic functional analysis of genes expressed in roots and for the selection of induced mutants with interesting root growth characteristics. We used the Arabidopsis-FOX Agrobacterium library (constructed by ligating pBIG2113SF) for the Agrobacterium-mediated transformation of superroots (SR) and the subsequent selection of gain-of-function mutants with ectopically expressed Arabidopsis genes. The original superroot culture of L. corniculatus is a unique host system displaying fast root growth in vitro, allowing continuous root cloning, direct somatic embryogenesis and mass regeneration of plants under entirely hormone-free culture conditions. Several of the Arabidopsis FOX-superroot lines show interesting deviations from normal growth and morphology of roots from SR-plants, such as differences in pigmentation, growth rate, length or diameter. Some of these mutations are of potential agricultural interest. Genomic PCR analysis revealed that 100 (76.9%) out of the 130 transgenic lines showed the amplification of single fragments. Sequence analysis of the PCR fragments from these 100 lines identified full-length cDNA in 74 of them. Forty-three out of 74 full-length cDNA carried known genes. The Arabidopsis FOX-superroot lines of L. corniculatus, produced in this study, expand the FOX hunting system and provide a new tool for the genetic analysis and control of root growth in a leguminous forage plant. Copyright © 2010 Elsevier GmbH. All rights reserved.

Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jianhua; Chen, Shishu

2002-10-01

To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

An infectious full-length cDNA clone of duck Tembusu virus, a newly emerging flavivirus causing duck egg drop syndrome in China.

PubMed

Li, Shuang; Zhang, Lijiao; Wang, Yongyue; Wang, Shuxia; Sun, Haigang; Su, Wenliang; He, Weiyong; Han, Bo; Su, Jingliang

2013-01-01

Duck Tembusu virus (TMUV) is a recently identified pathogenic flavivirus that causes severe egg drop and encephalitis in Chinese ducks and geese. It has been found to be most closely related to the mosquito-origin Tembusu virus and chicken Sitiawan virus reported in Malaysia. However, the ecological characteristics and the pathogenesis of duck TMUV are largely unknown. We report the construction of full-length cDNA clone of duck TMUV strain JXSP. The virus genome was reverse transcribed, amplified as seven overlapping fragments and successively ligated into the low copy number vector pWSK29 under the control of a T7 promoter. Transfection of BHK-21 cells with the transcribed RNA from the full-length cDNA clone resulted in production of highly infectious progeny virus. In vitro growth characteristics in BHK-21 cells and virulence in ducklings and BALB/c mice were similar for the rescued and parental viruses. This stable infectious cDNA clone will be a valuable tool for studying the genetic determinants of duck TMUV. Copyright © 2012 Elsevier B.V. All rights reserved.

The α6 nicotinic acetylcholine receptor subunit of Frankliniella occidentalis is not involved in resistance to spinosad.

PubMed

Hou, Wenjie; Liu, Qiulei; Tian, Lixia; Wu, Qingjun; Zhang, Youjun; Xie, Wen; Wang, Shaoli; Miguel, Keri San; Funderburk, Joe; Scott, Jeffrey G

2014-05-01

Insects evolve resistance which constrains the sustainable use of insecticides. Spinosyns, a class of environmentally-friendly macrolide insecticides, is not an exception. The mode of inheritance and the mechanisms of resistance to spinosad (the most common spinosyn insecticide) in Frankliniella occidentalis (Western flower thrips, WFT) were investigated in this study. Resistance (170,000-fold) was autosomal and completely recessive. Recent studies showed that deletion of the nicotinic acetylcholine receptor α6 subunit gene resulted in strains of Drosophila melanogaster, Plutella xylostella and Bactrocera dorsalis that are resistant to spinosad, indicating that nAChRα6 subunit maybe important for the toxic action of this insecticide. Conversely, a G275E mutation of this subunit in F. occidentalis was recently proposed as the mechanism of resistance to spinosad. We cloned and characterized nAChRα6 from three susceptible and two spinosad resistant strains from China and the USA. The Foα6 cDNA is 1873bp and the open reading frame is 1458bp which encodes 485 amino acid residues with a predicted molecular weight of 53.5-kDa, the 5' and 3' UTRs are 121 and 294bp, respectively. There was no difference in the cDNA sequence between the resistant and susceptible thrips, suggesting the G275E mutation does not confer resistance in these populations. Ten isoforms of Foα6, arising from alternative splicing, were isolated and did not differ between the spinosad-susceptible and resistant strains. Quantitative real time PCR analysis showed Foα6 was highly expressed in the first instar larva, pupa and adult, and the expression levels were 3.67, 2.47, 1.38 times that of the second instar larva. The expression level was not significantly different between the susceptible and resistant strains. These results indicate that Foα6 is not involved in resistance to spinosad in F. occidentalis from China and the USA. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular characterization of the ghrelin and ghrelin receptor genes and effects on fat deposition in chicken and duck.

PubMed

Nie, Q; Fang, M; Xie, L; Peng, X; Xu, H; Luo, C; Zhang, D; Zhang, X

2009-01-01

Ghrelin (GHRL) and its receptor (GHSR) are involved in various bioactivities. In this study, the complete cDNA and 5' flanking region of the duck GHRL (dGHRL) gene and a 3717 bp fragment of the duck GHSR (dGHSR) gene were obtained. A total of 19, 8, 43, and 48 SNPs identified in 2751, 1358, 3671, and 3567 bp of the chicken GHRL (cGHRL), chicken GHSR (cGHSR), dGHRL, and dGHSR genes, respectively. Both cGHRL and dGHRL were expressed predominantly in the proventriculus, whereas the highest mRNA levels of cGHSR and dGHSR were detected in the breast muscle and pituitary. Association analysis showed that C-2047G, A-2355C, and A-2220C of the cGHRL gene were significantly associated with abdominal fat weight (AFW; P = .01), crude protein content of leg muscle (CPCLM; P = .02), and CPCLM (P = .0009), respectively. C-1459T of the cGHSR gene was also significantly associated with CPCLM (P = .0004). C-729T of dGHRL and A3427T of dGHSR were both significantly associated with subcutaneous fat thickness (SFT; P = .04). It was indicated by this study that the GHRL and GHSR genes were related to fat deposition in both chicken and duck.

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Characterisation and In Silico Analysis of Interleukin-4 cDNA of Nilgai (Boselaphus tragocamelus) and Indian Buffalo (Bubalus bubalis)

PubMed Central

Saini, M.; Palai, T. K.; Das, D. K.; Hatle, K. M.; Gupta, P. K.

2013-01-01

Interleukin-4 (IL-4) produced from Th2 cells modulates both innate and adaptive immune responses. It is a common belief that wild animals possess better immunity against diseases than domestic and laboratory animals; however, the immune system of wild animals is not fully explored yet. Therefore, a comparative study was designed to explore the wildlife immunity through characterisation of IL-4 cDNA of nilgai, a wild ruminant, and Indian buffalo, a domestic ruminant. Total RNA was extracted from peripheral blood mononuclear cells of nilgai and Indian buffalo and reverse transcribed into cDNA. Respective cDNA was further cloned and sequenced. Sequences were analysed in silico and compared with their homologues available at GenBank. The deduced 135 amino acid protein of nilgai IL-4 is 95.6% similar to that of Indian buffalo. N-linked glycosylation sequence, leader sequence, Cysteine residues in the signal peptide region, and 3′ UTR of IL-4 were found to be conserved across species. Six nonsynonymous nucleotide substitutions were found in Indian buffalo compared to nilgai amino acid sequence. Tertiary structure of this protein in both species was modeled, and it was found that this protein falls under 4-helical cytokines superfamily and short chain cytokine family. Phylogenetic analysis revealed a single cluster of ruminants including both nilgai and Indian buffalo that was placed distinct from other nonruminant mammals. PMID:24348167

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

PubMed

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

NASA Technical Reports Server (NTRS)

Biermann, B.; Johnson, E. M.; Feldman, L. J.

1990-01-01

Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

Evaluation of reference genes for reverse transcription quantitative real-time PCR (RT-qPCR) studies in Silene vulgaris considering the method of cDNA preparation

PubMed Central

Koloušková, Pavla; Stone, James D.

2017-01-01

Accurate gene expression measurements are essential in studies of both crop and wild plants. Reverse transcription quantitative real-time PCR (RT-qPCR) has become a preferred tool for gene expression estimation. A selection of suitable reference genes for the normalization of transcript levels is an essential prerequisite of accurate RT-qPCR results. We evaluated the expression stability of eight candidate reference genes across roots, leaves, flower buds and pollen of Silene vulgaris (bladder campion), a model plant for the study of gynodioecy. As random priming of cDNA is recommended for the study of organellar transcripts and poly(A) selection is indicated for nuclear transcripts, we estimated gene expression with both random-primed and oligo(dT)-primed cDNA. Accordingly, we determined reference genes that perform well with oligo(dT)- and random-primed cDNA, making it possible to estimate levels of nucleus-derived transcripts in the same cDNA samples as used for organellar transcripts, a key benefit in studies of cyto-nuclear interactions. Gene expression variance was estimated by RefFinder, which integrates four different analytical tools. The SvACT and SvGAPDH genes were the most stable candidates across various organs of S. vulgaris, regardless of whether pollen was included or not. PMID:28817728

A Recurrent Germline Mutation in the 5’UTR of the Androgen Receptor Causes Complete Androgen Insensitivity by Activating Aberrant uORF Translation

PubMed Central

Hornig, Nadine C.; de Beaufort, Carine; Denzer, Friederike; Cools, Martine; Wabitsch, Martin; Ukat, Martin; Kulle, Alexandra E.; Schweikert, Hans-Udo; Werner, Ralf; Hiort, Olaf; Audi, Laura; Siebert, Reiner; Ammerpohl, Ole; Holterhus, Paul-Martin

2016-01-01

A subset of patients with monogenic disorders lacks disease causing mutations in the protein coding region of the corresponding gene. Here we describe a recurrent germline mutation found in two unrelated patients with complete androgen insensitivity syndrome (CAIS) generating an upstream open reading frame (uORF) in the 5’ untranslated region (5’-UTR) of the androgen receptor (AR) gene. We show in patient derived primary genital skin fibroblasts as well as in cell-based reporter assays that this mutation severely impacts AR function by reducing AR protein levels without affecting AR mRNA levels. Importantly, the newly generated uORF translates into a polypeptide and the expression level of this polypeptide inversely correlates with protein translation from the primary ORF of the AR thereby providing a model for AR-5′UTR mediated translational repression. Our findings not only add a hitherto unrecognized genetic cause to complete androgen insensitivity but also underline the importance of 5′UTR mutations affecting uORFs for the pathogenesis of monogenic disorders in general. PMID:27110943

BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA from disk abalone Haliotis discus discus.

PubMed

Kim, Yucheol; De Zoysa, Mahanama; Lee, Youngdeuk; Whang, Ilson; Lee, Jehee

2010-11-01

A BRICHOS domain-containing leukocyte cell-derived chemotaxin 1-like cDNA was cloned from the disk abalone (Haliotis discus discus) and designated as AbLECT-1. A full-length (705 bp) of AbLECT-1 cDNA was composed of a 576 bp open reading frame that translates into a putative peptide of 192 amino acids. Deduced amino acid sequence of AbLECT-1 had 15.5- and 27.8% identity and similarity to human LECT-1, respectively. Quantitative real-time PCR analysis results showed that the mRNA of AbLECT-1 was constitutively expressed in abalone hemocytes, gills, mantle, muscle, digestive tract and hepatopancreas in a tissue-specific manner. Moreover, the AbLECT-1 transcription level was induced in hemocytes after challenge with Vibrio alginolyticus, Vibrio parahemolyticus, and Listeria monocytogenes suggesting that it may be involved in immune response reactions in abalone. Copyright 2010 Elsevier Ltd. All rights reserved.

Filamin A Modulates Kinase Activation and Intracellular Trafficking of Epidermal Growth Factor Receptors in Human Melanoma Cells

PubMed Central

Fiori, Jennifer L.; Zhu, Tie-Nian; O'Connell, Michael P.; Hoek, Keith S.; Indig, Fred E.; Frank, Brittany P.; Morris, Christa; Kole, Sutapa; Hasskamp, Joanne; Elias, George; Weeraratna, Ashani T.; Bernier, Michel

2009-01-01

The actin-binding protein filamin A (FLNa) affects the intracellular trafficking of various classes of receptors and has a potential role in oncogenesis. However, it is unclear whether FLNa regulates the signaling capacity and/or down-regulation of the activated epidermal growth factor receptor (EGFR). Here it is shown that partial knockdown of FLNa gene expression blocked ligand-induced EGFR responses in metastatic human melanomas. To gain greater insights into the role of FLNa in EGFR activation and intracellular sorting, we used M2 melanoma cells that lack endogenous FLNa and a subclone in which human FLNa cDNA has been stably reintroduced (M2A7 cells). Both tyrosine phosphorylation and ubiquitination of EGFR were significantly lower in epidermal growth factor (EGF)-stimulated M2 cells when compared with M2A7 cells. Moreover, the lack of FLNa interfered with EGFR interaction with the ubiquitin ligase c-Cbl. M2 cells exhibited marked resistance to EGF-induced receptor degradation, which was very active in M2A7 cells. Despite comparable rates of EGF-mediated receptor endocytosis, internalized EGFR colocalized with the lysosomal marker lysosome-associated membrane protein-1 in M2A7 cells but not M2 cells, in which EGFR was found to be sequestered in large vesicles and subsequently accumulated in punctated perinuclear structures after EGF stimulation. These results suggest the requirement of FLNa for efficient EGFR kinase activation and the sorting of endocytosed receptors into the degradation pathway. PMID:19213840

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

Crystal structure of a complete ternary complex of T-cell receptor, peptide-MHC, and CD4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Yiyuan; Wang, Xin Xiang; Mariuzza, Roy A

2012-07-11

Adaptive immunity depends on specific recognition by a T-cell receptor (TCR) of an antigenic peptide bound to a major histocompatibility complex (pMHC) molecule on an antigen-presenting cell (APC). In addition, T-cell activation generally requires binding of this same pMHC to a CD4 or CD8 coreceptor. Here, we report the structure of a complete TCR-pMHC-CD4 ternary complex involving a human autoimmune TCR, a myelin-derived self-peptide bound to HLA-DR4, and CD4. The complex resembles a pointed arch in which TCR and CD4 are each tilted ~65° relative to the T-cell membrane. By precluding direct contacts between TCR and CD4, the structure explainsmore » how TCR and CD4 on the T cell can simultaneously, yet independently, engage the same pMHC on the APC. The structure, in conjunction with previous mutagenesis data, places TCR-associated CD3εγ and CD3εδ subunits, which transmit activation signals to the T cell, inside the TCR-pMHC-CD4 arch, facing CD4. By establishing anchor points for TCR and CD4 on the T-cell membrane, the complex provides a basis for understanding how the CD4 coreceptor focuses TCR on MHC to guide TCR docking on pMHC during thymic T-cell selection.« less

Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

PubMed Central

Kirkegaard, K; Nelsen, B

1990-01-01

Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

Particle aggregation during receptor-mediated endocytosis

NASA Astrophysics Data System (ADS)

Mao, Sheng; Kosmrlj, Andrej

Receptor-mediated endocytosis of particles is driven by large binding energy between ligands on particles and receptors on a membrane, which compensates for the membrane bending energy and for the cost due to the mixing entropy of receptors. While the receptor-mediated endocytosis of individual particle is well understood, much less is known about the joint entry of multiple particles. Here, we demonstrate that the endocytosis of multiple particles leads to a kinetically driven entropic attraction, which may cause the aggregation of particles observed in experiments. During the endocytosis particles absorb nearby receptors and thus produce regions, which are depleted of receptors. When such depleted regions start overlapping, the corresponding particles experience osmotic-like attractive entropic force. If the attractive force between particles is large enough to overcome the repulsive interaction due to membrane bending, then particles tend to aggregate provided that they are sufficiently close, such that they are not completely engulfed before they come in contact. We discuss the necessary conditions for the aggregation of cylindrical particles during receptor-mediated endocytosis and comment on the generalization to spherical particles.

Single amino acid substitutions at 2 of 14 positions in an ultra-conserved region of the androgen receptor yield an androgen-binding domain that is reversibly thermolabile

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasiliou, M.; Lumbroso, R.; Alvarado, C.

1994-09-01

The stereochemistry of the androgen receptor (AR) that is responsible for androgen-specific binding and for its contribution to the transregulatory attributes of an androgen-receptor complex are unknown. Our objective is to define structure-function relations of the human AR by correlating germline missense mutations at its X-linked locus with its resultant misbehavior. Subjects with Arg773Cys have complete androgen insensitivity. We and several other laboratories have reported that their genital skin fibroblasts (GSF) have negligible androgen-binding activity at 37{degrees}. We have found that Phe763Leu also causes CAI, but with approximately 10 fmol/mg protein androgen-binding activity at 37{degrees} (R-deficient). Within COS-1 cells transfectedmore » with each mutant AR cDNA, Phe763Leu and Arg773Cys androgen-binding activities are reversibly thermolabile, by a factor of 2, at 37{degrees} versus 22{degrees}, only in the presence of androgen; in the absence of androgen they are thermostable at 37{degrees}. We have discovered that (for a reason yet unknown) the GSF from a third family with Arg773Cys (and no other coding sequence mutation) have 20-40 mol/mg protein of androgen-binding activity at 37{degrees} when measured with 3-6 nFM androgen. This activity reversibly doubles at 22{degrees}. The reversible thermolability of an AR with Arg773Cys (and probably with Phe763Leu) is demonstrable within GSF. Ligand-dependence of this thermolability implies that ligand induces these mutant AR to undergo a deviant conformational change in, or near, a 14-aa region that shares 90% identity/similarity with its closest receptor relatives.« less

Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

PubMed Central

2011-01-01

Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN CDNA MICROARRAY ANALYSES

EPA Science Inventory

GENE EXPRESSION IN THE TESTES OF NORMOSPERMIC VERSUS TERATOSPERMIC DOMESTIC CATS USING HUMAN cDNA MICROARRAY ANALYSES

B.S. Pukazhenthi1, J. C. Rockett2, M. Ouyang3, D.J. Dix2, J.G. Howard1, P. Georgopoulos4, W.J. J. Welsh3 and D. E. Wildt1

1Department of Reproductiv...

Development of a monoclonal anitbody to immuno-cytochemical analysis of the cellular localization of the peripheral benzodiazepine receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dussossoy, D.; Carayon, P.; Feraut, D.

1996-05-01

Based on the amino acid sequence deduced from the cloned human peripheral benzodiazepine receptor (PBR) gene, monoclonal antibody (Mab 8D7) was produced against the C-terminal fragment of the receptor. Immunoblot experiments, performed against purified PBR, indicated that the antipeptide antibody recognized, under denaturing conditions, the corresponding amino acid sequence of the PBR. When mitochondrial membranes form PBR transfected yeast or from THP1 and U937 cells were used on immunoblot analysis, a high level of immunoreactivity was observed at 18 kDa, the PBR molecular mass deduced from cDNA, establishing the specificity of the antibody for the receptor. Moreover, binding experiments realizedmore » with intact mitochondria demonstrated that the immunogenic sequence was accessible to the antibody indicating that the C-terminal fragment of the PBR faces the cytosol. Using this Mab we developed a technique which allowed precise quantification of PBR density per cell. Furthermore, cellular localization studies by flow cytometric analysis and confocal microscopy on cell lines displaying different levels of PBR showed that Mab 8D7 was entirely colocalized with an antimitochondria Mab. 34 refs., 7 figs.« less

Molecular characterization of a cDNA encoding copper/zinc superoxide dismutase from cultured cells of Manihot esculenta.

PubMed

Shin, Seung-Yong; Lee, Haeng-Soon; Kwon, Suk-Yoon; Kwon, Soon-Tae; Kwak, Sang-Soo

2005-01-01

Superoxide dismutase (SOD) cDNA, mSOD2, encoding cytosolic copper/zinc SOD (CuZnSOD) cDNA was isolated from suspension-cultured cells of cassava (Manihot esculenta Crantz) by cDNA library screening, and its expression was investigated in relation to environmental stress. mSOD2 is 774 bp in length with an open reading frame (ORF) of 152 amino acids, corresponding to a protein of predicted molecular mass 15 kDa and a pI of 5.22. One copy of the mSOD2 gene was found to be present in the cassava genome by Southern analysis using an mSOD2 cDNA-specific probe. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed diverse expression patterns for the mSOD2 gene in various tissues of intact cassava plants, at various stages of the growth in suspension cultures, and in the leaf tissues exposed to different stresses. The mSOD2 gene was highly expressed in suspension-cultured cells and in the stems of intact plants. However, it was expressed at low levels in leaves and roots. During suspension cell growth, the mSOD2 transcript progressively increased during culture. Moreover, the mSOD2 gene in excised cassava leaves responded to various stresses in different ways. In particular, it was highly induced in leaf tissue by several abiotic stresses, including high temperature (37 degrees C), chilling (4 degrees C), methyl viologen (MV) exposure, and wounding treatment. These results indicate that the mSOD2 gene is involved in the antioxidative process triggered by oxidative stress induced by environmental change.

Impulsivity and AMPA receptors: aniracetam ameliorates impulsive behavior induced by a blockade of AMPA receptors in rats.

PubMed

Nakamura, K; Kurasawa, M; Shirane, M

2000-04-17

The study aimed to ascertain the involvement of central AMPA receptors in impulsive behaviors of aged rats and to examine the effects of aniracetam. Premature response in the two-lever choice reaction task was assessed as an index of impulsivity. Intracerebroventricular injection of 2, 3-dihydroxy-6-nitro-7-sulfamoyl-benzo(F)quinoxaline (NBQX), an AMPA receptor antagonist, dose-dependently (10.1-1009 ng/rat) increased only premature response without altering responding speed and choice accuracy 30 min after the injection. Aniracetam (30 mg/kg p.o.), a positive allosteric modulator of AMPA receptors, or AMPA (55.9 ng/rat, co-injected with NBQX) completely restored the NBQX-induced increase in impulsivity. These results indicate that AMPA receptors are tonically involved in the regulation of impulsivity.

Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

PubMed

Tsuzuki, K; Takeuchi, T; Ozawa, S

1992-11-01

GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

Murine c-mpl: a member of the hematopoietic growth factor receptor superfamily that transduces a proliferative signal.

PubMed Central

Skoda, R C; Seldin, D C; Chiang, M K; Peichel, C L; Vogt, T F; Leder, P

1993-01-01

The murine myeloproliferative leukemia virus has previously been shown to contain a fragment of the coding region of the c-mpl gene, a member of the cytokine receptor superfamily. We have isolated cDNA and genomic clones encoding murine c-mpl and localized the c-mpl gene to mouse chromosome 4. Since some members of this superfamily function by transducing a proliferative signal and since the putative ligand of mpl is unknown, we have generated a chimeric receptor to test the functional potential of mpl. The chimera consists of the extracellular domain of the human interleukin-4 receptor and the cytoplasmic domain of mpl. A mouse hematopoietic cell line transfected with this construct proliferates in response to human interleukin-4, thereby demonstrating that the cytoplasmic domain of mpl contains all elements necessary to transmit a growth stimulatory signal. In addition, we show that 25-40% of mpl mRNA found in the spleen corresponds to a novel truncated and potentially soluble isoform of mpl and that both full-length and truncated forms of mpl protein can be immunoprecipitated from lysates of transfected COS cells. Interestingly, however, although the truncated form of the receptor possesses a functional signal sequence and lacks a transmembrane domain, it is not detected in the culture media of transfected cells. Images PMID:8334987

Insights from computational analysis of full-length β-ketoacyl-[ACP] synthase-II cDNA isolated from American and African oil palms

PubMed Central

Bhore, Subhash J.; Cha, Thye S.; Amelia, Kassim; Shah, Farida H.

2014-01-01

Background: Palm oil derived from fruits (mesocarp) of African oil palm (Elaeis guineensis Jacq. Tenera) and American oil palm (E. oleifera) is important for food industry. Due to high yield, Elaeis guineensis (Tenera) is cultivated on commercial scale, though its oil contains high (~54%) level of saturated fatty acids. The rate-limiting activity of beta-ketoacyl-[ACP] synthase-II (KAS-II) is considered mainly responsible for the high (44%) level of palmitic acid (C16:0) in the oil obtained from E. guineensis. Objective: The objective of this study was to annotate KAS-II cDNA isolated from American and African oil palms. Materials and Methods: The full-length E. oleifera KAS-II (EoKAS-II) cDNA clone was isolated using random method of gene isolation. Whereas, the E. guineensis KAS-II (EgTKAS-II) cDNA was isolated using reverse transcriptase polymerase chain reaction (RT-PCR) technique; and missing ends were obtained by employing 5’and 3’ RACE technique. Results: The results show that EoKAS-II and EgTKAS-II open reading frames (ORFs) are of 1689 and 1721 bp in length, respectively. Further analysis of the both EoKAS-II and EgTKAS-II predicted protein illustrates that they contains conserved domains for ‘KAS-I and II’, ‘elongating’ condensing enzymes, ‘condensing enzymes super-family’, and ‘3-oxoacyl-[ACP] synthase II’. The predicted protein sequences shows 95% similarity with each other. Consecutively, the three active sites (Cys, His, and His) were identified in both proteins. However, difference in positions of two active Histidine (His) residues was noticed. Conclusion: These insights may serve as the foundation in understanding the variable activity of KAS-II in American and African oil palms; and cDNA clones could be useful in the genetic engineering of oil palms. PMID:24678202

Gene-expression profiling using suppression-subtractive hybridization and cDNA microarray in rat mononuclear cells in response to welding-fume exposure.

PubMed

Rim, Kyung Taek; Park, Kun Koo; Sung, Jae Hyuck; Chung, Yong Hyun; Han, Jeong Hee; Cho, Key Seung; Kim, Kwang Jong; Yu, Il Je

2004-06-01

Welders with radiographic pneumoconiosis abnormalities have shown a gradual clearing of the X-ray identified effects following removal from exposure. In some cases, the pulmonary fibrosis associated with welding fumes appears in a more severe form in welders. Accordingly, for the early detection of welding-fume-exposure-induced pulmonary fibrosis, the gene expression profiles of peripheral mononuclear cells from rats exposed to welding fumes were studied using suppression-subtractive hybridization (SSH) and a cDNA microarray. As such, Sprague-Dawley rats were exposed to a stainless steel arc welding fume for 2 h/day in an inhalation chamber with a 1107.5 +/- 2.6 mg/m3 concentration of total suspended particulate (TSP) for 30 days. Thereafter, the total RNA was extracted from the peripheral blood mononuclear cells, the cDNA synthesized from the total RNA using the SMART PCR cDNA method, and SSH performed to select the welding-fume-exposure-regulated genes. The cDNAs identified by the SSH were then cloned into a plasmid miniprep, sequenced and the sequences analysed using the NCBI BLAST programme. In the SSH cloned cDNA microarray analysis, five genes were found to increase their expression by 1.9-fold or more, including Rgs 14, which plays an important function in cellular signal transduction pathways; meanwhile 36 genes remained the same and 30 genes decreased their expression by more than 59%, including genes associated with the immune response, transcription factors and tyrosine kinases. Among the 5200 genes analysed, 256 genes (5.1%) were found to increase their gene expression, while 742 genes (15%) decreased their gene expression in response to the welding-fume exposure when tested using a commercial 5.0k DNA microarray. Therefore, unlike exposure to other toxic substances, prolonged welding-fume exposure was found to substantially downregulate many genes.

Heat-shock response in a molluscan cell line: characterization of the response and cloning of an inducible HSP70 cDNA.

PubMed

Laursen, J R; di Liu, H; Wu, X J; Yoshino, T P

1997-11-01

Sublethal heat-shock of cells of the Bge (Biomphalaria glabrata embryonic) snail cell line resulted in increased or new expression of metabolically labeled polypeptides of approximately 21.5, 41, 70, and 74 kDa molecular mass. Regulation of this response appeared to be at the transcriptional level since a similar protein banding pattern was seen upon SDS-PAGE/fluorographic analysis of polypeptides produced by in vitro translation of total RNA from cells subjected to heat shock. Using a yeast (Saccharomyces cerevisiae) 70-kDa heat-shock protein (HSP70) probe to screen a cDNA library from heat-treated Bge cells, we isolated a full-length cDNA clone encoding a putative Bge HSP70. The cDNA was 2453 bp in length and contained an open reading frame of 1908 bp encoding a 636-amino-acid polypeptide with calculated molecular mass of 70,740 Da. Comparison of a conserved region of 209 amino acid residues revealed > 80% identity between the deduced amino acid sequence of Bge HSP70 and that of yeast (81%), the human blood fluke Schistosoma mansoni (for which B. glabrata serves as intermediate host) (81%), Drosophila (81%), human (84%), and the marine gastropod Aplysia californica (88%, 90%). In addition to the extensive sharing of sequence homology, the identification of several eukaryotic HSP70 signature sequences and an N-linked glycosylation site characteristic of cytoplasmic HSPs strongly support the identity of the Bge cDNA as encoding an authentic HSP70. Results of a Northern blot analysis, using Bge HSP70 clone-specific probes, indicated that gene expression was heat inducible and not constitutively expressed. This is the first reported sequence of an inducible HSP70 from cells originating from a freshwater gastropod and provides a first step in the development of a genetic transformation system for molluscs of medical importance.

Human alpha 7 acetylcholine receptor: cloning of the alpha 7 subunit from the SH-SY5Y cell line and determination of pharmacological properties of native receptors and functional alpha 7 homomers expressed in Xenopus oocytes.

PubMed

Peng, X; Katz, M; Gerzanich, V; Anand, R; Lindstrom, J

1994-03-01

The alpha-bungarotoxin-binding acetylcholine receptors from the human neuroblastoma cell line SH-SY5Y were found to cross-react with some monoclonal antibodies to alpha 7 subunits of nicotinic acetylcholine receptors from chicken brain. The human alpha 7 subunit cDNA from SH-SY5Y was cloned, revealing 94% amino acid sequence identity to rat alpha 7 subunits and 92% identity to chicken alpha 7 subunits. Native human alpha 7 receptors showed affinities for some ligands similar to those previously observed with native chicken alpha 7 receptors, but for other ligands there were large species-specific differences in binding affinity. These results paralleled properties of alpha 7 homomers expressed in Xenopus oocytes. Human alpha 7 homomers exhibited rapidly desensitizing, inwardly rectifying, agonist-induced, cation currents that triggered Ca(2+)-sensitive Cl- channels in the oocytes. A change in efficacy from partial agonist for chicken alpha 7 homomers to full agonist for human alpha 7 homomers was exhibited by 1,1-dimethyl-4-phenylpiperazinium. This result reveals a large species-specific pharmacological difference, despite small differences in alpha 7 sequences. This is important for understanding the effects of these drugs in humans and for identifying amino acids that may contribute to the acetylcholine binding site, for analysis by in vitro mutagenesis. These results also characterize properties of native alpha 7 receptors and alpha 7 homomers that will provide criteria for functional properties expected of structural subunits, when these can be identified, cloned, and coexpressed with alpha 7 subunits.

Molecular analysis of two cDNA clones encoding acidic class I chitinase in maize.

PubMed Central

Wu, S; Kriz, A L; Widholm, J M

1994-01-01

The cloning and analysis of two different cDNA clones encoding putative maize (Zea mays L.) chitinases obtained by polymerase chain reaction (PCR) and cDNA library screening is described. The cDNA library was made from poly(A)+ RNA from leaves challenged with mercuric chloride for 2 d. The two clones, pCh2 and pCh11, appear to encode class I chitinase isoforms with cysteine-rich domains (not found in pCh11 due to the incomplete sequence) and proline-/glycine-rich or proline-rich hinge domains, respectively. The pCh11 clone resembles a previously reported maize seed chitinase; however, the deduced proteins were found to have acidic isoelectric points. Analysis of all monocot chitinase sequences available to date shows that not all class I chitinases possess the basic isoelectric points usually found in dicotyledonous plants and that monocot class II chitinases do not necessarily exhibit acidic isoelectric points. Based on sequence analysis, the pCh2 protein is apparently synthesized as a precursor polypeptide with a signal peptide. Although these two clones belong to class I chitinases, they share only about 70% amino acid homology in the catalytic domain region. Southern blot analysis showed that pCh2 may be encoded by a small gene family, whereas pCh11 was single copy. Northern blot analysis demonstrated that these genes are differentially regulated by mercuric chloride treatment. Mercuric chloride treatment caused rapid induction of pCh2 from 6 to 48 h, whereas pCh11 responded only slightly to the same treatment. During seed germination, embryos constitutively expressed both chitinase genes and the phytohormone abscisic acid had no effect on the expression. The fungus Aspergillus flavus was able to induce both genes to comparable levels in aleurone layers and embryos but not in endosperm tissue. Maize callus growth on the same plate with A. flavus for 1 week showed induction of the transcripts corresponding to pCh2 but not to pCh11. These studies indicate that

Acetylcholinesterase of the sand fly, Phlebotomus papatasi (Scopoli): cDNA sequence, baculovirus expression, and biochemical properties

PubMed Central

2013-01-01

Background Millions of people and domestic animals around the world are affected by leishmaniasis, a disease caused by various species of flagellated protozoans in the genus Leishmania that are transmitted by several sand fly species. Insecticides are widely used for sand fly population control to try to reduce or interrupt Leishmania transmission. Zoonotic cutaneous leishmaniasis caused by L. major is vectored mainly by Phlebotomus papatasi (Scopoli) in Asia and Africa. Organophosphates comprise a class of insecticides used for sand fly control, which act through the inhibition of acetylcholinesterase (AChE) in the central nervous system. Point mutations producing an altered, insensitive AChE are a major mechanism of organophosphate resistance in insects and preliminary evidence for organophosphate-insensitive AChE has been reported in sand flies. This report describes the identification of complementary DNA for an AChE in P. papatasi and the biochemical characterization of recombinant P. papatasi AChE. Methods A P. papatasi Israeli strain laboratory colony was utilized to prepare total RNA utilized as template for RT-PCR amplification and sequencing of cDNA encoding acetylcholinesterase 1 using gene specific primers and 3’-5’-RACE. The cDNA was cloned into pBlueBac4.5/V5-His TOPO, and expressed by baculovirus in Sf21 insect cells in serum-free medium. Recombinant P. papatasi acetylcholinesterase was biochemically characterized using a modified Ellman’s assay in microplates. Results A 2309 nucleotide sequence of PpAChE1 cDNA [GenBank: JQ922267] of P. papatasi from a laboratory colony susceptible to insecticides is reported with 73-83% nucleotide identity to acetylcholinesterase mRNA sequences of Culex tritaeniorhynchus and Lutzomyia longipalpis, respectively. The P. papatasi cDNA ORF encoded a 710-amino acid protein [GenBank: AFP20868] exhibiting 85% amino acid identity with acetylcholinesterases of Cx. pipiens, Aedes aegypti, and 92% amino acid identity for

Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

PubMed

Wang, Jian-Hua; Chen, Shi-Shu

2002-07-01

To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

Isolation and characterization of a cDNA encoding a membrane bound acyl-CoA binding protein from Agave americana L. epidermis.

PubMed

Guerrero, Consuelo; Martín-Rufián, M; Reina, José J; Heredia, Antonio

2006-01-01

A cDNA encoding an acyl-CoA binding protein (ACBP) homologue has been cloned from a cDNA library made from mRNA isolated from epidermis of young leaves of Agave americana L. The derived amino acid sequence reveals a protein corresponding to the membrane-associated form of ACBPs only previously described in Arabidopsis and rice. Northern blot analysis showed that the A. americana ACBP gene is mainly expressed in the epidermis of mature zone of the leaves. The epidermis of A. americana leaves have a well developed cuticle with the highest amounts of the cuticular components waxes, cutin and cutan suggesting a potential role of the protein in cuticle formation.

Insights into GABA receptor signalling in TM3 Leydig cells.

PubMed

Doepner, Richard F G; Geigerseder, Christof; Frungieri, Monica B; Gonzalez-Calvar, Silvia I; Calandra, Ricardo S; Raemsch, Romi; Fohr, Karl; Kunz, Lars; Mayerhofer, Artur

2005-01-01

Gamma-aminobutyric acid (GABA) is an emerging signalling molecule in endocrine organs, since it is produced by endocrine cells and acts via GABA(A) receptors in a paracrine/autocrine fashion. Testicular Leydig cells are producers and targets for GABA. These cells express GABA(A) receptor subunits and in the murine Leydig cell line TM3 pharmacological activation leads to increased proliferation. The signalling pathway of GABA in these cells is not known in this study. We therefore attempted to elucidate details of GABA(A) signalling in TM3 and adult mouse Leydig cells using several experimental approaches. TM3 cells not only express GABA(A )receptor subunits, but also bind the GABA agonist [(3)H]muscimol with a binding affinity in the range reported for other endocrine cells (K(d) = 2.740 +/- 0.721 nM). However, they exhibit a low B(max) value of 28.08 fmol/mg protein. Typical GABA(A) receptor-associated events, including Cl(-) currents, changes in resting membrane potential, intracellular Ca(2+) or cAMP, were not measurable with the methods employed in TM3 cells, or, as studied in part, in primary mouse Leydig cells. GABA or GABA(A) agonist isoguvacine treatment resulted in increased or decreased levels of several mRNAs, including transcription factors (c-fos, hsf-1, egr-1) and cell cycle-associated genes (Cdk2, cyclin D1). In an attempt to verify the cDNA array results and because egr-1 was recently implied in Leydig cell development, we further studied this factor. RT-PCR and Western blotting confirmed a time-dependent regulation of egr-1 in TM3. In the postnatal testis egr-1 was seen in cytoplasmic and nuclear locations of developing Leydig cells, which bear GABA(A) receptors and correspond well to TM3 cells. Thus, GABA acts via an atypical novel signalling pathway in TM3 cells. Further details of this pathway remain to be elucidated. Copyright (c) 2005 S. Karger AG, Basel.