Science.gov

Sample records for regulatory protein-dependent mechanism

  1. GTP cyclohydrolase I feedback regulatory protein-dependent and -independent inhibitors of GTP cyclohydrolase I.

    PubMed

    Yoneyama, T; Wilson, L M; Hatakeyama, K

    2001-04-01

    GTP cyclohydrolase I feedback regulatory protein (GFRP) mediates the feedback inhibition of GTP cyclohydrolase I activity by (6R)-L-erythro-5,6,7,8-tetrahydrobiopterin (BH4) through protein complex formation. Since guanine and BH4 have a common pyrimidine ring structure, we examined the inhibitory effect of guanine and its analogs on the enzyme activity. Guanine, 8-hydroxyguanine, 8-methylguanine, and 8-bromoguanine inhibited the enzyme activity in a GFRP-dependent and pH-dependent manner and induced complex formation between GTP cyclohydrolase I and GFRP. The type of inhibition by this group is a mixed type. All these properties were shared with BH4. In striking contrast, inhibition by 8-azaguanine and 8-mercaptoguanine was GFRP-independent and pH-independent. The type of inhibition by 8-azaguanine and 8-mercaptoguanine was a competitive type. The two compounds did not induce complex formation between the enzyme and GFRP. These results demonstrate that guanine compounds of the first group bind to the BH4-binding site of the GTP cyclohydrolase I/GFRP complex, whereas 8-azaguanine and 8-mercaptoguanine bind to the active site of the enzyme. Finally, the possible implications in Lesch-Nyhan syndrome and Parkinson diseases of the inhibition of GTP cyclohydrolase I by guanine and 8-hydroxyguanine are discussed. PMID:11361142

  2. LPS induces KH-type splicing regulatory protein-dependent processing of microRNA-155 precursors in macrophages.

    PubMed

    Ruggiero, Tina; Trabucchi, Michele; De Santa, Francesca; Zupo, Simona; Harfe, Brian D; McManus, Michael T; Rosenfeld, M Geoff; Briata, Paola; Gherzi, Roberto

    2009-09-01

    The importance of post-transcriptional mechanisms for the regulation of the homoeostasis of the immune system and the response to challenge by microorganisms is becoming increasingly appreciated. We investigated the contribution of microRNAs (miRNAs) to macrophage activation induced by lipopolysaccharide (LPS). We first observed that Dicer knockout in bone marrow-derived macrophages (BMDMs) increases the LPS-induced expression of some inflammation mediators. miRNA microarray analysis in BMDMs revealed that LPS significantly induces the expression of a single miRNA, miR-155, and this induction depends on enhanced miR-155 maturation from its precursors. The single-strand RNA-binding protein KH-type splicing regulatory protein (KSRP) binds to the terminal loop of miR-155 precursors and promotes their maturation. Both inhibition of miR-155 and KSRP knockdown enhance the LPS-induced expression of select inflammation mediators, and the effect of KSRP knockdown is reverted by mature miR-155. Our studies unveil the existence of an LPS-dependent post-transcriptional regulation of miR-155 biogenesis. Once induced, miR-155 finely tunes the expression of select inflammation mediators in response to LPS. PMID:19423639

  3. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth

    PubMed Central

    2013-01-01

    Background Regulation of lipid metabolism via activation of sterol regulatory element binding proteins (SREBPs) has emerged as an important function of the Akt/mTORC1 signaling axis. Although the contribution of dysregulated Akt/mTORC1 signaling to cancer has been investigated extensively and altered lipid metabolism is observed in many tumors, the exact role of SREBPs in the control of biosynthetic processes required for Akt-dependent cell growth and their contribution to tumorigenesis remains unclear. Results We first investigated the effects of loss of SREBP function in non-transformed cells. Combined ablation of SREBP1 and SREBP2 by siRNA-mediated gene silencing or chemical inhibition of SREBP activation induced endoplasmic reticulum (ER)-stress and engaged the unfolded protein response (UPR) pathway, specifically under lipoprotein-deplete conditions in human retinal pigment epithelial cells. Induction of ER-stress led to inhibition of protein synthesis through increased phosphorylation of eIF2α. This demonstrates for the first time the importance of SREBP in the coordination of lipid and protein biosynthesis, two processes that are essential for cell growth and proliferation. SREBP ablation caused major changes in lipid composition characterized by a loss of mono- and poly-unsaturated lipids and induced accumulation of reactive oxygen species (ROS) and apoptosis. Alterations in lipid composition and increased ROS levels, rather than overall changes to lipid synthesis rate, were required for ER-stress induction. Next, we analyzed the effect of SREBP ablation in a panel of cancer cell lines. Importantly, induction of apoptosis following SREBP depletion was restricted to lipoprotein-deplete conditions. U87 glioblastoma cells were highly susceptible to silencing of either SREBP isoform, and apoptosis induced by SREBP1 depletion in these cells was rescued by antioxidants or by restoring the levels of mono-unsaturated fatty acids. Moreover, silencing of SREBP1

  4. Endothelin activates voltage-dependent Ca2+ current by a G protein-dependent mechanism in rabbit cardiac myocytes.

    PubMed Central

    Lauer, M R; Gunn, M D; Clusin, W T

    1992-01-01

    1. Endothelin is a vasoactive peptide released from vascular endothelial cells which has potent cardiac inotropic effects. We examined the effect of endothelin on the verapamil-sensitive Ca2+ current (ICa) in enzymatically dispersed rabbit ventricular myocytes. 2. Using the whole-cell voltage clamp technique with a standard dialysing pipette solution, the application of extracellular endothelin (20 nM) did not increase the peak ICa, but in fact caused a small reversible decline (903 +/- 109 pA without endothelin, 727 +/- 95 pA with endothelin (means +/- S.E.M., n = 14, P less than 0.05)). 3. If GTP (100 microM) was added to the pipette solution, the extracellular application of endothelin (0.2 or 20 nM) caused a large, reproducible increase in peak ICa (871 +/- 85 pA without endothelin, 1230 +/- 110 pA with 20 nM-endothelin (n = 10, P less than 0.05). The endothelin enhancement of ICa occurred after a delay of approximately 3-4 min at room temperature. 4. The GTP requirement for the endothelin effect on ICa suggests that its effect may be mediated through a G protein-dependent pathway. To investigate this further, experiments were performed with pipette solutions containing guanosine-5'-O-(2-thiodiphosphate) (GDP beta S), a GDP analogue which inhibits G protein cycling. With the addition of GDP beta S (0.5-5.0 mM) to the pipette solution (along with 100 microM-GTP), the effect of endothelin on peak ICa was blocked (1062 +/- 86 pA without endothelin, 1170 +/- 134 pA with endothelin (n = 11, P greater than 0.05)). 5. Incubation of myocytes with pertussis toxin (500 ng/ml) prevented the partial ACh-induced reversal of the isoprenolol enhancement of ICa. However, this identical treatment failed to block the endothelin enhancement of the voltage-dependent Ca2+ current (n = 4). 6. Taken together, these results confirm that while the effect of endothelin in rabbit cardiac ventricular myocytes is mediated through a G protein-dependent pathway, the G protein involved is

  5. Comparative studies of gene regulatory mechanisms.

    PubMed

    Pai, Athma A; Gilad, Yoav

    2014-12-01

    It has become increasingly clear that changes in gene regulation have played an important role in adaptive evolution both between and within species. Over the past five years, comparative studies have moved beyond simple characterizations of differences in gene expression levels within and between species to studying variation in regulatory mechanisms. We still know relatively little about the precise chain of events that lead to most regulatory adaptations, but we have taken significant steps towards understanding the relative importance of changes in different mechanisms of gene regulatory evolution. In this review, we first discuss insights from comparative studies in model organisms, where the available experimental toolkit is extensive. We then focus on a few recent comparative studies in primates, where the limited feasibility of experimental manipulation dictates the approaches that can be used to study gene regulatory evolution. PMID:25215415

  6. Advances in Autophagy Regulatory Mechanisms

    PubMed Central

    Gallagher, Laura E.; Williamson, Leon E.; Chan, Edmond Y. W.

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  7. Advances in Autophagy Regulatory Mechanisms.

    PubMed

    Gallagher, Laura E; Williamson, Leon E; Chan, Edmond Y W

    2016-01-01

    Autophagy plays a critical role in cell metabolism by degrading and recycling internal components when challenged with limited nutrients. This fundamental and conserved mechanism is based on a membrane trafficking pathway in which nascent autophagosomes engulf cytoplasmic cargo to form vesicles that transport their content to the lysosome for degradation. Based on this simple scheme, autophagy modulates cellular metabolism and cytoplasmic quality control to influence an unexpectedly wide range of normal mammalian physiology and pathophysiology. In this review, we summarise recent advancements in three broad areas of autophagy regulation. We discuss current models on how autophagosomes are initiated from endogenous membranes. We detail how the uncoordinated 51-like kinase (ULK) complex becomes activated downstream of mechanistic target of rapamycin complex 1 (MTORC1). Finally, we summarise the upstream signalling mechanisms that can sense amino acid availability leading to activation of MTORC1. PMID:27187479

  8. Chromatin insulators: regulatory mechanisms and epigenetic inheritance

    PubMed Central

    Bushey, Ashley M.; Dorman, Elizabeth R.; Corces, Victor G.

    2008-01-01

    Enhancer-blocking insulators are DNA elements that disrupt the communication between a regulatory sequence, such as an enhancer or a silencer, and a promoter. Insulators participate in both transcriptional regulation and global nuclear organization, two features of chromatin that are thought to be maintained from one generation to the next through epigenetic mechanisms. Furthermore, there are many regulatory mechanisms in place that enhance or hinder insulator activity. These modes of regulation could be used to establish cell-type specific insulator activity that is epigenetically inherited along a cell and/or organismal lineage. This review will discuss the evidence for epigenetic inheritance and regulation of insulator function. PMID:18851828

  9. Gene regulatory mechanisms underpinning prostate cancer susceptibility.

    PubMed

    Whitington, Thomas; Gao, Ping; Song, Wei; Ross-Adams, Helen; Lamb, Alastair D; Yang, Yuehong; Svezia, Ilaria; Klevebring, Daniel; Mills, Ian G; Karlsson, Robert; Halim, Silvia; Dunning, Mark J; Egevad, Lars; Warren, Anne Y; Neal, David E; Grönberg, Henrik; Lindberg, Johan; Wei, Gong-Hong; Wiklund, Fredrik

    2016-04-01

    Molecular characterization of genome-wide association study (GWAS) loci can uncover key genes and biological mechanisms underpinning complex traits and diseases. Here we present deep, high-throughput characterization of gene regulatory mechanisms underlying prostate cancer risk loci. Our methodology integrates data from 295 prostate cancer chromatin immunoprecipitation and sequencing experiments with genotype and gene expression data from 602 prostate tumor samples. The analysis identifies new gene regulatory mechanisms affected by risk locus SNPs, including widespread disruption of ternary androgen receptor (AR)-FOXA1 and AR-HOXB13 complexes and competitive binding mechanisms. We identify 57 expression quantitative trait loci at 35 risk loci, which we validate through analysis of allele-specific expression. We further validate predicted regulatory SNPs and target genes in prostate cancer cell line models. Finally, our integrated analysis can be accessed through an interactive visualization tool. This analysis elucidates how genome sequence variation affects disease predisposition via gene regulatory mechanisms and identifies relevant genes for downstream biomarker and drug development. PMID:26950096

  10. Regulatory mechanisms link phenotypic plasticity to evolvability.

    PubMed

    van Gestel, Jordi; Weissing, Franz J

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question - the optimal timing of bacterial sporulation - we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  11. Regulatory mechanisms link phenotypic plasticity to evolvability

    PubMed Central

    van Gestel, Jordi; Weissing, Franz J.

    2016-01-01

    Organisms have a remarkable capacity to respond to environmental change. They can either respond directly, by means of phenotypic plasticity, or they can slowly adapt through evolution. Yet, how phenotypic plasticity links to evolutionary adaptability is largely unknown. Current studies of plasticity tend to adopt a phenomenological reaction norm (RN) approach, which neglects the mechanisms underlying plasticity. Focusing on a concrete question – the optimal timing of bacterial sporulation – we here also consider a mechanistic approach, the evolution of a gene regulatory network (GRN) underlying plasticity. Using individual-based simulations, we compare the RN and GRN approach and find a number of striking differences. Most importantly, the GRN model results in a much higher diversity of responsive strategies than the RN model. We show that each of the evolved strategies is pre-adapted to a unique set of unseen environmental conditions. The regulatory mechanisms that control plasticity therefore critically link phenotypic plasticity to the adaptive potential of biological populations. PMID:27087393

  12. Immune Regulatory Mechanisms in Allergic Conjunctivitis

    PubMed Central

    Niederkorn, Jerry Y.

    2008-01-01

    Purpose of review This review highlights recent findings regarding the immune regulation of allergic conjunctivitis (AC). Mouse models have facilitated prospective studies that have not been possible in patients. The availability of gene knockout mice and the wealth of monoclonal antibodies have permitted exquisite dissection of the pathophysiology and immune regulation of AC. Recent findings New insights have emerged in three areas: a) role of costimulatory molecules in the induction of Th2 immune responses; b) crucial role of interferon-γ (IFN-γ) in the expression of AC; and c) the function of T regulatory cells in shaping conjunctival inflammation once the immune response has been initiated. Summary Allergic conjunctivitis involves early phase and late phase reactions. The early phase reaction (EPR) is IgE antibody-dependent, while the late phase reaction (LPR) is IgE-independent and is mediated by inflammatory cells, especially eosinophils. Recent studies in mouse models of AC have provided important insights into the immune regulation of both the EPR and LPR of AC. Mounting evidence suggests that IFN-γ is crucial for optimum expression of AC. Costimulatory molecules influence the induction of Th2 immune responses and the EPR while regulatory T cells shape the expression of the LPR of AC. PMID:18769204

  13. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    PubMed Central

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-01-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution. PMID:26184971

  14. Effects of Four Different Regulatory Mechanisms on the Dynamics of Gene Regulatory Cascades

    NASA Astrophysics Data System (ADS)

    Hansen, Sabine; Krishna, Sandeep; Semsey, Szabolcs; Lo Svenningsen, Sine

    2015-07-01

    Gene regulatory cascades (GRCs) are common motifs in cellular molecular networks. A given logical function in these cascades, such as the repression of the activity of a transcription factor, can be implemented by a number of different regulatory mechanisms. The potential consequences for the dynamic performance of the GRC of choosing one mechanism over another have not been analysed systematically. Here, we report the construction of a synthetic GRC in Escherichia coli, which allows us for the first time to directly compare and contrast the dynamics of four different regulatory mechanisms, affecting the transcription, translation, stability, or activity of a transcriptional repressor. We developed a biologically motivated mathematical model which is sufficient to reproduce the response dynamics determined by experimental measurements. Using the model, we explored the potential response dynamics that the constructed GRC can perform. We conclude that dynamic differences between regulatory mechanisms at an individual step in a GRC are often concealed in the overall performance of the GRC, and suggest that the presence of a given regulatory mechanism in a certain network environment does not necessarily mean that it represents a single optimal evolutionary solution.

  15. Nitrogen fixation: key genetic regulatory mechanisms.

    PubMed

    Martinez-Argudo, I; Little, R; Shearer, N; Johnson, P; Dixon, R

    2005-02-01

    The necessity to respond to the level of fixed nitrogen and external oxygen concentrations and to provide sufficient energy for nitrogen fixation imposes common regulatory principles amongst diazotrophs. The NifL-NifA system in Azotobacter vinelandii integrates the signals of redox, fixed-nitrogen and carbon status to regulate nif transcription. Multidomain signalling interactions between NifL and NifA are modulated by redox changes, ligand binding and interaction with the signal-transduction protein GlnK. Under adverse redox conditions (excess oxygen) or when fixed nitrogen is in excess, NifL forms a complex with NifA in which transcriptional activation is prevented. Oxidized NifL forms a binary complex with NifA to inhibit NifA activity. When fixed nitrogen is in excess, the non-covalently modified form of GlnK interacts with NifL to promote the formation of a GlnK-NifL-NifA ternary complex. When the cell re-encounters favourable conditions for nitrogen fixation, it is necessary to deactivate the signals to ensure that the NifL-NifA complex is dissociated so that NifA is free to activate transcription. This is achieved through interactions with 2-oxoglutarate, a key metabolic signal of the carbon status, which binds to the N-terminal GAF (cGMP-specific and stimulated phosphodiesterases, Anabaena adenylate cyclases and Escherichia coli FhlA) domain of NifA. PMID:15667291

  16. Molecular regulatory mechanism of tooth root development

    PubMed Central

    Huang, Xiao-Feng; Chai, Yang

    2012-01-01

    The root is crucial for the physiological function of the tooth, and a healthy root allows an artificial crown to function as required clinically. Tooth crown development has been studied intensively during the last few decades, but root development remains not well understood. Here we review the root development processes, including cell fate determination, induction of odontoblast and cementoblast differentiation, interaction of root epithelium and mesenchyme, and other molecular mechanisms. This review summarizes our current understanding of the signaling cascades and mechanisms involved in root development. It also sets the stage for de novo tooth regeneration. PMID:23222990

  17. [Regulatory mechanism of circulating inorganic phosphate].

    PubMed

    Michigami, Toshimi

    2016-02-01

    Circulating level of phosphate is altered by age and diet, and is also controlled by several hormones such as parathyroid hormone(PTH), 1,25-dihydroxyvitamin D[1,25(OH)2D]and fibroblast growth factor 23(FGF23). The main function of PTH and 1,25(OH)2D is maintaining calcium homeostasis, while FGF23 plays a central role in phosphate metabolism. PTH suppresses phosphate reabsorption in the proximal tubules to increase the renal phosphate wasting, while 1,25(OH)2D facilitates the intestinal phosphate absorption. FGF23 increases the renal phosphate wasting and reduces the production of 1,25(OH)2D. Of note, these hormones mutually regulate one another. The production of FGF23 is also regulated by various local factors. The mechanism for sensing the phosphate availability still remains unknown, and further investigation is required. PMID:26813498

  18. Nucleotide sequences of the fecBCDE genes and locations of the proteins suggest a periplasmic-binding-protein-dependent transport mechanism for iron(III) dicitrate in Escherichia coli.

    PubMed Central

    Staudenmaier, H; Van Hove, B; Yaraghi, Z; Braun, V

    1989-01-01

    The fec region of the Escherichia coli chromosome determines a citrate-dependent iron(III) transport system. The nucleotide sequence of fec revealed five genes, fecABCDE, which are transcribed from fecA to fecE. The fecA gene encodes a previously described outer membrane receptor protein. The fecB gene product is formed as a precursor protein with a signal peptide of 21 amino acids; the mature form, with a molecular weight of 30,815, was previously found in the periplasm. The fecB genes of E. coli B and E. coli K-12 differed in 3 nucleotides, of which 2 gave rise to conservative amino acid exchanges. The fecC and fecD genes were found to encode very hydrophobic polypeptides with molecular weights of 35,367 and 34,148, respectively, both of which are localized in the cytoplasmic membrane. The fecE product was a rather hydrophilic but cytoplasmic membrane-bound protein of Mr 28,189 and contained regions of extensive homology to ATP-binding proteins. The number, structural characteristics, and locations of the FecBCDE proteins were typical for a periplasmic-binding-protein-dependent transport system. It is proposed that after FecA- and TonB-dependent transport of iron(III) dicitrate across the outer membrane, uptake through the cytoplasmic membrane follows the binding-protein-dependent transport mechanism. FecC and FecD exhibited homologies to each other, to the N- and C-terminal halves of FhuB of the iron(III) hydroxamate transport system, and to BtuC of the vitamin B12 transport system. FecB showed some homology to FhuD, suggesting that the latter may function in the same manner as a binding protein in iron(III) hydroxamate transport. The close homology between the proteins of the two iron transport systems and of the vitamin B12 transport system indicates a common evolution for all three systems. Images PMID:2651410

  19. Subversion of cell cycle regulatory mechanisms by HIV

    PubMed Central

    Rice, Andrew P.; Kimata, Jason T.

    2015-01-01

    To establish a productive infection, HIV-1 must counteract cellular innate immune mechanisms and redirect cellular process towards viral replication. Recent studies have discovered that HIV-1 and other primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to achieve these ends. The viral Vpr and Vpx proteins target cell cycle controls to counter innate immunity. The cell cycle-related protein Cyclin L2 is also utilized to counter innate immunity. The viral Tat protein utilizes Cyclin T1 to activated proviral transcription, and regulation of Cyclin T1 levels in CD4+ T cells has important consequences for viral replication and latency. This review will summarize this emerging evidence that primate immunodeficiency viruses subvert cell cycle regulatory mechanisms to enhance replication. PMID:26067601

  20. Regulatory mechanisms related to biofuel tolerance in producing microbes.

    PubMed

    Fu, Y; Chen, L; Zhang, W

    2016-08-01

    Production of renewable biofuels through either native or engineered microbes has drawn significant attention in recent years, mostly due to the increasing concerns on the energy crisis and the environmental consequences of the overutilization of petroleum-based fuels. Although significant progress has been achieved thus far, further advances are still necessary in order to decrease the manufacturing cost so that the producing processes can be more competitive to petroleum fuels. Among various possible approaches, the increase in biofuel tolerance in microbes has been suggested as one aspect which is important for the success of biofuel production at industry-scale. In this article, we critically summarize recent advances in deciphering regulatory mechanisms for enhancing biofuel tolerance in various micro-organisms, focusing on functions and utilization of several well-studied regulatory mechanisms in microbes, such as two-component signal transduction systems, sigma factors, transcription factors, noncoding RNA and other regulators. PMID:27123568

  1. Secretory pattern and regulatory mechanism of growth hormone in cattle.

    PubMed

    Kasuya, Etsuko

    2016-02-01

    The ultradian rhythm of growth hormone (GH) secretion has been known in several animal species for years and has recently been observed in cattle. Although the physiological significance of the rhythm is not yet fully understood, it appears essential for normal growth. In this review, previous studies concerning the GH secretory pattern in cattle, including its ultradian rhythm, are introduced and the regulatory mechanism is discussed on the basis of recent findings. PMID:26260675

  2. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes.

    PubMed

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-08-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  3. Molecular regulatory mechanisms of osteoclastogenesis through cytoprotective enzymes

    PubMed Central

    Kanzaki, Hiroyuki; Shinohara, Fumiaki; Kanako, Itohiya; Yamaguchi, Yuuki; Fukaya, Sari; Miyamoto, Yutaka; Wada, Satoshi; Nakamura, Yoshiki

    2016-01-01

    It has been reported that reactive oxygen species (ROS), such as hydrogen peroxide and superoxide, take part in osteoclast differentiation as intra-cellular signaling molecules. The current assumed signaling cascade from RANK to ROS production is RANK, TRAF6, Rac1, and then Nox. The target molecules of ROS in RANKL signaling remain unclear; however, several reports support the theory that NF-κB signaling could be the crucial downstream signaling molecule of RANKL-mediated ROS signaling. Furthermore, ROS exert cytotoxic effects such as peroxidation of lipids and phospholipids and oxidative damage to proteins and DNA. Therefore, cells have several protective mechanisms against oxidative stressors that mainly induce cytoprotective enzymes and ROS scavenging. Three well-known mechanisms regulate cytoprotective enzymes including Nrf2-, FOXO-, and sirtuin-dependent mechanisms. Several reports have indicated a crosslink between FOXO- and sirtuin-dependent regulatory mechanisms. The agonists against the regulatory mechanisms are reported to induce these cytoprotective enzymes successfully. Some of them inhibit osteoclast differentiation and bone destruction via attenuation of intracellular ROS signaling. In this review article, we discuss the above topics and summarize the current information available on the relationship between cytoprotective enzymes and osteoclastogenesis. PMID:26795736

  4. Regulatory mechanisms of EGFR signalling during Drosophila eye development.

    PubMed

    Malartre, Marianne

    2016-05-01

    EGFR signalling is a well-conserved signalling pathway playing major roles during development and cancers. This review explores what studying the EGFR pathway during Drosophila eye development has taught us in terms of the diversity of its regulatory mechanisms. This model system has allowed the identification of numerous positive and negative regulators acting at specific time and place, thus participating to the tight control of signalling. EGFR signalling regulation is achieved by a variety of mechanisms, including the control of ligand processing, the availability of the receptor itself and the transduction of the cascade in the cytoplasm. Ultimately, the transcriptional responses contribute to the establishment of positive and negative feedback loops. The combination of these multiple mechanisms employed to regulate the EGFR pathway leads to specific cellular outcomes involved in functions as diverse as the acquisition of cell fate, proliferation, survival, adherens junction remodelling and morphogenesis. PMID:26935860

  5. Molecular and Cellular Regulatory Mechanisms of Tongue Myogenesis

    PubMed Central

    Parada, C.; Han, D.; Chai, Y.

    2012-01-01

    The tongue exerts crucial functions in our daily life. However, we know very little about the regulatory mechanisms of mammalian tongue development. In this review, we summarize recent findings of the molecular and cellular mechanisms that control tissue-tissue interactions during tongue morphogenesis. Specifically, cranial neural crest cells (CNCC) lead the initiation of tongue bud formation and contribute to the interstitial connective tissue, which ultimately compartmentalizes tongue muscles and serves as their attachments. Occipital somite-derived cells migrate into the tongue primordium and give rise to muscle cells in the tongue. The intimate relationship between CNCC- and mesoderm-derived cells, as well as growth and transcription factors that have been shown to be crucial for tongue myogenesis, clearly indicate that tissue-tissue interactions play an important role in regulating tongue morphogenesis. PMID:22219210

  6. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  7. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  8. The Molecular Mechanisms of Regulatory T Cell Immunosuppression

    PubMed Central

    Pandiyan, Pushpa; Zheng, Lixin; Lenardo, Michael J.

    2011-01-01

    CD4+CD25+Foxp3+ T lymphocytes, known as regulatory T cells or Tregs, have been proposed to be a lineage of professional immune suppressive cells that exclusively counteract the effects of the immunoprotective “helper” and “cytotoxic” lineages of T lymphocytes. Here we discuss new concepts on the mechanisms and functions of Tregs. There are several key points we emphasize: 1. Tregs exert suppressive effects both directly on effector T cells and indirectly through antigen-presenting cells; 2. Regulation can occur through a novel mechanism of cytokine consumption to regulate as opposed to the usual mechanism of cytokine/chemokine production; 3. In cases where CD4+ effector T cells are directly inhibited by Tregs, it is chiefly through a mechanism of lymphokine withdrawal apoptosis leading to polyclonal deletion; and 4. Contrary to the current view, we discuss new evidence that Tregs, similar to other T-cells lineages, can promote protective immune responses in certain infectious contexts (Chen et al., 2011; Pandiyan et al., 2011). Although these points are at variance to varying degrees with the standard model of Treg behavior, we will recount developing findings that support these new concepts. PMID:22566849

  9. The prion hypothesis: from biological anomaly to basic regulatory mechanism

    PubMed Central

    Tuite, Mick F; Serio, Tricia R

    2010-01-01

    Preface Prions are unusual proteinaceous infectious agents that are typically associated with a class of fatal degenerative diseases of the mammalian brain. However, the discovery of fungal prions, which are not associated with disease, suggests that we must now consider the impact of these factors on basic cellular physiology in a different light. Fungal prions are epigenetic determinants that can alter a range of cellular processes, including metabolism and gene expression pathways, and these changes can lead to a range of prion-associated phenotypes. The mechanistic similarities between prion propagation in mammals and fungi suggest that prions are not a biological anomaly but instead are a new appreciated and perhaps ubiquitous regulatory mechanism. PMID:21081963

  10. Emerging regulatory mechanisms in ubiquitin-dependent cell cycle control

    PubMed Central

    Mocciaro, Annamaria; Rape, Michael

    2012-01-01

    The covalent modification of proteins with ubiquitin is required for accurate cell division in all eukaryotes. Ubiquitylation depends on an enzymatic cascade, in which E3 enzymes recruit specific substrates for modification. Among ~600 human E3s, the SCF (Skp1–cullin1–F-box) and the APC/C (anaphase-promoting complex/cyclosome) are known for driving the degradation of cell cycle regulators to accomplish irreversible cell cycle transitions. The cell cycle machinery reciprocally regulates the SCF and APC/C through various mechanisms, including the modification of these E3s or the binding of specific inhibitors. Recent studies have provided new insight into the intricate relationship between ubiquitylation and the cell division apparatus as they revealed roles for atypical ubiquitin chains, new mechanisms of substrate and E3 regulation, as well as extensive crosstalk between ubiquitylation enzymes. Here, we review these emerging regulatory mechanisms of ubiquitin-dependent cell cycle control and discuss how their manipulation might provide therapeutic benefits in the future. PMID:22357967

  11. Mechanisms of regulatory volume increase in collecting duct cells.

    PubMed

    Fu, W J; Kuwahara, M; Cragoe, E J; Marumo, F

    1993-01-01

    To examine the mechanisms of cell volume regulation in response to hyperosmolality, segments of the inner stripe of rabbit outer medullary collecting duct (OMCDi) were perfused in vitro. The cross-sectional area of the tubule was monitored as an index of the relative cell volume. When luminal and basolateral osmolalities were increased from 290 to 390 mOsm simultaneously, the tubule cell shrank instantaneously and reswelled gradually, showing the so-called regulatory volume increase (RVI). Basolateral Na+ removal and addition of basolateral ethyl isopropyl amiloride (EIPA) decreased the RVI response by 76 and 66%, respectively. By contrast, apical Na+ removal had no effect on this response. RVI response was also inhibited by basolateral, but not luminal, Cl- removal (-63%), by total HCO3- removal (-74%), and by adding basolateral 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS) (-62%). Intracellular pH did not change significantly during RVI. Vasopressin increased RVI response by 56%. However, this increase was abolished in the absence of basolateral Na+ and Cl-, and in the presence of basolateral EIPA and DIDS. These results suggest that major mechanisms responsible for RVI are Na(+)-H+ and Cl(-)-HCO3- exchange systems in the basolateral membrane, and that these systems are stimulated by vasopressin in rabbit OMCDi. PMID:8007444

  12. T-cell regulatory mechanisms in specific immunotherapy.

    PubMed

    Jutel, Marek; Akdis, Cezmi A

    2008-01-01

    Allergen-specific immunotherapy (SIT) is the only treatment which leads to a lifelong tolerance against previously disease-causing allergens due to restoration of normal immunity against allergens. The description of T-regulatory (Treg) cells being involved in prevention of sensitization to allergens has led to great interest whether they represent a major target for allergen-SIT and whether it would be possible to manipulate Treg cells to increase its efficacy. Activationinduced cell death, anergy and/or immune response modulation by Treg cells are essential mechanisms of peripheral T-cell tolerance. There is growing evidence that anergy, tolerance and active suppression are not entirely distinct, but rather represent linked mechanisms possibly involving the same cells and multiple suppressor mechanisms. Skewing of allergen-specific effector T cells to Treg cells appears as a crucial event in the control of healthy immune response to allergens and successful allergen-SIT. The Treg cell response is characterized by abolished allergen- induced specific T-cell proliferation and suppressed Thelper (Th)1- and Th2-type cytokine secretion. In addition, mediators of allergic inflammation that trigger cAMP-associated G-protein-coupled receptors, such as histamine receptor-2, may contribute to peripheral tolerance mechanisms. The increased levels of interleukin-10 and transforming growth factor-Beta that are produced by Treg cells potently suppress IgE production, while simultaneously increasing production of non-inflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress effector cells of allergic inflammation such as mast cells, basophils and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms. It is associated with regulation of antibody isotypes and effector cells to the direction of a healthy immune response. By the application of the recent knowledge in Treg

  13. Redox-switch regulatory mechanism of thiolase from Clostridium acetobutylicum

    PubMed Central

    Kim, Sangwoo; Jang, Yu-Sin; Ha, Sung-Chul; Ahn, Jae-Woo; Kim, Eun-Jung; Hong Lim, Jae; Cho, Changhee; Shin Ryu, Yong; Kuk Lee, Sung; Lee, Sang Yup; Kim, Kyung-Jin

    2015-01-01

    Thiolase is the first enzyme catalysing the condensation of two acetyl-coenzyme A (CoA) molecules to form acetoacetyl-CoA in a dedicated pathway towards the biosynthesis of n-butanol, an important solvent and biofuel. Here we elucidate the crystal structure of Clostridium acetobutylicum thiolase (CaTHL) in its reduced/oxidized states. CaTHL, unlike those from other aerobic bacteria such as Escherichia coli and Zoogloea ramegera, is regulated by the redox-switch modulation through reversible disulfide bond formation between two catalytic cysteine residues, Cys88 and Cys378. When CaTHL is overexpressed in wild-type C. acetobutylicum, butanol production is reduced due to the disturbance of acidogenic to solventogenic shift. The CaTHLV77Q/N153Y/A286K mutant, which is not able to form disulfide bonds, exhibits higher activity than wild-type CaTHL, and enhances butanol production upon overexpression. On the basis of these results, we suggest that CaTHL functions as a key enzyme in the regulation of the main metabolism of C. acetobutylicum through a redox-switch regulatory mechanism. PMID:26391388

  14. The Cellular and Molecular Mechanisms of Immuno-Suppression by Human Type 1 Regulatory T Cells

    PubMed Central

    Gregori, Silvia; Goudy, Kevin S.; Roncarolo, Maria Grazia

    2011-01-01

    The immuno-regulatory mechanisms of IL-10-producing type 1 regulatory T (Tr1) cells have been widely studied over the years. However, several recent discoveries have shed new light on the cellular and molecular mechanisms that human Tr1 cells use to control immune responses and induce tolerance. In this review we outline the well known and newly discovered regulatory properties of human Tr1 cells and provide an in-depth comparison of the known suppressor mechanisms of Tr1 cells with FOXP3+ Treg. We also highlight the role that Tr1 cells play in promoting and maintaining tolerance in autoimmunity, allergy, and transplantation. PMID:22566914

  15. Modeling Transport and Flow Regulatory Mechanisms of the Kidney

    PubMed Central

    Layton, Anita T.

    2013-01-01

    The kidney plays an indispensable role in the regulation of whole-organism water balance, electrolyte balance, and acid-base balance, and in the excretion of metabolic wastes and toxins. In this paper, we review representative mathematical models that have been developed to better understand kidney physiology and pathophysiology, including the regulation of glomerular filtration, the regulation of renal blood flow by means of the tubuloglomerular feedback mechanisms and of the myogenic mechanism, the urine concentrating mechanism, and regulation of renal oxygen transport. We discuss how such modeling efforts have significantly expanded our understanding of renal function in both health and disease. PMID:23914303

  16. Structural imprints in vivo decode RNA regulatory mechanisms

    NASA Astrophysics Data System (ADS)

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-03-01

    Visualizing the physical basis for molecular behaviour inside living cells is a great challenge for biology. RNAs are central to biological regulation, and the ability of RNA to adopt specific structures intimately controls every step of the gene expression program. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles include only two of the four nucleotides that make up RNA. Here we present a novel biochemical approach, in vivo click selective 2'-hydroxyl acylation and profiling experiment (icSHAPE), which enables the first global view, to our knowledge, of RNA secondary structures in living cells for all four bases. icSHAPE of the mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguish different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro conditions, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA-binding proteins or RNA-modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression.

  17. Structural imprints in vivo decode RNA regulatory mechanisms

    PubMed Central

    Spitale, Robert C.; Flynn, Ryan A.; Zhang, Qiangfeng Cliff; Crisalli, Pete; Lee, Byron; Jung, Jong-Wha; Kuchelmeister, Hannes Y.; Batista, Pedro J.; Torre, Eduardo A.; Kool, Eric T.; Chang, Howard Y.

    2015-01-01

    Visualizing the physical basis for molecular behavior inside living cells is a grand challenge in biology. RNAs are central to biological regulation, and RNA’s ability to adopt specific structures intimately controls every step of the gene expression program1. However, our understanding of physiological RNA structures is limited; current in vivo RNA structure profiles view only two of four nucleotides that make up RNA2,3. Here we present a novel biochemical approach, In Vivo Click SHAPE (icSHAPE), that enables the first global view of RNA secondary structures of all four bases in living cells. icSHAPE of mouse embryonic stem cell transcriptome versus purified RNA folded in vitro shows that the structural dynamics of RNA in the cellular environment distinguishes different classes of RNAs and regulatory elements. Structural signatures at translational start sites and ribosome pause sites are conserved from in vitro, suggesting that these RNA elements are programmed by sequence. In contrast, focal structural rearrangements in vivo reveal precise interfaces of RNA with RNA binding proteins or RNA modification sites that are consistent with atomic-resolution structural data. Such dynamic structural footprints enable accurate prediction of RNA-protein interactions and N6-methyladenosine (m6A) modification genome-wide. These results open the door for structural genomics of RNA in living cells and reveal key physiological structures controlling gene expression. PMID:25799993

  18. Transcription factor-microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome

    PubMed Central

    LIU, HAI-YING; HUANG, YU-LING; LIU, JIAN-QIAO; HUANG, QING

    2016-01-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5–11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF-microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS-associated TF-microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir-355-5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF-microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  19. Transcription factor‑microRNA synergistic regulatory network revealing the mechanism of polycystic ovary syndrome.

    PubMed

    Liu, Hai-Ying; Huang, Yu-Ling; Liu, Jian-Qiao; Huang, Qing

    2016-05-01

    Polycystic ovary syndrome (PCOS) is the most common type of endocrine disorder, affecting 5‑11% of women of reproductive age worldwide. Transcription factors (TFs) and microRNAs are considered to have crucial roles in the developmental process of several diseases and have synergistic regulatory actions. However, the effects of TFs and microRNAs, and the patterns of their cooperation in the synergistic regulatory network of PCOS, remain to be elucidated. The present study aimed to determine the possible mechanism of PCOS, based on a TF‑microRNA synergistic regulatory network. Initially, the differentially expressed genes (DEGs) in PCOS were identified using microarray data of the GSE34526 dataset. Subsequently, the TFs and microRNAs which regulated the DEGs of PCOS were identified, and a PCOS‑associated TF‑microRNA synergistic regulatory network was constructed. This network included 195 DEGs, 136 TFs and 283 microRNAs, and the DEGs were regulated by TFs and microRNAs. Based on topological and functional enrichment analyses, SP1, mir‑355‑5p and JUN were identified as potentially crucial regulators in the development of PCOS and in characterizing the regulatory mechanism. In conclusion, the TF‑microRNA synergistic regulatory network constructed in the present study provides novel insight on the molecular mechanism of PCOS in the form of synergistic regulated model. PMID:27035648

  20. Translational regulatory mechanisms in persistent forms of synaptic plasticity.

    PubMed

    Kelleher, Raymond J; Govindarajan, Arvind; Tonegawa, Susumu

    2004-09-30

    Memory and synaptic plasticity exhibit distinct temporal phases, with long-lasting forms distinguished by their dependence on macromolecular synthesis. Prevailing models for the molecular mechanisms underlying long-lasting synaptic plasticity have largely focused on transcriptional regulation. However, a growing body of evidence now supports a crucial role for neuronal activity-dependent mRNA translation, which may occur in dendrites for a subset of neuronal mRNAs. Recent work has begun to define the signaling mechanisms coupling synaptic activation to the protein synthesis machinery. The ERK and mTOR signaling pathways have been shown to regulate the activity of the general translational machinery, while the translation of particular classes of mRNAs is additionally controlled by gene-specific mechanisms. Rapid enhancement of the synthesis of a diverse array of neuronal proteins through such mechanisms provides the components necessary for persistent forms of LTP and LTD. These findings have important implications for the synapse specificity and associativity of protein synthesis-dependent changes in synaptic strength. PMID:15450160

  1. Potential self-regulatory mechanisms of yoga for psychological health

    PubMed Central

    Gard, Tim; Noggle, Jessica J.; Park, Crystal L.; Vago, David R.; Wilson, Angela

    2014-01-01

    Research suggesting the beneficial effects of yoga on myriad aspects of psychological health has proliferated in recent years, yet there is currently no overarching framework by which to understand yoga’s potential beneficial effects. Here we provide a theoretical framework and systems-based network model of yoga that focuses on integration of top-down and bottom-up forms of self-regulation. We begin by contextualizing yoga in historical and contemporary settings, and then detail how specific components of yoga practice may affect cognitive, emotional, behavioral, and autonomic output under stress through an emphasis on interoception and bottom-up input, resulting in physical and psychological health. The model describes yoga practice as a comprehensive skillset of synergistic process tools that facilitate bidirectional feedback and integration between high- and low-level brain networks, and afferent and re-afferent input from interoceptive processes (somatosensory, viscerosensory, chemosensory). From a predictive coding perspective we propose a shift to perceptual inference for stress modulation and optimal self-regulation. We describe how the processes that sub-serve self-regulation become more automatized and efficient over time and practice, requiring less effort to initiate when necessary and terminate more rapidly when no longer needed. To support our proposed model, we present the available evidence for yoga affecting self-regulatory pathways, integrating existing constructs from behavior theory and cognitive neuroscience with emerging yoga and meditation research. This paper is intended to guide future basic and clinical research, specifically targeting areas of development in the treatment of stress-mediated psychological disorders. PMID:25368562

  2. The beginning of a seed: regulatory mechanisms of double fertilization

    PubMed Central

    Bleckmann, Andrea; Alter, Svenja; Dresselhaus, Thomas

    2014-01-01

    The launch of seed development in flowering plants (angiosperms) is initiated by the process of double fertilization: two male gametes (sperm cells) fuse with two female gametes (egg and central cell) to form the precursor cells of the two major seed components, the embryo and endosperm, respectively. The immobile sperm cells are delivered by the pollen tube toward the ovule harboring the female gametophyte by species-specific pollen tube guidance and attraction mechanisms. After pollen tube burst inside the female gametophyte, the two sperm cells fuse with the egg and central cell initiating seed development. The fertilized central cell forms the endosperm while the fertilized egg cell, the zygote, will form the actual embryo and suspensor. The latter structure connects the embryo with the sporophytic maternal tissues of the developing seed. The underlying mechanisms of double fertilization are tightly regulated to ensure delivery of functional sperm cells and the formation of both, a functional zygote and endosperm. In this review we will discuss the current state of knowledge about the processes of directed pollen tube growth and its communication with the synergid cells resulting in pollen tube burst, the interaction of the four gametes leading to cell fusion and finally discuss mechanisms how flowering plants prevent multiple sperm cell entry (polyspermy) to maximize their reproductive success. PMID:25309552

  3. Genetic control and regulatory mechanisms of succinoglycan and curdlan biosynthesis in genus Agrobacterium.

    PubMed

    Wu, Dan; Li, Ang; Ma, Fang; Yang, Jixian; Xie, Yutong

    2016-07-01

    Agrobacterium is a genus of gram-negative bacteria that can produce several typical exopolysaccharides with commercial uses in the food and pharmaceutical fields. In particular, succinoglycan and curdlan, due to their good quality in high yield, have been employed on an industrial scale comparatively early. Exopolysaccharide biosynthesis is a multiple-step process controlled by different functional genes, and various environmental factors cause changes in exopolysaccharide biosynthesis through regulatory mechanisms. In this mini-review, we focus on the genetic control and regulatory mechanisms of succinoglycan and curdlan produced by Agrobacterium. Some key functional genes and regulatory mechanisms for exopolysaccharide biosynthesis are described, possessing a high potential for application in metabolic engineering to modify exopolysaccharide production and physicochemical properties. This review may contribute to the understanding of exopolysaccharide biosynthesis and exopolysaccharide modification by metabolic engineering methods in Agrobacterium. PMID:27255488

  4. Structure of the TRPA1 ion channel suggests regulatory mechanisms

    PubMed Central

    Paulsen, Candice E.; Armache, Jean-Paul; Gao, Yuan; Cheng, Yifan; Julius, David

    2015-01-01

    The TRPA1 ion channel (a.k.a the ‘wasabi receptor’) is a detector of noxious chemical agents encountered in our environment or produced endogenously during tissue injury or drug metabolism. These include a broad class of electrophiles that activate the channel through covalent protein modification. TRPA1 antagonists hold potential for treating neurogenic inflammatory conditions provoked or exacerbated by irritant exposure. Despite compelling reasons to understand TRPA1 function, structural mechanisms underlying channel regulation remain obscure. Here, we use single-particle electron cryo-microscopy to determine the structure of full-length human TRPA1 to ~4Å resolution in the presence of pharmacophores, including a potent antagonist. A number of unexpected features are revealed, including an extensive coiled-coil assembly domain stabilized by polyphosphate co-factors and a highly integrated nexus that converges on an unpredicted TRP-like allosteric domain. These findings provide novel insights into mechanisms of TRPA1 regulation, and establish a blueprint for structure-based design of analgesic and anti-inflammatory agents. PMID:25855297

  5. Ser/Thr phosphorylation as a regulatory mechanism in bacteria

    PubMed Central

    Dworkin, Jonathan

    2015-01-01

    This review will discuss some recent work describing the role of Ser/Thr phosphorylation as a post-translational mechanism of regulation in bacteria. I will discuss the interaction between bacterial eukaryotic-like Ser/Thr kinases (eSTKs) and two-component systems as well as hints as to physiological function of eSTKs and their cognate eukaryotic-like phosphatases (eSTPs). In particular, I will highlight the role of eSTKs and eSTPs in the regulation of peptidoglycan metabolism and protein synthesis. In addition, I will discuss how data from phosphoproteomic surveys suggests that Ser/Thr phosphorylation plays a much more significant physiological role than would be predicted simply based on in vivo and in vitro analyses of individual kinases. PMID:25625314

  6. Gap junction-mediated electrical transmission: regulatory mechanisms and plasticity

    PubMed Central

    Pereda, Alberto E.; Curti, Sebastian; Hoge, Gregory; Cachope, Roger; Flores, Carmen E.; Rash, John E.

    2012-01-01

    The term synapse applies to cellular specializations that articulate the processing of information within neural circuits by providing a mechanism for the transfer of information between two different neurons. There are two main modalities of synaptic transmission: chemical and electrical. While most efforts have been dedicated to the understanding of the properties and modifiability of chemical transmission, less is still known regarding the plastic properties of electrical synapses, whose structural correlate is the gap junction. A wealth of data indicates that, rather than passive intercellular channels, electrical synapses are more dynamic and modifiable than was generally perceived. This article will discuss the factors determining the strength of electrical transmission and review current evidence demonstrating its dynamic properties. Like their chemical counterparts, electrical synapses can also be plastic and modifiable. PMID:22659675

  7. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus

    PubMed Central

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  8. Novel RNA regulatory mechanisms revealed in the epitranscriptome.

    PubMed

    Saletore, Yogesh; Chen-Kiang, Selina; Mason, Christopher E

    2013-03-01

    Methyl-6-adenosine (m (6)A) has been hypothesized to exist since the 1970s, (1) but little has been known about the specific RNAs, or sites within them, that are affected by this RNA modification. Here, we report that recent work has shown RNA modifications like m (6)A, collectively called the "epitranscriptome," are a pervasive feature of mammalian cells and likely play a role in development and disease. An enrichment of m (6)A near the last CDS of thousands of genes has implicated m (6)A in transcript processing, translational regulation and potentially a mechanism for regulating miRNA maturation. Also, because the sites of m (6)A show strong evolutionary conservation and have been replicated in nearly identical sites between mouse and human, strong evolutionary pressures are likely being maintained for this mark. (2)(,) (3) Finally, we note that m (6)A is one of over 100 modifications of RNA that have been reported, (4) and with the combination of high-throughput, next-generation sequencing (NGS) techniques, immunoprecipitation with appropriate antibodies and splicing-aware peak-finding, the dynamics of the epitranscriptome can now be mapped and characterized to discern their specific cellular roles. PMID:23434792

  9. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  10. Transcriptional and Epigenetic Regulatory Mechanisms Affecting HTLV-1 Provirus.

    PubMed

    Miyazato, Paola; Matsuo, Misaki; Katsuya, Hiroo; Satou, Yorifumi

    2016-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is a retrovirus associated with human diseases, such as adult T-cell leukemia (ATL) and HTLV-1-associated myelopathy/Tropic spastic paraparesis (HAM/TSP). As a retrovirus, its life cycle includes a step where HTLV-1 is integrated into the host genomic DNA and forms proviral DNA. In the chronic phase of the infection, HTLV‑1 is known to proliferate as a provirus via the mitotic division of the infected host cells. There are generally tens of thousands of infected clones within an infected individual. They exist not only in peripheral blood, but also in various lymphoid organs. Viral proteins encoded in HTLV-1 genome play a role in the proliferation and survival of the infected cells. As is the case with other chronic viral infections, HTLV-1 gene expression induces the activation of the host immunity against the virus. Thus, the transcription from HTLV-1 provirus needs to be controlled in order to evade the host immune surveillance. There should be a dynamic and complex regulation in vivo, where an equilibrium between viral antigen expression and host immune surveillance is achieved. The mechanisms regulating viral gene expression from the provirus are a key to understanding the persistent/latent infection with HTLV-1 and its pathogenesis. In this article, we would like to review our current understanding on this topic. PMID:27322309

  11. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  12. Multiple regulatory mechanisms in the chloroplast of green algae: relation to hydrogen production.

    PubMed

    Antal, Taras K; Krendeleva, Tatyana E; Tyystjärvi, Esa

    2015-09-01

    A complex regulatory network in the chloroplast of green algae provides an efficient tool for maintenance of energy and redox balance in the cell under aerobic and anaerobic conditions. In this review, we discuss the structural and functional organizations of electron transport pathways in the chloroplast, and regulation of photosynthesis in the green microalga Chlamydomonas reinhardtii. The focus is on the regulatory mechanisms induced in response to nutrient deficiency stress and anoxia and especially on the role of a hydrogenase-mediated reaction in adaptation to highly reducing conditions and ATP deficiency in the cell. PMID:25986411

  13. Control and regulatory mechanisms associated with thermogenesis in flying insects and birds.

    PubMed

    Loli, Denise; Bicudo, José Eduardo P W

    2005-01-01

    Most insects and birds are able to fly. The chitin made exoskeleton of insects poses them several constraints, and this is one the reasons they are in general small sized animals. On the other hand, because birds possess an endoskeleton made of bones they may grow much larger when compared to insects. The two taxa are quite different with regards to their general "design" platform, in particular with respect to their respiratory and circulatory systems. However, because they fly, they may share in common several traits, namely those associated with the control and regulatory mechanisms governing thermogenesis. High core temperatures are essential for animal flight irrespective of the taxa they belong to. Birds and insects have thus evolved mechanisms which allowed them to control and regulate high rates of heat fluxes. This article discusses possible convergent thermogenic control and regulatory mechanisms associated with flight in insects and birds. PMID:16283551

  14. Regulatory mechanisms of immune tolerance in type 1 diabetes and their failures.

    PubMed

    Kuhn, Chantal; Besançon, Alix; Lemoine, Sébastien; You, Sylvaine; Marquet, Cindy; Candon, Sophie; Chatenoud, Lucienne

    2016-07-01

    In this brief review we propose to discuss salient data showing the importance of immune regulatory mechanisms, and in particular of Treg, for the control of pathogenic anti-β-cell response in autoimmune diabetes. Disease progression that culminates with the massive destruction of insulin-secreting β-cells and advent of hyperglycemia and glycosuria tightly correlates with a functional deficit in immune regulation. Better dissection of the cellular and molecular mechanisms through which the immune system normally sustains tolerance to "self", and which become defective when autoimmune aggression is overt, is the only direct and robust way to learn how to harness these effectively, so as to restore immune tolerance in patients with insulin-dependent type 1 diabetes. No doubt that regulatory T cells are a privileged mechanism underlying this self-tolerance in the periphery. The discovery of the key role of the transcription factor FoxP3, represented the cornerstone leading to the great advances in the field we are witnessing today. Type 1 diabetes is certainly one of the prototypic T cell-mediated autoimmune diseases where immune regulatory mechanisms relying on specialized subsets of T cells have been the most thoroughly analyzed from the fundamental point of view and also largely exploited in a translational therapeutic perspective. PMID:27216249

  15. Modeling the Regulatory Mechanisms by Which NLRX1 Modulates Innate Immune Responses to Helicobacter pylori Infection

    PubMed Central

    Philipson, Casandra W.; Bassaganya-Riera, Josep; Viladomiu, Monica; Kronsteiner, Barbara; Abedi, Vida; Hoops, Stefan; Michalak, Pawel; Kang, Lin; Girardin, Stephen E.; Hontecillas, Raquel

    2015-01-01

    Helicobacter pylori colonizes half of the world’s population as the dominant member of the gastric microbiota resulting in a lifelong chronic infection. Host responses toward the bacterium can result in asymptomatic, pathogenic or even favorable health outcomes; however, mechanisms underlying the dual role of H. pylori as a commensal versus pathogenic organism are not well characterized. Recent evidence suggests mononuclear phagocytes are largely involved in shaping dominant immunity during infection mediating the balance between host tolerance and succumbing to overt disease. We combined computational modeling, bioinformatics and experimental validation in order to investigate interactions between macrophages and intracellular H. pylori. Global transcriptomic analysis on bone marrow-derived macrophages (BMDM) in a gentamycin protection assay at six time points unveiled the presence of three sequential host response waves: an early transient regulatory gene module followed by sustained and late effector responses. Kinetic behaviors of pattern recognition receptors (PRRs) are linked to differential expression of spatiotemporal response waves and function to induce effector immunity through extracellular and intracellular detection of H. pylori. We report that bacterial interaction with the host intracellular environment caused significant suppression of regulatory NLRC3 and NLRX1 in a pattern inverse to early regulatory responses. To further delineate complex immune responses and pathway crosstalk between effector and regulatory PRRs, we built a computational model calibrated using time-series RNAseq data. Our validated computational hypotheses are that: 1) NLRX1 expression regulates bacterial burden in macrophages; and 2) early host response cytokines down-regulate NLRX1 expression through a negative feedback circuit. This paper applies modeling approaches to characterize the regulatory role of NLRX1 in mechanisms of host tolerance employed by macrophages to

  16. Type 1 regulatory T cells: a new mechanism of peripheral immune tolerance.

    PubMed

    Zeng, Hanyu; Zhang, Rong; Jin, Boquan; Chen, Lihua

    2015-09-01

    The lack of immune response to an antigen, a process known as immune tolerance, is essential for the preservation of immune homeostasis. To date, two mechanisms that drive immune tolerance have been described extensively: central tolerance and peripheral tolerance. Under the new nomenclature, thymus-derived regulatory T (tT(reg)) cells are the major mediators of central immune tolerance, whereas peripherally derived regulatory T (pT(reg)) cells function to regulate peripheral immune tolerance. A third type of T(reg) cells, termed iT(reg), represents only the in vitro-induced T(reg) cells(1). Depending on whether the cells stably express Foxp3, pT(reg), and iT(reg) cells may be divided into two subsets: the classical CD4(+)Foxp3(+) T(reg) cells and the CD4(+)Foxp3(-) type 1 regulatory T (Tr1) cells(2). This review focuses on the discovery, associated biomarkers, regulatory functions, methods of induction, association with disease, and clinical trials of Tr1 cells. PMID:26051475

  17. Metabolic and transcriptional regulatory mechanisms underlying the anoxic adaptation of rice coleoptile.

    PubMed

    Lakshmanan, Meiyappan; Mohanty, Bijayalaxmi; Lim, Sun-Hyung; Ha, Sun-Hwa; Lee, Dong-Yup

    2014-01-01

    The ability of rice to germinate under anoxia by extending the coleoptile is a highly unusual characteristic and a key feature underpinning the ability of rice seeds to establish in such a stressful environment. The process has been a focal point for research for many years. However, the molecular mechanisms underlying the anoxic growth of the coleoptile still remain largely unknown. To unravel the key regulatory mechanisms of rice germination under anoxic stress, we combined in silico modelling with gene expression data analysis. Our initial modelling analysis via random flux sampling revealed numerous changes in rice primary metabolism in the absence of oxygen. In particular, several reactions associated with sucrose metabolism and fermentation showed a significant increase in flux levels, whereas reaction fluxes across oxidative phosphorylation, the tricarboxylic acid cycle and the pentose phosphate pathway were down-regulated. The subsequent comparative analysis of the differences in calculated fluxes with previously published gene expression data under air and anoxia identified at least 37 reactions from rice central metabolism that are transcriptionally regulated. Additionally, cis-regulatory content analyses of these transcriptionally controlled enzymes indicate a regulatory role for transcription factors such as MYB, bZIP, ERF and ZnF in transcriptional control of genes that are up-regulated during rice germination and coleoptile elongation under anoxia. PMID:24894389

  18. A SerpinB1 regulatory mechanism is essential for restricting NETosis

    PubMed Central

    Farley, Kalamo; Stolley, J Michael; Zhao, Picheng; Cooley, Jessica; Remold-O’Donnell, Eileen

    2014-01-01

    NETosis (NET generation), a programmed death pathway initiated in mature neutrophils by pathogens and inflammatory mediators, can be a protective process that sequesters microbes and prevents spread of infection, but can also be a pathological process that causes inflammation and serious tissue injury. Little is known about the regulatory mechanism. Previously we demonstrated that serpinb1-deficient mice are highly susceptible to pulmonary bacterial and viral infections due to inflammation and tissue injury associated with increased neutrophilic death. Here we used in vitro and in vivo approaches to investigate whether SerpinB1 regulates NETosis. We found that serpinb1-deficient bone marrow and lung neutrophils are hyper-susceptible to NETosis induced by multiple mediators in both NADPH-dependent and independent manner, indicating a deeply rooted regulatory role in NETosis. This role is further supported by increased nuclear expansion (representing chromatin decondensation) of PMA-treated serpinb-1-deficient neutrophils compared to wild-type, by migration of SerpinB1 from the cytoplasm to the nucleus of human neutrophils coincident with, or before, early conversion of lobulated (segmented) nuclei to delobulated (spherical) morphology, and by finding that exogenous rSerpinB1 abrogates NET production. NETosis of serpinb1-deficient neutrophils is also increased in vivo during Pseudomonas aeruginosa lung infection. The findings identify a previously unrecognized regulatory mechanism involving SerpinB1 that restricts the production of NETs. PMID:23002442

  19. Novel Regulatory Mechanisms of Pathogenicity and Virulence to Combat MDR in Candida albicans

    PubMed Central

    Hameed, Saif; Fatima, Zeeshan

    2013-01-01

    Continuous deployment of antifungals in treating infections caused by dimorphic opportunistic pathogen Candida albicans has led to the emergence of drug resistance resulting in cross-resistance to many unrelated drugs, a phenomenon termed multidrug resistance (MDR). Despite the current understanding of major factors which contribute to MDR mechanisms, there are many lines of evidence suggesting that it is a complex interplay of multiple factors which may be contributed by still unknown mechanisms. Coincidentally with the increased usage of antifungal drugs, the number of reports for antifungal drug resistance has also increased which further highlights the need for understanding novel molecular mechanisms which can be explored to combat MDR, namely, ROS, iron, hypoxia, lipids, morphogenesis, and transcriptional and signaling networks. Considering the worrying evolution of MDR and significance of C. albicans being the most prevalent human fungal pathogen, this review summarizes these new regulatory mechanisms which could be exploited to prevent MDR development in C. albicans as established from recent studies. PMID:24163696

  20. Multiple posttranscriptional regulatory mechanisms partner to control ethanolamine utilization in Enterococcus faecalis

    PubMed Central

    Fox, Kristina A.; Ramesh, Arati; Stearns, Jennifer E.; Bourgogne, Agathe; Reyes-Jara, Angelica; Winkler, Wade C.; Garsin, Danielle A.

    2009-01-01

    Ethanolamine, a product of the breakdown of phosphatidylethanolamine from cell membranes, is abundant in the human intestinal tract and in processed foods. Effective utilization of ethanolamine as a carbon and nitrogen source may provide a survival advantage to bacteria that inhabit the gastrointestinal tract and may influence the virulence of pathogens. In this work, we describe a unique series of posttranscriptional regulatory strategies that influence expression of ethanolamine utilization genes (eut) in Enterococcus, Clostridium, and Listeria species. One of these mechanisms requires an unusual 2-component regulatory system. Regulation involves specific sensing of ethanolamine by a sensor histidine kinase (EutW), resulting in autophosphorylation and subsequent phosphoryl transfer to a response regulator (EutV) containing a RNA-binding domain. Our data suggests that EutV is likely to affect downstream gene expression by interacting with conserved transcription termination signals located within the eut locus. Breakdown of ethanolamine requires adenosylcobalamin (AdoCbl) as a cofactor, and, intriguingly, we also identify an intercistronic AdoCbl riboswitch that has a predicted structure different from previously established AdoCbl riboswitches. We demonstrate that association of AdoCbl to this riboswitch prevents formation of an intrinsic transcription terminator element located within the intercistronic region. Together, these results suggest an intricate and carefully coordinated interplay of multiple regulatory strategies for control of ethanolamine utilization genes. Gene expression appears to be directed by overlapping posttranscriptional regulatory mechanisms, each responding to a particular metabolic signal, conceptually akin to regulation by multiple DNA-binding transcription factors. PMID:19246383

  1. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.

    PubMed

    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang

    2015-11-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  2. Identification of genes involved in regulatory mechanism of pigments in broiler chickens.

    PubMed

    Tarique, T M; Yang, S; Mohsina, Z; Qiu, J; Yan, Z; Chen, G; Chen, A

    2014-01-01

    Chicken is an important model organism that unites the evolutionary gap between mammals and other vertebrates and provide major source of protein from meat and eggs for all over the world population. However, specific genes underlying the regulatory mechanism of broiler pigmentation have not yet been determined. In order to better understand the genes involved in the mechanism of pigmentation in the muscle tissues of broilers, the Affymetrix microarray hybridization experiment platform was used to identify gene expression profiles at 7 weeks of age. Broilers fed canthaxanthin, natural lutein, and orangeII pigments (100 mg/kg) were used to explore gene expression profiles). Our data showed that the 7th week of age was a very important phase with regard to gene expression profiles. We identified a number of differentially expressed genes; in canthaxanthin, natural lutein, and orangeII, there were 54 (32 upregulated and 22 downregulated), 23 (15 upregulated and 8 downregulated), and 7 (5 upregulated and 2 downregulated) known genes, respectively. Our data indicate that the numbers of differentially expressed genes were more upregulated than downregulated, and several genes showed conserved signaling to previously known functions. Thus, functional characterization of differentially expressed genes revealed several categories that are involved in important biological processes, including pigmentation, growth, molecular mechanisms, fat metabolism, cell proliferation, immune response, lipid metabolism, and protein synthesis and degradation. The results of the present study demonstrate that the genes associated with canthaxanthin, natural lutein, and orangeII are key regulatory genes that control the regulatory mechanisms of pigmentation. PMID:25222226

  3. USP1 deubiquitinase: cellular functions, regulatory mechanisms and emerging potential as target in cancer therapy

    PubMed Central

    2013-01-01

    Reversible protein ubiquitination is emerging as a key process for maintaining cell homeostasis, and the enzymes that participate in this process, in particular E3 ubiquitin ligases and deubiquitinases (DUBs), are increasingly being regarded as candidates for drug discovery. Human DUBs are a group of approximately 100 proteins, whose cellular functions and regulatory mechanisms remain, with some exceptions, poorly characterized. One of the best-characterized human DUBs is ubiquitin-specific protease 1 (USP1), which plays an important role in the cellular response to DNA damage. USP1 levels, localization and activity are modulated through several mechanisms, including protein-protein interactions, autocleavage/degradation and phosphorylation, ensuring that USP1 function is carried out in a properly regulated spatio-temporal manner. Importantly, USP1 expression is deregulated in certain types of human cancer, suggesting that USP1 could represent a valid target in cancer therapy. This view has gained recent support with the finding that USP1 inhibition may contribute to revert cisplatin resistance in an in vitro model of non-small cell lung cancer (NSCLC). Here, we describe the current knowledge on the cellular functions and regulatory mechanisms of USP1. We also summarize USP1 alterations found in cancer, combining data from the literature and public databases with our own data. Finally, we discuss the emerging potential of USP1 as a target, integrating published data with our novel findings on the effects of the USP1 inhibitor pimozide in combination with cisplatin in NSCLC cells. PMID:23937906

  4. Regulatory role of collagen V in establishing mechanical properties of tendons and ligaments is tissue dependent.

    PubMed

    Connizzo, Brianne K; Freedman, Benjamin R; Fried, Joanna H; Sun, Mei; Birk, David E; Soslowsky, Louis J

    2015-06-01

    Patients with classic (type I) Ehlers-Danlos syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus (FDL) tendon, Achilles tendon (ACH), the anterior cruciate ligament (ACL), and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1(ΔTen/ΔTen) group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1(ΔTen/ΔTen) group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  5. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci.

    PubMed

    Miller, Clint L; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K; Majmudar, Deshna; Kim, Juyong B; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L; Montgomery, Stephen B; Schadt, Eric E; Björkegren, Johan L M; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  6. Integrative functional genomics identifies regulatory mechanisms at coronary artery disease loci

    PubMed Central

    Miller, Clint L.; Pjanic, Milos; Wang, Ting; Nguyen, Trieu; Cohain, Ariella; Lee, Jonathan D.; Perisic, Ljubica; Hedin, Ulf; Kundu, Ramendra K.; Majmudar, Deshna; Kim, Juyong B.; Wang, Oliver; Betsholtz, Christer; Ruusalepp, Arno; Franzén, Oscar; Assimes, Themistocles L.; Montgomery, Stephen B.; Schadt, Eric E.; Björkegren, Johan L.M.; Quertermous, Thomas

    2016-01-01

    Coronary artery disease (CAD) is the leading cause of mortality and morbidity, driven by both genetic and environmental risk factors. Meta-analyses of genome-wide association studies have identified >150 loci associated with CAD and myocardial infarction susceptibility in humans. A majority of these variants reside in non-coding regions and are co-inherited with hundreds of candidate regulatory variants, presenting a challenge to elucidate their functions. Herein, we use integrative genomic, epigenomic and transcriptomic profiling of perturbed human coronary artery smooth muscle cells and tissues to begin to identify causal regulatory variation and mechanisms responsible for CAD associations. Using these genome-wide maps, we prioritize 64 candidate variants and perform allele-specific binding and expression analyses at seven top candidate loci: 9p21.3, SMAD3, PDGFD, IL6R, BMP1, CCDC97/TGFB1 and LMOD1. We validate our findings in expression quantitative trait loci cohorts, which together reveal new links between CAD associations and regulatory function in the appropriate disease context. PMID:27386823

  7. Biosafety, biosecurity and internationally mandated regulatory regimes: compliance mechanisms for education and global health security

    PubMed Central

    Sture, Judi; Whitby, Simon; Perkins, Dana

    2015-01-01

    This paper highlights the biosafety and biosecurity training obligations that three international regulatory regimes place upon states parties. The duty to report upon the existence of such provisions as evidence of compliance is discussed in relation to each regime. We argue that such mechanisms can be regarded as building blocks for the development and delivery of complementary biosafety and biosecurity teaching and training materials. We show that such building blocks represent foundations upon which life and associated scientists – through greater awareness of biosecurity concerns – can better fulfil their responsibilities to guard their work from misuse in the future. PMID:24494580

  8. The human sperm acrosome reaction: physiology and regulatory mechanisms. An update.

    PubMed

    Brucker, C; Lipford, G B

    1995-01-01

    The acrosome reaction is a crucial step during gamete interaction in all species, including man. It allows spermatozoa to penetrate the zona pellucida and fuse with the oocyte membrane. Spermatozoa unable to undergo the acrosome reaction will not fertilize intact oocytes. This article concentrates on the characteristics and regulatory mechanisms of the acrosome reaction in human spermatozoa. During recent years, various entities found in the vicinity of the ovulated oocyte have been identified as stimulators of the acrosome reaction, of which zona protein is considered the prime physiological inducer in vivo. The steroid hormone progesterone has been shown to evoke critical responses in sperm cells leading to the acrosome reaction. Calcium has also been shown to play a central role during the acrosome reaction. Calcium flux is induced specifically by progesterone in capacitated and uncapacitated sperm cells, whereas only capacitated spermatozoa are able to subsequently complete the acrosome reaction. Progesterone as well as zona protein has been shown to evoke crucial responses within human spermatozoa, shedding light on the cascade of intracellular signalling events leading to the completion of the acrosome reaction. Furthermore, chemical agents which bring about the reaction in vitro, such as the ionophores ionomycin or A23187, have been used to shed light on its regulatory mechanisms. A number of molecules have been postulated to regulate the acrosome reaction in mammals, for example a galactosyl-transferase and a sperm protein tyrosine kinase. In addition, a novel protein, termed SAA-1, that was first detected on human spermatozoa is discussed with respect to its potential role as a regulatory protein closely involved in the initiation of the acrosome reaction. PMID:9080206

  9. Deletional and regulatory mechanisms coalesce to drive transplantation tolerance through mixed chimerism.

    PubMed

    Hock, Karin; Mahr, Benedikt; Schwarz, Christoph; Wekerle, Thomas

    2015-09-01

    Establishing donor-specific immunological tolerance could improve long-term outcome by obviating the need for immunosuppressive drug therapy, which is currently required to control alloreactivity after organ transplantation. Mixed chimerism is defined as the engraftment of donor hematopoietic stem cells in the recipient, leading to viable coexistence of both donor and recipient leukocytes. In numerous experimental models, cotransplantation of donor bone marrow (BM) into preconditioned (e.g., through irradiation or cytotoxic drugs) recipients leads to transplantation tolerance through (mixed) chimerism. Mixed chimerism offers immunological advantages for clinical translation; pilot trials have established proof of concept by deliberately inducing tolerance in humans. Widespread clinical application is prevented, however, by the harsh preconditioning currently necessary for permitting BM engraftment. Recently, the immunological mechanisms inducing and maintaining tolerance in experimental mixed chimerism have been defined, revealing a more prominent role for regulation than historically assumed. The evidence from murine models suggests that both deletional and regulatory mechanisms are critical in promoting complete tolerance, encompassing also the minor histocompatibility antigens. Here, we review the current understanding of tolerance through mixed chimerism and provide an outlook on how to realize widespread clinical translation based on mechanistic insights gained from chimerism protocols, including cell therapy with polyclonal regulatory T cells. PMID:26200095

  10. Mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis.

    PubMed

    Xu, Wen; Fazekas, Gyorgy; Hara, Hideo; Tabira, Takeshi

    2005-06-01

    The mechanism of natural killer (NK) cell regulatory role in experimental autoimmune encephalomyelitis (EAE) was studied in SJL/J mice. In vivo experiments showed that NK cell depletion by anti-NK1.1 monoclonal antibody treatment enhanced EAE in mice. To investigate the mechanism, we cultured proteolipid protein (PLP)136-150 peptide-specific, encephalitogenic T cell lines, which were used as the NK cell target. Our results show that NK cells exert a direct cytotoxic effect on autoantigen-specific, encephalitogenic T cells. Furthermore, cytotoxicity to PLP-specific, encephalitogenic T line cells was enhanced by using enriched NK cells as effector cells. However, the cytotoxic effect of NK cells to ovalbumin-specific T line cells and ConA-stimulated T cells could also be detected with a lesser efficiency. Our studies indicate that NK cells play a regulatory role in EAE through killing of syngeneic T cells which include myelin antigen-specific, encephalitogenic T cells, and thus ameliorate EAE. PMID:15885305

  11. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying

    2015-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  12. Gene expression in maturing neurons: regulatory mechanisms and related neurodevelopmental disorders.

    PubMed

    Ding, Baojin

    2015-04-25

    During the central nervous system (CNS) development, the interactions between intrinsic genes and extrinsic environment ensure that each neuronal developmental stage (eg. neuronal proliferation, differentiation, migration, axon extension, dendritogenesis and formation of functional synapses) occurs in the proper timing and sequence. The successful coordination requires that numerous groups of genes are exquisitely regulated in a spatiotemporal manner by various regulatory mechanisms, including sequence-specific DNA-binding proteins, histone modifications, DNA methylation, chromatin remodeling, and microRNAs (miRNAs). By targeting chromatin structure, transcription and translation processes, these mechanisms form a regulatory network to accomplish the fine regulation of gene expression in response to environmental stimuli at different developmental stages. Dysregulation of the gene expression during neuronal development has been shown to be implicated in a number of neurodevelopmental disorders, such as autism spectrum disorders (ASD), Rett syndrome (RTT), Fragile-X syndrome (FXS) and other genetic diseases. The further understanding of the regulation of gene expression during neuronal development may provide new approaches for the diagnosis and treatment of these disorders. PMID:25896042

  13. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean

    PubMed Central

    Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  14. Innovation of a Regulatory Mechanism Modulating Semi-determinate Stem Growth through Artificial Selection in Soybean.

    PubMed

    Liu, Yunfeng; Zhang, Dajian; Ping, Jieqing; Li, Shuai; Chen, Zhixiang; Ma, Jianxin

    2016-01-01

    It has been demonstrated that Terminal Flowering 1 (TFL1) in Arabidopsis and its functional orthologs in other plants specify indeterminate stem growth through their specific expression that represses floral identity genes in shoot apical meristems (SAMs), and that the loss-of-function mutations at these functional counterparts result in the transition of SAMs from the vegetative to reproductive state that is essential for initiation of terminal flowering and thus formation of determinate stems. However, little is known regarding how semi-determinate stems, which produce terminal racemes similar to those observed in determinate plants, are specified in any flowering plants. Here we show that semi-determinacy in soybean is modulated by transcriptional repression of Dt1, the functional ortholog of TFL1, in SAMs. Such repression is fulfilled by recently enabled spatiotemporal expression of Dt2, an ancestral form of the APETALA1/FRUITFULL orthologs, which encodes a MADS-box factor directly binding to the regulatory sequence of Dt1. In addition, Dt2 triggers co-expression of the putative SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (GmSOC1) in SAMs, where GmSOC1 interacts with Dt2, and also directly binds to the Dt1 regulatory sequence. Heterologous expression of Dt2 and Dt1 in determinate (tfl1) Arabidopsis mutants enables creation of semi-determinacy, but the same forms of the two genes in the tfl1 and soc1 background produce indeterminate stems, suggesting that Dt2 and SOC1 both are essential for transcriptional repression of Dt1. Nevertheless, the expression of Dt2 is unable to repress TFL1 in Arabidopsis, further demonstrating the evolutionary novelty of the regulatory mechanism underlying stem growth in soybean. PMID:26807727

  15. Visual- and Vestibular-Autonomic Influence on Short-Term Cardiovascular Regulatory Mechanisms

    NASA Technical Reports Server (NTRS)

    Mullen, Thomas J.; Ramsdell, Craig D.

    1999-01-01

    This synergy project was a one-year effort conducted cooperatively by members of the NSBRI Cardiovascular Alterations and Neurovestibular Adaptation Teams in collaboration with NASA Johnson Space Center (JSC) colleagues. The objective of this study was to evaluate visual autonomic interactions on short-term cardiovascular regulatory mechanisms. Based on established visual-vestibular and vestibular-autonomic shared neural pathways, we hypothesized that visually induced changes in orientation will trigger autonomic cardiovascular reflexes. A second objective was to compare baroreflex changes during postural changes as measured with the new Cardiovascular System Identification (CSI) technique with those measured using a neck barocuff. While the neck barocuff stimulates only the carotid baroreceptors, CSI provides a measure of overall baroreflex responsiveness. This study involved a repeated measures design with 16 healthy human subjects (8 M, 8 F) to examine cardiovascular regulatory responses during actual and virtual head-upright tilts. Baroreflex sensitivity was first evaluated with subjects in supine and upright positions during actual tilt-table testing using both neck barocuff and CSI methods. The responses to actual tilts during this first session were then compared to responses during visually induced tilt and/or rotation obtained during a second session.

  16. Global analysis of p53-regulated transcription identifies its direct targets and unexpected regulatory mechanisms

    PubMed Central

    Allen, Mary Ann; Andrysik, Zdenek; Dengler, Veronica L; Mellert, Hestia S; Guarnieri, Anna; Freeman, Justin A; Sullivan, Kelly D; Galbraith, Matthew D; Luo, Xin; Kraus, W Lee; Dowell, Robin D; Espinosa, Joaquin M

    2014-01-01

    The p53 transcription factor is a potent suppressor of tumor growth. We report here an analysis of its direct transcriptional program using Global Run-On sequencing (GRO-seq). Shortly after MDM2 inhibition by Nutlin-3, low levels of p53 rapidly activate ∼200 genes, most of them not previously established as direct targets. This immediate response involves all canonical p53 effector pathways, including apoptosis. Comparative global analysis of RNA synthesis vs steady state levels revealed that microarray profiling fails to identify low abundance transcripts directly activated by p53. Interestingly, p53 represses a subset of its activation targets before MDM2 inhibition. GRO-seq uncovered a plethora of gene-specific regulatory features affecting key survival and apoptotic genes within the p53 network. p53 regulates hundreds of enhancer-derived RNAs. Strikingly, direct p53 targets harbor pre-activated enhancers highly transcribed in p53 null cells. Altogether, these results enable the study of many uncharacterized p53 target genes and unexpected regulatory mechanisms. DOI: http://dx.doi.org/10.7554/eLife.02200.001 PMID:24867637

  17. Phenotype Specific Analyses Reveal Distinct Regulatory Mechanism for Chronically Activated p53

    PubMed Central

    Cairns, Jonathan M.; Menon, Suraj; Pérez-Mancera, Pedro A.; Tomimatsu, Kosuke; Bermejo-Rodriguez, Camino; Ito, Yoko; Chandra, Tamir; Narita, Masako; Lyons, Scott K.; Lynch, Andy G.; Kimura, Hiroshi; Ohbayashi, Tetsuya; Tavaré, Simon; Narita, Masashi

    2015-01-01

    The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage) and chronically activated (in senescent or pro-apoptotic conditions) p53. Compared to the classical ‘acute’ p53 binding profile, ‘chronic’ p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory ‘p53 hubs’ where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the ‘lipogenic phenotype’, a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms. PMID:25790137

  18. Regulatory motifs on ISWI chromatin remodelers: molecular mechanisms and kinetic proofreading

    NASA Astrophysics Data System (ADS)

    Brysbaert, Guillaume; Lensink, Marc F.; Blossey, Ralf

    2015-02-01

    Recently, kinetic proofreading scenarios have been proposed for the regulation of chromatin remodeling, first on purely theoretical grounds (Blossey and Schiessel 2008 HFSP J. 2 167-70) and deduced from experiments on the ISWI/ACF system (Narlikar 2010 Curr. Opin. Chem. Biol. 14 660). In the kinetic proofreading scenario of chromatin remodeling, the combination of the recognition of a histone tail state and ATP-hydrolysis in the remodeler motor act together to select (i.e. proofread) a nucleosomal substrate. ISWI remodelers have recently been shown to have an additional level of regulation as they contain auto-inhibitory motifs which need to be inactivated through an interaction with the nucleosome. In this paper we show that the auto-regulatory effect enhances substrate recognition in kinetic proofreading. We further report some suggestive additional insights into the molecular mechanism underlying ISWI-autoregulation.

  19. Potential impact of gene regulatory mechanisms on the evolution of multicellularity in the volvocine algae.

    PubMed

    Kianianmomeni, Arash

    2015-01-01

    A fundamental question in biology is how multicellular organisms can arise from their single-celled precursors. The evolution of multicellularity requires the adoption of new traits in unicellular ancestors that allows the generation of form by, for example, increasing the size and developing new cell types. But what are the genetic, cellular and biochemical bases underlying the evolution of multicellularity? Recent advances in evolutionary developmental biology suggest that the regulation of gene expression by cis-regulatory factors, gene duplication and alternative splicing contribute to phenotypic evolution. These mechanisms enable different degrees of phenotypic divergence and complexity with variation in traits from genomes with similar gene contents. In addition, signaling pathways specific to cell types are developed to guarantee the modulation of cellular and developmental processes matched to the cell types as well as the maintenance of multicellularity. PMID:26479715

  20. Transcriptional Control of Photosynthesis Genes: The Evolutionarily Conserved Regulatory Mechanism in Plastid Genome Function

    PubMed Central

    Puthiyaveetil, Sujith; Ibrahim, Iskander M.; Jeličić, Branka; Tomašić, Ana; Fulgosi, Hrvoje; Allen, John F.

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts—photosynthetic plastids—in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  1. Heritability of symbiont density reveals distinct regulatory mechanisms in a tripartite symbiosis.

    PubMed

    Parkinson, Jasmine F; Gobin, Bruno; Hughes, William O H

    2016-04-01

    Beneficial eukaryotic-bacterial partnerships are integral to animal and plant evolution. Understanding the density regulation mechanisms behind bacterial symbiosis is essential to elucidating the functional balance between hosts and symbionts. Citrus mealybugs, Planococcus citri (Risso), present an excellent model system for investigating the mechanisms of symbiont density regulation. They contain two obligate nutritional symbionts, Moranella endobia, which resides inside Tremblaya princeps, which has been maternally transmitted for 100-200 million years. We investigate whether host genotype may influence symbiont density by crossing mealybugs from two inbred laboratory-reared populations that differ substantially in their symbiont density to create hybrids. The density of the M. endobia symbiont in the hybrid hosts matched that of the maternal parent population, in keeping with density being determined either by the symbiont or the maternal genotype. However, the density of the T. princeps symbiont was influenced by the paternal host genotype. The greater dependency of T. princeps on its host may be due to its highly reduced genome. The decoupling of T. princeps and M. endobia densities, in spite of their intimate association, suggests that distinct regulatory mechanisms can be at work in symbiotic partnerships, even when they are obligate and mutualistic. PMID:27099709

  2. The regulatory mechanisms of myogenin expression in doxorubicin-treated rat cardiomyocytes

    PubMed Central

    Yen, Li-Chen; Huang, Chi-Jung; Lin, Wei-Shiang; Chan, James Yi-Hsin

    2015-01-01

    Doxorubicin, an anthracycline antibiotic, has been used as an anti-neoplastic drug for almost 60 years. However, the mechanism(s) by which anthracyclines cause irreversible myocardial injury remains unclear. In order to delineate possible molecular signals involved in the myocardial toxicity, we assessed candidate genes using mRNA expression profiling in the doxorubicin-treated rat cardiomyocyte H9c2 cell line. In the study, it was confirmed that myogenin, an important transcriptional factor for muscle terminal differentiation, was significantly reduced by doxorubicin in a dose-dependent manner using both RT-PCR and western blot analyses. Also, it was identified that the doxorubicin-reduced myogenin gene level could not be rescued by most cardio-protectants. Furthermore, it was demonstrated how the signaling of the decreased myogenin expression by doxorubicin was altered at the transcriptional, post-transcriptional and translational levels. Based on these findings, a working model was proposed for relieving doxorubicin-associated myocardial toxicity by down-regulating miR-328 expression and increasing voltage-gated calcium channel β1 expression, which is a repressor of myogenin gene regulation. In summary, this study provides several lines of evidence indicating that myogenin is the target for doxorubicin-induced cardio-toxicity and a novel therapeutic strategy for doxorubicin clinical applications based on the regulatory mechanisms of myogenin expression. PMID:26452256

  3. MYCN-driven regulatory mechanisms controlling LIN28B in neuroblastoma

    PubMed Central

    Beckers, Anneleen; Van Peer, Gert; Carter, Daniel R.; Gartlgruber, Moritz; Herrmann, Carl; Agarwal, Saurabh; Helsmoortel, Hetty H.; Althoff, Kristina; Molenaar, Jan J.; Cheung, Belamy B.; Schulte, Johannes H.; Benoit, Yves; Shohet, Jason M.; Westermann, Frank; Marshall, Glenn M.; Vandesompele, Jo; De Preter, Katleen; Speleman, Frank

    2016-01-01

    LIN28B has been identified as an oncogene in various tumor entities, including neuroblastoma, a childhood cancer that originates from neural crest-derived cells, and is characterized by amplification of the MYCN oncogene. Recently, elevated LIN28B expression levels were shown to contribute to neuroblastoma tumorigenesis via let-7 dependent de-repression of MYCN. However, additional insight in the regulation of LIN28B in neuroblastoma is lacking. Therefore, we have performed a comprehensive analysis of the regulation of LIN28B in neuroblastoma, with a specific focus on the contribution of miRNAs. We show that MYCN regulates LIN28B expression in neuroblastoma tumors via two distinct parallel mechanisms. First, through an unbiased LIN28B-3′UTR reporter screen, we found that miR-26a-5p and miR-26b-5p regulate LIN28B expression. Next, we demonstrated that MYCN indirectly affects the expression of miR-26a-5p, and hence regulates LIN28B, therefor establishing a MYCN-miR-26a-5p-LIN28B regulatory axis. Second, we provide evidence that MYCN regulates LIN28B expression via interaction with the LIN28B promotor, establishing a direct MYCN-LIN28B regulatory axis. We believe that these findings mark LIN28B as an important effector of the MYCN oncogenic phenotype and underlines the importance of MYCN-regulated miRNAs in establishing the MYCN-driven oncogenic process. PMID:26123663

  4. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins.

    PubMed

    Li, Junlin; Zhao, Guifang; Gao, Xiaocai

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  5. Structural insights into the regulatory mechanism of the Pseudomonas aeruginosa YfiBNR system.

    PubMed

    Xu, Min; Yang, Xuan; Yang, Xiu-An; Zhou, Lei; Liu, Tie-Zheng; Fan, Zusen; Jiang, Tao

    2016-06-01

    YfiBNR is a recently identified bis-(3'-5')-cyclic dimeric GMP (c-di-GMP) signaling system in opportunistic pathogens. It is a key regulator of biofilm formation, which is correlated with prolonged persistence of infection and antibiotic drug resistance. In response to cell stress, YfiB in the outer membrane can sequester the periplasmic protein YfiR, releasing its inhibition of YfiN on the inner membrane and thus provoking the diguanylate cyclase activity of YfiN to induce c-di-GMP production. However, the detailed regulatory mechanism remains elusive. Here, we report the crystal structures of YfiB alone and of an active mutant YfiB(L43P) complexed with YfiR with 2:2 stoichiometry. Structural analyses revealed that in contrast to the compact conformation of the dimeric YfiB alone, YfiB(L43P) adopts a stretched conformation allowing activated YfiB to penetrate the peptidoglycan (PG) layer and access YfiR. YfiB(L43P) shows a more compact PG-binding pocket and much higher PG binding affinity than wild-type YfiB, suggesting a tight correlation between PG binding and YfiB activation. In addition, our crystallographic analyses revealed that YfiR binds Vitamin B6 (VB6) or L-Trp at a YfiB-binding site and that both VB6 and L-Trp are able to reduce YfiB(L43P)-induced biofilm formation. Based on the structural and biochemical data, we propose an updated regulatory model of the YfiBNR system. PMID:27113583

  6. Development of neurodevelopmental disorders: a regulatory mechanism involving bromodomain-containing proteins

    PubMed Central

    2013-01-01

    Neurodevelopmental disorders are classified as diseases that cause abnormal functions of the brain or central nervous system. Children with neurodevelopmental disorders show impaired language and speech abilities, learning and memory damage, and poor motor skills. However, we still know very little about the molecular etiology of these disorders. Recent evidence implicates the bromodomain-containing proteins (BCPs) in the initiation and development of neurodevelopmental disorders. BCPs have a particular domain, the bromodomain (Brd), which was originally identified as specifically binding acetyl-lysine residues at the N-terminus of histone proteins in vitro and in vivo. Other domains of BCPs are responsible for binding partner proteins to form regulatory complexes. Once these complexes are assembled, BCPs alter chromosomal states and regulate gene expression. Some BCP complexes bind nucleosomes, are involved in basal transcription regulation, and influence the transcription of many genes. However, most BCPs are involved in targeting. For example, some BCPs function as a recruitment platform or scaffold through their Brds-binding targeting sites. Others are recruited to form a complex to bind the targeting sites of their partners. The regulation mediated by these proteins is especially critical during normal and abnormal development. Mutant BCPs or dysfunctional BCP-containing complexes are implicated in the initiation and development of neurodevelopmental disorders. However, the pathogenic molecular mechanisms are not fully understood. In this review, we focus on the roles of regulatory BCPs associated with neurodevelopmental disorders, including mental retardation, Fragile X syndrome (FRX), Williams syndrome (WS), Rett syndrome and Rubinstein-Taybi syndrome (RTS). A better understanding of the molecular pathogenesis, based upon the roles of BCPs, will lead to screening of targets for the treatment of neurodevelopmental disorders. PMID:23425632

  7. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus.

    PubMed

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3'-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  8. Core level regulatory network of osteoblast as molecular mechanism for osteoporosis and treatment.

    PubMed

    Yuan, Ruoshi; Ma, Shengfei; Zhu, Xiaomei; Li, Jun; Liang, Yuhong; Liu, Tao; Zhu, Yanxia; Zhang, Bingbing; Tan, Shuang; Guo, Huajie; Guan, Shuguang; Ao, Ping; Zhou, Guangqian

    2016-01-26

    To develop and evaluate the long-term prophylactic treatment for chronic diseases such as osteoporosis requires a clear view of mechanism at the molecular and systems level. While molecular signaling pathway studies for osteoporosis are extensive, a unifying mechanism is missing. In this work, we provide experimental and systems-biology evidences that a tightly connected top-level regulatory network may exist, which governs the normal and osteoporotic phenotypes of osteoblast. Specifically, we constructed a hub-like interaction network from well-documented cross-talks among estrogens, glucocorticoids, retinoic acids, peroxisome proliferator-activated receptor, vitamin D receptor and calcium-signaling pathways. The network was verified with transmission electron microscopy and gene expression profiling for bone tissues of ovariectomized (OVX) rats before and after strontium gluconate (GluSr) treatment. Based on both the network structure and the experimental data, the dynamical modeling predicts calcium and glucocorticoids signaling pathways as targets for GluSr treatment. Modeling results further reveal that in the context of missing estrogen signaling, the GluSr treated state may be an outcome that is closest to the healthy state. PMID:26783964

  9. Atomistic Insights into Regulatory Mechanisms of the HER2 Tyrosine Kinase Domain: A Molecular Dynamics Study

    PubMed Central

    Telesco, Shannon E.; Radhakrishnan, Ravi

    2009-01-01

    HER2 (ErbB2/Neu) is a receptor tyrosine kinase belonging to the epidermal growth factor receptor (EGFR)/ErbB family and is overexpressed in 20–30% of human breast cancers. Although several crystal structures of ErbB kinases have been solved, the precise mechanism of HER2 activation remains unknown, and it has been suggested that HER2 is unique in its requirement for phosphorylation of Y877, a key tyrosine residue located in the activation loop. To elucidate mechanistic details of kinase domain regulation, we performed molecular dynamics simulations of a homology-modeled HER2 kinase structure in active and inactive conformations. Principal component analysis of the atomistic fluctuations reveals a tight coupling between the activation loop and catalytic loop that may contribute to alignment of residues required for catalysis in the active kinase. The free energy perturbation method is also employed to predict a role for phosphorylated Y877 in stabilizing the kinase conformations. Finally, simulation results are presented for a HER2/EGFR heterodimer and reveal that the dimeric interface induces a rearrangement of the αC helix toward the active conformation. Elucidation of the molecular regulatory mechanisms in HER2 will help establish structure-function relationships in the wild-type kinase, as well as predict mutations with a propensity for constitutive activation in HER2-mediated cancers. PMID:19289058

  10. Up-regulation of miR-98 and unraveling regulatory mechanisms in gestational diabetes mellitus

    PubMed Central

    Cao, Jing-Li; Zhang, Lu; Li, Jian; Tian, Shi; Lv, Xiao-Dan; Wang, Xue-Qin; Su, Xing; Li, Ying; Hu, Yi; Ma, Xu; Xia, Hong-Fei

    2016-01-01

    MiR-98 expression was up-regulated in kidney in response to early diabetic nephropathy in mouse and down-regulated in muscle in type 2 diabetes in human. However, the expression prolife and functional role of miR-98 in human gestational diabetes mellitus (GDM) remained unclear. Here, we investigated its expression and function in placental tissues from GDM patients and the possible molecular mechanisms. The results showed that miR-98 was up-regulated in placentas from GDM patients compared with normal placentas. MiR-98 over-expression increased global DNA methylational level and miR-98 knockdown reduced global DNA methylational level. Further investigation revealed that miR-98 could inhibit Mecp2 expression by binding the 3′-untranslated region (UTR) of methyl CpG binding protein 2 (Mecp2), and then led to the expression dysregulation of canonical transient receptor potential 3 (Trpc3), a glucose uptake related gene. More importantly, in vivo analysis found that the expression level of Mecp2 and Trpc3 in placental tissues from GDM patients, relative to the increase of miR-98, was diminished, especially for GDM patients over the age of 35 years. Collectively, up-regulation of miR-98 in the placental tissues of human GDM is linked to the global DNA methylation via targeting Mecp2, which may imply a novel regulatory mechanism in GDM. PMID:27573367

  11. A Cell-Regulatory Mechanism Involving Feedback between Contraction and Tissue Formation Guides Wound Healing Progression

    PubMed Central

    Valero, Clara; Javierre, Etelvina; García-Aznar, José Manuel; Gómez-Benito, María José

    2014-01-01

    Wound healing is a process driven by cells. The ability of cells to sense mechanical stimuli from the extracellular matrix that surrounds them is used to regulate the forces that cells exert on the tissue. Stresses exerted by cells play a central role in wound contraction and have been broadly modelled. Traditionally, these stresses are assumed to be dependent on variables such as the extracellular matrix and cell or collagen densities. However, we postulate that cells are able to regulate the healing process through a mechanosensing mechanism regulated by the contraction that they exert. We propose that cells adjust the contraction level to determine the tissue functions regulating all main activities, such as proliferation, differentiation and matrix production. Hence, a closed-regulatory feedback loop is proposed between contraction and tissue formation. The model consists of a system of partial differential equations that simulates the evolution of fibroblasts, myofibroblasts, collagen and a generic growth factor, as well as the deformation of the extracellular matrix. This model is able to predict the wound healing outcome without requiring the addition of phenomenological laws to describe the time-dependent contraction evolution. We have reproduced two in vivo experiments to evaluate the predictive capacity of the model, and we conclude that there is feedback between the level of cell contraction and the tissue regenerated in the wound. PMID:24681636

  12. Functional role of regulatory T cells in B cell lymphoma and related mechanisms.

    PubMed

    Wu, Wei; Wan, Jun; Xia, Ruixiang; Huang, Zhenqi; Ni, Jing; Yang, Mingzhen

    2015-01-01

    B cell lymphoma (BCL) has a higher degree of malignancy and complicated pathogenic mechanism. Regulatory T cells (Treg cells) are known to exert certain immune suppression functions, in addition to immune mediating effects. Recent studies have revealed the role of Treg cells in pathogenesis and progression of multiple malignant tumors. This study therefore investigated the functional role and related mechanism of Treg cells in BCL. A cohort of thirty patients who were diagnosed with BCL in our hospital between January 2013 and December 2014. Another thirty healthy individuals were recruited. Peripheral blood mononuclear cells (PBMCs) were separated and analyzed for the ratio of CD4+/CD25+ Treg cells. The mRNA expression levels of Foxp3, transforming growth factor (TGF)-β1 and interleukin (IL)-10 genes were quantified by real-time PCR, while their serum levels were determined by enzyme-linked immunosorbent assay (ELISA). Meanwhile all laboratory indexes for patients were monitored during the complete remission (CR) stage. BCL patients significantly elevated ratio of CD4+/CD25+ Treg cells, which were decreased at CR stage. mRNA levels of Foxp3, TGF-β1 and IL-10, in addition to protein levels of TGF-β1 and IL-10 were potentiated in lymphoma patients but decreased in CR patients (P<0.05 in all cases). CD4+/CD25+ Treg cells exert immune suppressing functions in BCL via regulating cytokines, thereby facilitating the pathogenesis and progression of lymphoma. PMID:26464657

  13. Mechanisms of allergen-specific immunotherapy: T-regulatory cells and more.

    PubMed

    Verhagen, Johan; Blaser, Kurt; Akdis, Cezmi A; Akdis, Mübeccel

    2006-05-01

    Activation-induced cell death, anergy, or immune response modulation by regulatory T cells (Treg cells) are essential mechanisms of peripheral T-cell tolerance. Genetic predisposition and environmental instructions tune thresholds for the activation of T cells, other inflammatory cells, and resident tissue cells in allergic diseases. Skewing allergen-specific effector T cells to a Treg-cell phenotype seems to be crucial in maintaining a healthy immune response to allergens and successful allergen-specific immunotherapy. The Treg-cell response is characterized by an abolished allergen-specific T-cell proliferation and the suppressed secretion of T-helper 1- and T-helper 2-type cytokines. Suppressed proliferative and cytokine responses against allergens are induced by multiple suppressor factors, including cytokines such as interleukin-10 (IL-10) and transforming growth factor beta (TGF-beta), and cell surface molecules such as cytotoxic T-lymphocyte antigen-4, programmed death-1, and histamine receptor 2. The increased levels of IL-10 and TGF-beta produced by Treg cells potently suppress IgE production while simultaneously increasing the production of noninflammatory isotypes IgG4 and IgA, respectively. In addition, Treg cells directly or indirectly suppress the activity of effector cells of allergic inflammation, such as mast cells, basophils, and eosinophils. In conclusion, peripheral tolerance to allergens is controlled by multiple active suppression mechanisms on T cells, regulation of antibody isotypes, and suppression of effector cells. The application of current knowledge of Treg cells and related mechanisms of peripheral tolerance may soon lead to more rational and safer approaches to the prevention and cure of allergic disease. PMID:16701141

  14. Regulatory mechanism of the flavoprotein Tah18-dependent nitric oxide synthesis and cell death in yeast.

    PubMed

    Yoshikawa, Yuki; Nasuno, Ryo; Kawahara, Nobuhiro; Nishimura, Akira; Watanabe, Daisuke; Takagi, Hiroshi

    2016-07-01

    Nitric oxide (NO) is a ubiquitous signaling molecule involved in the regulation of a large number of cellular functions. The regulatory mechanism of NO generation in unicellular eukaryotic yeast cells is poorly understood due to the lack of mammalian and bacterial NO synthase (NOS) orthologues, even though yeast produces NO under oxidative stress conditions. Recently, we reported that the flavoprotein Tah18, which was previously shown to transfer electrons to the iron-sulfur cluster protein Dre2, is involved in NOS-like activity in the yeast Saccharomyces cerevisiae. On the other hand, Tah18 was reported to promote apoptotic cell death after exposure to hydrogen peroxide (H2O2). Here, we showed that NOS-like activity requiring Tah18 induced cell death upon treatment with H2O2. Our experimental results also indicate that Tah18-dependent NO production and cell death are suppressed by enhancement of the interaction between Tah18 and its molecular partner Dre2. Our findings indicate that the Tah18-Dre2 complex regulates cell death as a molecular switch via Tah18-dependent NOS-like activity in response to environmental changes. PMID:27178802

  15. Identification of regulatory mechanisms of intestinal folate transport in condition of folate deficiency.

    PubMed

    Thakur, Shilpa; Rahat, Beenish; Hamid, Abid; Najar, Rauf Ahmad; Kaur, Jyotdeep

    2015-10-01

    Folic acid is an essential micronutrient, deficiency of which can lead to disturbance in various metabolic processes of cell. Folate transport across intestine occurs via the involvement of specialized folate transporters viz. proton coupled folate transporter (PCFT) and reduced folate carrier (RFC), which express at the membrane surfaces. The current study was designed to identify the regulatory mechanisms underlying the effects of folate deficiency (FD) on folate transport in human intestinal cell line as well as in rats and to check the reversibility of such effects. Caco-2 cells were grown for five generations in control and FD medium. Following treatment, one subgroup of cells was shifted on folate sufficient medium and grown for three more generations. Similarly, rats were fed an FD diet for 3 and 5 months, and after 3 months of FD treatment, one group of rats were shifted on normal folate-containing diet. Increase in folate transport and expression of folate transporters were observed on FD treatment. However, when cells and rats were shifted to control conditions after treatment, transport and expression of these genes restored to the control level. FD was found to have no impact on promoter methylation of PCFT and RFC; however, messenger RNA stability of transporters was found to be decreased, suggesting some adaptive response. Overall, increased expression of transporters under FD conditions can be attributed to enhanced rate of transcription of folate transporters and also to the increased binding of specificity protein 1 transcription factor to the RFC promoter only. PMID:26168702

  16. Molecular interactions of the Saccharomyces cerevisiae Atg1 complex provide insights into assembly and regulatory mechanisms

    PubMed Central

    Chew, Leon H; Lu, Shan; Liu, Xu; Li, Franco Kk; Yu, Angela Yh; Klionsky, Daniel J; Dong, Meng-Qiu; Yip, Calvin K

    2015-01-01

    The Atg1 complex, which contains 5 major subunits: Atg1, Atg13, Atg17, Atg29, and Atg31, regulates the induction of autophagy and autophagosome formation. To gain a better understanding of the overall architecture and assembly mechanism of this essential autophagy regulatory complex, we have reconstituted a core assembly of the Saccharomyces cerevisiae Atg1 complex composed of full-length Atg17, Atg29, and Atg31, along with the C-terminal domains of Atg1 (Atg1[CTD]) and Atg13 (Atg13[CTD]). Using chemical-crosslinking coupled with mass spectrometry (CXMS) analysis we systematically mapped the intersubunit interaction interfaces within this complex. Our data revealed that the intrinsically unstructured C-terminal domain of Atg29 interacts directly with Atg17, whereas Atg17 interacts with Atg13 in 2 distinct intrinsically unstructured regions, including a previously unknown motif that encompasses several putative phosphorylation sites. The Atg1[CTD] crosslinks exclusively to the Atg13[CTD] and does not appear to make direct contact with the Atg17-Atg31-Atg29 scaffold. Finally, single-particle electron microscopy analysis revealed that both the Atg13[CTD] and Atg1[CTD] localize to the tip regions of Atg17-Atg31-Atg29 and do not alter the distinct curvature of this scaffolding subcomplex. This work provides a comprehensive understanding of the subunit interactions in the fully assembled Atg1 core complex, and uncovers the potential role of intrinsically disordered regions in regulating complex integrity. PMID:25998554

  17. Cardiovascular Risk in Systemic Autoimmune Diseases: Epigenetic Mechanisms of Immune Regulatory Functions

    PubMed Central

    López-Pedrera, Chary; Pérez-Sánchez, Carlos; Ramos-Casals, Manuel; Santos-Gonzalez, Monica; Rodriguez-Ariza, Antonio; José Cuadrado, Ma

    2012-01-01

    Autoimmune diseases (AIDs) have been associated with accelerated atherosclerosis (AT) leading to increased cardio- and cerebrovascular disease risk. Traditional risk factors, as well as systemic inflammation mediators, including cytokines, chemokines, proteases, autoantibodies, adhesion receptors, and others, have been implicated in the development of these vascular pathologies. Yet, the characteristics of vasculopathies may significantly differ depending on the underlying disease. In recent years, many new genes and signalling pathways involved in autoimmunity with often overlapping patterns between different disease entities have been further detected. Epigenetics, the control of gene packaging and expression independent of alterations in the DNA sequence, is providing new directions linking genetics and environmental factors. Epigenetic regulatory mechanisms comprise DNA methylation, histone modifications, and microRNA activity, all of which act upon gene and protein expression levels. Recent findings have contributed to our understanding of how epigenetic modifications could influence AID development, not only showing differences between AID patients and healthy controls, but also showing how one disease differs from another and even how the expression of key proteins involved in the development of each disease is regulated. PMID:21941583

  18. A mechanism for expansion of regulatory T cell repertoire and its role in self tolerance

    PubMed Central

    Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-01-01

    SUMMARY T cell receptor (TCR) signaling plays a key role in T cell fate determination. Precursor cells expressing TCRs within a certain low affinity range for self peptide-MHC complexes undergo positive selection and differentiate into naïve T cells expressing a highly diverse self-MHC restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for “self” are either eliminated through TCR agonist induced apoptosis (negative selection)1 or restrained by regulatory CD4+ T (Treg) cells, whose differentiation and function are controlled by the X-chromosome encoded transcription factor Foxp3 (review2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist driven TCR signals combined with interleukin-2 (IL-2) receptor signaling. In addition to Treg cells, TCR agonist-driven selection results in the generation of several other specialized T cell lineages like NKT and MAIT cells3. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs4-6, Here we explored whether a specialized mechanism enables agonist driven selection of Treg cells with a diverse TCR repertoire and its significance for self-tolerance. We found that intronic Foxp3 enhancer CNS3 acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to effectively control self-reactive T cells, especially when thymic negative selection was genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  19. Luteal regression vs. prepartum luteolysis: regulatory mechanisms governing canine corpus luteum function.

    PubMed

    Kowalewski, Mariusz P

    2014-04-01

    Canine reproductive physiology exhibits several unusual features. Among the most interesting of these are the lack of an acute luteolytic mechanism, coinciding with the apparent luteal independency of a uterine luteolysin in absence of pregnancy, contrasting with the acute prepartum luteolysis observed in pregnant animals. These features indicate the existence of mechanisms different from those in other species for regulating the extended luteal regression observed in non-pregnant dogs, and the actively regulated termination of luteal function observed prepartum as a prerequisite for parturition. Nevertheless, the supply of progesterone (P4) depends on corpora lutea (CL) as its primary source in both conditions, resulting in P4 levels that are similar in pregnant and non-pregnant bitches during almost the entire luteal life span prior to the prepartum luteolysis. Consequently, the duration of the prolonged luteal phase in non-pregnant bitches frequently exceeds that of pregnant ones, which is a peculiarity when compared with other domestic animal species. Both LH and prolactin (PRL) are endocrine luteotrophic factors in the dog, the latter being the predominant one. In spite of increased availability of these hormones, luteal regression/luteolysis still takes place. Recently, possible mechanisms regulating the expression and function of PRL receptor have been implicated in the local, i.e., intraluteal regulation of PRL bioavailability and thus its steroidogenic potential. Similar mechanisms may relate to the luteal LH receptor. Most recently, evidence has been provided for an autocrine/paracrine role of prostaglandin E2 (PGE2) as a luteotrophic factor in the canine CL acting at the level of steroidogenic acute regulatory (STAR)-protein mediated supply of steroidogenic substrate, without having a significant impact on the enzymatic activity of the respective steroidogenic enzymes, 3β-hydroxysteroid-dehydrogenase (3βHSD, HSD3B2) and cytochrome P450 side

  20. Controlling the fire--tissue-specific mechanisms of effector regulatory T-cell homing.

    PubMed

    Chow, Zachary; Banerjee, Ashish; Hickey, Michael J

    2015-04-01

    Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. PMID:25582339

  1. Heart Rate Variability: New Perspectives on Physiological Mechanisms, Assessment of Self-regulatory Capacity, and Health risk

    PubMed Central

    Shaffer, Fred

    2015-01-01

    Heart rate variability, the change in the time intervals between adjacent heartbeats, is an emergent property of interdependent regulatory systems that operates on different time scales to adapt to environmental and psychological challenges. This article briefly reviews neural regulation of the heart and offers some new perspectives on mechanisms underlying the very low frequency rhythm of heart rate variability. Interpretation of heart rate variability rhythms in the context of health risk and physiological and psychological self-regulatory capacity assessment is discussed. The cardiovascular regulatory centers in the spinal cord and medulla integrate inputs from higher brain centers with afferent cardiovascular system inputs to adjust heart rate and blood pressure via sympathetic and parasympathetic efferent pathways. We also discuss the intrinsic cardiac nervous system and the heart-brain connection pathways, through which afferent information can influence activity in the subcortical, frontocortical, and motor cortex areas. In addition, the use of real-time HRV feedback to increase self-regulatory capacity is reviewed. We conclude that the heart's rhythms are characterized by both complexity and stability over longer time scales that reflect both physiological and psychological functional status of these internal self-regulatory systems. PMID:25694852

  2. microRNA regulatory mechanism by which PLLA aligned nanofibers influence PC12 cell differentiation

    NASA Astrophysics Data System (ADS)

    Yu, Yadong; Lü, Xiaoying; Ding, Fei

    2015-08-01

    Objective. Aligned nanofibers (AFs) are regarded as promising biomaterials in nerve tissue engineering. However, a full understanding of the biocompatibility of AFs at the molecular level is still challenging. Therefore, the present study focused on identifying the microRNA (miRNA)-mediated regulatory mechanism by which poly-L-lactic acid (PLLA) AFs influence PC12 cell differentiation. Approach. Firstly, the effects of PLLA random nanofibers (RFs)/AFs and PLLA films (control) on the biological responses of PC12 cells that are associated with neuronal differentiation were examined. Then, SOLiD sequencing and cDNA microarray were employed to profile the expressions of miRNAs and mRNAs. The target genes of the misregulated miRNAs were predicted and compared with the mRNA profile data. Functions of the matched target genes (the intersection between the predicted target genes and the experimentally-determined, misregulated genes) were analyzed. Main results. The results revealed that neurites spread in various directions in control and RF groups. In the AF group, most neurites extended in parallel with each other. The glucose consumption and lactic acid production in the RF and AF groups were higher than those in the control group. Compared with the control group, 42 and 94 miRNAs were significantly dysregulated in the RF and AF groups, respectively. By comparing the predicted target genes with the mRNA profile data, five and 87 matched target genes were found in the RF and AF groups, respectively. Three of the matched target genes in the AF group were found to be associated with neuronal differentiation, whereas none had this association in the RF group. The PLLA AFs induced the dysregulation of miRNAs that regulate many biological functions, including axonal guidance, lipid metabolism and long-term potentiation. In particular, two miRNA-matched target gene-biological function modules associated with neuronal differentiation were identified as follows: (1) miR-23b, mi

  3. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis

    PubMed Central

    YANG, YANG; XING, YIQIAO; LIANG, CHAOQUN; HU, LIYA; XU, FEI; MEI, QI

    2016-01-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin-dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  4. Regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor-α genetic variations

    PubMed Central

    LIU, YANGZHOU; HAN, NING; LI, QINCHUAN; LI, ZENGCHUN

    2016-01-01

    The present study aimed to investigate the regulatory mechanisms underlying sepsis progression in patients with tumor necrosis factor (TNF)-α genetic variations. The GSE5760 expression profile data, which was downloaded from the Gene Expression Omnibus database, contained 30 wild-type (WT) and 28 mutation (MUT) samples. Differentially expressed genes (DEGs) between the two types of samples were identified using the Student's t-test, and the corresponding microRNAs (miRNAs) were screened using WebGestalt software. An integrated miRNA-DEG network was constructed using the Cytoscape software, based on the interactions between the DEGs, as identified using the Search Tool for the Retrieval of Interacting Genes/Proteins database, and the correlation between miRNAs and their target genes. Furthermore, Gene Ontology and pathway enrichment analyses were conducted for the DEGs using the Database for Annotation, Visualization and Integrated Discovery and the KEGG Orthology Based Annotation System, respectively. A total of 390 DEGS between the WT and MUT samples, along with 11 -associated miRNAs, were identified. The integrated miRNA-DEG network consisted of 38 DEGs and 11 miRNAs. Within this network, COPS2 was found to be associated with transcriptional functions, while FUS was found to be involved in mRNA metabolic processes. Other DEGs, including FBXW7 and CUL3, were enriched in the ubiquitin-mediated proteolysis pathway. In addition, miR-15 was predicted to target COPS2 and CUL3. The results of the present study suggested that COPS2, FUS, FBXW7 and CUL3 may be associated with sepsis in patients with TNF-α genetic variations. In the progression of sepsis, FBXW7 and CUL3 may participate in the ubiquitin-mediated proteolysis pathway, whereas COPS2 may regulate the phosphorylation and ubiquitination of the FUS protein. Furthermore, COPS2 and CUL3 may be novel targets of miR-15. PMID:27347057

  5. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer

    2012-01-01

    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  6. Analysis of regulatory mechanism after ErbB4 gene mutation based on local modeling methodology.

    PubMed

    Chen, C L; Zhao, J W

    2016-01-01

    ErbB4 is an oncogene belonging to the epidermal growth factor receptor family and contributes to the occurrence and development of multiple cancers, such as gastric, breast, and colorectal cancers. Therefore, studies of the regulation of ErbB4 in cancerigenic pathway will advance molecular targeted therapy. Advanced bioinformatic analysis softwares, such as ExPASy, Predictprotei, QUARK, and I-TASSER, were used to analyze the regulatory mechanism after ErbB4 gene mutation in terms of amino acid sequence, primary, secondary, and tertiary structure of the protein and upstream-downstream receptor/ligands. Mutation of the 19th and 113th amino acids at the carboxyl terminus of ErbB4 protein did not affect its biological nature, but its secondary structure changed and protein binding sites were near 2 mutational sites; moreover, after mutation introduction, additional binding sites were observed. Tertiary structure modeling indicated that local structure of ErbB4 was changed from an α helical conformation into a β chain folding structure; the α helical conformation is the functional site of protein, while active sites are typically near junctions between helical regions, thus the helical structures are easily destroyed and change into folding structures or other structures after stretching. Mutable sites of ErbB4 is exact binding sites where dimer formed with other epidermal growth factor family proteins; mutation enabled the ErbB4 receptor to bind to neuregulin 1 ligand without dimer formation, disrupting the signal transduction pathway and affecting ErbB4 function. PMID:27323039

  7. Sleep-wake states and their regulatory mechanisms throughout early human development.

    PubMed

    Peirano, Patricio; Algarín, Cecilia; Uauy, Ricardo

    2003-10-01

    The emergence of sleep states is one of the most significant aspects of development. Descriptions of both neonatal and late fetal behavior and studies on the organization of sleep have shown that fetus and newborns exhibit spontaneously discrete and cyclic patterns of active sleep (AS) and quiet sleep (QS). Human fetuses and neonates sleep most of their life, and AS is the prevailing state even during the first postnatal months. Several hypotheses to explain central nervous system development consider that AS is the expression of a basic activation program for the central nervous system that increases the functional competence of neurons, circuits, and complex patterns before the organism is called on to use them. Current results indicate the maturation of QS not only coincides with the formation of thalamocortical and intracortical patterns of innervation and periods of heightened synaptogenesis, since this sleep state is also associated with important processes in synaptic remodeling. In fact, several studies suggest that the information acquired during wakefulness is further processed during AS and QS. This article reviews the processes involved in the timing of both AS/QS and sleep/wake alternating patterns throughout early human development. A growing body of evidence indicates that the duration of unmodulated parental care and noncircadian environmental conditions may be detrimental for the establishment of these basic rhythmicities. As a consequence, alterations in parental/environmental entraining factors may well contribute to disturb sleep and feeding commonly experienced by preterm infants. Further knowledge on the early establishment of sleep-wake states regulatory mechanisms is needed to improve modalities for appropriate stimulation in the developing human being. PMID:14597916

  8. Nitrous Oxide Metabolism in Nitrate-Reducing Bacteria: Physiology and Regulatory Mechanisms.

    PubMed

    Torres, M J; Simon, J; Rowley, G; Bedmar, E J; Richardson, D J; Gates, A J; Delgado, M J

    2016-01-01

    Nitrous oxide (N2O) is an important greenhouse gas (GHG) with substantial global warming potential and also contributes to ozone depletion through photochemical nitric oxide (NO) production in the stratosphere. The negative effects of N2O on climate and stratospheric ozone make N2O mitigation an international challenge. More than 60% of global N2O emissions are emitted from agricultural soils mainly due to the application of synthetic nitrogen-containing fertilizers. Thus, mitigation strategies must be developed which increase (or at least do not negatively impact) on agricultural efficiency whilst decrease the levels of N2O released. This aim is particularly important in the context of the ever expanding population and subsequent increased burden on the food chain. More than two-thirds of N2O emissions from soils can be attributed to bacterial and fungal denitrification and nitrification processes. In ammonia-oxidizing bacteria, N2O is formed through the oxidation of hydroxylamine to nitrite. In denitrifiers, nitrate is reduced to N2 via nitrite, NO and N2O production. In addition to denitrification, respiratory nitrate ammonification (also termed dissimilatory nitrate reduction to ammonium) is another important nitrate-reducing mechanism in soil, responsible for the loss of nitrate and production of N2O from reduction of NO that is formed as a by-product of the reduction process. This review will synthesize our current understanding of the environmental, regulatory and biochemical control of N2O emissions by nitrate-reducing bacteria and point to new solutions for agricultural GHG mitigation. PMID:27134026

  9. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    PubMed Central

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  10. [Progress of research in osteoarthritis. Gene expression and its regulatory mechanisms in the degenerative cartilage in osteoarthritis].

    PubMed

    Okazaki, Ken; Iwamoto, Yukihide

    2009-11-01

    Spatiotemporal variations of pathological changes were observed in the osteoarthritis joints. Gene expressions vary depending on the zones in the cartilage. For example, the expressions of degradative enzymes such as matrix metalloproteinases were enhanced in the superficial zone whereas the expression of matrix proteins enhanced at the deep zone. Many factors such as mechanical stress, aging, genetic background, inflammation and phenotypic changes of chondrocytes influence the pathogenesis of osteoarthritis, suggesting the involvement of many regulatory mechanisms in the gene expression. However, discoveries of regulatory factors that provide common pathways for the various phenomenon observed in the osteoarthritis cartilage suggest the interaction and co-operation of these important factors to conduct the pathology of degenerative cartilage. PMID:19880989

  11. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence

    PubMed Central

    Kinney, Justin B.; Murugan, Anand; Callan, Curtis G.; Cox, Edward C.

    2010-01-01

    Cells use protein-DNA and protein-protein interactions to regulate transcription. A biophysical understanding of this process has, however, been limited by the lack of methods for quantitatively characterizing the interactions that occur at specific promoters and enhancers in living cells. Here we show how such biophysical information can be revealed by a simple experiment in which a library of partially mutated regulatory sequences are partitioned according to their in vivo transcriptional activities and then sequenced en masse. Computational analysis of the sequence data produced by this experiment can provide precise quantitative information about how the regulatory proteins at a specific arrangement of binding sites work together to regulate transcription. This ability to reliably extract precise information about regulatory biophysics in the face of experimental noise is made possible by a recently identified relationship between likelihood and mutual information. Applying our experimental and computational techniques to the Escherichia coli lac promoter, we demonstrate the ability to identify regulatory protein binding sites de novo, determine the sequence-dependent binding energy of the proteins that bind these sites, and, importantly, measure the in vivo interaction energy between RNA polymerase and a DNA-bound transcription factor. Our approach provides a generally applicable method for characterizing the biophysical basis of transcriptional regulation by a specified regulatory sequence. The principles of our method can also be applied to a wide range of other problems in molecular biology. PMID:20439748

  12. An examination of the regulatory mechanism of Pxdn mutation-induced eye disorders using microarray analysis.

    PubMed

    Yang, Yang; Xing, Yiqiao; Liang, Chaoqun; Hu, Liya; Xu, Fei; Mei, Qi

    2016-06-01

    The present study aimed to identify biomarkers for peroxidasin (Pxdn) mutation-induced eye disorders and study the underlying mechanisms involved in this process. The microarray dataset GSE49704 was used, which encompasses 4 mouse samples from embryos with Pxdn mutation and 4 samples from normal tissues. After data preprocessing, the differentially expressed genes (DEGs) between Pxdn mutation and normal tissues were identified using the t-test in the limma package, followed by functional enrichment analysis. The protein-protein interaction (PPI) network was constructed based on the STRING database, and the transcriptional regulatory (TR) network was established using the GeneCodis database. Subsequently, the overlapping DEGs with high degrees in two networks were identified, as well as the sub-network extracted from the TR network. In total, 121 (75 upregulated and 46 downregulated) DEGs were identified, and these DEGs play important roles in biological processes (BPs), including neuron development and differentiation. A PPI network containing 25 nodes such as actin, alpha 1, skeletal muscle (Acta1) and troponin C type 2 (fast) (Tnnc2), and a TR network including 120 nodes were built. By comparing the two networks, seven crucial genes which overlapped were identified, including cyclin‑dependent kinase inhibitor 1B (Cdkn1b), Acta1 and troponin T type 3 (Tnnt3). In the sub-network, Cdkn1b was predicted as the target of miRNAs such as mmu-miR-24 and transcription factors (TFs) including forkhead box O4 (FOXO4) and activating enhancer binding protein 4 (AP4). Thus, we suggest that seven crucial genes, including Cdkn1b, Acta1 and Tnnt3, play important roles in the progression of eye disorders such as glaucoma. We suggest that Cdkn1b exert its effects via the inhibition of proliferation and is mediated by mmu-miR-24 and targeted by the TFs FOXO4 and AP4. PMID:27121343

  13. Identification and characterization of the novel Col10a1 regulatory mechanism during chondrocyte hypertrophic differentiation.

    PubMed

    Gu, J; Lu, Y; Li, F; Qiao, L; Wang, Q; Li, N; Borgia, J A; Deng, Y; Lei, G; Zheng, Q

    2014-01-01

    hypertrophic MCT cells. Electrophoretic mobility shift assay and chromatin immunoprecipitation assays confirmed the interaction between Cox-2 and Col10a1 cis-enhancer, supporting its role as a candidate Col10a1 regulator. Together, our data support a Cox-2-containing, Runx2-centered Col10a1 regulatory mechanism, during chondrocyte hypertrophic differentiation. PMID:25321476

  14. Protein-dependent regulation of feeding and metabolism.

    PubMed

    Morrison, Christopher D; Laeger, Thomas

    2015-05-01

    Free-feeding animals often face complex nutritional choices that require the balancing of competing nutrients, but the mechanisms driving macronutrient-specific food intake are poorly defined. A large number of behavioral studies indicate that both the quantity and quality of dietary protein can markedly influence food intake and metabolism, and that dietary protein intake may be prioritized over energy intake. This review focuses on recent progress in defining the mechanisms underlying protein-specific feeding. Considering the evidence that protein powerfully regulates both food intake and metabolism, uncovering these protein-specific mechanisms may reveal new molecular targets for the treatment of obesity and diabetes while also offering a more complete understanding of how dietary factors shape both food intake and food choice. PMID:25771038

  15. CHOOSING A CHEMICAL MECHANISM FOR REGULATORY AND RESEARCH AIR QUALITY MODELING APPLICATIONS

    EPA Science Inventory

    There are numerous, different chemical mechanisms currently available for use in air quality models, and new mechanisms and versions of mechanisms are continually being developed. The development of Morphecule-type mechanisms will add a near-infinite number of additional mecha...

  16. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms

    PubMed Central

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-01-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  17. Biofilm formation by Bacillus subtilis: new insights into regulatory strategies and assembly mechanisms.

    PubMed

    Cairns, Lynne S; Hobley, Laura; Stanley-Wall, Nicola R

    2014-08-01

    Biofilm formation is a social behaviour that generates favourable conditions for sustained survival in the natural environment. For the Gram-positive bacterium Bacillus subtilis the process involves the differentiation of cell fate within an isogenic population and the production of communal goods that form the biofilm matrix. Here we review recent progress in understanding the regulatory pathways that control biofilm formation and highlight developments in understanding the composition, function and structure of the biofilm matrix. PMID:24988880

  18. De Novo Evolution of Complex, Global and Hierarchical Gene Regulatory Mechanisms

    PubMed Central

    Jenkins, Dafyd J.

    2010-01-01

    Gene regulatory networks exhibit complex, hierarchical features such as global regulation and network motifs. There is much debate about whether the evolutionary origins of such features are the results of adaptation, or the by-products of non-adaptive processes of DNA replication. The lack of availability of gene regulatory networks of ancestor species on evolutionary timescales makes this a particularly difficult problem to resolve. Digital organisms, however, can be used to provide a complete evolutionary record of lineages. We use a biologically realistic evolutionary model that includes gene expression, regulation, metabolism and biosynthesis, to investigate the evolution of complex function in gene regulatory networks. We discover that: (i) network architecture and complexity evolve in response to environmental complexity, (ii) global gene regulation is selected for in complex environments, (iii) complex, inter-connected, hierarchical structures evolve in stages, with energy regulation preceding stress responses, and stress responses preceding growth rate adaptations and (iv) robustness of evolved models to mutations depends on hierarchical level: energy regulation and stress responses tend not to be robust to mutations, whereas growth rate adaptations are more robust and non-lethal when mutated. These results highlight the adaptive and incremental evolution of complex biological networks, and the value and potential of studying realistic in silico evolutionary systems as a way of understanding living systems. Electronic supplementary material The online version of this article (doi:10.1007/s00239-010-9369-4) contains supplementary material, which is available to authorized users. PMID:20680619

  19. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands.

    PubMed

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  20. Role of Sodium Bicarbonate Cotransporters in Intracellular pH Regulation and Their Regulatory Mechanisms in Human Submandibular Glands

    PubMed Central

    Namkoong, Eun; Shin, Yong-Hwan; Bae, Jun-Seok; Choi, Seulki; Kim, Minkyoung; Kim, Nahyun; Hwang, Sung-Min; Park, Kyungpyo

    2015-01-01

    Sodium bicarbonate cotransporters (NBCs) are involved in the pH regulation of salivary glands. However, the roles and regulatory mechanisms among different NBC isotypes have not been rigorously evaluated. We investigated the roles of two different types of NBCs, electroneutral (NBCn1) and electrogenic NBC (NBCe1), with respect to pH regulation and regulatory mechanisms using human submandibular glands (hSMGs) and HSG cells. Intracellular pH (pHi) was measured and the pHi recovery rate from cell acidification induced by an NH4Cl pulse was recorded. Subcellular localization and protein phosphorylation were determined using immunohistochemistry and co-immunoprecipitation techniques. We determined that NBCn1 is expressed on the basolateral side of acinar cells and the apical side of duct cells, while NBCe1 is exclusively expressed on the apical membrane of duct cells. The pHi recovery rate in hSMG acinar cells, which only express NBCn1, was not affected by pre-incubation with 5 μM PP2, an Src tyrosine kinase inhibitor. However, in HSG cells, which express both NBCe1 and NBCn1, the pHi recovery rate was inhibited by PP2. The apparent difference in regulatory mechanisms for NBCn1 and NBCe1 was evaluated by artificial overexpression of NBCn1 or NBCe1 in HSG cells, which revealed that the pHi recovery rate was only inhibited by PP2 in cells overexpressing NBCe1. Furthermore, only NBCe1 was significantly phosphorylated and translocated by NH4Cl, which was inhibited by PP2. Our results suggest that both NBCn1 and NBCe1 play a role in pHi regulation in hSMG acinar cells, and also that Src kinase does not regulate the activity of NBCn1. PMID:26375462

  1. Regulatory Role of Collagen V in Establishing Mechanical Properties of Tendons and Ligaments is Tissue-Dependent

    PubMed Central

    Connizzo, Brianne K.; Freedman, Benjamin R.; Fried, Joanna H.; Sun, Mei; Birk, David E.; Soslowsky, Louis J.

    2015-01-01

    Patients with classic (type I) Ehlers-Danlos Syndrome (EDS), characterized by heterozygous mutations in the Col5a1 and Col5a2 genes, exhibit connective tissue hyperelasticity and recurrent joint dislocations, indicating a potential regulatory role for collagen V in joint stabilizing soft tissues. This study asked whether the contribution of collagen V to the establishment of mechanical properties is tissue-dependent. We mechanically tested four different tissues from wild type and targeted collagen V-null mice: the flexor digitorum longus tendon (FDL), Achilles tendon (ACH), the anterior cruciate ligament (ACL) and the supraspinatus tendon (SST). Area was significantly reduced in the Col5a1ΔTen/ΔTen group in the FDL, ACH, and SST. Maximum load and stiffness were reduced in the Col5a1ΔTen/ΔTen group for all tissues. However, insertion site and midsubstance modulus were reduced only for the ACL and SST. This study provides evidence that the regulatory role of collagen V in extracellular matrix assembly is tissue-dependent and that joint instability in classic EDS may be caused in part by insufficient mechanical properties of the tendons and ligaments surrounding each joint. PMID:25876927

  2. Mechanisms of diabetic autoimmunity: II--Is diabetes a central or peripheral disorder of effector and regulatory cells?

    PubMed

    Askenasy, Nadir

    2016-02-01

    Two competing hypotheses aiming to explain the onset of autoimmune reactions are discussed in the context of genetic and environmental predisposition to type 1 diabetes (T1D). The first hypothesis has evolved along characterization of the mechanisms of self-discrimination and attributes diabetic autoimmunity to escape of reactive T cells from central regulation in the thymus. The second considers frequent occurrence of autoimmune reactions within the immune homunculus, which are adequately suppressed by regulatory T cells originating from the thymus, and occasionally, insufficient suppression results in autoimmunity. Besides thymic dysfunction, deregulation of both effector and suppressor cells can in fact result from homeostatic aberrations at the peripheral level during initial stages of evolution of adaptive immunity. Pathogenic cells sensitized in the islets are efficiently expanded in the target tissue and pancreatic lymph nodes of lymphopenic neonates. In parallel, the same mechanisms of peripheral sensitization contribute to tolerization through education of naïve/effector T cells and expansion of regulatory T cells. Experimental evidence presented for each individual mechanism implies that T1D may result from a primary effector or suppressor immune abnormality. Disturbed self-tolerance leading to T1D may well result from peripheral deregulation of innate and adaptive immunity, with variable contribution of central thymic dysfunction. PMID:26482052

  3. Activation of Vago by interferon regulatory factor (IRF) suggests an interferon system-like antiviral mechanism in shrimp

    PubMed Central

    Li, Chaozheng; Li, Haoyang; Chen, Yixiao; Chen, Yonggui; Wang, Sheng; Weng, Shao-Ping; Xu, Xiaopeng; He, Jianguo

    2015-01-01

    There is a debate on whether invertebrates possess an antiviral immunity similar to the interferon (IFN) system of vertebrates. The Vago gene from arthropods encodes a viral-activated secreted peptide that restricts virus infection through activating the JAK-STAT pathway and is considered to be a cytokine functionally similar to IFN. In this study, the first crustacean IFN regulatory factor (IRF)-like gene was identified in Pacific white shrimp, Litopenaeus vannamei. The L. vannamei IRF showed similar protein nature to mammalian IRFs and could be activated during virus infection. As a transcriptional regulatory factor, L. vannamei IRF could activate the IFN-stimulated response element (ISRE)-containing promoter to regulate the expression of mammalian type I IFNs and initiate an antiviral state in mammalian cells. More importantly, IRF could bind the 5′-untranslated region of L. vannamei Vago4 gene and activate its transcription, suggesting that shrimp Vago may be induced in a similar manner to that of IFNs and supporting the opinion that Vago might function as an IFN-like molecule in invertebrates. These suggested that shrimp might possess an IRF-Vago-JAK/STAT regulatory axis, which is similar to the IRF-IFN-JAK/STAT axis of vertebrates, indicating that invertebrates might possess an IFN system-like antiviral mechanism. PMID:26459861

  4. Mosaic gene network modelling identified new regulatory mechanisms in HCV infection.

    PubMed

    Popik, Olga V; Petrovskiy, Evgeny D; Mishchenko, Elena L; Lavrik, Inna N; Ivanisenko, Vladimir A

    2016-06-15

    Modelling of gene networks is widely used in systems biology to study the functioning of complex biological systems. Most of the existing mathematical modelling techniques are useful for analysis of well-studied biological processes, for which information on rates of reactions is available. However, complex biological processes such as those determining the phenotypic traits of organisms or pathological disease processes, including pathogen-host interactions, involve complicated cross-talk between interacting networks. Furthermore, the intrinsic details of the interactions between these networks are often missing. In this study, we developed an approach, which we call mosaic network modelling, that allows the combination of independent mathematical models of gene regulatory networks and, thereby, description of complex biological systems. The advantage of this approach is that it allows us to generate the integrated model despite the fact that information on molecular interactions between parts of the model (so-called mosaic fragments) might be missing. To generate a mosaic mathematical model, we used control theory and mathematical models, written in the form of a system of ordinary differential equations (ODEs). In the present study, we investigated the efficiency of this method in modelling the dynamics of more than 10,000 simulated mosaic regulatory networks consisting of two pieces. Analysis revealed that this approach was highly efficient, as the mean deviation of the dynamics of mosaic network elements from the behaviour of the initial parts of the model was less than 10%. It turned out that for construction of the control functional, data on perturbation of one or two vertices of the mosaic piece are sufficient. Further, we used the developed method to construct a mosaic gene regulatory network including hepatitis C virus (HCV) as the first piece and the tumour necrosis factor (TNF)-induced apoptosis and NF-κB induction pathways as the second piece. Thus

  5. Mechanisms and treatment of allergic disease in the big picture of regulatory T cells.

    PubMed

    Akdis, Cezmi A; Akdis, Mübeccel

    2009-04-01

    Various populations of regulatory T (Treg) cells have been shown to play a central role in the maintenance of peripheral homeostasis and the establishment of controlled immune responses. Their identification as key regulators of immunologic processes in peripheral tolerance to allergens has opened an important era in the prevention and treatment of allergic diseases. Both naturally occurring CD4+CD25+ Treg cells and inducible populations of allergen-specific, IL-10-secreting Treg type 1 (T(R)1) cells inhibit allergen-specific effector cells in experimental models. Skewing of allergen-specific effector T cells to a regulatory phenotype appears to be a key event in the development of healthy immune response to allergens and successful outcome in allergen-specific immunotherapy. Forkhead box protein 3-positive CD4+CD25+ Treg cells and T(R)1 cells contribute to the control of allergen-specific immune responses in several major ways, which can be summarized as suppression of dendritic cells that support the generation of effector T cells; suppression of effector T(H)1, T(H)2, and T(H)17 cells; suppression of allergen-specific IgE and induction of IgG4; suppression of mast cells, basophils, and eosinophils; interaction with resident tissue cells and remodeling; and suppression of effector T-cell migration to tissues. Current strategies for drug development and allergen-specific immunotherapy exploit these observations, with the potential for preventive therapies and cure for allergic diseases. PMID:19348912

  6. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  7. Analysis of the dual regulatory mechanisms controlling expression of the vegetative catalase gene of Bacillus subtilis.

    PubMed Central

    Bol, D K; Yasbin, R E

    1994-01-01

    The expression of a vegetative catalase gene, katA (formerly the kat-19 gene), is necessary to protect Bacillus subtilis from H2O2, presumably by removing the oxidant from the environment. Genetic analysis of katA revealed that this gene is under two distinct forms of regulation, temporal and H2O2 inducible. The results reported here demonstrate that (i) the H2O2-inducible regulation of katA gene is not a component of the SOS regulon, (ii) the regulatory genes spo0A and abrB are involved in the temporal regulation but not the H2O2-specific induction of katA gene expression, and (iii) transcription initiation for the katA gene occurs at the same site under both forms of regulation. Images PMID:7961428

  8. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis

    PubMed Central

    Jones, Danielle M.; Murray, Christian M.; Ketelaar, KassaDee J.; Thomas, Joseph J.; Villalobos, Jose A.; Wallace, Ian S.

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  9. The Emerging Role of Protein Phosphorylation as a Critical Regulatory Mechanism Controlling Cellulose Biosynthesis.

    PubMed

    Jones, Danielle M; Murray, Christian M; Ketelaar, KassaDee J; Thomas, Joseph J; Villalobos, Jose A; Wallace, Ian S

    2016-01-01

    Plant cell walls are extracellular matrices that surround plant cells and critically influence basic cellular processes, such as cell division and expansion. Cellulose is a major constituent of plant cell walls, and this paracrystalline polysaccharide is synthesized at the plasma membrane by a large protein complex known as the cellulose synthase complex (CSC). Recent efforts have identified numerous protein components of the CSC, but relatively little is known about regulation of cellulose biosynthesis. Numerous phosphoproteomic surveys have identified phosphorylation events in CSC associated proteins, suggesting that protein phosphorylation may represent an important regulatory control of CSC activity. In this review, we discuss the composition and dynamics of the CSC in vivo, the catalog of CSC phosphorylation sites that have been identified, the function of experimentally examined phosphorylation events, and potential kinases responsible for these phosphorylation events. Additionally, we discuss future directions in cellulose synthase kinase identification and functional analyses of CSC phosphorylation sites. PMID:27252710

  10. Regulatory mechanisms of ethylene biosynthesis in response to various stimuli during maturation and ripening in fig fruit (Ficus carica L.).

    PubMed

    Owino, W O; Manabe, Y; Mathooko, F M; Kubo, Y; Inaba, A

    2006-01-01

    In order to obtain a greater uniformity of maturation, the growth of the fig fruit (Ficus carica L.) can be stimulated by the application of either olive oil, ethrel/ethephon or auxin. The three treatments induce ethylene production in figs. In this study, we investigated the regulatory mechanisms responsible for oil, auxin and ethylene induced ethylene production in figs. The ethylene production in response to olive oil, auxin, and propylene treatments and during ripening were all induced by 1-methylcyclopropene (1-MCP) and inhibited by propylene indicating a negative feedback regulation mechanism. Three 1-aminocyclopropane-1-carboxylic acid (ACC) synthase genes (Fc-ACS1, Fc-ACS2 and Fc-ACS3) and one ACC oxidase gene (Fc-ACO1) were isolated and their expression patterns in response to either oil, propylene or auxin treatment in figs determined. The expression patterns of Fc-ACS1 and Fc-ACO1 were clearly inhibited by 1-MCP and induced by propylene in oil treated and ripe fruits indicating positive regulation by ethylene, whereas Fc-ACS2 gene expression was induced by 1-MCP and inhibited by propylene indicating negative regulation by ethylene. The Fc-ACS3 mRNA showed high level accumulation in the auxin treated fruit. The inhibition of Fc-ACS3 gene by 1-MCP in oil treated and in ripe fruits suggests that auxin and ethylene modulate the expression of this gene by multi-responsive signal transduction pathway mechanisms. We further report that the olive oil-induced ethylene in figs involves the ACC-dependent pathway and that multiple ethylene regulatory pathways are involved during maturation and ripening in figs and each specific pathway depends on the inducer/stimulus. PMID:16889975

  11. Overexpression of Heat Shock Protein 72 Attenuates NF-κB Activation Using a Combination of Regulatory Mechanisms in Microglia

    PubMed Central

    Khammash, Mustafa; Giffard, Rona G.

    2014-01-01

    Overexpression of the inducible heat shock protein 70, Hsp72, has broadly cytoprotective effects and improves outcome following stroke. A full understanding of how Hsp72 protects cells against injury is elusive, though several distinct mechanisms are implicated. One mechanism is its anti-inflammatory effects. We study the effects of Hsp72 overexpression on activation of the transcription factor NF-κB in microglia combining experimentation and mathematical modeling, using TNFα to stimulate a microglial cell line stably overexpressing Hsp72. We find that Hsp72 overexpression reduces the amount of NF-κB DNA binding activity, activity of the upstream kinase IKK, and amount of IκBα inhibitor phosphorylated following TNFα application. Simulations evaluating several proposed mechanisms suggest that inhibition of IKK activation is an essential component of its regulatory activities. Unexpectedly we find that Hsp72 overexpression reduces the initial amount of the RelA/p65 NF-κB subunit in cells, contributing to the attenuated response. Neither mechanism in isolation, however, is sufficient to attenuate the response, providing evidence that Hsp72 relies upon multiple mechanisms to attenuate NF-κB activation. An additional observation from our study is that the induced expression of IκBα is altered significantly in Hsp72 expressing cells. While the mechanism responsible for this observation is not known, it points to yet another means by which Hsp72 may alter the NF-κB response. This study illustrates the multi-faceted nature of Hsp72 regulation of NF-κB activation in microglia and offers further clues to a novel mechanism by which Hsp72 may protect cells against injury. PMID:24516376

  12. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium.

    PubMed

    Mazin, Pavel V; Fisunov, Gleb Y; Gorbachev, Alexey Y; Kapitskaya, Kristina Y; Altukhov, Ilya A; Semashko, Tatiana A; Alexeev, Dmitry G; Govorun, Vadim M

    2014-12-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3'-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  13. The Hematopoietic Stem and Progenitor Cell Cistrome: GATA Factor-Dependent cis-Regulatory Mechanisms.

    PubMed

    Hewitt, K J; Johnson, K D; Gao, X; Keles, S; Bresnick, E H

    2016-01-01

    Transcriptional regulators mediate the genesis and function of the hematopoietic system by binding complex ensembles of cis-regulatory elements to establish genetic networks. While thousands to millions of any given cis-element resides in a genome, how transcriptional regulators select these sites and how site attributes dictate functional output is not well understood. An instructive system to address this problem involves the GATA family of transcription factors that control vital developmental and physiological processes and are linked to multiple human pathologies. Although GATA factors bind DNA motifs harboring the sequence GATA, only a very small subset of these abundant motifs are occupied in genomes. Mechanistic studies revealed a unique configuration of a GATA factor-regulated cis-element consisting of an E-box and a downstream GATA motif separated by a short DNA spacer. GATA-1- or GATA-2-containing multiprotein complexes at these composite elements control transcription of genes critical for hematopoietic stem cell emergence in the mammalian embryo, hematopoietic progenitor cell regulation, and erythroid cell maturation. Other constituents of the complex include the basic helix-loop-loop transcription factor Scl/TAL1, its heterodimeric partner E2A, and the Lim domain proteins LMO2 and LDB1. This chapter reviews the structure/function of E-box-GATA composite cis-elements, which collectively constitute an important sector of the hematopoietic stem and progenitor cell cistrome. PMID:27137654

  14. Site-specific silencing of regulatory elements as a mechanism of X inactivation.

    PubMed

    Calabrese, J Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E; Magnuson, Terry

    2012-11-21

    The inactive X chromosome's (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequences is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to nontranscribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X inactivation occurred within, and X inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  15. Site-specific silencing of regulatory elements as a mechanism of X-inactivation

    PubMed Central

    Calabrese, J. Mauro; Sun, Wei; Song, Lingyun; Mugford, Joshua W.; Williams, Lucy; Yee, Della; Starmer, Joshua; Mieczkowski, Piotr; Crawford, Gregory E.; Magnuson, Terry

    2012-01-01

    The inactive X chromosome’s (Xi) physical territory is microscopically devoid of transcriptional hallmarks and enriched in silencing-associated modifications. How these microscopic signatures relate to specific Xi sequence is unknown. Therefore, we profiled Xi gene expression and chromatin states at high resolution via allele-specific sequencing in mouse trophoblast stem cells. Most notably, X-inactivated transcription start sites harbored distinct epigenetic signatures relative to surrounding Xi DNA. These sites displayed H3-lysine27-trimethylation enrichment and DNaseI hypersensitivity, similar to autosomal Polycomb targets, yet excluded Pol II and other transcriptional hallmarks, similar to non-transcribed genes. CTCF bound X-inactivated and escaping genes, irrespective of measured chromatin boundaries. Escape from X-inactivation occurred within, and X-inactivation was maintained exterior to, the area encompassed by Xist in cells subject to imprinted and random X-inactivation. The data support a model whereby inactivation of specific regulatory elements, rather than a simple chromosome-wide separation from transcription machinery, governs gene silencing over the Xi. PMID:23178118

  16. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues

    PubMed Central

    Suzuki, Takashi; Swift, Larry L.

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5′-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5′-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  17. Transcriptome analysis reveals novel regulatory mechanisms in a genome-reduced bacterium

    PubMed Central

    Mazin, Pavel V.; Fisunov, Gleb Y.; Gorbachev, Alexey Y.; Kapitskaya, Kristina Y.; Altukhov, Ilya A.; Semashko, Tatiana A.; Alexeev, Dmitry G.; Govorun, Vadim M.

    2014-01-01

    The avian bacterial pathogen Mycoplasma gallisepticum is a good model for systems studies due to small genome and simplicity of regulatory pathways. In this study, we used RNA-Seq and MS-based proteomics to accurately map coding sequences, transcription start sites (TSSs) and transcript 3′-ends (T3Es). We used obtained data to investigate roles of TSSs and T3Es in stress-induced transcriptional responses. We identified 1061 TSSs at a false discovery rate of 10% and showed that almost all transcription in M. gallisepticum is initiated from classic TATAAT promoters surrounded by A/T-rich sequences. Our analysis revealed the pronounced operon structure complexity: on average, each coding operon has one internal TSS and T3Es in addition to the primary ones. Our transcriptomic approach based on the intervals between the two nearest transcript ends allowed us to identify two classes of T3Es: strong, unregulated, hairpin-containing T3Es and weak, heat shock-regulated, hairpinless T3Es. Comparing gene expression levels under different conditions revealed widespread and divergent transcription regulation in M. gallisepticum. Modeling suggested that the core promoter structure plays an important role in gene expression regulation. We have shown that the heat stress activation of cryptic promoters combined with the hairpinless T3Es suppression leads to widespread, seemingly non-functional transcription. PMID:25361977

  18. Discovery of Novel Splice Variants and Regulatory Mechanisms for Microsomal Triglyceride Transfer Protein in Human Tissues.

    PubMed

    Suzuki, Takashi; Swift, Larry L

    2016-01-01

    Microsomal triglyceride transfer protein (MTP) is a unique lipid transfer protein essential for the assembly of triglyceride-rich lipoproteins by the liver and intestine. Previous studies in mice identified a splice variant of MTP with an alternate first exon. Splice variants of human MTP have not been reported. Using PCR approaches we have identified two splice variants in human tissues, which we have named MTP-B and MTP-C. MTP-B has a unique first exon (Ex1B) located 10.5 kb upstream of the first exon (Ex1A) for canonical MTP (MTP-A); MTP-C contains both first exons for MTP-A and MTP-B. MTP-B was found in a number of tissues, whereas MTP-C was prominent in brain and testis. MTP-B does not encode a protein; MTP-C encodes the same protein encoded by MTP-A, although MTP-C translation is strongly inhibited by regulatory elements within its 5'-UTR. Using luciferase assays, we demonstrate that the promoter region upstream of exon 1B is quite adequate to drive expression of MTP. We conclude that alternate splicing plays a key role in regulating cellular MTP levels by introducing distinct promoter regions and unique 5'-UTRs, which contain elements that alter translation efficiency, enabling the cell to optimize MTP activity. PMID:27256115

  19. On multiple regulatory mechanisms in the tryptophan operon system in Escherichia coli: in silico study of perturbation dynamics.

    PubMed

    Nguyen, Lan K; Kulasiri, Don

    2008-01-01

    Living organisms often exist in uncertain environments where changes are the norm. Cellular systems therefore require resilient regulatory mechanisms for timely and stable adaptation. Among various regulation motifs, multiple feedback control emerges as a common theme. The tryptophan operon system in Escherichia coli regulates the production ofintracellular tryptophan using an apparatus of three feedback mechanisms: repression, attenuation and enzyme inhibition; each provides essentially the same function but operates in distinctly different ways. Here we aim to understand the roles of each loop by studying transient dynamics of the system to perturbations of different types; to reveal the underlying relationships between individual control mechanisms and macroscopic behaviour. We develop an S-systems approximation of an existing model for the system and characterise transient dynamics by introducing two measurable quantities: maximum disturbance (MD) and recovery time (RT). Our simulation results showed that combined regulation using all three feedback mechanisms significantly increases system stability, broadening the range of kinetic parameters for stable behaviour. Enzyme inhibition was shown to directly control the disturbance level in system variables after perturbations. Attenuation, on the other hand, was found to speed up system recovery whereas repression lengthens recovery time. The method developed in this paper and the defined transient dynamics measurements can be applied to other cellular systems. PMID:19374133

  20. The regulatory role of cell mechanics for migration of differentiating myeloid cells.

    PubMed

    Lautenschläger, Franziska; Paschke, Stephan; Schinkinger, Stefan; Bruel, Arlette; Beil, Michael; Guck, Jochen

    2009-09-15

    Migration of cells is important for tissue maintenance, immune response, and often altered in disease. While biochemical aspects, including cell adhesion, have been studied in detail, much less is known about the role of the mechanical properties of cells. Previous measurement methods rely on contact with artificial surfaces, which can convolute the results. Here, we used a non-contact, microfluidic optical stretcher to study cell mechanics, isolated from other parameters, in the context of tissue infiltration by acute promyelocytic leukemia (APL) cells, which occurs during differentiation therapy with retinoic acid. Compliance measurements of APL cells reveal a significant softening during differentiation, with the mechanical properties of differentiated cells resembling those of normal neutrophils. To interfere with the migratory ability acquired with the softening, differentiated APL cells were exposed to paclitaxel, which stabilizes microtubules. This treatment does not alter compliance but reduces cell relaxation after cessation of mechanical stress six-fold, congruent with a significant reduction of motility. Our observations imply that the dynamical remodeling of cell shape required for tissue infiltration can be frustrated by stiffening the microtubular system. This link between the cytoskeleton, cell mechanics, and motility suggests treatment options for pathologies relying on migration of cells, notably cancer metastasis. PMID:19717452

  1. Understanding gene regulatory mechanisms by integrating ChIP-seq and RNA-seq data: statistical solutions to biological problems

    PubMed Central

    Angelini, Claudia; Costa, Valerio

    2014-01-01

    The availability of omic data produced from international consortia, as well as from worldwide laboratories, is offering the possibility both to answer long-standing questions in biomedicine/molecular biology and to formulate novel hypotheses to test. However, the impact of such data is not fully exploited due to a limited availability of multi-omic data integration tools and methods. In this paper, we discuss the interplay between gene expression and epigenetic markers/transcription factors. We show how integrating ChIP-seq and RNA-seq data can help to elucidate gene regulatory mechanisms. In particular, we discuss the two following questions: (i) Can transcription factor occupancies or histone modification data predict gene expression? (ii) Can ChIP-seq and RNA-seq data be used to infer gene regulatory networks? We propose potential directions for statistical data integration. We discuss the importance of incorporating underestimated aspects (such as alternative splicing and long-range chromatin interactions). We also highlight the lack of data benchmarks and the need to develop tools for data integration from a statistical viewpoint, designed in the spirit of reproducible research. PMID:25364758

  2. TGF-β-Induced Regulatory T Cells Directly Suppress B Cell Responses through a Noncytotoxic Mechanism.

    PubMed

    Xu, Anping; Liu, Ya; Chen, Weiqian; Wang, Julie; Xue, Youqiu; Huang, Feng; Rong, Liming; Lin, Jin; Liu, Dahai; Yan, Mei; Li, Quan-Zhen; Li, Bin; Song, Jianxun; Olsen, Nancy; Zheng, Song Guo

    2016-05-01

    Foxp3(+) regulatory T cells (Treg) playing a crucial role in the maintenance of immune tolerance and prevention of autoimmune diseases consist of thymus-derived naturally occurring CD4(+)Foxp3(+) Treg cells (nTreg) and those that can be induced ex vivo with TGF-β (iTreg). Although both Treg subsets share similar phenotypes and functional characteristics, they also have potential biologic differences on their biology. The role of iTreg in regulating B cells remains unclear so far. The suppression assays of Treg subsets on activation, proliferation, and Abs production of B cells were measured using a Treg and B cell coculture system in vitro. Transwell and Ab blockade experiments were performed to assess the roles of cell contact and soluble cytokines. Treg were adoptively transferred to lupus mice to assess in vivo effects on B cells. Like nTreg, iTreg subset also directly suppressed activation and proliferation of B cells. nTreg subset suppressed B cell responses through cytotoxic manner related to expression of granzyme A, granzyme B, and perforin, whereas the role of iTreg subset on B cells did not involve in cytotoxic action but depending on TGF-β signaling. Furthermore, iTreg subset can significantly suppress Ab produced by lupus B cells in vitro. Comparison experiments using autoantibodies microarrays demonstrated that adoptive transfer of iTreg had a superior effect than nTreg subset on suppressing lupus B cell responses in vivo. Our data implicate a role and advantage of iTreg subset in treating B cell-mediated autoimmune diseases, boosting the translational potential of these findings. PMID:27001954

  3. [VEGETATIVE REGULATORY MECHANISMS IN DIFFERENT GEOMAGNETIC CONDITIONS DEPENDING ON A DEGREE OF PHYSICAL CONDITIONING].

    PubMed

    Kvachadze, I; Tsibadze, A; Sanadiradze, G; Mzhavanadze, D; Chichinadze, G

    2016-04-01

    The aim of the study was to evaluate the vegetative regulatory action in healthy, untrained and trained individuals in different geomagnetic conditions. The study involved 94 healthy untrained young men aged 18-22 years - I group (control), and 60 trained volunteers aged 18-25 years - II group, who during the period of the study and for at least three years prior have been following active regular physical exercise regimen(weight lifting), but were not professional athletes. In order to evaluate the heart rate variability the following statistical indicators were studied: arithmetic mean, the arithmetic mean of the error variance, dispersion, the arithmetic mean deviation, coefficient of skewness, kurtosis, standard deviation of the mean. Geometric analysis was performed using a variation pulsometry. All the individuals were studied in natural/tranquil conditions, during naturally occuring or a simulated geomagnetic storm, which provided the use of the characteristics of vegetative balance as a marker for differential assessment of the impact of electromagnetic field (EMF). The forecast of natural geomagnetic conditions had been made at least three days before the study. Under the conditions of simulated geomagnetic storm the test subjects were placed in a solenoid with non-magnetic equipment. EMF inductance in the solenoid corresponded to the geomagnetic storm frequencies. The study had a nature of social experiment and was carried out by a single blind method: tested subjects were unaware of geomagnetic conditions during the study. This was an open, three-step, cohort, prospective study with parallel character. The results showed that under the uniform qualitative conditions (balanced, in particular) of initial state of vegetative equilibrium, the level of fitness of the human body determines the differentiated response to EMF exposure. Thus, with the possible inclusion of the EMF in the complex of therapeutic or preventive measures, it is necessary to predict

  4. Single-Nucleotide Mutations in FMR1 Reveal Novel Functions and Regulatory Mechanisms of the Fragile X Syndrome Protein FMRP

    PubMed Central

    Suhl, Joshua A.; Warren, Stephen T.

    2015-01-01

    Fragile X syndrome is a monogenic disorder and a common cause of intellectual disability. Despite nearly 25 years of research on FMR1, the gene underlying the syndrome, very few pathological mutations other than the typical CGG-repeat expansion have been reported. This is in contrast to other X-linked, monogenic, intellectual disability disorders, such as Rett syndrome, where many point mutations have been validated as causative of the disorder. As technology has improved and significantly driven down the cost of sequencing, allowing for whole genes to be sequenced with relative ease, in-depth sequencing studies on FMR1 have recently been performed. These studies have led to the identification of novel variants in FMR1, where some of which have been functionally evaluated and are likely pathogenic. In this review, we discuss recently identified FMR1 variants, the ways these novel variants cause dysfunction, and how they reveal new regulatory mechanisms and functionalities of the gene. PMID:26819560

  5. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods

    NASA Astrophysics Data System (ADS)

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay; Chatterjee, Suvro; Patra, Chitta Ranjan

    2015-05-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role.Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular

  6. The Potential Regulatory Mechanisms of miR-196a in Huntington’s Disease through Bioinformatic Analyses

    PubMed Central

    Tsai, Shaw-Jeng; Lai, Yen-Yu; Chang, Yu-Fan; Cheng, Pei-Hsun; Chen, Chuan-Mu; Yang, Shang-Hsun

    2015-01-01

    High throughput screening is a powerful tool to identify the potential candidate molecules involved during disease progression. However, analysis of complicated data is one of the most challenging steps on the way to obtaining useful results from this approach. Previously, we showed that a specific miRNA, miR-196a, could ameliorate the pathological phenotypes of Huntington’s disease (HD) in different models, and performed high throughput screening by using the striatum of transgenic mice. In this study, we further tried to identify the potential regulatory mechanisms using different bioinformatic tools, including Database for Annotation, Visualization and Integrated Discovery (DAVID), Molecular Signatures Database (MSigDB), TargetScan and MetaCore. The results showed that miR-196a dominantly altered “ABC transporters”, “RIG-I-like receptor signaling pathway”, immune system”, “adaptive immune system”,“tissue remodeling and wound repair” and “cytoskeleton remodeling”. In addition, miR-196a also changed the expression of several well-defined pathways of HD, such as apoptosis and cell adhesion. Since these analyses showed the regulatory pathways are highly related to the modification of the cytoskeleton, we further confirmed that miR-196a could enhance the neurite outgrowth in neuroblastoma cells, suggesting miR-196a might provide beneficial functions through the alteration of cytoskeleton structures. Since impairment of the cytoskeleton has been reported in several neuronal diseases, this study will provide not only the potential working mechanisms of miR-196a but also insights for therapeutic strategies for use with different neuronal diseases. PMID:26376480

  7. [Research Progress of NOS3 Participation in Regulatory Mechanisms of Cardiovascular Diseases].

    PubMed

    Sun, Ting; Chi, Qingjia; Wang, Guixue

    2016-02-01

    Cardiovascular disease has been a major threat to human's health and lives for many years. It is of great importance to explore the mechanisms and develop strategies to prevent the pathogenesis. Generally, cardiovascular disease is associated with endothelial dysfunction, which is closely related to the nitric oxide (NO)-mediated vasodilatation. The release of NO is regulated by NOS3 gene in mammals' vascular system. A great deal of evidences have shown that the polymorphism and epigenetic of NOS3 gene play vital roles in the pathological process of cardiovascular disease. To gain insights into the role of NOS3 in the cardiovascular diseases, we reviewed the molecular mechanisms underlying the development of cardiovascular diseases in this paper, including the uncoupling of NOS3 protein, epigenetic and polymorphism of NOS3 gene. The review can also offer possible strategies to prevent and treat cardiovascular diseases. PMID:27382763

  8. Hypoxia stimulates urokinase receptor expression through a heme protein-dependent pathway.

    PubMed

    Graham, C H; Fitzpatrick, T E; McCrae, K R

    1998-05-01

    Hypoxia underlies a number of biologic processes in which cellular migration and invasion occur. Because earlier studies have shown that the receptor for urokinase-type plasminogen activator (uPAR) may facilitate such events, we studied the effect of hypoxia on the expression of uPAR by first trimester human trophoblasts (HTR-8/SVneo) and human umbilical vein endothelial cells (HUVEC). Compared with control cells cultured under standard conditions (20% O2), HTR-8/SVneo cells and HUVEC cultured in 1% O2 expressed more uPAR, as determined by flow cytometric and [125I]-prourokinase ligand binding analyses. Increased uPAR expression paralleled increases in uPAR mRNA. The involvement of a heme protein in the hypoxia-induced expression of uPAR was suggested by the observations that culture of cells with cobalt chloride, or sodium 4, 5-dihydroxybenzene-1,3-disulfonate (Tiron), an iron-chelating agent, also stimulated uPAR expression, and that the hypoxia-induced uPAR expression was inhibited by adding carbon monoxide to the hypoxic atmosphere. Culture of HTR-8/SVneo cells with vascular endothelial growth factor (VEGF) did not increase uPAR mRNA levels, suggesting that the hypoxia-mediated effect on uPAR expression by these cells did not occur through a VEGF-dependent mechanism. The functional importance of these findings is suggested by the fact that HTR-8/SVneo cells cultured under hypoxia displayed higher levels of cell surface plasminogen activator activity and greater invasion through a reconstituted basement membrane. These results suggest that hypoxia may promote cellular invasion by stimulating the expression of uPAR through a heme protein-dependent pathway. PMID:9558386

  9. Regulatory mechanism of the three-component system HptRSA in glucose-6-phosphate uptake in Staphylococcus aureus.

    PubMed

    Yang, Yifan; Sun, Haipeng; Liu, Xiaoyu; Wang, Mingxing; Xue, Ting; Sun, Baolin

    2016-06-01

    Glucose-6-phosphate (G6P) is a common alternative carbon source for various bacteria, and its uptake usually relies on the hexose phosphate antiporter UhpT. In the human pathogenic bacterium Staphylococcus aureus, the ability to utilize different nutrients, particularly alternative carbon source uptake in glucose-limiting conditions, is essential for its fitness in the host environment during the infectious process. It has been reported that G6P uptake in S. aureus is regulated by the three-component system HptRSA. When G6P is provided as the only carbon source, HptRSA could sense extracellular G6P and activate uhpT expression to facilitate G6P utilization. However, the regulatory mechanism of HptRSA is still unclear. In this study, we further investigated the HptRSA system in S. aureus. First, we confirmed that HptRSA is necessary for the normal growth of this pathogen in chemically defined medium with G6P supplementation, and we discovered that HptRSA could exclusively sense extracellular G6P compared to the other organophosphates we tested. Next, using isothermal titration calorimetry, we found that HptA could bind to G6P, suggesting that it may be the G6P sensor. After that experiment, using an electrophoresis mobility shift assay, we verified that the response regulator HptR could directly bind to the uhpT promoter and identified a putative binding site from -67 to -96-bp. Subsequently, we created different point mutations in the putative binding site and revealed that the entire 30-bp sequence is essential for HptR regulation. In summary, we unveiled the regulatory mechanism of the HptRSA system in S. aureus, HptA most likely functions as the G6P sensor, and HptR could implement its regulatory function by directly binding to a conserved, approximately 30-bp sequence in the uhpT promoter. PMID:26711125

  10. Investigation of molecular mechanisms and regulatory pathways of pro-angiogenic nanorods†

    PubMed Central

    Nethi, Susheel Kumar; Veeriah, Vimal; Barui, Ayan Kumar; Rajendran, Saranya; Mattapally, Saidulu; Misra, Sanjay

    2016-01-01

    Angiogenesis, a process involving the growth of new blood vessels from the pre-existing vasculature, plays a crucial role in various pathophysiological conditions. We have previously demonstrated that europium hydroxide [EuIII(OH)3] nanorods (EHNs) exhibit pro-angiogenic properties through the generation of reactive oxygen species (ROS) and mitogen activated protein kinase (MAPK) activation. Considering the enormous implication of angiogenesis in cardiovascular diseases (CVDs) and cancer, it is essential to understand in-depth molecular mechanisms and signaling pathways in order to develop the most efficient and effective alternative treatment strategy for CVDs. However, the exact underlying mechanism and cascade signaling pathways behind the pro-angiogenic properties exhibited by EHNs still remain unclear. Herein, we report for the first time that the hydrogen peroxide (H2O2), a redox signaling molecule, generated by these EHNs activates the endothelial nitric oxide synthase (eNOS) that promotes the nitric oxide (NO) production in a PI3K (phosphoinositide 3-kinase)/Akt dependent manner, eventually triggering angiogenesis. We intensely believe that the investigation and understanding of the in-depth molecular mechanism and signaling pathways of EHNs induced angiogenesis will help us in developing an effective alternative treatment strategy for cardiovascular related and ischemic diseases where angiogenesis plays an important role. PMID:25963768

  11. Identification of Novel Pretranslational Regulatory Mechanisms for NF-κB Activation*

    PubMed Central

    Huang, Xiao; Gong, Ren; Li, Xinyuan; Virtue, Anthony; Yang, Fan; Yang, Irene H.; Tran, Anh H.; Yang, Xiao-Feng; Wang, Hong

    2013-01-01

    NF-κB-controlled transcriptional regulation plays a central role in inflammatory and immune responses. Currently, understanding about NF-κB activation mechanism emphasizes IκB-tethered complex inactivation in the cytoplasm. In the case of NF-κB activation, IκB phosphorylation leads to its degradation, followed by NF-κB relocation to the nucleus and trans-activation of NF-κB-targeted genes. Pretranslational mechanism mediated NF-κB activation remains poorly understood. In this study, we investigated NF-κB pretranslational regulation by performing a series of database mining analyses and using six large national experimental databases (National Center of Biotechnology Information UniGene expressed sequence tag profile database, Gene Expression Omnibus database, Transcription Element Search System database, AceView database, and Epigenomics database) and TargetScan software. We reported the following findings: 1) NF-κB-signaling genes are differentially expressed in human and mouse tissues; 2) heart and vessels are the inflammation-privileged tissues and less easy to be inflamed because lacking in key NF-κB-signaling molecular expression; 3) NF-κB-signaling genes are induced by cardiovascular disease risk factors oxidized phospholipids and proinflammatory cytokines in endothelial cells; 4) transcription factors CCAAT/enhancer-binding proteins and NF-κB have higher binding site frequencies in the promoters of proinflammatory cytokine-induced NF-κB genes; 5) most NF-κB-signaling genes have multiple alternative promoters and alternatively spliced isoforms; 6) NF-κB family genes can be regulated by DNA methylation; and 7) 27 of 38 NF-κB-signaling genes can be regulated by microRNAs. Our findings provide important insight into the mechanism of NF-κB activation, which may contribute to cardiovascular disease, inflammatory diseases, and immunological disorders. PMID:23515310

  12. Regulatory mechanisms of betacellulin in CXCL8 production from lung cancer cells

    PubMed Central

    2014-01-01

    Background Betacellulin (BTC), a member of the epidermal growth factor (EGF) family, binds and activates ErbB1 and ErbB4 homodimers. BTC was expressed in tumors and involved in tumor growth progression. CXCL8 (interleukin-8) was involved in tumor cell proliferation via the transactivation of the epidermal growth factor receptor (EGFR). Materials and methods The present study was designed to investigate the possible interrelation between BTC and CXCL8 in human lung cancer cells (A549) and demonstrated the mechanisms of intracellular signals in the regulation of both functions. Bio-behaviors of A549 were assessed using Cell-IQ Alive Image Monitoring System. Results We found that BTC significantly increased the production of CXCL8 through the activation of the EGFR-PI3K/Akt-Erk signal pathway. BTC induced the resistance of human lung cancer cells to TNF-α/CHX-induced apoptosis. Treatments with PI3K inhibitors, Erk1/2 inhibitor, or Erlotinib significantly inhibited BTC-induced CXCL8 production and cell proliferation and movement. Conclusion Our data indicated that CXCL8 production from lung cancer cells could be initiated by an autocrine mechanism or external sources of BTC through the EGFR–PI3K–Akt–Erk pathway to the formation of inflammatory microenvironment. BTC may act as a potential target to monitor and improve the development of lung cancer inflammation. PMID:24629040

  13. The chain-flipping mechanism of ACP (acyl carrier protein)-dependent enzymes appears universal.

    PubMed

    Cronan, John E

    2014-06-01

    ACPs (acyl carrier proteins) play essential roles in the synthesis of fatty acids, polyketides and non-ribosomal polypeptides. ACP function requires the modification of the protein by attachment of 4'-phosphopantetheine to a conserved serine residue. The phosphopantetheine thiol acts to tether the starting materials and intermediates as their thioesters. ACPs are small highly soluble proteins composed of four α-helices. The helices form a bundle that acts as a hydrophobic sleeve that sequesters the acyl chains and activated thioesters from solvent. However, in the synthesis of fatty acids and complex lipids the enzymes of the pathway must access the thioester and the proximal carbon atoms in order to perform the needed chemistry. How such access is provided without exposure of the acyl chains to solvent has been a longstanding question due to the lack of acyl-ACP-enzyme complexes, a situation generally attributed to the brevity of the interactions of acyl-ACPs with their cognate enzymes. As discussed in the present review the access question has now been answered by four recent crystal structures, each of which shows that the entire acyl chain plus the 4'-phosphopantetheine prosthetic group partitions from the ACP hydrophobic sleeve into a hydrophobic pocket or groove of the enzyme protein, a process termed chain flipping. PMID:24825445

  14. Dss1 Interaction with Brh2 as a Regulatory Mechanism for Recombinational Repair▿

    PubMed Central

    Zhou, Qingwen; Kojic, Milorad; Cao, Zhimin; Lisby, Michael; Mazloum, Nayef A.; Holloman, William K.

    2007-01-01

    Brh2, the BRCA2 ortholog in Ustilago maydis, enables recombinational repair of DNA by controlling Rad51 and is in turn regulated by Dss1. Interplay with Rad51 is conducted via the BRC element located in the N-terminal region of the protein and through an unrelated domain, CRE, at the C terminus. Mutation in either BRC or CRE severely reduces functional activity, but repair deficiency of the brh2 mutant can be complemented by expressing BRC and CRE on different molecules. This intermolecular complementation is dependent upon the presence of Dss1. Brh2 molecules associate through the region overlapping with the Dss1-interacting domain to form at least dimer-sized complexes, which in turn, can be dissociated by Dss1 to monomer. We propose that cooperation between BRC and CRE domains and the Dss1-provoked dissociation of Brh2 complexes are requisite features of Brh2's molecular mechanism. PMID:17261595

  15. [The defense and regulatory mechanisms during development of legume-Rhizobium symbiosis].

    PubMed

    Glian'ko, A K; Akimova, G P; Sokolova, M G; Makarova, L E; Vasil'eva, G G

    2007-01-01

    The roles of indolylacetic acid, the peroxidase system, catalase, active oxygen species, and phenolic compounds in the physiological and biochemical mechanisms involved in the autoregulation of nodulation in the developing legume-Rhizobium symbiosis were studied. It was inferred that the concentration of indolylacetic acid in the roots of inoculated plants, controlled by the enzymes of the peroxidase complex, is the signal permitting or limiting nodulation at the initial stages of symbiotic interaction. Presumably, the change in the level of active oxygen species is determined by an antioxidant activity of phenolic compounds. During the development of symbiosis, phytohormones, antioxidant enzymes, and active oxygen species may be involved in the regulation of infection via both a direct antibacterial action and regulation of functional activity of the host plant defense systems. PMID:17619575

  16. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes

    PubMed Central

    Bunting, Karen L.; Melnick, Ari M.

    2014-01-01

    The BCL6 oncogenic repressor is a master regulator of humoral immunity and B-cell lymphoma survival. Whereas much research has focused on its regulation and function in germinal center B-cells, its role in other mature lymphoid cell compartments is less clear. A novel role for BCL6 in follicular T helper cell development was recently uncovered. The latest discoveries reveal that BCL6 is also an important regulator of other specialized helper T-cell subsets within germinal centers, pre-germinal center events, and peripheral T-cells effector functions. Here, we review newly discovered roles for BCL6 in lymphocyte subsets residing within and outside of germinal centers, and discuss their implications with respect to the molecular mechanisms of BCL6 regulation and potential links to B and T-cell lymphomas. PMID:23725655

  17. The T box mechanism: tRNA as a regulatory molecule

    PubMed Central

    Green, Nicholas J.; Grundy, Frank J.; Henkin, Tina M.

    2009-01-01

    The T box mechanism is widely used in Gram-positive bacteria to regulate expression of aminoacyl-tRNA synthetase genes and genes involved in amino acid biosynthesis and uptake. Binding of a specific uncharged tRNA to a riboswitch element in the nascent transcript causes a structural change in the transcript that promotes expression of the downstream coding sequence. In most cases, this occurs by stabilization of an antiterminator element that competes with formation of a terminator helix. Specific tRNA recognition by the nascent transcript results in increased expression of genes important for tRNA aminoacylation in response to decreased pools of charged tRNA. PMID:19932103

  18. The Influence of Early Life Nutrition on Epigenetic Regulatory Mechanisms of the Immune System

    PubMed Central

    Paparo, Lorella; di Costanzo, Margherita; di Scala, Carmen; Cosenza, Linda; Leone, Ludovica; Nocerino, Rita; Berni Canani, Roberto

    2014-01-01

    The immune system is exquisitely sensitive to environmental changes. Diet constitutes one of the major environmental factors that exerts a profound effect on immune system development and function. Epigenetics is the study of mitotically heritable, yet potentially reversible, molecular modifications to DNA and chromatin without alteration to the underlying DNA sequence. Nutriepigenomics is an emerging discipline examining the role of dietary influences on gene expression. There is increasing evidence that the epigenetic mechanisms that regulate gene expression during immune differentiation are directly affected by dietary factors or indirectly through modifications in gut microbiota induced by different dietary habits. Short-chain fatty acids, in particular butyrate, produced by selected bacteria stains within gut microbiota, are crucial players in this network. PMID:25353665

  19. Possible involvement of lipoic acid in binding protein-dependent transport systems in Escherichia coli.

    PubMed

    Richarme, G

    1985-04-01

    We describe the properties of the binding protein dependent-transport of ribose, galactose, and maltose and of the lactose permease, and the phosphoenolpyruvate-glucose phosphotransferase transport systems in a strain of Escherichia coli which is deficient in the synthesis of lipoic acid, a cofactor involved in alpha-keto acid dehydrogenation. Such a strain can grow in the absence of lipoic acid in minimal medium supplemented with acetate and succinate. Although the lactose permease and the phosphoenolypyruvate-glucose phosphotransferase are not affected by lipoic acid deprivation, the binding protein-dependent transports are reduced by 70% in conditions of lipoic acid deprivation when compared with their activity in conditions of lipoic acid supply. The remaining transport is not affected by arsenate but is inhibited by the uncoupler carbonylcyanide-m-chlorophenylhydrazone; however the lipoic acid-dependent transport is completely inhibited by arsenate and only weakly inhibited by carbonylcyanide-m-chlorophenylhydrazone. The known inhibitor of alpha-keto acid dehydrogenases, 5-methoxyindole-2-carboxylic acid, completely inhibits all binding protein-dependent transports whether in conditions of lipoic supply or deprivation; the results suggest a possible relation between binding protein-dependent transport and alpha-keto acid dehydrogenases and shed light on the inhibition of these transports by arsenicals and uncouplers. PMID:3920206

  20. Gene Regulatory Mechanisms Underlying the Spatial and Temporal Regulation of Target-Dependent Gene Expression in Drosophila Neurons

    PubMed Central

    Ridyard, Marc S.; Lian, Tianshun; Keatings, Kathleen; Allan, Douglas W.

    2015-01-01

    Neuronal differentiation often requires target-derived signals from the cells they innervate. These signals typically activate neural subtype-specific genes, but the gene regulatory mechanisms remain largely unknown. Highly restricted expression of the FMRFa neuropeptide in Drosophila Tv4 neurons requires target-derived BMP signaling and a transcription factor code that includes Apterous. Using integrase transgenesis of enhancer reporters, we functionally dissected the Tv4-enhancer of FMRFa within its native cellular context. We identified two essential but discrete cis-elements, a BMP-response element (BMP-RE) that binds BMP-activated pMad, and a homeodomain-response element (HD-RE) that binds Apterous. These cis-elements have low activity and must be combined for Tv4-enhancer activity. Such combinatorial activity is often a mechanism for restricting expression to the intersection of cis-element spatiotemporal activities. However, concatemers of the HD-RE and BMP-RE cis-elements were found to independently generate the same spatiotemporal expression as the Tv4-enhancer. Thus, the Tv4-enhancer atypically combines two low-activity cis-elements that confer the same output from distinct inputs. The activation of target-dependent genes is assumed to 'wait' for target contact. We tested this directly, and unexpectedly found that premature BMP activity could not induce early FMRFa expression; also, we show that the BMP-insensitive HD-RE cis-element is activated at the time of target contact. This led us to uncover a role for the nuclear receptor, seven up (svp), as a repressor of FMRFa induction prior to target contact. Svp is normally downregulated immediately prior to target contact, and we found that maintaining Svp expression prevents cis-element activation, whereas reducing svp gene dosage prematurely activates cis-element activity. We conclude that the target-dependent FMRFa gene is repressed prior to target contact, and that target-derived BMP signaling directly

  1. Regulatory mechanisms, expression levels and proliferation effects of the FUS-DDIT3 fusion oncogene in liposarcoma.

    PubMed

    Åman, Pierre; Dolatabadi, Soheila; Svec, David; Jonasson, Emma; Safavi, Setareh; Andersson, Daniel; Grundevik, Pernilla; Thomsen, Christer; Ståhlberg, Anders

    2016-04-01

    Fusion oncogenes are among the most common types of oncogene in human cancers. The gene rearrangements result in new combinations of regulatory elements and functional protein domains. Here we studied a subgroup of sarcomas and leukaemias characterized by the FET (FUS, EWSR1, TAF15) family of fusion oncogenes, including FUS-DDIT3 in myxoid liposarcoma (MLS). We investigated the regulatory mechanisms, expression levels and effects of FUS-DDIT3 in detail. FUS-DDIT3 showed a lower expression than normal FUS at both the mRNA and protein levels, and single-cell analysis revealed a lack of correlation between FUS-DDIT3 and FUS expression. FUS-DDIT3 transcription was regulated by the FUS promotor, while its mRNA stability depended on the DDIT3 sequence. FUS-DDIT3 protein stability was regulated by protein interactions through the FUS part, rather than the leucine zipper containing DDIT3 part. In addition, in vitro as well as in vivo FUS-DDIT3 protein expression data displayed highly variable expression levels between individual MLS cells. Combined mRNA and protein analyses at the single-cell level showed that FUS-DDIT3 protein expression was inversely correlated to the expression of cell proliferation-associated genes. We concluded that FUS-DDIT3 is uniquely regulated at the transcriptional as well as the post-translational level and that its expression level is important for MLS tumour development. The FET fusion oncogenes are potentially powerful drug targets and detailed knowledge about their regulation and functions may help in the development of novel treatments. PMID:26865464

  2. Ocean warming and acidification modulate energy budget and gill ion regulatory mechanisms in Atlantic cod (Gadus morhua).

    PubMed

    Kreiss, C M; Michael, K; Lucassen, M; Jutfelt, F; Motyka, R; Dupont, S; Pörtner, H-O

    2015-10-01

    Ocean warming and acidification are threatening marine ecosystems. In marine animals, acidification is thought to enhance ion regulatory costs and thereby baseline energy demand, while elevated temperature also increases baseline metabolic rate. Here we investigated standard metabolic rates (SMR) and plasma parameters of Atlantic cod (Gadus morhua) after 3-4 weeks of exposure to ambient and future PCO2 levels (550, 1200 and 2200 µatm) and at two temperatures (10, 18 °C). In vivo branchial ion regulatory costs were studied in isolated, perfused gill preparations. Animals reared at 18 °C responded to increasing CO2 by elevating SMR, in contrast to specimens at 10 °C. Isolated gills at 10 °C and elevated PCO2 (≥1200 µatm) displayed increased soft tissue mass, in parallel to increased gill oxygen demand, indicating an increased fraction of gill in whole animal energy budget. Altered gill size was not found at 18 °C, where a shift in the use of ion regulation mechanisms occurred towards enhanced Na(+)/H(+)-exchange and HCO3 (-) transport at high PCO2 (2200 µatm), paralleled by higher Na(+)/K(+)-ATPase activities. This shift did not affect total gill energy consumption leaving whole animal energy budget unaffected. Higher Na(+)/K(+)-ATPase activities in the warmth might have compensated for enhanced branchial permeability and led to reduced plasma Na(+) and/or Cl(-) concentrations and slightly lowered osmolalities seen at 18 °C and 550 or 2200 µatm PCO2 in vivo. Overall, the gill as a key ion regulation organ seems to be highly effective in supporting the resilience of cod to effects of ocean warming and acidification. PMID:26219611

  3. Glucocorticoid receptor-mediated cell cycle arrest is achieved through distinct cell-specific transcriptional regulatory mechanisms.

    PubMed Central

    Rogatsky, I; Trowbridge, J M; Garabedian, M J

    1997-01-01

    Glucocorticoids inhibit proliferation of many cell types, but the events leading from the activated glucocorticoid receptor (GR) to growth arrest are not understood. Ectopic expression and activation of GR in human osteosarcoma cell lines U2OS and SAOS2, which lack endogenous receptors, result in a G1 cell cycle arrest. GR activation in U2OS cells represses expression of the cyclin-dependent kinases (CDKs) CDK4 and CDK6 as well as their regulatory partner, cyclin D3, leading to hypophosphorylation of the retinoblastoma protein (Rb). We also demonstrate a ligand-dependent reduction in the expression of E2F-1 and c-Myc, transcription factors involved in the G1-to-S-phase transition. Mitogen-activated protein kinase, CDK2, cyclin E, and the CDK inhibitors (CDIs) p27 and p21 are unaffected by receptor activation in U2OS cells. The receptor's N-terminal transcriptional activation domain is not required for growth arrest in U2OS cells. In Rb-deficient SAOS2 cells, however, the expression of p27 and p21 is induced upon receptor activation. Remarkably, in SAOS2 cells that express a GR deletion derivative lacking the N-terminal transcriptional activation domain, induction of CDI expression is abolished and the cells fail to undergo ligand-dependent cell cycle arrest. Similarly, murine S49 lymphoma cells, which, like SAOS2 cells, lack Rb, require the N-terminal activation domain for growth arrest and induce CDI expression upon GR activation. These cell-type-specific differences in receptor domains and cellular targets linking GR activation to cell cycle machinery suggest two distinct regulatory mechanisms of GR-mediated cell cycle arrest: one involving transcriptional repression of G1 cyclins and CDKs and the other involving enhanced transcription of CDIs by the activated receptor. PMID:9154817

  4. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  5. Stimulation of rat hepatic low density lipoprotein receptors by glucagon. Evidence of a novel regulatory mechanism in vivo.

    PubMed Central

    Rudling, M; Angelin, B

    1993-01-01

    We studied the influence of glucagon on hepatic LDL receptors and plasma lipoproteins in rats. A dose-dependent (maximum, threefold) increase in LDL-receptor binding was evident already at a dose of 2 x 4 micrograms, and detectable 3 h after injection; concomitantly, cholesterol and apolipoprotein (apo) B and apoE within LDL and large HDL decreased in plasma. LDL receptor mRNA levels were however unaltered or reduced. Hepatic microsomal cholesterol was increased and the enzymatic activities of 3-hydroxy-3-methylglutaryl coenzyme A reductase and cholesterol 7 alpha-hydroxylase in hepatic microsomes were reduced. Insulin alone increased receptor binding and receptor mRNA levels twofold, but plasma cholesterol was unchanged and plasma apoE and apoB increased. Administration of insulin to glucagon-treated animals reduced the LDL-receptor binding to control levels and apoB appeared in LDL particles. Estrogen treatment increased LDL-receptor binding and mRNA levels five- and eightfold, respectively. Combined treatment with glucagon and estrogen reduced the stimulation of LDL-receptor mRNA levels by 80% although LDL-receptor binding was unchanged. Immunoblot analysis showed that glucagon increased the number of hepatic LDL receptors. We conclude that glucagon induces the number of hepatic LDL receptors by a mechanism not related to increased mRNA levels, suggesting the presence of a posttranscriptional regulatory mechanism present in the liver in vivo. Images PMID:8514887

  6. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress

    PubMed Central

    Hossain, M. Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  7. Seasonality of reproduction in mammals: intimate regulatory mechanisms and practical implications.

    PubMed

    Chemineau, P; Guillaume, D; Migaud, M; Thiéry, J C; Pellicer-Rubio, M T; Malpaux, B

    2008-07-01

    Farm mammals generally express seasonal variations in their production traits, thus inducing changing availability of fresh derived animal products (meat, milk and cheese) or performances (horses). This is due to a more or less marked seasonal birth distribution in sheep and goats, in horses but not cattle. Birth peak occurs at the end of winter-early spring, the most favourable period for the progeny to survive. Most species show seasonal variations in their ovulation frequency (presence or absence of ovulation), spermatogenic activity (from moderate decrease to complete absence of sperm production), gamete quality (variations in fertilization rates and embryo survival), and also sexual behaviour. The intimate mechanism involved is a complex combination of endogenous circannual rhythm driven and synchronized by light and melatonin. Profound and long-term neuroendocrine changes involving different neuromediator systems were described to play a role in these processes. In most species artificial photoperiodic treatments consisting of extra-light during natural short days (in sheep and goats and mares) or melatonin during long days (in sheep and goats) are extensively used to either adjust the breeding season to animal producer needs and/or to completely overcome seasonal variations of sperm production in artificial insemination centres. Pure light treatments (without melatonin), especially when applied in open barns, could be considered as non-invasive ones which fully respect animal welfare. Genetic selection could be one of the future ways to decrease seasonality in sheep and goats. PMID:18638103

  8. The regulatory mechanism underlying light-inducible production of carotenoids in nonphototrophic bacteria.

    PubMed

    Takano, Hideaki

    2016-07-01

    Light is a ubiquitous environmental factor serving as an energy source and external stimulus. Here, I review the conserved molecular mechanism of light-inducible production of carotenoids in three nonphototrophic bacteria: Streptomyces coelicolor A3(2), Thermus thermophilus HB27, and Bacillus megaterium QM B1551. A MerR family transcriptional regulator, LitR, commonly plays a central role in their light-inducible carotenoid production. Genetic and biochemical studies on LitR proteins revealed a conserved function: LitR in complex with adenosyl B12 (AdoB12) has a light-sensitive DNA-binding activity and thus suppresses the expression of the Crt biosynthesis gene cluster. The in vitro DNA-binding and transcription assays showed that the LitR-AdoB12 complex serves as a repressor allowing transcription initiation by RNA polymerase in response to illumination. The existence of novel light-inducible genes and the unique role of the megaplasmid were revealed by the transcriptomic analysis of T. thermophilus. The findings suggest that LitR is a general regulator responsible for the light-inducible carotenoid production in the phylogenetically divergent nonphototrophic bacteria, and that LitR performs diverse physiological functions in bacteria. PMID:26967471

  9. Sweat, the driving force behind normal skin: an emerging perspective on functional biology and regulatory mechanisms.

    PubMed

    Murota, Hiroyuki; Matsui, Saki; Ono, Emi; Kijima, Akiko; Kikuta, Junichi; Ishii, Masaru; Katayama, Ichiro

    2015-01-01

    The various symptoms associated with excessive or insufficient perspiration can significantly reduce a patient's quality of life. If a versatile and minimally invasive method could be established for returning sweat activity to normalcy, there is no question that it could be used in the treatment of many diseases that are believed to involve perspiration. For this reason, based on an understanding of the sweat-gland control function and sweat activity, it was necessary to conduct a comprehensive search for the factors that control sweating, such as the central and peripheral nerves that control sweat-gland function, the microenvironment surrounding the sweat glands, and lifestyle. We focused on the mechanism by which atopic dermatitis leads to hypohidrosis and confirmed that histamine inhibits acetylcholinergic sweating. Acetylcholine promotes the phosphorylation of glycogen synthesis kinase 3β (GSK3β) in the sweat-gland secretory cells and leads to sensible perspiration. By suppressing the phosphorylation of GSK3β, histamine inhibits the movement of sweat from the sweat-gland secretory cells through the sweat ducts, which could presumably be demonstrated by dynamic observations of the sweat glands using two-photon microscopy. It is expected that the discovery of new factors that control sweat-gland function can contribute to the treatment of diseases associated with dyshidrosis. PMID:25266651

  10. Tuning of Redox Regulatory Mechanisms, Reactive Oxygen Species and Redox Homeostasis under Salinity Stress.

    PubMed

    Hossain, M Sazzad; Dietz, Karl-Josef

    2016-01-01

    Soil salinity is a crucial environmental constraint which limits biomass production at many sites on a global scale. Saline growth conditions cause osmotic and ionic imbalances, oxidative stress and perturb metabolism, e.g., the photosynthetic electron flow. The plant ability to tolerate salinity is determined by multiple biochemical and physiological mechanisms protecting cell functions, in particular by regulating proper water relations and maintaining ion homeostasis. Redox homeostasis is a fundamental cell property. Its regulation includes control of reactive oxygen species (ROS) generation, sensing deviation from and readjustment of the cellular redox state. All these redox related functions have been recognized as decisive factors in salinity acclimation and adaptation. This review focuses on the core response of plants to overcome the challenges of salinity stress through regulation of ROS generation and detoxification systems and to maintain redox homeostasis. Emphasis is given to the role of NADH oxidase (RBOH), alternative oxidase (AOX), the plastid terminal oxidase (PTOX) and the malate valve with the malate dehydrogenase isoforms under salt stress. Overwhelming evidence assigns an essential auxiliary function of ROS and redox homeostasis to salinity acclimation of plants. PMID:27242807

  11. TRIENNIAL LACTATION SYMPOSIUM: Systems biology of regulatory mechanisms of nutrient metabolism in lactation.

    PubMed

    McNamara, J P

    2015-12-01

    A major role of the dairy cow is to convert low-quality plant materials into high-quality protein and other nutrients for humans. We must select and manage cows with the goal of having animals of the greatest efficiency matched to their environment. We have increased efficiency tremendously over the years, yet the variation in productive and reproductive efficiency among animals is still large. In part, this is because of a lack of full integration of genetic, nutritional, and reproductive biology into management decisions. However, integration across these disciplines is increasing as the biological research findings show specific control points at which genetics, nutrition, and reproduction interact. An ordered systems biology approach that focuses on why and how cells regulate energy and N use and on how and why organs interact through endocrine and neurocrine mechanisms will speed improvements in efficiency. More sophisticated dairy managers will demand better information to improve the efficiency of their animals. Using genetic improvement and animal management to improve milk productive and reproductive efficiency requires a deeper understanding of metabolic processes throughout the life cycle. Using existing metabolic models, we can design experiments specifically to integrate data from global transcriptional profiling into models that describe nutrient use in farm animals. A systems modeling approach can help focus our research to make faster and larger advances in efficiency and determine how this knowledge can be applied on the farms. PMID:26641166

  12. The Mechanisms of Water Exchange: The Regulatory Roles of Multiple Interactions in Social Wasps

    PubMed Central

    Agrawal, Devanshu; Karsai, Istvan

    2016-01-01

    Evolutionary benefits of task fidelity and improving information acquisition via multiple transfers of materials between individuals in a task partitioned system have been shown before, but in this paper we provide a mechanistic explanation of these phenomena. Using a simple mathematical model describing the individual interactions of the wasps, we explain the functioning of the common stomach, an information center, which governs construction behavior and task change. Our central hypothesis is a symmetry between foragers who deposit water and foragers who withdraw water into and out of the common stomach. We combine this with a trade-off between acceptance and resistance to water transfer. We ultimately derive a mathematical function that relates the number of interactions that foragers complete with common stomach wasps during a foraging cycle. We use field data and additional model assumptions to calculate values of our model parameters, and we use these to explain why the fullness of the common stomach stabilizes just below 50 percent, why the average number of successful interactions between foragers and the wasps forming the common stomach is between 5 and 7, and why there is a variation in this number of interactions over time. Our explanation is that our proposed water exchange mechanism places natural bounds on the number of successful interactions possible, water exchange is set to optimize mediation of water through the common stomach, and the chance that foragers abort their task prematurely is very low. PMID:26751076

  13. Familial autoinflammation with neutrophilic dermatosis reveals a regulatory mechanism of pyrin activation.

    PubMed

    Masters, Seth L; Lagou, Vasiliki; Jéru, Isabelle; Baker, Paul J; Van Eyck, Lien; Parry, David A; Lawless, Dylan; De Nardo, Dominic; Garcia-Perez, Josselyn E; Dagley, Laura F; Holley, Caroline L; Dooley, James; Moghaddas, Fiona; Pasciuto, Emanuela; Jeandel, Pierre-Yves; Sciot, Raf; Lyras, Dena; Webb, Andrew I; Nicholson, Sandra E; De Somer, Lien; van Nieuwenhove, Erika; Ruuth-Praz, Julia; Copin, Bruno; Cochet, Emmanuelle; Medlej-Hashim, Myrna; Megarbane, Andre; Schroder, Kate; Savic, Sinisa; Goris, An; Amselem, Serge; Wouters, Carine; Liston, Adrian

    2016-03-30

    Pyrin responds to pathogen signals and loss of cellular homeostasis by forming an inflammasome complex that drives the cleavage and secretion of interleukin-1β (IL-1β). Mutations in the B30.2/SPRY domain cause pathogen-independent activation of pyrin and are responsible for the autoinflammatory disease familial Mediterranean fever (FMF). We studied a family with a dominantly inherited autoinflammatory disease, distinct from FMF, characterized by childhood-onset recurrent episodes of neutrophilic dermatosis, fever, elevated acute-phase reactants, arthralgia, and myalgia/myositis. The disease was caused by a mutation in MEFV, the gene encoding pyrin (S242R). The mutation results in the loss of a 14-3-3 binding motif at phosphorylated S242, which was not perturbed by FMF mutations in the B30.2/SPRY domain. However, loss of both S242 phosphorylation and 14-3-3 binding was observed for bacterial effectors that activate the pyrin inflammasome, such as Clostridium difficile toxin B (TcdB). The S242R mutation thus recapitulated the effect of pathogen sensing, triggering inflammasome activation and IL-1β production. Successful therapy targeting IL-1β has been initiated in one patient, resolving pyrin-associated autoinflammation with neutrophilic dermatosis. This disease provides evidence that a guard-like mechanism of pyrin regulation, originally identified for Nod-like receptors in plant innate immunity, also exists in humans. PMID:27030597

  14. Fluorescence single-molecule imaging of actin turnover and regulatory mechanisms.

    PubMed

    Watanabe, Naoki

    2012-01-01

    Cells must rapidly remodel the actin filament network to achieve various cellular functions. Actin filament turnover is a dynamic process that plays crucial roles in cell adhesion, locomotion, cytokinesis, endocytosis, phagocytosis, tissue remodeling, etc., and is regulated by cell signaling cascades. Success in elucidating dynamic biological processes such as actin-based motility relies on the means enabling real time monitoring of the process. The invention of live-cell fluorescence single-molecule imaging has opened a window for direct viewing of various actin remodeling processes. In general, assembly and dissociation of actin and its regulators turned out to occur at the faster rates than previously estimated by biochemical and structural analyses. Cells undergo such fast continuous exchange of the components perhaps not only to drive actin remodeling but also to facilitate rapid response in many other cell mechanics and signaling cascades. This chapter describes how epifluorescence single-molecule imaging which visualizes deeper area than the TIRF microscopy is achieved in XTC cells, the currently best platform for this approach. PMID:22289456

  15. A Regulatory Mechanism for RSK2 NH2-Terminal Kinase Activity

    PubMed Central

    Cho, Yong-Yeon; Yao, Ke; Pugliese, Angelo; Malakhova, Margarita L.; Bode, Ann M.; Dong, Zigang

    2010-01-01

    Our previous findings indicated that RSK2 plays a critical role in proliferation and cell transformation induced by tumor promoters, such as epidermal growth factor or 12-O-tetradecanoylphorbol-13-acetate, and that kaempferol, a natural compound found in edible plants, selectively inhibits RSK2 activity. However, the molecular mechanism for RSK2 activation is unclear. Herein, we provide evidence showing that NH2-terminal kinase domain (NTD) activation of RSK2 is required for the activation of the extracellular signal-regulated kinase–mediated COOH-terminal kinase domain (CTD). We also found that the NTD plays a key role in substrate phosphorylation and that kaempferol binds with the NTD but not the CTD in both the active and inactive forms. Homology modeling of the RSK2 NH2-terminal domain and small-molecule docking, validated by mutagenesis experiments, clearly showed that Val82 and Lys100 are critical amino acids for kaempferol binding and RSK2 activity. Furthermore, immunohistofluorescence and Western blot results indicated that the RSK2 protein level is markedly higher in cancer cell lines as well as cancer tissues compared with nonmalignant cell lines or normal tissues. In addition, kaempferol inhibited proliferation of malignant human cancer cell lines, including A431, SK-MEL-5 and SK-MEL-28, and HCT-116. These results indicate that targeting RSK2 with natural compounds, such as kaempferol, might be a good strategy for chemopreventive or chemotherapeutic application. PMID:19435896

  16. Regulatory mechanism of ZNF139 in multi-drug resistance of gastric cancer cells.

    PubMed

    Li, Yong; Tan, Bi-bo; Zhao, Qun; Fan, Li-qiao; Liu, Yü; Wang, Dong

    2014-06-01

    Our previous study found increased zinc finger protein 139 (ZNF139) expression in gastric cancer (GC) cells. Purpose of the study is to further clarify the role and mechanism of ZNF139 in multi-drug resistance (MDR) of GC cells. MTT assay, RT-PCR, Western blotting were employed to detect susceptibility of GC cells to chemotherapeutic agents (5-FU, L-OHP) in vitro, and expressions of ZNF139 and MDR associated genes MDR1/P-gp, MRP1, Bcl-2, Bax were also detected. siRNA specific to ZNF139 was transfected into MKN28 cells, then chemosensitivity of GC cells as well as changes of ZNF139 and MDR associated genes were detected. It's found the inhibition rate of 5-FU, L-OHP to well-differentiated GC tissues and cell line was lower than that in the poorly differentiated tissues and cell line; expressions of ZNF139 and MDR1/P-gp, MRP1 and Bcl-2 in well-differentiated GC tissues and cell line MKN28 were higher, while Bax expression was lower. After ZNF139-siRNA was transfected into MKN28, ZNF139 expression in GC cells was inhibited by 90%; inhibition rate of 5-FU, L-OHP to tumor cells increased, and expressions of MDR1/P-gp, MRP1 and Bcl-2 were down-regulated, while Bax was up-regulated. ZNF139 was involved in GC MDR by promoting expressions of MDR1/P-gp, MRP1 and Bcl-2 and inhibiting Bax simultaneously. PMID:24515389

  17. Regulatory effect and mechanism of gastrin and its antagonists on colorectal carcinoma

    PubMed Central

    He, Shuang-Wu; Shen, Kang-Qiang; He, Yu-Jun; Xie, Bin; Zhao, Yan-Ming

    1999-01-01

    AIM: To explore the effect and mechanism of gastrin and its an tagonists proglumide and somatostatin on colorectal carcinoma and their clinical significance. METHODS: A model of transplanted human colonic carcinoma was established from SW480 cell line in gymnomouse body. The volume and weight of transplanted carcinoma was observed under the effect of pentagatrin (PG), proglumide (PGL) and octapeptide somotostatin (SMS201-995, SMS). The cAMP content of carcinoma cell was determined by radioimmunoassay and the DNA, protein content and cell cycle were determined by flow-cytometry. The amount of viable cells was determined by MTT colorimetric analysis, IP3 content was determined by radioimmuno assay, Ca2+ concentration in cell by fluorometry and PKC activity by isotopic enzymolysis. The expression of gastrin, c-myc, c-fos and rasP21 in 48 case s of colorectal carcinoma tissue was detected by the immuno-cytochemistry SP method. Argyrophilia nucleolar organizer regions was determined with argyrophilia stain. RESULTS: The volume, weight, cAMP, DNA and protein content in carcinoma cell, cell amount and proliferation index of S and G2M phase in PG group were all significantly higher than those of control group. When PG was at the concentration of 25 mg/L, the amount of viable cells, IP3 content and Ca2+ concentration in cell and membrane PKC activity in PG group were significantly higher than those in control group; when PGL was at a concentration of 32 mg/L, they dropped to the lowest level in PG (25 mg/L) + PGL group, but without significant difference from the control group. The positive expression rate of gastrin, c-myc, c-fos and rasP21 in carcinoma tissue was 39.6%, 54.2%, 47.9% and 54.2% respectively and significantly higher than that in mucosa 3 cm and 6 cm adjacent to carcinoma tissue and normal colorectal mucosa. The positive expression rate of gastrin of highly-differentiated adenocarcinoma group was significantly higher than that of poorly-differentiated and

  18. Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Mechanisms underlying zoonotic success of Campylobacter jejuni: the CprRS two-component regulatory system influences essential processes, biofilm formation, and pathogenesis Campylobacter jejuni is a leading cause of food- and waterbourne bacterial gastroenteritis in the developed world. Although il...

  19. Endocytosis and trafficking of BMP receptors: Regulatory mechanisms for fine-tuning the signaling response in different cellular contexts.

    PubMed

    Ehrlich, Marcelo

    2016-02-01

    Signaling by bone morphogenetic protein (BMP) receptors is regulated at multiple levels in order to ensure proper interpretation of BMP stimuli in different cellular settings. As with other signaling receptors, regulation of the amount of exposed and signaling-competent BMP receptors at the plasma-membrane is predicted to be a key mechanism in governing their signaling output. Currently, the endocytosis of BMP receptors is thought to resemble that of the structurally related transforming growth factor-β (TGF-β) receptors, as BMP receptors are constitutively internalized (independently of ligand binding), with moderate kinetics, and mostly via clathrin-mediated endocytosis. Also similar to TGF-β receptors, BMP receptors are able to signal from the plasma membrane, while internalization to endosomes may have a signal modulating effect. When at the plasma membrane, BMP receptors localize to different membrane domains including cholesterol rich domains and caveolae, suggesting a complex interplay between membrane distribution and internalization. An additional layer of complexity stems from the putative regulatory influence on the signaling and trafficking of BMP receptors exerted by ligand traps and/or co-receptors. Furthermore, the trafficking and signaling of BMP receptors are subject to alterations in cellular context. For example, genetic diseases involving changes in the expression of auxiliary factors of endocytic pathways hamper retrograde BMP signals in neurons, and perturb the regulation of synapse formation. This review summarizes current understanding of the trafficking of BMP receptors and discusses the role of trafficking in regulation of BMP signals. PMID:26776724

  20. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato

    PubMed Central

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-01-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  1. Aspects of the regulatory mechanisms of PPAR functions: analysis of a bidirectional response element and regulation by sumoylation.

    PubMed

    Shimizu, Makoto; Yamashita, Daisuke; Yamaguchi, Tomohiro; Hirose, Fumiko; Osumi, Takashi

    2006-06-01

    Peroxisome proliferator-activated receptors (PPARs) constitute a subfamily of nuclear receptor superfamily. A wide variety of compounds including hypolipidemic agents, antidiabetic drugs, and long-chain fatty acids are the potential ligands of PPARs. To approach the regulatory mechanisms of PPARs, we studied on two subjects in this work. First, we identified a functional PPAR-binding site in the spacer region between the PEX11alpha and perilipin genes, which are arranged in tandem on the mouse genome. By gene reporter assays and in vivo as well as in vitro binding assays, we show that these genes are regulated tissue-selectively through this common binding site: The PEX11alpha gene is activated by PPARalpha in the liver, whereas the perilipin gene by PPARgamma in the adipose tissue. As the second subject, we found that PPARgamma2 is conjugated with small ubiquitin-related modifier (SUMO) at a specific lysine residue in the amino-terminal region. By site-directed mutagenesis combined with gene reporter assays and sumoylation analyses, we show that sumoylation represses the ligand-independent transactivating function carried by this region, and hence negatively regulates the whole transactivating competence of PPARgamma2. In addition, phosphorylation at a specific site in the amino-terminal region represses the transactivation by PPARgamma2 possibly through enhancing sumoylation. PMID:16534556

  2. Myosin Light Chain Kinase (MLCK) Regulates Cell Migration in a Myosin Regulatory Light Chain Phosphorylation-independent Mechanism*

    PubMed Central

    Chen, Chen; Tao, Tao; Wen, Cheng; He, Wei-Qi; Qiao, Yan-Ning; Gao, Yun-Qian; Chen, Xin; Wang, Pei; Chen, Cai-Ping; Zhao, Wei; Chen, Hua-Qun; Ye, An-Pei; Peng, Ya-Jing; Zhu, Min-Sheng

    2014-01-01

    Myosin light chain kinase (MLCK) has long been implicated in the myosin phosphorylation and force generation required for cell migration. Here, we surprisingly found that the deletion of MLCK resulted in fast cell migration, enhanced protrusion formation, and no alteration of myosin light chain phosphorylation. The mutant cells showed reduced membrane tether force and fewer membrane F-actin filaments. This phenotype was rescued by either kinase-dead MLCK or five-DFRXXL motif, a MLCK fragment with potent F-actin-binding activity. Pull-down and co-immunoprecipitation assays showed that the absence of MLCK led to attenuated formation of transmembrane complexes, including myosin II, integrins and fibronectin. We suggest that MLCK is not required for myosin phosphorylation in a migrating cell. A critical role of MLCK in cell migration involves regulating the cell membrane tension and protrusion necessary for migration, thereby stabilizing the membrane skeleton through F-actin-binding activity. This finding sheds light on a novel regulatory mechanism of protrusion during cell migration. PMID:25122766

  3. Auxin Response Factor SlARF2 Is an Essential Component of the Regulatory Mechanism Controlling Fruit Ripening in Tomato.

    PubMed

    Hao, Yanwei; Hu, Guojian; Breitel, Dario; Liu, Mingchun; Mila, Isabelle; Frasse, Pierre; Fu, Yongyao; Aharoni, Asaph; Bouzayen, Mondher; Zouine, Mohamed

    2015-12-01

    Ethylene is the main regulator of climacteric fruit ripening, by contrast the putative role of other phytohormones in this process remains poorly understood. The present study brings auxin signaling components into the mechanism regulating tomato fruit ripening through the functional characterization of Auxin Response Factor2 (SlARF2) which encodes a downstream component of auxin signaling. Two paralogs, SlARF2A and SlARF2B, are found in the tomato genome, both displaying a marked ripening-associated expression but distinct responsiveness to ethylene and auxin. Down-regulation of either SlARF2A or SlARF2B resulted in ripening defects while simultaneous silencing of both genes led to severe ripening inhibition suggesting a functional redundancy among the two ARFs. Tomato fruits under-expressing SlARF2 produced less climacteric ethylene and exhibited a dramatic down-regulation of the key ripening regulators RIN, CNR, NOR and TAGL1. Ethylene treatment failed to reverse the non-ripening phenotype and the expression of ethylene signaling and biosynthesis genes was strongly altered in SlARF2 down-regulated fruits. Although both SlARF proteins are transcriptional repressors the data indicate they work as positive regulators of tomato fruit ripening. Altogether, the study defines SlARF2 as a new component of the regulatory network controlling the ripening process in tomato. PMID:26716451

  4. Transcriptome Profiling Reveals the Regulatory Mechanism Underlying Pollination Dependent and Parthenocarpic Fruit Set Mainly Mediated by Auxin and Gibberellin

    PubMed Central

    Tang, Ning; Deng, Wei; Hu, Guojian; Hu, Nan; Li, Zhengguo

    2015-01-01

    Background Fruit set is a key process for crop production in tomato which occurs after successful pollination and fertilization naturally. However, parthenocarpic fruit development can be uncoupled from fertilization triggered by exogenous auxin or gibberellins (GAs). Global transcriptome knowledge during fruit initiation would help to characterize the molecular mechanisms by which these two hormones regulate pollination-dependent and -independent fruit set. Principal Findings In this work, digital gene expression tag profiling (DGE) technology was applied to compare the transcriptomes from pollinated and 2, 4-D/GA3-treated ovaries. Activation of carbohydrate metabolism, cell division and expansion as well as the down-regulation of MADS-box is a comprehensive regulatory pathway during pollination-dependent and parthenocarpic fruit set. The signaling cascades of auxin and GA are significantly modulated. The feedback regulations of Aux/IAAs and DELLA genes which functioned to fine-tune auxin and GA response respectively play fundamental roles in triggering fruit initiation. In addition, auxin regulates GA synthesis via up-regulation of GA20ox1 and down-regulation of KNOX. Accordingly, the effect of auxin on fruit set is mediated by GA via ARF2 and IAA9 down-regulation, suggesting that both pollination-dependent and parthenocarpic fruit set depend on the crosstalk between auxin and GA. Significance This study characterizes the transcriptomic features of ovary development and more importantly unravels the integral roles of auxin and GA on pollination-dependent and parthenocarpic fruit set. PMID:25909657

  5. Comparative Study between Transcriptionally- and Translationally-Acting Adenine Riboswitches Reveals Key Differences in Riboswitch Regulatory Mechanisms

    PubMed Central

    Blouin, Simon; Heppell, Benoit; Bastet, Laurène; St-Pierre, Patrick; Massé, Eric; Lafontaine, Daniel A.

    2011-01-01

    Many bacterial mRNAs are regulated at the transcriptional or translational level by ligand-binding elements called riboswitches. Although they both bind adenine, the adenine riboswitches of Bacillus subtilis and Vibrio vulnificus differ by controlling transcription and translation, respectively. Here, we demonstrate that, beyond the obvious difference in transcriptional and translational modulation, both adenine riboswitches exhibit different ligand binding properties and appear to operate under different regulation regimes (kinetic versus thermodynamic). While the B. subtilis pbuE riboswitch fully depends on co-transcriptional binding of adenine to function, the V. vulnificus add riboswitch can bind to adenine after transcription is completed and still perform translation regulation. Further investigation demonstrates that the rate of transcription is critical for the B. subtilis pbuE riboswitch to perform efficiently, which is in agreement with a co-transcriptional regulation. Our results suggest that the nature of gene regulation control, that is transcription or translation, may have a high importance in riboswitch regulatory mechanisms. PMID:21283784

  6. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    PubMed Central

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-01

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations to the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal/mol. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called `finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive cycle and

  7. The function of the RNA-binding protein TEL1 in moss reveals ancient regulatory mechanisms of shoot development.

    PubMed

    Vivancos, Julien; Spinner, Lara; Mazubert, Christelle; Charlot, Florence; Paquet, Nicolas; Thareau, Vincent; Dron, Michel; Nogué, Fabien; Charon, Céline

    2012-03-01

    The shoot represents the basic body plan in land plants. It consists of a repeated structure composed of stems and leaves. Whereas vascular plants generate a shoot in their diploid phase, non-vascular plants such as mosses form a shoot (called the gametophore) in their haploid generation. The evolution of regulatory mechanisms or genetic networks used in the development of these two kinds of shoots is unclear. TERMINAL EAR1-like genes have been involved in diploid shoot development in vascular plants. Here, we show that disruption of PpTEL1 from the moss Physcomitrella patens, causes reduced protonema growth and gametophore initiation, as well as defects in gametophore development. Leafy shoots formed on ΔTEL1 mutants exhibit shorter stems with more leaves per shoot, suggesting an accelerated leaf initiation (shortened plastochron), a phenotype shared with the Poaceae vascular plants TE1 and PLA2/LHD2 mutants. Moreover, the positive correlation between plastochron length and leaf size observed in ΔTEL1 mutants suggests a conserved compensatory mechanism correlating leaf growth and leaf initiation rate that would minimize overall changes in plant biomass. The RNA-binding protein encoded by PpTEL1 contains two N-terminus RNA-recognition motifs, and a third C-terminus non-canonical RRM, specific to TEL proteins. Removal of the PpTEL1 C-terminus (including this third RRM) or only 16-18 amino acids within it seriously impairs PpTEL1 function, suggesting a critical role for this third RRM. These results show a conserved function of the RNA-binding PpTEL1 protein in the regulation of shoot development, from early ancestors to vascular plants, that depends on the third TEL-specific RRM. PMID:22170036

  8. A mechanism for expansion of regulatory T-cell repertoire and its role in self-tolerance.

    PubMed

    Feng, Yongqiang; van der Veeken, Joris; Shugay, Mikhail; Putintseva, Ekaterina V; Osmanbeyoglu, Hatice U; Dikiy, Stanislav; Hoyos, Beatrice E; Moltedo, Bruno; Hemmers, Saskia; Treuting, Piper; Leslie, Christina S; Chudakov, Dmitriy M; Rudensky, Alexander Y

    2015-12-01

    T-cell receptor (TCR) signalling has a key role in determining T-cell fate. Precursor cells expressing TCRs within a certain low-affinity range for complexes of self-peptide and major histocompatibility complex (MHC) undergo positive selection and differentiate into naive T cells expressing a highly diverse self-MHC-restricted TCR repertoire. In contrast, precursors displaying TCRs with a high affinity for 'self' are either eliminated through TCR-agonist-induced apoptosis (negative selection) or restrained by regulatory T (Treg) cells, whose differentiation and function are controlled by the X-chromosome-encoded transcription factor Foxp3 (reviewed in ref. 2). Foxp3 is expressed in a fraction of self-reactive T cells that escape negative selection in response to agonist-driven TCR signals combined with interleukin 2 (IL-2) receptor signalling. In addition to Treg cells, TCR-agonist-driven selection results in the generation of several other specialized T-cell lineages such as natural killer T cells and innate mucosal-associated invariant T cells. Although the latter exhibit a restricted TCR repertoire, Treg cells display a highly diverse collection of TCRs. Here we explore in mice whether a specialized mechanism enables agonist-driven selection of Treg cells with a diverse TCR repertoire, and the importance this holds for self-tolerance. We show that the intronic Foxp3 enhancer conserved noncoding sequence 3 (CNS3) acts as an epigenetic switch that confers a poised state to the Foxp3 promoter in precursor cells to make Treg cell lineage commitment responsive to a broad range of TCR stimuli, particularly to suboptimal ones. CNS3-dependent expansion of the TCR repertoire enables Treg cells to control self-reactive T cells effectively, especially when thymic negative selection is genetically impaired. Our findings highlight the complementary roles of these two main mechanisms of self-tolerance. PMID:26605529

  9. Mechanisms of immune suppression by interleukin-10 and transforming growth factor-beta: the role of T regulatory cells.

    PubMed

    Taylor, Alison; Verhagen, Johan; Blaser, Kurt; Akdis, Mübeccel; Akdis, Cezmi A

    2006-04-01

    Specific immune suppression and induction of tolerance are essential processes in the regulation and circumvention of immune defence. The balance between allergen-specific type 1 regulatory (Tr1) cells and T helper (Th) 2 cells appears to be decisive in the development of allergy. Tr1 cells consistently represent the dominant subset specific for common environmental allergens in healthy individuals. In contrast, there is a high frequency of allergen-specific interleukin-4 (IL-4)-secreting T cells in allergic individuals. Allergen-specific immunotherapy can induce specific Tr1 cells that abolish allergen-induced proliferation of Th1 and Th2 cells, as well as their cytokine production. Tr1 cells utilize multiple suppressor mechanisms, such as IL-10 and transforming growth factor-beta (TGF-beta) as secreted cytokines and various surface molecules, such as cytotoxic T-lymphocyte antigen 4 and programmed death-1. IL-10 only inhibits T cells stimulated by low numbers of triggered T-cell receptors, which depend on CD28 costimulation. IL-10 inhibits CD28 tyrosine phosphorylation, preventing the binding of phosphatidylinositol 3-kinase p85 and consequently inhibiting the CD28 signalling pathway. In addition, IL-10 and TGF-beta secreted by Tr1 cells skew the antibody production from immunoglobulin E (IgE) towards the non-inflammatory isotypes IgG4 and IgA, respectively. Induction of antigen-specific Tr1 cells can thus re-direct an inappropriate immune response against allergens or auto-antigens using a broad range of suppressor mechanisms. PMID:16556256

  10. Effect and Regulatory Mechanism of Clock Gene Per1 on Biological Behaviors of Human Oral Squamous Carcinoma Cell.

    PubMed

    Han-Xue, L I; Kai, Yang; Xiao-Juan, F U; Qin, Zhao

    2016-04-10

    Objective To investigate the effect and regulatory mechanism of clock gene Per1 on the proliferation,apoptosis,migration,and invasion of human oral squamous carcinoma SCC15 cells. Methods RNA interference was used to knock down Per1 gene in human oral squamous cell carcinoma SCC15 cell line. Changes of cell proliferation and apoptosis were analyzed by flow cytometry. Transwell assay was carried out to assess cell migration and invasion. Real-time polymerase chain reaction was used to detect the mRNA expressions of Ki-67,murine double minute 2(MDM2),c-Myc,p53,Bax,Bcl-2,metalloproteinase (MMP)2,MMP9,and vascular endothelial growth factor (VEGF). Results shRNA-mediated knockdown of Per1 promoted the proliferation,migration and invasion capacity,and inhibited cell apoptosis capacity of SCC15 cells (all P<0.05). Additionally,Per1 knockdown also increased the mRNA expressions of Ki-67,MDM2,Bcl-2,MMP2,and MMP9 and decreased the mRNA expressions of c-Myc,p53,and Bax (all P<0.05);however,the VEGF mRNA expression did not differ significantly after Per1 knockdown (P>0.05). Conclusions Clock gene Perl can regulate important tumor-related genes downstream such as Ki-67,MDM2,c-Myc,p53,Bax,Bcl-2,MMP2,and MMP9,and the aberrant expression of Per1 can affect tumor cell proliferation,apoptosis,migration and invasion. An in-depth study of Per1 may further clarify the mechanism of tumorigenesis and tumor development and thus provides new effective molecular targets for cancer treatment. PMID:27181891

  11. Simulations of cellulose translocation in the bacterial cellulose synthase suggest a regulatory mechanism for the dimeric structure of cellulose

    DOE PAGESBeta

    Knott, Brandon C.; Crowley, Michael F.; Himmel, Michael E.; Zimmer, Jochen; Beckham, Gregg T.

    2016-01-29

    The processive cycle of the bacterial cellulose synthase (Bcs) includes the addition of a single glucose moiety to the end of a growing cellulose chain followed by the translocation of the nascent chain across the plasma membrane. The mechanism of this translocation and its precise location within the processive cycle are not well understood. In particular, the molecular details of how a polymer (cellulose) whose basic structural unit is a dimer (cellobiose) can be constructed by adding one monomer (glucose) at a time are yet to be elucidated. Here, we have utilized molecular dynamics simulations and free energy calculations tomore » the shed light on these questions. We find that translocation forward by one glucose unit is quite favorable energetically, giving a free energy stabilization of greater than 10 kcal mol-1. In addition, there is only a small barrier to translocation, implying that translocation is not rate limiting within the Bcs processive cycle (given experimental rates for cellulose synthesis in vitro). Perhaps most significantly, our results also indicate that steric constraints at the transmembrane tunnel entrance regulate the dimeric structure of cellulose. Namely, when a glucose molecule is added to the cellulose chain in the same orientation as the acceptor glucose, the terminal glucose freely rotates upon forward motion, thus suggesting a regulatory mechanism for the dimeric structure of cellulose. We characterize both the conserved and non-conserved enzyme-polysaccharide interactions that drive translocation, and find that 20 of the 25 residues that strongly interact with the translocating cellulose chain in the simulations are well conserved, mostly with polar or aromatic side chains. Our results also allow for a dynamical analysis of the role of the so-called 'finger helix' in cellulose translocation that has been observed structurally. Taken together, these findings aid in the elucidation of the translocation steps of the Bcs processive

  12. Regulatory Mechanisms That Prevent Re-initiation of DNA Replication Can Be Locally Modulated at Origins by Nearby Sequence Elements

    PubMed Central

    Richardson, Christopher D.; Li, Joachim J.

    2014-01-01

    Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs). We have mapped the two RIPs to ∼60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some regions of the genome

  13. Redundancy in Periplasmic Binding Protein-Dependent Transport Systems for Trehalose, Sucrose, and Maltose in Sinorhizobium meliloti

    PubMed Central

    Jensen, John Beck; Peters, N. Kent; Bhuvaneswari, T. V.

    2002-01-01

    We have identified a cluster of six genes involved in trehalose transport and utilization (thu) in Sinorhizobium meliloti. Four of these genes, thuE, -F, -G, and -K, were found to encode components of a binding protein-dependent trehalose/maltose/sucrose ABC transporter. Their deduced gene products comprise a trehalose/maltose-binding protein (ThuE), two integral membrane proteins (ThuF and ThuG), and an ATP-binding protein (ThuK). In addition, a putative regulatory protein (ThuR) was found divergently transcribed from the thuEFGK operon. When the thuE locus was inactivated by gene replacement, the resulting S. meliloti strain was impaired in its ability to grow on trehalose, and a significant retardation in growth was seen on maltose as well. The wild type and the thuE mutant were indistinguishable for growth on glucose and sucrose. This suggested a possible overlap in function of the thuEFGK operon with the aglEFGAK operon, which was identified as a binding protein-dependent ATP-binding transport system for sucrose, maltose, and trehalose. The Kms for trehalose transport were 8 ± 1 nM and 55 ± 5 nM in the uninduced and induced cultures, respectively. Transport and growth experiments using mutants impaired in either or both of these transport systems show that these systems form the major transport systems for trehalose, maltose, and sucrose. By using a thuE′-lacZ fusion, we show that thuE is induced only by trehalose and not by cellobiose, glucose, maltopentaose, maltose, mannitol, or sucrose, suggesting that the thuEFGK system is primarily targeted toward trehalose. The aglEFGAK operon, on the other hand, is induced primarily by sucrose and to a lesser extent by trehalose. Tests for root colonization, nodulation, and nitrogen fixation suggest that uptake of disaccharides can be critical for colonization of alfalfa roots but is not important for nodulation and nitrogen fixation per se. PMID:12003938

  14. Regulatory mechanisms and the role of calcium and potassium channels controlling supercontractile crop muscles in adult Phormia regina.

    PubMed

    Solari, Paolo; Stoffolano, John G; Fitzpatrick, Joanna; Gelperin, Alan; Thomson, Alan; Talani, Giuseppe; Sanna, Enrico; Liscia, Anna

    2013-09-01

    Bioassays and electrophysiological recordings were conducted in the adult blowfly Phormia regina to provide new insights into the regulatory mechanisms governing the crop filling and emptying processes of the supercontractile crop muscles. The cibarial pump drives ingestion. Simultaneous multisite extracellular recordings show that crop lobe (P5) distension during ingestion of a 4.7 μl sugar meal does not require muscle activity by any of the other pumps of the system. Conversely, pumping of fluids toward the anterior of the crop system during crop emptying is brought about by active muscle contraction, in the form of a highly coordinated peristaltic wave starting from P5 and progressively propagating to P6, P4 and P3 pumps, with P5 contracting with a frequency about 3.4 times higher than the other pumps. The crop contraction rate is also modulated by hemolymph-borne factors such as sugars, through ligand recognition at a presumptive receptor site rather than by an osmotic effect, as assessed by both behavioural and electrophysiological experiments. In this respect, sugars of equal osmolarity produce different effects, glucose being inhibitory and mannose ineffective for crop muscles, while trehalose enhances crop activity. Finally, voltage and current clamp experiments show that the muscle action potentials (mAPs) at the P4 pump are sustained by a serotonin-sensitive calcium conductance. Serotonin enhances calcium entry into the muscle cells and this could lead, as an indirect modulatory effect, to activation of a Ca(2+)-activated K(+) conductance (IK(Ca)), which sustains the following mAP repolarization phase in such a way that further mAPs can be generated early and the frequency consequently increased. PMID:23834826

  15. The Inhibition Mechanism of Non-phosphorylated Ser768 in the Regulatory Domain of Cystic Fibrosis Transmembrane Conductance Regulator*

    PubMed Central

    Wang, Guangyu

    2011-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a member of the ATP-binding cassette transporters but serves as a chloride channel dysfunctional in cystic fibrosis. The activity of CFTR is tightly controlled not only by ATP-driven dimerization of its nucleotide-binding domains but also by phosphorylation of a unique regulatory (R) domain by protein kinase A (PKA). The R domain has multiple excitatory phosphorylation sites, but Ser737 and Ser768 are inhibitory. The underlying mechanism is unclear. Here, sulfhydryl-specific cross-linking strategy was employed to demonstrate that Ser768 or Ser737 could interact with outwardly facing hydrophilic residues of cytoplasmic loop 3 regulating channel gating. Furthermore, mutation of these residues to alanines promoted channel opening by curcumin in an ATP-dependent manner even in the absence of PKA. However, mutation of Ser768 and His950 with different hydrogen bond donors or acceptors clearly changed ATP- and PKA-dependent channel activity no matter whether curcumin was present or not. More importantly, significant activation of a double mutant H950R/S768R needed only ATP. Finally, in vitro and in vivo single channel recordings suggest that Ser768 may form a putative hydrogen bond with His950 of cytoplasmic loop 3 to prevent channel opening by ATP in the non-phosphorylated state and by subsequent cAMP-dependent phosphorylation. These observations support an electron cryomicroscopy-based structural model on which the R domain is closed to cytoplasmic loops regulating channel gating. PMID:21059651

  16. Accumulation Mechanisms of CD4(+)CD25(+)FOXP3(+) Regulatory T Cells in EBV-associated Gastric Carcinoma.

    PubMed

    Zhang, Na-na; Chen, Jian-ning; Xiao, Lin; Tang, Fang; Zhang, Zhi-gang; Zhang, Yi-wang; Feng, Zhi-ying; Jiang, Ye; Shao, Chun-kui

    2015-01-01

    Approximately 10% of gastric carcinomas are associated with Epstein-Barr virus (EBV) and are defined as EBV-associated gastric carcinomas (EBVaGCs). EBVaGCs are known to be accompanied by massive CD8(+) cytotoxic T cell (CTL) infiltration; however, adoptive cellular immunotherapy based on EBV-specific CD8(+) CTLs has been explored with limited success. Because regulatory T cells (Tregs) are regarded as a critical hurdle in anti-tumour immunity, we assessed the distribution of Tregs in 45 cases of EBVaGC and 45 cases of EBV-negative gastric carcinoma (EBVnGC) with matched clinicopathological parameters by immunohistochemistry. We showed that Tregs were significantly increased in EBVaGC compared to EBVnGC (15.92 ± 11.45/HPF vs. 8.45 ± 6.16/HPF, p = 0.001). In addition, we explored the accumulation mechanisms of Tregs in EBVaGC by using EBV (+) gastric carcinoma cell lines SNU719 and GT39 as ex vivo models. When peripheral blood mononuclear cells (PBMCs) were co-cultured with EBV (+) gastric carcinoma cell lines, the Treg frequency increased, and they underwent phenotypic and functional changes. The enhanced recruitment by CCL22 produced by EBVaGC cells, the decreased emigration due to CCR7 downregulation on the Treg surface, the higher proliferation rate, and the lower apoptosis rate of Tregs at tumour sites may promote the accumulation of Tregs in EBVaGC. PMID:26673957

  17. Awareness of federal regulatory mechanisms relevant to community-engaged research: survey of health disparities-oriented NIH-funded investigators

    PubMed Central

    Fullerton, Stephanie M.; Anderson, Emily E.; Cowan, Ketch; Malen, Rachel C.; Brugge, Doug

    2015-01-01

    Few studies or investigators involved in community engaged research or community-based participatory research have examined awareness and adoption of federal regulatory mechanisms. We conducted a survey of investigators affiliated with the ten National Institutes of Health (NIH) Centers for Population Health and Health Disparities. A questionnaire designed to capture experience with the conduct and oversight of community engaged research, and awareness of pertinent regulatory mechanisms, including Federalwide Assurances (FWAs), Individual Investigator Agreements (IIAs), and Institutional Review Board Authorization Agreements (IAAs), was completed by 101 respondents (68% response rate). Although most were aware of FWAs, only a minority of those surveyed reported knowledge of IAAs and IIAs and even fewer had used them in their research with community partners. Implications for future training and oversight are discussed. PMID:25742662

  18. Contrasting Evolutionary Dynamics of the Developmental Regulator PAX9, among Bats, with Evidence for a Novel Post-Transcriptional Regulatory Mechanism

    PubMed Central

    Phillips, Caleb D.; Butler, Boyd; Fondon, John W.; Mantilla-Meluk, Hugo; Baker, Robert J.

    2013-01-01

    Morphological evolution can be the result of natural selection favoring modification of developmental signaling pathways. However, little is known about the genetic basis of such phenotypic diversity. Understanding these mechanisms is difficult for numerous reasons, yet studies in model organisms often provide clues about the major developmental pathways involved. The paired-domain gene, PAX9, is known to be a key regulator of development, particularly of the face and teeth. In this study, using a comparative genetics approach, we investigate PAX9 molecular evolution among mammals, focusing on craniofacially diversified (Phyllostomidae) and conserved (Vespertilionidae) bat families, and extend our comparison to other orders of mammal. Open-reading frame analysis disclosed signatures of selection, in which a small percentage of residues vary, and lineages acquire different combinations of variation through recurrent substitution and lineage specific changes. A few instances of convergence for specific residues were observed between morphologically convergent bat lineages. Bioinformatic analysis for unknown PAX9 regulatory motifs indicated a novel post-transcriptional regulatory mechanism involving a Musashi protein. This regulation was assessed through fluorescent reporter assays and gene knockdowns. Results are compatible with the hypothesis that the number of Musashi binding-elements in PAX9 mRNA proportionally regulates protein translation rate. Although a connection between morphology and binding element frequency was not apparent, results indicate this regulation would vary among craniofacially divergent bat species, but be static among conserved species. Under this model, Musashi’s regulatory control of alternative human PAX9 isoforms would also vary. The presence of Musashi-binding elements within PAX9 of all mammals examined, chicken, zebrafish, and the fly homolog of PAX9, indicates this regulatory mechanism is ancient, originating basal to much of the

  19. Regulatory mechanisms underlying oil palm fruit mesocarp maturation, ripening, and functional specialization in lipid and carotenoid metabolism.

    PubMed

    Tranbarger, Timothy J; Dussert, Stéphane; Joët, Thierry; Argout, Xavier; Summo, Marilyne; Champion, Antony; Cros, David; Omore, Alphonse; Nouy, Bruno; Morcillo, Fabienne

    2011-06-01

    Fruit provide essential nutrients and vitamins for the human diet. Not only is the lipid-rich fleshy mesocarp tissue of the oil palm (Elaeis guineensis) fruit the main source of edible oil for the world, but it is also the richest dietary source of provitamin A. This study examines the transcriptional basis of these two outstanding metabolic characters in the oil palm mesocarp. Morphological, cellular, biochemical, and hormonal features defined key phases of mesocarp development. A 454 pyrosequencing-derived transcriptome was then assembled for the developmental phases preceding and during maturation and ripening, when high rates of lipid and carotenoid biosynthesis occur. A total of 2,629 contigs with differential representation revealed coordination of metabolic and regulatory components. Further analysis focused on the fatty acid and triacylglycerol assembly pathways and during carotenogenesis. Notably, a contig similar to the Arabidopsis (Arabidopsis thaliana) seed oil transcription factor WRINKLED1 was identified with a transcript profile coordinated with those of several fatty acid biosynthetic genes and the high rates of lipid accumulation, suggesting some common regulatory features between seeds and fruits. We also focused on transcriptional regulatory networks of the fruit, in particular those related to ethylene transcriptional and GLOBOSA/PISTILLATA-like proteins in the mesocarp and a central role for ethylene-coordinated transcriptional regulation of type VII ethylene response factors during ripening. Our results suggest that divergence has occurred in the regulatory components in this monocot fruit compared with those identified in the dicot tomato (Solanum lycopersicum) fleshy fruit model. PMID:21487046

  20. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  1. Cis- and Trans-Regulatory Mechanisms of Gene Expression in the ASJ Sensory Neuron of Caenorhabditis elegans

    PubMed Central

    González-Barrios, María; Fierro-González, Juan Carlos; Krpelanova, Eva; Mora-Lorca, José Antonio; Pedrajas, José Rafael; Peñate, Xenia; Chavez, Sebastián; Swoboda, Peter; Jansen, Gert; Miranda-Vizuete, Antonio

    2015-01-01

    The identity of a given cell type is determined by the expression of a set of genes sharing common cis-regulatory motifs and being regulated by shared transcription factors. Here, we identify cis and trans regulatory elements that drive gene expression in the bilateral sensory neuron ASJ, located in the head of the nematode Caenorhabditis elegans. For this purpose, we have dissected the promoters of the only two genes so far reported to be exclusively expressed in ASJ, trx-1 and ssu-1. We hereby identify the ASJ motif, a functional cis-regulatory bipartite promoter region composed of two individual 6 bp elements separated by a 3 bp linker. The first element is a 6 bp CG-rich sequence that presumably binds the Sp family member zinc-finger transcription factor SPTF-1. Interestingly, within the C. elegans nervous system SPTF-1 is also found to be expressed only in ASJ neurons where it regulates expression of other genes in these neurons and ASJ cell fate. The second element of the bipartite motif is a 6 bp AT-rich sequence that is predicted to potentially bind a transcription factor of the homeobox family. Together, our findings identify a specific promoter signature and SPTF-1 as a transcription factor that functions as a terminal selector gene to regulate gene expression in C. elegans ASJ sensory neurons. PMID:25769980

  2. Genome-Wide Analysis of Wilms' Tumor 1-Controlled Gene Expression in Podocytes Reveals Key Regulatory Mechanisms.

    PubMed

    Kann, Martin; Ettou, Sandrine; Jung, Youngsook L; Lenz, Maximilian O; Taglienti, Mary E; Park, Peter J; Schermer, Bernhard; Benzing, Thomas; Kreidberg, Jordan A

    2015-09-01

    The transcription factor Wilms' tumor suppressor 1 (WT1) is key to podocyte development and viability; however, WT1 transcriptional networks in podocytes remain elusive. We provide a comprehensive analysis of the genome-wide WT1 transcriptional network in podocytes in vivo using chromatin immunoprecipitation followed by sequencing (ChIPseq) and RNA sequencing techniques. Our data show a specific role for WT1 in regulating the podocyte-specific transcriptome through binding to both promoters and enhancers of target genes. Furthermore, we inferred a podocyte transcription factor network consisting of WT1, LMX1B, TCF21, Fox-class and TEAD family transcription factors, and MAFB that uses tissue-specific enhancers to control podocyte gene expression. In addition to previously described WT1-dependent target genes, ChIPseq identified novel WT1-dependent signaling systems. These targets included components of the Hippo signaling system, underscoring the power of genome-wide transcriptional-network analyses. Together, our data elucidate a comprehensive gene regulatory network in podocytes suggesting that WT1 gene regulatory function and podocyte cell-type specification can best be understood in the context of transcription factor-regulatory element network interplay. PMID:25636411

  3. The Regulatory T Cell Lineage Factor Foxp3 Regulates Gene Expression through Several Distinct Mechanisms Mostly Independent of Direct DNA Binding

    PubMed Central

    Andersen, Kristian G.; Hebenstreit, Daniel; Teichmann, Sarah A.; Betz, Alexander G.

    2015-01-01

    The lineage factor Foxp3 is essential for the development and maintenance of regulatory T cells, but little is known about the mechanisms involved. Here, we demonstrate that an N-terminal proline-rich interaction region is crucial for Foxp3’s function. Subdomains within this key region link Foxp3 to several independent mechanisms of transcriptional regulation. Our study suggests that Foxp3, even in the absence of its DNA-binding forkhead domain, acts as a bridge between DNA-binding interaction partners and proteins with effector function permitting it to regulate a large number of genes. We show that, in one such mechanism, Foxp3 recruits class I histone deacetylases to the promoters of target genes, counteracting activation-induced histone acetylation and thereby suppressing their expression. PMID:26107960

  4. Signal Transduction and Regulatory Mechanisms Involved in Control of the σS (RpoS) Subunit of RNA Polymerase

    PubMed Central

    Hengge-Aronis, Regine

    2002-01-01

    The σS (RpoS) subunit of RNA polymerase is the master regulator of the general stress response in Escherichia coli and related bacteria. While rapidly growing cells contain very little σS, exposure to many different stress conditions results in rapid and strong σS induction. Consequently, transcription of numerous σS-dependent genes is activated, many of which encode gene products with stress-protective functions. Multiple signal integration in the control of the cellular σS level is achieved by rpoS transcriptional and translational control as well as by regulated σS proteolysis, with various stress conditions differentially affecting these levels of σS control. Thus, a reduced growth rate results in increased rpoS transcription whereas high osmolarity, low temperature, acidic pH, and some late-log-phase signals stimulate the translation of already present rpoS mRNA. In addition, carbon starvation, high osmolarity, acidic pH, and high temperature result in stabilization of σS, which, under nonstress conditions, is degraded with a half-life of one to several minutes. Important cis-regulatory determinants as well as trans-acting regulatory factors involved at all levels of σS regulation have been identified. rpoS translation is controlled by several proteins (Hfq and HU) and small regulatory RNAs that probably affect the secondary structure of rpoS mRNA. For σS proteolysis, the response regulator RssB is essential. RssB is a specific direct σS recognition factor, whose affinity for σS is modulated by phosphorylation of its receiver domain. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded. This review summarizes our current knowledge about the molecular functions and interactions of these components and tries to establish a framework for further research on the mode of multiple signal input into this complex regulatory system. PMID:12208995

  5. Posttranslational Modification of Maize Chloroplast Pyruvate Orthophosphate Dikinase Reveals the Precise Regulatory Mechanism of Its Enzymatic Activity.

    PubMed

    Chen, Yi-Bo; Lu, Tian-Cong; Wang, Hong-Xia; Shen, Jie; Bu, Tian-Tian; Chao, Qing; Gao, Zhi-Fang; Zhu, Xin-Guang; Wang, Yue-Feng; Wang, Bai-Chen

    2014-04-01

    In C4 plants, pyruvate orthophosphate dikinase (PPDK) activity is tightly dark/light regulated by reversible phosphorylation of an active-site threonine (Thr) residue; this process is catalyzed by PPDK regulatory protein (PDRP). Phosphorylation and dephosphorylation of PPDK lead to its inactivation and activation, respectively. Here, we show that light intensity rather than the light/dark transition regulates PPDK activity by modulating the reversible phosphorylation at Thr-527 (previously termed Thr-456) of PPDK in maize (Zea mays). The amount of PPDK (unphosphorylated) involved in C4 photosynthesis is indeed strictly controlled by light intensity, despite the high levels of PPDK protein that accumulate in mesophyll chloroplasts. In addition, we identified a transit peptide cleavage site, uncovered partial amino-terminal acetylation, and detected phosphorylation at four serine (Ser)/Thr residues, two of which were previously unknown in maize. In vitro experiments indicated that Thr-527 and Ser-528, but not Thr-309 and Ser-506, are targets of PDRP. Modeling suggests that the two hydrogen bonds between the highly conserved residues Ser-528 and glycine-525 are required for PDRP-mediated phosphorylation of the active-site Thr-527 of PPDK. Taken together, our results suggest that the regulation of maize plastid PPDK isoform (C4PPDK) activity is much more complex than previously reported. These diverse regulatory pathways may work alone or in combination to fine-tune C4PPDK activity in response to changes in lighting. PMID:24710069

  6. Regulatory RNAs

    PubMed Central

    Vazquez-Anderson, Jorge; Contreras, Lydia M

    2013-01-01

    RNAs have many important functional properties, including that they are independently controllable and highly tunable. As a result of these advantageous properties, their use in a myriad of sophisticated devices has been widely explored. Yet, the exploitation of RNAs for synthetic applications is highly dependent on the ability to characterize the many new molecules that continue to be discovered by large-scale sequencing and high-throughput screening techniques. In this review, we present an exhaustive survey of the most recent synthetic bacterial riboswitches and small RNAs while emphasizing their virtues in gene expression management. We also explore the use of these RNA components as building blocks in the RNA synthetic biology toolbox and discuss examples of synthetic RNA components used to rewire bacterial regulatory circuitry. We anticipate that this field will expand its catalog of smart devices by mimicking and manipulating natural RNA mechanisms and functions. PMID:24356572

  7. Mechanisms of impaired regulation by CD4+CD25+FOXP3+ regulatory T cells in human autoimmune diseases

    PubMed Central

    Buckner, Jane Hoyt

    2011-01-01

    A lack of regulatory T (TReg) cells that express CD4, CD25 and forkhead box P3 (FOXP3) results in severe autoimmunity in both mice and humans. Since the discovery of TReg cells, there has been intense investigation aimed at determining how they protect an organism from autoimmunity and whether defects in their number or function contribute to the development of autoimmunity in model systems. The next phase of investigation — that is, to define the role that defects in TReg cells have in human autoimmunity — is now underway. This Review summarizes our progress so far towards understanding the role of CD4+CD25+FOXP3+ TReg cells in human autoimmune diseases and the impact that this knowledge might have on the diagnosis and treatment of these diseases. PMID:21107346

  8. The dynamics of the MBP-MalFGK(2) interaction: a prototype for binding protein dependent ABC-transporter systems.

    PubMed

    Shilton, Brian H

    2008-09-01

    This review is focused on the interaction between maltose binding protein (MBP) and the maltose transporter complex, MalFGK(2), which is a member of the ATP Binding Cassette (ABC) superfamily. The interaction between MBP and MalFGK(2) has a critical role in maltose transport, but a coherent description of the interaction is complicated because both MBP and MalFGK(2) can adopt multiple conformations. Drawing on genetic, structural, and biochemical data, the different conformations of MBP and MalFGK(2) are described and incorporated into a model for their interaction. The most important feature of this model is that ligand-bound MBP initiates the process of ATP-dependent maltose transport by stabilizing a high-energy conformation of MalFGK(2). In this model of the MBP-MalFGK(2) interaction, stabilization of a high-energy conformation of MalFGK(2) allows ATP to drive conformational changes in the system - in particular the opening of bound MBP - that leads to formation of a transition state for ATP hydrolysis. Such a role for ligand-bound MBP explains how MBP-independent MalFGK(2) mutants work, and represents a general mechanism for binding-protein dependent ABC import systems. In ABC export systems, which do not use a binding protein, the substrate itself is expected to play a role similar to ligand-bound MBP in the maltose transport system. The mechanistic model for the maltose transporter suggests that ABC-type import systems evolved to make use of a peripheral binding protein so that the transport process is essentially irreversible. PMID:17950243

  9. Analysis of functional selectivity through G protein-dependent and -independent signaling pathways at the adrenergic α(2C) receptor.

    PubMed

    Kurko, Dalma; Kapui, Zoltán; Nagy, József; Lendvai, Balázs; Kolok, Sándor

    2014-08-01

    Although G protein-coupled receptors (GPCRs) are traditionally categorized as Gs-, Gq-, or Gi/o-coupled, their signaling is regulated by multiple mechanisms. GPCRs can couple to several effector pathways, having the capacity to interact not only with more than one G protein subtype but also with alternative signaling or effector proteins such as arrestins. Moreover, GPCR ligands can have different efficacies for activating these signaling pathways, a characteristic referred to as biased agonism or functional selectivity. In this work our aim was to detect differences in the ability of various agonists acting at the α2C type of adrenergic receptors (α2C-ARs) to modulate cAMP accumulation, cytoplasmic Ca(2+) release, β-arrestin recruitment and receptor internalization. A detailed comparative pharmacological characterization of G protein-dependent and -independent signaling pathways was carried out using adrenergic agonists (norepinephrine, phenylephrine, brimonidine, BHT-920, oxymetazoline, clonidine, moxonidine, guanabenz) and antagonists (MK912, yohimbine). As initial analysis of agonist Emax and EC50 values suggested possible functional selectivity, ligand bias was quantified by applying the relative activity scale and was compared to that of the endogenous agonist norepinephrine. Values significantly different from 0 between pathways indicated an agonist that promoted different level of activation of diverse effector pathways most likely due to the stabilization of a subtly different receptor conformation from that induced by norepinephrine. Our results showed that a series of agonists acting at the α2C-AR displayed different degree of functional selectivity (bias factors ranging from 1.6 to 36.7) through four signaling pathways. As signaling via these pathways seems to have distinct functional and physiological outcomes, studying all these stages of receptor activation could have further implications for the development of more selective therapeutics with

  10. In Vivo Profiling of Estrogen Receptor/Specificity Protein-Dependent Transactivation

    PubMed Central

    Wu, Fei; Xu, Rui; Kim, Kyounghyun; Martin, James; Safe, Stephen

    2008-01-01

    17β-Estradiol (E2) activates the estrogen receptor (ER) through multiple genomic and nongenomic pathways in various tissues/organs. ERα/specificity protein-dependent activation of E2-responsive genes containing GC-rich promoters has been identified in breast and other cancer cell lines, and in this study, we describe transgenic animals overexpressing a transgene containing three tandem GC-rich sites linked to a minimal TATA or thymidine kinase promoter and a luciferase gene. Several mouse lines expressing the transgenes were characterized and, in line 15, E2 induced a 9-fold increase in luciferase activity in the female mouse uterus, and the synthetic estrogens bisphenol A and nonylphenol also induced uterine luciferase activity. The pure antiestrogen ICI 182,780 induced luciferase activity in the mouse uterus, and similar results were observed for ICI 182,780 in breast cancer cells transfected with this construct. Differences in the ER agonist and antagonist activities of E2, nonylphenol, bisphenol A, and ICI 182,780 were investigated in the male testis and penis and the male and female stomach in line 15 transgenic mice. All of these tissues were hormone responsive; however, the patterns of induced or repressed luciferase activity were ligand structure, tissue, and sex dependent. These results demonstrate for the first time hormonal activation or repression of a GC-rich promoter in vivo, and the results suggest that the ERα/specificity protein pathway may contribute to E2-dependent induction and repression of genes. PMID:18635651

  11. FarR regulates the farAB-encoded efflux pump of Neisseria gonorrhoeae via an MtrR regulatory mechanism.

    PubMed

    Lee, E-H; Rouquette-Loughlin, C; Folster, J P; Shafer, W M

    2003-12-01

    The farAB operon of Neisseria gonorrhoeae encodes an efflux pump which mediates gonococcal resistance to antibacterial fatty acids. It was previously observed that expression of the farAB operon was positively regulated by MtrR, which is a repressor of the mtrCDE-encoded efflux pump system (E.-H. Lee and W. M. Shafer, Mol. Microbiol. 33:839-845, 1999). This regulation was believed to be indirect since MtrR did not bind to the farAB promoter. In this study, computer analysis of the gonococcal genome sequence database, lacZ reporter fusions, and gel mobility shift assays were used to elucidate the regulatory mechanism by which expression of the farAB operon is modulated by MtrR in gonococci. We identified a regulatory protein belonging to the MarR family of transcriptional repressors and found that it negatively controls expression of farAB by directly binding to the farAB promoter. We designated this regulator FarR to signify its role in regulating the farAB operon. We found that MtrR binds to the farR promoter, thereby repressing farR expression. Hence, MtrR regulates farAB in a positive fashion by modulating farR expression. This MtrR regulatory cascade seems to play an important role in adjusting levels of the FarAB and MtrCDE efflux pumps to prevent their excess expression in gonococci. PMID:14645274

  12. Temperature controls on the basal emission rate of isoprene in a tropical tree Ficus septica: exploring molecular regulatory mechanisms.

    PubMed

    Mutanda, Ishmael; Inafuku, Masashi; Saitoh, Seikoh; Iwasaki, Hironori; Fukuta, Masakazu; Watanabe, Keiichi; Oku, Hirosuke

    2016-10-01

    Isoprene emission from plants is very sensitive to environmental temperature both at short-term and long-term scales. Our previous study demonstrated suppression of isoprene emission by cold temperatures in a high emitting tropical tree Ficus septica and revealed a strong correlation of emission to isoprene synthase (IspS) protein levels. When challenged with decreasing daily temperatures from 30 to 12 °C, F. septica completely stopped isoprene emission at 12 °C, only to recover on the second day after re-exposure to 30 °C. Here, we explored this regulation of isoprene emission in response to environmental temperature by a comprehensive analysis of transcriptome data, gene expressions and metabolite pools of the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. MEP pathway genes and metabolites dynamics did not support substrate-level limitations as major control over observed basal emission, but transcriptome data, network inferences and putative regulatory elements on IspS promoter suggested transcriptional regulation of IspS gene through circadian rhythm and phytohormone signalling processes. Expression levels of 29 genes involved in these pathways were examined by quantitative real-time PCR. We propose that temperature controls over basal isoprene emission at a time-scale of hours to few days are regulated by phytohormone-mediated transcriptional modulation of IspS gene under synchronization by the circadian clock. PMID:27425779

  13. Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development

    PubMed Central

    2010-01-01

    Background MicroRNAs (miRNAs), a family of small non-coding RNA molecules, appear to regulate animal lipid metabolism and preadipocyte conversion to form lipid-assimilating adipocytes (i.e. adipogenesis). However, no miRNA to date has been reported to modulate adipogenesis and lipid deposition in beef cattle. Results The expression patterns of 89 miRNAs including four bovine specific miRNAs in subcutaneous adipose tissues from three groups of crossbred steers differing in backfat thickness were compared using qRT-PCR analysis. Eighty-six miRNAs were detectable in all samples, with 42 miRNAs differing among crossbreds (P < 0.05) and 15 miRNAs differentially expressed between tissues with high and low backfat thickness (P < 0.05). The expression levels of 18 miRNAs were correlated with backfat thickness (P < 0.05). The miRNA most differentially expressed and the most strongly associated with backfat thickness was miR-378, with a 1.99-fold increase in high backfat thickness tissues (r = 0.72). Conclusions MiRNA expression patterns differed significantly in response to host genetic components. Approximately 20% of the miRNAs in this study were identified as being correlated with backfat thickness. This result suggests that miRNAs may play a regulatory role in white adipose tissue development in beef animals. PMID:20423511

  14. Digestive cells from Mytilus galloprovincialis show a partial regulatory volume decrease following acute hypotonic stress through mechanisms involving inorganic ions.

    PubMed

    Torre, Agata; Trischitta, Francesca; Corsaro, Carmelo; Mallamace, Domenico; Faggio, Caterina

    2013-08-01

    The response of isolated digestive cells of the digestive gland of Mytilus galloprovincialis to hypotonic shock was studied using videometric methods. The isolated cells exposed to a rapid change (from 1100 to 800 mosmol kg(-1) ) of the bathing solution osmolality swelled but thereafter underwent a regulatory volume decrease (RVD), tending to recover the original size. When the hypotonic stress was applied in the presence of quinine and glibenclamide, known inhibitors of swelling activated ion channels, the cells did not exhibit an RVD response; in addition, they showed a larger increase in size in respect to control cells. These observations suggest that the digestive cells of the digestive gland have the machinery to cope with the hyposmotic shock allowing them to exhibit a small but significant RVD preventing an excessive increase in cell size. The pharmacological treatment of digestive cells during the RVD experiments suggests that cell volume is regulated by K(+) and Cl(-) efflux followed by an obliged water efflux from the cell. The involvement of organic osmolytes such as taurine and betaine seems to be excluded by NMR measurement on digestive cells. PMID:23112133

  15. Mechanisms of andrographolide-induced platelet apoptosis in human platelets: regulatory roles of the extrinsic apoptotic pathway.

    PubMed

    Lien, Li-Ming; Su, Cheng-Chen; Hsu, Wen-Hsien; Lu, Wan-Jung; Chung, Chi-Li; Yen, Ting-Lin; Chiu, Hou-Chang; Sheu, Joen-Rong; Lin, Kuan-Hung

    2013-11-01

    Andrographolide, a novel nuclear factor-κB (NF-κB) inhibitor, is isolated from the leaves of Andrographis paniculata. Platelet activation is relevant to a variety of coronary heart diseases. Our recent studies revealed that andrographolide possesses potent antiplatelet activity by inhibition of the p38 MAPK/(●) HO-NF-κB-ERK2 cascade. Although platelets are anucleated cells, apoptotic machinery apparatus recently has been found to regulate platelet activation and limit platelet lifespan. Therefore, we further investigated the regulatory effects of andrographolide on platelet apoptotic events. In this study, apoptotic signaling events for caspase-3, -8, and Bid were time (10-60 min)- and dose (25-100 μΜ)-dependently activated by andrographolide in human platelets. Andrographolide could also disrupt mitrochondrial membrane potential. In addition, caspase-8 inhibitor (z-IETD-fmk, 50 μΜ) was found to reverse andrographolide-induced caspase-8 activation, whereas the antagonistic anti-Fas receptor (ZB4, 500 ng/mL) and anti-tumor necrosis factor-R1 (H398, 10 µg/mL) monoclonal antibodies did not. In conclusion, this study for the first time demonstrated that andrographolide might limit platelet lifespan by initiating the caspase-8-dependent extrinsic apoptotic pathway, in spite of no direct evidence that death receptors are involved in this process proved. Overall, the various medicinal properties of andrographolide suggest its potential value in treating patients with thromboembolic disorders. PMID:23292890

  16. Simultaneous coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp locus-directed regulatory mechanism.

    PubMed

    El-Hage, Nazira; Stevenson, Brian

    2002-08-01

    An individual Borrelia burgdorferi bacterium can encode as many as 13 different Erp (OspE/F-related) proteins from mono-and bicistronic loci that are carried on up to 10 separate plasmids. We demonstrate through multilabel immunofluorescence analyses that individual bacteria simultaneously coexpress their entire Erp protein repertoire. While it has been proposed that B. burgdorferi controls expression of Erp and other plasmid-encoded proteins through changes in DNA topology, we observed regulated Erp expression in the absence of detectable differences in DNA supercoiling. Likewise, inhibition of DNA gyrase had no detectable effect on Erp expression. Furthermore, expression of loci physically adjacent to erp loci was observed to be independently regulated. It is concluded that Erp expression is regulated by a mechanism(s) directed at erp loci and not by a global, plasmid-wide mechanism. PMID:12142424

  17. Inference of the Arabidopsis Lateral Root Gene Regulatory Network Suggests a Bifurcation Mechanism That Defines Primordia Flanking and Central Zones[OPEN

    PubMed Central

    Lavenus, Julien; Goh, Tatsuaki; Guyomarc’h, Soazig; Hill, Kristine; Lucas, Mikael; Voß, Ute; Kenobi, Kim; Wilson, Michael H.; Farcot, Etienne; Hagen, Gretchen; Guilfoyle, Thomas J.; Fukaki, Hidehiro; Laplaze, Laurent; Bennett, Malcolm J.

    2015-01-01

    A large number of genes involved in lateral root (LR) organogenesis have been identified over the last decade using forward and reverse genetic approaches in Arabidopsis thaliana. Nevertheless, how these genes interact to form a LR regulatory network largely remains to be elucidated. In this study, we developed a time-delay correlation algorithm (TDCor) to infer the gene regulatory network (GRN) controlling LR primordium initiation and patterning in Arabidopsis from a time-series transcriptomic data set. The predicted network topology links the very early-activated genes involved in LR initiation to later expressed cell identity markers through a multistep genetic cascade exhibiting both positive and negative feedback loops. The predictions were tested for the key transcriptional regulator AUXIN RESPONSE FACTOR7 node, and over 70% of its targets were validated experimentally. Intriguingly, the predicted GRN revealed a mutual inhibition between the ARF7 and ARF5 modules that would control an early bifurcation between two cell fates. Analyses of the expression pattern of ARF7 and ARF5 targets suggest that this patterning mechanism controls flanking and central zone specification in Arabidopsis LR primordia. PMID:25944102

  18. “Curcumin, the King of Spices”: Epigenetic Regulatory Mechanisms in the Prevention of Cancer, Neurological, and Inflammatory Diseases

    PubMed Central

    Boyanapalli, Sarandeep S. S.

    2015-01-01

    Curcumin (diferuloylmethane), a polyphenolic compound, is a component of Curcuma longa, commonly known as turmeric. It is a well-known anti-inflammatory, anti-oxidative, and anti-lipidemic agent and has recently been shown to modulate several diseases via epigenetic regulation. Many recent studies have demonstrated the role of epigenetic inactivation of pivotal genes that regulate human pathologies, such as neurocognitive disorders, inflammation, obesity, and cancers. Epigenetic changes involve changes in DNA methylation, histone modifications, or altered microRNA expression patterns which are known to be interconnected and play a key role in tumor progression and failure of conventional chemotherapy. The majority of epigenetic changes are influenced by lifestyle and diets. In this regard, dietary phytochemicals as dietary supplements have emerged as a promising source that are able to reverse these epigenetic alterations, to actively regulate gene expression and molecular targets that are known to promote tumorigenesis, and also to prevent age-related diseases through epigenetic modifications. There have been several studies which reported the role of curcumin as an epigenetic regulator in neurological disorders, inflammation, and in diabetes apart from cancers. The epigenetic regulatory roles of curcumin include (1) inhibition of DNA methyltransferases (DNMTs), which has been well defined from the recent studies on its function as a DNA hypomethylating agent; (2) regulation of histone modifications via regulation of histone acetyltransferases (HATs) and histone deacetylases (HDACs); and (3) regulation of micro RNAs (miRNA). This review summarizes the current knowledge on the effect of curcumin in the treatment and/or prevention of inflammation, neurodegenerative diseases, and cancers by regulating histone deacetylases, histone acetyltransferases, and DNA methyltransferases. PMID:26457241

  19. Reovirus μ2 Protein Inhibits Interferon Signaling through a Novel Mechanism Involving Nuclear Accumulation of Interferon Regulatory Factor 9▿

    PubMed Central

    Zurney, Jennifer; Kobayashi, Takeshi; Holm, Geoffrey H.; Dermody, Terence S.; Sherry, Barbara

    2009-01-01

    The secreted cytokine alpha/beta interferon (IFN-α/β) binds its receptor to activate the Jak-STAT signal transduction pathway, leading to formation of the heterotrimeric IFN-stimulated gene factor 3 (ISGF3) transcription complex for induction of IFN-stimulated genes (ISGs) and establishment of an antiviral state. Many viruses have evolved countermeasures to inhibit the IFN pathway, thereby subverting the innate antiviral response. Here, we demonstrate that the mildly myocarditic reovirus type 1 Lang (T1L), but not the nonmyocarditic reovirus type 3 Dearing, represses IFN induction of a subset of ISGs and that this repressor function segregates with the T1L M1 gene. Concordantly, the T1L M1 gene product, μ2, dramatically inhibits IFN-β-induced reporter gene expression. Surprisingly, T1L infection does not degrade components of the ISGF3 complex or interfere with STAT1 or STAT2 nuclear translocation as has been observed for other viruses. Instead, infection with T1L or reassortant or recombinant viruses containing the T1L M1 gene results in accumulation of interferon regulatory factor 9 (IRF9) in the nucleus. This effect has not been previously described for any virus and suggests that μ2 modulates IRF9 interactions with STATs for both ISGF3 function and nuclear export. The M1 gene is a determinant of virus strain-specific differences in the IFN response, which are linked to virus strain-specific differences in induction of murine myocarditis. We find that virus-induced myocarditis is associated with repression of IFN function, providing new insights into the pathophysiology of this disease. Together, these data provide the first report of an increase in IRF9 nuclear accumulation associated with viral subversion of the IFN response and couple virus strain-specific differences in IFN antagonism to the pathogenesis of viral myocarditis. PMID:19109390

  20. Autophagy Regulatory Network — A systems-level bioinformatics resource for studying the mechanism and regulation of autophagy

    PubMed Central

    Türei, Dénes; Földvári-Nagy, László; Fazekas, Dávid; Módos, Dezső; Kubisch, János; Kadlecsik, Tamás; Demeter, Amanda; Lenti, Katalin; Csermely, Péter; Vellai, Tibor; Korcsmáros, Tamás

    2015-01-01

    Autophagy is a complex cellular process having multiple roles, depending on tissue, physiological, or pathological conditions. Major post-translational regulators of autophagy are well known, however, they have not yet been collected comprehensively. The precise and context-dependent regulation of autophagy necessitates additional regulators, including transcriptional and post-transcriptional components that are listed in various datasets. Prompted by the lack of systems-level autophagy-related information, we manually collected the literature and integrated external resources to gain a high coverage autophagy database. We developed an online resource, Autophagy Regulatory Network (ARN; http://autophagy-regulation.org), to provide an integrated and systems-level database for autophagy research. ARN contains manually curated, imported, and predicted interactions of autophagy components (1,485 proteins with 4,013 interactions) in humans. We listed 413 transcription factors and 386 miRNAs that could regulate autophagy components or their protein regulators. We also connected the above-mentioned autophagy components and regulators with signaling pathways from the SignaLink 2 resource. The user-friendly website of ARN allows researchers without computational background to search, browse, and download the database. The database can be downloaded in SQL, CSV, BioPAX, SBML, PSI-MI, and in a Cytoscape CYS file formats. ARN has the potential to facilitate the experimental validation of novel autophagy components and regulators. In addition, ARN helps the investigation of transcription factors, miRNAs and signaling pathways implicated in the control of the autophagic pathway. The list of such known and predicted regulators could be important in pharmacological attempts against cancer and neurodegenerative diseases. PMID:25635527

  1. Stimulation of beta(1----3)glucan synthetase of various fungi by nucleoside triphosphates: generalized regulatory mechanism for cell wall biosynthesis.

    PubMed Central

    Szaniszlo, P J; Kang, M S; Cabib, E

    1985-01-01

    Particulate fractions from the taxonomically diverse fungi Achlya ambisexualis, Hansenula anomala, Neurospora crassa, Cryptococcus laurentii, Schizophyllum commune, and Wangiella dermatitidis were found to catalyze the time-dependent incorporation of glucose from UDP-[14C]glucose into a water-insoluble material. The reaction was stimulated by bovine serum albumin. The product was characterized as beta(1----3)glucan on the basis of its resistance to alpha- and beta-amylase and susceptibility to beta(1----3)glucanase. With the exception of the preparation from A. ambisexualis, all others were stimulated by nucleoside triphosphates and their analogs. The best activators were GTP and guanosine 5'-(gamma-thio)triphosphate. It is concluded that the stimulation by nucleotides, previously found with the glucan synthetase of Saccharomyces cerevisiae, is a regulatory mechanism that was well conserved during fungal evolution, presumably because of its importance in controlling cell wall biosynthesis and cell growth. PMID:3156122

  2. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle.

    PubMed

    Manimaran, A; Kumaresan, A; Jeyakumar, S; Mohanty, T K; Sejian, V; Kumar, Narender; Sreela, L; Prakash, M Arul; Mooventhan, P; Anantharaj, A; Das, D N

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  3. Potential of acute phase proteins as predictor of postpartum uterine infections during transition period and its regulatory mechanism in dairy cattle

    PubMed Central

    Manimaran, A.; Kumaresan, A.; Jeyakumar, S.; Mohanty, T. K.; Sejian, V.; Kumar, Narender; Sreela, L.; Prakash, M. Arul; Mooventhan, P.; Anantharaj, A.; Das, D. N.

    2016-01-01

    Among the various systemic reactions against infection or injury, the acute phase response is the cascade of reaction and mostly coordinated by cytokines-mediated acute phase proteins (APPs) production. Since APPs are sensitive innate immune molecules, they are useful for early detection of inflammation in bovines and believed to be better discriminators than routine hematological parameters. Therefore, the possibility of using APPs as a diagnostic and prognostic marker of inflammation in major bovine health disorders including postpartum uterine infection has been explored by many workers. In this review, we discussed specifically importance of postpartum uterine infection, the role of energy balance in uterine infections and potential of APPs as a predictor of postpartum uterine infections during the transition period and its regulatory mechanism in dairy cattle. PMID:27051191

  4. FGF23-Associated Tumor-Induced Osteomalacia in a Patient With Small Cell Carcinoma: A Case Report and Regulatory Mechanism Study.

    PubMed

    Sauder, Adrienne; Wiernek, Szymon; Dai, Xumin; Pereira, Renata; Yudd, Michael; Patel, Charvi; Golden, Andrew; Ahmed, Shahida; Choe, Jin; Chang, Victor; Sender, Slawomir; Cai, Donghong

    2016-04-01

    Tumor-induced osteomalacia (TIO) is typically caused by phosphaturic mesenchymal tumor (PMT) that secretes the phosphaturic hormone, fibroblast growth factor-23 (FGF23), resulting in decreased phosphate reabsorption in kidneys, hypophosphatemia, and finally osteomalacia. Rare cases of malignant tumor manifesting with TIO other than PMT had been reported, although in most of these reports, except one, circulating FGF23 levels were not evaluated and tissue expressing of FGF23 was not confirmed. In this article, we report a case of TIO in a patient with pulmonary small cell carcinoma with liver metastasis. The patient manifested with hypophosphatemia. His circulating level of FGF23 was markedly increased. The expression of FGF23 in tumor cells was confirmed. Furthermore, the regulatory mechanism of FGF23 in this patient was also investigated. PMID:26612848

  5. Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid.

    PubMed

    Yao, D W; Luo, J; He, Q Y; Li, J; Wang, H; Shi, H B; Xu, H F; Wang, M; Loor, J J

    2016-05-01

    Stearoyl-coenzyme A desaturase 1 (SCD1) is a key enzyme in the biosynthesis of palmitoleic and oleic acid. Although the transcriptional regulatory mechanism of SCD1 via polyunsaturated fatty acids (PUFA) has been extensively explored in nonruminants, the existence of such mechanism in ruminant mammary gland remains unknown. In this study, we used goat genomic DNA to clone and sequence a 1,713-bp fragment of the SCD1 5' flanking region. Deletion assays revealed a core region of the promoter located between -415 and -109 bp upstream of the transcription start site, and contained the highly conserved PUFA response region. An intact PUFA response region was required for the basal transcriptional activity of SCD1. Linoleic acid reduced endogenous expression of SCD1 and sterol regulatory element binding factor-1 (SREBF1) in goat mammary epithelial cells. Further analysis indicated that both the sterol response element (SRE) and the nuclear factor Y (NF-Y) binding site in the SCD1 promoter were responsible for the inhibition effect by linoleic acid, whereas the effect was abrogated once NF-Y was deleted. In addition, SRE and NF-Y were partly responsible for the transcriptional activation induced via the liver X receptor agonist T 4506585 (Sigma-Aldrich, St. Louis, MO). When goat mammary epithelial cells were cultured with linoleic acid, addition of T 4506585 markedly increased SCD1 transcription in controls, but had no effect on cells with a deleted SRE promoter. These results demonstrated that linoleic acid can regulate SCD1 expression at the transcriptional level through SRE and NF-Y in a liver X receptor-dependent fashion in the goat mammary gland. PMID:26947306

  6. Probing the chemical mechanism and critical regulatory amino acid residues of Drosophila melanogaster arylalkylamine N-acyltransferase like 2.

    PubMed

    Dempsey, Daniel R; Carpenter, Anne-Marie; Ospina, Santiago Rodriguez; Merkler, David J

    2015-11-01

    Arylalkylamine N-acyltransferase like 2 (AANATL2) catalyzes the formation of N-acylarylalkylamides from the corresponding acyl-CoA and arylalkylamine. The N-acylation of biogenic amines in Drosophila melanogaster is a critical step for the inactivation of neurotransmitters, cuticle sclerotization, and melatonin biosynthesis. In addition, D. melanogaster has been used as a model system to evaluate the biosynthesis of fatty acid amides: a family of potent cell signaling lipids. We have previously showed that AANATL2 catalyzes the formation of N-acylarylakylamides, including long-chain N-acylserotonins and N-acyldopamines. Herein, we define the kinetic mechanism for AANATL2 as an ordered sequential mechanism with acetyl-CoA binding first followed by tyramine to generate the ternary complex prior to catalysis. Bell shaped kcat,app - acetyl-CoA and (kcat/Km)app - acetyl-CoA pH-rate profiles identified two apparent pKa,app values of ∼7.4 and ∼8.9 that are critical to catalysis, suggesting the AANATL2-catalyzed formation of N-acetyltyramine occurs through an acid/base chemical mechanism. Site-directed mutagenesis of a conserved glutamate that corresponds to the catalytic base for other D. melanogaster AANATL enzymes did not produce a substantial depression in the kcat,app value nor did it abolish the pKa,app value attributed to the general base in catalysis (pKa ∼7.4). These data suggest that AANATL2 catalyzes the formation of N-acylarylalkylamides using either different catalytic residues or a different chemical mechanism relative to other D. melanogaster AANATL enzymes. In addition, we constructed other site-directed mutants of AANATL2 to help define the role of targeted amino acids in substrate binding and/or enzyme catalysis. PMID:26476413

  7. Immune-Regulatory Mechanisms of Classical and Experimental Multiple Sclerosis Drugs: A Special Focus on Helminth-Derived Treatments.

    PubMed

    Peón, Alberto N; Terrazas, Luis I

    2016-01-01

    Multiple sclerosis (MS) is the most prevalent autoimmune disease affecting the central nervous system (CNS). Its pathophysiology is centered on neuron myelin sheath destruction in a manner largely dependent upon CD4+/CD8+ T-cell autoreactivity against myelin antigens, inducing Th1/Th17 pathogenic responses with the resulting production of free radicals and soluble mediators that exhibit the effector mechanisms of neurodegeneration. The immune response responsible for this disease is complex and challenges modern medicine. Consequently, many experimental therapies have been proposed in addition to the classical array of immunoregulatory/ immunosuppressive drugs that are normally used to treat MS. In this review, we will describe the effects and mechanisms of action of widely used disease-modifying MS drugs as well as those of select treatments that are currently in the experimental phase. Special emphasis is placed on helminth-derived immunoregulators, as some of them have shown promising results. Additionally, we will compare the mechanisms of action of both the MS drugs and the helminth-derived treatments to discuss the potential importance of some signaling pathways in the control of MS. PMID:26947777

  8. The Allosteric Regulatory Mechanism of the Escherichia coli MetNI Methionine ATP Binding Cassette (ABC) Transporter*

    PubMed Central

    Yang, Janet G.; Rees, Douglas C.

    2015-01-01

    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of d- and l-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by l-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. PMID:25678706

  9. To gate, or not to gate: regulatory mechanisms for intercellular protein transport and virus movement in plants.

    PubMed

    Ueki, Shoko; Citovsky, Vitaly

    2011-09-01

    Cell-to-cell signal transduction is vital for orchestrating the whole-body physiology of multi-cellular organisms, and many endogenous macromolecules, proteins, and nucleic acids function as such transported signals. In plants, many of these molecules are transported through plasmodesmata (Pd), the cell wall-spanning channel structures that interconnect plant cells. Furthermore, Pd also act as conduits for cell-to-cell movement of most plant viruses that have evolved to pirate these channels to spread the infection. Pd transport is presumed to be highly selective, and only a limited repertoire of molecules is transported through these channels. Recent studies have begun to unravel mechanisms that actively regulate the opening of the Pd channel to allow traffic. This macromolecular transport between cells comprises two consecutive steps: intracellular targeting to Pd and translocation through the channel to the adjacent cell. Here, we review the current knowledge of molecular species that are transported though Pd and the mechanisms that control this traffic. Generally, Pd traffic can occur by passive diffusion through the trans-Pd cytoplasm or through the membrane/lumen of the trans-Pd ER, or by active transport that includes protein-protein interactions. It is this latter mode of Pd transport that is involved in intercellular traffic of most signal molecules and is regulated by distinct and sometimes interdependent mechanisms, which represent the focus of this article. PMID:21746703

  10. Mechanism of Regulatory Effect of MicroRNA-206 on Connexin 43 in Distant Metastasis of Breast Cancer

    PubMed Central

    Lin, Zi-Jing; Ming, Jia; Yang, Lu; Du, Jun-Ze; Wang, Ning; Luo, Hao-Jun

    2016-01-01

    Background: MicroRNA-206 (miR-206) and connexin 43 (Cx43) are related with the distant metastasis of breast cancer. It remains unclear whether the regulatory effect of miR-206 on Cx43 is involved in metastasis of breast cancer. Methods: Using quantitative real-time polymerase chain reaction and Western blot, the expressions of miR-206 and Cx43 were determined in breast cancer tissues, hepatic and pulmonary metastasis (PM), and cell lines (MCF-10A, MCF-7, and MDA-MB-231). MCF-7/MDA-M-231 cells were transfected with lentivirus-shRNA vectors to enhance/inhibit miR-206, and then Cx43 expression was observed. Cell counting kit-8 assay and Transwell method were used to detect their changes in proliferation, migration, and invasion activity. The mutant plasmids of Cx43-3’ untranslated region (3’UTR) at position 478–484 and position 1609–1615 were constructed. Luciferase reporter assay was performed to observe the effects of miR-206 on luciferase expression of different mutant plasmids and to confirm the potential binding sites of Cx43. Results: Cx43 protein expression in hepatic and PM was significantly higher than that in the primary tumor, while no significant difference was showed in messenger RNA (mRNA) expression. MiR-206 mRNA expression in hepatic and PM was significantly lower than that in the primary tumor. Cx43 mRNA and protein levels, as well as cell proliferation, migration, and invasion capabilities, were all significantly improved in MDA-MB-231 cells after reducing miR-206 expression but decreased in MCF-7 cells after elevating miR-206 expression, which demonstrated a significantly negative correlation between miR-206 and Cx43 expression (P = 0.03). MiR-206 can drastically decrease Cx43 expression of MCF-7 cells but exerts no effects on Cx43 expression in 293 cells transfected with the Cx43 coding region but the lack of Cx43-3’UTR, suggesting that Cx43-3’UTR may be the key in Cx43 regulated by miR-206. Luciferase expression showed that the

  11. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog

    PubMed Central

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W.; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  12. The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms

    PubMed Central

    Ruiz-Roig, Clàudia; Noriega, Núria; Duch, Alba; Posas, Francesc; de Nadal, Eulàlia

    2012-01-01

    Cells modulate expression of nuclear genes in response to alterations in mitochondrial function, a response termed retrograde (RTG) regulation. In budding yeast, the RTG pathway relies on Rtg1 and Rtg3 basic helix-loop-helix leucine Zipper transcription factors. Exposure of yeast to external hyperosmolarity activates the Hog1 stress-activated protein kinase (SAPK), which is a key player in the regulation of gene expression upon stress. Several transcription factors, including Sko1, Hot1, the redundant Msn2 and Msn4, and Smp1, have been shown to be directly controlled by the Hog1 SAPK. The mechanisms by which Hog1 regulates their activity differ from one to another. In this paper, we show that Rtg1 and Rtg3 transcription factors are new targets of the Hog1 SAPK. In response to osmostress, RTG-dependent genes are induced in a Hog1-dependent manner, and Hog1 is required for Rtg1/3 complex nuclear accumulation. In addition, Hog1 activity regulates Rtg1/3 binding to chromatin and transcriptional activity. Therefore Hog1 modulates Rtg1/3 complex activity by multiple mechanisms in response to stress. Overall our data suggest that Hog1, through activation of the RTG pathway, contributes to ensure mitochondrial function as part of the Hog1-mediated osmoadaptive response. PMID:22956768

  13. Subchromoplast Sequestration of Carotenoids Affects Regulatory Mechanisms in Tomato Lines Expressing Different Carotenoid Gene Combinations[C][W

    PubMed Central

    Nogueira, Marilise; Mora, Leticia; Enfissi, Eugenia M.A.; Bramley, Peter M.; Fraser, Paul D.

    2013-01-01

    Metabolic engineering of the carotenoid pathway in recent years has successfully enhanced the carotenoid contents of crop plants. It is now clear that only increasing biosynthesis is restrictive, as mechanisms to sequestrate these increased levels in the cell or organelle should be exploited. In this study, biosynthetic pathway genes were overexpressed in tomato (Solanum lycopersicum) lines and the effects on carotenoid formation and sequestration revealed. The bacterial Crt carotenogenic genes, independently or in combination, and their zygosity affect the production of carotenoids. Transcription of the pathway genes was perturbed, whereby the tissue specificity of transcripts was altered. Changes in the steady state levels of metabolites in unrelated sectors of metabolism were found. Of particular interest was a concurrent increase of the plastid-localized lipid monogalactodiacylglycerol with carotenoids along with membranous subcellular structures. The carotenoids, proteins, and lipids in the subchromoplast fractions of the transgenic tomato fruit with increased carotenoid content suggest that cellular structures can adapt to facilitate the sequestration of the newly formed products. Moreover, phytoene, the precursor of the pathway, was identified in the plastoglobule, whereas the biosynthetic enzymes were in the membranes. The implications of these findings with respect to novel pathway regulation mechanisms are discussed. PMID:24249831

  14. Transcriptomes reveal the genetic mechanisms underlying ionic regulatory adaptations to salt in the crab-eating frog.

    PubMed

    Shao, Yong; Wang, Li-Jun; Zhong, Li; Hong, Mei-Ling; Chen, Hong-Man; Murphy, Robert W; Wu, Dong-Dong; Zhang, Ya-Ping; Che, Jing

    2015-01-01

    The crab-eating frog, Fejervarya cancrivora, is the only frog that lives near seas. It tolerates increased environmental concentrations of sodium, chloride and potassium partly by raising ion and urea levels in its blood plasma. The molecular mechanism of the adaptation remains rarely documented. Herein, we analyze transcriptomes of the crab-eating frog and its closely related saline-intolerant species, F. limnocharis, to explore the molecular basis of adaptations to such extreme environmental conditions. Analyses reveal the potential genetic mechanism underlying the adaptation to salinity for the crab-eating frog. Genes in categories associated with ion transport appear to have evolved rapidly in F. cancrivora. Both positively selected and differentially expressed genes exhibit enrichment in the GO category regulation of renal sodium excretion. In this category, the positively selected sites of ANPEP and AVPR2 encode CD13 and V2 receptors, respectively; they fall precisely on conserved domains. More differentially expressed rapidly evolved genes occur in the kidney of F. cancrivora than in F. limnocharis. Four genes involved in the regulation of body fluid levels show signs of positive selection and increased expression. Significant up-regulation occurs in several genes of F. cancrivora associated with renin-angiotensin system and aldosterone-regulated sodium reabsorption pathways, which relate to osmotic regulation. PMID:26619819

  15. GTP cyclohydrolase I inhibition by the prototypic inhibitor 2, 4-diamino-6-hydroxypyrimidine. Mechanisms and unanticipated role of GTP cyclohydrolase I feedback regulatory protein.

    PubMed

    Xie, L; Smith, J A; Gross, S S

    1998-08-14

    2,4-Diamino-6-hydroxypyrimidine (DAHP) is considered to be a selective and direct-acting inhibitor of GTP cyclohydrolase I (GTPCH), the first and rate-limiting enzyme in the pathway for synthesis of tetrahydrobiopterin (BH4). Accordingly, DAHP has been widely employed to distinguish whether de novo BH4 synthesis is required in a given biological system. Although it has been assumed that DAHP inhibits GTPCH by direct competition with substrate GTP, this has never been formally demonstrated. In view of apparent structural homology between DAHP and BH4, we questioned whether DAHP may mimic BH4 in its inhibition of GTPCH by an indirect mechanism, involving interaction with a recently cloned 9.5-kDa protein termed GTPCH Feedback Regulatory Protein (GFRP). We show by reverse transcription-polymerase chain reaction that GFRP mRNA is constitutively expressed in rat aortic smooth muscle cells and further induced by treatment with immunostimulants. Moreover, functional GFRP is expressed and immunostimulant-induced BH4 accumulates in sufficient quantity to trigger feedback inhibition of GTPCH. Studies with DAHP reveal that GFRP is also essential to achieve potent inhibition of GTPCH. Indeed, DAHP inhibits GTPCH by dual mechanisms. At a relatively low concentration, DAHP emulates BH4 and engages the GFRP-dependent feedback inhibitory system; at higher concentrations, DAHP competes directly for binding with GTP substrate. This knowledge predicts that DAHP would preferably target GTPCH in tissues with abundant GFRP. PMID:9694862

  16. Control of the Inflammatory Response Mechanisms Mediated by Natural and Induced Regulatory T-Cells in HCV-, HTLV-1-, and EBV-Associated Cancers

    PubMed Central

    Moralès, Olivier; Delhem, Nadira

    2014-01-01

    Virus infections are involved in chronic inflammation and, in some cases, cancer development. Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. Indeed, it is well described that viruses, such as hepatitis C virus (HCV), Epstein Barr virus (EBV), human papillomavirus (HPV) or human T-cell lymphotropic virus type-1 (HTLV-1), are important risk factors for tumor malignancies. The inflammatory response is a fundamental immune mechanism which involves several molecular and cellular components consisting of cytokines and chemokines that are released by various proinflammatory cells. In parallel to this process, some endogenous recruited components release anti-inflammatory mediators to restore homeostasis. The development of tools and strategies using viruses to hijack the immune response is mostly linked to the presence of regulatory T-cells (Treg) that can inhibit inflammation and antiviral responses of other effector cells. In this review, we will focus on current understanding of the role of natural and induced Treg in the control and the resolution of inflammatory response in HCV-, HTLV-1-, and EBV-associated cancers. PMID:25525301

  17. Comparative transcriptomic analysis reveals novel genes and regulatory mechanisms of Tetragenococcus halophilus in response to salt stress.

    PubMed

    Liu, Licui; Si, Lifang; Meng, Xin; Luo, Lixin

    2015-04-01

    Tetragenococcus halophilus, a moderately halophilic Gram-positive bacterium, was isolated from Chinese style soy sauce. This species is a valuable resource for investigating salt tolerance mechanisms and improving salinity resistance in microorganisms. RNA-seq was used to sequence T. halophilus samples treated with 0 M (T1), 1 M (T2), and 3.5 M NaCl (T3). Comparative transcriptomic analyses of the different treatments were performed using gene ontology and Kyoto encyclopedia of genes and genome. The comparison of T1 and T2 by RNA-seq revealed that genes involved in transcription, translation, membrane system, and division were highly up-regulated under optimum salt condition. The comparison of T2 and T3 showed that genes related to heat shock proteins or the ATP-binding cassette transport systems were significantly up-regulated under maximum-salt condition. In addition, a considerable proportion of the significantly differently expressed genes identified in this study are novel. These data provide a crucial resource that may determine specific responses to salt stress in T. halophilus. PMID:25563971

  18. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  19. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences.

    PubMed

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M; Puisieux, Alain; Payen, Léa

    2016-06-20

    The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  20. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage.

    PubMed

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4-6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1-2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  1. Comparative transcriptome and metabolome provides new insights into the regulatory mechanisms of accelerated senescence in litchi fruit after cold storage

    PubMed Central

    Yun, Ze; Qu, Hongxia; Wang, Hui; Zhu, Feng; Zhang, Zhengke; Duan, Xuewu; Yang, Bao; Cheng, Yunjiang; Jiang, Yueming

    2016-01-01

    Litchi is a non-climacteric subtropical fruit of high commercial value. The shelf life of litchi fruit under ambient conditions (AC) is approximately 4–6 days. Post-harvest cold storage prolongs the life of litchi fruit for up to 30 days with few changes in pericarp browning and total soluble solids. However, the shelf life of litchi fruits at ambient temperatures after pre-cold storage (PCS) is only 1–2 days. To better understand the mechanisms involved in the rapid fruit senescence induced by pre-cold storage, a transcriptome of litchi pericarp was constructed to assemble the reference genes, followed by comparative transcriptomic and metabolomic analyses. Results suggested that the senescence of harvested litchi fruit was likely to be an oxidative process initiated by ABA, including oxidation of lipids, polyphenols and anthocyanins. After cold storage, PCS fruit exhibited energy deficiency, and respiratory burst was elicited through aerobic and anaerobic respiration, which was regulated specifically by an up-regulated calcium signal, G-protein-coupled receptor signalling pathway and small GTPase-mediated signal transduction. The respiratory burst was largely associated with increased production of reactive oxygen species, up-regulated peroxidase activity and initiation of the lipoxygenase pathway, which were closely related to the accelerated senescence of PCS fruit. PMID:26763309

  2. Studies on the regulatory effect of Peony-Glycyrrhiza Decoction on prolactin hyperactivity and underlying mechanism in hyperprolactinemia rat model.

    PubMed

    Wang, Di; Wang, Wei; Zhou, Yulin; Wang, Juan; Jia, Dongxu; Wong, Hei Kiu; Zhang, Zhang-Jin

    2015-10-01

    Clinical trials have demonstrated the beneficial effects of Peony-Glycyrrhiza Decoction (PGD) in alleviating antipsychotic-induced hyperprolactinemia (hyperPRL) in schizophrenic patients. In previous experiment, PGD suppressed prolactin (PRL) level in MMQ cells, involving modulating the expression of D2 receptor (DRD2) and dopamine transporter (DAT). In the present study, hyperPRL female rat model induced by dopamine blocker metoclopramide (MCP) was applied to further confirm the anti-hyperpPRL activity of PGD and underlying mechanism. In MCP-induced hyperPRL rats, the elevated serum PRL level was significantly suppressed by either PGD (2.5-10 g/kg) or bromocriptine (BMT) (0.6 mg/kg) administration for 14 days. However, in MCP-induced rats, only PGD restored the under-expressed serum progesterone (P) to control level. Both PGD and BMT administration restore the under-expression of DRD2, DAT and TH resulted from MCP in pituitary gland and hypothalamus. Compared to untreated group, hyperPRL animals had a marked reduction on DRD2 and DAT expression in the arcuate nucleus. PGD (10 g/kg) and BMT (0.6 mg/kg) treatment significant reversed the expression of DRD2 and DAT. Collectively, the anti-hyperPRL activity of PGD associates with the modulation of dopaminergic neuronal system and the restoration of serum progesterone level. Our finding supports PGD as an effective agent against hyperPRL. PMID:26297122

  3. Nek2A phosphorylates and stabilizes SuFu: A new strategy of Gli2/Hedgehog signaling regulatory mechanism.

    PubMed

    Wang, Yao; Li, Yong; Hu, Guanghui; Huang, Xuan; Rao, Hai; Xiong, Xiangyang; Luo, Zhijun; Lu, Quqin; Luo, Shiwen

    2016-09-01

    Suppressor of Fused (SuFu) plays a conservative role in the regulation of the Gli transcription factors within the Hedgehog (Hh) signaling pathway. Despite the central importance of SuFu in the Hh pathway, little is known about its regulation. Here, we performed a GAL4-based yeast two-hybrid screen using human SuFu as bait, and identified NIMA-related expressed kinase 2A (Nek2A) as a new SuFu-interacting protein, which was also confirmed by glutathione-S-transferase pull-down and co-immunoprecipitation assays. Intriguingly, Nek2A is found to stabilize SuFu at least partly depending on its kinase activity, thereby triggering phosphorylation of the SuFu protein. Moreover, the phosphorylated SuFu inhibits the nuclear localization and transcriptional activity of Gli2/Hh signaling. These findings reveal a new mechanism of mammalian SuFu regulation, and offers novel insights into Hh signaling regulation in development and human disease. PMID:27297360

  4. S-nitrosation of β-catenin and p120 catenin: a novel regulatory mechanism in endothelial hyperpermeability

    PubMed Central

    Marín, N.; Zamorano, P.; Carrasco, R.; Mujica, P.; González, FG.; Quezada, C.; Meininger, CJ.; Boric, MP.; Durán, WN.; Sánchez, FA.

    2014-01-01

    Rationale Endothelial adherens junction proteins constitute an important element in the control of microvascular permeability. Platelet-activating factor (PAF) increases permeability to macromolecules via translocation of eNOS to cytosol and stimulation of eNOS-derived NO signaling cascade. The mechanisms by which NO signaling regulates permeability at adherens junctions are still incompletely understood. Objective We explored the hypothesis that PAF stimulates hyperpermeability via S-nitrosation (SNO) of adherens junction proteins. Methods and Results We measured PAF-stimulated S-nitrosation of β-catenin and p120-catenin (p120) in three cell lines: ECV-eNOSGFP, EAhy926 (derived from human umbilical vein) and CVEC (derived from bovine heart endothelium) and in the mouse cremaster muscle in vivo. SNO correlated with diminished abundance of β-catenin and p120 at the adherens junction and with hyperpermeability. TNF-α increased NO production and caused similar increase in S-nitrosation as PAF. To ascertain the importance of eNOS subcellular location in this process, we used ECV-304 cells transfected with cytosolic eNOS (GFPeNOSG2A) and plasma membrane eNOS (GFPeNOSCAAX). PAF induced S-nitrosation of β-catenin and p120 and significantly diminished association between these proteins in cells with cytosolic eNOS but not in cells wherein eNOS is anchored to the cell membrane. Inhibitors of NO production and of S-nitrosation blocked PAF-induced S-nitrosation and hyperpermeability whereas inhibition of the cGMP pathway had no effect. Mass spectrometry analysis of purified p120 identified cysteine 579 as the main S-nitrosated residue in the region that putatively interacts with VE-cadherin. Conclusions Our results demonstrate that agonist-induced SNO contributes to junctional membrane protein changes that enhance endothelial permeability. PMID:22777005

  5. Lycopene treatment against loss of bone mass, microarchitecture and strength in relation to regulatory mechanisms in a postmenopausal osteoporosis model.

    PubMed

    Ardawi, Mohammed-Salleh M; Badawoud, Mohammed H; Hassan, Sherif M; Rouzi, Abdulrahim A; Ardawi, Jumanah M S; AlNosani, Nouf M; Qari, Mohammed H; Mousa, Shaker A

    2016-02-01

    Lycopene supplementation decreases oxidative stress and exhibits beneficial effects on bone health, but the mechanisms through which it alters bone metabolism in vivo remain unclear. The present study aims to evaluate the effects of lycopene treatment on postmenopausal osteoporosis. Six-month-old female Wistar rats (n=264) were sham-operated (SHAM) or ovariectomized (OVX). The SHAM group received oral vehicle only and the OVX rats were randomized into five groups receiving oral daily lycopene treatment (mg/kg body weight per day): 0 OVX (control), 15 OVX, 30 OVX, and 45 OVX, and one group receiving alendronate (ALN) (2μg/kg body weight per day), for 12weeks. Bone densitometry measurements, bone turnover markers, biomechanical testing, and histomorphometric analysis were conducted. Micro computed tomography was also used to evaluate changes in microarchitecture. Lycopene treatment suppressed the OVX-induced increase in bone turnover, as indicated by changes in biomarkers of bone metabolism: serum osteocalcin (s-OC), serum N-terminal propeptide of type 1 collagen (s-PINP), serum crosslinked carboxyterminal telopeptides (s-CTX-1), and urinary deoxypyridinoline (u-DPD). Significant improvement in OVX-induced loss of bone mass, bone strength, and microarchitectural deterioration was observed in lycopene-treated OVX animals. These effects were observed mainly at sites rich in trabecular bone, with less effect in cortical bone. Lycopene treatment down-regulated osteoclast differentiation concurrent with up-regulating osteoblast together with glutathione peroxidase (GPx) catalase (CAT) and superoxide dismutase (SOD) activities. These findings demonstrate that lycopene treatment in OVX rats primarily suppressed bone turnover to restore bone strength and microarchitecture. PMID:26549245

  6. Study on the molecular regulatory mechanism of MicroRNA-195 in the invasion and metastasis of colorectal carcinoma

    PubMed Central

    Yang, Bin; Tan, Zhigang; Song, Yan

    2015-01-01

    Objective: This study aims to identify the target gene of hsa-miR-195 and to research the molecular mechanism of hsa-miR-195 which is through its target genes in the colorectal cancer invasion and metastasis. Methods: We used biological informatics (RNAhybrid and Target Scan analysis database) to predict the target genes of hsa-miR-195. Collected colon cancer tissues from clinical colorectal cancer patients by surgical removal of the carcinoma and control tissues, and researched the expression of Bcl-2 in tissues by immunohistochemical. Next, Real-time PCR was used to research the expression of hsa-miR-195 in Caco-2 and NCM460 cell line. hsa -miR-195 Mimics was transient transfered to Caco-2 cells, western blot was used to analysis the expression changes of Bcl-2. To analysis the possibility that hsa-miR-195 can affect the invasive ability of tumor cells by Bcl-2, we transferred hsa-miR-195 Mimics and Bcl-2 expression plasmid, and used the cell invasion experiment to discusses hsa-miR-195 effect on the ability of tumor cell invasion. Results: the immunohistochemical results showed that, the semi-quantitative parameters for the Bcl-2: control by 0.89 ± 0.51, 6 colon cancer by 31 ± 0.79. The expression of has-miR-195 in Caco-2 is 0.39 ± 1.5 while the value in control is2.01 ± 0.2, **P < 0.01. Conclusion: In colorectal cancer, has-miR-195 can promote cell apoptosis and inhibit the invasion and metastasis by inhibiting the expression of Bcl-2. PMID:26064276

  7. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32

    PubMed Central

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-01-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  8. Identification of a Novel Regulatory Mechanism of Nutrient Transport Controlled by TORC1-Npr1-Amu1/Par32.

    PubMed

    Boeckstaens, Mélanie; Merhi, Ahmad; Llinares, Elisa; Van Vooren, Pascale; Springael, Jean-Yves; Wintjens, René; Marini, Anna Maria

    2015-07-01

    Fine-tuning the plasma-membrane permeability to essential nutrients is fundamental to cell growth optimization. Nutritional signals including nitrogen availability are integrated by the TORC1 complex which notably regulates arrestin-mediated endocytosis of amino-acid transporters. Ammonium is a ubiquitous compound playing key physiological roles in many, if not all, organisms. In yeast, it is a preferred nitrogen source transported by three Mep proteins which are orthologues of the mammalian Rhesus factors. By combining genetic, kinetic, biochemical and cell microscopy analyses, the current study reveals a novel mechanism enabling TORC1 to regulate the inherent activity of ammonium transport proteins, independently of arrestin-mediated endocytosis, identifying the still functional orphan Amu1/Par32 as a selective regulator intermediate. We show that, under poor nitrogen supply, the TORC1 effector kinase' Npr1' promotes phosphorylation of Amu1/Par32 which appears mainly cytosolic while ammonium transport proteins are active. Upon preferred nitrogen supplementation, like glutamine or ammonium addition, TORC1 upregulation enables Npr1 inhibition and Amu1/Par32 dephosphorylation. In these conditions, as in Npr1-lacking cells, hypophosphorylated Amu1/Par32 accumulates at the cell surface and mediates the inhibition of specific ammonium transport proteins. We show that the integrity of a conserved repeated motif of Amu1/Par32 is required for the interaction with these transport proteins. This study underscores the diversity of strategies enabling TORC1-Npr1 to selectively monitor cell permeability to nutrients by discriminating between transporters to be degraded or transiently inactivated and kept stable at the plasma membrane. This study further identifies the function of Amu1/Par32 in acute control of ammonium transport in response to variations in nitrogen availability. PMID:26172854

  9. Network-based integration of molecular and physiological data elucidates regulatory mechanisms underlying adaptation to high-fat diet.

    PubMed

    Derous, Davina; Kelder, Thomas; van Schothorst, Evert M; van Erk, Marjan; Voigt, Anja; Klaus, Susanne; Keijer, Jaap; Radonjic, Marijana

    2015-07-01

    Health is influenced by interplay of molecular, physiological and environmental factors. To effectively maintain health and prevent disease, health-relevant relations need to be understood at multiple levels of biological complexity. Network-based methods provide a powerful platform for integration and mining of data and knowledge characterizing different aspects of health. Previously, we have reported physiological and gene expression changes associated with adaptation of murine epididymal white adipose tissue (eWAT) to 5 days and 12 weeks of high-fat diet (HFD) and low-fat diet feeding (Voigt et al. in Mol Nutr Food Res 57:1423-1434, 2013. doi: 10.1002/mnfr.201200671 ). In the current study, we apply network analysis on this dataset to comprehensively characterize mechanisms driving the short- and long-term adaptation of eWAT to HFD across multiple levels of complexity. We built a three-layered interaction network comprising enriched biological processes, their transcriptional regulators and associated changes in physiological parameters. The multi-layered network model reveals that early eWAT adaptation to HFD feeding involves major changes at a molecular level, including activation of TGF-β signalling pathway, immune and stress response and downregulation of mitochondrial functioning. Upon prolonged HFD intake, initial transcriptional response tails off, mitochondrial functioning is even further diminished, and in turn the relation between eWAT gene expression and physiological changes becomes more prominent. In particular, eWAT weight and total energy intake negatively correlate with cellular respiration process, revealing mitochondrial dysfunction as a hallmark of late eWAT adaptation to HFD. Apart from global understanding of the time-resolved adaptation to HFD, the multi-layered network model allows several novel mechanistic hypotheses to emerge: (1) early activation of TGF-β signalling as a trigger for structural and morphological changes in

  10. Integrative Modeling of eQTLs and Cis-Regulatory Elements Suggests Mechanisms Underlying Cell Type Specificity of eQTLs

    PubMed Central

    Brown, Christopher D.; Mangravite, Lara M.; Engelhardt, Barbara E.

    2013-01-01

    Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL) mapping has paralleled the adoption of genome-wide association studies (GWAS) for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE) data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human complex phenotypic