Evidence of Paternal N5, N10 - Methylenetetrahydrofolate Reductase (MTHFR) C677T Gene Polymorphism in Couples with Recurrent Spontaneous Abortions (RSAs) in Kolar District- A South West of India

PubMed Central

Vanilla, Shiny; Kotur, Pushpa F; Kutty, Moideen A; Vegi, Pradeep Kumar

2015-01-01

Introduction: Recurrent spontaneous abortion (RSA) is a multifactorial clinical obstetrics complication commonly occurring in pregnancy. Many research studies have noted the mutations such as C677T in N5, N10 - Methylenetetrahydrofolate reductase (MTHFR)gene which is regarded as RSA risk factor. This study was carried out to determine the occurrence of frequency of C677T of the MTHFR gene mutations with RSA. Aim: The purpose of present study is to determine the frequency of MTHFR C677T polymorphisms in couples with recurrent pregnancy loss and the impact of paternal polymorphisms of MTHFR C677T in recurrent pregnancy loss in population of couples living in Kolar district of Karnataka with RSA. Design: A total of 15 couples with a history of two or more unexplained RSA were enrolled as subjects in the study and a total of 15 couples with normal reproductive history, having two or more children and no history of miscarriages were enrolled as controls. Materials and Methods: DNA extraction from samples case and control group couples and its quantification by Agarose gel electrophoresis, assessment of DNA purity, MTHFR C 677T gene mutation detection by PCR-RFLP method. Statistical analysis: Carried out by web based online SPSS tool. Results: The frequency of C677T genotype showed homozygous wild type CC (80%), heterozygous CT type (13.3%) and homozygous mutation TT type (6.67%) observed in males. Similarly from female’s homozygous wild type CC (86.6%), heterozygous type (13.3%), and homozygous type mutations TT (0%) was recorded. In couple control groups, we observed homozygous wild type CC (86.6%), heterozygous CT type (13.3%) and homozygous type mutations TT type (0%). Conclusion: We noticed a high frequency of MTHFR specifically T allele associated with paternal side.Therefore, the present study indicated the impact of paternal gene polymorphism of MTHFR C677T on screening in couples with recurrent pregnancy loss. PMID:25859445

Association of Methylenetetrahydrofolate Reductase C677T Polymorphism with Hyperhomocysteinemia and Deep Vein Thrombosis in the Iranian Population.

PubMed

Ghaznavi, Habib; Soheili, Zahra; Samiei, Shahram; Soltanpour, Mohammad Soleiman

2015-12-01

Deep venous thrombosis (DVT) is a common but elusive condition characterized by a high morbidity and mortality rate. The aim of the present study was to investigate the correlation between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism with plasma total homocysteine (tHcy) levels and DVT risk in an Iranian population. Our study population consisted of 67 patients with a diagnosis of DVT and 67 healthy subjects as controls. Genotyping of MTHFR C677T polymorphism was performed by the polymerase chain reaction technique combined with restriction enzyme fragment length polymorphism (PCR-RFLP) and measurement of tHcy levels was done by enzyme immunoassay method. Plasma tHcy levels were significantly higher in DVT patients than controls (18.09±7.6 vs. 10.5±4.3, P=0.001). Also, plasma tHcy levels were significantly higher in MTHFR 677TT genotypes compared to 677CC genotypes in both DVT patients (P=0.016) and controls (P=0.03). Neither heterozygote nor homozygote genotypes of MTHFR C677T polymorphism was significantly correlated with DVT (P>0.05). The distribution of MTHFR C677T genotypes was similar between men and women in both DVT patients and controls (P>0.05). Moreover, the frequency of mutant 677T allele did not differ significantly between the two groups (28.3% vs. 21.6%, P=0.15). Based on this study, we propose that hyperhomocysteinemia but not homozygosity for MTHFR C677T polymorphism is a significant risk factor for DVT in the Iranian population. Also, MTHFR 677TT genotype is a determinant of elevated plasma tHcy levels.

Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

PubMed

Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

2012-07-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

Methylenetetrahydrofolate reductase C677T and overall survival in pediatric acute lymphoblastic leukemia: a systematic review.

PubMed

Ojha, Rohit P; Gurney, James G

2014-01-01

A summary of the evidence pertaining to the association between methylenetetrahydrofolate reductase (MTHFR) C677T and overall survival in pediatric acute lymphoblastic leukemia (ALL) is not currently available. We thus reviewed the literature on the association between MTFHR C677T and overall survival in pediatric ALL. We searched PubMed/MEDLINE, Scopus and ISI Web of Knowledge literature databases without language restrictions to identify observational studies among children diagnosed between ages 0 and 19 years that assessed MTHFR 677 polymorphisms in relation to ALL survival. We identified six studies comprising 909 pediatric patients with ALL. The magnitude of relative risk (RR) for pediatric ALL mortality varied by genotype comparison and study population, ranging from RR = 0.84 (95% confidence limits [CL]: 0.24, 3.0) for a TT vs. CT/CC comparison to RR = 7.0 (95% CL: 0.98, 49) for a TT vs. CC comparison. The current evidence suggests that individuals with MTHFR 677 variants (i.e. at least one T allele) may have a higher relative risk of pediatric ALL mortality, with greater statistical support for MTHFR 677TT. With more detailed supporting evidence, MTHFR 677 genotyping at diagnosis could provide an option for individualizing therapy and further reducing pediatric ALL mortality in certain populations.

Methylenetetrahydrofolate reductase C677T polymorphism in patients with gastric and colorectal cancer in a Korean population

PubMed Central

2010-01-01

Background This study was designed to investigate an association between the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and the risk of gastric and colorectal cancer in the Korean population. Methods We conducted a population-based large-scale case-control study involving 2,213 patients with newly diagnosed gastric cancer, 1,829 patients with newly diagnosed colorectal cancer, and 1,700 healthy controls. Genotyping was performed with peripheral blood DNA for MTHFR C677T polymorphisms. The statistical significance was estimated by logistic regression analysis. Results The MTHFR C677T frequencies of CC, CT, and TT genotypes were 35.2%, 47.5%, and 17.3% among stomach cancer, 34%, 50.5%, and 15.5% in colorectal cancer, and 31.8%, 50.7%, and 17.5% in the controls, respectively. The MTHFR 677TT genotype showed a weak opposite association with colorectal cancer compared to the homozygous CC genotype [adjusted age and sex odds ratio (OR) = 0.792, 95% confidence interval (CI) = 0.638-0.984, P = 0.035]. Subjects with the MTHFR 677CT showed a significantly reduced risk of gastric cancer compared whose with the 677CC genotype (age- and sex-adjusted OR = 0.810; 95% CI = 0.696-0.942, P = 0.006). We also observed no significant interactions between the MTHFR C677T polymorphism and smoking or drinking in the risk of gastric and colorectal cancer. Conclusions The T allele was found to provide a weak protective association with gastric cancer and colorectal cancer. PMID:20504332

[677T mutation of the MTHFR gene in adenomas and colorectal cancer in a population sample from the Northeastern Mexico. Preliminary results].

PubMed

Delgado-Enciso, I; Martínez-Garza, S G; Rojas-Martínez, A; Ortiz-López, R; Bosques-Padilla, F; Calderón-Garcidueñas, A L; Zárate-Gómez, M; Barrera-Saldaña, H A

2001-01-01

Adequate intake of folates has been associated to low prevalence of colon cancer. Methylenetetrahydrofolate reductase enzyme (MTHFR) plays an important role in folate metabolism. The role of the 677 mutation at the MTHFR gene in the risk for colorectal cancer remains controversial. A recent report established that this mutation has a high prevalence in the healthy Mexican population. To analyze the prevalence of 677T MTHFR mutation in patients with colorectal cancer and controls without chronic gastrointestinal disorders. Seventy-four colorectal cancer, 32 adenomas and 110 normal samples were analyzed. Patients and controls were matched for sex and age. For each sample, DNA isolation, PCR, and mutation detection by restriction enzyme digestion were performed to determine the allele at the 677 position in the MTHFR gene. Genotype 677C/677C was found in 18.7, 20.3, and 30.9% in adenomas, cancer lesions and controls, respectively. Frequencies of the 677C/677T genotype were 59.4, 56.7, and 47.3%, in adenomas, cancer lesions, and controls, respectively. Genotype 677T/677T was found in 21.9, 23.0, and 21.8% in adenomas, cancer lesions, and controls, respectively. The odds ratio between genotypes carrying the mutation (T/T and C/T) and normal genotype (CC) was 1.81 (IC 95% 0.97-3.3), chi 2 = 3.5, p = 0.06. Our results showed that persons who carry the 677T mutation at MTHFR locus have a tendency for an increased risk for colorectal cancer. This study supports the basic concept that low levels of folic acid contribute with the colorectal cancer pathogenesis. Our lack of statistic significance may be due to reduced sample size.

The methylenetetrahydrofolate reductase (MTHFR) 677 C>T polymorphism increases the risk of developing chronic myeloid leukemia-a case-control study.

PubMed

Bănescu, Claudia; Iancu, Mihaela; Trifa, Adrian P; Macarie, Ioan; Dima, Delia; Dobreanu, Minodora

2015-04-01

The methylenetetrahydrofolate reductase (MTHFR) 677 C>T and 1298 A>C polymorphisms are associated with variations in folate levels, a phenomenon linked to the development of various malignancies. The aim of this study was to investigate the influence of the 677 C>T and 1298 A>C polymorphisms in the MTHFR gene on the risk of developing chronic myeloid leukemia (CML). Our study included 151 patients with CML and 305 controls. The MTHFR 677 C>T and 1298 A>C polymorphisms were investigated by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and allele-specific PCR techniques. The CT and TT genotypes of the MTHFR 677 C>T polymorphism were associated with an increased risk of developing CML (odds ratio (OR) = 1.556, 95% confidence interval (CI) = 1.017-2.381, p value = 0.041, and OR = 1.897, 95% CI = 1.046-3.44, p value = 0.035, respectively). No association was observed between the prognostic factors (blasts, basophils, additional chromosomal abnormalities, EUTOS score, Sokal and Hasford risk groups) and the MTHFR 677 C>T and 1298 A>C variant genotypes in CML patients. Our study shows that the MTHFR 677 C>T polymorphism is significantly associated with the risk of CML in Romanian patients.

The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children

PubMed Central

Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S.; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

2017-01-01

Abstract The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry. The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes. The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes. The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. PMID:29390492

The association between methylenetetrahydrofolate reductase C677 > T polymorphisms and risk of pediatric acute lymphoblastic leukemia in Asia.

PubMed

Lin, Shiguang; Liu, Qin; Zeng, Xiaoming

2014-11-01

The association between methylenetetrahydrofolate reductase (MTHFR) C677 > T polymorphisms and pediatric acute lymphoblastic leukemia (ALL) risk in Asia is controversial. The aim of this meta-analysis was to further assess the relationship between MTHFR C677 > T polymorphisms and pediatric ALL for Chinese children. Studies about the MTHFR C677 > T polymorphisms and pediatric ALL risk were searched in the Medline, PubMed, EMBASE, Wanfang and CNIK databases. The genotype of the case and control group were extracted and pooled by meta-analysis. The association between ALL risk and C677 > T polymorphisms was demonstrated by odds ratio (OR) and its 95% confidence interval (CI). Twelve articles were included in this study with 1803 ALL cases and 4146 controls. In recessive genetic model (TT vs. CC + CT), the OR was 0.37 (95%CI: 0.31-0.43); in dominant genetic model (TT + CT vs. CC) the OR was 0.94 (95%CI: 0.82-1.06); and in the homozygous model the OR was 0.84 (95%CI: 0.69-1.03). The results indicated that Asian children with TT genotype of MTHFR gene may have less risk of developing ALL.

Association between the methylenetetrahydrofolate reductase c.677C>T polymorphism and bone mineral density: an updated meta-analysis.

PubMed

Li, Hong-Zhuo; Wang, Wei; Liu, Yi-Ling; He, Xiao-Feng

2016-02-01

Many studies have reported an association between the methylenetetrahydrofolate reductase (MTHFR) c.677C>T polymorphism and reduced bone mineral density (BMD), but results have been inconsistent. We, therefore, performed a meta-analysis to further explore this association. Twenty-one studies, comprising 33,045 subjects, analyzed the association of MTHFR c.677C>T with femoral neck BMD. Significant association with reduced BMD was observed in Caucasians (recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.008 to -0.006), post-menopausal women (recessive model: WMD = -0.005 g/cm(2), 95 % CI -0.007 to -0.003), men (dominant model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; recessive model: WMD = -0.004 g/cm(2), 95 % CI -0.005 to -0.004; TT vs. CC: WMD = -0.006 g/cm(2), 95 % CI -0.006 to -0.006; CT vs. CC: WMD = -0.003 g/cm(2), 95 % CI -0.003 to -0.003), and cohort studies (recessive model: WMD = -0.003 g/cm(2), 95 % CI -0.006 to -0.001). Twenty-two studies, which included 32,271 subjects, analyzed the MTHFR c.677C>T association with lumbar spine BMD. Significant association with reduced BMD was observed in Caucasians, women, post-menopausal women, men, and cohort studies. Seven studies, comprising 6806 subjects, analyzed the MTHFR c.677C>T association with total hip BMD, but no significant association was observed in any population. Nine studies involving 5591 subjects analyzed the association with total body BMD. Significant association with reduced BMD was observed in overall and women subgroup analyses. In summary, this meta-analysis indicates that the MTHFR c.677C>T polymorphism is associated with reduced BMD in lumbar spine and femoral neck in Caucasians, post-menopausal women, and men, and with total body BMD in women. In addition, our results suggest that new studies examining the association between MTHFR c.677C>T polymorphism and BMD of lumbar spine and femoral neck in Asians is warranted, because I (2) > 75.0 % was observed.

The methylenetetrahydrofolate reductase 677T-1298C haplotype is a risk factor for acute lymphoblastic leukemia in children.

PubMed

Kałużna, Ewelina Maria; Strauss, Ewa; Świątek-Kościelna, Bogna; Zając-Spychała, Olga; Gowin, Ewelina; Nowak, Jerzy S; Rembowska, Jolanta; Januszkiewicz-Lewandowska, Danuta

2017-12-01

The etiology of acute lymphoblastic leukemia (ALL) is complex, linked with both environmental exposures and genetic factors. Functional variants of the methylenetetrahydrofolate reductase (MTHFR) gene result in disturbance in folate metabolism and may affect susceptibility to cancer. The study was performed to evaluate whether MTHFR C677T and A1298C polymorphisms, analyzed separately and together, are associated with the development of ALL in a population under 18 years of age of Caucasian ancestry.The study included 117 pediatric patients (59% males, mean age at diagnosis 7.4 ± 5.2 years) with ALL, confirmed by conventional immunophenotyping surface-marker analysis and 404 healthy control subjects (48.5% men, mean age 37.7 ± 11.3 years). The MTHFR C677T and A1298C genotypes were analyzed using allele discrimination tests with Taq-Man fluorescent probes.The MTHFR 677TT genotype was related to a 2-fold increase in risk of ALL (P = .014). The 677T-1298C haplotype was found in ALL patients but not in controls (frequency 0.598%; P <.0001). The observed frequency of carriers of this rare haplotype was 12%, including 677CT/1298CC (1.7%), 677TT/1298AC (6.0%), and 677CT/1298AC (4.3%) genotypes.The MTHFR 677T allele alone or in combination with the MTHFR 1298C allele significantly increases the risk of development of ALL in Polish population under 18 years of age. Further studies of haplotype composition in subjects with the 677CT/1298AC genotype are necessary to assess the risk of childhood ALL. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

Individual and Joint Associations of Methylenetetrahydrofolate Reductase C677T Genotype and Plasma Homocysteine With Dyslipidemia in a Chinese Population With Hypertension.

PubMed

Liu, Yanhong; Li, Kang; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

2017-04-01

We aimed to examine the cross-sectional associations of plasma total homocysteine (tHcy) concentrations and methylenetetrahydrofolate reductase ( MTHFR) C677T genotype with dyslipidemia. A total of 231 patients with mild-to-moderate essential hypertension were enrolled from the Huoqiu and Yuexi communities in Anhui Province, China. Plasma tHcy levels were measured by high-performance liquid chromatography. Genotyping was performed by TaqMan allelic discrimination technique. Compared with MTHFR 677 CC + CT genotype carriers, TT genotype carriers had higher odds of hypercholesterolemia (adjusted odds ratio [OR] [95% confidence interval (CI)]: 2.7 [1.4-5.2]; P = .004) and higher odds of abnormal low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.3 [1.1-4.8]; P = .030). The individuals with the TT genotype had higher concentrations of log(tHcy) than those with the 677 CC + CT genotype (adjusted β [standard error]: .2 [0.03]; P < .001). Patients with tHcy ≥ 10 μmol/L had significantly higher odds of hypercholesterolemia (adjusted OR [95% CI]: 2.4 [1.2-4.7]; P = .010). Furthermore, patients with both the TT genotype and the tHcy ≥ 10 μmol/L had the highest odds of hypercholesterolemia (adjusted OR [95% CI]: 4.1 [1.8-9.4]; P = .001) and low-density lipoprotein cholesterol (adjusted OR [95% CI]: 2.4 [1.0-6.0]; P = .064). This study suggests that both tHcy and the MTHFR C677T gene polymorphism may be important determinants of the incidence of dyslipidemia in Chinese patients with essential hypertension. Further studies are needed to confirm the role of tHcy and the MTHFR C677T mutation in the development of dyslipidemia in a larger sample.

Methylenetetrahydrofolate reductase C677T genetic polymorphisms and risk of leukaemia among the North Indian population.

PubMed

Hussain, Syed Rizwan; Naqvi, Hena; Raza, Syed Tasleem; Ahmed, Faisal; Babu, Sunil G; Kumar, Ashutosh; Zaidi, Zeashan Haider; Mahdi, Farzana

2012-08-01

Leukaemia is a heterogeneous disease in which haematopoietic progenitor cells acquire genetic lesions that lead to a block in differentiation, increased self-renewal, and unregulated proliferation. The enzyme 5,10-methylenetetrahydrofolate reductase (MTHFR), involved in folate metabolism, plays a crucial role in cells because folate availability is important for DNA integrity. The aim of this case-control study was to evaluate the association of the C677T MTHFR gene polymorphism with acute myeloid leukaemia (AML), acute lymphoblastic leukaemia (ALL), chronic myeloid leukaemia (CML) and chronic lymphocytic leukaemia (CLL). A total of 275 leukaemia cases - including AML (n = 112), ALL (n = 81), CML (n = 43), CLL (n = 39) - and 251 age/sex-matched healthy control individuals participated in this study. MTHFR C677T polymorphisms in the cases and controls were evaluated by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The average MTHFR 677CC, 677CT, 677TT genotype frequencies of total leukaemia cases were 68.73%, 19.64%, and 11.64% in cases, and 71.71%, 24.30%, and 3.98% in healthy controls, respectively. The average frequency of the MTHFR 677T allele was 21.45% among the cases compared to 16.13% among the controls. In the present case-control study we have observed a higher frequency of the MTHFR 677TT genotype in cases of leukaemia (AML, ALL, CML and CLL) as compared with controls; this might be due to ethnic and geographic variation. As per our findings, although the frequency of the MTHFR 677T allele is moderately high in AML, ALL and CLL, no statistically significant association was found; on the other hand statistically significant association was found in the context of CML cases. Copyright © 2012 Elsevier Ltd. All rights reserved.

Folate restriction and methylenetetrahydrofolate reductase 677T polymorphism decreases adoMet synthesis via folate-dependent remethylation in human-transformed lymphoblasts.

PubMed

Chiang, E-P; Wang, Y-C; Tang, F-Y

2007-04-01

The homozygous mutation (677TT) in the methylenetetrahydrofolate reductase (MTHFR) gene reduces enzyme activity and alters cellular folate composition. Previous epidemiological studies reported a potential protective effect of MTHFR677C --> T against acute lymphocytic leukemia and malignant lymphoma, but the mechanism remains to be determined. We investigated the biochemical impacts of MTHFR677C --> T on cellular S-adenosyl methionine (adoMet) synthesis, global DNA methylation, and de novo purine synthesis, all of which are potential regulatory pathways involved in tumorigenesis. Metabolic fluxes of homocysteine remethylation and de novo purine synthesis were compared between Epstein-Barr virus-transformed lymphoblasts expressing MTHFR 677C and MTHFR 677T using stable isotopic tracers and GCMS. MTHFR TT genotype significantly reduced folate-dependent remethylation under folate restriction, reflecting limited methylated folates under folate restriction. Data also suggested increased formylated folate pool and increased purine synthesis when folate is adequate. The impacts of MTHFR 677T polymorphism appeared closely related to folate status, and such alterations may modulate metabolic pathways involved in cancer onset/progression. The advantage of de novo purine synthesis found in the MTHFR TT genotype may account for the protective effect of MTHFR in hematological malignancies. These transformed cells are potential models for studying the consequences of human genetic variation and cancer pathogenesis.

Association of PHB 1630 C>T and MTHFR 677 C>T polymorphisms with breast and ovarian cancer risk in BRCA1/2 mutation carriers: results from a multicenter study

PubMed Central

Jakubowska, A; Rozkrut, D; Antoniou, A; Hamann, U; Scott, R J; McGuffog, L; Healy, S; Sinilnikova, O M; Rennert, G; Lejbkowicz, F; Flugelman, A; Andrulis, I L; Glendon, G; Ozcelik, H; Thomassen, M; Paligo, M; Aretini, P; Kantala, J; Aroer, B; von Wachenfeldt, A; Liljegren, A; Loman, N; Herbst, K; Kristoffersson, U; Rosenquist, R; Karlsson, P; Stenmark-Askmalm, M; Melin, B; Nathanson, K L; Domchek, S M; Byrski, T; Huzarski, T; Gronwald, J; Menkiszak, J; Cybulski, C; Serrano, P; Osorio, A; Cajal, T R; Tsitlaidou, M; Benítez, J; Gilbert, M; Rookus, M; Aalfs, C M; Kluijt, I; Boessenkool-Pape, J L; Meijers-Heijboer, H E J; Oosterwijk, J C; van Asperen, C J; Blok, M J; Nelen, M R; van den Ouweland, A M W; Seynaeve, C; van der Luijt, R B; Devilee, P; Easton, D F; Peock, S; Frost, D; Platte, R; Ellis, S D; Fineberg, E; Evans, D G; Lalloo, F; Eeles, R; Jacobs, C; Adlard, J; Davidson, R; Eccles, D; Cole, T; Cook, J; Godwin, A; Bove, B; Stoppa-Lyonnet, D; Caux-Moncoutier, V; Belotti, M; Tirapo, C; Mazoyer, S; Barjhoux, L; Boutry-Kryza, N; Pujol, P; Coupier, I; Peyrat, J-P; Vennin, P; Muller, D; Fricker, J-P; Venat-Bouvet, L; Johannsson, O Th; Isaacs, C; Schmutzler, R; Wappenschmidt, B; Meindl, A; Arnold, N; Varon-Mateeva, R; Niederacher, D; Sutter, C; Deissler, H; Preisler-Adams, S; Simard, J; Soucy, P; Durocher, F; Chenevix-Trench, G; Beesley, J; Chen, X; Rebbeck, T; Couch, F; Wang, X; Lindor, N; Fredericksen, Z; Pankratz, V S; Peterlongo, P; Bonanni, B; Fortuzzi, S; Peissel, B; Szabo, C; Mai, P L; Loud, J T; Lubinski, J

2012-01-01

Background: The variable penetrance of breast cancer in BRCA1/2 mutation carriers suggests that other genetic or environmental factors modify breast cancer risk. Two genes of special interest are prohibitin (PHB) and methylene-tetrahydrofolate reductase (MTHFR), both of which are important either directly or indirectly in maintaining genomic integrity. Methods: To evaluate the potential role of genetic variants within PHB and MTHFR in breast and ovarian cancer risk, 4102 BRCA1 and 2093 BRCA2 mutation carriers, and 6211 BRCA1 and 2902 BRCA2 carriers from the Consortium of Investigators of Modifiers of BRCA1 and BRCA2 (CIMBA) were genotyped for the PHB 1630 C>T (rs6917) polymorphism and the MTHFR 677 C>T (rs1801133) polymorphism, respectively. Results: There was no evidence of association between the PHB 1630 C>T and MTHFR 677 C>T polymorphisms with either disease for BRCA1 or BRCA2 mutation carriers when breast and ovarian cancer associations were evaluated separately. Analysis that evaluated associations for breast and ovarian cancer simultaneously showed some evidence that BRCA1 mutation carriers who had the rare homozygote genotype (TT) of the PHB 1630 C>T polymorphism were at increased risk of both breast and ovarian cancer (HR 1.50, 95%CI 1.10–2.04 and HR 2.16, 95%CI 1.24–3.76, respectively). However, there was no evidence of association under a multiplicative model for the effect of each minor allele. Conclusion: The PHB 1630TT genotype may modify breast and ovarian cancer risks in BRCA1 mutation carriers. This association need to be evaluated in larger series of BRCA1 mutation carriers. PMID:22669161

[Study on the association between 5,10-methylenetrahydrofolate reductase C677T polymorphism and acute lymphoblastic leukemia risk: a Meta-analysis].

PubMed

Li, Xiao-lei; Yu, Feng; Zhang, Yong; Qiu, Jin-chun; Liu, Si-ting; Liao, Qing-chuan

2011-10-01

To evaluate the association between polymorphism of 5,10-methylenetrahydrofolate reductase C677T and risk of acute lymphoblastic leukemia (ALL). Electronic search strategy was carried out among the databases from home and abroad to collect qualified research papers, according to the inclusion and exclusion criteria. Data on case-control studies on association between MTHFR C677T polymorphism and susceptibility to ALL were collected and analyzed by models of TT vs. CC + CT or TT vs. CC through Meta-analysis. Stratified analysis was carried out according to different age groups (children or adult). In systematical analysis, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.87 (0.69 - 1.09) and 0.82 (0.63 - 1.06) respectively; in children's group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.92 (0.79 - 1.08), 0.88 (0.75 - 1.05) while in adult group, the pooled odds ratios of MTHFR C677T genetype TT vs. CC + CT or TT vs. CC were 0.45 (0.26 - 0.77), and 0.41 (0.22 - 0.72) respectively. The MTHFR gene 677T variant might not be associated with the risk of children's ALL but might be associated with a reduced risk on adult's ALL.

Associations of methylenetetrahydrofolate reductase C677T genotype with blood pressure levels in Chinese population with essential hypertension.

PubMed

Cheng, Jun; Tao, Fang; Liu, Yanhong; Venners, Scott A; Hsu, Yi-Hsiang; Jiang, Shanqun; Weinstock, Justin; Wang, Binyan; Tang, Genfu; Xu, Xiping

2018-01-01

To confirm the association between baseline blood pressure (BP) levels and the methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism in patients with essential hypertension. A total of 347 patients were enrolled from the Dongzhi community in Anhui Province, China. The C677T polymorphism of the MTHFR gene was detected using high-throughput TaqMan allelic discrimination assay. Baseline BP was measured using a standardized mercury-gravity monometer. In the whole sample, the frequency of the MTHFR C677T genotypes CC, CT, and TT were 38.6%, 48.1%, and 13.3%, respectively. In a recessive model (CC+CT versus TT genotypes), baseline diastolic blood pressure (DBP) was significantly higher in patients with the TT genotype compared to those with the CT or CC genotypes (P= 0.013). We also divided all patients into three groups based on the tertiles of the baseline BP distribution. Compared to subjects in the lowest tertile of DBP, the adjusted odds of having the TT genotype among subjects in the highest tertile was 2.6 (95% CI: 1.1 to 6.2). However, no significant associations were observed between baseline systolic blood pressure (SBP) and the MTHFR C677T polymorphism. The MTHFR gene polymorphism could be an important genetic determinant of baseline DBP levels in Chinese essential hypertensive patients.

Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms and the risk of primary Hepatocellular Carcinoma (HCC) in a Chinese population

PubMed Central

Cao, Wei; Zhang, Zuo-Feng; Cai, Lin; Jiang, Qing-Wu; You, Nai-Chieh; Goldstein, Binh Yang; Wei, Guo-Rong; Chen, Chuan-Wei; Lu, Qing-Yi; Zhou, Xue-Fu; Ding, Bao-Guo; Chang, Jun; Yu, Shun-Zhang

2014-01-01

Objectives Methylenetetrahydrofolate reductase (MTHFR), which is expressed in the liver, may be involved in both DNA methylation and DNA synthesis. It is also indicated as a potential risk factor of liver cancer in patients with chronic liver disease. To date, no study has been conducted on MTHFR and hepatocellular carcinoma (HCC) using a population-based design. The objective of this study was to evaluate the effects of polymorphisms of the MTHFR gene on the risk of primary liver cancer and their possible effect modifications on various environmental risk factors. Methods A population-based case–control study was conducted in Taixing, China. MTHFR C677T and A1298C were assayed by PCR-RFLP techniques. Results The frequency of MTHFR 677 C/C wild homo-zygotes genotype was 25.8% in cases, which was lower than that in controls (34.5%). The adjusted odds ratios (ORs) for the MTHFR 677 C/T and T/T genotype were 1.66(95% CI: 1.06–2.61), 1.21(95% CI: 0.65–2.28) respectively when compared with the MTHFR 677 C/C genotype. Subjects carrying any T genotype have the increased risk of 1.55(95% CI: 1.01–2.40) for development of primary hepatocellular carcinoma. A high degree of linkage disequilibrium was observed between the C677T and A1298C polymorphisms, with the D′ of 0.887 and p < 0.01. The MTHFR 677 any T genotype was suggested to have potentially more than multiplicative interactions with raw water drinking with p-value for adjusted interaction of 0.03. Conclusion We observed that the MTHFR 677 C/T genotype was associated with an increased risk of primary liver cancer in a Chinese population. The polymorphism of MTHFR 677 might modify the effects of raw water drinking on the risk of primary hepatocellular carcinoma. PMID:17503006

High prevalence of three prothrombotic polymorphisms among Palestinians: factor V G1691A, factor II G20210A and methylenetetrahydrofolate reductase C677T.

PubMed

Hussein, Ayman S

2012-10-01

Factor V leiden G1691A/R506Q (FVL), prothrombin G20210A (FII) and methylenetetrahydrofolate reductase (MTHFR) C677T are related genetic risk factors for venous thromboembolism. Analysis for those mutations is increasingly being performed on patients exhibiting hypercoagulability. The objective of this study was to determine the prevalence of FVL, FII-G20210A and MTHFR-C677T polymorphisms and their coexistence among apparently healthy Palestinians. After institutional approval, 303 apparently healthy students from An-Najah University representative to North and South regions of West Bank with no previous history of cardiovascular diseases participated in this study. A uniform questionnaire was used to collect relevant information through personal interview with the subjects. The collected information included gender, age, smoking habits, weight and height, diseases such as diabetes, cardiovascular and family history of CVD. The frequencies of allelic distribution of the three prothrombotic polymorphisms factor V G1691A/R506Q), prothrombin G2010A, and MTHFR-C677T were 0.114, 0.050 and 0.071, respectively. The prevalence of the three thrombotic polymorphisms (FVL, FII G20210A and MTHFR-C677T) were 20.1, 9.1 and 13.8 %, respectively. Statistical analysis for factor V leiden showed no significant association between place of residence (P value = 0.953) and gender (P value >0.082). The data presented in this study showed the highest prevalence of FVL among healthy Palestinians compared to other populations and this important finding should be followed in terms of clinical significance.

Association of Methylenetetrahydrofolate Reductase C677T and A1298C Gene Polymorphisms With Recurrent Pregnancy Loss in Syrian Women.

PubMed

Al-Achkar, Walid; Wafa, Abdulsamad; Ammar, Samer; Moassass, Faten; Jarjour, Rami A

2017-09-01

C677T polymorphism of the methylenetetrahydrofolate reductase ( MTHFR) gene was a risk factor for recurrent pregnancy loss (RPL), but few studies have confirmed a possible role of MTHFR A1298C polymorphism in RPL risk. This study was carried out to determine the influence of the MTHFR gene polymorphisms in RPL Syrian women. A case-control study was performed on 2 groups (106 healthy and 100 RPL women). The frequency of the MTHFR gene polymorphisms was determined by polymerase chain reaction based on restriction fragment length gene polymorphism. In the RPL group, the genotype frequencies of MTHFR C677T were CC (41%), CT (41%), and TT (18%), and in the control group, the frequencies were CC (62.2%), CT (36.7%), and TT (1%). Statistical analysis showed a homozygous TT genotype and T allele were significantly different in the RPL group ( P = .000003 and P = .000019, respectively). The genotype frequencies of MTHFR A1298C were AA (53%), AC (44%), and CC (8%) in the RPL group, whereas in the control group, these were AA (61.3%), AC (37.8%), and CC (1%). A significant difference in the CC genotype and C allelic frequencies in the RPL women was observed ( P = .014 and P = .064, respectively). The patients having compound heterozygous (677 CT/1298AC) were associated with an estimated 4.86-fold increase in risk of pregnancy loss compared to individuals with a wild type ( P = .012). Our findings indicate that RPL women with homozygous genotype for (C677T and A1298C) either alone or compound heterozygous genotypes have a high risk of pregnancy loss in Syrian women.

Association of Methylenetetrahydrofolate Reductase (MTHFR 677C>T and 1298A>C) Polymorphisms and Haplotypes with Silent Brain Infarction and Homocysteine Levels in a Korean Population

PubMed Central

Han, In Bo; Kim, Ok Joon; Ahn, Jung Yong; Oh, Doyeun; Hong, Sun Pyo; Huh, Ryoong; Chung, Sang Sup

2010-01-01

Purpose Methylenetetrahydrofolate reductase (MTHFR) is the main regulatory enzyme for homocysteine metabolism. In the present study, we evaluated whether the MTHFR 677C>T and 1298A>C gene polymorphisms are associated with SBI and plasma homocysteine concentration in a Korean population. Materials and Methods We enrolled 264 patients with SBI and 234 healthy controls in South Korea. Fasting plasma total homocysteine (tHcy) concentrations were measured, and genotype analysis of the MTHFR gene was carried out. Results The plasma tHcy levels were significantly higher in patients with SBI than in healthy controls. Despite a significant association between the MTHFR 677TT genotype and hyperhomocysteinemia, the MTHFR 677C>T genotypes did not appear to influence susceptibility to SBI. However, odds ratios of the 1298AC and 1298AC + CC genotypes for the 1298AA genotype were significantly different between SBI patients and normal controls. The frequencies of 677C-1298A and 677C-1298C haplotypes were significantly higher in the SBI group than in the control group. Conclusion This study demonstrates that the MTHFR 1298A>C polymorphism is a risk factor for SBI in a Korean population. The genotypes of 677C>T and 1298A>C polymorphisms interact additively, and increase the risk of SBI in Korean subjects. PMID:20191019

Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

PubMed

Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

2009-06-01

This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

Status of vitamin B-12 and B-6 but not of folate, homocysteine and the methylenetetrahydrofolate reductase C677T polymorphism are associated with impaired cognition and depression in adults

USDA-ARS?s Scientific Manuscript database

The C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene differs in frequency in different ethnic groups which have differing prevalence of age-related cognitive impairments. We used a battery of neuropsychological tests to examine association of the MTHFR C677T polymorphism w...

Coexistence of the 677C>T and 1298A>C MTHFR polymorphisms and its significance in the population of Polish women.

PubMed

Wolski, Hubert; Kocięcka, Maria; Mrozikiewicz, Aleksandra E; Barlik, Magdalena; Kurzawińska, Grażyna

2015-10-01

The aim of the study was to evaluate the frequency of the 677C>T and 1298A>C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene, as well as the coexistence of both these genetic variants in women from the Polish population. A total of 662 women from the Polish population were enrolled in the study group. The frequency of the investigated genotypes of the 677C>T and 1298A>C polymorphisms of the MTHFR gene was analyzed with the use of PCR/RFLP methods. The frequency of the 677CC, 677CT and 677TT genotypes in the studied population of women was 50.60%, 39.88% and 9.52%, respectively As to the 1298AA, 1298AC and 1298CC genotypes, the obtained results were as follows: 42.75%, 47.88% and 9.37%, respectively (Tables II and III). Simultaneous analysis revealed the most frequent coexistence of 677CC/1298AC (28.85%), 677CT/1298AA (20.85%) and 677CT/1298AC (19.03%) genotypes. The coexistence of 677CC/1298AA (12.39%), 677CC/1298CC (9.37%) and 677TT/1298AA (9.51%) genotypes was observed less frequently In the studied population of Polish women, the coexistence of 677CT/1298CC, 677TT/1298AC and 677TT/1298CC genotypes has been not observed. The frequency and coexistence of genotypes of the 677C>T and 1298A>C MTHFR gene polymorphisms in the studied population of Polish women is similar to other North-European populations. Women carriers of the mutated variants of both, 677C>T and 1298A>C polymorphisms of the MTHFR gene should receive special perinatal care in order to prevent fetal defects and thrombosis-related complications during pregnancy It is vital to emphasize the significance of proper education of folate supplementation, especially in pregnant patients and women of reproductive age.

MTHFR C677T mutation increased the risk of Ischemic Stroke, especially in large-artery atherosclerosis in adults: an updated meta-analysis from 38 researches.

PubMed

Cui, Tao

2016-01-01

To date, many publications have evaluated the correlation between the Ethylenetetrahydrofolate reductase gene (MTHFR) C677T and Ischemic Stroke susceptibility in adults. However, the results remain inconclusive. The meta-analysis was performed to resolve the problem. Based on 38 studies, dichotomous data were presented as the odds ratio (OR) with a 95% confidence interval (CI). This study found, the carriers of the MTHFR 677C→T variation were more likely to increase the risk of Ischemic Stroke susceptibility in all over pooled population, including Asian and European, but not in African population (Europe: TT vs. CC+TC: OR = 1.364 95% CI = 1.010-1.841 p = 0.043; Asia subgroup: T vs. C: OR = 1.245, 95% CI = 1.141-1.358, p < 0.001; Africa: T vs. C: OR = 1.202, 95% CI = 0.990-1.459, p = 0.062). Among etiology stratified analysis, only large-artery atherosclerosis subgroups had a significant different, and the p value was less than 0.01 in all genetic models (T vs. C: OR = 1.29, 95% CI = 1.09-1.52, p = 0.002; TT+TC vs. CC: OR = 1.27, 95% CI = 1.06-1.51, p = 0.009; TT vs. CC+TC: OR = 1.62, 95% CI = 1.19-2.19, p = 0.002). This meta-analysis suggests that MTHFR C677T mutation increased the risk of Ischemic Stroke in adults, especially in large-artery atherosclerosis.

Methylenetetrahydrofolate reductase polymorphism C677T is a protective factor for pediatric acute lymphoblastic leukemia in the Chinese population: a meta-analysis.

PubMed

Wang, Haigang; Meng, Lujing; Zhao, Lixia; Wang, Jiali; Liu, Xinchun; Mi, Wenjie

2012-12-01

Two polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, were hypothesized to decrease the risk of acute lymphoblastic leukemia (ALL). Studies examining the associations between these two polymorphisms and ALL susceptibility drew inconsistent results. To obtain a reliable conclusion in a Chinese population, we carried out a meta-analysis. In total, 11 studies on C677T polymorphism (1597 cases and 2295 controls) and 10 studies on A1298C polymorphism (1553 cases and 2224 controls) were included in the meta-analysis. We found a significant association between the 677T variant and reduced ALL risk in Chinese children (Dominant model: odds ratio [OR(FE)]=0.73, 95% confidence interval [CI]: 0.63-0.86, p<0.01). Heterogeneity between the studies in the children subgroup was weak and vanished after excluding one study deviating from HWE in the control group (p>0.1). In the adult subgroup, there was no significant association between the C677T variant and ALL risk (Dominant model: OR(RE)=0.88, 95% CI: 0.45-1.72, p=0.72). Significant heterogeneity was found in the adult subgroup in all the genetic model tests (p<0.1). The A1298C polymorphism had an effect on ALL risk neither in adults (Dominant model: OR(FE)=0.95, 95% CI: 0.71-1.27, p=0.72) nor in children (Dominant model: OR(FE)=1.02, 95% CI: 0.87-1.21, p=0.77). No significant heterogeneity between studies on A1298C polymorphism was found in the meta-analysis (p>0.1). The results showed that there was a protective effect of the MTHFR C677T variant on ALL risk in Chinese children.

Association of methylenetetrahydrofolate reductase gene C677T polymorphism with polycystic ovary syndrome risk: a systematic review and meta-analysis update.

PubMed

Fu, Li-yuan; Dai, Li-meng; Li, Xiao-gang; Zhang, Kun; Bai, Yun

2014-01-01

To re-estimate the association between methylenetetrahydrofolate reductase gene (MTHFR) C677T polymorphism and polycystic ovary syndrome (PCOS) risk by critically reviewing, analyzing and updating the current evidence. MTHFR C677T polymorphism has been studied as a possible risk factor for a variety of common conditions including heart disease, stroke and hypertension. Its association with PCOS was negative in a previous meta-analysis which had possible shortcomings. More studies have now been done but their results remain inconclusive. Available case-control studies containing genotype frequencies of MTHFR C677T were chosen, and odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of the association. Statistical analyses were performed using software Review Manager (Version 5. 2) and Stata (Version 11.0). Nine case-control studies including 638 PCOS and 759 healthy controls were identified. Meta-analysis showed a significant effect in the dominant model (TT+CT vs. CC: OR=1.65, 95%CI=1.28-2.12, P<0.0001) and heterozygote comparison (CT vs. CC: OR=1.83, 95%CI=1.17-2.87, P=0.008). In subgroup analysis stratified by ethnicity, MTHFR C677T variant was statistically significantly relevant to PCOS risk in European populations (TT+CT vs. CC: OR=2.16, 95%CI=1.50-3.12, P<0.0001; CT vs. CC: OR=2.11, 95%CI=1.15-3.87, P=0.02) but not in Asian populations (TT+CT vs. CC: OR=1.29, 95%CI=0.91-1.82, P=0.15; CT vs. CC: OR=1.31, 95%CI=0.91-1.90, P=0.15). This meta-analysis indicates that the 677T allele increases PCOS susceptibility, and this relevance seems to be more intense in Europeans than in Asians. Copyright © 2013. Published by Elsevier Ireland Ltd.

C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase gene: effect on methotrexate-related toxicity in adult acute lymphoblastic leukaemia.

PubMed

Eissa, Deena Samir; Ahmed, Tamer Mohamed

2013-03-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism. Two polymorphisms, C677T and A1298C, were described leading to reduced enzyme activity. Methotrexate (MTX) is an antifolate agent of consolidation and maintenance therapy of acute lymphoblastic leukaemia (ALL). Despite its clinical success, MTX can be associated with serious toxicities resulting in treatment interruption or discontinuation, impacting disease outcome. There is evidence that MTX toxicity can be affected by polymorphisms in genes encoding for drug-metabolizing enzymes such as MTHFR. Therefore, we aimed to investigate the influence of MTHFR C677T and A1298C polymorphisms on the frequency of MTX-related toxicity, disease outcome and patients' survival. MTHFR polymorphisms were assessed in 50 adult patients with de novo ALL using real-time PCR. Patients were followed-up for the development of haematologic and/or nonhaematologic toxicity and assessment of clinical outcome. Frequency of C677T polymorphisms was 42% for TT, 24% for CT and 34% for CC; A1298C polymorphisms were 28, 6 and 66% for CC, AC and AA, respectively. MTX therapy was significantly associated with neutropaenia, hepatic and gastrointestinal toxicities, unfavourable response at day 14 of induction therapy, increased relapse and mortality rates and shorter survival in patients with 677 TT genotype than in those with CC and CT, whereas 1298 CC genotype patients had lower frequency of neutropaenia, hepatic toxicity and relapse than in those with AA and AC. Our study suggests MTHFR polymorphism as an attractive predictor of MTX-related toxicity in adult ALL, considering it a potential prognostic factor influencing disease outcome.

Methylenetetrahydrofolate reductase C677T polymorphism is associated with increased risk of coronary artery disease in young South African Indians.

PubMed

Ramkaran, Prithiksha; Phulukdaree, Alisa; Khan, Sajidah; Moodley, Devapregasan; Chuturgoon, Anil A

2015-10-15

Methylenetetrahydrofolate reductase (MTHFR) reduces 5',10'-methylenetetrahydrofolate to 5'-methyltetrahydrofolate, and is involved in remethylation of homocysteine to methionine, two important reactions involved in folate metabolism and methylation pathways. The common MTHFR C677T single nucleotide polymorphism (SNP) (rs1801133) has been associated with raised levels of homocysteine, a well known risk factor for coronary artery disease (CAD). CAD is a major cause of mortality worldwide. The age of onset of this chronic disorder is on the decline, particularly in the Indian population. Indians in South Africa (SA) have a higher prevalence of premature CAD compared to Black South Africans. The MTHFR C677T SNP has not been investigated in the SA Indian population. The present study therefore investigated the MTHFR C677T SNP in young SA Indian males with CAD compared to young Indian and Black male controls. A total of 290 subjects were recruited into this study which included 106 CAD patients (diagnosed on angiography, mean age 37.5, range 24-45 years), 100 Indian male controls (mean age 37.5, range 28-45 years), and 84 Black male controls (mean age 36.4, range 25-45). Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) was used to genotype CAD patients and healthy controls. Data for clinical markers were obtained from pathology reports. There was a significant association between the 677 MTHFR variant (T) allele and CAD patients compared to the healthy Indian controls (p=0.0353, OR=2.105 95% CI 1.077-4.114). Indian controls presented with a higher frequency of the variant allele compared to Black controls (7% vs. 2% respectively, p=0.0515 OR=3.086 95% CI 0.9958-9.564). The MTHFR C677T SNP did not influence levels of total cholesterol, LDL, HDL, triglycerides, fasting glucose, fasting insulin, HbA1c or hsCRP. The higher frequency of the MTHFR 677 variant allele in South African Indians may be a contributing factor to the higher

Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

PubMed Central

2014-01-01

Background The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). Methods A case–control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. Results No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. Conclusions The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population. PMID:24476575

Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population.

PubMed

Li, Xiaolei; Liao, Qingchuan; Zhang, Shunguo; Chen, Minling

2014-01-29

The aim of this study was to investigate the relationship between the polymorphisms of the methylenetetrahytrofolate reductase (MTHFR) gene and susceptibility to childhood acute lymphoblastic leukemia (ALL). A case-control study was conducted among 98 children with ALL and 93 age- and sex- matched non-ALL controls. Genotyping of MTHFR C677T and A1298C polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) of MTHFR genotypes were used to assess the associations of these polymorphisms with childhood ALL susceptibility. No significant differences were observed for frequencies of the 677CC, 677CT and 677TT genotypes between patients and controls. Frequencies of the 1298AA, 1298 AC and 1298CC genotypes between the two groups were significantly different. The risk of ALL with the 1298C allele carriers (AC + CC) was elevated by 1.1 times compared with the AA genotype [OR = 2.100; 95% CI (1.149; 3.837); P = 0.015]. The MTHFR A1298C polymorphism is associated with susceptibility to childhood ALL in the Chinese population.

Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

PubMed Central

Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

2016-01-01

Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

Prevalence of factor V leiden, MTHFR C677T and MTHFR A1298C polymorphisms in patients with deep vein thrombosis in Central Iran.

PubMed

Ehsani, Majid; Imani, Aida; Moravveji, Alireza

2018-05-31

Deep vein thrombosis (DVT) is a common disease, especially among elderly patients, which is associated with high costs of treatment and high rates of recurrence. The risk factors for venous thrombosis are primarily related to hypercoagulability, which can be genetic or acquired, or because of immobilization and venous stasis. Among relevant genetic markers are a number of common polymorphisms and mutations in the genes coding for Factor V leiden and methylenetetrahydrofolate reductase. Differential associations of these polymorphisms have been reported in different populations with DVT due to ethnic variations. However, no study has been reported with respect to these polymorphisms in DVT in Iran. Thus, the aim of the present study is to determine the prevalence of FVL, MTHFR C677T and MTHFR A1298C gene polymorphisms in patients with DVT in central Iran. In the present cross-sectional study, a total of 100 patients with first and recurrent episodes of DVT and age less than 70 years were recruited during 2016-2017. Blood sample was collected from the recruited patients and FVL mutation was screened using ARMS-PCR method, MTHFR C677T and MTHFR A1298C mutations were screened using PCR-RFLP method. The results revealed that MTHFR A1298C gene polymorphism in both homozygote and heterozygote form was found to be most frequent i.e. 77% among cases, followed by MTHFR C677T (67%) and FVL (17%). The study highlights the importance of screening of these genetic markers among patients with DVT in this region.

Subacute methotrexate neurotoxicity and cerebral venous sinus thrombosis in a 12-year-old with acute lymphoblastic leukemia and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism: homocysteine-mediated methotrexate neurotoxicity via direct endothelial injury.

PubMed

Mahadeo, Kris M; Dhall, Girish; Panigrahy, Ashok; Lastra, Carlos; Ettinger, Lawrence J

2010-02-01

From as early as the 1970s methotrexate has been associated with disseminated necrotizing leukoencephalopathy and other neurotoxic sequelae. Yet, a clear mechanism for methotrexate-induced neurotoxicity has not been established. The authors describe the case of a 12-year-old male with acute lymphoblastic leukemia and a homozygous methylenetetrahydrofolate reductase C677T mutation, who developed subacute methotrexate-induced toxicity and cerebral venous thrombosis after receiving intrathecal methotrexate. The role of homocysteine as a possible mediator in methotrexate-induced neurotoxicity via direct endothelial injury is discussed.

Effects of Maternal 5,10-Methylenetetrahydrofolate Reductase C677T and A1298C Polymorphisms and Tobacco Smoking on Infant Birth Weight in a Japanese Population

PubMed Central

Yila, Thamar Ayo; Sasaki, Seiko; Miyashita, Chihiro; Braimoh, Titilola Serifat; Kashino, Ikuko; Kobayashi, Sumitaka; Okada, Emiko; Baba, Toshiaki; Yoshioka, Eiji; Minakami, Hisanori; Endo, Toshiaki; Sengoku, Kazuo; Kishi, Reiko

2012-01-01

Background Intracellular folate hemostasis depends on the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene. Because 5,10-MTHFR 677TT homozygosity and tobacco smoking are associated with low folate status, we tested the hypothesis that smoking in mothers with 5,10-MTHFR C677T or A1298C polymorphisms would be independently associated with lower birth weight among their offspring. Methods We assessed 1784 native Japanese mother-child pairs drawn from the ongoing birth cohort of The Hokkaido Study on Environment and Children’s Health. Data (demographic information, hospital birth records, and biological specimens) were extracted from recruitments that took place during the period from February 2003 to March 2006. Maternal serum folate were assayed by chemiluminescent immunoassay, and genotyping of 5,10-MTHFR C677T/A1298C polymorphisms was done using a TaqMan allelic discrimination assay. Results The prevalence of folate deficiency (<6.8 nmol/L) was 0.3%. The 5,10-MTHFR 677CT genotype was independently associated with an increase of 36.40 g (95% CI: 2.60 to 70.30, P = 0.035) in mean infant birth weight and an increase of 90.70 g (95% CI: 6.00 to 175.50, P = 0.036) among male infants of nonsmokers. Female infants of 677TT homozygous passive smokers were 99.00 g (95% CI: −190.26 to −7.56, P = 0.034) lighter. The birth weight of the offspring of smokers with 5,10-MTHFR 1298AA homozygosity was lower by 107.00 g (95% CI: −180.00 to −33.90, P = 0.004). Conclusions The results suggest that, in this population, maternal 5,10-MTHFR C677T polymorphism, but not the 5,10-MTHFR A1298C variant, is independently associated with improvement in infant birth weight, especially among nonsmokers. However, 5,10-MTHFR 1298AA might be associated with folate impairment and could interact with tobacco smoke to further decrease birth weight. PMID:22277790

Association of methylenetetrahydrofolate reductase (MTHFR 677C>T) and thymidylate synthase (TSER and TS 1494del6) polymorphisms with premature ovarian failure in Korean women.

PubMed

Rah, HyungChul; Jeon, Young Joo; Choi, Youngsok; Shim, Sung Han; Yoon, Tae Ki; Choi, Dong Hee; Cha, Sun Hee; Kim, Nam Keun

2012-11-01

The aim of our study was to investigate whether methylenetetrahydrofolate reductase (MTHFR) gene variant (MTHFR 677C>T) and thymidylate synthase (TS) gene variants (TS enhancer region [TSER] and TS 1494del6) confer a risk for premature ovarian failure (POF). We genotyped 136 POF patients and 236 controls among Korean women for the three single nucleotide polymorphism sites using polymerase chain reaction restriction fragment length polymorphism analysis. Differences in the MTHFR 677C>T, TSER, and TS 1494del6 genotype frequencies between POF patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as a measure of the strength of the association between genotypes and POF. The MTHFR 677CT and CT + TT variant genotypes were more frequent in POF patients than in controls (OR, 2.249; 95% CI, 1.317-3.843; and OR, 2.132; 95% CI, 1.268-3.585, respectively). The combined genotype frequencies of MTHFR 677CT + TT/TSER 3R3R and 677CT + TT/TS 1494del6 del6/del6 were higher in patients than in controls (OR, 2.300; 95% CI, 1.219-4.337; and OR, 3.314; 95% CI, 1.623-6.767, respectively). The T-3R-del6 and T-2R-del6 (MTHFR 677C>T/TSER/TS 1494del6) haplotypes were more frequent in patients (OR, 1.450; 95% CI, 1.050-2.002; and OR, 2.911; 95% CI, 1.191-7.117, respectively), whereas the C-2R-del6 haplotype was less frequent in patients (OR, 0.372; 95% CI, 0.152-0.912). The T-del6 (MTHFR 677/TS 1494del6) haplotype frequency was higher among patients (OR, 1.653; 95% CI, 1.206-2.266), whereas the C-del6 haplotype frequency was lower among patients (OR, 0.700; 95% CI, 0.516-0.950). We did not find an association between TSER or TS 1494del6 polymorphisms and POF. Our data suggest that the MTHFR 677T allele may increase the risk for POF, which could lead to the development of novel genetic markers for predicting the risk of POF in patients.

Influence of Combined Methionine Synthase (MTR 2756A > G) and Methylenetetrahydrofolate Reductase (MTHFR 677C > T) Polymorphisms to Plasma Homocysteine Levels in Korean Patients with Ischemic Stroke

PubMed Central

Kim, Ok Joon; Hong, Sun Pyo; Ahn, Jung Yong; Hong, Seung Ho; Hwang, Tae Sun; Kim, Soo Ok; Yoo, Wangdon; Oh, Doyeun

2007-01-01

Purpose Methionine synthase (MTR) and 5,10-methylenetetrahydrofolate reductase (MTHFR) are the main regulatory enzymes for homocysteine metabolism. The present case-control study was conducted to determine whether there is an association between the MTR 2756A > G or MTHFR 677C > T polymorphism and plasma homocysteine concentration in Korean subjects with ischemic stroke. Materials and Methods DNA samples of 237 patients who had an ischemic stroke and 223 age and sex-matched controls were studied. MTR 2756A > G and MTHFR 677C > T genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results Frequencies of mutant alleles for MTR and MTHFR polymorphisms were not significantly different between the controls and cases. The patient group, however, had significantly higher homocysteine concentrations of the MTR 2756AA and MTHFR 677TT genotypes than the control group (p = 0.04 for MTR, p = 0.01 for MTHFR). The combined MTR 2756AA and MTHFR 677TT genotype (p = 0.04) and the homocysteine concentrations of the patient group were also higher than those of the controls. In addition, the genotype distribution was significant in the MTHFR 677TT genotype (p = 0.008) and combined MTR 2756AA and MTHFR 677TT genotype (p = 0.03), which divided the groups into the top 20% and bottom 20% based on their homocysteine levels. Conclusion The results of the present study demonstrate that the MTR 2756A > G and MTHFR 677C > T polymorphisms interact with elevated total homocysteine (tHcy) levels, leading to an increased risk of ischemic stroke. PMID:17461517

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-01-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. Results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Creatine kinase MM TaqI and methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms influence exercise-induced C-reactive protein levels.

PubMed

Miranda-Vilela, Ana Luisa; Akimoto, Arthur K; Lordelo, Graciana S; Pereira, Luiz C S; Grisolia, Cesar K; Klautau-Guimarães, Maria de Nazaré

2012-03-01

Physical training induces beneficial adaptations, but exhausting exercise increases reactive oxygen species, which can cause muscular injuries with consequent inflammatory processes, implying jeopardized performance and possibly overtraining. Acute strenuous exercise almost certainly exceeds the benefits of physical activity; it can compromise performance and may contribute to increased future risk of cardiovascular disease (CVD) in athletes. Polymorphisms in the muscle-type creatine kinase (CK-MM) gene may influence performance and adaptation to training, while many potentially significant genetic variants are reported as risk factors for CVD. Therefore, we investigated the influence of polymorphisms in CK-MM TaqI and NcoI, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) and C-reactive protein (CRP G1059C) genes on exercise-induced damage and inflammation markers. Blood samples were taken immediately after a race (of at least 4 km) that took place outdoors on flat tracks, and were submitted to genotyping and biochemical evaluation of aspartate aminotransferase (AST), CK, CRP and high-sensitivity CRP (hs-CRP). CK-MM TaqI polymorphism significantly influenced results of AST, CK and hs-CRP, and an association between MTHFR C677T and A1298C with CRP level was found, although these levels did not exceed reference values. The results indicate that these polymorphisms can indirectly influence performance, contribute to higher susceptibility to exercise-induced inflammation or protection against it, and perhaps affect future risks of CVD in athletes.

Clinical impact of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations among sickle cell disease patients of Central India.

PubMed

Nishank, Sudhansu Sekhar; Singh, Mendi Prema Shyam Sunder; Yadav, Rajiv

2013-11-01

It is known that patients with sickle cell disease (SCD) present activation of the blood coagulation and fibrinolytic systems, especially during vaso-occlusive crises and also during the steady state of the disease. We determined whether the presence of the factor prothrombin gene G20210A variant, factor V gene G1691A mutation (factor V Leiden), and methylenetetrahydrofolate reductase (MTHFR) C677T polymorphisms may be risk factors for vascular complications in individuals with SCD. The study involved 150 patients with sickle cell anemia and 150 healthy controls of Central India. Genotyping of three thrombophilic mutations was carried out by PCR-RFLP methods using MnlI, Hind III, and Hinf I, respectively, for factor V Leiden, prothrombin, and MTHFR mutations. Patients with SCD had significantly higher prevalence of mutant variants of MTHFR gene (28.0% heterozygotes and 14.6% homozygotes) and FVL gene (14.6% heterozygotes) as compared to normal/control individuals, but complete absence of mutant variants of prothrombin gene. The patients with SCD having mutant variants of MTHFR and FVL genes showed higher incidence of pain in chest, abdomen, and bone joints along with early age of onset of clinical manifestations as well as frequent dependence on blood transfusion than those patients with SCD having wild variants of these thrombotic genes. As compared to control subjects, SCD individuals having mutant variants of FVL and MTHFR genes had significant association with higher levels of prothrombin fragment (F1+2), D-dimer, thrombin-antithrombin (TAT), and lower level of protein C. MTHFR C677T and FVL G1691A polymorphisms may be risk factors for increased vascular complications in patient with SCD. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Methylenetetrahydrofolate reductase C677T polymorphism predicts response and time to progression to gemcitabine-based chemotherapy for advanced non-small cell lung cancer in a Chinese Han population*

PubMed Central

Hong, Wei; Wang, Kai; Zhang, Yi-ping; Kou, Jun-yan; Hong, Dan; Su, Dan; Mao, Wei-min; Yu, Xin-min; Xie, Fa-jun; Wang, Xiao-jian

2013-01-01

Objective: The aim of this study was to evaluate the association between the methylenetetrahydrofolate reductase (MTHFR) C677T excision repair cross-complementation group 1 (ERCC1) genetic polymorphisms and the clinical efficacy of gemcitabine-based chemotherapy in advanced non-small cell lung cancer (NSCLC). Methods: A total of 135 chemonaive patients with unresectable advanced NSCLC were treated with gemcitabine/platinum regimens. The polymorphisms of MTHFR C677T, ERCC1 C8092A, and ERCC1 C118T were genotyped using the TaqMan methods. Results: The overall response rate was 28.9%. Patients with MTHFR CC genotype had a higher rate of objective response than patients with variant genotype (TT or CT) (41.2% versus 19.1%, P=0.01). Median time to progression (TTP) of patients with MTHFR CC genotype was longer than that of patients with variant genotype (7.6 months versus 5.0 months, P=0.003). No significant associations were obtained between ERCC1 C118T and C8092A polymorphisms and both response and survival. Conclusions: Our data suggest the value of MTHFR C677T polymorphism as a possible predictive marker of response and TTP in advanced NSCLC patients treated with gemcitabine/platinum. PMID:23463763

Synergistic effect of methyltetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphism as risk modifiers of pediatric acute lymphoblastic leukemia.

PubMed

Kamel, Azza M; Moussa, Heba S; Ebid, Gamal T; Bu, Rong R; Bhatia, Kishor G

2007-06-01

ALL is the most common pediatric cancer. The causes of the majority of pediatric acute leukemia are unknown and are likely to involve an interaction between genetic and environmental factors. Therefore, unfavourable gene-environmental interactions might be involved in the genesis of ALL. The aim of this work was to evaluate, in a case-control study, whether the common polymorphisms in 5, 10-methylenetetrahydrofolate reductase (MTHFR) namely (C677T and A1298C) and methionine synthase (MS) (A2756G) genes may play a role in altering susceptibility to pediatric ALL as individual genes and in combination. DNA of 88 ALL patients (age < or = 18 years) and 311 healthy control subjects was analyzed for the polymorphisms of MTHFR and MS genes using PCR-RFLP method. The frequencies of the wild types of MTHFR 677CC, MTHFR 1298AA and MS 2756AA, the homozygous genotypes of MTHFR 677TT, MTHFR 1298CC and MS 2756GG and heterozygous genotypes of MTHFR 677CT and MS 2756AG showed no statistically significant differences between patients and controls. The frequency of the MTHFR 1298AC heterozygous genotype was 25% among patients compared to 45.0% among controls; the difference was found to be statistically significant (p value =0.001, O.R=0.382 & 95% C.I=0.222-0.658). The frequency of the MTHFR1298AC heterozygous genotype plus 1298CC homozygous genotype was 34% among patients compared to 54.3% among controls and the difference was statistically significant (p value =0.001). A synergistic effect of 677CT and1298AC (CTAC) was observed, (p value=0.002) with 3.65 fold protection (OR 0.273 & 95% C.I=0.155-0.9) compared to 2.6 folds for MTHFR 1298AC alone. This protective effect of CTAC polymorphism was abolished when combined with MS 2756AA or AG. The present study provided further evidence for the protective role of MTHFR 1298AC mutant alleles in acute lymphoblastic leukemia in children (2.6 fold protection). This suggests that folate and methionine metabolism play an important role in the

Spectrum of MTHFR gene SNPs C677T and A1298C: a study among 23 population groups of India.

PubMed

Saraswathy, Kallur Nava; Asghar, Mohammad; Samtani, Ratika; Murry, Benrithung; Mondal, Prakash Ranjan; Ghosh, Pradeep Kumar; Sachdeva, Mohinder Pal

2012-04-01

Elevated homocysteine is a risk factor for many complex disorders. The role of methylenetetrahydrofolate reductase (MTHFR) gene in methylation of homocysteine makes it one of the most important candidate genes for these disorders. Considering the heterogeneity in its distribution in world populations, we screened MTHFR C677T and A1298C single nucleotide polymorphisms in a total of 23 Indian caste, tribal and religious population groups from five geographical regions of India and belonging to four major linguistic groups. The frequencies of MTHFR 677T and 1298C alleles were found to be 10.08 and 20.66%, respectively. MTHFR homozygous genotype 677TT was absent in eight population groups and homozygous 1298CC was absent in two population groups. 677T allele was found to be highest among north Indian populations with Indo-European tongue and 1298C was high among Dravidian-speaking tribes of east India and south India. The less common mutant haplotype 677T-1298C was observed among seven population groups and overall the frequency of this haplotype was 0.008, which is similar to that of African populations. cis configuration of 677T and 1298C was 0.94%. However, we could not find any individual with four mutant alleles which supports the earlier observation that presence of more than two mutant alleles may decrease the viability of foetus and possibly be a selective disadvantage in the population.

Association of methylenetetrahydrofolate reductase C677T polymorphism and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

PubMed Central

2010-01-01

Background The association of methylenetetrahydrofolate reductase (MTHFR) gene polymorphism and serum lipid profiles is still controversial in diverse ethnics. Bai Ku Yao is an isolated subgroup of the Yao minority in China. The aim of the present study was to eveluate the association of MTHFR C677T polymorphism and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 780 subjects of Bai Ku Yao and 686 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Genotyping of the MTHFR C677T was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.05-0.001). The frequency of C and T alleles was 77.4% and 22.6% in Bai Ku Yao, and 60.9% and 39.1% in Han (P < 0.001); respectively. The frequency of CC, CT and TT genotypes was 58.7%, 37.3% and 4.0% in Bai Ku Yao, and 32.6%, 56.4% and 11.0% in Han (P < 0.001); respectively. The levels of TC and LDL-C in both ethnic groups were significant differences among the three genotypes (P < 0.05-0.01). The T allele carriers had higher serum TC and LDL-C levels than the T allele noncarriers. The levels of ApoB in Han were significant differences among the three genotypes (P < 0.05). The T allele carriers had higher serum ApoB levels as compared with the T allele noncarriers. The levels of TC, TG and LDL-C in Bai Ku Yao were correlated with genotypes (P < 0.05-0.001), whereas the levels of LDL-C in Han were associated with genotypes (P < 0.001). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, cigarette smoking, and blood pressure in the both ethnic

Prevalence of metilentetrahidrofolate reductase C677T polymorphism, consumption of vitamins B6, B9, B12 and determination of lipidic hydroperoxides in obese and normal weight Mexican population.

PubMed

Hernández-Guerrero, César; Romo-Palafox, Inés; Díaz-Gutiérrez, Mary Carmen; Iturbe-García, Mariana; Texcahua-Salazar, Alejandra; Pérez-Lizaur, Ana Bertha

2013-11-01

Oxidative stress is a key factor in the development of the principal comorbidities of obesity. Methylenetetrahydrofolate reductase enzyme (MTHFR) participates in the metabolism of folate with the action of vitamins B6 and B12. The gene of MTHFR may present a single nucleotide polymorphism (SNP) at position 677 (C677T), which can promote homocysteinemia associated to the production of free radicals. To determine the frequency of SNP C677T of the MTHFR, evaluate the consumption of vitamins B6, B9, B12 and determine the concentration of plasma lipid hydroperoxides (LOOH) in obese and control groups. 128 Mexican mestizo according to their body mass index were classified as normal weight (Nw; n=75) and obesity (ObeI-III; n=53). Identification of SNP C677T of MTHFR was performed by PCR-RFLP technic. The consumption of vitamins B6, B9 and B12 was assessed by a validate survey. LOOH was determined as an indicator of peripheral oxidative stress. There was no statistical difference in the frequency of the C677T polymorphism between the TT homozygous genotype in Nw (0.19) and ObeI-III (0.25). The frequency of T allele in Nw was 0.45 and 0.51 in ObI-III group. There were no statistical differences in the consumption of vitamins B6, B9 and B12 between Nw and ObI-III groups. The LOOH showed statistical difference (p < 0.05) between Nw and ObI–III group. Oxidative stress is present in all grades of obesity although there were no differences in the vitamin consumption and the SNP C677T between Nw and ObeI–III groups. Copyright AULA MEDICA EDICIONES 2013. Published by AULA MEDICA. All rights reserved.

Influence of Methylenetetrahydrofolate Reductase C677T Polymorphism on the Risk of Lung Cancer and the Clinical Response to Platinum-Based Chemotherapy for Advanced Non-Small Cell Lung Cancer: An Updated Meta-Analysis

PubMed Central

Zhu, Ning; Gong, Yi; He, Jian; Xia, Jingwen

2013-01-01

Purpose Methylenetetrahydrofolate reductase (MTHFR) has been implicated in lung cancer risk and response to platinum-based chemotherapy in advanced non-small cell lung cancer (NSCLC). However, the results are controversial. We performed meta-analysis to investigate the effect of MTHFR C677T polymorphism on lung cancer risk and response to platinum-based chemotherapy in advanced NSCLC. Materials and Methods The databases of PubMed, Ovid, Wanfang and Chinese Biomedicine were searched for eligible studies. Nineteen studies on MTHFR C677T polymorphism and lung cancer risk and three articles on C677T polymorphism and response to platinum-based chemotherapy in advanced NSCLC, were identified. Results The results indicated that the allelic contrast, homozygous contrast and recessive model of the MTHFR C677T polymorphism were associated significantly with increased lung cancer risk. In the subgroup analysis, the C677T polymorphism was significantly correlated with an increased risk of NSCLC, with the exception of the recessive model. The dominant model and the variant T allele showed a significant association with lung cancer susceptibility of ever smokers. Male TT homozygote carriers had a higher susceptibility, but the allelic contrast and homozygote model had a protective effect in females. No relationship was observed for SCLC in any comparison model. In addition, MTHFR 677TT homozygote carriers had a better response to platinum-based chemotherapy in advanced NSCLC in the recessive model. Conclusion The MTHFR C677T polymorphism might be a genetic marker for lung cancer risk or response to platinum-based chemotherapy in advanced NSCLC. However, our results require further verification. PMID:24142642

Methylenetetrahydrofolate reductase (MTHFR) C677T and thymidylate synthase promoter (TSER) polymorphisms in Indonesian children with and without leukemia.

PubMed

Giovannetti, Elisa; Ugrasena, Dewa G; Supriyadi, Eddy; Vroling, Laura; Azzarello, Antonino; de Lange, Desiree; Peters, Godefridus J; Veerman, Anjo J P; Cloos, Jacqueline

2008-01-01

Genetic variations in the polymorphic tandem repeat sequence of the enhancer region of the thymidylate synthase promoter (TSER), as well as in methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, influence methotrexate sensitivity. We studied these polymorphisms in children with acute lymphoblastic leukaemia (ALL) and in subjects without malignancy in Indonesia and Holland. The frequencies of TT and CT genotypes were two-fold higher in Dutch children. The TSER 3R/3R repeat was three-fold more frequent in the Indonesian children, while the 2R/2R repeat was only 1% compared to 21% in the Dutch children. No differences of these polymorphisms were found between ALL cells and normal blood cells, indicating an ethnic rather than leukemic origin. These results may have implications for treatment of Indonesian children with ALL.

Association between MTHFR C677T polymorphism and abdominal aortic aneurysm risk

PubMed Central

Liu, Jie; Jia, Xin; Li, Haifeng; Jia, Senhao; Zhang, Minhong; Xu, Yongle; Du, Xin; Zhang, Nianrong; Lu, Weihang; Guo, Wei

2016-01-01

Abstract Background: Abdominal aortic aneurysm (AAA) is a life-threatening condition. A number of studies reported the association between methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and AAA risk, but substantial controversial findings were observed and the strength of the association remains unclear. Objective: The aim of this study was to investigate the aforementioned association in the overall population and different subgroups. Methods: PUBMED and EMBASE databases were searched until March 2016 to identify eligible studies, restricted to humans and articles published in English. Summary odds ratios (ORs) and 95% confidence intervals (CIs) were used to evaluate the susceptibility to AAA. Subgroup meta-analyses were conducted on features of the population, such as ethnicity, sex of the participants, and study design (source of control). Results: Twelve case–control studies on MTHFR C677T polymorphism and AAA risk, including 3555 cases and 6568 case-free controls were identified. The results revealed no significant association between the MTHFR C677T polymorphism and AAA risk in the overall population and within Caucasian or Asian subpopulations in all 5 genetic models. Further subgroup meta-analysis indicated that significantly increased risks were observed among cases with a mean age <70 years (OR = 1.73, 95% CI = 1.10–2.12, P = 0.02), cases with prevalence of smoking <60% (OR = 1.39, 95% CI = 1.02–1.90, P = 0.04), and cases with aneurysm diameter ≥55 mm (OR = 1.55, 95% CI = 1.07–2.24, P = 0.02) in the dominant genetic model. No publication bias was detected in the present study. Conclusion: In conclusion, our comprehensive meta-analysis suggests that the MTHFR C677T polymorphism may play an important role in AAA susceptibility, especially in younger, non-smoking, larger AAA-diameter subgroups of patients PMID:27603386

MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt.

PubMed

Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR=2.513, 95% CI: 0.722-4.086, P=0.025). No such association was shown for heterozygous 677CT (OR=1.010, 95% CI: 0.460-2.218, P=0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR=1.1816, 95% CI: 0.952-3.573, P=0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR=1.046, 95% CI: 0.740-1.759, P=0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR=1.849, 95% CI: 0.935-2.540, P=0.024; OR=1.915, 95% CI: 1.202-3.845, P=0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P=0.001, P=0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy.

MTHFR A1298C and C677T gene polymorphisms and susceptibility to chronic myeloid leukemia in Egypt

PubMed Central

Aly, Rabab M; Taalab, Mona M; Ghazy, Hayam F

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation. We aimed to evaluate the association between MTHFR A1298C and C677T polymorphisms and the risks of chronic myeloid leukemia (CML). Eighty-five patients with CML and a control group containing 100 healthy, age and sex matched individuals were examined for MTHFR C677T and A1298C polymorphisms using polymerase chain reaction-restriction fragment-length (PCR-RFLP) method. The frequency of 677TT genotype in patients with CML was significantly higher compared to controls (OR = 2.513, 95% CI: 0.722-4.086, P = 0.025). No such association was shown for heterozygous 677CT (OR = 1.010, 95% CI: 0.460-2.218, P = 0.981). Moreover, for A1298C genotype, a statistically significant higher frequency of 1298CC was also detected in CML patients compared to control group (OR = 1.1816, 95% CI: 0.952-3.573, P = 0.036), 0.036). No such statistical significance was demonstrable for heterozygote 1298AC (OR = 1.046, 95% CI: 0.740-1.759, P = 0.092). In addition, patients with joint 677CT/1298AC or 677TT/1298CC genotypes showed an association with increased risk of CML (OR = 1.849, 95% CI: 0.935-2.540, P = 0.024; OR = 1.915, 95% CI: 1.202-3.845, P = 0.020 respectively). .A statistically significant increased risk of resistant to therapy was observed with 677CT and 1298AC genotypes (P = 0.001, P = 0.002 respectively). We conclude that both MTHFR 677TT and 1298CC polymorphisms have been associated with risk of CML and both 677CT and 1298AC genotypes are associated with higher risk of resistant to therapy. PMID:24966971

MTHFR (C677T) polymorphism and PR (PROGINS) mutation as genetic factors for preterm delivery, fetal death and low birth weight: A Northeast Indian population based study.

PubMed

Tiwari, Diptika; Bose, Purabi Deka; Das, Somdatta; Das, Chandana Ray; Datta, Ratul; Bose, Sujoy

2015-02-01

Preterm delivery (PTD) is one of the most significant contributors to neonatal mortality, morbidity, and long-term adverse consequences for health; with highest prevalence reported from India. The incidence of PTD is alarmingly very high in Northeast India. The objective of the present study is to evaluate the associative role of MTHFR gene polymorphism and progesterone receptor (PR) gene mutation (PROGINS) in susceptibility to PTD, negative pregnancy outcome and low birth weights (LBW) in Northeast Indian population. A total of 209 PTD cases {extreme preterm (< 28 weeks of gestation, n = 22), very preterm (28-32 weeks of gestation, n = 43) and moderate preterm (32-37 weeks of gestation, n = 144) and 194 term delivery cases were studied for MTHFR C677T polymorphism and PR (PROGINS) gene mutation. Statistical analysis was performed using SPSS software. Distribution of MTHFR and PR mutation was higher in PTD cases. Presence of MTHFR C677T polymorphism was significantly associated and resulted in the increased risk of PTD (p < 0.001), negative pregnancy outcome (p < 0.001) and LBW (p = 0.001); more significantly in extreme and very preterm cases. Presence of PR mutation (PROGINS) also resulted in increased risk of PTD and negative pregnancy outcome; but importantly was found to increase the risk of LBW significantly in case of very preterm (p < 0.001) and moderately preterm (p < 0.001) delivery cases. Both MTHFR C677T polymorphism and PR (PROGINS) mutation are evident genetic risk factors associated with the susceptibility of PTD, negative pregnancy outcome and LBW. MTHFR C677T may be used as a prognostic marker to stratify subpopulation of pregnancy cases predisposed to PTD; thereby controlling the risks associated with PTD.

Methylenetetrahydrofolate reductase (MTHFR) gene 677C>T and 1298A>C polymorphisms are associated with differential apoptosis of leukemic B cells in vitro and disease progression in chronic lymphocytic leukemia.

PubMed

Nückel, H; Frey, U H; Dürig, J; Dührsen, U; Siffert, W

2004-11-01

Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. We investigated whether the two genetic MTHFR polymorphisms (677C>T and 1298A>C) are associated with an increased risk for chronic lymphocytic leukemia (CLL) or may predict disease progression. Moreover, we measured potential genotype effects on apoptosis of B-CLL cells.Allele frequencies and genotype distributions for both polymorphisms were not significantly different in 111 patients vs 92 healthy controls. While progression-free survival (PFS) was not significantly different in individuals with CLL including all stages, in patients with Binet stage A PFS was significantly longer in patients displaying the MTHFR 677CC (P=0.043) and the MTHFR 1298A/C or CC genotypes (P=0.019). In a multivariate analysis, MTHFR haplotype (677CC plus 1298CC or A/C) was the best independent prognostic factor for PFS compared with other known prognostic factors. Spontaneous apoptosis of B-CLL cells in vitro was significantly increased in the favorable risk group with MTHFR 677CC and MTHFR 1298AC, which may constitute the cellular basis of the observed associations. While MTHFR polymorphisms do not affect the risk for B-CLL, they may be independent prognostic markers that influence the PFS in patients with early-stage B-CLL.

The association between MTHFR gene C677T polymorphism and ALL risk based on a meta-analysis involving 17,469 subjects.

PubMed

Zhang, Beibei; Zhang, Weiming; Yan, Liang; Wang, Daogang

2017-03-01

The methylenetetrahydrofolate reductase (MTHFR) gene C677T polymorphism is closely related to the acute lymphoblastic leukaemia (ALL) indicated by many previous epidemiologic studies. However, their conclusions were still conflicting. Our aim is to evaluate their associations using a more comprehensive updated meta-analysis. Electronic searches were conducted to select published studies prior to February, 2016. Totally, 39 case-control studies including 6551 ALL cases and 10,918 controls were selected in current meta-analysis. The association was detected significantly between MTHFR C677T polymorphism and ALL reducing susceptibility. Our results indicate that the MTHFR C677T polymorphism may be a promising ALL biomarker and studies to explore the protein levels of the variants and their functional role are required for the definitive conclusions. Copyright © 2017 Elsevier B.V. All rights reserved.

A literature review of MTHFR (C677T and A1298C polymorphisms) and cancer risk.

PubMed

Izmirli, Muzeyyen

2013-01-01

5,10-Methlenetetrahydrofolate reductase (MTHFR) is one of the most important enzymes for folate metabolism. This enzyme is mapped on chromosome 1, which is located at the end of the short arm (1p36.3). The C677T and A1298C are MTHFR polymorphisms that decrease in vitro MTHFR enzyme activity. Folate metabolism plays a key role in cell metabolism. These reactions are associated with purine-pyrimidine synthesis: DNA, RNA, and protein methylation. Polymorphism is also a factor in biodiversity, and be affected by ethnic heritage and geographic locale. In the case of unknown outcomes, not only should all geographical regions be investigated to ascertain biodiversity, but all populations as well to fully understand the variations in the effect. PUBMED was searched from January 2006 to December 2011 to develop an investigatory pursuit strategy. MTHFR, cancer, C677T, A1298C, and polymorphisms were key words used to focus the search. The literature review included all published relevant cancer types and MTHFR polymorphisms for that 5 years period. All selected polymorphisms data for cancer types was listed in tables for easy access and retrieval.

Association between C677T and A1298C polymorphisms of the MTHFR gene and risk of male infertility: a meta-analysis.

PubMed

Yang, Y; Luo, Y Y; Wu, S; Tang, Y D; Rao, X D; Xiong, L; Tan, M; Deng, M Z; Liu, H

2016-04-26

Published studies on the association between the C677T and A1298C polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene and male infertility risk are controversial. To obtain a more precise evaluation, we performed a meta-analysis based on published case-control studies. We conducted an electronic search of PubMed, EMBASE, the Cochrane Library, the Web of Science, and the China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and male infertility risk. Pooled odds ratios (ORs) with 95% confidence intervals (95%CIs) were used to assess the strength of association in homozygote, heterozygote, dominant, recessive, and additive models. Statistical heterogeneity, test of publication bias, and sensitivity analysis were carried out using the STATA software (Version 13.0). Overall, 21 studies of C677T (4505 cases and 4024 controls) and 13 studies of A1298C (2785 cases and 3094 controls) were included in this meta-analysis. For C677T, the homozygote comparison results were OR = 1.629, 95%CI (1.215- 2.184), and the recessive model results were OR = 1.462 (1.155- 1.850). For A1298C, the homozygote comparison results were OR = 1.289 (1.029-1.616), and the recessive model results were OR = 1.288 (1.034-1.604). In conclusion, the current meta-analysis showed that the MTHFR C677T polymorphism was associated with a significantly increased male infertility risk in the Asian and overall populations, but not in the Caucasian population, and there was a significant association between the A1298C polymorphism and male infertility risk in the Asian, Caucasian, and overall groups.

Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

PubMed

Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

2016-04-01

Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

MTHFR C677T polymorphism, homocysteine and B-vitamins status in a sample of Chinese and Malay subjects in Universiti Putra Malaysia.

PubMed

Choo, S C; Loh, S P; Khor, G L; Sabariah, M N; Rozita, R

2011-08-01

Methylenetetrahydrofolate reductase (MTHFR) C677T is involved in folate and homocysteine metabolism. Disruption in the activity of this enzyme will alter their levels in the body. This study assessed MTHFR C677T polymorphism and its relationship with serum homocysteine and B-vitamins levels in a sample of Chinese and Malays subjects in UPM, Serdang. One hundred subjects were randomly selected from among the university population. Folate, vitamin B12, B6, and homocysteine levels were determined using MBA, ECLIA, and HPLC, respectively. PCR coupled with HinfI digestion was used for detection of MTHFR C677T polymorphism. The frequency of T allele was higher in the Chinese subjects (0.40) compared to the Malay (0.14). Folate, vitamin B12 and B6 levels were highest in the wild genotype in both ethnic groups. Subjects with heterozygous and homozygous genotype showed the highest homocysteine levels. The serum folate and homocysteine were mainly affected by homozygous genotype. MTHFR C677T polymorphism plays an important role in influencing the folate and homocysteine metabolism.

Lack of association between MTHFR C677T and A1298C polymorphisms and risk of childhood acute lymphoblastic leukemia in the Kurdish population from Western Iran.

PubMed

Azhar, Mohammad-Reza; Rahimi, Zohreh; Vaisi-Raygani, Asad; Akramipour, Reza; Madani, Hamid; Rahimi, Ziba; Parsian, Abbas

2012-03-01

Polymorphism in genes involved in folate metabolism may influence the susceptibility to acute lymphoblastic leukemia (ALL). The aim of the present study was to determine the role of the two most common polymorphisms of the 5, 10-methylenetetrahydrofolate reductase (MTHFR) gene, MTHFR C677T and A1298C, and their interaction on the susceptibility to ALL. Seventy-two children with ALL and 109 age- and sex-matched healthy children from Western Iran were screened for MTHFR C677T and A1298C variants by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The frequencies of MTHFR 677T and 1298C alleles in patients were 29.9% and 43.1%, respectively, that were higher than those in controls (24.8% and 38.1%, respectively). Logistic regression analysis was performed and its result in the odds ratios (ORs) for possession of either MTHFR 677T or 1298C allele was found to be 1.98 [95% confidence interval (CI) 0.72-5.4, p = 0.18] and 1.48 (95% CI 0.59-3.69, p = 0.4), respectively. Also the concomitant presence of both MTHFR 677T and 1298C alleles was not associated with the risk of ALL [OR = 2.12 (95% CI 0.8-5.7, p = 0.13)]. Our results in a homogenous population with Kurdish ethnic background indicated that neither the MTHFR 677T allele nor the MTHFR 1298C allele is associated with increased risk of ALL.

The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population.

PubMed

Nowak, Izabela; Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

2017-01-01

Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms' association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms.

The methylenetetrahydrofolate reductase c.c.677 C>T and c.c.1298 A>C polymorphisms in reproductive failures: Experience from an RSA and RIF study on a Polish population

PubMed Central

Bylińska, Aleksandra; Wilczyńska, Karolina; Wiśniewski, Andrzej; Malinowski, Andrzej; Wilczyński, Jacek R.; Radwan, Paweł; Radwan, Michał; Barcz, Ewa; Płoski, Rafał; Motak-Pochrzęst, Hanna; Banasik, Małgorzata; Sobczyński, Maciej; Kuśnierczyk, Piotr

2017-01-01

Almost 1600 individuals from the Polish population were recruited to this study. Among them 319 were fertile couples, 289 were recurrent spontaneous abortion (RSA) couples, and 131 were in the group of recurrent implantation failure (RIF) following in vitro fertilization. The aim of this study was to evaluate the MTHFR c.c.677 C>T and c.c.1298 A>C polymorphisms’ association with RSA and RIF. We used PCR-RFLP with HinfI (677 C>T) and MboII (1298 A>C) digestion. We observed a protective effect of the female AC genotype (OR = 0.64, p = 0.01) and the C allele (AC+CC genotypes; OR = 0.65, p = 0.009) against RSA. Moreover, 1298 AA/677 CT women were more frequent in RSA (31.14%) and RIF (25.20%) groups in comparison to fertile women (22.88%), although this difference was significant only in the case of RSA (p = 0.022, OR = 1.52). Male combined genotype analysis revealed no association with reproductive failure of their partners. Nevertheless, the female/male combination AA/AC of the 1298 polymorphism was more frequent in RSA couples (p = 0.049, OR = 1.49). However, the significant results became insignificant after Bonferroni correction. In addition, analysis of haplotypes showed significantly higher frequency of the C/C haplotype (1298 C/677 C) in the female control group than in the female RSA group (p = 0.03, OR = 0.77). Moreover, the association between elevated homocysteine (Hcy) level in plasma of RSA and RIF women and MTHFR polymorphisms was investigated but did not reveal significant differences. In conclusion, for clinical practice, it is better to check the homocysteine level in plasma and, if the Hcy level is increased, to recommend patients to take folic acid supplements rather than undergo screening of MTHFR for 1298 A>C and 677 C>T polymorphisms. PMID:29073227

Methylenetetrahydrofolate reductase C677T polymorphism: association with risk for childhood acute lymphoblastic leukemia and response during the initial phase of chemotherapy in greek patients.

PubMed

Chatzidakis, Konstantinos; Goulas, Antonis; Athanassiadou-Piperopoulou, Fani; Fidani, Liana; Koliouskas, Dimitrios; Mirtsou, Vassiliki

2006-08-01

As of late, a number of studies have focused on the association of the gene for methyletetrahydrofolate reductase (MTHFR) with risk for acute lymphoblastic leukemia (ALL) in children and in adults, as well as with response to chemotherapy. The degree of this association may vary according to the ethnic background and geographic localization of the population under study, or the phase of treatment when response to chemotherapy is concerned. We have analyzed the MTHFR C677T polymorphism in 52 patients and 88 control individuals, all ethnic Greek residents of northern Greece, and examined the association of this polymorphism with (a) susceptibility to childhood ALL and (b) the distribution of average plasma alanine aminotransferase (ALT) levels, white blood cell counts (WBC), and hemoglobin levels (Hb) during the induction and consolidation phases of treatment. We were able to detect a statistically significant protective effect, with respect to ALL, associated with carriage of the MTHFR 677T allele [OR = 0.387 (95% CI = 0.193-0.776)]. In addition, we observed a general tendency towards lower values in all three parameters studied, associated with the MTHFR 677CC genotype, which was more evident in the transition from the induction to the consolidation phase, indicating that MTHFR genotyping may be of prognostic value in the early phase of treatment for childhood ALL, in our population.

Association between maternal, fetal and paternal MTHFR gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss: a comprehensive evaluation.

PubMed

Yang, Yi; Luo, Yunyao; Yuan, Jing; Tang, Yidan; Xiong, Lang; Xu, MangMang; Rao, XuDong; Liu, Hao

2016-06-01

Numerous studies have investigated the associations between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms and risk of recurrent pregnancy loss (RPL); however, the results remain controversial. The aim of this study is to drive a more precise estimation of association between MTHFR gene polymorphisms and risk of RPL. We searched PubMed, EMBASE, Cochrane library, Web of Science and China Knowledge Resource Integrated Database for papers on MTHFR gene C677T and A1298C polymorphisms and RPL risk. The pooled odds ratios (ORs) with 95 % confidence intervals (CIs) were used to assess the strength of association in the homozygous model, heterozygous model, dominant model, recessive model and an additive model. The software STATA (Version 13.0) was used for statistical analysis. Overall, 57 articles were included in the final meta-analysis. In maternal group the MTHFR C677T polymorphism showed pooled odds ratios for the homozygous comparison [OR = 2.285, 95 % CI (1.702, 3.067)] and the MTHFR A1298C polymorphism showed pooled odds ratios for recessive model [OR = 1.594, 95 % CI (1.136, 2.238)]. In fetal group the MTHFR C677T polymorphism showed pooled odds ratios for dominant model [OR = 1.037, 95 % CI (0.567, 1.894)] and the MTHFR A1298C polymorphism showed pooled odds ratios for dominant model [OR = 1.495, 95 % CI (1.102, 2.026)]. In summary, the results of our meta-analysis indicate that maternal and paternal MTHFR gene C677T and A1298C polymorphisms are associated with RPL. We also observed a significant association between fetal MTHFR A1298C polymorphism and RPL but not C677T.

Association between MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: a meta-analysis based on 51 case-control studies.

PubMed

Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

2015-03-12

Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79-1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80-1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84-1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73-1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81-1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility.

Additive Interaction of MTHFR C677T and MTRR A66G Polymorphisms with Being Overweight/Obesity on the Risk of Type 2 Diabetes.

PubMed

Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Li, Yongfang; He, Miao; Wang, Da; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

2016-12-15

Although both methylenetetrahydrofolate reductase ( MTHFR ) C677T and methionine synthase reductase ( MTRR ) A66G polymorphisms have been associated with type 2 diabetes (T2D), their interactions with being overweight/obesity on T2D risk remain unclear. To evaluate the associations of the two polymorphisms with T2D and their interactions with being overweight/obesity on T2D risk, a case-control study of 180 T2D patients and 350 healthy controls was conducted in northern China. Additive interaction was estimated using relative excess risk due to interaction (RERI), attributable proportion due to interaction (AP) and synergy index (S). After adjustments for age and gender, borderline significant associations of the MTHFR C677T and MTRR A66G polymorphisms with T2D were observed under recessive (OR = 1.43, 95% CI: 0.98-2.10) and dominant (OR = 1.43, 95% CI: 1.00-2.06) models, respectively. There was a significant interaction between the MTHFR 677TT genotype and being overweight/obesity on T2D risk (AP = 0.404, 95% CI: 0.047-0.761), in addition to the MTRR 66AG/GG genotypes (RERI = 1.703, 95% CI: 0.401-3.004; AP = 0.528, 95% CI: 0.223-0.834). Our findings suggest that individuals with the MTHFR 677TT or MTRR 66AG/GG genotypes are more susceptible to the detrimental effect of being overweight/obesity on T2D. Further large-scale studies are still needed to confirm our findings.

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population.

PubMed

Romero-Sánchez, Consuelo; Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics(®)). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies.

A meta-analysis of MTHFR C677T and A1298C polymorphisms and risk of acute lymphoblastic leukemia in children.

PubMed

Yan, Jingrong; Yin, Ming; Dreyer, ZoAnn E; Scheurer, Michael E; Kamdar, Kala; Wei, Qingyi; Okcu, M Fatih

2012-04-01

Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms have been implicated in childhood acute lymphoblastic leukemia (ALL) risk, but previously published studies were inconsistent and recent meta-analyses were not adequate. In a meta-analysis of 21 publications with 4,706 cases and 7,414 controls, we used more stringent inclusion method and summarized data on associations between MTHFR C677T and A1298C polymorphisms and childhood ALL risk. We found an overall association between 677T variant genotypes and reduced childhood ALL risk. Specifically, in the dominant genetic model, an association was found in a fixed-effect (TT + CT vs. CC: OR = 0.92; 95% CI = 0.85-0.99) but not random-effect model, whereas such an association was observed in both homozygote genetic model (TT vs. CC: OR = 0.80; 95% CI = 0.70-0.93 by fixed effects and OR = 0.78; 95% CI = 0.65-0.93 by random effects) and recessive genetic model (TT vs. CC + CT: OR = 0.83; 95% CI = 0.72-0.95 by fixed effects and OR = 0.84; 95% CI = 0.73-0.97 by random effects). These associations were also observed in subgroups by ethnicity: for Asians in all models except for the dominant genetic model by random effect and for Caucasians in all models except for the recessive genetic model. However, the A1298C polymorphism did not appear to have an effect on childhood ALL risk. These results suggest that the MTHFR C677T, but not A1298C, polymorphism is a potential biomarker for childhood ALL risk. Copyright © 2011 Wiley Periodicals, Inc.

MTHFR 677C --> T genotype disrupts prefrontal function in schizophrenia through an interaction with COMT 158Val --> Met.

PubMed

Roffman, Joshua L; Gollub, Randy L; Calhoun, Vince D; Wassink, Thomas H; Weiss, Anthony P; Ho, Beng C; White, Tonya; Clark, Vincent P; Fries, Jill; Andreasen, Nancy C; Goff, Donald C; Manoach, Dara S

2008-11-11

Understanding how risk genes cumulatively impair brain function in schizophrenia could provide critical insights into its pathophysiology. Working memory impairment in schizophrenia has been associated with abnormal dopamine signaling in the prefrontal cortex, which is likely under complex genetic control. The catechol-O-methyltransferase (COMT) 158Val --> Met polymorphism (rs4680), which affects the availability of prefrontal dopamine signaling, consistently stratifies prefrontal activation during working memory performance. However, the low-dopamine COMT 158Val allele does not confer increased risk for schizophrenia, and its effects on prefrontal function are not specific to the disorder. In the setting of other genetic variants influencing prefrontal dopamine signaling, COMT 158Val --> Met genotype may exert disease-specific effects. A second polymorphism, methylenetetrahydrofolate reductase (MTHFR) 677C --> T (rs1801133), has been associated with overall schizophrenia risk and executive function impairment in patients, and may influence dopamine signaling through mechanisms upstream of COMT effects. We found that the hypofunctional 677T variant was associated with decreased working memory load-dependent activation in the prefrontal and insular cortices in 79 schizophrenia patients, but not in 75 demographically matched healthy controls. Further, significant MTHFR x COMT genotype interactions were observed, which differed by diagnostic group: Reduced prefrontal activation was associated with the 677T and 158Val alleles in patients, but with 677C/C and 158Met/Met genotype in controls. These findings are consistent with epistatic effects of the COMT and MTHFR polymorphisms on prefrontal dopamine signaling, and suggest that in schizophrenia patients, the MTHFR 677T allele exacerbates prefrontal dopamine deficiency. The findings also suggest the importance of weighing COMT effects on prefrontal function within the context of MTHFR genotype.

[C677T-SNP of methylenetetrahydrofolate reductase gene and breast cancer in Mexican women].

PubMed

Calderón-Garcidueñas, Ana Laura; Cerda-Flores, Ricardo Martín; Castruita-Ávila, Ana Lilia; González-Guerrero, Juan Francisco; Barrera-Saldaña, Hugo Alberto

2017-01-01

Low-penetrance susceptibility genes such as 5,10-methylenetetrahydrofolate reductase gene (MTHFR) have been considered in the progression of breast cancer (BC). Cancer is a result of genetic, environmental and epigenetic interactions; therefore, these genes should be studied in environmental context, because the results can vary between populations and even within the same country. The objective was to analyze the allelic and genotypic frequencies of the MTHFR C667T SNP in Mexican Mestizo patients with BC and controls from Northeastern Mexico. 243 patients and 118 healthy women were studied. The analysis of the polymorphism was performed with a DNA microarray. Once the frequency of the polymorphism was obtained, Hardy-Weinberg equilibrium test was carried out for the genotypes. Chi square test was used to compare the distribution of frequencies. The allele frequency in patients was: C = 0.5406; T = 0.4594 and in controls C = 0.5678, T = 0.4322. Genotype in BC patients was: C / C = 29.9%, C / T = 48.3% and T / T = 21.8. The distribution in controls was: C / C = 31.4%, C / T = 50.8%, T / T = 17.8% (chi squared 0.77, p = 0.6801). Northeastern Mexican women in this study showed no association between MTFHR C667T SNP and the risk of BC. It seems that the contribution of this polymorphism to BC in Mexico varies depending on various factors, both genetic and environmental.

Association between MTHFR C677T Polymorphism and Risk of Acute Lymphoblastic Leukemia: A Meta-Analysis Based on 51 Case-Control Studies

PubMed Central

Li, Su-yi; Ye, Jie-yu; Liang, En-yu; Zhou, Li-xia; Yang, Mo

2015-01-01

Background Studies and systematic reviews have reached inconsistent conclusions on the role of 5, 10-methylenetetrahydrofolate reductase (MTHFR) polymorphism C677T in acute lymphoblastic leukemia (ALL) risk. Material/Methods The present meta-analysis comprising of 51 case-control studies, including 7892 cases and 14 280 controls was performed to reevaluate the association between MTHFR C677T polymorphism and ALL risk. Results Statistical differences were found in the dominant model (TT+CT vs. CC, odd ratio (OR)=0.89, 95% CI, 0.79–1.00, P=0.04) and the CT vs. CC (OR=0.89, 95% CI, 0.80–1.00, P=0.05), but not in the allele contrast model (T vs. C, OR=0.92, 95% CI, 0.84–1.01, P=0.08), additive model (TT vs. CC, OR=0.87, 95% CI, 0.73–1.05, P=0.15), or recessive model (TT vs. CT+CC, OR=0.94, 95% CI, 0.81–1.10, P=0.44) in overall populations. In the subgroup analyses stratified by age (children and adults) and ethnicity (Asian and Caucasian), no significant associations between MTHFR C677T polymorphism and ALL risk were observed. Conclusions The current study found no sufficient evidence of a protective role of MTHFR C677T polymorphism in ALL susceptibility. PMID:25761797

COMT Val158Met and MTHFR C677T moderate risk of schizophrenia in response to childhood adversity.

PubMed

Debost, J-C; Debost, M; Grove, J; Mors, O; Hougaard, D M; Børglum, A D; Mortensen, P B; Petersen, L

2017-07-01

Mesolimbic dopamine sensitization has been hypothesized to be a mediating factor of childhood adversity (CA) on schizophrenia risk. Activity of catechol-O-methyltransferase (COMT) Val158Met increases mesolimbic dopamine signaling and may be further regulated by methylenetetrahydrofolate reductase (MTHFR) C677T. This study investigates the three-way interaction between CA, COMT, and MTHFR. We conducted a nested case-control study on individuals born after 1981, linking population-based registers to study the three-way interaction. We included 1699 schizophrenia cases and 1681 controls, and used conditional logistic regression to report incidence rate ratios (IRRs). Childhood adversity was robustly associated with schizophrenia. No main genetic effects were observed. MTHFR C677T increased schizophrenia risk in a dose-dependent manner per MTHFR T allele (P = 0.005) consequent upon CA exposure. After inclusion of the significant (P = 0.03) COMT × MTHFR × CA interaction, the risk was further increased per high-activity COMT Val allele. Hence, exposed COMT Val/Val and MTHFR T/T carriers had an IRR of 2.76 (95% CI, 1.66-4.61). Additional adjustments for ancestry and parental history of mental illness attenuated the results with the interaction being only marginally significant. MTHFR C677T and COMT Val158Met interact with CA to increase risk of schizophrenia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

C677T (RS1801133 ) MTHFR gene polymorphism frequency in a colombian population

PubMed Central

Gómez-Gutierrez, Alberto; Gómez, Piedad Elena; Casas-Gomez, Maria Consuelo; Briceño, Ignacio

2015-01-01

Introduction: Abnormal levels of the enzyme methylenetetrahydrofolate reductase (MTHFR) are associated with an increased risk of both cardiovascular and cerebrovascular disease and higher concentrations of homocysteine. Abnormal levels are also related to birth defects, pregnancy complications, cancer and toxicity to methotrexate (MTX). Polymorphisms of MTHFR affect the activity of the enzyme. Genetic associations have been related to treatment efficacy. Objective: To establish the frequency of the C> T polymorphism at nucleotide 677 of the MTHFR gene in a group of Colombian individuals. Methods: Data from pharmacogenetic microarrays that include MTX sensibility-associated polymorphisms were retrospectively collected (Pathway Genomics®). The frequency of the C> T MTHFR rs1801133 marker polymorphism was analyzed. Results: Microarray data from 68 men and 84 women were analyzed. Comparisons of genotype C/C vs. C/T and T/T were statistically significantly different (p= 0.00, p= 0.026, respectively), as were C/T and T / T (p= 0.0001). Conclusions: Results for the C/C and C/T genotypes in a Colombian population are similar to other previously studied groups of healthy subjects. Subjects from our population might be at risk of developing diseases associated with MTHFR polymorphisms and might present toxicity and adverse effects if treated with MTX, which suggests the need to evaluate therapeutic alternatives based on individual pharmacogenetic studies. PMID:26309343

Methylenetetrahydrofolate Reductase Gene Polymorphisms (C677T and A1298C) and Hemorrhagic Stroke in Moroccan Patients.

PubMed

Abidi, Omar; Haissam, Mohammed; Nahili, Halima; El Azhari, Abdessamad; Hilmani, Said; Barakat, Abdelhamid

2018-07-01

The number of deaths from hemorrhagic strokes is about twice as high than the number of deaths from ischemic strokes. Genetic risk assessment could play important roles in preventive and therapeutic strategies. The present study was aimed to evaluate whether the MTHFR gene polymorphisms could increase the risk of cerebral hemorrhage in Moroccan patients. A total of 113 patients with hemorrhagic stroke and 323 healthy controls were included in this case-control study. The C677T (rs1801133) and A1298C (rs1801131) MTHFR gene polymorphisms were genotyped by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method in all patients and controls. The genotype and allele frequencies were compared between groups using appropriate statistical analyses. Both groups, patients and controls, were in accordance with the Hardy-Weinberg Equilibrium. For the C677T polymorphism, the frequencies of the CC, CT, and TT genotypes were 50.44% versus 46.13%, 39.82% versus 43.03, and 9.73% versus 10.84% in controls versus patients, respectively, whereas for the A1298C polymorphism, the frequencies of the AA, AC, and CC genotypes were 56.64% versus 57.59%, 40.71% versus 37.15, and 2.65% versus 5.26% in controls versus patients, respectively. No statistically significant difference has been proved between patients and controls frequencies (P >.05) for all additive, recessive, and dominant models. Additional analyses including genotypes combination, allelic frequencies, and hemorrhagic stroke patient subtypes did not show any statistically significant difference between controls and patients/subgroup patients. Our findings suggested no association between MTHFR gene polymorphisms and susceptibility to hemorrhagic strokes in Moroccan patients. Further investigations should be conducted to elucidate the roles of other gene variants in the pathogenesis of this condition. Copyright © 2018 National Stroke Association. Published by Elsevier Inc. All rights reserved.

Molecular genetic analysis in mild hyperhomocysteinemia: A common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kluijtmans, L.A.J.; Heuvel, L.P.W.J. van den; Stevens, E.M.B.

1996-01-01

Mild hyperhomocysteinemia is an established risk factor for cardiovascular disease. Genetic aberrations in the cystathionine P-synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) genes may account for reduced enzyme activities and elevated plasma homocysteine levels. In 15 unrelated Dutch patients with homozygous CBS deficiency, we observed the 833T{yields}C (1278T) mutation in 50% of the alleles. Very recently, we identified a common mutation (677C{yields}T; A{yields}V) in the MTHFR gene, which, in homozygous state, is responsible for the thermolabile phenotype and which is associated with decreased specific MTHFR activity and elevated homocysteine levels. We screened 60 cardiovascular patients and 111 controls for these twomore » mutations, to determine whether these mutations are risk factors for premature cardiovascular disease. Heterozygosity for the 833T{yields}C mutation in the CBS gene was observed in one individual of the control group but was absent in patients with premature cardiovascular disease. Homozygosity for the 677C-{yields}T mutation in the MTHFR gene was found in 9 (15%) of 60 cardiovascular patients and in only 6 ({approximately}5%) of 111 control individuals (odds ratio 3.1 [95% confidence interval 1.0-9.21]). Because of both the high prevalence of the 833T-{yields}C mutation among homozygotes for CBS deficiency and its absence in 60 cardiovascular patients, we may conclude that heterozygosity for CBS deficiency does not appear to be involved in premature cardiovascular disease. However, a frequent homozygous mutation in the MTHFR gene is associated with a threefold increase in risk for premature cardiovascular disease. 35 refs., 3 figs., 1 tab.« less

The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

PubMed

Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

2011-01-01

Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

MTHFR 677C>T Polymorphism and the Risk of Breast Cancer: Evidence from an Original Study and Pooled Data for 28031 Cases and 31880 Controls

PubMed Central

Sekhar, Deepa; Francis, Amirtharaj; Gupta, Nishi; Konwar, Rituraj; Kumar, Sandeep; Kumar, Surender; Thangaraj, Kumarasamy; Rajender, Singh

2015-01-01

Background Methylenetetrahydrofolate reductase (MTHFR) acts at an important metabolic point in the regulation of cellular methylation reaction. It assists in the conversion of 5, 10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. The latter aids in remethylation of homocysteine to de novo methionine that is required for DNA synthesis. The objective of this study was to examine the effect of MTHFR 677 C>T polymorphism on the risk of breast cancer in the Indian sub-continent. Methods and Results We genotyped 677 C>T locus in 1096 individuals that were classified into cases (N=588) and controls (N=508). Genotype data were analyzed using chi-square test. No significant difference was observed in the distribution of genotypes between cases and controls in north Indian (P = 0.932), south Indian (P = 0.865), and pooled data (P = 0.680). To develop a consensus regarding the impact of 677C>T polymorphism on breast cancer risk, we also conducted a meta-analysis on 28031 cases and 31880 controls that were pooled from sixty one studies. The overall summary estimate upon meta-analysis suggested no significant correlation between the 677C>T substitution and breast cancer in the dominant model (Fixed effect model: OR = 0.97, P=0.072, Random effects model: OR = 0.96, P = 0.084) or the recessive model (Fixed effect model: OR = 1.05, P = 0.089; Random effects model: OR= 1.08, P= 0.067). Conclusion 677 C>T substitution does not affect breast cancer risk in the Indo-European and Dravidian populations of India. Analysis on pooled data further ruled out association between the 677 C>T polymorphism and breast cancer. Therefore, 677 C>T substitution does not appear to influence the risk of breast cancer. PMID:25803740

Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

USDA-ARS?s Scientific Manuscript database

To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

Folate intake and the MTHFR C677T genotype influence choline status in young Mexican American women☆

PubMed Central

Abratte, Christian M.; Wang, Wei; Li, Rui; Moriarty, David J.; Caudill, Marie A.

2009-01-01

Numerous studies have reported a relationship between folate status, the methylenetetrahydrofolate reductase (MTHFR) 677C→T variant and disease risk. Although folate and choline metabolism are inter-related, only limited data are available on the relationship between choline and folate status in humans. This study sought to examine the influences of folate intake and the MTHFR 677C→T variant on choline status. Mexican-American women (n =43; 14 CC, 12 CT and 17 TT) consumed 135 μg/day as dietary folate equivalents (DFE) for 7 weeks followed by randomization to 400 or 800 μg DFE/day for 7 weeks. Throughout the study, total choline intake remained unchanged at ∼350 mg/day. Plasma concentrations of betaine, choline, glycerophosphocholine, phosphatidylcholine and sphingomyelin were measured via LC-MS/MS for Weeks 0, 7 and 14. Phosphatidylcholine and sphingomyelin declined ( P=.001, P=.009, respectively) in response to folate restriction and increased ( P=.08, P=.029, respectively) in response to folate treatment. The increase in phosphatidylcholine occurred in response to 800 ( P=.03) not 400 ( P=.85) μg DFE/day (week×folate interaction, P=.017). The response of phosphatidylcholine to folate intake appeared to be influenced by MTHFR C677T genotype. The decline in phosphatidylcholine during folate restriction occurred primarily in women with the CC or CT genotype and not in the TT genotype (week×genotype interaction, P=.089). Moreover, when examined independent of folate status, phosphatidylcholine was higher ( P <.05) in the TT genotype relative to the CT genotype. These data suggest that folate intake and the MTHFR C677T genotype influence choline status in humans. PMID:17588738

The MTHFR C677T polymorphism and risk of acute lymphoblastic leukemia: an updated meta-analysis based on 37 case-control studies.

PubMed

Jiang, Yuan; Hou, Jing; Zhang, Qiang; Jia, Shu-Ting; Wang, Bo-Yuan; Zhang, Ji-Hong; Tang, Wen-Ru; Luo, Ying

2013-01-01

The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) has been associated with acute lymphoblastic leukemia (ALL). However, results were conflicting. The aim of this study was to quantitatively summarize the evidence for the MTHFRC677T polymorphism and ALL risk. Electronic searches of PubMed and the Chinese Biomedicine database were conducted to select case-control studies containing available genotype frequencies of C677T and the odds ratio (OR) with 95% confidence interval (CI) was used to assess the strength of any association. Case-control studies including 6,371 cases and 10,850 controls were identified. The meta-analysis stratified by ethnicity showed that individuals with the homozygous TT genotype had decreased risk of ALL (OR= 0.776, 95% CI: 0.687~0.877, p< 0.001) in Caucasians (OR= 0.715, 95% CI: 0.655~0.781, p= 0.000). However, results among Asians (OR=0.711, 95% CI: 0.591~1.005, p= 0.055) and others (OR=0.913, 95% CI: 0.656~1.271, p= 0. 590) did not suggest an association. A symmetric funnel plot, the Egger's test (P=0.093), and the Begg- test (P=0.072) were all suggestive of the lack of publication bias. This meta-analysis supports the idea that the MTHFR C677T genotype is associated with risk of ALL in Caucasians. To draw comprehensive and true conclusions, further prospective studies with larger numbers of participants worldwide are needed to examine associations between the MTHFRC677T polymorphism and ALL.

Association of the methylenetetrahydrofolate reductase polymorphism in Korean patients with childhood acute lymphoblastic leukemia.

PubMed

Kim, Nam Keun; Chong, So Young; Jang, Moon Ju; Hong, Seung Ho; Kim, Heung Sik; Cho, Eun Kyung; Lee, Jung Ae; Ahn, Myung Ju; Kim, Chul Soo; Oh, Doyeun

2006-01-01

Methylenetetrahydrofolate reductase plays a central role in converting folate to methyl donor for DNA methylation. Recently, methylenetetrahydrofolate reductase (MTHFR C677T and A1298C) mutations were discovered to be associated with childhood acute lymphoblastic leukemia (ALL), as well as colon cancer, lymphoma, esophageal and stomach cancer. Therefore, it was hypothesized that the MTHFR polymorphisms are associated with the risk of childhood ALL in the Korean population. DNA samples taken from 66 patients with ALL and 100 age-matched controls were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay for detection of MTHFR C677T and A1298C mutations. The frequency of the AC genotype for MTHFR A1298C polymorphism was significantly different between the controls and the cases (OR, 2.22; CI, 95% 1.09-4.51, p=0.03). The 1298AC+CC genotype was also significantly different (OR, 2.11; 95% CI, 1.06-4.22; p=0.049). There was, however, no significant difference for MTHFR C677T polymorphism and combined genotype frequencies between the two groups. Although no consistent results on associations between MTHFR A 1298C polymorphism and ALL in the populations studied were obtained, the A1298C polymorphism, at least in Koreans, may be a genetic determinant among childhood ALL patients.

Evaluation of Factor V Leiden, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C gene polymorphisms in retinopathy of prematurity in a Turkish cohort.

PubMed

Aydin, Hatip; Gunay, Murat; Celik, Gokhan; Gunay, Betul Onal; Aydin, Umeyye Taka; Karaman, Ali

2016-12-01

To assess Factor V Leiden (FVL) (rs6025), Prothrombin G20210A (rs1799963), MTHFR C677T (rs1801133), and MTHFR A1298C (rs1801131) gene mutations as risk factors in the development of retinopathy of prematurity (ROP). A total of 105 children were included in this cross-sectional study. Patients were divided into two groups. The study group consisted of 55 infants with a history of ROP and the control group comprised 50 healthy infants with term birth. All subjects were screened for the presence of certain mutations (FVL, Prothrombin G20210A, MTHFR C677T and MTHFR A1298C) by Real-Time PCR at 1 year of age. The mean gestational age (GA) and birth weight (BW) of the study group were, 28.65 ± 2.85 weeks and 1171 ± 385.74 g, respectively. There were no significant differences of genotype and allele frequency of Prothrombin G20210A, MTHFR A1298C and MTHFR C677T between the study and control groups (p > 0.05). Eight children (14.5 %) had heterozygous and one child (1.8%) had homozygous FVL mutation in the study group. One child (2%) in the control group had heterozygous FVL mutation. There was statistically significant differences of FVL allele and genotype frequencies between the groups (p < 0.05). The prevalence of FVL polymorphism (16.3 %) was higher in ROP patients than control subjects in this Turkish cohort. We suggest a possible association of FVL mutation with ROP at the end of the study.

Status of Vitamins B-12 and B-6 but Not of Folate, Homocysteine, and the Methylenetetrahydrofolate Reductase C677T Polymorphism Are Associated with Impaired Cognition and Depression in Adults123

PubMed Central

Moorthy, Denish; Peter, Inga; Scott, Tammy M.; Parnell, Laurence D.; Lai, Chao-Qiang; Crott, Jimmy W.; Ordovás, José M.; Selhub, Jacob; Griffith, John; Rosenberg, Irwin H.; Tucker, Katherine L.; Troen, Aron M.

2012-01-01

The C677T polymorphism of the methylenetetrahydrofolate reductase (MTHFR) gene differs in frequency in various ethnic groups that have differing prevalence of age-related cognitive impairments. We used a series of neuro-psychological tests to examine the association of the MTHFR C677T polymorphism with cognition and depression and also to assess whether genotype modifies the association of folate and homocysteine with these outcomes. This study analyzed pooled cross-sectional data from 2 ethnically diverse cohorts of community-living adults: the Boston Puerto Rican Health Study (n = 939) and the Nutrition, Aging, and Memory in Elders study (n = 1017). Individuals in both cohorts underwent anthropometric and laboratory measurements and dietary and health assessments using validated questionnaires between the years 2003 and 2007. Cognitive outcomes included measures of global cognition [Mini-Mental Status Exam (MMSE)], depression (Center for Epidemiological Studies Depression Scale), and 3 factor scores for the domains of attention, executive function, and memory that were derived from a detailed set of neuropsychological tests. Low plasma vitamin B-12 concentrations were associated with poorer MMSE scores and higher depression scores, and low vitamin B-6 concentrations were associated with lower MMSE and worse attention and executive function in the multivariate analysis. In contrast, MTHFR genotype, folate, and homocysteine were not associated with cognition or depression in either ethnicity-pooled or stratified analysis. The current study did not find evidence of an association between the MTHFR C677T TT genotype and impaired cognition or depression in a population with adequate folate status and a high prevalence of cognitive impairment and depression. PMID:22739363

Response of serum and red blood cell folate concentrations to folic acid supplementation depends on methylenetetrahydrofolate reductase C677T genotype: Results from a crossover trial

PubMed Central

Anderson, Cheryl A.M.; Beresford, Shirley A. A.; McLerran, Dale; Lampe, Johanna W.; Deeb, Samir; Feng, Ziding; Motulsky, Arno G.

2013-01-01

Scope By increasing blood folate concentrations, folic acid supplementation reduces risk for neural tube defect-affected pregnancies, and lowers homocysteine concentrations. We assessed response of red blood cell (RBC) and serum folate to folic acid supplementation, and examined association of response with the genetic polymorphism C677T of the methylenetetrahydrofolate NAD(P)H (MTHFR) gene. Methods and Results Randomized, controlled, crossover trial with two folic acid supplement treatment periods and a 30-week washout period. The primary outcome is blood folate (serum and RBC) concentrations. Volunteers (n=142) aged 18-69 were randomized to two of three doses (0, 200, and 400 μg) of folic acid for twelve weeks. Serum folate response depended on treatment period with significant responses to 200 μg seen only in the second treatment periods (4.4 ng/mL or 3.4 ng/mL). Additionally, serum folate increased as folic acid dose increased to 400 μg (p< 0.01) and response was greater after the washout period (8.7 ng/mL), than after a 6-week run-in (2.3 ng/mL). The differential change attributable to a daily supplement of 400 μg compared to 200 μg was 96.8 ng/mL; while the change attributable to 400 μg compared to 0 μg was 121.4. Increases in RBC folate concentrations with 400 μg occurred within MTHFR gene mutation (C677T); and in the African American group. Conclusions Serum folate concentration is responsive to modest increases in folic acid intake. Red blood cell folate increases only with higher additional doses of folic acid supplementation, and this is true for each MTHFR C677T genotype. PMID:23456769

Methotrexate elimination and toxicity: MTHFR 677C>T polymorphism in patients with primary CNS lymphoma treated with high-dose methotrexate.

PubMed

Choi, Yun Jung; Park, Hyangmin; Lee, Ji Sung; Lee, Ju-Yeon; Kim, Shin; Kim, Tae Won; Park, Jung Sun; Kim, Jeong Eun; Yoon, Dok Hyun; Suh, Cheolwon

2017-12-01

The genetic association of the methylenetetrahydrofolate reductase gene (MTHFR) 677C>T polymorphism with methotrexate (MTX)-associated toxicity has been evaluated and conflicting results have been reported. The substantial heterogeneity of the studied population was suggested to be a possible explanation because ethnicity, MTX dose, coadministered chemotherapeutic agents, and folinate rescue dosage regimen could alter the MTX toxicity profile. The patient population was homogenized by limiting the cancer type to primary central nervous system lymphoma and chemotherapy protocol to a high-dose MTX monotherapy regimen. A total of 111 patients with 402 chemotherapy courses were analyzed. MTHFR 677C>T polymorphism was identified as an independent predictive marker for MTX-associated hematologic toxicity (odds ratio, 2.60; 95% confidence interval, 1.32-5.09; P = .0055). Clinically significant nephrotoxicity occurred in patients without delayed elimination, suggesting roles for factors other than serum MTX levels. MTX-induced hepatotoxicity and oral mucositis occurred independently of plasma MTX levels. Copyright © 2016 John Wiley & Sons, Ltd.

Gender-specific interactions of MTHFR C677T and MTRR A66G polymorphisms with overweight/obesity on serum lipid levels in a Chinese Han population.

PubMed

Zhi, Xueyuan; Yang, Boyi; Fan, Shujun; Wang, Yanxun; Wei, Jian; Zheng, Quanmei; Sun, Guifan

2016-10-28

Little is known regarding the interactions of methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase reductase (MTRR) A66G polymorphisms with overweight/obesity on serum lipid profiles. The aim of the current study was to explore interactions between the two polymorphisms and overweight/obesity on four common lipid levels in a Chinese Han population and further to evaluate whether these interactions exhibit gender-specificity. A total of 2239 participants (750 females and 1489 males) were enrolled into this study. The genotypes of the MTHFR C677T and MTRR A66G were determined by a TaqMan assay. Overweight and obesity were defined as a body mass index between 24 and 27.99 and ≥ 28 kg/m 2 , respectively. The interactions were examined by factorial design covariance analysis, and further multiple comparisons were conducted by Bonferroni correction. There was no significant difference in the genotypic and allelic frequencies between females and males (MTHFR 677 T allele: 54.47 % for females and 54.40 % for males; MTRR 66G allele: 24.73 % for females and 24.71 % for males). Interaction between the MTHFR C677T polymorphism and overweight/obesity on serum triglyceride levels, and interaction between the MTRR A66G polymorphism and overweight/obesity on serum high-density lipoprotein cholesterol levels were detected in women (P = 0.015 and P = 0.056, respectively). For female subjects with overweight/obesity, the serum triglyceride levels in MTHFR 677TT genotype [1.09 (0.78-1.50) mmol/L] were significantly higher as compared with MTHFR 677CC genotype [0.90 (0.60-1.15) mmol/L, P = 0.007], and the MTRR 66GG genotype carriers had higher serum high-density lipoprotein cholesterol levels than those with MTRR 66AG genotype (1.46 ± 0.50 vs. 1.19 ± 0.31 mmol/L, P = 0.058). Furthermore, in male subjects with overweight/obesity, the MTHFR 677CT genotype carriers had higher low-density lipoprotein cholesterol levels than those

Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension.

PubMed

Cai, Weijuan; Yin, Liang; Yang, Fang; Zhang, Lei; Cheng, Jiang

2014-11-01

-D haplotype and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH.

Association between Hcy levels and the CBS844ins68 and MTHFR C677T polymorphisms with essential hypertension

PubMed Central

CAI, WEIJUAN; YIN, LIANG; YANG, FANG; ZHANG, LEI; CHENG, JIANG

2014-01-01

and EH (OR, 1.376). MTHFR C677T and CBS844ins68 polymorphisms were present in the populations studied and the CBS844ins68 homozygous mutation was not present. Therefore, there is a correlation between the polymorphisms of the MTHFR C677T gene and EH, and allele T may be one of the predisposing factors. MTHFR C677T and CBS844ins68 may exist with a certain linkage and the T-D haplotype may be a risk factor for EH. PMID:25279160

Erythrocyte volume, folate levels, and the presence of methylenetetrahydrofolate reductase polymorphism.

PubMed

García-García, Inés; García-Fragoso, Lourdes; Renta, Jessicca; Arce, Sylvia; Cadilla, Carmen L

2002-03-01

Homozygosity for a common polymorphism in the 5,10 methylenetetrahydrofolate reductase (MTHFR) gene (C677T) has been associated to an increased risk of neural tube defects as well as derangements in folate, homocysteine, and hematological parameters. This study analyzed the relationship between folate levels, the erythrocyte volume, and the presence of homozygosity for the C677T polymorphism in a group of 126 Puerto Rican healthy women of childbearing age. Blood samples were analyzed for erythrocyte mean corpuscular volume (MCV), mean erythrocyte hemoglobin content (MCH), folate, and RBC folate. Homozygosity for the C677T mutation was determined by PCR. Thirty-two percent (32%) of women used a folic acid supplement during the three months prior to sampling. Mean folate and RBC folate levels were within the normal range. Individuals homozygous for the MTHFR C677T polymorphism had no elevation of MCV (p = 0.70) or MCH (p = 0.68). Women in the lower quartile of folate levels did not show differences in their MCV or MCH. In this sample of Puerto Rican women, homozygosity for the C677T MTHFR polymorphism was not associated to elevations of MCV or MCH even in the presence of lower folate levels.

MTHFR c.677C>T is a risk factor for non-syndromic cleft lip with or without cleft palate in Chile.

PubMed

Ramírez-Chau, C; Blanco, R; Colombo, A; Pardo, R; Suazo, J

2016-10-01

The functional variant within the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene c.677C>T, producing alterations in folate metabolism, has been associated with the risk of non-syndromic cleft lip with or without cleft palate (NSCL/P). We assessed this association in a Chilean population using a combined analysis of case-control and case-parent trio samples. Samples of 165 cases and 291 controls and 121 case-parent trios (sharing the cases) were genotyped. Odds ratio (OR) was estimated for case-control (allele and genotype frequency differences), and this result was confirmed by allele transmission distortion in trios. Due to that these samples are not independent, a combined OR was also computed. Maternal genotype effect was additionally evaluated based on a log-linear method. Borderline but not significant OR (1.28; CI 0.97-1.69) was observed for risk allele (T) in the case-control sample. However, triad sample showed a significant association (OR 1.56: CI 1.09-2.25) which was confirmed by the combined OR (1.37; CI 1.11-1.71). Maternal genotype has been also associated with the phenotype (P = 0.002). In contrast to previous reports considering Chilean subjects, our results demonstrated that the offspring and maternal genotypes for MTHFR c.677C>T variant are strongly associated with NSCL/P in this Chilean population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu Xiayu; Liang Ziqing; Zou Tianning

2009-02-13

Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicitymore » was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.« less

Association of 5, 10- methylenetetrahydrofolate reductase C677T polymorphism in susceptibility to tropical chronic pancreatitis in north Indian population.

PubMed

Singh, S; Choudhuri, G; Kumar, R; Agarwal, S

2012-12-22

MTHFR is a key enzyme in folate metabolism that catalyzes the conversion of 5, 10—methlenetetrahydrofolate (5, 10— methylene THF) to 5—methyltetrahydrofolate (5—methyl THF), a predominant circulatory form of folate and methyl donor for the remethylation of homocysteine to methionine. Some studies have shown that C667T polymorphism increases the risk of pancreatic cancer. Since MTHFR is involved in methylation, inflammation and protection against oxidative stress, the processes especially important for pancreatic homeostasis. The altered enzyme activity could play a role in pancreatic injury. The role of MTHFR C677T polymorphism in chronic pancreatitis has been explored by conducting a hospital based; case—control study involving 100 patients radiologically confirmed chronic pancreatitis and 329 healthy controls. All samples were analyzed for MTHFR C677T polymorphism using PCR—RFLP method. Restriction enzyme Hinf I was used to digest the 198 bp amplified product. The frequency of the MTHFR was 57.3%, 34.1% and 8.5% among cases compared with 87.2%,11.2% and 1.5% of controls for CC, CT and TT genotypes, respectively. The T Allele frequency was found significantly higher in patients than in controls. A significant association with T allele was observed with p—value (< 0.0001) odds ratio 4.475 and (95% CI=2.961—7.046). It could be predisposing to the traditional risk factors such as diabetes, dietary, alcohal and smoking habit that are known to be associated with chronic pancreatitis. Additionally it was observed that smoking increases the risk of chronic pancreatitis by 4.1 times. The T allele frequency of MTHFR (C667T) was found to be a significant risk factor for chronic pancreatitis playing a crucial role in altered folate metabolsim.

MTHFR C677T genotype influences the isotopic enrichment of one-carbon metabolites in folate-compromised men consuming d9-choline.

PubMed

Yan, Jian; Wang, Wei; Gregory, Jesse F; Malysheva, Olga; Brenna, J Thomas; Stabler, Sally P; Allen, Robert H; Caudill, Marie A

2011-02-01

Homozygosity for the variant 677T allele in the methylenetetrahydrofolate reductase (MTHFR) gene increases the requirement for folate and may alter the metabolic use of choline. The choline adequate intake is 550 mg/d for men, although the metabolic consequences of consuming extra choline are unclear. Deuterium-labeled choline (d9-choline) as tracer was used to determine the differential effects of the MTHFR C677T genotype and the effect of various choline intakes on the isotopic enrichment of choline derivatives in folate-compromised men. Mexican American men with the MTHFR 677CC or 677TT genotype consumed a diet providing 300 mg choline/d plus supplemental choline chloride for total choline intakes of 550 (n = 11; 4 with 677CC and 7 with 677TT) or 1100 (n = 12; 4 with 677CC and 8 with 677TT) mg/d for 12 wk. During the last 3 wk, 15% of the total choline intake was provided as d9-choline. Low but measurable enrichments of the choline metabolites were achieved, including that of d3-phosphatidylcholine (d3-PtdCho)--a metabolite produced in the de novo pathway via choline-derived methyl groups. Men with the MTHFR 677TT genotype had a higher urinary enrichment ratio of betaine to choline (P = 0.041), a higher urinary enrichment of sarcosine (P = 0.041), and a greater plasma enrichment ratio of d9-betaine to d9-PtdCho with the 1100 mg choline/d intake (P = 0.033). These data show for the first time in humans that choline itself is a source of methyl groups for de novo PtdCho biosynthesis and indicate that the MTHFR 677TT genotype favors the use of choline as a methyl donor.

A case of recurrent pancytopenia in a patient with acute promyelocytic leukemia on maintenance chemotherapy and concomitant methyltetrahydrofolate reductase and thiopurine S-methyltransferase mutation - review of literature.

PubMed

Keung, Yi-Kong; Keung, Lap-Woon; Hong-Lung Hu, Eddie

2016-06-01

Pharmacogenetics is a study of how genetic variation of an individual affects the drug response. We report a case of recurrent pancytopenia resulting from maintenance chemotherapy in a patient with acute promyelocytic leukemia and two pharmacogenetic mutations, namely, methylene tetrahydrofolate reductase C677T homozygous mutation and thiopurine methyltransferase mutation. © The Author(s) 2015.

The effect of MTHFR(C677T) genotype on plasma homocysteine concentrations in healthy children is influenced by gender.

PubMed

Papoutsakis, C; Yiannakouris, N; Manios, Y; Papaconstantinou, E; Magkos, F; Schulpis, K H; Zampelas, A; Matalas, A L

2006-02-01

To explore the influence of gender, together with folate status, on the relation between the common methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism and plasma total homocysteine (tHcy) concentrations in healthy children. Cross-sectional study by face-to-face interview. A total of 186 sixth-grade students participated from twelve randomly selected primary schools in Volos, Greece. Fasting tHcy, folate, and vitamin B(12) were measured in plasma. The MTHFR genotypes were determined. Anthropometric and dietary intake data by 24-h recall were collected. Geometric means for plasma tHcy, plasma folate and energy-adjusted dietary folate did not differ between females and males. The homozygous mutant TT genotype was associated with higher tHcy only in children with lower plasma folate concentrations (<19.9 nmol/l, P = 0.012). As a significant gender interaction was observed (P = 0.050), we stratified the lower plasma folate group by gender and found that the association between the genotype and tHcy was restricted to males (P = 0.026). Similar results were obtained when folate status was based on estimated dietary folate. Specifically, only TT males that reported lower dietary folate consumption (<37 microg/MJ/day) had tHcy that was significantly higher than tHcy levels of C-allele carriers (P = 0.001). Under conditions of lower folate status (as estimated by either plasma concentration or reported dietary consumption), gender modifies the association of the MTHFR(C677T) polymorphism with tHcy concentrations in healthy children. Kellog Europe.

A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

PubMed Central

Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

2002-01-01

DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

PubMed

Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

2008-01-01

Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

Correlations of MTHFR 677C>T Polymorphism with Cardiovascular Disease in Patients with End-Stage Renal Disease: A Meta-Analysis

PubMed Central

Gao, Xian-Hui; Zhang, Guo-Yi; Wang, Ying; Zhang, Hui-Ying

2014-01-01

Objective This meta-analysis was conducted to evaluate the correlations of a common polymorphism (677C>T) in the methylenetetrahydrofolate reductase (MTHFR) gene with risk of cardiovascular disease (CVD) in patients with end-stage renal disease (ESRD). Method The following electronic databases were searched without language restrictions: Web of Science (1945∼2013), the Cochrane Library Database (Issue 12, 2013), MEDLINE (1966∼2013), EMBASE (1980∼2013), CINAHL (1982∼2013) and the Chinese Biomedical Database (CBM) (1982∼2013). Meta-analysis was performed using STATA statistical software. Odds ratios (ORs) with their 95% confidence intervals (95%CIs) were calculated. Results Eight cohort studies met all inclusion criteria and were included in this meta-analysis. A total of 2,292 ESRD patients with CVD were involved in this meta-analysis. Our meta-analysis results revealed that the MTHFR 677C>T polymorphism might increase the risk of CVD in ESRD patients (TT vs. CC: OR = 2.75, 95%CI = 1.35∼5.59, P = 0.005; CT+TT vs. CC: OR = 1.39, 95%CI = 1.09∼1.78, P = 0.008; TT vs. CC+CT: OR = 2.52, 95%CI = 1.25∼5.09, P = 0.010; respectively). Further subgroup analysis by ethnicity suggested that the MTHFR 677C>T polymorphism was associated with an elevated risk for CVD in ESRD patients among Asians (TT vs. CC: OR = 3.38, 95%CI = 1.11∼10.28, P = 0.032; CT+TT vs. CC: OR = 1.44, 95%CI = 1.05∼1.97, P = 0.022; TT vs. CC+CT: OR = 3.15, 95%CI = 1.02∼9.72, P = 0.046; respectively), but not among Africans or Caucasians (all P>0.05). Conclusion Our findings indicate that the MTHFR 677C>T polymorphism may be associated with an elevated risk for CVD in ESRD patients, especially among Asians. PMID:25050994

Genetic polymorphism of MTHFR C677T and premature coronary artery disease susceptibility: A meta-analysis.

PubMed

Hou, Xiaowen; Chen, Xin; Shi, Jingpu

2015-07-01

The association between 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T gene polymorphism and premature coronary artery disease (PCAD) is controversial. To explore a more precise estimation of the association, a meta-analysis was conducted in the present study. The relevant studies were identified by searching PubMed, EMBASE, the Web of Science, Cochrane Collaboration Database, Chinese National Knowledge Infrastructure, Wanfang Database and China Biological Medicine up to November, 2014. The meta-analysis was performed by STATA 11. 21 studies with a total of 6912 subjects, including 2972 PCAD patients and 3940 controls. The pooled analysis showed that MTHFR C677T gene polymorphism was probably associated with PCAD (CT vs. CC: OR=1.13, 95% CI=1.01-1.27; dominant model: OR=1.16, 95% CI=1.04-1.29; recessive model: OR=1.19, 95% CI=1.00-1.40; allele analysis: OR=1.17, 95% CI=1.01-1.34). Subgroup analysis by plasma homocysteine concentration showed a significant association in the homocysteine >15μmol/L subgroup (CT vs. CC: OR=1.44, 95% CI=1.10-1.88; TT vs. CC: OR=2.51, 95% CI=1.12-5.63; dominant model: OR=1.51, 95% CI=1.16-1.96; recessive model: OR=2.33, 95% CI=1.05-5.20; allele analysis: OR=1.48, 95% CI=1.18-1.87). Subgroup analysis by continent displayed a significant association among the Asian population (CT vs. CC: OR=1.51, 95% CI=1.23-1.86; TT vs. CC: OR=2.81, 95% CI=1.87-4.23; dominant model: OR=1.65, 95% CI=1.35-2.01; recessive model: OR=2.22, 95% CI=1.53-3.21; allele analysis: OR=1.61, 95% CI=1.37-1.89). The statistical stability and reliability was demonstrated by sensitivity analysis and publication bias outcomes. In conclusion, the meta-analysis suggests that MTHFR C677T gene polymorphism may be associated with PCAD. Copyright © 2015 Elsevier B.V. All rights reserved.

Plasminogen activator inhibitor-1 4G/5G and the MTHFR 677C/T polymorphisms and susceptibility to polycystic ovary syndrome: a meta-analysis.

PubMed

Lee, Young Ho; Song, Gwan Gyu

2014-04-01

The aim of this study was to explore whether the plasminogen activator inhibitor-1 (PAI-1) 4G/5G and the methylenetetrahydrofolate reductase (MTHFR) 677C/T polymorphisms are associated with susceptibility to polycystic ovary syndrome (PCOS). Meta-analyses were conducted to determine the association between the PAI-1 4G/5G and MTHFR 677C/T polymorphisms and PCOS using: (1) allele contrast (2) homozygote contrast, (3) recessive, and (4) dominant models. For meta-analysis, nine studies of the PAI-1 4G/5G polymorphism with 2384 subjects (PCOS, 1615; controls, 769) and eight studies of the MTHFR 677C/T polymorphism with 1270 study subjects were included. Meta-analysis of all study subjects showed no association between PCOS and the PAI-1 4G allele (OR=0.949, 95% CI=0.671-1.343, p=0.767). Stratification by ethnicity, however, indicated a significant association between the PAI-1 4G allele and PCOS in Turkish and Asian populations (OR=0.776, 95% CI=0.602-0.999, p=0.049; OR=1.749, 95% CI=1.297-2.359, p=2.5×10(-5) respectively). In addition, meta-analysis indicated an association between PCOS and the PAI-1 4G4G+4G5G genotype in Europeans (OR=1.406, 95% CI=1.025-1.928, p=0.035). However, meta-analysis of all study subjects showed no association between PCOS and the MTHFR 677T allele (OR=0.998, 95% CI=0.762-1.307, p=0.989), including Europeans (OR=0.806, 95% CI=0.610-1.063, p=0.126). Meta-analysis showed no association between PCOS and the MTHFR 677C/T polymorphism using homozygote contrast, and recessive and dominant models. In conclusion, meta-analysis suggests the PAI-1 4G/5G polymorphism is associated with susceptibility to PCOS in European, Turkish, and Asian populations, but the MTHFR 677C/T polymorphism is not associated with susceptibility to PCOS in Europeans. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

MTHFR gene C677T and A1298C polymorphisms and homocysteine levels in primary open angle and primary closed angle glaucoma

PubMed Central

Micheal, Shazia; Qamar, Raheel; Akhtar, Farah; Khan, Muhammad Imran; Khan, Wajid Ali

2009-01-01

Purpose To investigate the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C genotypes and plasma concentrations of total homocysteine (tHcy) in Pakistani patients with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). Methods This was a prospective case-control study. A total of 295 patients (173 POAG, 122 PCAG) and 143 age- and sex-matched controls were subdivided into two ethnic groups, Punjabis (Punjab province, central Pakistan) and Pathans (North-West Frontier Province, northern Pakistan). Genotypes of the MTHFR C677T and A1298C polymorphisms were detected by polymerase chain reaction–restriction fragment length polymorphism (PCR-RFLP). An enzyme-linked immunosorbent assay was used to determine the total serum homocysteine (tHcy) levels. Associations were determined by logistic regression analysis. Results Frequency distributions of genotypes and combined genotypes as well as homocysteine levels were obtained. The overall distribution of the C677T genotype was found to be significantly associated with PCAG (CC 69%, CT 21%, TT 10%; p=0.001, χ2=12.6), but not with POAG (CC 71%, CT 28%, TT 1%; p=0.98, χ2=0.02) as compared to the controls (CC 71%, CT 29%, TT 1%). The Pathan cohorts revealed no association with the disease; however, the Punjabis demonstrated a significant association with PCAG (CC 75%, CT 11%, TT 13%; p<0.001, χ2=17.2). PCAG in the Punjabi subjects was also significantly associated with the A1298C polymorphism (AA 43%, AC 54%, CC 3%; p<0.001, χ2=33.9) as compared to the controls. Combined genotype data showed no association with POAG; however, a significant association with all combined genotypes was observed in the overall PCAG subjects (p<0.05, χ2=20.1). This difference was particularly apparent in the TTAA and TTAC combinations that were completely absent in the control groups (p<0.05. χ2=49.6). Mean serum tHcy levels were found to be significantly increased in the POAG (15.2±1.28 µmol/l, p<0

Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population

PubMed Central

Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

2015-01-01

Abstract The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population. A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group). Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model. Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population. PMID:26717388

Homocysteine and the C677T Gene Polymorphism of Its Key Metabolic Enzyme MTHFR Are Risk Factors of Early Renal Damage in Hypertension in a Chinese Han Population.

PubMed

Yun, Lin; Xu, Rui; Li, Guohua; Yao, Yucai; Li, Jiamin; Cong, Dehong; Xu, Xingshun; Zhang, Lihua

2015-12-01

The combined hyperhomocysteinemia condition is a feature of the Chinese hypertensive population. This study used the case-control method to investigate the association between plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme, 5, 10-methylenetetrahydrofolate reductase (MTHFR), and early renal damage in a hypertensive Chinese Han population.A total of 379 adult essential hypertensive patients were selected as the study subjects. The personal information, clinical indicators, and the C677T gene polymorphism of MTHFR were texted. This study used the urine microalbumin/urine creatinine ratio (UACR) as a grouping basis: the hypertension without renal damage group (NRD group) and the hypertension combined with early renal damage group (ERD group).Early renal damage in the Chinese hypertensive population was associated with body weight, systolic pressure, diastolic pressure, urea nitrogen, serum creatinine, cystatin C, uric acid, aldosterone, and glomerular filtration rate. The homocysteine level and the UACR in the TT genotype group were higher than those in the CC genotype group. The binary logistic regression analysis results showed that after sex and age were adjusted, the MTHFR C677T gene polymorphism was correlated with early renal damage in hypertension in both the recessive model and in the additive model.Plasma homocysteine and the C677T gene polymorphism of its key metabolic enzyme MTHFR might be independent risk factors of early renal damage in the hypertensive Chinese Han population.

5,10 Methylenetetrahydrofolate reductase genetic polymorphism as a risk factor for neural tube defects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ou, C.Y.; Brown, V.K.; Khoury, M.J.

1996-06-28

Persons with a thermolabile form of the enzyme 5,10 methylenetetrahydrofolate reductase (MTHFR) have reduced enzyme activity and increased plasma homocysteine which can be lowered by supplemental folic acid. Thermolability of the enzyme has recently been shown to be caused by a common mutation (677C{sup {r_arrow}}T) in the MTHFR gene. We studied 41 fibroblast cultures from NTD-affected fetuses and compared their genotypes with those of 109 blood specimens from individuals in the general population. 677C{sup {r_arrow}}T homozygosity was associated with a 7.2 fold increased risk for NTDs (95% confidence interval: 1.8-30.3; p value: 0.001). These preliminary data suggest that the 677C{supmore » {r_arrow}}T polymorphism of the MTHFR gene is a risk factor for spina bifida and anencephaly that may provide a partial biologic explanation for why folic acid prevents these types of NTD. 13 refs., 1 fig., 1 tab.« less

Choline Intake, Plasma Riboflavin, and the Phosphatidylethanolamine N-Methyltransferase G5465A Genotype Predict Plasma Homocysteine in Folate-Deplete Mexican-American Men with the Methylenetetrahydrofolate Reductase 677TT Genotype12

PubMed Central

Caudill, Marie A.; Dellschaft, Neele; Solis, Claudia; Hinkis, Sabrina; Ivanov, Alexandre A.; Nash-Barboza, Susan; Randall, Katharine E.; Jackson, Brandi; Solomita, Gina N.; Vermeylen, Francoise

2009-01-01

We previously showed that provision of the folate recommended dietary allowance and either 300, 550, 1100, or 2200 mg/d choline for 12 wk resulted in diminished folate status and a tripling of plasma total homocysteine (tHcy) in men with the methylenetetrahydrofolate reductase (MTHFR) 677TT genotype. However, the substantial variation in tHcy within the 677TT genotype at wk 12 implied that several factors were interacting with this genotype to affect homocysteine. As an extension of this work, the present study sought to identify the main predictors of wk-12 plasma tHcy, alone and together with the MTHFR C677T genotype (29 TT, 31 CC), using linear regression analysis. A basic model explaining 82.5% of the variation (i.e. adjusted R2 = 0.825) was constructed. However, the effects of the variables within this model were dependent upon the MTHFR C677T genotype (P for interaction ≤ 0.021). Within the 677TT genotype, serum folate (P = 0.005) and plasma riboflavin (P = 0.002) were strong negative predictors (inversely related) explaining 12 and 15%, respectively, of the variation in tHcy, whereas choline intake (P = 0.003) and serum creatinine (P < 0.001) were strong positive predictors, explaining 19 and 25% of the variation. None of these variables, except creatinine (P = 0.021), correlated with tHcy within the 677CC genotype. Of the 8 additional polymorphisms tested, none appeared to influence tHcy. However, when creatinine was not in the model, the phosphatidylethanolamine N-methyltransferase 5465G→A variant predicted lower tHcy (P < 0.001); an effect confined to the MTHFR 677TT genotype. Thus, in folate-deplete men, several factors with roles in 1-carbon metabolism interact with the MTHFR C677T genotype to affect plasma tHcy. PMID:19211833

MTHFR 677C-->T and 1298A-->C polymorphisms in children with Down syndrome and acute myeloid leukemia in Brazil.

PubMed

Amorim, Marcia R; Zanrosso, Crisiane Wais; Magalhães, Isis Q; Pereira, Simone C; Figueiredo, Alexandre; Emerenciano, Mariana; Pinheiro, Vitoria Regia; d'Andréa, Maria Lydia; Orioli, Ieda M; Koifman, Sergio; Pombo-de-Oliveira, Maria S

2008-12-01

Down syndrome (DS) is an important risk factor associated with acute leukemia (AL). The presence of polymorphisms that reduce 5,10-methylenetetrahydrofolate reductase (MTHFR) activity has been linked to the multifactorial leukemogenic process. The authors have conducted a study to test whether 677C-->T and/or 1298A-->C polymorphisms of MTHFR would play an additional role in susceptibility of acute myeloid leukemia (AML) in DS children. They also verified whether any polymorphism in the MTHFR gene was associated with the risk of DS. Genetic polymorphisms determination was carried out in 248 samples from healthy individuals as controls and a total of 115 DS children (65 without leukemia and 50 with AML). The present study failed to reveal any association between these polymorphisms and risk of AML in DS children. The data also indicate that MTHFR polymorphisms are not associated with risk of being a DS child.

Association between MTHFR C677T polymorphism and depression: a meta-analysis in the Chinese population.

PubMed

Jiang, Wei; Xu, Jun; Lu, Xiao-Jie; Sun, Yang

2016-09-01

Depression is a worldwide public health issue, and its prevalence increases each year. Although a number of studies have been conducted on the association between MTHFR C677T polymorphism and depression in China, this association remains elusive and controversial. To clarify the impact of MTHFR C677T polymorphism on the risk of depression, a meta-analysis was performed in the Chinese population. Relevant studies were identified using PubMed, Springer Link, Ovid, Chinese Wanfang Data Knowledge Service Platform, Chinese National Knowledge Infrastructure and Chinese Biology Medicine through May 5, 2015. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the associations. A total of 13 case-control studies including 1895 patients and 1913 controls were involved in this meta-analysis. Overall, T variant of MTHFR C677T gene polymorphism was significantly associated with an increased risk of depression in the Chinese population (T vs. C: OR = 1.52, 95% CI = 1.24-1.85; TT + CT vs. CC: OR = 1.64, 95% CI = 1.16-2.30; TT vs. CC: OR = 2.19, 95% CI = 1.49-3.24; TT vs. CC + CT: OR = 1.80, 95% CI = 1.31-2.46). In subgroup analyses stratified by geographic area and source of controls, the significant results were found in population-based studies, in hospital-based studies, in North and South China. The risk conferred by MTHFR C677T polymorphism is higher in North China than in South China. In conclusion, this meta-analysis suggests that MTHFR C677T polymorphism is associated with depression in the Chinese population, but these associations vary in different geographic locations.

The association between MTHFR 677C>T genotype and folate status and genomic and gene-specific DNA methylation in the colon of individuals without colorectal neoplasia.

PubMed

Hanks, Joanna; Ayed, Iyeman; Kukreja, Neil; Rogers, Chris; Harris, Jessica; Gheorghiu, Alina; Liu, Chee Ling; Emery, Peter; Pufulete, Maria

2013-12-01

Decreased genomic and increased gene-specific DNA methylation predispose to colorectal cancer. Dietary folate intake and the methylenetetrahydrofolate reductase polymorphism (MTHFR 677C>T) may influence risk by modifying DNA methylation. We investigated the associations between MTHFR 677C>T genotype, folate status, and DNA methylation in the colon. We conducted a cross-sectional study of 336 men and women (age 19-92 y) in the United Kingdom without colorectal neoplasia. We obtained blood samples for measurement of serum and red blood cell folate, plasma homocysteine, and MTHFR 677C>T genotype and colonic tissue biopsies for measurement of colonic tissue folate and DNA methylation (genomic- and gene-specific, estrogen receptor 1, ESR1; myoblast determination protein 1, MYOD1; insulin-like growth factor II, IGF2; tumor suppressor candidate 33, N33; adenomatous polyposis coli, APC; mut-L homolog 1, MLH1; and O(6)-methylguanine-DNA methyltransferase, MGMT) by liquid chromatography/electrospray ionization mass spectrometry and pyrosequencing, respectively. Of the 336 subjects recruited, 185 (55%) carried the CC, 119 (35%) the CT, and 32 (10%) the TT alleles. No significant differences in systemic markers of folate status and colonic tissue folate between genotypes were found. The MTHFR TT genotype was not associated with genomic or gene-specific DNA methylation. Biomarkers of folate status were not associated with genomic DNA methylation. Relations between biomarkers of folate status and gene-specific methylation were inconsistent. However, low serum folate was associated with high MGMT methylation (P = 0.001). MTHFR 677C>T genotype and folate status were generally not associated with DNA methylation in the colon of a folate-replete population without neoplasia.

Combined 677CC/1298AC genotypes of methylenetetrahydrofolate reductase (MTHFR ) reduce susceptibility to precursor B lymphoblastic leukemia in a Chinese population.

PubMed

Lv, Ling; Wu, Cuie; Sun, Henjuan; Zhu, Saijuan; Yang, Yongchen; Chen, Xi; Fu, Hua; Bao, Liming

2010-06-01

The methylenetetrahydrofolate reductase (MTHFR) encodes a major enzyme in folate metabolism. It has been suggested that two MTHFR polymorphisms, 677C>T and 1298A>C, influence risk of acute lymphoblastic leukemia (ALL). Most studies on relation of MTHFR polymorphisms to ALL susceptibility have been in pediatric populations because ALL is relatively rare in adults. Here, we report a case-control study of 127 Chinese patients with adult precursor B lymphoblastic leukemia (B-ALL) to examine correlation between the MTHFR polymorphisms and B-ALL susceptibility in adults. Our data show that although the prevalence of genotype 1298CC was significantly higher in the female patients than in the controls (P = 0.04), the differences in distributions of combined genotypes of 1298CC with either 677CC or 677CT between the cases and the controls were statistically insignificant. Haplotype analysis revealed no significant difference between the cases and the controls. The prevalence for joint MTHFR genotypes 677CC/1298AC was significantly lower in the female B-ALL cases than in the controls [odds ratio (OR) = 0.06, 95% CI = 0.00-0.53, P = 0.0033] and no differences among the men [OR = 0.71, 95% CI = 0.20-2.53, P = 0.55], suggesting that protective effects of combined MTHFR 677CC/1298AC genotypes on susceptibility of adult B-ALL are gender bias toward women with 677CC/1298AC women being at a 17-fold reduced odds to develop B-ALL.

Supplementation with Watermelon Extract Reduces Total Cholesterol and LDL Cholesterol in Adults with Dyslipidemia under the Influence of the MTHFR C677T Polymorphism.

PubMed

Massa, Nayara M L; Silva, Alexandre S; de Oliveira, Caio V C; Costa, Maria J C; Persuhn, Darlene C; Barbosa, Carlos V S; Gonçalves, Maria da C R

2016-08-01

Dyslipidemia and genetic polymorphisms are associated with increased risk for developing cardiovascular diseases, and watermelon appears to have the potential to improve hyperlipidemia due to the presence of nutrients such as arginine and citrulline. To test the hypolipidemic effect of watermelon extract (Citrullus lanatus) and the influence of the methylenetetrahydrofolate reductase genotype (MTHFR C677T) on supplementation response. This is an experimental clinical phase II randomized and double-blind study. Forty-three subjects with dyslipidemia were randomly divided into 2 groups: experimental (n = 22) and control (n = 21) groups. The subjects were supplemented daily for 42 days with 6 g of watermelon extract or a mixture of carbohydrates (sucrose/glucose/fructose). The use of watermelon extract reduced plasma total cholesterol (p < 0.05) and low-density lipoprotein (p < 0.01) without modifying triglycerides, high-density lipoprotein, and very low-density lipoprotein values. Only carriers of the T allele (MTHFR C677T) showed decreasing concentrations of low-density lipoprotein (p < 0.01). No changes in anthropometric parameters analyzed were observed. This is the first study to demonstrate the beneficial effect of the consumption of watermelon extract in reducing plasma levels of lipids in humans. The MTHFR C677T polymorphism did not affect the plasma lipid concentration but made individuals more responsive to treatment with watermelon. The consumption of this functional food represents an alternative therapy in the combined treatment of patients with dyslipidemia, promoting health and minimizing the development of risk factors for cardiovascular diseases.

Normal Weight Obese syndrome: role of single nucleotide polymorphism of IL-1 5Ralpha and MTHFR 677C-->T genes in the relationship between body composition and resting metabolic rate.

PubMed

Di Renzo, L; Bigioni, M; Bottini, F G; Del Gobbo, V; Premrov, M G; Cianci, R; De Lorenzo, A

2006-01-01

We have identified a subset of metabolically obese, but normal weight individuals, with potentially increased risks of developing the metabolic syndrome, despite their normal body mass index. We determined the relationship among body fat distribution, resting metabolic rate (RMR), total body water amount (%TBW), selected gene polymorphism on interleukin-15 receptor-alpha (IL-15Ralpha) and methylenetetrahydrofolate reductase 677C-->T (MTHFR 677C-->T), to distinguish normal weight obese (NWO) from nonobese with a normal metabolic profile and obese individuals. We analysed anthropometric variables, body composition by Dual energy X-ray Absorptiometry (DXA), RMR by indirect calorimetry, %TBW by bioimpedence analysis (BIA), MTHFR 677C-->T and IL-15Ralpha genotypes of 128 clinically healthy Caucasian individuals. We compared a group of female, defined as NWO and characterised by a BMI < or = 25 kg/m(2) and FM > or = 30% with groups of others female, and males, represented by nonobese with a BMI < or = 25 kg/m(2) and FM < or = 30%, and preobese-obese individuals with BMI > or = 25 kg/m(2) and %FM > or = 30%; none of the males was classified as NWO. Significant correlations were found among body fat mass distribution, metabolic variables, percentage of total body water distribution and selected genetic variations. The variables that contributed significantly to the separation of classes were body tissue (Tissue), %TBW, RMR, the volumes of both oxygen (VO2) and carbon dioxide (VCO2). The distribution of MTHFR 677C-->T and IL-15 genotypes was significantly different between classes. Our data highlight that NWO individuals showed a significant relationship between the decrease in the basal metabolism (RMR), body fat mass increasing and total water amount. Possession of wild type homozygotes genotypes regarding IL-15Ralpha cytokine and 677C-->T MTHFR enzyme characterised NWO individuals.

MTHFR polymorphisms C677T and A1298C and associations with IVF outcomes in Brazilian women.

PubMed

D'Elia, Priscila Queiroz; dos Santos, Aline Amaro; Bianco, Bianca; Barbosa, Caio Parente; Christofolini, Denise Maria; Aoki, Tsutomu

2014-06-01

The aim of this study was to investigate the association between MTHFR gene polymorphisms and IVF outcomes in Brazilian women undergoing assisted reproduction treatment. A prospective study was conducted in the Human Reproduction Department at the ABC University School of Medicine and the Ideia Fertility Institute between December 2010 and April 2012. The patient population was 82 women undergoing assisted reproduction cycles. The MTHFR polymorphisms C677T and A1298C were evaluated and compared with laboratory results and pregnancy rates. The C677T variant was associated with proportions of mature (P=0.006) and immature (P=0.003) oocytes whereas the A1298C variant was associated with number of oocytes retrieved (P=0.044). The polymorphisms, whether alone or in combination, were not associated with normal fertilization, good-quality embryo or clinical pregnancy rates. This study suggests that the number and maturity of oocytes retrieved may be related to the MTHFR polymorphisms C677T and A1298C. It is believed that folate has a crucial function in human reproduction and that folate deficiency can compromise the function of the metabolic pathways it is involved in, leading to an accumulation of homocysteine. The gene MTHFR encodes the 5-MTHFR enzyme, which is involved in folate metabolism, and C677T/A1298C polymorphisms of this gene are related to decreased enzyme activity and consequent changes in homocysteine concentration. Folate deficiency and hyperhomocysteinaemia can also compromise fertility and lead to pregnancy complications by affecting the development of oocytes, preparation of endometrial receptivity, implantation of the embryo and pregnancy. In folliculogenesis, hyperhomocysteinaemia can activate apoptosis, leading to follicular atresia and affecting the maturity of oocytes and the quality of embryos cultured in vitro. This study was performed to investigate the association between MTHFR polymorphisms and IVF outcomes in women undergoing assisted

CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

PubMed

Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

2018-03-29

Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis

PubMed Central

Fryar-Williams, Stephanie

2016-01-01

The Mental Health Biomarker Project (2010–2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman’s correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO’s cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The

Fundamental Role of Methylenetetrahydrofolate Reductase 677 C → T Genotype and Flavin Compounds in Biochemical Phenotypes for Schizophrenia and Schizoaffective Psychosis.

PubMed

Fryar-Williams, Stephanie

2016-01-01

The Mental Health Biomarker Project (2010-2016) explored variables for psychosis in schizophrenia and schizoaffective disorder. Blood samples from 67, highly characterized symptomatic cases and 67 gender and age matched control participants were analyzed for methyl tetrahydrofolate reductase (MTHFR) 677C → T gene variants and for vitamin B6, B12 and D, folate, unbound copper, zinc cofactors for enzymes in the methylation cycle, and related catecholamine pathways. Urine samples were analyzed for indole-catecholamines, their metabolites, and oxidative-stress marker, hydroxylpyrolline-2-one (HPL). Rating scales were Brief Psychiatric Rating Scale, Positive and Negative Syndrome Scale, Global Assessment of Function scale, Clinical Global Impression (CGI) score, and Social and Occupational Functioning Assessment Scale (SOFAS). Analysis used Spearman's correlates, receiver operating characteristics and structural equation modeling (SEM). The correlative pattern of variables in the overall participant sample strongly implicated monoamine oxidase (MAO) enzyme inactivity so the significant role of MAO's cofactor flavin adenine nucleotide and its precursor flavin adenine mononucleotide (FMN) within the biochemical pathways was investigated and confirmed as 71% on SEM of the total sample. Splitting the data sets for MTHFR 677C → T polymorphism variants coding for the MTHFR enzyme, discovered that biochemistry variables relating to the wild-type enzyme differed markedly in pattern from those coded by the homozygous variant and that the hereozygous-variant pattern resembled the wild-type-coded pattern. The MTHFR 677C → T-wild and -heterozygous gene variants have a pattern of depleted vitamin cofactors characteristic of flavin insufficiency with under-methylation and severe oxidative stress. The second homozygous MTHFR 677TT pattern related to elevated copper:zinc ratio and a vitamin pattern related to flavin sufficiency and risk of over-methylation. The two

MTHFR C677T gene polymorphism and head and neck cancer risk: a meta-analysis based on 23 publications.

PubMed

Niu, Yu-Ming; Deng, Mo-Hong; Chen, Wen; Zeng, Xian-Tao; Luo, Jie

2015-01-01

Conflicting results on the association between MTHFR polymorphism and head and neck cancer (HNC) risk were reported. We therefore performed a meta-analysis to derive a more precise relationship between MTHFR C677T polymorphism and HNC risk. Three online databases of PubMed, Embase, and CNKI were researched on the associations between MTHFR C677T polymorphism and HNC risk. Twenty-three published case-control studies involving 4,955 cases and 8,805 controls were collected. Odds ratios (ORs) with 95% confidence interval (CI) were used to evaluate the relationship between MTHFR C677T polymorphism and HNC risk. Sensitivity analysis, cumulative analyses, and publication bias were conducted to validate the strength of the results. Overall, no significant association between MTHFR C677T polymorphism and HNC risk was found in this meta-analysis (T versus C: OR = 1.04, 95% CI = 0.92-1.18; TT versus CC: OR = 1.15, 95% CI = 0.90-1.46; CT versus CC: OR = 1.00, 95% CI = 0.85-1.17; CT + TT versus CC: OR = 1.01, 95% CI = 0.87-1.18; TT versus CC + CT: OR = 1.11, 95% CI = 0.98-1.26). In the subgroup analysis by HWE, ethnicity, study design, cancer location, and negative significant associations were detected in almost all genetic models, except for few significant risks that were found in thyroid cancer. This meta-analysis demonstrates that MTHFR C677T polymorphism may not be a risk factor for the developing of HNC.

A common mutation in the methylenetetrahydrofolate reductase gene is associated with an accumulation of formylated tetrahydrofolates in red blood cells

PubMed Central

Bagley, Pamela J.; Selhub, Jacob

1998-01-01

A common mutation (C677T) in the gene encoding for methylenetetrahydrofolate reductase (MTHFR) (5-methyltetrahydrofolate:(acceptor) oxidoreductase, EC 1.7.99.5), a key regulatory enzyme in one-carbon metabolism, results in a thermolabile variant of the MTHFR enzyme with reduced activity in vitro. In the present study we used a chromatographic method for folate analysis to test the hypothesis that this mutation would be associated with altered distribution of red blood cell (RBC) folates. An alteration was found as manifested by the presence of formylated tetrahydrofolate polyglutamates in addition to methylated derivatives in the RBCs from homozygous mutant individuals. 5-Methyltetrahydrofolate polyglutamates were the only folate form found in RBCs from individuals with the wild-type genotype. Existence of formylated folates in RBCs only from individuals with the thermolabile MTHFR is consistent with the hypothesis that there is in vivo impairment in the activity of the thermolabile variant of MTHFR and that this impairment results in an altered distribution of RBC folates. PMID:9789068

MTHFR GENE C677T POLYMORPHISM AND LEVELS OF DNA METHYLTRASFERASES IN SUBCLINICAL HYPOTHYROIDISM.

PubMed

Kvaratskhelia, T; Kvaratskhelia, E; Kankava, K; Abzianidze, E

2017-04-01

The aim of our study was to investigate the link between MTHFR gene C677T polymorphism and DNMTs levels in patients with Subclinical Hypothyroidism (SCH). In this study 19 adult patients with subclinical hypothyroidism and 19 healthy controls (mean age 31±5.5 and 33±5.1 years respectively) were recruited. All patients were diagnosed based on serum levels of TSH, FT4, anti-TG and anti-TPO antibodies. Written informed consents were obtained from all study subjects. Genomic DNA was extracted using Quick-DNA Universal Kit (Zymo Research, USA). The MTHFR C677T polymorphism was genotyped by PCR-RFLP method. Levels of DNMT1 and 3a were measured in nuclear extracts of PBMC using DNMTs assay kits (Abcam). Our data indicates that the frequency of genotypes and alleles were different among the patient and the control group. There is a significant increase in CC genotype distribution in the control group when compared to the SCH patient group, while the CT as well as TT genotype distribution were not increased significantly in SCH group versus control group. However the C allele is significantly prevalent in the control group compared to the SCH group, while T allele is prevalent in patients compared to the control group with a statically significant difference. In addition, individuals with TT and CT genotypes and hypothyroidism showed elevated amount of DNMT3a in nuclear extracts of PBMC compared with controls, while no significant difference in DNMT1 levels was observed. This study indicates the MTHFR C677T variant may contribute in alteration of epigenetic regulation such as DNA methylation mediated by DNA methyltransferases in patients with subclinical hypothyroidism and also, carriers of the T allele might have an increasing risk of developing SCH.

MTHFR C677T Polymorphism is Associated with Tumor Response to Preoperative Chemoradiotherapy: A Result Based on Previous Reports.

PubMed

Zhao, Yue; Li, Xingde; Kong, Xiangjun

2015-10-12

Preoperative chemoradiotherapy (pRCT) followed by surgery has been widely practiced in locally advanced rectal cancer, esophageal cancer, gastric cancer and other cancers. However, the therapy also exerts some severe adverse effects and some of the patients show poor or no response. It is very important to develop biomarkers (e.g., gene polymorphisms) to identify patients who have a higher likelihood of responding to pRCT. Recently, a series of reports have investigated the association of the genetic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) and epidermal growth factor receptor (EGFR) genes with the tumor response to pRCT; however, the results were inconsistent and inconclusive. A systematic review and meta-analysis was performed by searching relevant studies about the association of MTHFR and EGFR polymorphisms with the tumor regression grade (TRG) in response to pRCT in databases of PubMed, EMBAS, Web of science, Chinese National Knowledge Infrastructure, and Wanfang database up to March 30, 2015. The pooled odds ratios (ORs) with corresponding 95% confidence intervals (95% CIs) were calculated to assess the strength of the association under 5 genetic models. A total of 11 eligible articles were included in the present meta-analysis, of which 8 studies were performed in rectal cancer and 3 studies were performed in esophageal cancer. We finally included 8 included studies containing 839 cases for MTHFR C677T, 5 studies involving 634 cases for MTHFR A1298C, 3 studies containing 340 cases for EGFR G497A, and 4 studies containing 396 cases for EGFR CA repeat. The pooled analysis results indicated that MTHFR C677T might be correlated with the tumor response to pRCT under the recessive model (CC vs. CTTT) in overall analysis (OR=1.426(1.074-1.894), P=0.014), rectal cancer (OR=1.483(1.102-1.996), P=0.009), and TRG 1-2 vs. 3-5 group (OR=1.423(1.046-1.936), P=0.025), while other polymorphism including MTHFR A1298C, EGFR G497A, and EGFR CA repeat

Human genetic selection on the MTHFR 677C>T polymorphism

PubMed Central

Mayor-Olea, Álvaro; Callejón, Gonzalo; Palomares, Arturo R; Jiménez, Ana J; Gaitán, María Jesús; Rodríguez, Alfonso; Ruiz, Maximiliano; Reyes-Engel, Armando

2008-01-01

Background The prevalence of genotypes of the 677C>T polymorphism for the MTHFR gene varies among humans. In previous studies, we found changes in the genotypic frequencies of this polymorphism in populations of different ages, suggesting that this could be caused by an increase in the intake of folate and multivitamins by women during the periconceptional period. The aim was to analyze changes in the allelic frequencies of this polymorphism in a Spanish population, including samples from spontaneous abortions (SA). Methods A total of 1305 subjects born in the 20th century were genotyped for the 677C>T polymorphism using allele specific real-time PCR with Taqman® probes. A section of our population (n = 276) born in 1980–1989 was compared with fetal samples (n = 344) from SA of unknown etiology from the same period. Results An increase in the frequency of the T allele (0.38 vs 0.47; p < 0.001) and of the TT genotype (0.14 vs 0.24; p < 0.001) in subjects born in the last quarter of the century was observed. In the 1980–1989 period, the results show that the frequency of the wild type genotype (CC) is about tenfold lower in the SA samples than in the controls (0.03 vs 0.33; p < 0.001) and that the frequency of the TT genotype increases in the controls (0.19 to 0.27) and in the SA samples (0.20 to 0.33 (p < 0.01)); r = 0.98. Conclusion Selection in favor of the T allele has been detected. This selection could be due to the increased fetal viability in early stages of embryonic development, as is deduced by the increase of mutants in both living and SA populations. PMID:19040733

Methylenetetrahydrofolate reductase (MTHFR) genotype, smoking habit, metastasis and oral cancer in Taiwan.

PubMed

Tsai, Chia-Wen; Hsu, Chia-Fang; Tsai, Ming-Hsui; Tsou, Yung-An; Hua, Chun-Hung; Chang, Wen-Shin; Lin, Cheng-Chieh; Bau, Da-Tian

2011-06-01

The aim of this study was to evaluate the association and interaction of genotypic polymorphism in methylenetetrahydrofolate reductase (MTHFR) with smoking habits and oral cancer in Taiwan. Two well-known polymorphic variants of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed in association with oral cancer risk, and their joint effects with individual smoking habits on oral cancer risk are discussed. In total, 620 oral cancer patients and 620 non-cancer controls in central Taiwan were recruited and genotyped. The MTHFR C677T genotype, but not the A1298C, was differently distributed between the oral cancer and control groups. The T allele of MTHFR C677T was significantly more frequently found in controls than in oral cancer patients. Joint effects of smoking and MTHFR C677T genotype significantly affected oral cancer susceptibility. The MTHFR C677T CT and TT genotypes in association with smoking conferred lower odds ratios of 0.66 and 0.54 (95% confidence interval=0.49-0.82 and 0.39-0.86), respectively. Those patients with MTHFR C677T CT and TT genotypes also had a lower risk of oral cancer metastasis. MTHFR C677T genotype may have joint effects with smoking on oral carcinogenesis, and may be a useful biomarker for prediction and prognosis of oral cancer.

[Association between methylene-tetrahydrofolate reductase gene polymorphisms and chronic myeloid leukemia].

PubMed

Dorgham, Samia; Aberkane, Meriem; Boughrara, Wefa; Antar Soltan, Badra; Mehalhal, Nemra; Touhami, Hadj; Sidimansour, Noureddine; Merad Boudia, Nadia; Louhibi, Lotfi; Boudjema, Abdallah

2014-09-01

Methylene-tetrahydrofolate reductase (MTHFR) is a key enzyme of folate metabolism. Few studies were reported about its relationship with chronic myeloid leukemia (CML). We conducted a case-control study analyzing the prevalence of the polymorphisms MTHFR C677T and MTHFR A1298C in Algerians CML patients. Using TaqMan(®) allelic discrimination assay, we investigate MTHFR C677T and A1298C polymorphism distribution in 90 cases of CML and 100 healthy subjects. The frequencies of 677T alleles and genotypes 677TT and 677CT were significantly higher in cases than in control (P = 1E-6; OR = 6.77 [4.22-10.86]) and (P = 1E-6; OR = 10.38 [4.56-23.6]) respectively. Also, the frequencies of 1298C alleles and genotypes 1298CC and 1298AC were higher in cases (P = 9 E-6; OR = 2.65 [1.71-4.10]) and (P = 0.008; OR = 2.22 [1.21-4.06]) respectively. We report also the higher significance of the haplotype 677T/1298A and 677T/1298C in cases (P = 0.007; OR = 2.57 [1.26-5.24]) and (P = 5 E-6, OR = 6.91 [2.7646-17.2899]) respectively. Our results demonstrate that 677T and 1298C alleles are both associated with an increased risk of CML in Algeria.

The importance of folate, vitamins B6 and B12 for the lowering of homocysteine concentrations for patients with recurrent pregnancy loss and MTHFR mutations.

PubMed

Serapinas, Danielius; Boreikaite, Evelina; Bartkeviciute, Agne; Bandzeviciene, Rita; Silkunas, Mindaugas; Bartkeviciene, Daiva

2017-09-01

In patients with MTHFR (methylenetetrahydrofolate reductase) mutations and hyperhomocysteinemia, recurrent pregnancy loss is a frequent feature. The aim of the study was to evaluate the impact of folic acid, vitamins B6 and B12 supplementation for the lowering of total homocysteine concentrations and pregnancy. 16 patients who had had 3 or more miscarriages and MTHFR mutations were used in the study. They received methylfolate (5mg/day), vitamin B6 (50mg/day) and vitamin B12 (1mg/week). Supplementation induced a decrease in homocysteine from 19.4±5.3μmol/L to 6.9±2.2μmol/L after folate supplementation (p<0.05). During one year 7 women became pregnant and delivered. Two women delivered from the homozygous C677T mutations group (7 patients) and combined heterozygous C677T/A1298C mutations group (5 patients), while 3 deliveries were in A1298C homozygous mutations group (4 patients). In conclusion, supraphysiologic methylfolate, vitamins B6 and B12 supplementation in woman with MTHFR mutations has a beneficial effect on pregnancy outcome. Copyright © 2017 Elsevier Inc. All rights reserved.

Association of MTHFR C677T Genotype With Ischemic Stroke Is Confined to Cerebral Small Vessel Disease Subtype

PubMed Central

Traylor, Matthew; Adib-Samii, Poneh; Thijs, Vincent; Sudlow, Cathie; Rothwell, Peter M.; Boncoraglio, Giorgio; Dichgans, Martin; Meschia, James; Maguire, Jane; Levi, Christopher; Rost, Natalia S.; Rosand, Jonathan; Hassan, Ahamad; Bevan, Steve; Markus, Hugh S.

2016-01-01

Background and Purpose— Elevated plasma homocysteine levels are associated with stroke. However, this might be a reflection of bias or confounding because trials have failed to demonstrate an effect from homocysteine lowering in stroke patients, although a possible benefit has been suggested in lacunar stroke. Genetic studies could potentially overcome these issues because genetic variants are inherited randomly and are fixed at conception. Therefore, we tested the homocysteine levels–associated genetic variant MTHFR C677T for association with magnetic resonance imaging–confirmed lacunar stroke and compared this with associations with large artery and cardioembolic stroke subtypes. Methods— We included 1359 magnetic resonance imaging–confirmed lacunar stroke cases, 1824 large artery stroke cases, 1970 cardioembolic stroke cases, and 14 448 controls, all of European ancestry. Furthermore, we studied 3670 ischemic stroke patients in whom white matter hyperintensities volume was measured. We tested MTHFR C677T for association with stroke subtypes and white matter hyperintensities volume. Because of the established association of homocysteine with hypertension, we additionally stratified for hypertension status. Results— MTHFR C677T was associated with lacunar stroke (P=0.0003) and white matter hyperintensity volume (P=0.04), but not with the other stroke subtypes. Stratifying the lacunar stroke cases for hypertension status confirmed this association in hypertensive individuals (P=0.0002), but not in normotensive individuals (P=0.30). Conclusions— MTHFR C677T was associated with magnetic resonance imaging–confirmed lacunar stroke, but not large artery or cardioembolic stroke. The association may act through increased susceptibility to, or interaction with, high blood pressure. This heterogeneity of association might explain the lack of effect of lowering homocysteine in secondary prevention trials which included all strokes. PMID:26839351

Methylenetetrahydrofolate reductase gene polymorphisms and recurrent pregnancy loss in China: a systematic review and meta-analysis.

PubMed

Chen, Hui; Yang, Xiaorong; Lu, Ming

2016-02-01

Recurrent pregnancy loss (RPL) is defined as two or more consecutive pregnancy losses before the 20th week of gestation with the same partner. Methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms were reported to have an effect on embryonic development and pregnancy success. To clarify the effects of MTHFR polymorphisms on the risk of RPL in the Chinese population, a meta-analysis was performed. Related studies were identified from Medline, Embase, Web of Science, and Chinese Databases up to March 7th, 2015. We extracted the number of both C677T and A1298C genotypes in the cases and controls. Odds ratios (ORs) and 95 % confidence intervals (95 % CIs) were used to estimate the associations. Data analysis was performed using Stata 13.1. Sixteen articles involving 1420 RPL cases and 1408 controls were included in this meta-analysis. MTHFR C677T polymorphism was significantly associated with RPL risk under dominant (TT + CT vs. CC; OR 2.10, 95 % CI 1.76-2.50), recessive (TT vs. CC + CT; OR 2.36, 95 % CI 1.92-2.90), heterozygote (CT vs. CC; OR 1.77, 95 % CI 1.32-2.37), homozygote (TT vs. CC; OR 3.55, 95 % CI 2.76-4.56), and additive (T vs. C; OR 1.83, 95 % CI 1.64-2.05) model. Sensitivity analyses excluding studies that deviated from HWE did not change the direction of effect. For the A1298C mutation, no significant association was found. The Egger's regression asymmetry test showed no significant publication bias. Identification of MTHFR C677T mutation would have some implication for primary prevention of RPL and screening of high-risk individuals in China. Large well-designed researches are needed to fully describe the associations.

Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

PubMed

Zhu, L

2015-07-28

We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion.

Plasma homocysteine and vitamin B12 serum levels, red blood cell folate concentrations, C677T methylenetetrahydrofolate reductase gene mutation and risk of recurrent miscarriage: a case-control study in Spain.

PubMed

Creus, Montserrat; Deulofeu, Ramon; Peñarrubia, Joana; Carmona, Francisco; Balasch, Juan

2013-03-01

Hyperhomocysteinemia and methylenetetrahydrofolate reductase (MTHFR) gene mutation have been postulated as a possible cause of recurrent miscarriage (RM). There is a wide variation in the prevalence of MTHFR polymorphisms and homocysteine (Hcy) plasma levels among populations around the world. The present study was undertaken to investigate the possible association between hyperhomocysteinemia and its causative genetic or acquired factors and RM in Catalonia, a Mediterranean region in Spain. Sixty consecutive patients with ≥ 3 unexplained RM and 30 healthy control women having at least one child but no previous miscarriage were included. Plasma Hcy levels, MTHFR gene mutation, red blood cell (RBC) folate and vitamin B12 serum levels were measured in all subjects. No significant differences were observed neither in plasma Hcy levels, RBC folate and vitamin B12 serum levels nor in the prevalence of homozygous and heterozygous MTHFR gene mutation between the two groups studied. In the present study RM is not associated with hyperhomocysteinemia, and/or the MTHFR gene mutation.

Association between methylenetetrahydrofolate reductase polymorphisms and the relapse of acute lymphoblastic leukemia: a meta-analysis.

PubMed

He, H-R; Chen, S-Y; You, H-S; Hu, S-S; Sun, J-Y; Dong, Y-L; Lu, J

2014-10-01

Relapse is a threat in patients treated for acute lymphoblastic leukemia (ALL). Methylenetetrahydrofolate reductase (MTHFR) activity may affect the sensitivity of patients to folate-based chemotherapeutic drugs, thus influencing the relapse risk. Two polymorphisms of the gene encoding MTHFR, C677T and A1298C, alter MTHFR enzyme activity and may be associated with ALL relapse. The aim of this meta-analysis was to clarify the correlation between the C677T and A1298C polymorphisms and ALL relapse. To this end, data were collected from studies of the association between these two polymorphisms and ALL relapse. Analysis of the data revealed a serious contradiction among the results. A recessive model demonstrated that the ALL relapse risk was significantly increased in carriers of the 677 TT genotype, especially for pediatric ALL, but was unaffected by the A1298C polymorphism. These findings confirm that the MTHFR C677T polymorphism could be considered as a good marker of the pediatric ALL relapse risk.

Methylenetetrahydrofolate Reductase Gene Polymorphisms in Children with Attention Deficit Hyperactivity Disorder

PubMed Central

Gokcen, Cem; Kocak, Nadir; Pekgor, Ahmet

2011-01-01

Objective: The purpose of this study was to evaluate the relationship between 5,10- methylenetetrahydrofolate reductase (MTHFR) polymorphisms and Attention Deficit Hyperactivity Disorder (ADHD) in a sample of Turkish children. Study Design: MTHFR gene polymorphisms were assessed in 40 patients with ADHD and 30 healty controls. Two mutations in the MTHFR gene were investigated using polymerase chain reactions and restriction fragment length polymorphisms. Results: Although there were no statistically significant differences in genotype distributions of the C677T alleles between the ADHD and the control groups (p=0,678) but the genotypic pattern of the distributions of the A1298C alleles was different between the ADHD patients and the controls (p=0,033). Conclusions: Preliminary data imply a possible relationship between A1298C MTHFR polymorphisms and the ADHD. PMID:21897766

Methylene tetrahydrofolate reductase (MTHFR) gene polymorphisms in chronic myeloid leukemia: an Egyptian study.

PubMed

Khorshied, Mervat Mamdooh; Shaheen, Iman Abdel Mohsen; Abu Khalil, Reham E; Sheir, Rania Elsayed

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) gene plays a pivotal role in folate metabolism. Several genetic variations in MTHFR gene as MTHFR-C677T and MTHFR-A1298C result in decreased MTHFR activity, which could influence efficient DNA methylation and explain susceptibility to different cancers. The etiology of chronic myeloid leukemia (CML) is obscure and little is known about individual's susceptibility to CML. In order to assess the influence of these genetic polymorphisms on the susceptibility to CML and its effect on the course of the disease among Egyptians, we performed an age-gender-ethnic matched case-control study. The study included 97 CML patients and 130 healthy controls. Genotyping of MTHFR-C677T and -A1298C was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. The results showed no statistical difference in the distribution of MTHFR-C677T and -A1298C polymorphic genotypes between CML patients and controls. The frequency of MTHFR 677-TT homozygous variant was significantly higher in patients with accelerated/blastic transformation phase when compared to those in the chronic phase of the disease. In conclusion, our study revealed that MTHFR-C677T and -A1298C polymorphisms could not be considered as genetic risk factors for CML in Egyptians. However, MTHFR 677-TT homozygous variant might be considered as a molecular predictor for disease progression.

Methylenetetrahydrofolate reductase gene polymorphisms: association with risk for pediatric acute lymphoblastic leukemia in north Indians.

PubMed

Sood, Swati; Das, Reena; Trehan, Amita; Ahluwalia, Jasmina; Sachdeva, Man Updesh; Varma, Neelam; Bansal, Deepak; Marwaha, Ram Kumar

2010-05-01

Genetic polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene have been associated with the development of acute leukemias and various malignancies. We conducted a case-control study in 95 north Indian children with acute lymphoblastic leukemia (ALL) and 255 controls, to investigate the role of MTHFR C677T and A1298C polymorphisms as risk factors in the development of ALL. PCR-RFLP on genomic DNA was carried out to determine C677T and A1298C genotypes. The frequency of MTHFR C677T for the T allele was found to be 23.2% among patients and 18.2% among controls. The frequency of the C allele in MTHFR A1298C was 44.2% among cases and 48.2% in controls. Patients showed a higher frequency of heterozygosity for the MTHFR C677T polymorphism as compared to controls (40% vs 27.8%; OR = 1.73, 95% CI 1.02-2.91, p = 0.02), and the A1298C polymorphism did not show any difference in genotype frequency between cases and controls. MTHFR 677CC/1298AC genotype frequencies showed a statistically significant difference between cases and controls (OR = 0.58, 95% CI 0.34-1.01, p = 0.04). In conclusion, our study in north Indian controls and patients with pediatric ALL showed increased frequency for MTHFR C677T in the heterozygous state and no significant difference in the frequency of A1298C genotype between the two groups.

Plasma folate, methylenetetrahydrofolate reductase (MTHFR), and colorectal cancer risk in three large nested case-control studies

USDA-ARS?s Scientific Manuscript database

Few prospective studies have examined the associations between blood levels of folate, in conjunction with methylenetetrahydrofolate reductase (MTHFR) polymorphisms, and colorectal cancer. We evaluated the associations between plasma folate, MTHFR C677T, and A1298C, and colorectal cancer in three la...

Methylenetetrahydrofolate reductase A1298C genotypes are associated with the risks of acute lymphoblastic leukaemia and chronic myelogenous leukaemia in the Korean population.

PubMed

Hur, M; Park, J Y; Cho, H C; Lee, K M; Shin, H Y; Cho, H I

2006-06-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme involved in folate metabolism, DNA methylation and synthesis. We investigated the association between MTHFR polymorphisms and the risks of acute and chronic leukaemias. MTHFR C677T and A1298C were genotyped in 396 Korean individuals using multiplex polymerase chain reaction/restriction fragment-length polymorphism. They were acute lymphoblastic leukaemia (ALL, n = 89), acute myeloid leukaemia (AML, n = 55), biphenotypic acute leukaemia (n = 12), chronic myelogenous leukaemia (CML, n = 40), and normal controls (n = 200). C677T genotypes were not associated with the risk of each disease. A1298C variants, however, significantly decreased the risks of ALL and CML compared with 1298AA. Odds ratios and 95% confidence intervals of 1298AC and 1298AC + CC were 0.53 (0.31-0.93) and 0.54 (0.31-0.93) in ALL, and 0.34 (0.14-0.80) and 0.40 (0.18-0.89) in CML, respectively, compared with 1298AA. These findings demonstrate that the development of ALL and CML is more dependent on folate status, and more susceptible to DNA instability than that of AML. In addition, A1298C rather than C677T may be a more important genetic risk modifier in leukaemogenesis at least in the Korean population.

Methotrexate-induced mucositis in acute leukemia patients is not associated with the MTHFR 677T allele in Mexico.

PubMed

Ruiz-Argüelles, Guillermo J; Coconi-Linares, Lucia Nancy; Garcés-Eisele, Javier; Reyes-Núñez, Virginia

2007-10-01

Methylenetetrahydrofolate reductase (MTHFR) has two common variants with reduced activity due to polymorphisms at nucleotides 677 and 1298. Both affect folate metabolism and thus remethylation of homocysteine, but are also thought to affect nucleotide synthesis and DNA methylation. Methotrexate (MTX), which interrupts folate metabolism, is used in the treatment of a variety of diseases including acute lymphoblastic leukemia (ALL), but exerts in some patients toxic effects on fast dividing tissues such as mucosal epithelia. The enhanced toxicity may be due to cooperative effects between MTX and MTHFR variants. Accordingly, it has been reported that carrying the 677T allele of the MTHFR is a risk factor for MTX-associated mucositis. As in the Mexican population, which is characterized by a high prevalence of the 677T MTHFR variant, several of its commonly associated defects have not been observed, we investigated the relationship between MTX toxicity and the 677T allele. Out of 28 patients with ALL (CC: 2, CT: 10, TT: 16), 16 had episodes of MTX-associated mucositis (CC: 0, CT: 6, TT: 10). Neither at the gene level nor at the genotype level was a significant association with mucositis found. It may be postulated that the risk of higher MTX toxicity in patients with decreased MTHFR activity could be neutralized by the normally folate rich diet in Mexico.

The association of factor V G1961A (factor V Leiden), prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women.

PubMed

Jusić, Amela; Balić, Devleta; Avdić, Aldijana; Pođanin, Maja; Balić, Adem

2018-08-01

Aim To investigate association of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms with recurrent pregnancy loss in Bosnian women. Methods A total of 60 women with two or more consecutive miscarriages before 20 weeks of gestation with the same partners and without history of known causes or recurrent pregnancy loss were included. A control group included 80 healthy women who had one or more successful pregnancies without history of any complication which could be associated with miscarriages. Genotyping of factor V Leiden, prothrombin G20210A, MTHFR C677T and PAI-1 4G/5G polymorphisms were performed by polymerase chain reaction/restriction fragments length polymorphism method (PCR/RFLP). Results Both factor V Leiden and MTHFR C677T polymorphisms were significantly associated with recurrent pregnancy loss (RPL) in Bosnian women while prothrombin G20210A and PAI-1 4G/5G polymorphisms did not show strongly significant association. Conclusion The presence of thrombophilic polymorphisms may predispose women to recurrent pregnancy loss. Future investigation should be addressed in order to find when carriers of those mutations, polymorphisms should be treated with anticoagulant therapy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.

Associations between Methylenetetrahydrofolate Reductase (MTHFR) Polymorphisms and Non-Alcoholic Fatty Liver Disease (NAFLD) Risk: A Meta-Analysis

PubMed Central

Sun, Man-Yi; Zhang, Li; Shi, Song-Li; Lin, Jing-Na

2016-01-01

Background C677T and A1298C are the most common allelic variants of Methylenetetrahydrofolate Reductase (MTHFR) gene. The association between MTHFR polymorphisms and the occurrence of non-alcoholic fatty liver disease (NAFLD) remains controversial. This study was thus performed to examine whether MTHFR mutations are associated with the susceptibility to NAFLD. Methods A first meta-analysis on the association between the MTHFR polymorphisms and NAFLD risks was carried out via Review Manager 5.0 and Stata/SE 12.0 software. The on-line databases, such as PubMed, EMBASE, CENTRAL, WOS, Scopus and EBSCOhost (updated to April 1st, 2016), were searched for eligible case-control studies. The odd radio (OR), 95% confidence interval (CI) and P value were calculated through Mantel-Haenszel statistics under random- or fixed-effect model. Results Eight articles (785 cases and 1188 controls) contributed data to the current meta-analysis. For C677T, increased NAFLD risks were observed in case group under homozygote model (T/T vs C/C, OR = 1.49, 95% CI = 1.03~2.15, P = 0.04) and recessive model (T/T vs C/C+C/T, OR = 1.42, 95% CI = 1.07~1.88, P = 0.02), but not the other genetics models, compared with control group. For A1298C, significantly increased NAFLD risks were detected in allele model (C vs A, OR = 1.53, 95% CI = 1.13~2.07, P = 0.006), homozygote model (C/C vs A/A, OR = 2.81, 95% CI = 1.63~4.85, P = 0.0002), dominant model (A/C+C/C vs A/A, OR = 1.60, 95% CI = 1.06~2.41, P = 0.03) and recessive model (C/C vs A/A+A/C, OR = 2.08, 95% CI = 1.45~3.00, P<0.0001), but not heterozygote model. Conclusion T/T genotype of MTHFR C677T polymorphism and C/C genotype of MTHFR A1298C are more likely to be associated with the susceptibility to NAFLD. PMID:27128842

The relationship between methylenetetrahydrofolate reductase polymorphism and hematological malignancy.

PubMed

Jiang, Ni; Zhu, Xishan; Zhang, Hongmei; Wang, Xiaoli; Zhou, Xinna; Gu, Jiezhun; Chen, Baoan; Ren, Jun

2014-01-01

Methylenetetrahydrofolate reductase (MTHFR) is the key enzyme for folate metabolism. Previous studies suggest a relationship between its single nucleotide polymorphisms (SNP) of C677T and A1298C with a variety of tumor susceptibility including hematological malignancy. SNP frequency distribution in different ethnic populations might lead to differences in disease susceptibility. There has been little research in Chinese people on the MTHFR SNP with the susceptibility of the hematological malignancy. Therefore, this study investigated the relationship between MTHFR SNPs and hematological malignancy in Jiangsu province in China. Gene microarray was used to detect MTHFR C677T and A1298C single nucleotide polymorphism loci on 157 healthy controls and 127 patients from Jiangsu province with hematological malignancies (30 with multiple myeloma, 28 with non-Hodgkin's lymphoma, 22 with acute lymphoblastic leukemia, 40 with acute myeloid leukemia, and seven with chronic myeloid leukemia). The allele frequency of 677T was 41.3% in patients and 33.1% in controls, showed significant difference (chi2 = 4.08, p = 0.043); 677TT genotype with a high susceptibility to hematological malignancy (OR 1.96, 95% CI 1.01 - 4.45, p = 0.041). In subgroup analyses, the genotypes 677TT and 1298CC were associated with significantly increased multiple myeloma risk (TT vs. CC: OR 8.92, 95% CI 1.06 - 75.24, p = 0.006; CC vs. AA: OR = 4.80, 95% CI 1.56 - 14.73, p = 0.044). No associations were found between polymorphisms and susceptibilities to acute lymphoblastic leukemia, acute myeloid leukemia, or non-Hodgkin's lymphoma. MTHFRC677T polymorphisms influence the risk of hematological malignancy among the population in Jiangsu province. Both MTHFR 677TT and MTHFR 1298CC genotypes increase susceptibility to myeloid leukemia.

Methylenetetrahydrofolate reductase gene haplotypes affect toxicity during maintenance therapy for childhood acute lymphoblastic leukemia in Japanese patients.

PubMed

Tanaka, Yoichi; Manabe, Atsushi; Nakadate, Hisaya; Kondoh, Kensuke; Nakamura, Kozue; Koh, Katsuyoshi; Kikuchi, Akira; Komiyama, Takako

2014-05-01

Abstract The aim of this study was to investigate the influence of daily 6-mercaptopurine (6-MP) and low-dose weekly methotrexate (MTX) combination treatment and methylenetetrahydrofolate reductase (MTHFR) haplotypes on toxicity during maintenance therapy in Japanese childhood acute lymphoblastic leukemia (ALL). We retrospectively analyzed the MTHFR C677T and A1298C polymorphisms and influence of haplotypes on toxicity in 73 patients. Patients with the MTHFR 677TT and 677CT + 1298AC were associated with severe liver toxicity (p = 0.014, odds ratio [OR] = 3.82, 95% confidence interval [CI] = 1.27-11.46) and more rapid onset of liver toxicity (p = 0.010). Patients with MTHFR 677TT and 677CT + 1298AC were associated with lower frequency of 6-MP and MTX dose reduction due to leukopenia (p < 0.05). No difference was observed in average drug doses in the MTHFR genotypes. In conclusion, the MTHFR C677T and A1298C haplotypes might be useful for monitoring adverse effects in childhood ALL maintenance therapy in Japanese patients.

Methylenetetrahydrofolate reductase polymorphisms, serum methylenetetrahydrofolate reductase levels, and risk of childhood acute lymphoblastic leukemia in a Chinese population.

PubMed

Tong, Na; Fang, Yongjun; Li, Jie; Wang, Meilin; Lu, Qin; Wang, Shizhi; Tian, Yuanyuan; Rong, Liucheng; Sun, Jielin; Xu, Jianfeng; Zhang, Zhengdong

2010-03-01

Methylenetetrahydrofolate reductase (MTHFR), involved in DNA methylation and nucleotide synthesis, is thought to be associated with a decreased risk of adult and childhood acute lymphoblastic leukemia (ALL). Accumulating evidence has indicated that two common genetic variants, C677T and A1298C, are associated with cancer risk. We hypothesized that these two variants were associated with childhood ALL susceptibility and influence serum MTHFR levels. We genotyped these two polymorphisms and detected MTHFR levels in a case-control study of 361 cases and 508 controls. Compared with the 677CC and 677CC/CT genotypes, the 677TT genotype was associated with a statistically significantly decreased risk of childhood ALL (odds ratio = 0.53, 95% confidence interval = 0.32-0.88, and odds ratio = 0.55, 95% confidence interval = 0.35-0.88, respectively). In addition, a pronounced reduced risk of ALL was observed among low-risk ALL and B-phenotype ALL. Moreover, the mean serum MTHFR level was 8.01 ng/mL (+/-4.38) in cases and 9.27 ng/mL (+/-4.80) in controls (P < 0.001). MTHFR levels in subjects with 677TT genotype was significantly higher than those with 677CC genotype (P = 0.010) or 677CT genotype (P = 0.043) in controls. In conclusion, our results provide evidence that the MTHFR polymorphisms might contribute to reduced childhood ALL risk in this population.

MTHFR 677CC/1298CC genotypes are highly associated with chronic myelogenous leukemia: a case-control study in Korea.

PubMed

Moon, Hee Won; Kim, Tae Young; Oh, Bo Ra; Min, Hyun Chung; Cho, Han Ik; Bang, Soo Mee; Lee, Jae Hoon; Yoon, Sung Soo; Lee, Dong Soon

2007-09-01

Methylenetetrahydrofolate reductase (MTHFR) is an enzyme involved in folate metabolism and DNA methylation. Studies on MTHFR polymorphism in leukemia have largely focused on the protective role of MTHFR polymorphism in acute lymphoblastic leukemia (ALL). We evaluated the C677T and A1298C polymorphisms using the TaqMan allelic discrimination assay in various malignancies. The study population included 115 subjects with chronic myelogenous leukemia (CML), 200 with acute myelogenous leukemia (AML), 196 with multiple myeloma (MM) and 434 healthy control subjects. The frequency of 1298CC was statistically significantly higher in subjects with CML than that of the controls (OR=5.12, 95% CI: 1.75-14.9, P-value=.003). Of note, the frequencies of 677CC/1298CC genotype were statistically significantly higher in subjects with CML, AML and MM than that of the controls (OR=8.8, 3.5, 3.83, P-value=.002, 0.036, 0.023, respectively). Our results demonstrate that the MTHFR 1298CC homozygote variant is strongly associated with an increased risk of CML, while MTHFR C677T does not significantly affect the risk of CML. Moreover, we demonstrated that MTHFR 677CC and 1298CC genotype might have combined effect on risk of CML, AML and MM and it is inferred that the A1298C may play a different role in carcinogenesis, depending on the types of organs involved, the types of disease entities and the genotype of C677T.

The role of methylenetetrahydrofolate reductase in acute lymphoblastic leukemia in a Brazilian mixed population.

PubMed

Zanrosso, Crisiane Wais; Hatagima, Ana; Emerenciano, Mariana; Ramos, Flávio; Figueiredo, Alexandre; Félix, Têmis Maria; Segal, Sandra L; Giugliani, Roberto; Guigliani, Roberto; Muniz, Maria Tereza Cartaxo; Pombo-de-Oliveira, Maria S

2006-04-01

The polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene are associated with leukemogenesis. In order to investigate the influence of two polymorphisms in the MTHFR gene, 677C>T and 1298A>C, on the risk of acute lymphoblastic leukemia (ALL) we performed a case-control study in children from different Brazilians' regions. Genotyping of 176 ALL and 199 unselected healthy subjects was performed using PCR-RFLP assay. There was no association between the 677C>T or 1298A>C and risk of ALL in total case-control sample. However, 677T allele was linked to a decrease risk of ALL [odds ratio (OR), 0.43; 95% confidence interval (CI), 0.22-0.86], whereas the 1298A>C polymorphism presents an elevated risk factor [OR, 2.01; 95% CI, 1.01-3.99] in non-White children. Our investigation provides interesting data concerning the opposite effect of A1298C polymorphisms, particularly in the light of relatively scarce data regarding the MTHFR role in leukemia susceptibility in different populations.

The association of methylenetetrahydrofolate reductase genotypes with the risk of childhood leukemia in Taiwan.

PubMed

Pei, Jen-Sheng; Hsu, Chin-Mu; Tsai, Chia-Wen; Chang, Wen-Shin; Ji, Hong-Xue; Hsiao, Chieh-Lun; Miao, Chia-En; Hsu, Yuan-Nian; Bau, Da-Tian

2015-01-01

Acute lymphoblastic leukemia (ALL) is the most prevalent type of pediatric cancer, the causes of which are likely to involve an interaction between genetic and environmental factors. To evaluate the effects of the genotypic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) on childhood ALL risk in Taiwan, two well-known polymorphic genotypes of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed to examine the extent of their associations with childhood ALL susceptibility and to discuss the MTHFR genotypic contribution to childhood ALL risk among different populations. In total, 266 patients with childhood ALL and an equal number of non-cancer controls recruited were genotyped utilizing PCR-RFLP methodology. The MTHFR C677T genotype, but not the A1298C, was differently distributed between childhood ALL and control groups. The CT and TT of MTHFR C677T genotypes were significantly more frequently found in controls than in childhood ALL patients (odds ratios=0.60 and 0.48, 95% confidence intervals=0.42-0.87 and 0.24-0.97, respectively). As for gender, the boys carrying the MTHFR C677T CT or TT genotype conferred a lower odds ratio of 0.51 (95% confidence interval=0.32-0.81, P=0.0113) for childhood ALL. As for age, those equal to or greater than 3.5 years of age at onset of disease carrying the MTHFR C677T CT or TT genotype were of lower risk (odds ratio= 0.43 and 95% confidence interval=0.26-0.71, P=0.0016). Our results indicated that the MTHFR C677T T allele was a protective biomarker for childhood ALL in Taiwan, and the association was more significant in male patients and in patients 3.5 years of age or older at onset of disease.

Methylenetetrahydrofolate reductase polymorphisms and risk of acute lymphoblastic leukemia-evidence from an updated meta-analysis including 35 studies.

PubMed

Wang, Haigang; Wang, Jiali; Zhao, Lixia; Liu, Xinchun; Mi, Wenjie

2012-09-04

5,10-methylenetetrahydrofolate reductase (MTHFR) variants, C677T and A1298C, have been reported to be associated with decreased risk of acute lymphoblastic leukemia (ALL). However, results derived from individually underpowered studies are conflicting. We carried out an updated meta-analysis on the association between MTHFR polymorphisms and ALL risk. Relevant publications were searched through PUBMED and EMBASE databases. The associations between MTHFR C677T and A1298C polymorphisms and the risk of ALL were evaluated by odds ratios (ORs). The heterogeneity and publication bias were estimated. Meta-regression analysis was performed to evaluate the potential sources of heterogeneity. C677T polymorphism was associated with a reduced risk of ALL (allele contrast: ORRE = 0.91, 95% CI: 0.83-0.99). Subgroup analysis showed MTHFR C677T variant was associated with decreased susceptibility to ALL in children and Caucasians. Meta-regression showed the logOR for the association between T allele and ALL increased as sex ratio (M/F) in the case group increased (P = 0.01). Regarding A1298C polymorphism, no significant association was observed (allele contrast: ORRE = 1.01, 95% CI: 0.91-1.11). There was no publication bias for C677T or A1298C polymorphism. The present meta-analysis suggests that the C677T polymorphism, not A1298C, in MTHFR gene is associated with a decreased risk of ALL, particularly among children and Caucasians subjects. Our findings suggest that the influence of the C677T polymorphism on ALL susceptibility is modified by sex ratio in cases (M/F). Since folate intake may be a possible confounding factor, including this factor in future prospective studies is warranted. Further meta-analysis studies should be at least stratified for folate levels and gender to give more powerful and informative results.

Methylenetetrahydrofolate reductase gene polymorphisms contribute to acute myeloid leukemia and chronic myeloid leukemia susceptibilities: evidence from meta-analyses.

PubMed

He, Hairong; He, Gonghao; Wang, Taotao; Cai, Jiangxia; Wang, Yan; Zheng, Xiaowei; Dong, Yalin; Lu, Jun

2014-10-01

The expression of methylenetetrahydrofolate reductase (MTHFR) is associated with acute myeloid leukemia (AML) and chronic myeloid leukemia (CML). Most studies have linked the common functional C677T and A1298C polymorphisms of the MTHFR gene and susceptibility to AML and CML, but the results were not consistent. The aim of the present study was to derive a more precise estimation of the relationship. Meta-analyses assessing the association of MTHFR C677T and A1298C variations with AML and CML were conducted. Eligible articles were identified from the PubMed and EMBASE databases. All statistical analyses were conducted using Review Manager Software. 10 and 10 studies were included in the meta-analysis about the role of C677T polymorphism on the AML and CML risks, respectively; 6 and 4 studies were included about the role of A1298C polymorphism on the AML and CML risks, respectively. Overall, both the C677T and A1298C polymorphisms were significantly associated with CML risk under the recessive model (P=0.04, OR=1.35, 95% CI=1.02-1.79 for C677T and P=0.003, OR=2.17, 95% CI=1.29-3.63 for A1298C). In addition, the risk of CML was higher in 1298CC genotype carriers than in 1298AA genotype carriers (P=0.004, OR=2.17, 95%=1.28-3.69). Conversely, the overall data failed to indicate a significant association of C677T or A1298C polymorphisms with AML risk under any model. The findings provide evidence that C677T and A1298C polymorphisms are risk factors for CML risk. Copyright © 2014 Elsevier Ltd. All rights reserved.

DPYD*2A and MTHFR C677T predict toxicity and efficacy, respectively, in patients on chemotherapy with 5-fluorouracil for colorectal cancer.

PubMed

Nahid, Noor Ahmed; Apu, Mohd Nazmul Hasan; Islam, Md Reazul; Shabnaz, Samia; Chowdhury, Surid Mohammad; Ahmed, Maizbha Uddin; Nahar, Zabun; Islam, Md Siddiqul; Islam, Mohammad Safiqul; Hasnat, Abul

2018-01-01

Significant inter-individual variation in the sensitivity to 5-fluorouracil (5-FU) represents a major therapeutic hindrance either by impairing drug response or inducing adverse drug reactions (ADRs). This study aimed at exploring the cause behind this inter-individual alterations in consequences of 5-fluorouracil-based chemotherapy by investigating the effects of DPYD*2A and MTHFR C677T polymorphisms on toxicity and response of 5-FU in Bangladeshi colorectal cancer patients. Colorectal cancer patients (n = 161) receiving 5-FU-based chemotherapy were prospectively enrolled. DPYD and MTHFR polymorphisms were assessed in peripheral leukocytes. Multivariate analyses were applied to evaluate which variables could predict chemotherapy-induced toxicity and efficacy. Multivariate analyses showed that DPYD*2A polymorphism was a predictive factor (P = 0.023) for grade 3 and grade 4 5-fluorouracil-related toxicities. Although MTHFR C677T polymorphism might act as forecasters for grade 3 or grade 4 neutropenia, diarrhea, and mucositis, this polymorphism was found to increase significantly (P = 0.006) the response of 5-FU. DPYD*2A and MTHFR C677T polymorphisms could explain 5-FU toxicity or clinical outcome in Bangladeshi colorectal patients.

Association between the MTHFR C677T polymorphism and risk of cancer: evidence from 446 case-control studies.

PubMed

Xie, Shu-Zhe; Liu, Zhi-Zhong; Yu, Jun-hua; Liu, Li; Wang, Wei; Xie, Dao-Lin; Qin, Jiang-Bo

2015-11-01

Many molecular epidemiological studies have been performed to explore the association between MTHFR C677T polymorphism and cancer risk in diverse populations. However, the results were inconsistent. Hence, we performed a meta-analysis to investigate the association between cancer risk and MTHFR C677T (150,086 cases and 200,699 controls from 446 studies) polymorphism. Overall, significantly increased cancer risk was found when all eligible studies were pooled into the meta-analysis. In the further stratified and sensitivity analyses, significantly increased breast cancer risk was found in Asians and Indians, significantly decreased colon cancer risk was found, significantly decreased colorectal cancer risk was found in male population, significantly increased gastric cancer risk was found in Caucasians and Asians, significantly increased hepatocellular cancer risk was found in Asians, significantly decreased adult acute lymphoblastic leukemia (AALL) risk was found in Caucasians, significantly decreased childhood acute lymphoblastic leukemia (CALL) risk was found in Asians, and significantly increased multiple myeloma and NHL risk was found in Caucasians. In summary, this meta-analysis suggests that MTHFR C677T polymorphism is associated with increased breast cancer, gastric cancer, and hepatocellular cancer risk in Asians, is associated with increased gastric cancer, multiple myeloma, and NHL risk in Caucasians, is associated with decreased AALL risk in Caucasians, is associated with decreased CALL risk in Asians, is associated with increased breast cancer risk in Asians, is associated with decreased colon cancer risk, and is associated with decreased colorectal cancer risk in male population. Moreover, this meta-analysis also points out the importance of new studies, such as Asians of HNC, Asians of lung cancer, and Indians of breast cancer, because they had high heterogeneity in this meta-analysis (I(2) > 75%).

Are the methylenetetrahydrofolate reductase 1298 and 677 gene polymorphisms related to optic glioma and hamartoma risk in neurofibromatosis type 1 patients?

PubMed

Tanyıldız, Hikmet Gülşah; Yeşil, Şule; Bozkurt, Ceyhun; Çandır, Mehmet Onur; Akpınar-Tekgündüz, Sibel; Toprak, Şule; Yüksel, Deniz; Şahin, Gürses

2016-01-01

The methylenetetrahydrofolate reductase (MTHFR) gene plays a key role in carcinogenesis through its effects on DNA synthesis and methylation and also has a significant role in the etiology of many disorders, such as diabetes, migraine, and cardiovascular disease. Neurofibromatoses (NF) are autosomal dominant inherited diseases that can affect tissues such as bone and skin and predispose individuals to tumor development in various parts of the nervous system or body. Optic nerve glioma and brain tumors are common in children with NF, and leukemia and lymphoma incidence is also higher than normal. We therefore aimed to investigate the possible relationship between the MTHFR gene polymorphism and accompanying tumors such as neurofibroma, hamartoma, and optic glioma in children with NF1 found to have the MTHFR 677 and MTHFR 1298 gene polymorphism in this study. We included 55 pediatric patients diagnosed with NF1 between 2005 and 2014 in the study group. The control group included 44 healthy subjects without acute or chronic disease findings. A significant relationship was found between the MTHFR A1298C polymorphism and the incidence of optic glioma (p=0.014) (AA vs. AC: OR 11, 95% CI 1.27-95.17; AA vs. CC: OR 7.33, 95% CI 0.35-150.70). We also found a significant relationship between the MTHFR C1298C polymorphism and the incidence of hamartoma (p=0.019) (AA vs. AC: OR 2.12, 95% CI 0.662-6.809; p=0.203). Epilepsy incidence was high in subjects with MTHFR C677C. The MTHFR A1298C, C1298C, and C677C gene polymorphisms can be associated with a higher optic glioma, hamartoma, and epilepsy incidence, respectively, in patients diagnosed with neurofibromatosis type 1.

Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white-matter integrity in Alzheimer's disease.

PubMed

Chang, Yu-Tzu; Hsu, Shih-Wei; Tsai, Shih-Jen; Chang, Ya-Ting; Huang, Chi-Wei; Liu, Mu-En; Chen, Nai-Ching; Chang, Wen-Neng; Hsu, Jung-Lung; Lee, Chen-Chang; Chang, Chiung-Chih

2017-06-01

The 677 C to T transition in the MTHFR gene is a genetic determinant for hyperhomocysteinemia. We investigated whether this polymorphism modulates gray matter (GM) structural covariance networks independently of white-matter integrity in patients with Alzheimer's disease (AD). GM structural covariance networks were constructed by 3D T1-magnetic resonance imaging and seed-based analysis. The patients were divided into two genotype groups: C homozygotes (n = 73) and T carriers (n = 62). Using diffusion tensor imaging and white-matter parcellation, 11 fiber bundle integrities were compared between the two genotype groups. Cognitive test scores were the major outcome factors. The T carriers had higher homocysteine levels, lower posterior cingulate cortex GM volume, and more clusters in the dorsal medial lobe subsystem showing stronger covariance strength. Both posterior cingulate cortex seed and interconnected peak cluster volumes predicted cognitive test scores, especially in the T carriers. There were no between-group differences in fiber tract diffusion parameters. The MTHFR 677T polymorphism modulates posterior cingulate cortex-anchored structural covariance strength independently of white matter integrities. Hum Brain Mapp 38:3039-3051, 2017. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc. © 2017 The Authors Human Brain Mapping Published Wiley by Periodicals, Inc.

Meta-Prediction of the Effect of Methylenetetrahydrofolate Reductase Polymorphisms and Air Pollution on Alzheimer's Disease Risk.

PubMed

Wu, Suh-Mian; Chen, Zhao-Feng; Young, Lufei; Shiao, S Pamela K

2017-01-11

Background : Alzheimer's disease (AD) is a significant public health issue. AD has been linked with methylenetetrahydrofolate reductase ( MTHFR ) C677T polymorphism, but the findings have been inconsistent. The purpose of this meta-predictive analysis is to examine the associations between MTHFR polymorphisms and epigenetic factors, including air pollution, with AD risk using big data analytics approaches. Methods and Results : Forty-three studies (44 groups) were identified by searching various databases. MTHFR C677T TT and CT genotypes had significant associations with AD risk in all racial populations (RR = 1.13, p = 0.0047; and RR = 1.12, p < 0.0001 respectively). Meta-predictive analysis showed significant increases of percentages of MTHFR C677T polymorphism with increased air pollution levels in both AD case group and control group ( p = 0.0021-0.0457); with higher percentages of TT and CT genotypes in the AD case group than that in the control group with increased air pollution levels. Conclusions : The impact of MTHFR C677T polymorphism on susceptibility to AD was modified by level of air pollution. Future studies are needed to further examine the effects of gene-environment interactions including air pollution on AD risk for world populations.

Methylenetetrahydrofolate reductase gene polymorphisms and risk of acute lymphoblastic leukemia in children.

PubMed

Sadananda Adiga, M N; Chandy, S; Ramachandra, N; Appaji, L; Aruna Kumari, B S; Ramaswamy, G; Savithri, H S; Krishnamoorthy, L

2010-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. Genetic polymorphisms of this enzyme have been shown to impact several diseases, including cancer. Leukemias are malignancies arising from rapidly proliferating hematopoietic cells having great requirement of DNA synthesis. This case-control study was undertaken to analyze the association of the MTHFR gene polymorphisms 677 C"T and 1298 A"C and the risk of acute lymphoblastic leukemia in children. Eighty-six patients aged below 15 years with a confirmed diagnosis of acute lymphoblastic leukemia (ALL) and 99 matched controls were taken for this study. Analysis of the polymorphisms was done using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Frequency of MTHFR 677 CC and CT were 85.9% and 14.1% in the controls, and 84.9% and 15.1% in the cases. The 'T' allele frequency was 7% and 7.5% in cases and controls respectively. The frequency of MTHFR 1298 AA, AC, and CC were 28.3%, 55.6% and 16.1% for controls and 23.3%, 59.3% and 17.4% for cases respectively. The 'C' allele frequency for 1298 A-->C was 43.9% and 47% respectively for controls and cases. The odds ratio (OR) for C677T was 1.08 (95% CI 0.48-2.45, p = 0.851) and OR for A1298C was 1.29 (95% CI 0.65-2.29, p = 0.46) and OR for 1298 CC was 1.31 (95% CI 0.53-3.26, p = 0.56). The OR for the combined heterozygous status (677 CT and 1298 AC) was 1.94 (95% CI 0.58-6.52, p = 0.286). The prevalence of 'T' allele for 677 MTHFR polymorphism was low in the population studied. There was no association between MTHFR 677 C-->T and 1298 A-->C gene polymorphisms and risk of ALL, which may be due to the small sample size.

Methylenetetrahydrofolate Reductase Polymorphisms and Risk of Acute Lymphoblastic Leukemia-Evidence from an updated meta-analysis including 35 studies

PubMed Central

2012-01-01

Background 5,10-methylenetetrahydrofolate reductase (MTHFR) variants, C677T and A1298C, have been reported to be associated with decreased risk of acute lymphoblastic leukemia (ALL). However, results derived from individually underpowered studies are conflicting. We carried out an updated meta-analysis on the association between MTHFR polymorphisms and ALL risk. Methods Relevant publications were searched through PUBMED and EMBASE databases. The associations between MTHFR C677T and A1298C polymorphisms and the risk of ALL were evaluated by odds ratios (ORs). The heterogeneity and publication bias were estimated. Meta-regression analysis was performed to evaluate the potential sources of heterogeneity. Results C677T polymorphism was associated with a reduced risk of ALL (allele contrast: ORRE = 0.91, 95% CI: 0.83-0.99). Subgroup analysis showed MTHFR C677T variant was associated with decreased susceptibility to ALL in children and Caucasians. Meta-regression showed the logOR for the association between T allele and ALL increased as sex ratio (M/F) in the case group increased (P = 0.01). Regarding A1298C polymorphism, no significant association was observed (allele contrast: ORRE = 1.01, 95% CI: 0.91-1.11). There was no publication bias for C677T or A1298C polymorphism. Conclusions The present meta-analysis suggests that the C677T polymorphism, not A1298C, in MTHFR gene is associated with a decreased risk of ALL, particularly among children and Caucasians subjects. Our findings suggest that the influence of the C677T polymorphism on ALL susceptibility is modified by sex ratio in cases (M/F). Since folate intake may be a possible confounding factor, including this factor in future prospective studies is warranted. Further meta-analysis studies should be at least stratified for folate levels and gender to give more powerful and informative results. PMID:22943282

The Association of Methylenetetrahydrofolate Reductase Genotypes with the Risk of Childhood Leukemia in Taiwan

PubMed Central

Chang, Wen-Shin; Ji, Hong-Xue; Hsiao, Chieh-Lun; Miao, Chia-En; Hsu, Yuan-Nian; Bau, Da-Tian

2015-01-01

Background Acute lymphoblastic leukemia (ALL) is the most prevalent type of pediatric cancer, the causes of which are likely to involve an interaction between genetic and environmental factors. To evaluate the effects of the genotypic polymorphisms in methylenetetrahydrofolate reductase (MTHFR) on childhood ALL risk in Taiwan, two well-known polymorphic genotypes of MTHFR, C677T (rs1801133) and A1298C (rs1801131), were analyzed to examine the extent of their associations with childhood ALL susceptibility and to discuss the MTHFR genotypic contribution to childhood ALL risk among different populations. Methodology/Principal Findings In total, 266 patients with childhood ALL and an equal number of non-cancer controls recruited were genotyped utilizing PCR-RFLP methodology. The MTHFR C677T genotype, but not the A1298C, was differently distributed between childhood ALL and control groups. The CT and TT of MTHFR C677T genotypes were significantly more frequently found in controls than in childhood ALL patients (odds ratios=0.60 and 0.48, 95% confidence intervals=0.42–0.87 and 0.24–0.97, respectively). As for gender, the boys carrying the MTHFR C677T CT or TT genotype conferred a lower odds ratio of 0.51 (95% confidence interval=0.32–0.81, P=0.0113) for childhood ALL. As for age, those equal to or greater than 3.5 years of age at onset of disease carrying the MTHFR C677T CT or TT genotype were of lower risk (odds ratio= 0.43 and 95% confidence interval=0.26–0.71, P=0.0016). Conclusions Our results indicated that the MTHFR C677T T allele was a protective biomarker for childhood ALL in Taiwan, and the association was more significant in male patients and in patients 3.5 years of age or older at onset of disease. PMID:25793509

5,10-Methylenetetrahydrofolate reductase polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis.

PubMed

Pereira, Tiago Veiga; Rudnicki, Martina; Pereira, Alexandre Costa; Pombo-de-Oliveira, Maria S; Franco, Rendrik França

2006-10-01

There is evidence supporting a role for 5-10 methylenetetrahydrofolate reductase (MTHFR) gene variants in acute lymphoblastic leukemia (ALL). To provide a more robust estimate of the effect of MTHFR polymorphisms on the risk of ALL, we did a meta-analysis to reevaluate the association between the two most commonly studied MTHFR polymorphisms (C677T and A1298C) and ALL risk. All case-control studies investigating an association between the C677T or A1298C polymorphisms and risk of ALL were included. We applied both fixed-effects and random-effects models to combine odds ratio (OR) and 95% confidence intervals (95% CI). Q-statistic was used to evaluate the homogeneity and both Egger and Begg-Mazumdar tests were used to assess publication bias. The meta-analysis of the C677T polymorphism and risk of childhood ALL included 13 studies with a total of 4,894 individuals. Under a fixed-effects model, the TT genotype failed to be associated with a statistically significant reduction of childhood ALL risk (TT versus CT + CC: OR, 0.88; 95% CI, 0.73-1.06; P = 0.18). However, individuals homozygous for the 677T allele exhibited a 2.2-fold decrease in risk of adult ALL (TT versus CT + CC: OR, 0.45; 95% CI, 0.26-0.77; P = 0.004). In both cases, no evidence of heterogeneity was observed. No association between the A1298C variant and susceptibility to both adult and childhood ALL was disclosed. Our findings support the proposal that the common genetic C677T polymorphism in the MTHFR contributes to the risk of adult ALL, but not to the childhood ALL susceptibility.

Meta-Prediction of the Effect of Methylenetetrahydrofolate Reductase Polymorphisms and Air Pollution on Alzheimer’s Disease Risk

PubMed Central

Wu, Suh-Mian; Chen, Zhao-Feng; Young, Lufei; Shiao, S. Pamela K.

2017-01-01

Background: Alzheimer’s disease (AD) is a significant public health issue. AD has been linked with methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, but the findings have been inconsistent. The purpose of this meta-predictive analysis is to examine the associations between MTHFR polymorphisms and epigenetic factors, including air pollution, with AD risk using big data analytics approaches. Methods and Results: Forty-three studies (44 groups) were identified by searching various databases. MTHFR C677T TT and CT genotypes had significant associations with AD risk in all racial populations (RR = 1.13, p = 0.0047; and RR = 1.12, p < 0.0001 respectively). Meta-predictive analysis showed significant increases of percentages of MTHFR C677T polymorphism with increased air pollution levels in both AD case group and control group (p = 0.0021–0.0457); with higher percentages of TT and CT genotypes in the AD case group than that in the control group with increased air pollution levels. Conclusions: The impact of MTHFR C677T polymorphism on susceptibility to AD was modified by level of air pollution. Future studies are needed to further examine the effects of gene-environment interactions including air pollution on AD risk for world populations. PMID:28085050

MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families

DTIC Science & Technology

2014-12-01

facts that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T...allele leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

Spinal cord infarction in carriers of methylenetetrahydrofolate reductase-polymorphism-like unique risk factor: report of two cases.

PubMed

Tejero-Fernández, V; Fernández-Rodríguez, I; Membrilla-Mesa, M D; Arroyo-Morales, M

2014-11-01

A case report. To present two cases of spinal cord infarction (SCI) in carriers of the C677T methylenetetrahydrofolate reductase (MTHFR) polymorphism. Physical Medicine and Rehabilitation Department, Section for Rehabilitation and Traumatology, Hospital Virgen de las Nieves, Granada, Spain. Two cases are presented, one with SCI at the C7 level American Spinal Injury Association (ASIA) A and one at the C5 level (ASIA A). One patient presented an acute onset of tetraplegia and the other a centromedular syndrome. In both cases the patients were carriers of the MTHFR polymorphism, which is a unique risk factor. Increased blood levels of homocysteine related to mutation of the MTHFR gene increase the risk of a thrombotic episode, triggering the development of SCI. These two cases increase the limited number reported in the recent literature regarding MTHFR polymorphism carriers suffering from thrombotic SCI. MTHFR mutation can be considered a risk factor for thrombotic SCI, but it is not the sole risk factor. We propose that a consensus regarding the inclusion of anticoagulation treatment after confirmation of the diagnosis in these patients is needed.

[Association of single nucleotide polymorphism of methylenetetrahydrofolate reductase gene with susceptibility to acute leukemia].

PubMed

Zheng, Miao-miao; Yue, Li-jie; Zhang, Hong-hong; Yang, Chun-lan; Xie, Cai

2013-08-01

To assess whether polymorphisms of methylenetetrahydrofolate reductase (MTHFR) gene is associated with susceptibility to acute lymphoblastic leukemia (ALL) or acute myeloid leukemia (AML) in Chinese Han children. The study has included 87 patients with ALL, 22 patients with AML and 120 healthy controls. All subjects were analyzed with reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. A 677CT genotype of the MTHFR gene was associated with decreased risk of ALL (OR=0.23, 95%CI: 0.07-0.79). However, MTHFR A1298C genotypes were not associated with the risk of either disease. 677TT/1298AA and 677CC/1298AC genotypes were associated with increased risk of ALL(OR=3.78, 95% CI: 1.38-10.40; OR=3.17, 95% CI: 1.18-8.53, respectively), whereas the genotype 677CT/1298AA was associated with susceptibility to AML (OR=0.23, 95% CI: 0.06-0.97). Our data suggested that C677T polymorphism of MTHFR gene may increase the risk of childhood AML.

MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families. Revision

DTIC Science & Technology

2013-10-01

that de novo CNVs rates are consistently high in SPX ASD (5.8%-10.2%) versus familial ASD (2-3%), we hypothesize that low-activity MTHFR 677T allele...leads to increase global DNA hypomethylation and consequently results in increased generation of de novo CNVs bringing about a higher risk for...developing sporadic cases of autism. We proposed to test 1) the association of MTHFR 677T allele with rate of ASD related de novo CNVs ; 2) the

Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population.

PubMed

Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

2005-05-27

Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population.

Polymorphisms of methylenetetrahydrofolate reductase (MTHFR) and susceptibility to pediatric acute lymphoblastic leukemia in a German study population

PubMed Central

Schnakenberg, Eckart; Mehles, Andrea; Cario, Gunnar; Rehe, Klaus; Seidemann, Kathrin; Schlegelberger, Brigitte; Elsner, Holger A; Welte, Karl H; Schrappe, Martin; Stanulla, Martin

2005-01-01

Background Methylenetetrahydrofolate reductase (MTHFR) has a major impact on the regulation of the folic acid pathway due to conversion of 5,10-methylenetetrahydrofolate (methylene-THF) to 5-methyl-THF. Two common polymorphisms (677C>T and 1298A>C) in the gene coding for MTHFR have been shown to reduce MTHFR enzyme activity and were associated with the susceptibility to different disorders, including vascular disease, neural tube defects and lymphoid malignancies. Studies on the role of these polymorphisms in the susceptibility to acute lymphoblastic leukemia (ALL) led to discrepant results. Methods We retrospectively evaluated the association of the MTHFR 677C>T and 1298A>C polymorphisms with pediatric ALL by genotyping a study sample of 443 ALL patients consecutively enrolled onto the German multicenter trial ALL-BFM 2000 and 379 healthy controls. We calculated odds ratios of MTHFR genotypes based on the MTHFR 677C>T and 1298A>C polymorphisms to examine if one or both of these polymorphisms are associated with pediatric ALL. Results No significant associations between specific MTHFR variants or combinations of variants and risk of ALL were observed neither in the total patient group nor in analyses stratified by gender, age at diagnosis, DNA index, immunophenotype, or TEL/AML1 rearrangement. Conclusion Our findings suggest that the MTHFR 677C>T and 1298A>C gene variants do not have a major influence on the susceptibility to pediatric ALL in the German population. PMID:15921520

mtDNA mutation C1494T, haplogroup A, and hearing loss in Chinese

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Chengye; Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091; Graduate University of the Chinese Academy of Sciences, Beijing 100039

2006-09-22

Mutation C1494T in mitochondrial 12S rRNA gene was recently reported in two large Chinese families with aminoglycoside-induced and nonsyndromic hearing loss (AINHL) and was claimed to be pathogenic. This mutation, however, was first reported in a sample from central China in our previous study that was aimed to reconstruct East Asian mtDNA phylogeny. All these three mtDNAs formed a subclade defined by mutation C1494T in mtDNA haplogroup A. It thus seems that mutation C1494T is a haplogroup A-associated mutation and this matrilineal background may contribute a high risk for the penetrance of mutation C1494T in Chinese with AINHL. To testmore » this hypothesis, we first genotyped mutation C1494T in 553 unrelated individuals from three regional Chinese populations and performed an extensive search for published complete or near-complete mtDNA data sets (>3000 mtDNAs), we then screened the C1494T mutation in 111 mtDNAs with haplogroup A status that were identified from 1823 subjects across China. The search for published mtDNA data sets revealed no other mtDNA besides the above-mentioned three carrying mutation C1494T. None of the 553 randomly selected individuals and the 111 haplogroup A mtDNAs was found to bear this mutation. Therefore, our results suggest that C1494T is a very rare event. The mtDNA haplogroup A background in general is unlikely to play an active role in the penetrance of mutation C1494T in AINHL.« less

Mitochondrial tRNALeu(UUR) C3275T, tRNAGln T4363C and tRNALys A8343G mutations may be associated with PCOS and metabolic syndrome.

PubMed

Ding, Yu; Xia, Bo-Hou; Zhang, Cai-Juan; Zhuo, Guang-Chao

2018-02-05

Polycystic ovary syndrome (PCOS) is a very prevalent endocrine disease affecting reproductive women. Clinically, patients with this disorder are more vulnerable to develop type 2 diabetes mellitus (T2DM), cardiovascular events, as well as metabolic syndrome (MetS). To date, the molecular mechanism underlying PCOS remains largely unknown. Previously, we showed that mitochondrial dysfunction caused by mitochondrial DNA (mtDNA) mutation was an important cause for PCOS. In the current study, we described the clinical and biochemical features of a three-generation pedigree with maternally transmitted MetS, combined with PCOS. A total of three matrilineal relatives exhibited MetS including obesity, high triglyceride (TG) and Hemoglobin A1c (HbA1c) levels, and hypertension. Whereas one patient from the third generation manifestated PCOS. Mutational analysis of the whole mitochondrial genes from the affected individuals identified a set of genetic variations belonging to East Asia haplogroup B4b1c. Among these variants, the homoplasmic C3275T mutation disrupted a highly evolutionary conserved base-pairing (28A-46C) on the variable region of tRNA Leu(UUR) , whereas the T4363C mutation created a new base-pairing (31T-37A) in the anticodon stem of tRNA Gln , furthermore, the A8343G mutation occurred at the very conserved position of tRNA Lys and may result the failure in mitochondrial tRNAs (mt-tRNAs) metabolism. Biochemical analysis revealed the deficiency in mitochondrial functions including lower levels of mitochondrial membrane potential (MMP), ATP production and mtDNA copy number, while a significantly increased reactive oxygen species (ROS) generation was observed in polymononuclear leukocytes (PMNs) from the individuals carrying these mt-tRNA mutations, suggesting that these mutations may cause mitochondrial dysfunction that was responsible for the clinical phenotypes. Taken together, our data indicated that mt-tRNA mutations were associated with MetS and PCOS in this

Hemolysis and Mediterranean G6PD mutation (c.563 C>T) and c.1311 C>T polymorphism among Palestinians at Gaza Strip.

PubMed

Sirdah, Mahmoud; Reading, N Scott; Perkins, Sherrie L; Shubair, Mohammad; Aboud, Lina; Prchal, Josef T

2012-04-15

The G6PD c.563 C>T deficient mutation is endemic among Mediterranean populations but its clinical significance is not well delineated. We set up to estimate the proportion of G6PD deficient children presenting with hemolytic anemia at Al Nasser Pediatric Hospital at Gaza Strip, Palestine. We then established the prevalence of c.563T Mediterranean mutation and its linkage to c.1311 C>T polymorphism in this population. G6PD deficiency was identified in children presenting with hemolytic anemia at Al Nasser Pediatric Hospital by spectrophotometric measurement of G6PD activity. G6PD exon 6 and exon 11 were amplified from genomic DNA and evaluated for c.563T mutation by sequencing and the c.1311T polymorphism by restriction fragment analysis. Seventy X-chromosomes (60 males and 5 females) from G6PD deficient patients and 40 X-chromosomes from a control group known to be not G6PD deficient were tested. Over 80% of these children presenting with hemolytic anemia were G6PD deficient and 34% of these had the Mediterranean G6PD deficient variant. The allelic frequencies of Mediterranean c.563T and c.1311T polymorphisms among G6PD deficient patients were 0.33 and 0.38 respectively. The c.1311T polymorphism was linked in 95.2% of patients with the Mediterranean mutation, an allele frequency of 0.87, compared to the control non-G6PD deficient group with an allele frequency of 0.18. We conclude that G6PD deficiency accounts for majority of hemolytic anemia encountered in Gaza children treated at Al Nasser Pediatric Hospital Emergency department. The Mediterranean mutation c.563T, while not accounting for a majority of G6PD deficiency, is common among G6PD deficient Gaza Strip Palestinians and is frequently, but not always, linked to the c.1311T polymorphism. This work provides a foundation for the population screening of Palestinians for G6PD deficiency and for investigations of ancestral origin of the Mediterranean variant in world populations. Copyright © 2012 Elsevier Inc

Methylenetetrahydrofolate reductase polymorphisms and therapy response in pediatric acute lymphoblastic leukemia.

PubMed

Aplenc, Richard; Thompson, Jennifer; Han, Peggy; La, Mei; Zhao, Huaqing; Lange, Beverly; Rebbeck, Timothy

2005-03-15

A significant portion of patients treated for pediatric acute lymphoblastic leukemia (ALL) relapse. We hypothesized that common polymorphisms with moderate effect sizes and large attributive risks could explain an important fraction of ALL relapses. Methylenetetrahydrofolate reductase (MTHFR) is central to folate metabolism and has two common functional polymorphisms (C677T and A1298G). Methotrexate (MTX), which interrupts folate metabolism, is a mainstay of pediatric ALL therapy. MTX inhibits the synthesis of dTMP needed for DNA replication by blocking the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate by MTHFR. We hypothesized that a deactivating MTHFR allele would increase ALL relapse risk by potentially increasing 5,10-methylenetetrahydrofolate and dTMP, enhancing DNA synthesis and thus opposing MTX. To test this hypothesis, we genotyped 520 patients on the Children's Cancer Study Group ALL study, CCG-1891. The MTHFR C677T variant allele was statistically significantly associated with relapse (chi2 = 4.38, P = 0.036). This association remained significant (hazard ratio = 1.82, P = 0.008), controlling for important covariates, and was more predictive of relapse than other predictors, including day 7 bone marrow response. The MTHFR C677T variant allele was not associated with an increased risk of toxicity or infection. The MTHFR A1298G polymorphism was not associated with altered risks of relapse, toxicity, or infection. Haplotype analysis showed six common haplotypes that did not provide additional information predictive for relapse. These data provide evidence that the MTHFR C677T polymorphism is a common genetic variant conferring a moderate relative risk and a high attributable risk for relapse in pediatric ALL patients.

High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism

PubMed Central

Aarabi, Mahmoud; San Gabriel, Maria C.; Chan, Donovan; Behan, Nathalie A.; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J.; Zini, Armand; Trasler, Jacquetta

2015-01-01

Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. PMID:26307085

Role of treatment-modifying MTHFR677C>T and 1298A>C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy.

PubMed

Jiménez-Ramírez, Francisco J; Castro, Liza M; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y; Morales-Borges, Raúl H; Miranda-Massari, Jorge R; Duconge, Jorge

2017-03-01

The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C>T and 1298A>C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer's exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p<0.0001 and p=0.03, respectively). Results suggest that 1298A>C but not 677C>T is associated with DPN susceptibility in this cohort (p=0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN.

Pregnancy-associated osteoporosis with a heterozygous deactivating LDL receptor-related protein 5 (LRP5) mutation and a homozygous methylenetetrahydrofolate reductase (MTHFR) polymorphism.

PubMed

Cook, Fiona J; Mumm, Steven; Whyte, Michael P; Wenkert, Deborah

2014-04-01

Pregnancy-associated osteoporosis (PAO) is a rare, idiopathic disorder that usually presents with vertebral compression fractures (VCFs) within 6 months of a first pregnancy and delivery. Spontaneous improvement is typical. There is no known genetic basis for PAO. A 26-year-old primagravida with a neonatal history of unilateral blindness attributable to hyperplastic primary vitreous sustained postpartum VCFs consistent with PAO. Her low bone mineral density (BMD) seemed to respond to vitamin D and calcium therapy, with no fractures after her next successful pregnancy. Investigation of subsequent fetal losses revealed homozygosity for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism associated both with fetal loss and with osteoporosis (OP). Because her neonatal unilateral blindness and OP were suggestive of loss-of-function mutation(s) in the gene that encodes LDL receptor-related protein 5 (LRP5), LRP5 exon and splice site sequencing was also performed. This revealed a unique heterozygous 12-bp deletion in exon 21 (c.4454_4465del, p.1485_1488del SSSS) in the patient, her mother and sons, but not her father or brother. Her mother had a normal BMD, no history of fractures, PAO, ophthalmopathy, or fetal loss. Her two sons had no ophthalmopathy and no skeletal issues. Her osteoporotic father (with a family history of blindness) and brother had low BMDs first documented at ages ∼40 and 32 years, respectively. Serum biochemical and bone turnover studies were unremarkable in all subjects. We postulate that our patient's heterozygous LRP5 mutation together with her homozygous MTHFR polymorphism likely predisposed her to low peak BMD. However, OP did not cosegregate in her family with the LRP5 mutation, the homozygous MTHFR polymorphism, or even the combination of the two, implicating additional genetic or nongenetic factors in her PAO. Nevertheless, exploration for potential genetic contributions to PAO may explain part of the pathogenesis of this

Association between the methylenetetrahydrofolate reductase polymorphisms and risk of acute lymphoblastic leukemia in Serbian children.

PubMed

Damnjanovic, Tatjana; Milicevic, Radomir; Novkovic, Tanja; Jovicic, Olivera; Bunjevacki, Vera; Jekic, Biljana; Lukovic, Ljiljana; Novakovic, Ivana; Redzic, Danka; Milasin, Jelena

2010-05-01

Methylenetetrahydrofolate reductase (MTHFR) regulates the metabolism of folate and methionine, essential components of DNA synthesis and methylation. Polymorphisms in the MTHFR gene have been associated with susceptibility to some types of cancer. We investigated a possible association of MTHFR polymorphisms (677C>T and 1298A>C) and increased risk for acute lymphoblastic leukemia in 78 affected children. The frequencies of both MTHFR 677 genotypes and alleles were significantly different between patients and controls. A significant association between CT/TT individuals and reduced risk of acute lymphoblastic leukemia was found. The odds ratios were 0.53 (95% confidence interval, 032-0.89) and 0.30 (95% confidence interval, 0.12-0.81). Polymorphism 1298 did not show statistical difference between patients and controls.

Association of MTHFR C667T polymorphism with bone mineral density and fracture risk: an updated meta-analysis.

PubMed

Wang, H; Liu, C

2012-11-01

This meta-analysis investigated the association of C677T polymorphism in MTHFR gene with bone mineral density (BMD) and fracture risk. The results suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was modestly associated with BMD of lumbar spine, femoral neck, total hip, and total body, respectively. The methylenetetrahydrofolate reductase (MTHFR) gene has been implicated in the regulation of BMD and, thus, may serve as a potential risk factor for the development of fracture. However, results have been inconsistent. In this study, a meta-analysis was performed to clarify the association of C677T polymorphism in MTHFR gene with BMD and fracture risk. Published literature from PubMed and EMBASE were searched for eligible publications. Pooled odds ratio (OR) or weighted mean difference (WMD) and 95% confidence interval (CI) were calculated using a fixed- or random-effects model. Twenty studies (3,525 cases and 17,909 controls) were included in this meta-analysis. The TT genotype of C677T polymorphism was marginally associated with an increased risk of fracture under recessive model (TT vs. TC + CC: OR = 1.23, 95% CI 1.04-1.47). Using this model, similar results were found among East Asians (OR = 1.40, 95% CI 1.07-1.83), female subpopulation (1.27, 95% CI 1.04-1.55), cohort studies (OR = 1.24, 95% CI 1.08-1.44), and subjects younger than aged 60 years (OR = 1.51, 95% CI 1.10-2.07). In addition, under homogeneous co-dominant model, there was a modest association of C677T polymorphism with BMD of lumbar spine (WMD = -0.017 g/cm(2); 95%CI, -0.030-(-0.005) g/cm(2)), femoral neck (WMD = -0.010 g/cm(2); 95% CI -0.017-(-0.003) g/cm(2)), total hip (WMD = -0.013 g/cm(2), 95% CI -0.022-(-0.004) g/cm(2)), and total body (WMD = -0.020 g/cm(2); 95% CI -0.027-(-0.013) g/cm(2)), respectively. This meta-analysis suggested that C677T polymorphism was marginally associated with fracture risk. In addition, this polymorphism was

Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas

PubMed Central

Yu, Helena A.; Sima, Camelia S.; Shen, Ronglai; Kass, Samantha; Gainor, Justin; Shaw, Alice; Hames, Megan; Iams, Wade; Aston, Jonathan; Lovly, Christine M.; Horn, Leora; Lydon, Christine; Oxnard, Geoffrey R.; Kris, Mark G.; Ladanyi, Marc; Riely, Gregory J.

2015-01-01

Background We previously demonstrated that patients with metastatic KRAS mutant lung cancers have a shorter survival compared to patients with KRAS wild type cancers. Recent reports have suggested different clinical outcomes and distinct activated signaling pathways depending on KRAS mutation subtype. To better understand the impact of KRAS mutation subtype, we analyzed data from 677 patients with KRAS mutant metastatic lung cancer. Methods We reviewed all patients with metastatic or recurrent lung cancers found to have KRAS mutations over a 6 year time period. We evaluated the associations between KRAS mutation type, clinical factors, and overall survival in univariate and multivariate analyses. Any significant findings were validated in an external multi-institution patient data set. Results Among 677 patients with KRAS mutant lung cancers (53 at codon 13, 624 at codon 12), there was no difference in overall survival for patients when comparing KRAS transition versus transversion mutations (p=0.99), smoking status (p=0.33) or when comparing specific amino acid substitutions (p=0.20). In our data set, patients with KRAS codon 13 mutant tumors (n=53) had shorter overall survival compared to patients with codon 12 mutant tumors (n=624)( 1.1 vs 1.3 years, respectively, p=0.009), and the findings were confirmed in a multivariate Cox model controlling for age, sex and smoking status (HR 1.52 95% CI 1.11-2.08, p=0.008). In an independent validation set of tumors from 682 patients with stage IV KRAS mutant lung cancers, there was no difference in survival between patients with KRAS codon 13 versus codon 12 mutations (1.0 vs 1.1 years respectively, p=0.41). Conclusions Among individuals with KRAS mutant metastatic lung cancers treated with conventional therapy, there are apparent differences in outcome based on KRAS mutation subtype PMID:25415430

5,10-methylenetetrahydrofolate reductase (MTHFR) polymorphisms and the risk of acute lymphoblastic leukemia (ALL) in Filipino children.

PubMed

Alcasabas, Patricia; Ravindranath, Yaddanapudi; Goyette, Gerard; Haller, Andrew; Del Rosario, Luz; Lesaca-Medina, Maria Ysabel; Darga, Linda; Ostrea, Enrique M; Taub, Jeffrey W; Everson, Richard B

2008-08-01

5,10-Methylenetetrahydrofolate reductase (MTHFR) is a critical enzyme in folate metabolism. Polymorphisms at the C677T and A1298C loci are associated with reduced activity; consequently more folate substrates are shunted toward thymidylate and DNA synthesis. Several studies have reported a reduced risk of developing ALL in children with MTHFR polymorphisms. The objective of this study was to determine the association between MTHFR polymorphisms and ALL in Filipino children. We conducted a case control study in children diagnosed with ALL at the Philippine General Hospital from 1/2001 through 12/2005. Bone marrow aspirate slides were reviewed by two expert hematologists to verify the morphologic diagnosis of ALL. DNA was isolated from the slides and MTHFR polymorphisms, C677T and A1298C, were determined using Taqman real-time PCR. Cord blood of healthy Filipino newborns served as control. There were a total of 191 ALL and 394 controls genotyped. The distribution of C677T polymorphisms was similar in the two groups (P = 1.0). However, for A1298C, there was significantly more AC and CC genotypes in the ALL compared to controls (P = 0.02; OR 1.57; CI: 1.08-2.28). The 1298C allele frequency for the control group was 36.8% and 677T allele frequency was 9.9%. A1298C polymorphisms is associated with an increased risk for ALL in Filipino children. This may be due to a difference in leukemia biology or to a high prevalence of folate deficiency in Filipinos. Our study reiterates the gene and environment interaction in leukemogenesis.

High-dose folic acid supplementation alters the human sperm methylome and is influenced by the MTHFR C677T polymorphism.

PubMed

Aarabi, Mahmoud; San Gabriel, Maria C; Chan, Donovan; Behan, Nathalie A; Caron, Maxime; Pastinen, Tomi; Bourque, Guillaume; MacFarlane, Amanda J; Zini, Armand; Trasler, Jacquetta

2015-11-15

Dietary folate is a major source of methyl groups required for DNA methylation, an epigenetic modification that is actively maintained and remodeled during spermatogenesis. While high-dose folic acid supplementation (up to 10 times the daily recommended dose) has been shown to improve sperm parameters in infertile men, the effects of supplementation on the sperm epigenome are unknown. To assess the impact of 6 months of high-dose folic acid supplementation on the sperm epigenome, we studied 30 men with idiopathic infertility. Blood folate concentrations increased significantly after supplementation with no significant improvements in sperm parameters. Methylation levels of the differentially methylated regions of several imprinted loci (H19, DLK1/GTL2, MEST, SNRPN, PLAGL1, KCNQ1OT1) were normal both before and after supplementation. Reduced representation bisulfite sequencing (RRBS) revealed a significant global loss of methylation across different regions of the sperm genome. The most marked loss of DNA methylation was found in sperm from patients homozygous for the methylenetetrahydrofolate reductase (MTHFR) C677T polymorphism, a common polymorphism in a key enzyme required for folate metabolism. RRBS analysis also showed that most of the differentially methylated tiles were located in DNA repeats, low CpG-density and intergenic regions. Ingenuity Pathway Analysis revealed that methylation of promoter regions was altered in several genes involved in cancer and neurobehavioral disorders including CBFA2T3, PTPN6, COL18A1, ALDH2, UBE4B, ERBB2, GABRB3, CNTNAP4 and NIPA1. Our data reveal alterations of the human sperm epigenome associated with high-dose folic acid supplementation, effects that were exacerbated by a common polymorphism in MTHFR. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

World distribution of the T833C/844INS68 CBS in cis double mutation: a reliable anthropological marker.

PubMed

Pepe, G; Vanegas, O C; Rickards, O; Giusti, B; Comeglio, P; Brunelli, T; Marcucci, R; Prisco, D; Gensini, G F; Abbate, R

1999-02-01

Mild hyperhomocysteinemia is associated to mutations either in cystathionine beta-synthase (CBS) or in 5,10-methylenetetrahydrofolate reductase (MTHFR) genes. In 1995, Sebastio et al. characterized a 68 bp insertion in cis with the most common CBS mutation (T833C) detected in homocystinuric patients. Recently, this double mutation has been detected in Italian and North-American controls. Compared to a group of patients affected by coronary artery disease, North-American controls showed not statistically significant difference. Moreover, Italian controls displayed a microheterogeneity in the mutant allele frequency distribution depending on their geographical origin (North or South of Italy). Aim of our study was to evaluate the prevalence of the double in cis mutation in different populations. We studied 377 healthy subjects belonging to various human groups. Genomic DNA, extracted from peripheral blood samples, was amplified using specific primers; PCR fragments were digested with Bsr I restriction enzyme to detect the double mutation. Our data show a significant heterogeneity among the populations studied, therefore this mutation turned out to be a reliable anthropogenetic marker. The distribution of the double mutation will contribute, with other DNA polymorphisms, to evaluate the genetic admixture of mixed populations such as Afro-Americans.

Role of treatment-modifying MTHFR677C>T and 1298A > C polymorphisms in metformin-treated Puerto Rican patients with type-2 diabetes mellitus and peripheral neuropathy

PubMed Central

Jiménez-Ramírez, Francisco J.; Castro, Liza M.; Ortiz, Clarymar; Concepción, Jennifer; Renta, Jessicca Y.; Morales-Borges, Raúl H.; Miranda-Massari, Jorge R.; Duconge, Jorge

2017-01-01

Background The study was conducted to investigate potential association between MTHFR genotypes and diabetic peripheral neuropathy (DPN) in Puerto Ricans with type-2 diabetes mellitus (T2DM) treated with metformin. The prevalence of major MTHFR polymorphisms in this cohort was also ascertained. Methods DNAs from 89 metformin-treated patients with T2DM and DPN were genotyped using the PCR-based RFLP assay for MTHFR677C > T and 1298A > C polymorphisms. Frequency distributions of these variants in the study cohort were compared to those reported for three reference populations (HapMap project) and controls (400 newborn specimens). Chi-square (or Fischer’s exact) tests and odds ratios (OR) were used to assess association with DPN susceptibility risk (patients vs. controls) and biochemical markers (wild types vs. carriers). Results Sixty-seven percent (67%) of participants carry at least one of these MTHFR polymorphisms. No deviations from Hardy-Weinberg equilibrium were detected. The genotype and allele frequencies showed statistically significant differences between participants and controls (p < 0.0001 and p = 0.03, respectively). Results suggest that 1298A > C but not 677C > T is associated with DPN susceptibility in this cohort (p = 0.018). Different patterns of allelic dissimilarities are observed when comparing our cohort vs. the three parental ancestries. After sorting individuals by their carrier status, no significant associations were observed between these genetic variants (independently or combined) and any of the biochemical markers (HbA1c, folate, vitamin B12, homocysteine). Conclusions Prevalence of major MTHFR variants in Puerto Rican patients with T2DM is first time ever reported. The study provides further evidence on the use of this genetic marker as an independent risk factor for DPN. PMID:28231061

Inherited thrombophilia in pregnant women with intrauterine growth restriction.

PubMed

Coriu, Letitia; Copaciu, Elena; Tulbure, Dan; Talmaci, Rodica; Secara, Diana; Coriu, Daniel; Cirstoiu, Monica

2014-12-01

Intrauterine growth restriction (IUGR) is a major cause of fetal morbidity and mortality during pregnancy. The role of mutation in the factor V gene, prothrombin gene, MTHFR gene, as risk factors for intrauterine growth restriction during pregnancy, is not very well known so far. This is a retrospective study of 151 pregnant women with a history of complicated pregnancy: intrauterine growth restriction, preeclampsia, recurrent pregnancy loss or maternal venous thromboembolism, who were admitted in Bucharest Emergency University Hospital, during the period January 2010 to July 2014. Genetic testing was performed for all the cases to detect: factor V Leiden mutation, G20210A mutation in the prothrombin gene, C677T mutation and A1298C mutation in methylenetetrahydrofolate reductase (MTHFR) gene. Blood samples were obtained as soon as the diagnosis of intrauterine growth restriction was established with ultrasonography. The following gene mutations were associated with increased risk of IUGR: G20210A prothrombin gene mutation (OR 4.81, 95% CI 1.05 - 2.22, p= 0.043), G1691A factor V gene mutation (factor V Leiden) (OR 1.58, 95% CI 0.61 - 4.080, p= 0.347), C677T MTHFR gene mutation (OR 1.61, 95% CI 0.79 to 3.26, p= 0.186), compound heterozygous MTHFR C677T and A1298C (OR 1.66, 95% CI 0.81- 3.42, p= 0.169). Particularly, for G20210A prothrombin gene mutation we found statistically significant risk (p≤0.05) of IUGR.

Effects of Common Polymorphisms in the MTHFR and ACE Genes on Diabetic Peripheral Neuropathy Progression: a Meta-Analysis.

PubMed

Wu, Shuai; Han, Yan; Hu, Qiang; Zhang, Xiaojie; Cui, Guangcheng; Li, Zezhi; Guan, Yangtai

2017-05-01

Diabetic peripheral neuropathy (DPN) is a microvascular complication of diabetes mellitus. The aim of this meta-analysis was to evaluate the effects of methylenetetrahydrofolate reductase (MTHFR) 677 C>T and ACE I/D polymorphisms in the development of DPN. We systematically reviewed published studies on MTHFR 677 C>T and ACE I/D polymorphisms and DPN found in various types of electronic databases. Strengthening the Reporting of Observational studies in Epidemiology (STROBE) quality score systems were used to determine the quality of the articles selected for inclusion. Odds ratios (ORs) and its corresponding 95 % confidence interval (95 % CI) were calculated. We used STATA statistical software (version 12.0, Stata Corporation, College Station, TX, USA) to deal with statistical data. Our results indicated an association of ACE D>I mutation (OR = 1.43, 95 % CI 1.12-1.83, P = 0.004) and MTHFR 677 C>T mutation (OR = 1.43, 95 % CI 1.08-1.90, P = 0.014) with DPN under the allele model, and similar results were also found under the dominant model (all P < 0.05). Subgroup analysis by country indicated that the MTHFR 677 C>T polymorphism may be the main risk factor for DPN in Turkey under four genetic models. ACE D>I mutation was correlated with DPN in Japanese and Pakistani populations in the majority of groups. The relationships of MTHFR 677 C>T and ACE I/D polymorphisms with DPN patients presented in this meta-analyses support the view that the MTHFR and ACE genes might play an important role in the development of DPN.

Role of folate status and methylenetetrahydrofolate reductase genotype on the toxicity and outcome of induction chemotherapy in children with acute lymphoblastic leukemia.

PubMed

Roy Moulik, Nirmalya; Kumar, Archana; Agrawal, Suraksha; Awasthi, Shally; Mahdi, Abbas Ali; Kumar, Ashutosh

2015-05-01

The effect of serum folate levels and methylenetetrahydrofolate reductase (MTHFR) genotype on complications and outcome of induction chemotherapy in 150 children with acute lymphoblastic leukemia (ALL) was studied. Folate deficiency in 26% at baseline was more common in children with MTHFR 677 mutations. Folate deficient children had a higher incidence of neutropenia (p = 0.03), thrombocytopenia (p = 0.02) and febrile neutropenia (p = 0.01) and higher transfusion requirement during induction compared to folate sufficient children. Sepsis related induction deaths were more frequent in folate deficient children (p = 0.02) during induction. Children with 677 and 1298 mutations had a higher incidence of cytopenias (p = 0.01) and mucositis (p = 0.007), the risks of which increased with concomitant folate deficiency. A significant fall in folate levels was observed post-induction (p = 0.02), most markedly in mutant 677 genotypes. Multivariate analysis revealed associations of baseline folate deficiency with low counts at day 14 (p = 0.001) and MTHFR 1298 mutations with mucositis (p = 0.02).

VHL c.505 T>C mutation confers a high age related penetrance but no increased overall mortality

PubMed Central

Bender, B.; Eng, C.; Olschewski, M.; Berger, D.; Laubenberger, J.; Altehofer, C.; Kirste, G.; Orszagh, M.; van Velthoven, V.; Miosczka, H.; Schmidt, D.; Neumann, H.

2001-01-01

BACKGROUND—Germline mutations of the VHL gene cause von Hippel-Lindau syndrome (VHL). In southern Germany, a specific mutation in this gene, c.505 T>C, is one of the most frequent alterations owing to a founder effect.
METHODS—This study was conducted to evaluate morbidity, specific clinical risk profile, and mortality among a series of VHL c.505 T/C mutation carriers. A total of 125 eligible subjects carrying VHL c.505 T/C underwent ophthalmoscopy and gadolinium enhanced magnetic resonance imaging of the brain, the spinal cord, and the abdomen. Age related penetrance, morbidity, and mortality were assessed.
RESULTS—Frequently observed lesions were phaeochromocytoma (47%), retinal angiomas (36%), haemangioblastoma of the spine (36%), and haemangioblastoma of the brain (16%). Four patients developed renal cell carcinoma. VHL was symptomatic in 47% of subjects; 30% were asymptomatic despite the presence of at least one VHL related tumour and 23% of the carriers had no detectable VHL lesion. Of the 19 patients who had died (15%), 10 died of symptomatic VHL lesions. Overall penetrance by cumulative incidence functions is estimated at 48% by 35 years and 88% by 70 years. In contrast to the only existing published report based on patients with presumably unselected VHL germline mutations, the mortality rate for c.505 T/C mutation carriers is comparable to that of the general population of Germany.
CONCLUSIONS—Our results are an important example that a specific genotype, at least in the case of VHL c.505 T/C, can favourably impact on mortality despite a high age related penetrance. Our study also indirectly provides objective data which might be useful to the life and health insurance industry; it would appear that c.505 T>C mutation positive subjects have similar disease specific mortality to that of the general population owing to a combination of phenotype and timely detection of mutation carrier status followed by aggressive clinical screening and

[Serum folate levels in adolescent population in Madrid, Spain].

PubMed

Gil, Ruth; Esteban, Jesús; Hernández, Valentín; Cano, Beatriz; de Oya, Manuel; Gil, Angel

2008-10-25

Serum folate concentrations in children are essential to establish values which allow to compare different regions or countries, and raise the possibility of fortifying diet with group B vitamins and folic acid as a secondary prevention against cardiovascular diseases. A cross-sectional epidemiological study was performed to assess serum folate levels in school children, aged 13-15 years, in Madrid. Folate and vitamin B12 determinations were determined in blood samples of fasting children. Genotype C677T of methylentetrahydrofolate reductase (MTHFR) enzyme was determined by polymerase chain reaction. Average folate levels obtained in our study were 7.83 nmol/l (95% confidence interval, 7.42 to 8.23 nmol/l). Median was 6.89 nmol/l (interquartilic range: 5.30 to -9.30 nmol/l). No statistically significant differences were found by gender, age or presence of menstruation. Serum folate concentration decreased significantly with the mutation of the C677T genotype for MTHFR. Prevalence of deficits of folate (< 5.3 nmol/l) was 23.8% and raised significantly with the mutation of the C677T genotype for MTHFR: 18.8% for CC, 20.4% for CT, and 46.7% for TT. This effect was mainly observed in girls after menstruation. Homozygosis mutation in C677T genotype of the enzyme MTHFR induces lower folate levels, mainly in girls after menstruation. 5.3 nmol/l is proposed as a threshold to define deficient serum folate levels in the Spanish adolescent population.

Multiple Mutations Modulate the Function of Dihydrofolate Reductase in Trimethoprim-Resistant Streptococcus pneumoniae

PubMed Central

Maskell, Jeffrey P.; Sefton, Armine M.; Hall, Lucinda M. C.

2001-01-01

Trimethoprim resistance in Streptococcus pneumoniae can be conferred by a single amino acid substitution (I100-L) in dihydrofolate reductase (DHFR), but resistant clinical isolates usually carry multiple DHFR mutations. DHFR genes from five trimethoprim-resistant isolates from the United Kingdom were compared to susceptible isolates and used to transform a susceptible control strain (CP1015). All trimethoprim-resistant isolates and transformants contained the I100-L mutation. The properties of DHFRs from transformants with different combinations of mutations were compared. In a transformant with only the I100-L mutation (R12/T2) and a D92-A mutation also found in the DHFRs of susceptible isolates, the enzyme was much more resistant to trimethoprim inhibition (50% inhibitory concentration [IC50], 4.2 μM) than was the DHFR from strain CP1015 (IC50, 0.09 μM). However, Km values indicated a lower affinity for the enzyme's natural substrates (Km for dihydrofolate [DHF], 3.1 μM for CP1015 and 27.5 μM for R12/T2) and a twofold decrease in the specificity constant. In transformants with additional mutations in the C-terminal portion of the enzyme, Km values for DHF were reduced (9.2 to 15.2 μM), indicating compensation for the lower affinity generated by I100-L. Additional mutations in the N-terminal portion of the enzyme were associated with up to threefold-increased resistance to trimethoprim (IC50 of up to 13.7 μM). It is postulated that carriage of the mutation M53-I—which, like I100-L, corresponds to a trimethoprim binding site in the Escherichia coli DHFR—is responsible for this increase. This study demonstrates that although the I100-L mutation alone may give rise to trimethoprim resistance, additional mutations serve to enhance resistance and modulate the effects of existing mutations on the affinity of DHFR for its natural substrates. PMID:11257022

Methylenetetrahydrofolate reductase polymorphisms and susceptibility to acute lymphoblastic leukemia in a Chinese population: a meta-analysis.

PubMed

Xiao, Yi; Deng, Tao-Ran; Su, Chang-Liang; Shang, Zhen

2014-01-01

Although many epidemiologic studies have investigated the methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and their association with acute lymphoblastic leukemia (ALL), definitive conclusions cannot be drawn. To clarify the effects of MTHFR polymorphisms on the risk of ALL, a meta-analysis was performed in a Chinese population. A computerized literature search was carried out in PubMed, the Chinese Biomedicine (CBM) database, China National Knowledge Infrastructure (CNKI) platform, and the Wanfang database (Chinese) to collect relevant articles. A total of 11 articles including 1,738 ALL cases and 2,438 controls were included in this meta-analysis. Overall, a significantly decreased association was found between the MTHFR C677T polymorphism and ALL risk when all studies in Chinese populations were pooled into the meta-analysis. In subgroup analyses stratified by age, ethnicity, and source of controls, the same results were observed in children, in population-based studies, and in people with no stated ethnicity. However, a significantly increased association was also found for MTHFR C677T in hospital-based studies, and for MTHFR A1298C in people with no stated ethnicity. Our results suggest that the MTHFR C677T and A1298C polymorphisms may be potential biomarkers for ALL risk in Chinese populations, and studies with a larger sample size and wider population spectrum are required before definitive conclusions can be drawn. © 2014 S. Karger GmbH, Freiburg.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation

PubMed Central

Yan, Hui-ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-bing; Liu, Jing; Jia, Zheng-jun; Wang, Hua

2017-01-01

Abstract Rationale: Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Patient concerns: Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. Diagnoses: The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Interventions: Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. Outcomes: The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. Lessons: We report the first 2 cases of

Methylenetetrahydrofolate reductase gene polymorphisms and acute lymphoblastic leukemia risk: a meta-analysis based on 28 case-control studies.

PubMed

Tong, Na; Sheng, Xiaojing; Wang, Meilin; Fang, Yongjun; Shi, Danni; Zhang, Zhizhong; Zhang, Zhengdong

2011-10-01

Methylenetetrahydrofolate reductase (MTHFR) is involved in DNA methylation and nucleotide synthesis. Accumulated evidence has demonstrated that C677T and A1298C polymorphisms of the MTHFR gene are associated with acute lymphoblastic leukemia (ALL) risk, but the results have been inconclusive. To determine a more precise estimation, we performed a meta-analysis of 28 studies with 4240 cases and 9289 controls. We found that the 677TT genotype showed a reduced risk of ALL compared with the 677CC genotype in the overall population (odds ratio [OR] 0.76, 95% confidence interval [CI] 0.61-0.92). The reduced risk was pronounced only among the Caucasian population (OR 0.68, 95% CI 0.51-0.90), not the Asian (OR 0.89, 95% CI 0.75-1.05). For the MTHFR A1298C polymorphism, no significant association with ALL susceptibility was observed in the pooled analyses. However, significantly increased ALL risk was found in childhood in the comparison of 1298CA versus AA genotype. This study provides evidence that MTHFR polymorphisms may play an important role in the development of ALL.

Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Min; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

2009-06-05

We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicatesmore » that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.« less

Seven novel mutations in the methylenetetrahydrofolate reductase gene and genotype/phenotype correlations in severe methylenetetrahydrofolate reductase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goyette, P.; Frosst, P.; Rosenblatt, D.S.

1995-05-01

5-Methyltetrahydrofolate, the major form of folate in plasma, is a carbon donor for the remethylation of homocysteine to methionine. This form of folate is generated from 5,10-methylenetetrahydrofolate through the action of 5,10-methylenetetrahydrofolate reductase (MTHFR), a cytosolic flavoprotein. Patients with an autosomal recessive severe deficiency of MTHFR have homocystinuria and a wide range of neurological and vascular disturbances. We have recently described the isolation of a cDNA for MTHFR and the identification of two mutations in patients with severe MTHFR deficiency. We report here the characterization of seven novel mutations in this gene: six missense mutations and a 5{prime} splice-site defectmore » that activates a cryptic splice in the coding sequence. We also present a preliminary analysis of the relationship between genotype and phenotype for all nine mutations identified thus far in this gene. A nonsense mutation and two missense mutations (proline to leucine and threonine to methionine) in the homozygous state are associated with extremely low activity (0%-3%) and onset of symptoms within the 1st year of age. Other missense mutations (arginine to cysteine and arginine to glutamine) are associated with higher enzyme activity and later onset of symptoms. 19 refs., 4 figs., 2 tabs.« less

The m.3291T>C mt-tRNALeu(UUR) mutation is definitely pathogenic and causes multisystem mitochondrial disease

PubMed Central

Yarham, John W.; Blakely, Emma L.; Alston, Charlotte L.; Roberts, Mark E.; Ealing, John; Pal, Piyali; Turnbull, Douglass M.; McFarland, Robert; Taylor, Robert W.

2013-01-01

Mitochondrial tRNA point mutations are important causes of human disease, and have been associated with a diverse range of clinical phenotypes. Definitively proving the pathogenicity of any given mt-tRNA mutation requires combined molecular, genetic and functional studies. Subsequent evaluation of the mutation using a pathogenicity scoring system is often very helpful in concluding whether or not the mutation is causing disease. Despite several independent reports linking the m.3291T>C mutation to disease in humans, albeit in association with several different phenotypes, its pathogenicity remains controversial. A lack of conclusive functional evidence and an over-emphasis on the poor evolutionary conservation of the affected nucleotide have contributed to this controversy. Here we describe an adult patient who presented with deafness and lipomas and evidence of mitochondrial abnormalities in his muscle biopsy, who harbours the m.3291T > C mutation, providing conclusive evidence of pathogenicity through analysis of mutation segregation with cytochrome c oxidase (COX) deficiency in single muscle fibres, underlining the importance of performing functional studies when assessing pathogenicity. PMID:23273904

Retrospective approach to methylenetetrahydrofolate reductase mutations in children.

PubMed

Özer, Işıl; Özçetin, Mustafa; Karaer, Hatice; Kurt, Semiha G; Şahin, Şemsettin

2011-07-01

Methylenetetrahydrofolate reductase reduces methyltetrahydrofolate, a cosubstrate in the remethylation of homocysteine, from methylenetetrahydrofolate. Congenital defects, hematologic tumors, and intrauterine growth retardation can occur during childhood. This study evaluated clinical and laboratory treatment approaches in children diagnosed with methylenetetrahydrofolate reductase mutations. Our group included 23 boys and 14 girls, aged 103.4 ± 70.8 months S.D. Clinical findings of patients and homocysteine, vitamin B12, folate, hemogram, electroencephalography, cranial magnetic resonance imaging, and echocardiography data were evaluated in terms of treatment approach. Our patients' findings included vitamin B12 at 400.4 ± 224.6 pg/mL S.D. (normal range, 300-700 pg/mL), folate at 10.1 ± 4.5 ng/mL S.D. (normal range, 1.8-9 ng/mL), and homocysteine at 8.4 ± 4.7 μmol/L S.D. (normal range, 5.5-17 μmol/L). Eighty-eight percent of patients demonstrated clinical findings. In comparisons involving categorical variables between groups, χ(2) tests were used. No relationship was evident between mutation type, laboratory data, and clinical severity. All mothers who had MTHFR mutations and had babies with sacral dimples had taken folate supplements during pregnancy. To avoid the risk of neural tube defects, pregnant women with a MTHFR mutation may require higher than normally recommended doses of folic acid supplementation for optimum health. Copyright © 2011 Elsevier Inc. All rights reserved.

Methylenetetrahydrofolate reductase gene polymorphism and risk of chronic myelogenous leukemia: a meta-analysis.

PubMed

Li, Chen; Yichao, Jin; Jiaxin, Lin; Yueting, Zhang; Qin, Lu; Tonghua, Yang

2015-01-01

Reported evidence supports a role for methylenetetrahydrofolate reductase (MTHFR) in the risk of chronic myelogenous leykemia (CML). However, these reports arrived at non-conclusive and even conflicting results regarding the association between two common MTHFR polymorphisms (C677T and A1298C) and CML risk. Thus, a meta-analysis was carried out to clarify a more precise association between these two polymorphisms and the CML risk by updating the available publications. Pooled odds ratios (OR) with corresponding 95% confidence interval (95% CI) and stratification analysis were performed to estimate the relationship between MTHFR polymorphisms and the risk of CML under different genetic comparison models. Data from the meta-analysis showed no significant association between MTHFR C677T polymorphism and CML risk. However, significant associations were found between MTHFR A1298C variants and CML risk under homozygous comparison model (CC vs AA, OR=1.62, 95% CI=1.11-2.36, p=0.01) and dominant comparison model (CC+AC vs AA, OR=1.68, 95% CI=1.17-2.43, p=0.005) in overall population; especially more obvious impacts were noticed for Asian populations in subgroup analysis for homozygous model (CC vs AA, OR=2.00, 95% CI=1.25-3.21, p=0.004) and dominant model (CC+AC vs AA, OR=2.49, 95% CI=1.42-4.36, p=0.001), but this did not apply in Caucasian populations. The results of this meta-analysis suggested no significant association between MTHFR C677T polymorphism and CML risk, while an increased CML risk was noticed for 1298C variant carriers, especially in Asian populations but not in Caucasian populations, which suggested ethnicity differences between MTHFR A1298C polymorphisms and risk of CML.

Hyperhomocysteinaemia, methylenetetrahydrofolate reductase polymorphism and risk of coronary artery disease.

PubMed

Kerkeni, Mohsen; Addad, Faouzi; Chauffert, Maryline; Myara, Anne; Gerhardt, Marie; Chevenne, Didier; Trivin, François; Farhat, Mohamed Ben; Miled, Abdelhedi; Maaroufi, Khira

2006-05-01

Hyperhomocysteinaemia is an independent, graded risk factor for coronary artery disease (CAD). The methylenetetrahydrofolate reductase (MTHFR) polymorphism is associated with hyperhomcysteinaemia and may therefore influence individual susceptibility to CAD. We have investigated this risk factor in a Tunisian Arab population. Polymerase chain reaction-restriction fragment length polymorphism analysis was used to detect the C677T and A1298C variants of the MTHFR gene in 100 patients with CAD and 120 healthy controls. The severity of CAD was expressed as the number of affected vessels. Plasma total homocysteine (tHcy) concentration was determined using a direct chemiluminescence assay. MTHFR CC, CT and TT genotype frequencies in the CAD group were significantly different from those observed in the control group (49%, 35% and 16% versus 48.3%, 45.8% and 5.8%, respectively; P = 0.031). However, MTHFR AA, AC and CC genotypes frequencies in the CAD group were not significantly different from the control group ( P = 0.568). Patients with CAD showed higher plasma tHcy concentrations than patients without CAD (15.86 +/- 8.63 micromol/L versus 11.90 +/- 3.25 micromol/L, P < 0.001). There was no association between the MTHFR polymorphisms and the number of stenosed vessels. Patients with the MTHFR TT genotype had higher plasma tHcy, serum creatinine, cholesterol and triglyceride concentrations than patients with the MTHFR CC genotype. The C677T polymorphism of the MTHFR gene is associated with hyperhomocysteinaemia, lipid dysregulation and the presence of CAD in this Tunisian Arab population.

A hybrid stochastic model of folate-mediated one-carbon metabolism: Effect of the common C677T MTHFR variant on de novo thymidylate biosynthesis.

PubMed

Misselbeck, Karla; Marchetti, Luca; Field, Martha S; Scotti, Marco; Priami, Corrado; Stover, Patrick J

2017-04-11

Folate-mediated one-carbon metabolism (FOCM) is an interconnected network of metabolic pathways, including those required for the de novo synthesis of dTMP and purine nucleotides and for remethylation of homocysteine to methionine. Mouse models of folate-responsive neural tube defects (NTDs) indicate that impaired de novo thymidylate (dTMP) synthesis through changes in SHMT expression is causative in folate-responsive NTDs. We have created a hybrid computational model comprised of ordinary differential equations and stochastic simulation. We investigated whether the de novo dTMP synthesis pathway was sensitive to perturbations in FOCM that are known to be associated with human NTDs. This computational model shows that de novo dTMP synthesis is highly sensitive to the common MTHFR C677T polymorphism and that the effect of the polymorphism on FOCM is greater in folate deficiency. Computational simulations indicate that the MTHFR C677T polymorphism and folate deficiency interact to increase the stochastic behavior of the FOCM network, with the greatest instability observed for reactions catalyzed by serine hydroxymethyltransferase (SHMT). Furthermore, we show that de novo dTMP synthesis does not occur in the cytosol at rates sufficient for DNA replication, supporting empirical data indicating that impaired nuclear de novo dTMP synthesis results in uracil misincorporation into DNA.

Novel mutation of SRD5A2 gene in a patient with 5α-reductase 2 deficiency from India.

PubMed

Shabir, Iram; Marumudi, Eunice; Khurana, Madan L; Khadgawat, Rajesh

2012-10-30

Master N had genital malformation at birth and had bilateral gonads in the labial fold. He was reared as a boy and corrective surgery was done at the age of 4 years and was reassessed at the age of 14 years. His testosterone/dihydrotestosterone (DHT) was 11.8 (reference range <=10). Molecular analysis of SRD5A2 gene indicated the presence of a novel heterozygous missense mutation of p.A52T in exon 1, which was also detected in mother. The father, sister and maternal grandfather were found to have normal SRD5A2 gene sequence. We also detected an intronic (1-2) homozygous T>C transition in patient, whereas both parents were found to have the same transition in heterozygous form. Although 5α-steroid reductase 2 deficiency is an autosomal-recessive disorder, in this case, it appears that there may be a dominant inheritance because only one identified mutation was present which was passed from mother to son.

Impact of methylenetetrahydrofolate reductase (MTHFR) polymorphisms on methotrexate-induced toxicities in acute lymphoblastic leukemia: a meta-analysis.

PubMed

Yang, Lin; Hu, Xin; Xu, Luhang

2012-10-01

The associations between methylenetetrahydrofolate reductase (MTHFR) polymorphism and methotrexate (MTX)-induced toxicities in patients with acute lymphoblastic leukemia (ALL) have been evaluated in various populations, with the results remained conflicting. Therefore, we conducted a meta-analysis by combining available data to derive a more precise estimation of the association. PubMed, Embase, and China National Knowledge Infrastructure were searched until 21 September 2011 to identify eligible studies. A total of 14 studies were included, with all studies investigating MTHFR C677T polymorphism while nine of them investigating MTHFR A1298C polymorphism only. Results suggested that MTHFR C677T polymorphism was associated with significantly increased risk of MTX-induced toxicity, specifically liver toxicity (TT/CT vs. CC: odds ratio (OR) = 1.70, 95 % confidence interval (CI) = 1.05-2.75), myelosuppression (TT vs. CT/CC: OR = 2.82, 95 %CI = 1.25-6.34), oral mucositis (TT/CT vs. CC: OR = 3.68, 95 %CI = 1.73-7.85), gastrointestinal toxicity (TT/CT vs. CC: OR = 2.36, 95 %CI = 1.36-4.11), and skin toxicity (T vs. C: OR = 2.26, 95 %CI = 1.07-4.74). MTHFR A1298C polymorphism was found to be associated with decreased risk of skin toxicity (CC/AC vs. AA: OR = 0.11, 95 %CI = 0.01-0.85). Genotyping of MTHFR polymorphism, C677T particularly, prior to treatment for ALL is likely to be useful with the aim of tailoring MTX therapy and thus reducing the MTX-related toxicities. However, further studies with larger data set and well-designed models are required to validate our findings.

Correlated motion and the effect of distal mutations in dihydrofolate reductase

PubMed Central

Rod, Thomas H.; Radkiewicz, Jennifer L.; Brooks, Charles L.

2003-01-01

Dihydrofolate reductase (DHFR) catalyzes the reduction of dihydrofolate to tetrahydrofolate. The catalytic rate in this system has been found to be significantly affected by mutations far from the site of chemical activity in the enzyme [Rajagopalan, P. T. R, Lutz, S., and Benkovic, S. J. (2002) Biochemistry 41, 12618–12628]. On the basis of extensive computer simulations for wild-type DHFR from Escherichia coli and four mutants (G121S, G121V, M42F, and M42F/G121S), we show that key parameters for catalysis are changed. The parameters we study are relative populations of different conformations sampled and hydrogen bonds. We find that the mutations result in long-range structural perturbations, rationalizing the effects that the mutations have on the kinetics of the enzyme. Such perturbations also provide a rationalization for the reported nonadditivity effect for double mutations. We finally examine the role a structural perturbation will have on the hydride transfer step. On the basis of our new findings, we discuss the role of coupled motions between distant regions in the enzyme, which previously was reported by Radkiewicz and Brooks. PMID:12756296

No evidence of association of methylenetetrahydrofolate reductase polymorphism with occurrence of second neoplasms after treatment of childhood leukemia.

PubMed

Jazbec, Janez; Kitanovski, Lidija; Aplenc, Richard; Debeljak, Marusa; Dolzan, Vita

2005-06-01

Methylenetetrahydrofolate reductase (MTHFR) polymorphisms have been associated not only with the risk for acute lymphoblastic leukemia (ALL) in adults and children, but also with increased methotrexate toxicity. The present study aimed to investigate whether MTHFR polymorphisms modify the risk for development of secondary malignancies in children treated for ALL with protocols that included high-dose methotrexate. MTHFR genotypes were determined in DNA samples isolated from archived bone marrow smears of 15 patients with a second malignancy and a matched control group of 30 patients who did not developed a second malignancy after the treatment for ALL. The frequencies of MTHFR C677T and A1298C genotypes in all patients were: C677T: CC 40%, CT 46.7% and TT 13.3% and A1298C: AA 46.7%, AC 44.4% and CC 8.9%. The relative risk for second malignancy was not significantly increased in ALL patients having at least one polymorphic C667T [odds ratio (OR) 1.51; 95% confidence interval (CI) 0.43-5.31] or one polymorphic A1298C allele (OR 1; 95% CI 0.29?-?3.46). Our study suggests that MTHFR polymorphisms are not associated with increased risk of second cancer in children treated with high-dose methotrexate.

A Lower Degree of PBMC L1 Methylation in Women with Lower Folate Status May Explain the MTHFR C677T Polymorphism Associated Higher Risk of CIN in the US Post Folic Acid Fortification Era

PubMed Central

Badiga, Suguna; Johanning, Gary L.; Macaluso, Maurizio; Azuero, Andres; Chambers, Michelle M.; Siddiqui, Nuzhat R.; Piyathilake, Chandrika J.

2014-01-01

Background Studies in populations unexposed to folic acid (FA) fortification have demonstrated that MTHFR C677T polymorphism is associated with increased risk of higher grades of cervical intraepithelial neoplasia (CIN 2+). However, it is unknown whether exposure to higher folate as a result of the FA fortification program has altered the association between MTHFR C677T and risk of CIN, or the mechanisms involved with such alterations. The current study investigated the following in a FA fortified population: 1) The association between MTHFR C677T polymorphism and risk of CIN 2+; 2) The modifying effects of plasma folate concentrations on this association; and 3) The modifying effects of plasma folate on the association between the polymorphism and degree of methylation of long interspersed nucleotide elements (L1s), in peripheral blood mononuclear cell (PBMC) DNA, a documented biomarker of CIN risk. Methods The study included 457 US women diagnosed with either CIN 2+ (cases) or ≤ CIN 1 (non-cases). Unconditional logistic regression models were used to test the associations after adjusting for relevant risk factors for CIN. Results The 677CT/TT MTHFR genotypes were not associated with the risk of CIN 2+. Women with CT/TT genotype with lower folate, however, were more likely to be diagnosed with CIN 2+ compared to women with CT/TT genotype with higher folate (OR = 2.41, P = 0.030). Women with CT/TT genotype with lower folate were less likely to have a higher degree of PBMC L1 methylation compared to women with CT/TT genotype with higher folate (OR = 0.28, P = 0.017). Conclusions This study provides the first evidence that the MTHFR 677CT/TT genotype-associated lower degree of PBMC L1 methylation increases the risk of CIN 2+ in women in the US post-FA fortification era. Thus, even in the post-FA fortification era, not all women have adequate folate status to overcome MTHFR 677CT/TT genotype-associated lower degree of L1 methylation. PMID:25302494

Role of genetic mutations in folate-related enzyme genes on Male Infertility

PubMed Central

Liu, Kang; Zhao, Ruizhe; Shen, Min; Ye, Jiaxin; Li, Xiao; Huang, Yuan; Hua, Lixin; Wang, Zengjun; Li, Jie

2015-01-01

Several studies showed that the genetic mutations in the folate-related enzyme genes might be associated with male infertility; however, the results were still inconsistent. We performed a meta-analysis with trial sequential analysis to investigate the associations between the MTHFR C677T, MTHFR A1298C, MTR A2756G, MTRR A66G mutations and the MTHFR haplotype with the risk of male infertility. Overall, a total of 37 studies were selected. Our meta-analysis showed that the MTHFR C677T mutation was a risk factor for male infertility in both azoospermia and oligoasthenoteratozoospermia patients, especially in Asian population. Men carrying the MTHFR TC haplotype were most liable to suffer infertility while those with CC haplotype had lowest risk. On the other hand, the MTHFR A1298C mutation was not related to male infertility. MTR A2756G and MTRR A66G were potential candidates in the pathogenesis of male infertility, but more case-control studies were required to avoid false-positive outcomes. All of these results were confirmed by the trial sequential analysis. Finally, our meta-analysis with trial sequential analysis proved that the genetic mutations in the folate-related enzyme genes played a significant role in male infertility. PMID:26549413

Significance of 5,10-methylenetetrahydrofolate reductase gene variants in acute lymphoblastic leukemia in Indian population: an experimental, computational and meta-analysis.

PubMed

Bellampalli, Ravishankara; Phani, Nagaraja M; Bhat, Kamalakshi G; Prasad, Krishna; Bhaskaranand, Nalini; Guruprasad, Kanive P; Rai, Padmalatha S; Satyamoorthy, Kapaettu

2015-05-01

Acute lymphoblastic leukemia (ALL) arises due to several genetic alterations in progenitor cells, and methotrexate is frequently used as part of the treatment regimen. Although there is evidence for an effect of 5,10-methylenetetrahydrofolate reductase gene (MTHFR) C677T and A1298C variations on drug response in ALL, its risk association for ALL is still unresolved. In a case-control study of 203 patients with ALL and 246 controls and meta-analysis in the Indian population, we showed an insignificant association of MTHFR C677T and A1298C genotypes with childhood and adult ALL. Comprehensive in silico characterization of non-synonymous single nucleotide polymorphisms (nsSNPs) and SNPs of the 3' untranslated region (UTR) revealed nine nsSNPs as deleterious, and three SNPs in the 3'UTR could possibly alter the binding of miRNAs. The study revealed that several overlooked SNPs may contribute to the risk of ALL susceptibility and further studies of these SNPs with functional characterization in a large sample size are required to understand the significant role of MTHFR in ALL development.

MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

PubMed

Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

2014-03-01

We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Fuxin; Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003; Guan, Minqiang

2009-11-20

We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visualmore » impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.« less

Haplotype analysis suggest that the MLH1 c.2059C > T mutation is a Swedish founder mutation.

PubMed

von Salomé, Jenny; Liu, Tao; Keihäs, Markku; Morak, Moni; Holinski-Feder, Elke; Berry, Ian R; Moilanen, Jukka S; Baert-Desurmont, Stéphanie; Lindblom, Annika; Lagerstedt-Robinson, Kristina

2017-12-29

Lynch syndrome (LS) predisposes to a spectrum of cancers and increases the lifetime risk of developing colorectal- or endometrial cancer to over 50%. Lynch syndrome is dominantly inherited and is caused by defects in DNA mismatch-repair genes MLH1, MSH2, MSH6 or PMS2, with the vast majority detected in MLH1 and MSH2. Recurrent LS-associated variants observed in apparently unrelated individuals, have either arisen de novo in different families due to mutation hotspots, or are inherited from a founder (a common ancestor) that lived several generations back. There are variants that recur in some populations while also acting as founders in other ethnic groups. Testing for founder mutations can facilitate molecular diagnosis of Lynch Syndrome more efficiently and more cost effective than screening for all possible mutations. Here we report a study of the missense mutation MLH1 c.2059C > T (p.Arg687Trp), a potential founder mutation identified in eight Swedish families and one Finnish family with Swedish ancestors. Haplotype analysis confirmed that the Finnish and Swedish families shared a haplotype of between 0.9 and 2.8 Mb. While MLH1 c.2059C > T exists worldwide, the Swedish haplotype was not found among mutation carriers from Germany or France, which indicates a common founder in the Swedish population. The geographic distribution of MLH1 c.2059C > T in Sweden suggests a single, ancient mutational event in the northern part of Sweden.

MTHFR Gene Polymorphism-Mutations and Air Pollution as Risk Factors for Breast Cancer

PubMed Central

Gonzales, Mildred C.; Yu, Pojui; Shiao, S. Pamela K.

2017-01-01

Background The methylenetetrahydrofolate reductase gene (MTHFR) is one of the most investigated genes associated with breast cancer for its role in epigenetic pathways. Objectives The objectives of this metaprediction study were to examine the polymorphism-mutation risk subtypes of MTHFR and air pollution as contributing factors for breast cancer. Methods For triangulation purposes in metapredictive analyses, we used a recursive partition tree, nonlinear association curve fit, and heat maps for data visualization, in addition to the conventional comparison procedure and pooled analyses. Results We included 36,683 breast cancer cases and 40,689 controls across 82 studies for MTHFR 677 and 23,252 cases and 27,094 controls across 50 studies for MTHFR 1298. MTHFR 677 TT was a risk genotype for breast cancer (p = .0004) and in the East Asian subgroup (p = .005). On global maps, the most polymorphism-mutations on MTHFR 677 TT were found in the Middle East, Europe, Asia, and the Americas, whereas the most mutations on MTHFR 1298 CC were located in Europe and the Middle East for the control group. The geographic information system maps further revealed that MTHFR 677 TT mutations yielded a higher risk of breast cancer for Australia, East Asia, the Middle East, South Europe, Morocco, and the Americas and that MTHFR 1298 CC mutations yielded a higher risk in Asia, the Middle East, South Europe, and South America. Metapredictive analysis revealed that air pollution level was significantly associated with MTHFR 677 TT polymorphism-mutation genotype. Discussion We present the most comprehensive analyses to date of MTHFR polymorphism-mutations and breast cancer risk. Future nursing studies are needed to investigate the health impact on breast cancer of epigenetics and air pollution across populations. PMID:28114181

Influence of methylenetetrahydrofolate reductase genotype, exercise and other risk factors on endothelial function in healthy individuals.

PubMed

Pullin, Catherine H; Wilson, John F; Ashfield-Watt, Pauline A L; Clark, Zoë E; Whiting, Jenny M; Lewis, Malcolm J; McDowell, Ian F W

2002-01-01

Cardiovascular disease has a multifactorial aetiology that is influenced by both genetic and environmental factors. Endothelial dysfunction is a key event in the pathogenesis of vascular disease that occurs before structural vascular changes or clinical symptoms are evident. Conventional risk factors, for example hypertension and diabetes mellitus, are associated with endothelial dysfunction, but the influence of other putative risk factors is not clear. The methylenetetrahydrofolate reductase (MTHFR) C677T genotype, a common polymorphism that induces hyperhomocysteinaemia, has been proposed as being a genetic risk factor for cardiovascular disease. A total of 126 healthy adults recruited by MTHFR C677T genotype (42 of each genotype, i.e. CC, CT and TT) underwent assessment of endothelial function. Brachial artery endothelium-dependent flow-mediated dilatation (FMD) was measured using high-resolution ultrasonic vessel "wall-tracking". Using multiple regression analysis, MTHFR genotype and 21 other subject and subject-lifestyle variables were investigated as potential predictors of endothelial function. FMD was influenced positively by frequency of aerobic exercise and by hormone replacement therapy, and negatively by increases in systolic blood pressure. MTHFR C677T genotype and the associated variation in plasma homocysteine levels did not influence FMD. Additionally, other factors, including plasma cholesterol and self-supplementation with either antioxidant vitamins or cod liver oil, showed no significant relationship with FMD, although these findings are compromised by the narrow range studied for cholesterol and the small number of subjects taking supplements. These observations have implications for risk factor management in the primary prevention of cardiovascular disease in healthy individuals.

MTHFR Gene Polymorphism-Mutations and Air Pollution as Risk Factors for Breast Cancer: A Metaprediction Study.

PubMed

Gonzales, Mildred C; Yu, Pojui; Shiao, S Pamela K

The methylenetetrahydrofolate reductase gene (MTHFR) is one of the most investigated genes associated with breast cancer for its role in epigenetic pathways. The objectives of this metaprediction study were to examine the polymorphism-mutation risk subtypes of MTHFR and air pollution as contributing factors for breast cancer. For triangulation purposes in metapredictive analyses, we used a recursive partition tree, nonlinear association curve fit, and heat maps for data visualization, in addition to the conventional comparison procedure and pooled analyses. We included 36,683 breast cancer cases and 40,689 controls across 82 studies for MTHFR 677 and 23,252 cases and 27,094 controls across 50 studies for MTHFR 1298. MTHFR 677 TT was a risk genotype for breast cancer (p = .0004) and in the East Asian subgroup (p = .005). On global maps, the most polymorphism-mutations on MTHFR 677 TT were found in the Middle East, Europe, Asia, and the Americas, whereas the most mutations on MTHFR 1298 CC were located in Europe and the Middle East for the control group. The geographic information system maps further revealed that MTHFR 677 TT mutations yielded a higher risk of breast cancer for Australia, East Asia, the Middle East, South Europe, Morocco, and the Americas and that MTHFR 1298 CC mutations yielded a higher risk in Asia, the Middle East, South Europe, and South America. Metapredictive analysis revealed that air pollution level was significantly associated with MTHFR 677 TT polymorphism-mutation genotype. We present the most comprehensive analyses to date of MTHFR polymorphism-mutations and breast cancer risk. Future nursing studies are needed to investigate the health impact on breast cancer of epigenetics and air pollution across populations.

Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family.

PubMed

Zhai, Wei; Jin, Xin; Gong, Yan; Qu, Ling-Hui; Zhao, Chen; Li, Zhao-Hui

2015-01-01

To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2). The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing. The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls. We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27)

PubMed Central

McCabe, Michael T.; Graves, Alan P.; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S.; Jiang, Yong; Smitheman, Kimberly N.; Ott, Heidi M.; Pappalardi, Melissa B.; Allen, Kimberly E.; Chen, Stephanie B.; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M.; Gilbert, Seth A.; Thrall, Sara H.; Tummino, Peter J.; Kruger, Ryan G.; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L.

2012-01-01

Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 kcat/Km ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 kcat/Km ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 kcat/Km ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2. PMID:22323599

Mutation of A677 in histone methyltransferase EZH2 in human B-cell lymphoma promotes hypertrimethylation of histone H3 on lysine 27 (H3K27).

PubMed

McCabe, Michael T; Graves, Alan P; Ganji, Gopinath; Diaz, Elsie; Halsey, Wendy S; Jiang, Yong; Smitheman, Kimberly N; Ott, Heidi M; Pappalardi, Melissa B; Allen, Kimberly E; Chen, Stephanie B; Della Pietra, Anthony; Dul, Edward; Hughes, Ashley M; Gilbert, Seth A; Thrall, Sara H; Tummino, Peter J; Kruger, Ryan G; Brandt, Martin; Schwartz, Benjamin; Creasy, Caretha L

2012-02-21

Trimethylation of histone H3 on lysine 27 (H3K27me3) is a repressive posttranslational modification mediated by the histone methyltransferase EZH2. EZH2 is a component of the polycomb repressive complex 2 and is overexpressed in many cancers. In B-cell lymphomas, its substrate preference is frequently altered through somatic mutation of the EZH2 Y641 residue. Herein, we identify mutation of EZH2 A677 to a glycine (A677G) among lymphoma cell lines and primary tumor specimens. Similar to Y641 mutant cell lines, an A677G mutant cell line revealed aberrantly elevated H3K27me3 and decreased monomethylated H3K27 (H3K27me1) and dimethylated H3K27 (H3K27me2). A677G EZH2 possessed catalytic activity with a substrate specificity that was distinct from those of both WT EZH2 and Y641 mutants. Whereas WT EZH2 displayed a preference for substrates with less methylation [unmethylated H3K27 (H3K27me0):me1:me2 k(cat)/K(m) ratio = 9:6:1] and Y641 mutants preferred substrates with greater methylation (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1:2:13), the A677G EZH2 demonstrated nearly equal efficiency for all three substrates (H3K27me0:me1:me2 k(cat)/K(m) ratio = 1.1:0.6:1). When transiently expressed in cells, A677G EZH2, but not WT EZH2, increased global H3K27me3 and decreased H3K27me2. Structural modeling of WT and mutant EZH2 suggested that the A677G mutation acquires the ability to methylate H3K27me2 through enlargement of the lysine tunnel while preserving activity with H3K27me0/me1 substrates through retention of the Y641 residue that is crucial for orientation of these smaller substrates. This mutation highlights the interplay between Y641 and A677 residues in the substrate specificity of EZH2 and identifies another lymphoma patient population that harbors an activating mutation of EZH2.

The contribution of the SPINK1 c.194+2T>C mutation to the clinical course of idiopathic chronic pancreatitis in Chinese patients.

PubMed

Sun, Chang; Liao, Zhuan; Jiang, Lili; Yang, Fu; Xue, Geng; Zhou, Qi; Chen, Ruiwen; Sun, Shuhan; Li, Zhaoshen

2013-01-01

Recent data suggest that the serine protease inhibitor Kazal type 1 (SPINK1) gene mutation is associated with idiopathic chronic pancreatitis. However, few studies have focused on the serine protease inhibitor Kazal type 1 c.194+2T>C mutation. Therefore, our goal was to study the prevalence and impact of serine protease inhibitor Kazal type 1 mutations on the clinical profile of idiopathic chronic pancreatitis patients in China. A retrospective-cohort study of 118 Chinese patients with idiopathic chronic pancreatitis was performed, and genetic tests were carried out to detect SPINK1 mutations. Subjects without pancreatitis were used as controls. In total, 118 idiopathic chronic pancreatitis patients and 100 control subjects were evaluated. The serine protease inhibitor Kazal type 1 c.194+2T>C variant was present in 44.9% of patients with idiopathic chronic pancreatitis. The frequency of diabetes in idiopathic chronic pancreatitis patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (39.6%) was higher than that of patients without the mutation (9.2%). The time to occurrence of diabetes mellitus after idiopathic chronic pancreatitis symptom onset is significantly influenced by the c.194+2T>C mutation (p<0.001). In addition, the mean age of diabetes onset in patients with the serine protease inhibitor Kazal type 1 c.194+2T>C mutation (38.33 ± 9.50) was significantly younger than that of patients without this mutation (49.67 ± 6.74). The presence of the serine protease inhibitor Kazal type 1 c.194+2T>C mutation seems to be associated with idiopathic chronic pancreatitis and could predispose individuals to pancreatic diabetes onset at an earlier age. Copyright © 2012 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

[Association between the methylenetetrahydrofolate reductase gene polymorphisms and haplotype with toxicity response of high dose methotrexate chemotherapy].

PubMed

Liao, Qing-Chuan; Li, Xiao-Lei; Liu, Si-Ting; Zhang, Yong; Li, Tian-Yuan; Qiu, Jin-Chun

2012-07-01

To investigate the association between single nucleotide polymorphisms (SNP) and its haplotypes of methylenetetrahydrofolate reductase (MTHFR) gene with high dose methotrexate (HDMTX)-induced toxicity in children with acute lymphoblastic leukemia (ALL). HDMTX-treated children with ALL (1.2 to 14-years old) were selected from inpatient and followed for a retrospective study. The toxicity response of HDMTX chemotherapy was evaluated using WHO common toxicity criteria. Sixty-one patients with therapy-related toxicity and 36 patients without therapy-related toxicity were genotyped for 2 SNP (677C > T and 1298A > C) of the MTHFR gene by polymerase chain reaction-restriction fragment length polymorphism. Frequency of haplotypes and linkage disequilibrium of MTHFR gene were analyzed by SHEsis program. The distribution of MTHFR gene 677C > T polymorphism did not appeare different between groups with or without toxicity response (χ(2) = 4.609, P = 0.100), but the 1298A > C polymorphism was significantly different (χ(2) = 10.192, P = 0.006). Individuals who carried C allele (AC + CC genotype) had a decreased risk of toxicity response compared to AA genotype (OR = 0.245, 95%CI: 0.099 - 0.607, P = 0.002). 677C > T and 1298A > C polymorphisms showed strong linkage disequilibrium (D' = 0.895). The CC haplotype was significantly associated with decreased risk of toxicity response (OR = 0.338, 95%CI: 0.155 - 0.738, P = 0.005), while the TA haplotype was significantly associated with the increased risk of toxicity response (OR = 1.907, 95%CI: 1.045 - 3.482, P = 0.035). MTHFR gene 1298C allele and CC haplotype might serve as protective factors while TA haplotype as a risk factor for the susceptibility to toxicity response of HDMTX chemotherapy in children with ALL.

Methylene tetrahydrofolate reductase gene polymorphism in Egyptian children with acute lymphoblastic leukemia.

PubMed

Tantawy, Azza A G; El-Bostany, Eman A; Adly, Amira A M; Abou El Asrar, Mohammed; El-Ghouroury, Eman A; Abdulghaffar, Esmat E

2010-01-01

Genetic variations of the enzymes involved in chemotherapy metabolism in cancer patients may play a role in determining relapse and toxicity risks. Methotrexate is a key drug in acute lymphoblastic leukemia (ALL) treatment; it inhibits DNA replication by blocking the conversion of 5,10 methylene tetrahydrofolate to 5-methylene tetrahydrofolate by methylene tetrahydrofolate reductase (MTHFR). MTHFR is central to folate metabolism and has two common functional polymorphisms (C677>T and A1298>C). The present study aimed to assess the prevalence of MTHFR polymorphisms C677>T and A1298>C in Egyptian children with ALL and the relation to the frequency of drug-induced complications and relapse rate. Forty ALL patients were included in the study. They were treated according to modified ALL-BFM 90 protocol, and were followed up for 3.1-6.5 years. The severity and duration of hepatic, mucosal and infectious complications during therapy were reported. MTHFR genotyping was done with a PCR-based restriction fragment length polymorphism assay. The MTHFR C677>T polymorphic allele frequencies were 40, 27.5, and 32.5% for TT, CT, and CC genotypes, respectively among the studied ALL patients. The MTHFR A1298>C polymorphic allele frequencies were 40, 35, and 25% for AA, AC, and CC genotypes, respectively. Methotrexate therapy was significantly associated with increased grade III/IV toxicity in TT genotype: diarrhea in 81.3%, oral mucositis in 81.3%, elevated transaminases in 87.5%, neutropenia in 78.7% compared to values of 7.7, 7.7, 15.3, and 7.7% in CC genotype, respectively (P < 0.0001, P < 0.0001, P < 0.0001, and P = 0.03). The 677 TT genotype was significantly associated with relapse in 5 years in 56.3%, compared to 18.2% in CT and 0% in CC alleles. The overall 5 years survival was significantly lower in 677 TT (50%) compared with CC genotypes (92.3%) (P = 0.001). No significant relation was found between MTHFR A1298C polymorphism and the risks of therapy induced complications

Long-term outcome of Leigh syndrome caused by the NARP-T8993C mtDNA mutation.

PubMed

Debray, François-Guillaume; Lambert, Marie; Lortie, Anne; Vanasse, Michel; Mitchell, Grant A

2007-09-01

Mutations at mitochondrial DNA (mtDNA) nucleotide 8993 can cause neurogenic weakness, ataxia and retinitis pigmentosa (NARP syndrome), or maternally inherited Leigh syndrome (LS), with a correlation between the amount of mutant mtDNA and the severity of the neurological disease. The T8993C mutation is generally considered to be clinically milder than the T8993G mutation but when the level of heteroplasmy exceeds 90%, progressive neurodegeneration has been found. We report on a long-term follow-up of a patient who presented at 4 years of age with typical LS but showed an unexpected resolution of his symptoms and a favorable outcome. At 18 years of age, his neurological examination was near normal, with neither peripheral neuropathy nor retinopathy. mtDNA analysis identified the presence of T8993C mutation at high level (>95%) in the patient's blood leukocytes. This case report and literature review emphasizes the variability of the phenotypic expression of the T8993C mutation and the need for caution in predictive counseling in such patients. (c) 2007 Wiley-Liss, Inc. Copyright 2007 Wiley-Liss, Inc.

Genetic polymorphisms of methylenetetrahydrofolate reductase and aldehyde dehydrogenase 2, alcohol use and risk of colorectal adenomas: Self-Defense Forces Health Study.

PubMed

Hirose, Maho; Kono, Suminori; Tabata, Shinji; Ogawa, Shinsaku; Yamaguchi, Keizo; Mineshita, Masamichi; Hagiwara, Tomoko; Yin, Guang; Lee, Kyong-Yeon; Tsuji, Akiko; Ikeda, Noriaki

2005-08-01

Methylenetetrahydrofolate reductase is a key enzyme in folate metabolism, which affects DNA synthesis and methylation and is possibly linked to colorectal carcinogenesis. Alcohol and acetaldehyde have an adverse effect on folate metabolism. This study investigated the relationship of functional MTHFR C677T and ALDH2 polymorphisms to colorectal adenomas with reference to alcohol consumption in a case-control study of male officials in the Self-Defense Forces (SDF) who received a preretirement health examination at two SDF hospitals. The study subjects were 452 cases of colorectal adenoma and 1050 controls with no polyp who underwent total colonoscopy. Genotypes were determined by the PCR-RFLP method using genomic DNA extracted from the buffy coat. Statistical adjustment was made for age, hospital, rank in the SDF, body mass index, cigarette-years and alcohol intake. Neither MTHFR C677T nor ALDH2 showed a measurable association with colorectal adenoma. While high alcohol consumption was associated with a moderately increased risk of colorectal adenoma, neither of the two polymorphisms showed a significant effect on the association between alcohol and colorectal adenoma. Individuals with the variant alleles ALDH2*2 and MTHFR 677T had a decreased risk of colorectal adenomas, showing adjusted odds ratios of 0.70 (95% confidence interval 0.49-1.00) for all adenomas and 0.57 (0.34-0.95) for large adenomas (> or = 5 mm), as compared to individuals with ALDH2*1/1 and MTHFR 677CC genotypes combined. The findings may be interpreted as suggesting that folate inhibits the growth of colorectal adenomas, but further confirmation is needed.

Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

PubMed

Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

2015-11-01

Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

Evaluation of Factor V G1691A, prothrombin G20210A, Factor XIII V34L, MTHFR A1298C, MTHFR C677T and PAI-1 4G/5G genotype frequencies of patients subjected to cardiovascular disease (CVD) panel in south-east region of Turkey.

PubMed

Oztuzcu, Serdar; Ergun, Sercan; Ulaşlı, Mustafa; Nacarkahya, Gülper; Iğci, Yusuf Ziya; Iğci, Mehri; Bayraktar, Recep; Tamer, Ali; Çakmak, Ecir Ali; Arslan, Ahmet

2014-06-01

Cardiovascular disease (CVD) risk factors, such as arterial hypertension, obesity, dyslipidemia or diabetes mellitus, as well as CVDs, including myocardial infarction, coronary artery disease or stroke, are the most prevalent diseases and account for the major causes of death worldwide. In the present study, 4,709 unrelated patients subjected to CVD panel in south-east part of Turkey between the years 2010 and 2013 were enrolled and DNA was isolated from the blood samples of these patients. Mutation analyses were conducted using the real-time polymerase chain reaction method to screen six common mutations (Factor V G1691A, PT G20210A, Factor XIII V34L, MTHFR A1298C and C677T and PAI-1 -675 4G/5G) found in CVD panel. The prevalence of these mutations were 0.57, 0.25, 2.61, 13.78, 9.34 and 24.27 % in homozygous form, respectively. Similarly, the mutation percent of them in heterozygous form were 7.43, 3.44, 24.91, 44.94, 41.09 and 45.66%, respectively. No mutation was detected in 92 (1.95%) patients in total. Because of the fact that this is the first study to screen six common mutations in CVD panel in south-east region of Turkey, it has a considerable value on the diagnosis and treatment of these diseases. Upon the results of the present and previous studied a careful examination for these genetic variants should be carried out in thrombophilia screening programs, particularly in Turkish population.

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant

A somatic T15091C mutation in the Cytb gene of mouse mitochondrial DNA dominantly induces respiration defects.

PubMed

Hayashi, Chisato; Takibuchi, Gaku; Shimizu, Akinori; Mito, Takayuki; Ishikawa, Kaori; Nakada, Kazuto; Hayashi, Jun-Ichi

2015-08-07

Our previous studies provided evidence that mammalian mitochondrial DNA (mtDNA) mutations that cause mitochondrial respiration defects behave in a recessive manner, because the induction of respiration defects could be prevented with the help of a small proportion (10%-20%) of mtDNA without the mutations. However, subsequent studies found the induction of respiration defects by the accelerated accumulation of a small proportion of mtDNA with various somatic mutations, indicating the presence of mtDNA mutations that behave in a dominant manner. Here, to provide the evidence for the presence of dominant mutations in mtDNA, we used mouse lung carcinoma P29 cells and examined whether some mtDNA molecules possess somatic mutations that dominantly induce respiration defects. Cloning and sequence analysis of 40-48 mtDNA molecules from P29 cells was carried out to screen for somatic mutations in protein-coding genes, because mutations in these genes could dominantly regulate respiration defects by formation of abnormal polypeptides. We found 108 missense mutations existing in one or more of 40-48 mtDNA molecules. Of these missense mutations, a T15091C mutation in the Cytb gene was expected to be pathogenic due to the presence of its orthologous mutation in mtDNA from a patient with cardiomyopathy. After isolation of many subclones from parental P29 cells, we obtained subclones with various proportions of T15091C mtDNA, and showed that the respiration defects were induced in a subclone with only 49% T15091C mtDNA. Because the induction of respiration defects could not be prevented with the help of the remaining 51% mtDNA without the T15091C mutation, the results indicate that the T15091C mutation in mtDNA dominantly induced the respiration defects. Copyright © 2015 Elsevier Inc. All rights reserved.

Seven novel mutations at the 5,10-methylenetetrahydrofolate reductase locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goyette, P.; Frosst, P.; Rosenblatt, D.S.

1994-09-01

5,10-methylenetetrahydrofolate reductase (MTHFR), a flavoprotein, catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a cofactor for methionine synthase in the methylation of homocysteine to methionine. Severe MTHFR deficiency, which causes homocysteinemia, is an autosomal recessive disorder with variable clinical features; developmental delay, perinatal death, mental retardation and asymptomatic individuals have been observed. A milder deficiency has been reported in patients with cardiovascular disease. We have recently described the isolation of a cDNA for MTHFR and the identification of 2 mutations in patients with severe MTHFR deficiency. We report here the characterization of 7 additional mutations at this locus: 5 missense mutationsmore » and 2 splicing mutations. Mutation analysis was performed by SSCP on PCR products generated either from reverse transcription-PCR of patients` total fibroblast RNA or from PCR of patients` genomic DNA. The 5 missense mutations are as follows: 1 Arg to Cys substitution in a hydrophilic segment proposed to be the hinge region that connects the catalytic and regulatory domains, 2 different Arg to Cys substitutions in 2 patients whose enzymatic thermolability is responsive to FAD, 1 Thr to Met substitution affecting an evolutionarily-conserved residue and a Pro to Leu substitution. The 2 splicing mutations affect the 5{prime} splice site and the 3{prime} splice site of 2 introns, respectively. The 5{prime} splice site mutation generates a 57 bp in-frame deletion of the RNA through the utilization of a cryptic 5{prime} splice site within the coding sequence. The identification of 9 mutations at this locus has allowed us to make preliminary correlations between genotype and phenotype and to contribute to a structure:function analysis of the enzyme.« less

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

Methylenetetrahydrofolate reductase (MTHFR) polymorphisms and promoter methylation in cervical oncogenic lesions and cancer

PubMed Central

Botezatu, Anca; Socolov, Demetra; Iancu, Iulia V; Huica, Irina; Plesa, Adriana; Ungureanu, Carmen; Anton, Gabriela

2013-01-01

The aim of this study was to investigate the role of methylenetetrahydrofolate reductase (MTHFR) polymorphisms and MTHFR methylation pattern in cervical lesions development among women from Romania, a country with high prevalence of human papillomavirus (HPV) cervical infections. To achieve this goal, blood samples and cervical cytology specimens (n = 77)/tumour tissue specimens (n = 23) were investigated. As control, blood and negative cytological smears (n = 50) were used. A statistically significant association was found between T allele of C677T polymorphism and cervical lesions, heterozygote women presenting a threefold increased risk (normal/cervical lesions and tumours: wild homozygote 34/41 (0.68/0.41), heterozygote 14/51 (0.28/0.51), mutant homozygote 2/8 (0.04/0.08); OR = 3.081, P = 0.0035). Using χ square test for the control group, the HPV-negative and HPV-positive patients with cervix lesions, a significant correlation between viral infection and T allele of C677T polymorphism (P = 0.0287) was found. The MTHFR promoter was methylated in all HGSIL and tumour samples, significant differences being noted between HPV-positive samples, control group and cases of cervical dysplastic lesions without HPV DNA (P < 0. 0001) and between samples from patients with high-risk (hr)HPV versus low-risk (lr)HPV (P = 0.0026). No correlations between polymorphisms and methylation were observed. In Romania, individuals carrying T allele are susceptible for cervical lesions. MTHFR promoter methylation is associated with cervical severity lesions and with hrHPV. PMID:23444906

Methylenetetrahydrofolate reductase (MTHFR) polymorphisms and risk of molecularly defined subtypes of childhood acute leukemia

PubMed Central

Wiemels, Joseph L.; Smith, Rosalyn N.; Taylor, G. Malcolm; Eden, Osborn B.; Alexander, Freda E.; Greaves, Mel F.

2001-01-01

Low folate intake as well as alterations in folate metabolism as a result of polymorphisms in the enzyme methylenetetrahydrofolate reductase (MTHFR) have been associated with an increased incidence of neural tube defects, vascular disease, and some cancers. Polymorphic variants of MTHFR lead to enhanced thymidine pools and better quality DNA synthesis that could afford some protection from the development of leukemias, particularly those with translocations. We now report associations of MTHFR polymorphisms in three subgroups of pediatric leukemias: infant lymphoblastic or myeloblastic leukemias with MLL rearrangements and childhood lymphoblastic leukemias with either TEL-AML1 fusions or hyperdiploid karyotypes. Pediatric leukemia patients (n = 253 total) and healthy newborn controls (n = 200) were genotyped for MTHFR polymorphisms at nucleotides 677 (C→T) and 1,298 (A→C). A significant association for carriers of C677T was demonstrated for leukemias with MLL translocations (MLL+, n = 37) when compared with controls [adjusted odd ratios (OR) = 0.36 with a 95% confidence interval (CI) of 0.15–0.85; P = 0.017]. This protective effect was not evident for A1298C alleles (OR = 1.14). In contrast, associations for A1298C homozygotes (CC; OR = 0.26 with a 95% CI of 0.07–0.81) and C677T homozygotes (TT; OR = 0.49 with a 95% CI of 0.20–1.17) were observed for hyperdiploid leukemias (n = 138). No significant associations were evident for either polymorphism with TEL-AML1+ leukemias (n = 78). These differences in allelic associations may point to discrete attributes of the two alleles in their ability to alter folate and one-carbon metabolite pools and impact after DNA synthesis and methylation pathways, but should be viewed cautiously pending larger follow-up studies. The data provide evidence that molecularly defined subgroups of pediatric leukemias have different etiologies and also suggest a role of folate in the development of childhood leukemia. PMID:11274424

Altered heme catabolism by heme oxygenase-1 caused by mutations in human NADPH cytochrome P450 reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pandey, Amit V., E-mail: amit@pandeylab.org; Flueck, Christa E.; Mullis, Primus E.

2010-09-24

Research highlights: {yields} Mutations in POR identified from patients lead to reduced HO-1 activities. {yields} POR mutation Y181D affecting FMN binding results in total loss of HO-1 activity. {yields} POR mutations A287P, C569Y and V608F, lost 50-70% activity. {yields} Mutations in FAD binding domain, R457H, Y459H and V492E lost all HO-1 activity. {yields} POR polymorphisms P228L, R316W, G413S, A503V and G504R have normal activity. -- Abstract: Human heme oxygenase-1 (HO-1) carries out heme catabolism supported by electrons supplied from the NADPH through NADPH P450 reductase (POR, CPR). Previously we have shown that mutations in human POR cause a rare formmore » of congenital adrenal hyperplasia. In this study, we have evaluated the effects of mutations in POR on HO-1 activity. We used purified preparations of wild type and mutant human POR and in vitro reconstitution with purified HO-1 to measure heme degradation in a coupled assay using biliverdin reductase. Here we show that mutations in POR found in patients may reduce HO-1 activity, potentially influencing heme catabolism in individuals carrying mutant POR alleles. POR mutants Y181D, A457H, Y459H, V492E and R616X had total loss of HO-1 activity, while POR mutations A287P, C569Y and V608F lost 50-70% activity. The POR variants P228L, R316W and G413S, A503V and G504R identified as polymorphs had close to WT activity. Loss of HO-1 activity may result in increased oxidative neurotoxicity, anemia, growth retardation and iron deposition. Further examination of patients affected with POR deficiency will be required to assess the metabolic effects of reduced HO-1 activity in affected individuals.« less

Biallelic mutations in the ferredoxin reductase gene cause novel mitochondriopathy with optic atrophy

PubMed Central

Peng, Yanyan; Shinde, Deepali N; Valencia, C Alexander; Mo, Jun-Song; Rosenfeld, Jill; Truitt Cho, Megan; Chamberlin, Adam; Li, Zhuo; Liu, Jie; Gui, Baoheng; Brockhage, Rachel; Basinger, Alice; Alvarez-Leon, Brenda; Heydemann, Peter; Magoulas, Pilar L; Lewis, Andrea M; Scaglia, Fernando; Gril, Solange; Chong, Shuk Ching; Bower, Matthew; Monaghan, Kristin G; Willaert, Rebecca; Plona, Maria-Renee; Dineen, Rich; Milan, Francisca; Hoganson, George; Helbig, Katherine L; Keller-Ramey, Jennifer; Harris, Belinda; Anderson, Laura C; Green, Torrian; Sukoff Rizzo, Stacey J; Kaylor, Julie; Chen, Jiani; Guan, Min-Xin; Sellars, Elizabeth; Sparagana, Steven P; Gibson, James B; Reinholdt, Laura G; Tang, Sha; Huang, Taosheng

2017-01-01

Abstract Iron–sulfur (Fe-S) clusters are ubiquitous cofactors essential to various cellular processes, including mitochondrial respiration, DNA repair, and iron homeostasis. A steadily increasing number of disorders are being associated with disrupted biogenesis of Fe–S clusters. Here, we conducted whole-exome sequencing of patients with optic atrophy and other neurological signs of mitochondriopathy and identified 17 individuals from 13 unrelated families with recessive mutations in FDXR, encoding the mitochondrial membrane-associated flavoprotein ferrodoxin reductase required for electron transport from NADPH to cytochrome P450. In vitro enzymatic assays in patient fibroblast cells showed deficient ferredoxin NADP reductase activity and mitochondrial dysfunction evidenced by low oxygen consumption rates (OCRs), complex activities, ATP production and increased reactive oxygen species (ROS). Such defects were rescued by overexpression of wild-type FDXR. Moreover, we found that mice carrying a spontaneous mutation allelic to the most common mutation found in patients displayed progressive gait abnormalities and vision loss, in addition to biochemical defects consistent with the major clinical features of the disease. Taken together, these data provide the first demonstration that germline, hypomorphic mutations in FDXR cause a novel mitochondriopathy and optic atrophy in humans. PMID:29040572

Correlation between methyltetrahydrofolate reductase (MTHFR) polymorphisms and isolated patent ductus arteriosus in Taiwan.

PubMed

Chao, Chia-Sheng; Wei, Jeng; Huang, Hurng-Wern; Yang, Shyh-Chyun

2014-07-01

Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C gene polymorphisms are associated with the risk of patent ductus arteriosus (PDA) congenital heart defects. This study aimed to determine the association of these polymorphisms in patients with isolated PDA and in non-PDA patients group without congenital heart disease. This retrospective case-controlled study was undertaken in 17 patients with isolated PDA and a control non-PDA group consisting of 34 subjects without congenital heart disease. MTHFR gene polymorphisms were analysed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). In addition, the genotype distribution of the MTHFR gene was compared among different ethnicities using the HapMap database. In contrast to the MTHFR C677T polymorphism, differences in the MTHFR A1298C genotype were observed between the two groups (P=0.002); a greater proportion of the PDA patients had the MTHFR 1298CC and 1298AA genotypes as compared to the non-PDA control group. After merging the data obtained from the Taiwanese participants with that from the HapMap database, genetic diversity of the MTHFR 1298AA genotype was observed. Thus, the MTHFR A1298C polymorphism is associated with isolated PDA in Taiwan. Larger studies are necessary to evaluate the prognostic value of determining MTHFR polymorphism in PDA. Copyright © 2014 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Polymorphisms in the methylene tetrahydrofolate reductase gene and their unique combinations are associated with an increased susceptibility to the renal cancers.

PubMed

Ajaz, Sadia; Khaliq, Shagufta; Hashmi, Altaf; Naqvi, Syed Ali Anwar; Rizvi, Syed Adib-ul-Hassan; Mehdi, Syed Qasim

2012-05-01

Two single nucleotide polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) gene, 677C/T and 1298A/C, encode the thermolabile isoforms of the MTHFR enzyme that adversely affect the folic acid metabolic pathway. In the present study, these polymorphisms were investigated for their associations with the risk and prognosis of the renal cell carcinomas (RCCs) in Pakistani patients. The study included 168 RCC patients and 178 controls. The polymorphisms were analyzed by the polymerase chain reaction-restriction fragment length polymorphism method. Statistical analysis revealed that the C-allele and homozygous C genotype of the MTHFR 1298A/C polymorphism were significantly correlated with the risk of RCCs (odds ratio [OR]=1.60; 95% confidence interval [CI]=1.1-2.34 and OR=3.26; 95% CI=1.27-8.37, respectively). The combined genotype analysis showed that the 677CC+1298CC combination greatly increased the susceptibility to RCCs (OR=8.34; 95% CI=2.7-25.7). The 677CT+1298AA and 677CC+1298CA combinations were also associated with an increased risk of RCC (OR=3.21; 95% CI=1.3-7.8 and OR=2.45; 95% CI=1.3-4.6, respectively). The combined genotype effects were also evident in a semiparametric expectation-maximization-based haplotype analysis. The results presented here indicate that the two MTHFR gene polymorphisms are significantly associated with the risk of RCCs in a cohort of Pakistani patients and may be useful as susceptibility markers in other populations of the world as well.

A variety of gene polymorphisms associated with idiopathic granulomatous mastitis

PubMed Central

Destek, Sebahattin; Gul, Vahit Onur; Ahioglu, Serkan

2016-01-01

Idiopathic granulomatous mastitis (IGM) is a rare and chronic inflammatory disorder. IGM mimics breast cancer regarding its clinical and radiological features. Etiology of IGM remains unclarified. Our patient was 37-year-old and 14 weeks pregnant. There was pain, redness and swelling in the right breast. The mass suggestive of malignancy was detected in sonography. Serum CA 125 and CA 15-3 levels were high. Genetic analysis was performed for the etiology. methylenetetrahydrofolate reductase (MTHFR) C 677 TT, β-fibrinogen-455 G>A, plasminogen activator inhibitor (PAI)-1 5 G/5 G, angiotensin-converting enzyme (ACE) I/D mutation was found. IGM was diagnosed by cor biopsy. An association was also reported between breast cancer and mutations in MTHFR-C 677 T, PAI-1, ACE genes. Genetic polymorphisms may involve in the development of IGM as it was seen in our case. Further studies should be conducted to better clarify this plausible association. PMID:27619324

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

High prevalence of factor V Leiden and prothrombin G20101A mutations in Kashmiri patients with venous thromboembolism.

PubMed

Shafia, Syed; Zargar, Mahrukh H; Khan, Nabeela; Ahmad, Rehana; Shah, Zafar Amin; Asimi, Ravouf

2018-05-15

The genetic variants of the factor V (G1691A), prothrombin (G20210A) and MTHFR (C677T) genes have been widely implicated as inherited risk factors for developing venous thrombosis. This study was undertaken to reveal the frequency of these mutations in Kashmiri patients with venous thromboembolism. A case-control study was designed with 250 VTE patients and 250 healthy controls. The mutations were analysed using ARMS-PCR and PCR-RFLP approach. The factor V Leiden G1691A mutation was found in 17/250 (6.8%) VTE patients and prothrombin G20210A mutation was found in 7/250 (2.8%) VTE patients while no mutation was found in any of the healthy controls. Both the mutations were found to be significantly associated with the increased risk of VTE (p = 0.0001 and 0.0150 respectively) while no association of VTE risk with MTHFR C677T polymorphism was found (p = 0.53). The increased frequency of factor V Leiden G1691A and prothrombin G20210A mutation in VTE patients indicates a significant role of these mutations in the development of VTE in our population. We therefore suggest the routine screening of these two mutations as thrombophilic markers in Kashmiri patients with venous thromboembolism. Copyright © 2018 Elsevier B.V. All rights reserved.

Association between decreased vitamin levels and MTHFR, MTR and MTRR gene polymorphisms as determinants for elevated total homocysteine concentrations in pregnant women.

PubMed

Barbosa, P R; Stabler, S P; Machado, A L K; Braga, R C; Hirata, R D C; Hirata, M H; Sampaio-Neto, L F; Allen, R H; Guerra-Shinohara, E M

2008-08-01

To examine the association between methylenetetrahydrofolate reductase (MTHFR) (C677T and A1298C), methionine synthase (MTR) A2756G and methionine synthase reductase (MTRR) A66G gene polymorphisms and total homocysteine (tHcy), methylmalonic acid (MMA) and S-adenosylmethionine/S-adenosylhomocysteine (SAM/SAH) levels; and to evaluate the potential interactions with folate or cobalamin (Cbl) status. Two hundred seventy-five healthy women at labor who delivered full-term normal babies. Cbl, folate, tHcy, MMA, SAM and SAH were measured in serum specimens. The genotypes for polymorphisms were determined by PCR-restriction fragment length polymorphism (RFLP). Serum folate, MTHFR 677T allele and MTR 2756AA genotypes were the predictors of tHcy levels in pregnant women. Serum Cbl and creatinine were the predictors of SAM/SAH ratio and MMA levels, respectively. The gene polymorphisms were not determinants for MMA levels and SAM/SAH ratios. Low levels of serum folate were associated with elevated tHcy in pregnant women, independently of the gene polymorphisms. In pregnant women carrying MTHFR 677T allele, or MTHFR 1298AA or MTRR 66AA genotypes, lower Cbl levels were associated with higher levels of tHcy. Lower SAM/SAH ratio was found in MTHFR 677CC or MTRR A2756AA genotypes carriers when Cbl levels were lower than 142 pmol/l. Serum folate and MTHFR C677T and MTR A2576G gene polymorphisms were the determinants for tHcy levels. The interaction between low levels of serum Cbl and MTHFR (C677T or A1298C) or MTRR A66G gene polymorphisms was associated with increased tHcy.

Biallelic mutations in the ferredoxin reductase gene cause novel mitochondriopathy with optic atrophy.

PubMed

Peng, Yanyan; Shinde, Deepali N; Valencia, C Alexander; Mo, Jun-Song; Rosenfeld, Jill; Truitt Cho, Megan; Chamberlin, Adam; Li, Zhuo; Liu, Jie; Gui, Baoheng; Brockhage, Rachel; Basinger, Alice; Alvarez-Leon, Brenda; Heydemann, Peter; Magoulas, Pilar L; Lewis, Andrea M; Scaglia, Fernando; Gril, Solange; Chong, Shuk Ching; Bower, Matthew; Monaghan, Kristin G; Willaert, Rebecca; Plona, Maria-Renee; Dineen, Rich; Milan, Francisca; Hoganson, George; Powis, Zoe; Helbig, Katherine L; Keller-Ramey, Jennifer; Harris, Belinda; Anderson, Laura C; Green, Torrian; Sukoff Rizzo, Stacey J; Kaylor, Julie; Chen, Jiani; Guan, Min-Xin; Sellars, Elizabeth; Sparagana, Steven P; Gibson, James B; Reinholdt, Laura G; Tang, Sha; Huang, Taosheng

2017-12-15

Iron-sulfur (Fe-S) clusters are ubiquitous cofactors essential to various cellular processes, including mitochondrial respiration, DNA repair, and iron homeostasis. A steadily increasing number of disorders are being associated with disrupted biogenesis of Fe-S clusters. Here, we conducted whole-exome sequencing of patients with optic atrophy and other neurological signs of mitochondriopathy and identified 17 individuals from 13 unrelated families with recessive mutations in FDXR, encoding the mitochondrial membrane-associated flavoprotein ferrodoxin reductase required for electron transport from NADPH to cytochrome P450. In vitro enzymatic assays in patient fibroblast cells showed deficient ferredoxin NADP reductase activity and mitochondrial dysfunction evidenced by low oxygen consumption rates (OCRs), complex activities, ATP production and increased reactive oxygen species (ROS). Such defects were rescued by overexpression of wild-type FDXR. Moreover, we found that mice carrying a spontaneous mutation allelic to the most common mutation found in patients displayed progressive gait abnormalities and vision loss, in addition to biochemical defects consistent with the major clinical features of the disease. Taken together, these data provide the first demonstration that germline, hypomorphic mutations in FDXR cause a novel mitochondriopathy and optic atrophy in humans. © The Author 2017. Published by Oxford University Press.

Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

PubMed

Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

2017-11-01

Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T

Genetic variants in 3′-UTRs of methylenetetrahydrofolate reductase (MTHFR) predict colorectal cancer susceptibility in Koreans

PubMed Central

Joo Jeon, Young; Woo Kim, Jong; Mi Park, Hye; Kim, Jung O; Geun Jang, Hyo; Oh, Jisu; Gyu Hwang, Seong; Won Kwon, Sung; Oh, Doyeun; Keun Kim, Nam

2015-01-01

Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) play important roles in tumor development, progression, and metastasis. Moreover, recent studies have reported that a number of 3′-UTR polymorphisms potentially bind to specific microRNAs in a variety of cancers. The aim of this study was to investigate the association of four MTHFR polymorphisms, 2572C>A [rs4846049], 4869C>G [rs1537514], 5488C>T [rs3737967], and 6685T>C [rs4846048] with colorectal cancer (CRC) in Koreans. A total of 850 participants (450 CRC patients and 400 controls) were enrolled in the study. The genotyping of MTHFR 3′-UTR polymorphisms was performed by polymerase chain reaction-restriction fragment length polymorphism analysis or TaqMan allelic discrimination assay. We found that MTHFR 2572C>A, 4869C>G, and 5488C>T genotypes were substantially associated with CRC susceptibility. Of the potentially susceptible polymorphisms, MTHFR 2572C>A was associated with increased homocysteine and decreased folate levels in the plasma based on MTHFR 677CC. Our study provides the evidences for 3′-UTR variants in MTHFR gene as potential biomarkers for use in CRC prevention. PMID:26046315

Effects of methylenetetrahydrofolate reductase gene polymorphisms on toxicities during consolidation therapy in pediatric acute lymphoblastic leukemia in a Chinese population.

PubMed

Liu, Shu-Guang; Li, Zhi-Gang; Cui, Lei; Gao, Chao; Li, Wei-Jing; Zhao, Xiao-Xi

2011-06-01

This study aimed to investigate whether there was a correlation between the genotype or haplotype of the methylenetetrahydrofolate reductase gene (MTHFR) and toxicities during consolidation therapy or plasma methotrexate (MTX) levels at 48 h after the first dose of MTX infusion. We retrospectively genotyped 181 children with newly diagnosed acute lymphoblastic leukemia (ALL) who were treated with the Chinese Children's Leukemia Group protocol. In standard- and medium-risk treatment branches, the 677T carriers (CT + TT) had a higher risk of developing thrombocytopenia when compared with carriers of the CC genotype (odds ratio [OR] 5.21, 95% confidence interval [CI] 1.18-23.01, p = 0.017). The 1298AC/CC genotypes were associated with a decrease in skin toxicity, as compared with the common AA genotype (p = 0.037). An estimation of haplotype frequencies showed that there was no 677T-1298C haplotype in the population. A lower frequency of anemia (OR 0.44, 95% CI 0.21-0.90, p = 0.025) and lower MTX level (p = 0.044) were observed in patients with the 677C-1298C haplotype than in those without. High plasma MTX level was correlated with anemia (p = 0.011) and neutropenia (p = 0.044). In the high-risk group, the polymorphisms or plasma MTX levels were not correlated with any toxicity. Taken together, our data demonstrate that genotyping of MTHFR and measurement of plasma MTX levels might be useful to optimize MTX therapy.

Meta-Prediction of MTHFR Gene Polymorphism Mutations and Associated Risk for Colorectal Cancer

PubMed Central

Yu, C. H.

2016-01-01

The methylenetetrahydrofolate reductase (MTHFR) gene is one of the most investigated of the genes associated with chronic human diseases because of its associations with hyperhomocysteinemia and toxicity. It has been proposed as a prototype gene for the prevention of colorectal cancer (CRC). The major objectives of this meta-analysis were to examine the polymorphism-mutation patterns of MTHFR and their associations with risk for CRC as well as potential contributing factors for mutations and disease risks. This analysis included 33,626 CRC cases and 48,688 controls across 92 studies for MTHFR 677 and 16,367 cases and 24,874 controls across 54 studies for MTHFR 1298, comprising data for various racial and ethnic groups, both genders, and multiple cancer sites. MTHFR 677 homozygous TT genotype was protective (p < .05) for CRC for all included populations; however, with heterogeneity across various racial–ethnic groups and opposing findings, it was a risk genotype for the subgroup of Hispanics (p < .01). Additional countries for which subgroup analyses resulted in 677 TT as a risk genotype included Turkey, Romania, Croatia, Hungary, Portugal, Mexico, Brazil, U.S. Hawai’i, Taiwan, India, and Egypt. Countries with the highest mutation rates and risks for both MTHFR 677 and 1298 genotypes are presented using global maps to visualize the grouping patterns. Meta-predictive analyses revealed that air pollution levels were associated with gene polymorphisms for both genotypes. Future nursing research should be conducted to develop proactive measures to protect populations in cities where air pollution causes more deaths. PMID:26858257

Glucose-6-Phosphate Dehydrogenase (G6PD) deficiency in Greek newborns: the Mediterranean C563T mutation screening.

PubMed

Molou, Elina; Schulpis, Kleopatra H; Thodi, Georgia; Georgiou, Vassiliki; Dotsikas, Yannis; Papadopoulos, Konstantinos; Biti, Sofia; Loukas, Yannis L

2014-04-01

Glucose-6-Phosphate Dehydrogenase (G6PD) gene is located at the X-chromosome at Xq28 and the disease is recessively inherited predominantly in males. More than 400 variants have been proposed based on clinical and enzymatic studies. The aim of the current study was to identify C563T mutation in G6PD-deficient newborns and to correlate the enzyme residual activity with the presence of the mutation. Some 1189 full-term neonates aged 3-5 days old were tested for G6PD activity in dried blood spots from Guthrie cards using a commercial kit. DNA extraction from Guthrie cards and mutation identification among the deficient samples were performed with current techniques. A total of 92 (7.7%) newborns were G6PD-deficient. In 46 (50%), the mutation C563T was identified. The residual activity in C563T hemizygote males (n = 28) was statistically significantly lower (1.23 ± 0.93 U/g Hb) than that in non-C563T G6PD-deficient males (n = 25) (4.01 ± 1.20 U/g Hb, p < 0.0001) and in controls (13.6 ± 2.9 U/g Hb, p < 0.0001). In C563T heterozygote females, the estimated enzyme activity was lower than that determined in non-C563T females. Male C563T hemizygotes suffer from G6PD deficiency and severe neonatal jaundice. G6PD activity showed statistically significant correlation with total bilirubin blood levels.

ACE I/D sequence variants but not MTHFR C677T, is strongly linked to malignant glioma risk and its variant DD genotype may act as a promising predictive biomarker for overall survival of glioma patients.

PubMed

Pandith, Arshad A; Qasim, Iqbal; Zahoor, Wani; Shah, Parveen; Bhat, Abdul R

2018-01-10

ACE I/D and MTHFR C677T gene polymorphisms can be seen as candidate genes for glioma on the basis of their biological functions and their involvement in different cancers. The aim of this study was to analyze potential association and overall survival between MTHFR C677T and ACE I/D polymorphism in glioma patients in our population. We tested genotype distribution of 112 glioma patients against 141 cancer-free controls from the same region. Kaplan-Meier survival analysis was performed to evaluate overall survival of patients for both genes. No significant differences were found among MTHFR C677T wild type C and variant genotypes CT/TT with glioma patients. In ACE, the distribution of variant ID and DD was found to be significantly higher in glioma cases as compared to controls (p<0.0001). ACE DD genotypes were highly presented in glioma cases 26.8% versus 10.6% in controls (p<0.0001) and conferred 5-fold risk for predisposition in glioma cases. Per copy D allele frequency was found higher in cases than in controls (0.54 versus 0.25: p<0.0001). Interestingly we found a significant overall survival (with log rank p<0.01) in patients who presented with ACE DD genotypes had the least estimated overall survival of 13.4months in comparison to 21. 7 and 17.6months for ACE II and I/D genotypes respectively. We conclude ACE I/D polymorphism plays a vital role in predisposition of higher risk for glioma. We also suggest that ACE DD genotypes may act as an important predictive biomarker for overall survival of glioma patients. Copyright © 2017. Published by Elsevier B.V.

[Features of allele polymorphism of genes involved in homocysteine and folate metabolism in patients with atherosclerosis of the lower extremity arteries].

PubMed

Klenkova, N A; Kapustin, S I; Saltykova, N B; Shmeleva, V M; Blinov, M N

2009-01-01

Under study were features of allele polymorphism of genes of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MS A 2756G), methionine synthase reductase (MTRR A66G) and methylenetetrahydrofolate dehydrogenase (MTHFD G1958A) in patients with atherosclerosis of the lower extremity arteries (ALEA). Patients with hyperhomocysteinemia (HHcy) had statistically significant increase of allele MTHFR 677T and MTRR 66GG as compared both with the control group and with the group of patients without HHcy. It suggests that polymorphism of genes involved in homocystein and folate metabolism might affect the risk of HHcy in patients with ALEA.

Consequences of the pathogenic T9176C mutation of human mitochondrial DNA on yeast mitochondrial ATP synthase

PubMed Central

Kucharczyk, Roza; Ezkurdia, Nahia; Couplan, Elodie; Procaccio, Vincent; Ackerman, Sharon H.; Blondel, Marc; di Rago, Jean-Paul

2010-01-01

Summary Several human neurological disorders have been associated with various mutations affecting mitochondrial enzymes involved in cellular ATP production. One of these mutations, T9176C in the mitochondrial DNA (mtDNA), changes a highly conserved leucine residue into proline at position 217 of the mitochondrially encoded Atp6p (or a) subunit of the F1FO-ATP synthase. The consequences of this mutation on the mitochondrial ATP synthase are still poorly defined. To gain insight into the primary pathogenic mechanisms induced by T9176C, we have investigated the consequences of this mutation on the ATP synthase of yeast where Atp6p is also encoded by the mtDNA. In vitro, yeast atp6-T9176C mitochondria showed a 30% decrease in the rate of ATP synthesis. When forcing the F1FO complex to work in the reverse mode, i.e. F1-catalyzed hydrolysis of ATP coupled to proton transport out of the mitochondrial matrix, the mutant showed a normal proton-pumping activity and this activity was fully sensitive to oligomycin, an inhibitor of the ATP synthase proton channel. However, under conditions of maximal ATP hydrolytic activity, using non-osmotically protected mitochondria, the mutant ATPase activity was less efficiently inhibited by oligomycin (60% inhibition versus 85% for the wild type control). BN-PAGE analyses revealed that atp6-T9176C yeast accumulated rather good levels of fully assembled ATP synthase complexes. However, a number of subcomplexes (F1, Atp9p-ring, unassembled α-F1 subunits) could be detected as well, presumably because of a decreased stability of Atp6p within the ATP synthase. Although the oxidative phosphorylation capacity was reduced in atp6-T9176C yeast, the number of ATP molecules synthesized per electron transferred to oxygen was similar compared with wild type yeast. It can therefore be inferred that the coupling efficiency within the ATP synthase was mostly unaffected and that the T9176C mutation did not increase the proton permeability of the

Methylenetetrahydrofolate reductase and thymidylate synthase genotypes and risk of acute graft-versus-host disease following hematopoietic cell transplantation for chronic myelogenous leukemia.

PubMed

Robien, Kim; Bigler, Jeannette; Yasui, Yutaka; Potter, John D; Martin, Paul; Storb, Rainer; Ulrich, Cornelia M

2006-09-01

Methylenetetrahydrofolate reductase (MTHFR) and thymidylate synthase (TS) play key roles in intracellular folate metabolism. Polymorphisms in these enzymes have been shown to modify toxicity of methotrexate (MTX) after hematopoietic cell transplantation. In this study, we evaluated the risk of acute graft-versus-host disease (GVHD) associated with genetic variation in recipient and donor MTHFR and TS genotypes to assess whether genotype alters the efficacy of MTX in acute GVHD prophylaxis. Data on the transplantation course were abstracted from medical records for 304 adults who received allogeneic hematopoietic cell transplants. MTHFR (C677T and A1298C) and TS (enhancer-region 28-base pair repeat, TSER, and 1494del6) genotypes were determined using polymerase chain reaction/restriction fragment length polymorphism and TaqMan assays. Multivariable logistic regression was used to assess the associations between genotypes and risk of acute GVHD. Compared with recipients with the wild-type MTHFR 677CC genotype, those with the variant 677T allele showed a decreased risk of detectable acute GVHD (677CT: odds ratio, 0.8; 95% confidence interval, 0.4-1.6; 677TT: odds ratio, 0.4; 95% confidence interval, 0.2-0.8; P for trend = .01). The variant MTHFR 1298C allele in recipients was associated with an increased risk of acute GVHD compared with the wild-type MTHFR 1298AA genotype (1298AC: odds ratio, 2.0; 95% confidence interval, 1.1-3.9; 1298CC: odds ratio, 3.6; 95% confidence interval, 1.0-12.7; P for trend < .01). No association with risk of acute GVHD was observed for donor MTHFR genotypes or for recipient or donor TS genotypes, with the exception of an increase in acute GVHD among recipients whose donors had the TSER 3R/2R genotype (odds ratio, 3.0; 95% confidence interval, 1.3-7.2). These findings indicate that host, but not donor, MTHFR genotypes modify the risk of acute GVHD in recipients receiving MTX, in a manner consistent with our previously reported associations

Polymorphisms in the methylenetetrahydrofolate reductase gene are associated with susceptibility to acute leukemia in adults

PubMed Central

Skibola, Christine F.; Smith, Martyn T.; Kane, Eleanor; Roman, Eve; Rollinson, Sara; Cartwright, Raymond A.; Morgan, Gareth

1999-01-01

Reduction of 5,10-methylenetetrahydrofolate (methyleneTHF), a donor for methylating dUMP to dTMP in DNA synthesis, to 5-methyltetrahydrofolate (methylTHF), the primary methyl donor for methionine synthesis, is catalyzed by 5,10-methylenetetrahydrofolate reductase (MTHFR). A common 677 C → T polymorphism in the MTHFR gene results in thermolability and reduced MTHFR activity that decreases the pool of methylTHF and increases the pool of methyleneTHF. Recently, another polymorphism in MTHFR (1298 A → C) has been identified that also results in diminished enzyme activity. We tested whether carriers of these variant alleles are protected from adult acute leukemia. We analyzed DNA from a case–control study in the United Kingdom of 308 adult acute leukemia patients and 491 age- and sex-matched controls. MTHFR variant alleles were determined by a PCR-restriction fragment length polymorphism assay. The MTHFR 677TT genotype was lower among 71 acute lymphocytic leukemia (ALL) cases compared with 114 controls, conferring a 4.3-fold decrease in risk of ALL [odds ratio (OR = 0.23; 95% CI = 0.06–0.81]. We observed a 3-fold reduction in risk of ALL in individuals with the MTHFR 1298AC polymorphism (OR = 0.33; 95% CI = 0.15–0.73) and a 14-fold decreased risk of ALL in those with the MTHFR 1298CC variant allele (OR = 0.07; 95% CI = 0.00–1.77). In acute myeloid leukemia, no significant difference in MTHFR 677 and 1298 genotype frequencies was observed between 237 cases and 377 controls. Individuals with the MTHFR 677TT, 1298AC, and 1298CC genotypes have a decreased risk of adult ALL, but not acute myeloid leukemia, which suggests that folate inadequacy may play a key role in the development of ALL. PMID:10536004

In vivo levels of S-adenosylmethionine modulate C:G to T:A mutations associated with repeat-induced point mutation in Neurospora crassa.

PubMed

Rosa, Alberto Luis; Folco, Hernán Diego; Mautino, Mario Ricardo

2004-04-14

In Neurospora crassa, the mutagenic process termed repeat-induced point mutation (RIP) inactivates duplicated DNA sequences during the sexual cycle by the introduction of C:G to T:A transition mutations. In this work, we have used a collection of N. crassa strains exhibiting a wide range of cellular levels of S-adenosylmethionine (AdoMet), the universal donor of methyl groups, to explore whether frequencies of RIP are dependent on the cellular levels of this metabolite. Mutant strains met-7 and eth-1 carry mutations in genes of the AdoMet pathway and have low levels of AdoMet. Wild type strains with high levels of AdoMet were constructed by introducing a chimeric transgene of the AdoMet synthetase (AdoMet-S) gene fused to the constitutive promoter trpC from Aspergillus nidulans. Crosses of these strains against tester duplications of the pan-2 and am genes showed that frequencies of RIP, as well as the total number of C:G to T:A transition mutations found in randomly selected am(RIP) alleles, are inversely correlated to the cellular level of AdoMet. These results indicate that AdoMet modulates the biochemical pathway leading to RIP.

Association of aldose reductase gene polymorphism (C-106T) in susceptibility of diabetic peripheral neuropathy among north Indian population.

PubMed

Gupta, Balram; Singh, S K

2017-07-01

Polymorphism in aldose reductase (ALR) gene at nucleotide C(-106)T (rs759853) in the promoter region is associated with susceptibility to development of diabetic peripheral neuropathy. The aim of this study was to detect the association of the C (-106)T polymorphism of ALR gene and its frequency among patients with type 2 diabetes mellitus with and without peripheral neuropathy. The study subjects were divided into three groups. Group I included 356 patients with diabetes having peripheral neuropathy. Group II included 294 patients with diabetes without peripheral neuropathy and group III included 181 healthy subjects. Genotyping of ALR C(-106)T SNPs was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and direct sequencing methods. The genetic risk among the groups was compared and tested by calculating odds ratio with 95% class interval. ALR 106TT genotype was significantly higher in group I compared to group II with an odds ratio of 2.12 (95% CI: 1.22-3.67; p<0.01). Recessive model (CC+CT vs. TT), as well as T allele distribution also showed significant association to develop neuropathy with relative risk of 1.97 (95% CI: 1.16-3.35; p<0.01) and 1.36 (95% CI: 1.07-1.72; p=0.01) respectively. In conclusion, the ALR C-106T polymorphism was associated with higher risk of peripheral neuropathy in patients with type 2 diabetes mellitus. Copyright © 2017 Elsevier Inc. All rights reserved.

Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

PubMed

Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

2018-04-13

While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

Methylenetetrahydrofolate reductase polymorphisms and interaction with smoking and alcohol consumption in lung cancer risk: a case-control study in a Japanese population.

PubMed

Kiyohara, Chikako; Horiuchi, Takahiko; Takayama, Koichi; Nakanishi, Yoichi

2011-10-25

Cigarette smoking is an established risk factor of lung cancer development while the current epidemiological evidence is suggestive of an increased lung cancer risk associated with alcohol consumption. Dietary folate, which is present in a wide range of fresh fruits and vegetables, may be a micronutrient that has a beneficial impact on lung carcinogenesis. Methylenetetrahydrofolate reductase (MTHFR) plays a crucial role in regulating folate metabolism, which affects both DNA synthesis/repair and methylation. We examined if smoking or alcohol consumption modify associations between MTHFR polymorphisms and lung cancer risk. We evaluated the role of the MTHFR C677T (rs1801133) and A1298C (rs1801131) polymorphisms in a case-control study comprised of 462 lung cancer cases and 379 controls in a Japanese population. Logistic regression was used to assess the adjusted odds ratios (OR) and 95% confidence intervals (95% CI). The TT genotype of the C677T polymorphism was significantly associated with an increased risk of lung cancer (OR = 2.27, 95% CI = 1.42 - 3.62, P < 0.01) while the A1298C polymorphism was not associated with lung cancer risk. The minor alleles of both polymorphisms behaved in a recessive fashion. The highest risks were seen for 677TT-carriers with a history of smoking or excessive drinking (OR = 6.16, 95% CI = 3.48 - 10.9 for smoking; OR = 3.09, 95% CI = 1.64 - 5.81 for drinking) compared with C-carriers without a history of smoking or excessive drinking, but no interactions were seen. The 1298CC genotype was only associated with increased risk among non-smokers (P < 0.05), and smoking was only associated with increased risks among 1298A-carriers (P < 0.01), but no significant interaction was seen. There was a synergistic interaction between the A1298C polymorphism and drinking (P < 0.05). The highest risk was seen for the CC-carriers with excessive drinking (OR = 7.24, 95% CI = 1.89 - 27.7) compared with the A-carriers without excessive drinking). The C

ACE I/D and MTHFR C677T polymorphisms are significantly associated with type 2 diabetes in Arab ethnicity: a meta-analysis.

PubMed

Al-Rubeaan, Khalid; Siddiqui, Khalid; Saeb, Amr T M; Nazir, Nyla; Al-Naqeb, Dhekra; Al-Qasim, Sara

2013-05-15

In this meta-analysis study, SNPs were investigated for their association with type 2 diabetes (T2D) in both Arab and Caucasian ethnicities. A total of 55 SNPs were analyzed, of which 11 fulfilled the selection criteria, and were used for analysis. It was found that TCF7L2 rs7903146 was significantly associated with a pooled OR of 1.155 (95%C.I.=1.059-1.259), p<0.0001 and I(2)=78.30% among the Arab population, whereas among Caucasians, the pooled OR was 1.45 (95%C.I.=1.386-1.516), p<0.0001 and I(2)=77.20%. KCNJ11 rs5219 was significantly associated in both the populations with a pooled OR of 1.176(1.092-1.268), p<0.0001 and I(2)=32.40% in Caucasians and a pooled OR of 1.28(1.111-1.475), p=0.001 among Arabs. The ACE I/D polymorphism was found to be significantly associated with a pooled OR of 1.992 (95%C.I.=1.774-2.236), p<0.0001 and I(2)=83.20% among the Arab population, whereas among Caucasians, the pooled OR was 1.078 (95%C.I.=0.993-1.17), p=0.073 and I(2)=0%. Similarly, MTHFR C677T polymorphism was also found to be significantly associated among Arabs with a pooled OR of 1.924 (95%C.I.=1.606-2.304), p<0.0001 and I(2)=27.20%, whereas among Caucasians, the pooled OR was 0.986 (95%C.I.=0.868-1.122), p=0.835 and I(2)=0%. Meanwhile PPARG-2 Pro12Ala, CDKN2A/2B rs10811661, IGF2BP2 rs4402960, HHEX rs7923837, CDKAL1 rs7754840, EXT2 rs1113132 and SLC30A8 rs13266634 were found to have no significant association with T2D among Arabs. In conclusion, it seems from this study that both Arabs and Caucasians have different SNPs associated with T2D. Moreover, this study sheds light on the profound necessity for further investigations addressing the question of the genetic components of T2D in Arabs. Copyright © 2013 Elsevier B.V. All rights reserved.

Complex I deficiency related to T10158C mutation ND3 gene: A further definition of the clinical spectrum.

PubMed

Grosso, Salvatore; Carluccio, Maria Alessandra; Cardaioli, Elena; Cerase, Alfonso; Malandrini, Alessandro; Romano, Chiara; Federico, Antonio; Dotti, Maria Teresa

2017-03-01

Complex I deficiency is the most common energy generation disorder which may clinically present at any age with a wide spectrum of symptoms and signs. The T10158C mutation ND3 gene is rare and occurs in patients showing an early rapid neurological deterioration invariably leading to death after a few months. We report a 9year-old boy with a mtDNA T10158C mutation showing a mild MELAS-like phenotype and brain MRI features congruent with both MELAS and Leigh syndrome. Epilepsia partialis continua also occurred in the clinical course and related to a mild cortical atrophy of the left perisylvian area. The present case confirms that the clinical spectrum of Complex I deficiency related to T10158C mutation ND3 gene is wider than previously described. Our observation further suggests that testing mutation in the MT-ND3 gene should be included in the diagnostic work-up of patients presenting with epilepsia partialis continua accompanied by suspicion of mitochondrial disorder. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Polymorphisms in the methylenetetrahydrofolate reductase gene (MTHFR) are associated with susceptibility to adult acute myeloid leukemia in a Chinese population.

PubMed

Huang, Lulu; Deng, Donghong; Peng, Zhigang; Ye, Fanghui; Xiao, Qiang; Zhang, Bing; Ye, Bingbing; Mo, Zengnan; Yang, Xiaobo; Liu, Zhenfang

2015-06-01

Methylenetetrahydrofolate reductase (MTHFR) is an essential enzyme in the metabolism of folate. Since acute myeloid leukemia (AML) is characterized by rapidly proliferating tissues that have a high requirement for DNA synthesis, it is possible that the presence of MTHFR polymorphisms could be linked to the multifactorial process of AML development. We evaluated the role of MTHFR C677T and A1298C polymorphisms in a case-control study comprising 98 AML patients and 2016 healthy controls in a Southern Chinese population. We further conducted a sub-study restricted to individuals who neither smoked nor drank alcohol (70 AML patients and 160 healthy controls). MTHFR polymorphisms in the patient and control groups were evaluated by SNaP shot genotype techniques and Illumina BeadChip, respectively. Logistic regression was used to assess the adjusted odds ratios (ORs) and 95% confidence intervals (95% CIs). The MTHFR 1298AC genotype and the 677CC/1298AC haplotype were significantly associated with a decreased risk of AML compared with the AA genotype and 677CC/1298AA haplotype (OR=0.60, 95% CI: 0.38-0.95, P=0.03; OR=0.49, 95% CI: 0.27-0.90, P=0.02, respectively). In addition, the 677TT genotype was significantly associated with an increased risk of AML compared with the AA genotype only in non-smokers and non-drinkers (OR=4.78; 95% CI=1.38-16.61, P=0.01). The results might suggest that MTHFR polymorphisms are significantly associated with AML risk. In addition, the role of MTHFR genetic susceptibility could be greater among non-smokers and non-drinkers. Copyright © 2015 Elsevier Ltd. All rights reserved.

Novel mutations of the SRD5A2 and AR genes in Thai patients with 46, XY disorders of sex development.

PubMed

Ittiwut, Chupong; Pratuangdejkul, Jaturong; Supornsilchai, Vichit; Muensri, Sasipa; Hiranras, Yodporn; Sahakitrungruang, Taninee; Watcharasindhu, Suttipong; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

2017-01-01

Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.

Leber's Hereditary Optic Neuropathy Is Associated with the T3866C Mutation in Mitochondrial ND1 Gene in Three Han Chinese Families

PubMed Central

Zhou, Xiangtian; Qian, Yaping; Zhang, Juanjuan; Tong, Yi; Jiang, Pingping; Liang, Min; Dai, Xianning; Zhou, Huihui; Zhao, Fuxin; Ji, Yanchun; Mo, Jun Qin; Qu, Jia; Guan, Min-Xin

2012-01-01

Purpose. To investigate the pathophysiology of Leber's hereditary optic neuropathy (LHON). Methods. Seventy-one subjects from three Chinese families with LHON underwent clinical, genetic, molecular, and biochemical evaluations. Biochemical characterizations included the measurements of the rates of endogenous, substrate-dependent respirations, the adenosine triphosphate (ATP) production and generation of reactive oxygen species using lymphoblastoid cell lines derived from five affected matrilineal relatives of these families and three control subjects. Results. Ten of 41 matrilineal relatives exhibited variable severity and age at onset of optic neuropathy. The average age at onset of optic neuropathy in matrilineal relatives of the three families was 5, 11, and 24 years, respectively. Molecular analysis identified the ND1 T3866C (I187T) mutation and distinct sets of polymorphisms belonging to the Eastern Asian haplogroups D4a, M10a, and R, respectively. The I187T mutation is localized at the highly conserved isoleucine at a transmembrane domain of the ND1 polypeptide. The marked reductions in the rate of endogenous, malate/glutamate-promoted and succinate/glycerol-3-phosphate-promoted respiration were observed in mutant cell lines carrying the T3866C mutation. The deficient respiration is responsible for the reduced ATP synthesis and increased generation of reactive oxygen species. Conclusions. Our data convincingly show that the ND1 T3866C mutation leads to LHON. This mutation may be insufficient to produce a clinical phenotype. Other modifier factors may contribute to the phenotypic manifestation of the T3866C mutation. The T3866C mutation should be added to the list of inherited factors for molecular diagnosis of LHON. Thus, our findings may provide new insights into the understanding of pathophysiology and valuable information on the management of LHON. PMID:22577081

A distal mutation perturbs dynamic amino acid networks in dihydrofolate reductase

PubMed Central

Bae, Sung-Hun; Duggan, Brendan M.; Benkovic, Stephen J.; Dyson, H. Jane; Wright, Peter E

2013-01-01

Correlated networks of amino acids have been proposed to play a fundamental role in allostery and enzyme catalysis. These networks of amino acids can be traced from surface-exposed residues all the way into the active site, and disruption of these networks can decrease enzyme activity. Substitution of the distal Gly121 residue in E.coli dihydrofolate reductase results in up to a 200-fold decrease in the hydride transfer rate despite the fact that the residue is located 15 Å from the active-site center. In the present study, NMR relaxation experiments are used to demonstrate that dynamics on the ps-ns and μs-ms timescales are changed significantly in the G121V mutant of dihydrofolate reductase. In particular, ps-ns timescale dynamics are decreased in the FG loop (containing the mutated residue 121) and the neighboring active-site loop (the Met20 loop) in the mutant compared to wild-type enzyme, suggesting that these loops are dynamically coupled. Changes in methyl order parameters reveal a pathway by which dynamic perturbations can be propagated more than 25 Å across the protein from the site of mutation. All of the enzyme complexes, including the model Michaelis complex with folate and NADP+ bound, assume an occluded ground state conformation, and we do not observe sampling of a higher energy closed conformation by 15N R2 relaxation dispersion. This is highly significant, since it is only in the closed conformation that the cofactor and substrate reactive centers are positioned for reaction. The mutation also impairs μs - ms timescale fluctuations that have been implicated in product release from the wild type enzyme. Our results are consistent with an important role for Gly121 in controlling protein dynamics critical for enzyme function and further validate the dynamic energy landscape hypothesis of enzyme catalysis. PMID:23758161

Role of Aldo-Keto Reductase Family 1 (AKR1) Enzymes in Human Steroid Metabolism

PubMed Central

Rižner, Tea Lanišnik; Penning, Trevor M.

2013-01-01

Human aldo-keto reductases AKR1C1-AKR1C4 and AKR1D1 play essential roles in the metabolism of all steroid hormones, the biosynthesis of neurosteroids and bile acids, the metabolism of conjugated steroids, and synthetic therapeutic steroids. These enzymes catalyze NADPH dependent reductions at the C3, C5, C17 and C20 positions on the steroid nucleus and side-chain. AKR1C1-AKR1C4 act as 3-keto, 17-keto and 20-ketosteroid reductases to varying extents, while AKR1D1 acts as the sole Δ4-3-ketosteroid-5β-reductase (steroid 5β-reductase) in humans. AKR1 enzymes control the concentrations of active ligands for nuclear receptors and control their ligand occupancy and trans-activation, they also regulate the amount of neurosteroids that can modulate the activity of GABAA and NMDA receptors. As such they are involved in the pre-receptor regulation of nuclear and membrane bound receptors. Altered expression of individual AKR1C genes is related to development of prostate, breast, and endometrial cancer. Mutations in AKR1C1 and AKR1C4 are responsible for sexual development dysgenesis and mutations in AKR1D1 are causative in bile-acid deficiency. PMID:24189185

Mitochondrial C4375T mutation might be a molecular risk factor in a maternal Chinese hypertensive family under haplotype C.

PubMed

Chen, Hong; Sun, Min; Fan, Zhen; Tong, Maoqing; Chen, Guodong; Li, Danhui; Ye, Jihui; Yang, Yumin; Zhu, Yongding; Zhu, Jianhua

2017-12-04

Here, we reported a Han Chinese essential hypertensive pedigree based on clinical hereditary and molecular data. To know the molecular basis on this family, mitochondrial genome of one proband from the family was identified through direct sequencing analysis. The age of onset year and affected degree of patients are different in this family. And matrilineal family members carrying C4375T mutation and belong to Eastern Asian halopgroup C. Phylogenetic analysis shows 4375C is highly conservative in 17 species. It is suggested that these mutations might participate in the development of hypertension in this family. And halopgroup C might play a modifying role on the phenotype in this Chinese hypertensive family.

Dihydrofolate Reductase Deficiency Due to a Homozygous DHFR Mutation Causes Megaloblastic Anemia and Cerebral Folate Deficiency Leading to Severe Neurologic Disease

PubMed Central

Cario, Holger; Smith, Desirée E.C.; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

2011-01-01

The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. PMID:21310277

Influence of 5,10-methylenetetrahydrofolate reductase polymorphism on whole-blood folate concentrations measured by LC-MS/MS, microbiologic assay, and bio-rad radioassay.

PubMed

Fazili, Zia; Pfeiffer, Christine M; Zhang, Mindy; Jain, Ram B; Koontz, Deborah

2008-01-01

The 5,10-methylenetetrahydrofolate reductase (NADPH) (MTHFR) C677T polymorphism may affect whole-blood folate pattern measured by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and total folate measured by LC-MS/MS, microbiologic assay, and Bio-Rad radioassay (BR). We analyzed 171 whole blood hemolysates from 2 blood banks for folate pattern and total folate concentrations using these 3 methods and determined MTHFR genotype. The median (range) total folate concentration by LC-MS/MS was higher in the US set [378 (228-820) nmol/L; n = 96] than in the European set [250 (122-582) nmol/L; n = 75]. The whole-blood folate pattern [median (range)] was similar for individuals with C/C (n = 73) and C/T (n = 66) genotype: 88% (71%-91%) and 86% (50%-91%), respectively, for 5-methyltetrahydrofolic acid (5CH(3)THF) vs 12% (9%-29%) and 14% (9%-51%) for forms other than 5-methyltetrahydrofolic acid (non-5CH(3)THF). Individuals with T/T (n = 32) genotype had 58% (22%-87%) 5CH(3)THF vs 42% (13%-78%) non-5CH(3)THF. Compared with microbiologic assay results, LC-MS/MS (r = 0.94) and BR (r = 0.87) results were significantly lower (-10% and -45%, respectively); however, these differences were concentration dependent and also genotype dependent for the BR assay (-48% for C/C+C/T and -31% for T/T). The microbiologic assay completely recovered [mean (SD)] folates added to a whole blood hemolysate, except for tetrahydrofolic acid (THF) [46.4% (8.1%)]. The BR assay under-recovered 5CH(3)THF [51% (4.1%)] and 5-formyltetrahydrofolic acid [18% (0.1%)], and over-recovered THF [152% (19%)]. MTHFR C677T polymorphism influences the folate pattern in whole blood. The agreement between total folate by LC-MS/MS and microbiologic assay, independent of the MTHFR genotype, allows the use of one regression equation. Because BR results are genotype dependent, different regression equations should be used.

Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

PubMed

Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

2013-10-03

Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

Clinical spectrum in homozygotes and compound heterozygotes inheriting cystic fibrosis mutation 3849+10kbC>T: Significance for geneticists

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilbert, F.; Li, Zhen; Arzimanoglou, I.

We describe patients inheriting cystic fibrosis (CF) mutation 3849+10kbC>T as homozygotes or compound heterozygotes. Three unrelated homozygotes for this mutation were all pancreatic-sufficient and sweat test-negative or inconclusive. Among the compound heterozygotes, both pancreatic sufficiency and insufficiency, as well as positive and negative/inconclusive sweat test results are reported, expanding the range of clinical expression associated with inheritance of this mutation. 3849+10kbC>T is one of several CF mutations that can result in atypical or variant forms of CF. For geneticists, the diagnosis of variant CF has implications for recurrence risk and prognosis counseling of the families of affected individuals, and possiblymore » for CF carrier screening in the general population. 19 refs., 1 tab.« less

Identification of XLRS1 gene mutation (608C > T) in a Portuguese family with juvenile retinoschisis.

PubMed

Teixeira, C; Rocha-Sousa, A; Trump, D; Brandão, E; Falcão-Reis, F

2005-01-01

To characterize electroretinogram (ERG) and molecular genetic findings in a family with XLRS1 mutation. The authors present two cases of a Portuguese family with juvenile retinoschisis with a mutation in exon 6. Two brothers and their parents, grandmother, and uncle underwent a full ophthalmic examination. The two brothers with ophthalmic disease were evaluated with color fundus photography, fluorescein angiography, optical coherence tomography (OCT), molecular genetic study (Group VI of Retinoschisis Consortium), pattern visual evoked potential (PVEP), and full field ERG. Both patients presented funduscopic manifestations of vitre o retinal degeneration. They presented peripheral schisis and retinal detachment. However, foveal schisis had never been observed at funduscopy. A negative ERG was recorded in both. Six months after that, the younger brother showed a typical foveal schisis at fundus examination. A retinoschisis gene (XLRS1) mutation with transition of cytosine by thymine at position 608 (608C > T) had been identified in both. Negative ERG is the most secure clinical marker to establish the diagnosis of juvenile retinoschisis. XLRS1 gene 608C > T mutation was described for the first time in a Portuguese family.

Response to immunotherapy in a patient with adult onset Leigh syndrome and T9176C mtDNA mutation.

PubMed

Chuquilin, Miguel; Govindarajan, Raghav; Peck, Dawn; Font-Montgomery, Esperanza

2016-09-01

Leigh syndrome is a mitochondrial disease caused by mutations in different genes, including ATP6A for which no known therapy is available. We report a case of adult-onset Leigh syndrome with response to immunotherapy. A twenty year-old woman with baseline learning difficulties was admitted with progressive behavioral changes, diplopia, headaches, bladder incontinence, and incoordination. Brain MRI and PET scan showed T2 hyperintensity and increased uptake in bilateral basal ganglia, respectively. Autoimmune encephalitis was suspected and she received plasmapheresis with clinical improvement. She was readmitted 4 weeks later with dysphagia and aspiration pneumonia. Plasmapheresis was repeated with resolution of her symptoms. Given the multisystem involvement and suggestive MRI changes, genetic testing was done, revealing a homoplasmic T9176C ATPase 6 gene mtDNA mutation. Monthly IVIG provided clinical improvement with worsening when infusions were delayed. Leigh syndrome secondary to mtDNA T9176C mutations could have an autoimmune mechanism that responds to immunotherapy.

The clinical spectrum of the m.10191T>C mutation in complex I-deficient Leigh syndrome.

PubMed

Nesbitt, Victoria; Morrison, Patrick J; Crushell, Ellen; Donnelly, Deirdre E; Alston, Charlotte L; He, Langping; McFarland, Robert; Taylor, Robert W

2012-06-01

Mitochondrial respiratory chain diseases represent one of the most common inherited neurometabolic disorders of childhood, affecting a minimum of 1 in 7500 live births. The marked clinical, biochemical, and genetic heterogeneity means that accurate genetic counselling relies heavily upon the identification of the underlying causative mutation in the individual and determination of carrier status in the parents. Isolated complex I deficiency is the most common respiratory chain defect observed in children, resulting in organ-specific or multisystem disease, but most often presenting as Leigh syndrome, for which mitochondrial DNA mutations are important causes. Several recurrent, pathogenic point mutations in the MTND3 gene - including m.10191T>C (p.Ser45Pro) - have been previously identified. In this short clinical review we evaluate the case reports of the m.10191T>C mutation causing complex I-deficient Leigh syndrome described in the literature, in addition to two new ones diagnosed in our laboratory. Both of these appear to have arisen de novo without transmission of the mutation from mother to offspring, illustrating the importance not only of fully characterizing the mitochondrial genome as part of the investigation of children with complex I-deficient Leigh syndrome but also of assessing maternal samples to provide crucial genetic advice for families. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

MTHFR 677TT genotype and disease risk: is there a modulating role for B-vitamins?

PubMed

Reilly, R; McNulty, H; Pentieva, K; Strain, J J; Ward, M

2014-02-01

Methylenetetrahydrofolate reductase (MTHFR) is a critical folate-metabolising enzyme which requires riboflavin as its co-factor. A common polymorphism (677C→T) in the MTHFR gene results in reduced MTHFR activity in vivo which in turn leads to impaired folate metabolism and elevated homocysteine concentrations. Homozygosity for this polymorphism (TT genotype) is associated with an increased risk of a number of conditions including heart disease and stroke, but there is considerable variability in the extent of excess risk in various reports. The present review will explore the evidence which supports a role for this polymorphism as a risk factor for a number of adverse health outcomes, and the potential modulating roles for B-vitamins in alleviating disease risk. The evidence is convincing in the case which links this polymorphism with hypertension and hypertensive disorders of pregnancy, particularly preeclampsia. Furthermore, elevated blood pressure was found to be highly responsive to riboflavin intervention specifically in individuals with the MTHFR 677TT genotype. Future intervention studies targeted at these genetically predisposed individuals are required to further investigate this novel gene-nutrient interaction. This polymorphism has also been associated with an increased risk of neural tube defects (NTD) and other adverse pregnancy outcomes; however, the evidence in this area has been inconsistent. Preliminary evidence has suggested that there may be a much greater need for women with the MTHFR 677TT genotype to adhere to the specific recommendation of commencing folic acid prior to conception for the prevention of NTD, but this requires further investigation.

Molecular analysis of congenital goitres with hypothyroidism caused by defective thyroglobulin synthesis. Identification of a novel c.7006C>T [p.R2317X] mutation and expression of minigenes containing nonsense mutations in exon 7.

PubMed

Machiavelli, Gloria A; Caputo, Mariela; Rivolta, Carina M; Olcese, María C; Gruñeiro-Papendieck, Laura; Chiesa, Ana; González-Sarmiento, Rogelio; Targovnik, Héctor M

2010-01-01

Thyroglobulin (TG) deficiency is an autosomal-recessive disorder that results in thyroid dyshormonogenesis. A number of distinct mutations have been identified as causing human hypothyroid goitre. The purpose of this study was to identify and characterize new mutations in the TG gene in an attempt to increase the understanding of the genetic mechanism responsible for this disorder. A total of six patients from four nonconsanguineous families with marked impairment of TG synthesis were studied. Single-strand conformation polymorphism (SSCP) analysis, sequencing of DNA, genotyping, expression of chimeric minigenes and bioinformatic analysis were performed. Four different inactivating TG mutations were identified: one novel mutation (c.7006C>T [p.R2317X]) and three previously reported (c.886C>T [p.R277X], c.6701C>A [p.A2215D] and c.6725G>A [p.R2223H]). Consequently, one patient carried a compound heterozygous for p.R2223H/p.R2317X mutations; two brothers showed a homozygous p.A2215D substitution and the remaining three patients, from two families with typical phenotype, had a single p.R277X mutated allele. We also showed functional evidences that premature stop codons inserted at different positions in exon 7, which disrupt exonic splicing enhancer (ESE) sequences, do not interfere with exon definition and processing. In this study, we have identified a novel nonsense mutation p.R2317X in the acetylcholinesterase homology domain of TG. We have also observed that nonsense mutations do not interfere with the pre-mRNA splicing of exon 7. The results are in accordance with previous observations confirming the genetic heterogeneity of TG defects.

Heterogenous Distribution of MTHFR Gene Variants among Mestizos and Diverse Amerindian Groups from Mexico

PubMed Central

Contreras-Cubas, Cecilia; Sánchez-Hernández, Beatríz E.; García-Ortiz, Humberto; Martínez-Hernández, Angélica; Barajas-Olmos, Francisco; Cid, Miguel; Mendoza-Caamal, Elvia C.; Centeno-Cruz, Federico; Ortiz-Cruz, Gabriela; Jiménez-López, José Concepción; Córdova, Emilio J.; Salas-Bautista, Eva Gabriela; Saldaña-Alvarez, Yolanda; Fernández-López, Juan Carlos; Mutchinick, Osvaldo M.

2016-01-01

Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme in folate metabolism. Folate deficiency has been related to several conditions, including neural tube defects (NTDs) and cardiovascular diseases. Hence, MTHFR genetic variants have been studied worldwide, particularly the C677T and A1298C. We genotyped the C677T and A1298C MTHFR polymorphisms in Mexican Amerindians (MAs), from the largest sample included in a genetic study (n = 2026, from 62 ethnic groups), and in a geographically-matched Mexican Mestizo population (MEZ, n = 638). The 677T allele was most frequent in Mexican individuals, particularly in MAs. The frequency of this allele in both MAs and MEZs was clearly enriched in the South region of the country, followed by the Central East and South East regions. In contrast, the frequency of the 1298C risk allele in Mexicans was one of the lowest in the world. Both in MAs and MEZs the variants 677T and 1298C displayed opposite allele frequency gradients from southern to northern Mexico. Our findings suggest that in Mestizos the 677T allele was derived from Amerindians while the 1298C allele was a European contribution. Some subgroups showed an allele frequency distribution that highlighted their genetic diversity. Notably, the distribution of the frequency of the 677T allele was consistent with that of the high incidence of NTDs reported in MEZ. PMID:27649570

Role of aldo-keto reductase family 1 (AKR1) enzymes in human steroid metabolism.

PubMed

Rižner, Tea Lanišnik; Penning, Trevor M

2014-01-01

Human aldo-keto reductases AKR1C1-AKR1C4 and AKR1D1 play essential roles in the metabolism of all steroid hormones, the biosynthesis of neurosteroids and bile acids, the metabolism of conjugated steroids, and synthetic therapeutic steroids. These enzymes catalyze NADPH dependent reductions at the C3, C5, C17 and C20 positions on the steroid nucleus and side-chain. AKR1C1-AKR1C4 act as 3-keto, 17-keto and 20-ketosteroid reductases to varying extents, while AKR1D1 acts as the sole Δ(4)-3-ketosteroid-5β-reductase (steroid 5β-reductase) in humans. AKR1 enzymes control the concentrations of active ligands for nuclear receptors and control their ligand occupancy and trans-activation, they also regulate the amount of neurosteroids that can modulate the activity of GABAA and NMDA receptors. As such they are involved in the pre-receptor regulation of nuclear and membrane bound receptors. Altered expression of individual AKR1C genes is related to development of prostate, breast, and endometrial cancer. Mutations in AKR1C1 and AKR1C4 are responsible for sexual development dysgenesis and mutations in AKR1D1 are causative in bile-acid deficiency. Copyright © 2013 Elsevier Inc. All rights reserved.

Thrombophilia-Related Complications in the Treatment of a Left Atrial Appendage Thrombus: A Case Report

PubMed Central

Parato, Vito Maurizio; Scarano, Michele; Labanti, Benedetto

2014-01-01

Trans-esophageal echocardiography (TEE) revealed a left atrial appendage (LAA) thrombus in an 84-year-old woman with nonvalvular atrial fibrillation not known before our evaluation. In her medical history, there were hypertension, dyslipidemia and a previous pulmonary embolism. She was taking warfarin at time of our evaluation and presented signs and symptoms of heart failure. Together with heart failure treatment, intravenous anticoagulation with unfractionated heparin was initiated. Treatment was complicated by additional right lower limb embolic event and the LAA thrombus remained unchanged. Testing revealed heterozygosity for both the factor V Leiden and the methylenetetrahydrofolate reductase C677T mutations inducing resistance to activated protein C. The patient refused transcatheter closure of the left atrial appendage. PMID:28465906

[Homocysteinemia and its relationship with the methylentetrahydrofolate reductase polymorphism in various ethnic groups from western Venezuela].

PubMed

Vizcaíno, Gilberto; Diez-Ewald, María; Herrmann, Falko H; Schuster, Gudrun; Torres-Guerra, Enrique; Arteaga-Vizcaíno, Melvis

2005-12-01

The prevalence of hyperhomocysteinemia and C677T MTHFR polymorphism was studied in various ethnic groups from Western Venezuela (60 Wayuu Indians, 42 italian immigrants and 77 Venezuelan mestizos) in relation with the prevalence of hyperhomocysteinemia and the C677T MTHFR polymorphism. Homocysteinemia was determined by polarized fluorescence immunoassay in an IMX system, serum folate was measured by radioimmunoanalysis and the MTHFR genotype was determined by PCR and restriction analysis. Hyperhomocysteinemia was defined as a value over 2 SD above the mean value for normal MTHFR (CC677) in each group. The prevalence of MTHFR variants (C677T and 677TT) was elevated in all ethnic groups (78% among the wayuu, 76% among Italians and 63% among mestizos) with a significant association between the concentrations of homocysteine and the levels of serum folate among the wayuu (p < 0.0001) and the mestizos (p < 0.001) only. Hyperhomocysteinemia was associated with MTHFR variants in 23% of the wayuu (OR: 6.17, CI 95: 0.74-51.36), 9.5% of the Italians (OR: 0.93, CI 95: 0.085-10.10) and 20.7 of the Venezuelans mestizos (OR: 5.2, CI 95: 1.08-24.90, p > 0.03). There was no relationship between hyperhomocysteinemia and folate deficiency in any of the groups studied. In conclusion, despite a high prevalence of C677T MTHFR variants in these ethnic groups of western Venezuela, the lack of no evidence of hyperhomocysteinemia combined with folate deficiency may imply that the nutritional status of these groups plays an important role in the control of hyperhomocysteinemia as a risk factor for cardiovascular disease.

Dihydrofolate reductase deficiency due to a homozygous DHFR mutation causes megaloblastic anemia and cerebral folate deficiency leading to severe neurologic disease.

PubMed

Cario, Holger; Smith, Desirée E C; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

2011-02-11

The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

PAI-1 4G/5G and MTHFR C677T polymorphisms increased the accuracy of two prediction scores for the risk of acute lower extremity deep vein thrombosis.

PubMed

Pop, Tudor Radu; Vesa, Ştefan Cristian; Trifa, Adrian Pavel; Crişan, Sorin; Buzoianu, Anca Dana

2014-01-01

This study investigates the accuracy of two scores in predicting the risk of acute lower extremity deep vein thrombosis. The study included 170 patients [85 (50%) women and 85 (50%) men] who were diagnosed with acute lower extremity deep vein thrombosis (DVT) with duplex ultrasonography. Median age was 62 (52.75; 72) years. The control group consisted of 166 subjects [96 (57.8%) women and 70 (42.2%) men], without DVT, matched for age (± one year) to those in the group with DVT. The patients and controls were selected from those admitted to the internal medicine, cardiology and geriatrics wards within the Municipal Hospital of Cluj-Napoca, Romania, between October 2009 and June 2011. Clinical, demographic and lab data were recorded for each patient. For each patient we calculated the prior risk of DVT using two prediction scores: Caprini and Padua. According to the Padua score only 93 (54.7%) patients with DVT had been at high risk of developing DVT, while 48 (28.9%) of controls were at high risk of developing DVT. When Padua score included PAI-1 4G/5G and MTHFR C677T polymorphisms, the sensitivity increased at 71.7%. Using the Caprini score, we determined that 147 (86.4%) patients with DVT had been at high risk of developing DVT, while 103 (62%) controls were at high risk of developing DVT. A Caprini score higher than 5 was the strongest predictor of acute lower extremity DVT risk. The Caprini prediction score was more sensitive than the Padua score in assessing the high risk of DVT in medical patients. PAI-1 4G/5G and MTHFR C677T polymorphisms increased the sensitivity of Padua score.

Mutation in Pyrroline-5-Carboxylate Reductase 1 Gene in Families with Cutis Laxa Type 2

PubMed Central

Guernsey, Duane L.; Jiang, Haiyan; Evans, Susan C.; Ferguson, Meghan; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea L.; Provost, Sylvie; Bedard, Karen; Orr, Andrew; Dubé, Marie-Pierre; Ludman, Mark; Samuels, Mark E.

2009-01-01

Autosomal-recessive cutis laxa type 2 (ARCL2) is a multisystem disorder characterized by the appearance of premature aging, wrinkled and lax skin, joint laxity, and a general developmental delay. Cutis laxa includes a family of clinically overlapping conditions with confusing nomenclature, generally requiring molecular analyses for definitive diagnosis. Six genes are currently known to mutate to yield one of these related conditions. We ascertained a cohort of typical ARCL2 patients from a subpopulation isolate within eastern Canada. Homozygosity mapping with high-density SNP genotyping excluded all six known genes, and instead identified a single homozygous region near the telomere of chromosome 17, shared identically by state by all genotyped affected individuals from the families. A putative pathogenic variant was identified by direct DNA sequencing of genes within the region. The single nucleotide change leads to a missense mutation adjacent to a splice junction in the gene encoding pyrroline-5-carboxylate reductase 1 (PYCR1). Bioinformatic analysis predicted a pathogenic effect of the variant on splice donor site function. Skipping of the associated exon was confirmed in RNA from blood lymphocytes of affected homozygotes and heterozygous mutation carriers. Exon skipping leads to deletion of the reductase functional domain-coding region and an obligatory downstream frameshift. PYCR1 plays a critical role in proline biosynthesis. Pathogenicity of the genetic variant in PYCR1 is likely, given that a similar clinical phenotype has been documented for mutation carriers of another proline biosynthetic enzyme, pyrroline-5-carboxylate synthase. Our results support a significant role for proline in normal development. PMID:19576563

Lynch syndrome: the influence of environmental factors on extracolonic cancer risk in hMLH1 c.C1528T mutation carriers and their mutation-negative sisters.

PubMed

Blokhuis, M M; Pietersen, G E; Goldberg, P A; Algar, U; Van der Merwe, L; Mbatani, N; Vorster, A A; Ramesar, R S

2010-09-01

Lynch Syndrome (LS) is a cancer susceptibility syndrome caused mostly by mutations in the mismatch repair genes, hMLH1, hMSH2 and hMSH6. Mutation carriers are at risk of colorectal and endometrial cancer and, less frequently, cancer of the ovaries, stomach, small bowel, hepatobiliary tract, ureter, renal pelvis and brain. The influence of environmental factors on extracolonic cancer risk in LS patients has not been investigated thus far. The aim of this study was to investigate some of these factors in South African females carrying the hMLH1 c.C1528T mutation and their mutation-negative relatives. Data were collected from 87 mutation-positive females and 121 mutation-negative female relatives regarding age, cancer history, hormonal contraceptive use, parity, duration of breast feeding, height, weight and age at first birth, last birth, menarche and menopause. Influence of these factors on cancer risk was analysed by mixed-effects generalised linear models. Extracolonic cancer occurred in 14% (12/87) of mutation-positive females versus 7% (8/121) of mutation-negative females, (P = 0.0279, adjusted for age and relatedness between women). Breast cancer was the most common extracolonic cancer. An association was found for oral contraceptive use and extracolonic cancer risk in mutation-negative females only. No association was found for any of the other risk factors investigated, when adjusted for age. This might be due to the scarcity of extracolonic cancers in our data. Future knowledge on the influence of additional environmental factors on cancer risk in LS females can lead to evidence-based lifestyle advice for mutation carriers, thereby complementing the prevention strategies available today. In addition, it can contribute to an integrated model of cancer aetiology. Therefore, this study should be taken as a thrust for further research.

The silent mutation MLH1 c.543C>T resulting in aberrant splicing can cause Lynch syndrome: a case report.

PubMed

Yamaguchi, Tatsuro; Wakatsuki, Tomokazu; Kikuchi, Mari; Horiguchi, Shin-Ichiro; Akagi, Kiwamu

2017-06-01

The proband was a 67-year-old man with transverse and sigmoid colon cancer. Microsatellite instability analysis revealed a high frequency of microsatellite instability, and immunohistochemical staining showed the absence of both MLH1 and PMS2 proteins in the sigmoid colon cancer tissue specimens from the patient. DNA sequencing revealed a nucleotide substitution c.543C>T in MLH1, but this variant did not substitute an amino acid. The MLH1 c.543C>T variant was located 3 bases upstream from the end of exon 6 and created a new splice donor site 4 bases upstream from the end of exon 6. Consequently, the last 4 bases of exon 6 were deleted and frameshift occurred. Thus, the MLH1 c.543C>T silent mutation is considered 'pathogenic'. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

[Study on the relationship of MTHFR polymorphisms with unexplained recurrent spontaneous abortion].

PubMed

Li, Xiao-mei; Zhang, You-zhong; Xu, Yan-xue; Jiang, Sen

2004-02-01

To assess the relationship of methylenetetrahydrofolate reductase (MTHFR) C677T genotypes to unexplained recurrent spontaneous abortion (URSA). This study included two groups:57 currently non-pregnant women with a history of URSA (URSA group), and 50 currently non-pregnant women with a history of having given birth to at least one live baby and without any history of spontaneous abortion, still-born fetus, placental thrombosis and intrauterine growth retardation(IUGR)(control group). The fasting serum-Hcy was measured with high pressure liquid chromatography. Folic acid and vitamin B(12) were detected by radioimmune assay; antiphospholipid antibody (ACA) was detected by ELISA. MTHFR C677T gene polymorphisms were detected by the technique of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). C/C genotype in URSA group was significantly lower than that in control group, the total mutant T allele frequency was significantly higher than that in control group. There was no significant difference in respect of "age, rural area/city, period, primary/secondary abortion" between the genotype distributions of MTHFR C677T. The T/T genotype and C/T+T/T genotypes frequencies for "abortion times>or=3" were higher than those for "abortion time <3". MTHFR C677T gene polymorphism is a genetic risk factor for URSA.

Arg753gln and Arg677 Trp Polymorphisms of Toll-Like Receptor 2 In Acute Apical Abscess.

PubMed

Miri-Moghaddam, Ebrahim; Farhad Mollashahi, Narges; Naghibi, Nava; Garme, Yasaman; Bazi, Ali

2018-06-01

Genetic polymorphisms can alter immunity response against pathogens, which in turn influence individuals' susceptibility to certain infections. Our aim was to determine the association of Arg753Gln (rs5743708) and Arg677Trp (rs12191786) polymorphisms of toll like receptor-2 gene with the two clinical forms of apical periodontitis: acute apical abscess (AAA) and asymptomatic apical periodontitis (AAP). There were 50 patients with AAA as case group and 50 with AAP as control group. Genotyping was done using Tetra-ARMS (amplification refractory mutation system) PCR. Heterozygous genotype of Arg677Trp polymorphism was associated with risk of AAA (OR=1.9, 95% CI: 0.7-5.5, p = 0.05). Although statistically insignificant, Arg677Trp polymorphism promoted the risk of AAA in dominant model (OR=2.1, 95% CI: 0.7-5.9, p > 0.05). The frequency of mutant allele (T) of Arg677Trp polymorphism was higher in AAA (14%) than AAP (7%) subjects (OR=1.7, 95% CI: 0.6-4.7). For Arg753Gln polymorphism, wild homozygous (GG) represented the dominant genotype in both cases (96%) and controls (100%). Variant allele (A) of Arg753Gln polymorphism was identified in 2% of AAA, while no individual represented with this allele in AAP subjects. Individuals with Arg753Gln; Arg677Trp (GG; TC) combination showed an elevated risk of AAA (OR=1.6, 95% CI: 0.5- 4.2, p > 0.05). Arg677Trp polymorphism of TLR-2 rendered a higher risk for the development of abscesses in apical periodontitis. It is recommended to explore role of this polymorphism in other populations.