Science.gov

Sample records for repetitive extragenic palindromes

  1. The processing of repetitive extragenic palindromes: the structure of a repetitive extragenic palindrome bound to its associated nuclease

    PubMed Central

    Messing, Simon A. J.; Ton-Hoang, Bao; Hickman, Alison B.; McCubbin, Andrew J.; Peaslee, Graham F.; Ghirlando, Rodolfo; Chandler, Michael; Dyda, Fred

    2012-01-01

    Extragenic sequences in genomes, such as microRNA and CRISPR, are vital players in the cell. Repetitive extragenic palindromic sequences (REPs) are a class of extragenic sequences, which form nucleotide stem-loop structures. REPs are found in many bacterial species at a high copy number and are important in regulation of certain bacterial functions, such as Integration Host Factor recruitment and mRNA turnover. Although a new clade of putative transposases (RAYTs or TnpAREP) is often associated with an increase in these repeats, it is not clear how these proteins might have directed amplification of REPs. We report here the structure to 2.6 Å of TnpAREP from Escherichia coli MG1655 bound to a REP. Sequence analysis showed that TnpAREP is highly related to the IS200/IS605 family, but in contrast to IS200/IS605 transposases, TnpAREP is a monomer, is auto-inhibited and is active only in manganese. These features suggest that, relative to IS200/IS605 transposases, it has evolved a different mechanism for the movement of discrete segments of DNA and has been severely down-regulated, perhaps to prevent REPs from sweeping through genomes. PMID:22885300

  2. The processing of repetitive extragenic palindromes: the structure of a repetitive extragenic palindrome bound to its associated nuclease.

    PubMed

    Messing, Simon A J; Ton-Hoang, Bao; Hickman, Alison B; McCubbin, Andrew J; Peaslee, Graham F; Ghirlando, Rodolfo; Chandler, Michael; Dyda, Fred

    2012-10-01

    Extragenic sequences in genomes, such as microRNA and CRISPR, are vital players in the cell. Repetitive extragenic palindromic sequences (REPs) are a class of extragenic sequences, which form nucleotide stem-loop structures. REPs are found in many bacterial species at a high copy number and are important in regulation of certain bacterial functions, such as Integration Host Factor recruitment and mRNA turnover. Although a new clade of putative transposases (RAYTs or TnpA(REP)) is often associated with an increase in these repeats, it is not clear how these proteins might have directed amplification of REPs. We report here the structure to 2.6 Å of TnpA(REP) from Escherichia coli MG1655 bound to a REP. Sequence analysis showed that TnpA(REP) is highly related to the IS200/IS605 family, but in contrast to IS200/IS605 transposases, TnpA(REP) is a monomer, is auto-inhibited and is active only in manganese. These features suggest that, relative to IS200/IS605 transposases, it has evolved a different mechanism for the movement of discrete segments of DNA and has been severely down-regulated, perhaps to prevent REPs from sweeping through genomes. PMID:22885300

  3. Repetitive extragenic palindromic elements within the genomes of biocontrol Pseudomonas spp.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repetitive extragenic palindromic (REP) sequence elements have been identified within the genome sequences of many bacterial species, including a number of animal and plant pathogenic Pseudomonas spp. Several functions have been proposed for these sequences, e.g., binding or target sites for DNA rep...

  4. Predicting Salmonella enterica subsp. enterica Serotypes by Repetitive Extragenic Palindromic Sequence-Based PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The DiversiLabTM System, which employs repetitive extragenic palindromic sequence-based PCR (rep-PCR) to genotype microorganisms, was evaluated as a method to predict the serotype of Salmonella isolates. Two hundred and thirty-three Salmonella isolates belonging to 14 frequently isolated serotypes f...

  5. Evaluation of repetitive extragenic palindromic-PCR and denatured gradient gel electrophoresis in identifying Salmonella serotypes isolated from processed turkeys

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella has been reported as the leading foodborne pathogen in the US. A study was conducted to compare the use of automated repetitive extragenic palindromic (REP-PCR) and denaturing gradient gel electrophoresis (DGGE) as diagnostic tools for identifying Salmonella serotypes. The interspersed ...

  6. Comparative genotyping of Streptococcus mutans by repetitive extragenic palindromic polymerase chain reaction and multilocus sequence typing.

    PubMed

    Momeni, S S; Whiddon, J; Moser, S A; Cheon, K; Ruby, J D; Childers, N K

    2013-02-01

    The genetic diversity of Streptococcus mutans has been extensively studied using a variety of genotyping methods. Repetitive extragenic palindromic-polymerase chain reaction (rep-PCR) is a genotyping approach used for screening large numbers of bacterial isolates. This two-part study used multilocus sequence typing (MLST) analysis to evaluate genotypes previously identified as unique using rep-PCR. In part one, an isolate was selected from each of the 22 S. mutans rep-PCR genotype groups representing 8000 clinical isolates. For part two, four additional isolates were selected from the six most commonly occurring genotype groups (GG) for further analysis. Real-time PCR was performed using eight housekeeping S. mutans gene loci and the amplicons were sequenced. Sequence data analysis was performed using CLC DNA Workbench and alleles were compared with the PubMLST database for Oral Streptococcus using the Nakano scheme. Concatenated sequences were evaluated with MEGA using a minimum evolution method with bootstrap. All 22 rep-PCR genotypes were unique by MLST analysis. Within rep-PCR GGs, MLST matched rep-PCR in three groups demonstrating clonality; three groups exhibited more diversity with MLST. The discovery of three clonal groups is unique to this study and suggests that S. mutans genotypes are shared between unrelated subjects. Furthermore, MLST defined 19 new alleles and 26 new sequence types that have been confirmed and registered with PubMLST. Methods for processing were streamlined and a process for using MLST with rep-PCR is suggested. In conclusion, MLST verified that rep-PCR is a reliable and cost-effective method for screening large numbers of S. mutans strains for epidemiological study. PMID:23194334

  7. Conformational diversity of single-stranded DNA from bacterial repetitive extragenic palindromes: Implications for the DNA recognition elements of transposases.

    PubMed

    Charnavets, Tatsiana; Nunvar, Jaroslav; Nečasová, Iva; Völker, Jens; Breslauer, Kenneth J; Schneider, Bohdan

    2015-10-01

    Repetitive extragenic palindrome (REP)-associated tyrosine transposase enzymes (RAYTs) bind REP DNA domains and catalyze their cleavage. Genomic sequence analyses identify potential noncoding REP sequences associated with RAYT-encoding genes. To probe the conformational space of potential RAYT DNA binding domains, we report here spectroscopic and calorimetric measurements that detect and partially characterize the solution conformational heterogeneity of REP oligonucleotides from six bacterial species. Our data reveal most of these REP oligonucleotides adopt multiple conformations, suggesting that RAYTs confront a landscape of potential DNA substrates in dynamic equilibrium that could be selected, enriched, and/or induced via differential binding. Thus, the transposase-bound DNA motif may not be the predominant conformation of the isolated REP domain. Intriguingly, for several REPs, the circular dichroism spectra suggest guanine tetraplexes as potential alternative or additional RAYT recognition elements, an observation consistent with these REP domains being highly nonrandom, with tetraplex-favoring 5'-G and 3'-C-rich segments. In fact, the conformational heterogeneity of REP domains detected and reported here, including the formation of noncanonical DNA secondary structures, may reflect a general feature required for recognition by RAYT transposases. Based on our biophysical data, we propose guanine tetraplexes as an additional DNA recognition element for binding by RAYT transposase enzymes. PMID:25951997

  8. Evidence of Bacillus thuringiensis intra-serovar diversity revealed by Bacillus cereus group-specific repetitive extragenic palindromic sequence-based PCR genomic fingerprinting.

    PubMed

    Sauka, Diego H; Basile, Juan I; Benintende, Graciela

    2011-01-01

    Bacillus thuringiensis is classified into serovars on the basis of H-flagellar antigens. Several alternative typing methods have been described. Among them, a B. cereus group-specific repetitive extragenic palindromic (Rep)-PCR fingerprinting technique was shown to be discriminative and able to identify B. thuringiensis serovars. The aim of this study was to investigate the genomic diversity and relationship among B. thuringiensis strains collected from different Argentinean ecosystems. Thirty-seven B. thuringiensis reference strains and 131 Argentinean isolates were analyzed using a B. cereus group-specific Rep-PCR. Fourteen different patterns were identified among the Argentinean isolates. Eight could not be associated to any pattern obtained from a reference strain. The pattern identical to the serovar kurstaki HD-1 strain was the most frequently identified in 68 native isolates. The profiles allowed tracing a single dendrogram with two groups and eight main lineages. Some strains showed distinctive patterns despite belonging to the same serovar. An intraspecific diversity resulted from this analysis that was highlighted by this technique since strains from a given serovar showed distinct profiles. This study may help to establish a system of B. thuringiensis classification with a higher discrimination level than established by the H antigen serotyping. PMID:22286045

  9. Clonal Relationship and Differentiation among Mycobacterium abscessus Isolates as Determined Using the Semiautomated Repetitive Extragenic Palindromic Sequence PCR-Based DiversiLab System

    PubMed Central

    Mougari, Faiza; Raskine, Laurent; Ferroni, Agnes; Marcon, Estelle; Sermet-Gaudelus, Isabelle; Veziris, Nicolas; Heym, Beate; Gaillard, Jean-Louis; Nassif, Xavier

    2014-01-01

    Mycobacterium abscessus is a rapidly growing mycobacterium that causes respiratory tract infections in predisposed patients, such as those with cystic fibrosis and nosocomial skin and soft tissue infections. In order to investigate the clonal relationships between the strains causing epidemic episodes, we evaluated the discriminatory power of the semiautomated DiversiLab (DL) repetitive extragenic palindromic sequence PCR (REP-PCR) test for M. abscessus genotyping. Since M. abscessus was shown to be composed of subspecies (M. abscessus subsp. massiliense, M. abscessus subsp. bolletii, and M. abscessus subsp. abscessus), we also evaluated the ability of this technique to differentiate subspecies. The technique was applied to two collections of clinical isolates, (i) 83 M. abscessus original isolates (43 M. abscessus subsp. abscessus, 12 M. abscessus subsp. bolletii, and 28 M. abscessus subsp. massiliense) from infected patients and (ii) 35 repeated isolates obtained over 1 year from four cystic fibrosis patients. The DL REP-PCR test was standardized for DNA extraction, DNA amplification, and electrophoresis pattern comparisons. Among the isolates from distinct patients, 53/83 (62%) isolates showed a specific pattern, and 30 were distributed in 11 clusters and 6 patterns, with 2 to 4 isolates per pattern. The clusters and patterns did not fully correlate with multilocus sequence typing (MLST) analysis results. This revealed a high genomic diversity between patients, with a discriminatory power of 98% (Simpson's diversity index). However, since some isolates shared identical patterns, this raises the question of whether it is due to transmission between patients or a common reservoir. Multiple isolates from the same patient showed identical patterns, except for one patient infected by two strains. Between the M. abscessus subspecies, the indexes were <70%, indicating that the DL REP-PCR test is not an accurate tool for identifying organisms to the subspecies level

  10. Validation of use of whole-cell repetitive extragenic palindromic sequence-based PCR (REP-PCR) for typing strains belonging to the Acinetobacter calcoaceticus-Acinetobacter baumannii complex and application of the method to the investigation of a hospital outbreak.

    PubMed Central

    Snelling, A M; Gerner-Smidt, P; Hawkey, P M; Heritage, J; Parnell, P; Porter, C; Bodenham, A R; Inglis, T

    1996-01-01

    Acinetobacter spp. are being reported with increasing frequency as causes of nosocomial infection. In order to identify reservoirs of infection as quickly as possible, a rapid typing method that can differentiate epidemic strains from environmental and nonepidemic strains is needed. In 1993, a cluster of Acinetobacter baumannii isolates from five patients in the adult intensive therapy unit of our tertiary-care teaching hospital led us to develop and optimize a rapid repetitive extragenic palindromic sequence-based PCR (REP-PCR) typing protocol for members of the Acinetobacter calcoaceticus-A. baumannii complex that uses boiled colonies and consensus primers aimed at repetitive extragenic palindromic sequences. Four of the five patient isolates gave the same REP-PCR typing pattern as isolates of A. baumannii obtained from the temperature probe of a Bennett humidifier; the fifth isolate had a unique profile. Disinfection of the probe with 70% ethanol, as recommended by the manufacturer, proved ineffective, as A. baumannii with the same REP-PCR pattern was isolated from it 10 days after cleaning, necessitating a change in our decontamination procedure. Results obtained with REP-PCR were subsequently confirmed by ribotyping. To evaluate the discriminatory power (D) of REP-PCR for typing members of the A. calcoaceticus-A. baumannii complex, compared with that of ribotyping, we have applied both methods to a collection of 85 strains that included representatives of six DNA groups within the complex. Ribotyping using EcoRI digests yielded 53 patterns (D = 0.98), whereas 68 different REP-PCR patterns were observed (D = 0.99). By computer-assisted analysis of gel images, 74 patterns were observed with REP-PCR (D = 1.0). Overall, REP-PCR typing proved to be slightly more discriminatory than ribotyping. Our results indicate that REP-PCR typing used boiled colonies is a simple, rapid, and effective means of typing members of the A. calcoaceticus-A. baumannii complex. PMID

  11. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions. PMID:16182294

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Short palindromic repetitive DNA elements in enterobacteria: a survey.

    PubMed

    Bachellier, S; Clément, J M; Hofnung, M

    1999-01-01

    We present a survey of short palindromic repetitive elements in enterobacteria. Seven families are presented. Five were already known (RSA, IRU, 29-bp repeats, BIMEs and boxC), and their properties are updated; in particular, a new composite element is shown to include the formerly identified boxC repeats. Two repetitions, YPAL1 and YPAL2, found primarily in Yersinia, are described here for the first time. PMID:10673002

  14. Use of Repetitive Element Palindromic-PCR (rep-PCR) for the Epidemiologic Discrimination of Food-Borne Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The use of defined primers for polymerase chain reactions (PCR) amplicifcations of interspersed repetitive DNA elements present at distinct locations in prokaryotic genomes is referred to as Repetitive Element Palindromic Sequences Based-Polymerase Chain Reactions, rep-PCR. The initial discovery of...

  15. Predicting Salmonella enterica serotypes by repetitive sequence-based PCR

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repetitive extragenic palindromic sequence-based PCR (rep-PCR) utilizing a semi-automated system, was evaluated as a method to determine Salmonella serotypes. A group of 216 Salmonella isolates belonging to 13 frequently isolated serotypes and one rarer serotype from poultry were used to create a D...

  16. IS1397 is active for transposition into the chromosome of Escherichia coli K-12 and inserts specifically into palindromic units of bacterial interspersed mosaic elements.

    PubMed

    Clément, J M; Wilde, C; Bachellier, S; Lambert, P; Hofnung, M

    1999-11-01

    We demonstrate that IS1397, a putative mobile genetic element discovered in natural isolates of Escherichia coli, is active for transposition into the chromosome of E. coli K-12 and inserts specifically into palindromic units, also called repetitive extragenic palindromes, the basic element of bacterial interspersed mosaic elements (BIMEs), which are found in intergenic regions of enterobacteria closely related to E. coli and Salmonella. We could not detect transposition onto a plasmid carrying BIMEs. This unprecedented specificity of insertion into a well-characterized chromosomal intergenic repeated element and its evolutionary implications are discussed. PMID:10559158

  17. Indole acetic acid production by fluorescent Pseudomonas spp. from the rhizosphere of Plectranthus amboinicus (Lour.) Spreng. and their variation in extragenic repetitive DNA sequences.

    PubMed

    Sethia, Bedhya; Mustafa, Mariam; Manohar, Sneha; Patil, Savita V; Jayamohan, Nellickal Subramanian; Kumudini, Belur Satyan

    2015-06-01

    Fluorescent Pseudomonas (FP) is a heterogenous group of growth promoting rhizobacteria that regulate plant growth by releasing secondary metabolic compounds viz., indole acetic acid (IAA), siderophores, ammonia and hydrogen cyanide. In the present study, IAA producing FPs from the rhizosphere of Plectranthus amboinicus were characterized morphologically, biochemically and at the molecular level. Molecular identification of the isolates were carried out using Pseudomonas specific primers. The effect of varying time (24, 48, 72 and 96 h), Trp concentrations (100, 200, 300, 400 and 500 μg x ml(-1)), temperature (10, 26, 37 and 50 ± 2 degrees C) and pH (6, 7 and 8) on IAA production by 10 best isolates were studied. Results showed higher IAA production at 72 h incubation, at 300 μg x ml(-1) Trp concentration, temperature 26 ± 2 degrees C and pH 7. TLC with acidified ethyl acetate extract showed that the IAA produced has a similar Rf value to that of the standard IAA. Results of TLC were confirmed by HPLC analysis. Genetic diversity of the isolates was also studied using 40 RAPD and 4 Rep primers. Genetic diversity parameters such as dominance, Shannon index and Simpson index were calculated. Out of 40 RAPD primers tested, 9 (2 OP-D series and 7 OP-E series) were shortlisted for further analysis. Studies using RAPD, ERIC, BOX, REP and GTG5 primers revealed that isolates exhibit significant diversity in repetitive DNA sequences irrespective of the rhizosphere. PMID:26155673

  18. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes.

    PubMed Central

    Versalovic, J; Koeuth, T; Lupski, J R

    1991-01-01

    Dispersed repetitive DNA sequences have been described recently in eubacteria. To assess the distribution and evolutionary conservation of two distinct prokaryotic repetitive elements, consensus oligonucleotides were used in polymerase chain reaction [PCR] amplification and slot blot hybridization experiments with genomic DNA from diverse eubacterial species. Oligonucleotides matching Repetitive Extragenic Palindromic [REP] elements and Enterobacterial Repetitive Intergenic Consensus [ERIC] sequences were synthesized and tested as opposing PCR primers in the amplification of eubacterial genomic DNA. REP and ERIC consensus oligonucleotides produced clearly resolvable bands by agarose gel electrophoresis following PCR amplification. These band patterns provided unambiguous DNA fingerprints of different eubacterial species and strains. Both REP and ERIC probes hybridized preferentially to genomic DNA from Gram-negative enteric bacteria and related species. Widespread distribution of these repetitive DNA elements in the genomes of various microorganisms should enable rapid identification of bacterial species and strains, and be useful for the analysis of prokaryotic genomes. Images PMID:1762913

  19. Why Chromosome Palindromes?

    PubMed Central

    Betrán, Esther; Demuth, Jeffery P.; Williford, Anna

    2012-01-01

    We look at sex-limited chromosome (Y or W) evolution with particular emphasis on the importance of palindromes. Y chromosome palindromes consist of inverted duplicates that allow for local recombination in an otherwise nonrecombining chromosome. Since palindromes enable intrachromosomal gene conversion that can help eliminate deleterious mutations, they are often highlighted as mechanisms to protect against Y degeneration. However, the adaptive significance of recombination resides in its ability to decouple the evolutionary fates of linked mutations, leading to both a decrease in degeneration rate and an increase in adaptation rate. Our paper emphasizes the latter, that palindromes may exist to accelerate adaptation by increasing the potential targets and fixation rates of incoming beneficial mutations. This hypothesis helps reconcile two enigmatic features of the “palindromes as protectors” view: (1) genes that are not located in palindromes have been retained under purifying selection for tens of millions of years, and (2) under models that only consider deleterious mutations, gene conversion benefits duplicate gene maintenance but not initial fixation. We conclude by looking at ways to test the hypothesis that palindromes enhance the rate of adaptive evolution of Y-linked genes and whether this effect can be extended to palindromes on other chromosomes. PMID:22844637

  20. Why chromosome palindromes?

    PubMed

    Betrán, Esther; Demuth, Jeffery P; Williford, Anna

    2012-01-01

    We look at sex-limited chromosome (Y or W) evolution with particular emphasis on the importance of palindromes. Y chromosome palindromes consist of inverted duplicates that allow for local recombination in an otherwise nonrecombining chromosome. Since palindromes enable intrachromosomal gene conversion that can help eliminate deleterious mutations, they are often highlighted as mechanisms to protect against Y degeneration. However, the adaptive significance of recombination resides in its ability to decouple the evolutionary fates of linked mutations, leading to both a decrease in degeneration rate and an increase in adaptation rate. Our paper emphasizes the latter, that palindromes may exist to accelerate adaptation by increasing the potential targets and fixation rates of incoming beneficial mutations. This hypothesis helps reconcile two enigmatic features of the "palindromes as protectors" view: (1) genes that are not located in palindromes have been retained under purifying selection for tens of millions of years, and (2) under models that only consider deleterious mutations, gene conversion benefits duplicate gene maintenance but not initial fixation. We conclude by looking at ways to test the hypothesis that palindromes enhance the rate of adaptive evolution of Y-linked genes and whether this effect can be extended to palindromes on other chromosomes. PMID:22844637

  1. More Magic with Palindromes.

    ERIC Educational Resources Information Center

    Whitin, David J.

    1985-01-01

    Third- and fourth-grade students were introduced to palindromes (numbers that can be read the same both forward and backward). The types of problems that they generated, investigated, and solved are presented. (JN)

  2. A W-linked palindrome and gene conversion in New World sparrows and blackbirds.

    PubMed

    Davis, Jamie K; Thomas, Pamela J; Thomas, James W

    2010-07-01

    A hallmark feature of the male-specific region of the human Y chromosome is the presence of large and near-identical palindromes. These palindromes are maintained in a state of near identity via gene conversion between the arms of the palindrome, and both neutral and selection-based theories have been proposed to explain their enrichment on the human Y and X chromosomes. While those proposed theories would be applicable to sex chromosomes in other species, it has not been established whether near-identical palindromes are a common feature of sex chromosomes in a broader range of taxa, including other tetrapods. Here, we report the genomic sequencing and features of a 279-kb region of the non-recombining portion of the W chromosome spanning the CHD1W locus in a New World sparrow, the white-throated sparrow (Zonotrichia albicollis), and the corresponding region on the Z chromosome. As has been observed for other Y and W chromosomes, we detected a high repetitive element content (51%) and low gene content on the white-throated sparrow W chromosome. In addition, we identified a 22-kb near-identical (>99%) palindrome on the W chromosome that flanks the 5' end of the CHD1W gene. Signatures of gene conversion were readily detected between the arms of this palindrome, as was the presence of this palindrome in other New World sparrows and blackbirds. Near-identical palindromes are therefore present on the avian W chromosome and may persist due to the same forces proposed for the enrichment of these elements on the human sex chromosomes. PMID:20535633

  3. An Investigation of Palindromes and Their Place in Mathematics

    ERIC Educational Resources Information Center

    Nivens, Ryan

    2013-01-01

    Some people recognize a palindrome when they see one, however fewer realize that a palindrome is a special case of a pattern and that these patterns are all around. Palindromes frequently occur in names, both of vehicles and people, and in music. The traditional mathematical curriculum has often left palindromes out of the common vernacular. Where…

  4. Musical Palindromes for Liberal Arts Students

    ERIC Educational Resources Information Center

    von Renesse, Christine

    2012-01-01

    This paper shows how to teach a mathematics for liberal arts class in an inquiry-based way using ideas from music to launch the mathematical activities. No musical knowledge is required to understand and teach the material. The main activity is analyzing the differences between two kinds of rhythmic palindromes. The content is mathematically…

  5. An algorithm to find all palindromic sequences in proteins.

    PubMed

    Prasanth, N; Vaishnavi, M Kirti; Sekar, K

    2013-03-01

    A palindrome is a set of characters that reads the same forwards and backwards. Since the discovery of palindromic peptide sequences two decades ago, little effort has been made to understand its structural, functional and evolutionary significance. Therefore, in view of this, an algorithm has been developed to identify all perfect palindromes (excluding the palindromic subset and tandem repeats) in a single protein sequence. The proposed algorithm does not impose any restriction on the number of residues to be given in the input sequence. This avant-garde algorithm will aid in the identification of palindromic peptide sequences of varying lengths in a single protein sequence. PMID:23385825

  6. Large-scale production of palindrome DNA fragments

    SciTech Connect

    Palmer, E.L.; Gewiess, A.; Harp, J.M.

    1995-10-10

    Our structural studies of nucleosomes necessitated the production of over 100 mg of a 146-bp perfect palindrome DNA for use in the reconstitution of perfectly symmetrical nucleosome core particles for detailed X-ray crystallographic analysis. The propagation of palindromic DNA sequences by bacterial culture is hindered by the instability of these sequences during bacterial replication and recombination. While the loss of some palindrome sequences can be elminated by the use of sbcB or sbcC mutants of Escherichia coli, not all palindrome-containing plasmids are faithfully maintained by these strains. The production of large quantities of palindrome DNA can therefore be extremely difficult. After trying several approaches, we were able to develop a reliable procedure for production of large quantities of palindrome DNA that involves production of plasmid containing multiple copies of the repeating unit of the palindrome which are isolated by restriction digestion and ligated in vitro to form the palindrome DNA. The procedure has resulted in the production of over 20 mg of a 146-bp DNA fragment in 2 weeks.

  7. Extragenic suppression of motA missense mutations of Escherichia coli.

    PubMed Central

    Garza, A G; Bronstein, P A; Valdez, P A; Harris-Haller, L W; Manson, M D

    1996-01-01

    The MotA and MotB proteins are thought to comprise elements of the stator component of the flagellar motor of Escherichia coli. In an effort to understand interactions among proteins within the motor, we attempted to identify extragenic suppressors of 31 dominant, plasmid-borne alleles of motA. Strains containing these mutations were either nonmotile or had severely impaired motility. Four of the mutants yielded extragenic suppressors mapping to the FlaII or FlaIIIB regions of the chromosome. Two types of suppression were observed. Suppression of one type (class I) probably results from increased expression of the chromosomal motB gene due to relief of polarity. Class I suppressors were partial deletions of Mu insertion sequences in the disrupted chromosomal motA gene. Class I suppression was mimicked by expressing the wild-type MotB protein from a second, compatible plasmid. Suppression of the other type (class II) was weaker, and it was not mimicked by overproduction of wild-type MotB protein. Class II suppressors were point mutations in the chromosomal motB or fliG genes. Among 14 independent class II suppressors characterized by DNA sequencing, we identified six different amino acid substitutions in MotB and one substitution in FliG. A number of the strongest class II suppressors had alterations of residues 136 to 138 of MotB. This particular region within the large, C-terminal periplasmic domain of MotB has previously not been associated with a specific function. We suggest that residues 136 to 138 of MotB may interact directly with the periplasmic face of MotA or help position the N-terminal membrane-spanning helix of MotB properly to interact with the membrane-spanning helices of the MotA proton channel. PMID:8892808

  8. Repetitive Sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repetitive sequences, or repeats, account for a substantial portion of the eukaryotic genomes. These sequences include very different types of DNA with respect to mode of origin, function, structure, and genomic distribution. Two large families of repetitive sequences can be readily recognized, ta...

  9. A method to find palindromes in nucleic acid sequences.

    PubMed

    Anjana, Ramnath; Shankar, Mani; Vaishnavi, Marthandan Kirti; Sekar, Kanagaraj

    2013-01-01

    Various types of sequences in the human genome are known to play important roles in different aspects of genomic functioning. Among these sequences, palindromic nucleic acid sequences are one such type that have been studied in detail and found to influence a wide variety of genomic characteristics. For a nucleotide sequence to be considered as a palindrome, its complementary strand must read the same in the opposite direction. For example, both the strands i.e the strand going from 5' to 3' and its complementary strand from 3' to 5' must be complementary. A typical nucleotide palindromic sequence would be TATA (5' to 3') and its complimentary sequence from 3' to 5' would be ATAT. Thus, a new method has been developed using dynamic programming to fetch the palindromic nucleic acid sequences. The new method uses less memory and thereby it increases the overall speed and efficiency. The proposed method has been tested using the bacterial (3891 KB bases) and human chromosomal sequences (Chr-18: 74366 kb and Chr-Y: 25554 kb) and the computation time for finding the palindromic sequences is in milli seconds. PMID:23515654

  10. Schroedinger operators with Rudin-Shapiro potentials are not palindromic

    SciTech Connect

    Allouche, J.

    1997-04-01

    We prove a conjecture of A. Hof, O. Knill and B. Simon [Commun. Math. Phys. {bold 174}, 149{endash}159 (1995)] by showing that the Rudin-Shapiro sequence is not {ital palindromic}, i.e., does not contain arbitrarily long palindromes. We prove actually this property for all paperfolding sequences and all Rudin-Shapiro sequences deduced from paperfolding sequences. As a consequence and as guessed by the above authors, their method cannot be used for establishing that discrete Schroedinger operators with Rudin-Shapiro potentials have a purely singular continuous spectrum. {copyright} {ital 1997 American Institute of Physics.}

  11. Cloning and characterization of oriL2, a large palindromic DNA replication origin of herpes simplex virus type 2.

    PubMed Central

    Lockshon, D; Galloway, D A

    1986-01-01

    An origin of replication within the long unique sequence of herpes simplex virus type 2 designated oriL2 has been identified in a position homologous to its type 1 counterpart, oriL1, between map coordinates 0.398 and 0.413. The difficulties encountered in previous attempts to clone both oriL2 and oriL1 in an undeleted form were surmounted by minimizing the growth of the host Escherichia coli, using a recBC sbcB E. coli host, and purifying the full-length plasmid from delected forms by using a novel method which exploits the ability of a palindrome-containing plasmid to adopt a cruciform conformation, thereby decreasing its supercoiling. In a previously developed assay for functional origin activity, oriL2 was localized to a 241-base-pair ApaI-SstII fragment. DNA sequence analysis revealed a 136-base pair, almost perfect palindrome. Comparison with oriL1 showed a very high degree of conservation: the two origins differ in only 16 of the 144-base-pair oriL1 palindromic region. Most significantly, the differences between oriL1 and oriL2 mainly occur in pairs so as to generally preserve the potential for intrastrand base pairing. The central region of oriL2 is homologous with the shorter palindromic structures detected in origins located within the repetitive sequences of the short component of herpes simplex virus type 1 or 2. Images PMID:3009865

  12. Discreteness criteria and the hyperbolic geometry of palindromes

    NASA Astrophysics Data System (ADS)

    Gilman, Jane; Keen, Linda

    We consider non-elementary representations of two generator free groups in PSL(2,C) , not necessarily discrete or free, G = < A, B >. A word in A and B , W(A,B) , is a palindrome if it reads the same forwards and backwards. A word in a free group is primitive if it is part of a minimal generating set. Primitive elements of the free group on two generators can be identified with the positive rational numbers. We study the geometry of palindromes and the action of G in {H}3 whether or not G is discrete. We show that there is a core geodesic {L} in the convex hull of the limit set of G and use it to prove three results: the first is that there are well-defined maps from the non-negative rationals and from the primitive elements to {L} ; the second is that G is geometrically finite if and only if the axis of every non-parabolic palindromic word in G intersects {L} in a compact interval; the third is a description of the relation of the pleating locus of the convex hull boundary to the core geodesic and to palindromic elements.

  13. Palindromes drive the re-assortment in Influenza A.

    PubMed

    Zubaer, Abdullah; Thapa, Simrika

    2011-01-01

    Different subtypes of Influenza A virus are associated with species specific, zoonotic or pandemic Influenza. The cause of its severity underlies in complicated evolution of its segmented RNA genome. Although genetic shift and genetic drift are well known in the evolution of this virus, we reported the significant role of unique RNA palindromes in its evolution. Our computational approach identified the existence of unique palindromes in each subtype of Influenza A virus with its absence in Influenza B relating the fact of virulence and vigorous genetic hitchhiking in Influenza A. The current study focused on the re-assortment event responsible for the emergence of pandemic-2009 H1N1 virus, which is associated with outgrow of new palindrome and in turn, changing its RNA structure. We hypothesize that the change in RNA structure due to the presence of palindrome facilitates the event of re-assortment in Influenza A. Thus the evolutionary process of Influenza A is much more complicated as previously known, and that has been demonstrated in this study. PMID:22125380

  14. Species-specific Typing of DNA Based on Palindrome Frequency Patterns

    PubMed Central

    Lamprea-Burgunder, Estelle; Ludin, Philipp; Mäser, Pascal

    2011-01-01

    DNA in its natural, double-stranded form may contain palindromes, sequences which read the same from either side because they are identical to their reverse complement on the sister strand. Short palindromes are underrepresented in all kinds of genomes. The frequency distribution of short palindromes exhibits more than twice the inter-species variance of non-palindromic sequences, which renders palindromes optimally suited for the typing of DNA. Here, we show that based on palindrome frequency, DNA sequences can be discriminated to the level of species of origin. By plotting the ratios of actual occurrence to expectancy, we generate palindrome frequency patterns that allow to cluster different sequences of the same genome and to assign plasmids, and in some cases even viruses to their respective host genomes. This finding will be of use in the growing field of metagenomics. PMID:21429991

  15. Species-specific typing of DNA based on palindrome frequency patterns.

    PubMed

    Lamprea-Burgunder, Estelle; Ludin, Philipp; Mäser, Pascal

    2011-04-01

    DNA in its natural, double-stranded form may contain palindromes, sequences which read the same from either side because they are identical to their reverse complement on the sister strand. Short palindromes are underrepresented in all kinds of genomes. The frequency distribution of short palindromes exhibits more than twice the inter-species variance of non-palindromic sequences, which renders palindromes optimally suited for the typing of DNA. Here, we show that based on palindrome frequency, DNA sequences can be discriminated to the level of species of origin. By plotting the ratios of actual occurrence to expectancy, we generate palindrome frequency patterns that allow to cluster different sequences of the same genome and to assign plasmids, and in some cases even viruses to their respective host genomes. This finding will be of use in the growing field of metagenomics. PMID:21429991

  16. Repeat Sequences and Base Correlations in Human Y Chromosome Palindromes

    NASA Astrophysics Data System (ADS)

    Jin, Neng-zhi; Liu, Zi-xian; Qi, Yan-jiao; Qiu, Wen-yuan

    2009-06-01

    On the basis of information theory and statistical methods, we use mutual information, n-tuple entropy and conditional entropy, combined with biological characteristics, to analyze the long range correlation and short range correlation in human Y chromosome palindromes. The magnitude distribution of the long range correlation which can be reflected by the mutual information is P5>P5a>P5b (P5a and P5b are the sequences that replace solely Alu repeats and all interspersed repeats with random uncorrelated sequences in human Y chromosome palindrome 5, respectively); and the magnitude distribution of the short range correlation which can be reflected by the n-tuple entropy and the conditional entropy is P5>P5a>P5b>random uncorrelated sequence. In other words, when the Alu repeats and all interspersed repeats replace with random uncorrelated sequence, the long range and short range correlation decrease gradually. However, the random uncorrelated sequence has no correlation. This research indicates that more repeat sequences result in stronger correlation between bases in human Y chromosome. The analyses may be helpful to understand the special structures of human Y chromosome palindromes profoundly.

  17. Intragenic and Extragenic Suppressors of Mutations in the Heptapeptide Repeat Domain of Saccharomyces Cerevisiae RNA Polymerase II

    PubMed Central

    Nonet, M. L.; Young, R. A.

    1989-01-01

    The largest subunit of RNA polymerase II contains a repeated heptapeptide sequence at its carboxy terminus. Yeast mutants with certain partial deletions of the carboxy-terminal repeat (CTR) domain are temperature-sensitive, cold-sensitive and are inositol auxotrophs. Intragenic and extragenic suppressors of the cold-sensitive phenotype of CTR domain deletion mutants were isolated and studied to investigate the function of this domain. Two types of intragenic suppressing mutations suppress the temperature-sensitivity, cold-sensitivity and inositol auxotrophy of CTR domain deletion mutants. Most intragenic mutations enlarge the repeat domain by duplicating various portions of the repeat coding sequence. Other intragenic suppressing mutations are point mutations in a conserved segment of the large subunit. An extragenic suppressing mutation (SRB2-1) was isolated that strongly suppresses the conditional and auxotrophic phenotypes of CTR domain mutations. The SRB2 gene was isolated and mapped, and an SRB2 partial deletion mutation (srb2Δ10) was constructed. The srb2Δ10 mutants are temperature-sensitive, cold-sensitive and are inositol auxotrophs. These phenotypes are characteristic of mutations in genes encoding components of the transcription apparatus. We propose that the SRB2 gene encodes a factor that is involved in RNA synthesis and may interact with the CTR domain of the large subunit of RNA polymerase II. PMID:2693207

  18. Active maize genes are unmodified and flanked by diverse classes of modified, highly repetitive DNA.

    PubMed

    Bennetzen, J L; Schrick, K; Springer, P S; Brown, W E; SanMiguel, P

    1994-08-01

    We have characterized the copy number, organization, and genomic modification of DNA sequences within and flanking several maize genes. We found that highly repetitive DNA sequences were tightly linked to most of these genes. The highly repetitive sequences were not found within the coding regions but could be found within 6 kb either 3' or 5' to the structural genes. These highly repetitive regions were each composed of unique combinations of different short repetitive sequences. Highly repetitive DNA blocks were not interrupted by any detected single copy DNA. The 13 classes of highly repetitive DNA identified were found to vary little between diverse Zea isolates. The level of DNA methylation in and near these genes was determined by scoring the digestibility of 63 recognition/cleavage sites with restriction enzymes that were sensitive to 5-methylation of cytosines in the sequences 5'-CG-3' and 5'-CNG-3'. All but four of these sites were digestible in chromosomal DNA. The four undigested sites were localized to extragenic DNA within or near highly repetitive DNA, while the other 59 sites were in low copy number DNAs. Pulsed field gel analysis indicated that the majority of cytosine modified tracts range from 20 to 200 kb in size. Single copy sequences hybridized to the unmodified domains, while highly repetitive sequences hybridized to the modified regions. Middle repetitive sequences were found in both domains. PMID:7958822

  19. Formation of large palindromic DNA by homologous recombination of short inverted repeat sequences in Saccharomyces cerevisiae.

    PubMed Central

    Butler, David K; Gillespie, David; Steele, Brandi

    2002-01-01

    Large DNA palindromes form sporadically in many eukaryotic and prokaryotic genomes and are often associated with amplified genes. The presence of a short inverted repeat sequence near a DNA double-strand break has been implicated in the formation of large palindromes in a variety of organisms. Previously we have established that in Saccharomyces cerevisiae a linear DNA palindrome is efficiently formed from a single-copy circular plasmid when a DNA double-strand break is introduced next to a short inverted repeat sequence. In this study we address whether the linear palindromes form by an intermolecular reaction (that is, a reaction between two identical fragments in a head-to-head arrangement) or by an unusual intramolecular reaction, as it apparently does in other examples of palindrome formation. Our evidence supports a model in which palindromes are primarily formed by an intermolecular reaction involving homologous recombination of short inverted repeat sequences. We have also extended our investigation into the requirement for DNA double-strand break repair genes in palindrome formation. We have found that a deletion of the RAD52 gene significantly reduces palindrome formation by intermolecular recombination and that deletions of two other genes in the RAD52-epistasis group (RAD51 and MRE11) have little or no effect on palindrome formation. In addition, palindrome formation is dramatically reduced by a deletion of the nucleotide excision repair gene RAD1. PMID:12136011

  20. Analyses of the Sequence and Structural Properties Corresponding to Pentapeptide and Large Palindromes in Proteins.

    PubMed

    Sridhar, Settu; Nagamruta, Mallapragada; Guruprasad, Kunchur

    2015-01-01

    The analyses of 3967 representative proteins selected from the Protein Data Bank revealed the presence of 2803 pentapeptide and large palindrome sequences with known secondary structure conformation. These represent 2014 unique palindrome sequences. 60% palindromes are not associated with any regular secondary structure and 28% are in helix conformation, 11% in strand conformation and 1% in the coil conformation. The average solvent accessibility values are in the range between 0-155.28 Å2 suggesting that the palindromes in proteins can be either buried, exposed to the solvent or share an intermittent property. The number of residue neighborhood contacts defined by interactions ≤ 3.2 Ǻ is in the range between 0-29 residues. Palindromes of the same length in helix, strand and coil conformation are associated with different amino acid residue preferences at the individual positions. Nearly, 20% palindromes interact with catalytic/active site residues, ligand or metal ions in proteins and may therefore be important for function in the corresponding protein. The average hydrophobicity values for the pentapeptide and large palindromes range between -4.3 to +4.32 and the number of palindromes is almost equally distributed between the negative and positive hydrophobicity values. The palindromes represent 107 different protein families and the hydrolases, transferases, oxidoreductases and lyases contain relatively large number of palindromes. PMID:26465610

  1. Analyses of the Sequence and Structural Properties Corresponding to Pentapeptide and Large Palindromes in Proteins

    PubMed Central

    Sridhar, Settu; Nagamruta, Mallapragada; Guruprasad, Kunchur

    2015-01-01

    The analyses of 3967 representative proteins selected from the Protein Data Bank revealed the presence of 2803 pentapeptide and large palindrome sequences with known secondary structure conformation. These represent 2014 unique palindrome sequences. 60% palindromes are not associated with any regular secondary structure and 28% are in helix conformation, 11% in strand conformation and 1% in the coil conformation. The average solvent accessibility values are in the range between 0–155.28 Å2 suggesting that the palindromes in proteins can be either buried, exposed to the solvent or share an intermittent property. The number of residue neighborhood contacts defined by interactions ≤ 3.2 Ǻ is in the range between 0–29 residues. Palindromes of the same length in helix, strand and coil conformation are associated with different amino acid residue preferences at the individual positions. Nearly, 20% palindromes interact with catalytic/active site residues, ligand or metal ions in proteins and may therefore be important for function in the corresponding protein. The average hydrophobicity values for the pentapeptide and large palindromes range between -4.3 to +4.32 and the number of palindromes is almost equally distributed between the negative and positive hydrophobicity values. The palindromes represent 107 different protein families and the hydrolases, transferases, oxidoreductases and lyases contain relatively large number of palindromes. PMID:26465610

  2. Symmetry Analysis of an X-palindrome in Human and Chimpanzee

    NASA Astrophysics Data System (ADS)

    Qi, Yan-jiao; Qiu, Wen-yuan

    2009-08-01

    We analyze for the first time the rules of breaking in an X-palindrome between human and chimpanzee. Results indicate that although the overall changes that occurred in the human X-palindrome are fewer than in the chimpanzee, mutations occurring between the left arm and right arm were nearly equivalent both in human and chimpanzee when compared with orangutan, which implies evolutionary synchronization. However, there are many more A/T→G/C changes than G/C→A/T in a single arm, which would lead to an increasing trend in GC content and suggest that the composition is not at equilibrium. In addition, it is remarkable to find that there are much more asymmetrical nucleotide changes between the two arms of the human palindrome than that of the chimpanzee palindrome, and these mutations are prone to occur between bases with similar chemical structures. The symmetry seems higher in the chimpanzee palindrome than in the human X-palindrome.

  3. [The mechanisms of palindrome-stimulated mutation and related human diseases].

    PubMed

    Chen, Xu; Xiao, Fei; Guo, Jian

    2013-05-01

    In prokaryotic and eukaryotic genomes, the palindrome regions are highly variable and instable. The reason for this instability is that palindrome can form a hairpin or cruciform structure, which can result in deletions or chromosomal translocations by certain mechanisms, such as slipped mispairing, single-strand annealing and non-homologous end joining. In human genomes, palindromes commonly exist in the essential elements which can regulate the expressions of different genes, and the mutations stimulated by palindromes are also closely associated with the occurrences and progressions of certain human diseases such as male infertility and thalassemia. Based on recent studies, we briefly summarize the types of mutations caused by palindromes and their possible mechanisms, as well as the related human diseases. This review would provide some information for the following researches about the roles and functions of palindromes in gene expression, regulation, mutation and related human diseases. PMID:23732662

  4. Palindrome-Mediated Translocations in Humans: A New Mechanistic Model for Gross Chromosomal Rearrangements

    PubMed Central

    Inagaki, Hidehito; Kato, Takema; Tsutsumi, Makiko; Ouchi, Yuya; Ohye, Tamae; Kurahashi, Hiroki

    2016-01-01

    Palindromic DNA sequences, which can form secondary structures, are widely distributed in the human genome. Although the nature of the secondary structure—single-stranded “hairpin” or double-stranded “cruciform”—has been extensively investigated in vitro, the existence of such unusual non-B DNA in vivo remains controversial. Here, we review palindrome-mediated gross chromosomal rearrangements possibly induced by non-B DNA in humans. Recent advances in next-generation sequencing have not yet overcome the difficulty of palindromic sequence analysis. However, a dozen palindromic AT-rich repeat (PATRR) sequences have been identified at the breakpoints of recurrent or non-recurrent chromosomal translocations in humans. The breakages always occur at the center of the palindrome. Analyses of polymorphisms within the palindromes indicate that the symmetry and length of the palindrome affect the frequency of the de novo occurrence of these palindrome-mediated translocations, suggesting the involvement of non-B DNA. Indeed, experiments using a plasmid-based model system showed that the formation of non-B DNA is likely the key to palindrome-mediated genomic rearrangements. Some evidence implies a new mechanism that cruciform DNAs may come close together first in nucleus and illegitimately joined. Analysis of PATRR-mediated translocations in humans will provide further understanding of gross chromosomal rearrangements in many organisms. PMID:27462347

  5. Palindrome-Mediated Translocations in Humans: A New Mechanistic Model for Gross Chromosomal Rearrangements.

    PubMed

    Inagaki, Hidehito; Kato, Takema; Tsutsumi, Makiko; Ouchi, Yuya; Ohye, Tamae; Kurahashi, Hiroki

    2016-01-01

    Palindromic DNA sequences, which can form secondary structures, are widely distributed in the human genome. Although the nature of the secondary structure-single-stranded "hairpin" or double-stranded "cruciform"-has been extensively investigated in vitro, the existence of such unusual non-B DNA in vivo remains controversial. Here, we review palindrome-mediated gross chromosomal rearrangements possibly induced by non-B DNA in humans. Recent advances in next-generation sequencing have not yet overcome the difficulty of palindromic sequence analysis. However, a dozen palindromic AT-rich repeat (PATRR) sequences have been identified at the breakpoints of recurrent or non-recurrent chromosomal translocations in humans. The breakages always occur at the center of the palindrome. Analyses of polymorphisms within the palindromes indicate that the symmetry and length of the palindrome affect the frequency of the de novo occurrence of these palindrome-mediated translocations, suggesting the involvement of non-B DNA. Indeed, experiments using a plasmid-based model system showed that the formation of non-B DNA is likely the key to palindrome-mediated genomic rearrangements. Some evidence implies a new mechanism that cruciform DNAs may come close together first in nucleus and illegitimately joined. Analysis of PATRR-mediated translocations in humans will provide further understanding of gross chromosomal rearrangements in many organisms. PMID:27462347

  6. CRISPR Recognition Tool (CRT): a tool for automatic detection ofclustered regularly interspaced palindromic repeats

    SciTech Connect

    Bland, Charles; Ramsey, Teresa L.; Sabree, Fareedah; Lowe,Micheal; Brown, Kyndall; Kyrpides, Nikos C.; Hugenholtz, Philip

    2007-05-01

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel type of direct repeat found in a wide range of bacteria and archaea. CRISPRs are beginning to attract attention because of their proposed mechanism; that is, defending their hosts against invading extrachromosomal elements such as viruses. Existing repeat detection tools do a poor job of identifying CRISPRs due to the presence of unique spacer sequences separating the repeats. In this study, a new tool, CRT, is introduced that rapidly and accurately identifies CRISPRs in large DNA strings, such as genomes and metagenomes. CRT was compared to CRISPR detection tools, Patscan and Pilercr. In terms of correctness, CRT was shown to be very reliable, demonstrating significant improvements over Patscan for measures precision, recall and quality. When compared to Pilercr, CRT showed improved performance for recall and quality. In terms of speed, CRT also demonstrated superior performance, especially for genomes containing large numbers of repeats. In this paper a new tool was introduced for the automatic detection of CRISPR elements. This tool, CRT, was shown to be a significant improvement over the current techniques for CRISPR identification. CRT's approach to detecting repetitive sequences is straightforward. It uses a simple sequential scan of a DNA sequence and detects repeats directly without any major conversion or preprocessing of the input. This leads to a program that is easy to describe and understand; yet it is very accurate, fast and memory efficient, being O(n) in space and O(nm/l) in time.

  7. Compositional bias is a major determinant of the distribution pattern and abundance of palindromes in Drosophila melanogaster.

    PubMed

    Liu, Guoqing; Liu, Jia; Zhang, Bingjie

    2012-10-01

    Palindromic sequences are important DNA motifs related to gene regulation, DNA replication and recombination, and thus, investigating the evolutionary forces shaping the distribution pattern and abundance of palindromes in the genome is substantially important. In this article, we analyzed the abundance of palindromes in the genome, and then explored the possible effects of several genomic factors on the palindrome distribution and abundance in Drosophila melanogaster. Our results show that the palindrome abundance in D. melanogaster deviates from random expectation and the uneven distribution of palindromes across the genome is associated with local GC content, recombination rate, and coding exon density. Our data suggest that base composition is the major determinant of the distribution pattern and abundance of palindromes and the correlation between palindrome density and recombination is a side-product of the effect of compositional bias on the palindrome abundance. PMID:23138634

  8. Characteristics of palindromic sequences in DNA of the sea urchin Stronglyocentrotus intermedius

    SciTech Connect

    Brykov, V.A.; Kukhlevskii, A.D.

    1986-03-20

    The fraction of palindromic sequences in the nuclear DNA of the sea urchin S. intermedius was characterized. Using chromatography on hydroxyapatite and treatment with S1 nuclease, it was shown that the fraction of palindromic sequences more than doubles when the sodium concentration in solution is increased or the temperature of reassociation is lowered. The increase is due to the involvement of inverted repeats in reassociation, which are characterized by a substantial nonhomologous character and/or the presence of an extended intervening DNA sequence. It was found by the method of reassociation of a nicked palindrome fraction with an excess of total homologous DNA that most of the inverted repeats in the sea urchin genome are unique sequences. The complexity of the palindrome fraction was estimated at 8.2 x 10/sup 7/ nucleotide pairs, and the number of palindromes per haploid genome approx. 500,000.

  9. Repetition Reduction: Lexical Repetition in the Absence of Referent Repetition

    ERIC Educational Resources Information Center

    Lam, Tuan Q.; Watson, Duane G.

    2014-01-01

    Compared to words that are new to a discourse, repeated words are produced with reduced acoustic prominence. Although these effects are often attributed to priming in the production system, the locus of the effect within the production system remains unresolved because, in natural speech, repetition often involves repetition of referents and…

  10. Assessment of palindromes as platforms for DNA amplification in breast cancer.

    PubMed

    Guenthoer, Jamie; Diede, Scott J; Tanaka, Hisashi; Chai, Xiaoyu; Hsu, Li; Tapscott, Stephen J; Porter, Peggy L

    2012-02-01

    DNA amplification, particularly of chromosomes 8 and 11, occurs frequently in breast cancer and is a key factor in tumorigenesis, often associated with poor prognosis. The mechanisms involved in the amplification of these regions are not fully understood. Studies from model systems have demonstrated that palindrome formation can be an early step in DNA amplification, most notably seen in the breakage-fusion-bridge (BFB) cycle. Therefore, palindromes might be associated with gene amplicons in breast cancer. To address this possibility, we coupled high-resolution palindrome profiling by the Genome-wide Analysis of Palindrome Formation (GAPF) assay with genome-wide copy-number analyses on a set of breast cancer cell lines and primary tumors to spatially associate palindromes and copy-number gains. We identified GAPF-positive regions distributed nonrandomly throughout cell line and tumor genomes, often in clusters, and associated with copy-number gains. Commonly amplified regions in breast cancer, chromosomes 8q and 11q, had GAPF-positive regions flanking and throughout the copy-number gains. We also identified amplification-associated GAPF-positive regions at similar locations in subsets of breast cancers with similar characteristics (e.g., ERBB2 amplification). These shared positive regions offer the potential to evaluate the utility of palindromes as prognostic markers, particularly in premalignant breast lesions. Our results implicate palindrome formation in the amplification of regions with key roles in breast tumorigenesis, particularly in subsets of breast cancers. PMID:21752925

  11. Trapping of palindromic ligands within native transthyretin prevents amyloid formation

    PubMed Central

    Kolstoe, Simon E.; Mangione, Palma P.; Bellotti, Vittorio; Taylor, Graham W.; Tennent, Glenys A.; Deroo, Stéphanie; Morrison, Angus J.; Cobb, Alexander J. A.; Coyne, Anthony; McCammon, Margaret G.; Warner, Timothy D.; Mitchell, Jane; Gill, Raj; Smith, Martin D.; Ley, Steven V.; Robinson, Carol V.; Wood, Stephen P.; Pepys, Mark B.

    2010-01-01

    Transthyretin (TTR) amyloidosis is a fatal disease for which new therapeutic approaches are urgently needed. We have designed two palindromic ligands, 2,2'-(4,4'-(heptane-1,7-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (mds84) and 2,2'-(4,4'-(undecane-1,11-diylbis(oxy))bis(3,5-dichloro-4,1-phenylene)) bis(azanediyl)dibenzoic acid (4ajm15), that are rapidly bound by native wild-type TTR in whole serum and even more avidly by amyloidogenic TTR variants. One to one stoichiometry, demonstrable in solution and by MS, was confirmed by X-ray crystallographic analysis showing simultaneous occupation of both T4 binding sites in each tetrameric TTR molecule by the pair of ligand head groups. Ligand binding by native TTR was irreversible under physiological conditions, and it stabilized the tetrameric assembly and inhibited amyloidogenic aggregation more potently than other known ligands. These superstabilizers are orally bioavailable and exhibit low inhibitory activity against cyclooxygenase (COX). They offer a promising platform for development of drugs to treat and prevent TTR amyloidosis. PMID:21059958

  12. Singular continuous spectrum for palindromic Schrödinger operators

    NASA Astrophysics Data System (ADS)

    Hof, A.; Knill, O.; Simon, B.

    1995-11-01

    We give new examples of discrete Schrödinger operators with potentials taking finitely many values that have purely singular continuous spectrum. If the hull X of the potential is strictly ergodic, then the existence of just one potential x in X for which the operator has no eigenvalues implies that there is a generic set in X for which the operator has purely singular continuous spectrum. A sufficient condition for the existence of such an x is that there is a z∈ X that contains arbitrarily long palindromes. Thus we can define a large class of primitive substitutions for which the operators are purely singularly continuous for a generic subset in X. The class includes well-known substitutions like Fibonacci, Thue-Morse, Period Doubling, binary non-Pisot and ternary non-Pisot. We also show that the operator has no absolutely continuous spectrum for all x∈ X if X derives from a primitive substitution. For potentials defined by circle maps, x n =1 J (θ0+ nα), we show that the operator has purely singular continuous spectrum for a generic subset in X for all irrational α and every half-open interval J.

  13. Analysis of compensatory substitution and gene evolution on the MAGEA/CSAG-palindrome of the primate X chromosomes.

    PubMed

    Qi, Yanjiao; Lu, Huining; Ai, Duiyuan

    2013-02-01

    The human X chromosome contains a large number of inverted repeat DNA palindromes. Although arbitrary substitutions destroyed the inverted repeat structure of MAGEA/CSAG-palindrome during the evolutionary process of the primates, most of the substitutions are compensatory. Using maximum parsimony, it is demonstrated that the compensatory substitutions are prone to occur between bases with similar structures on the human, chimpanzee and orangutan MAGEA/CSAG-palindromes. Furthermore, it is found that MAGEA/CSAG genes also exist in orangutan and rhesus monkey palindromes by homologous searching. This suggests that the MAGEA/CSAG-palindrome might predate the divergence of human and other primate lineages. Comparative sequence analysis of the arms and genes on the primate MAGEA/CSAG-palindromes provides possible evidence of subsequently arm to arm gene conversion. These compensatory substitutions on the MAGEA/CSAG-palindrome of the primate X chromosomes play an important role in maintaining their structural symmetry during the process of formation. PMID:23257410

  14. Wavelet analysis of DNA walks on the human and chimpanzee MAGE/CSAG-palindromes.

    PubMed

    Qi, Yanjiao; Jin, Nengzhi; Ai, Duiyuan

    2012-08-01

    The palindrome is one class of symmetrical duplications with reverse complementary characters, which is widely distributed in many organisms. Graphical representation of DNA sequence provides a simple way of viewing and comparing various genomic structures. Through 3-D DNA walk analysis, the similarity and differences in nucleotide composition, as well as the evolutionary relationship between human and chimpanzee MAGE/CSAG-palindromes, can be clearly revealed. Further wavelet analysis indicated that duplicated segments have irregular patterns compared to their surrounding sequences. However, sequence similarity analysis suggests that there is possible common ancestor between human and chimpanzee MAGE/CSAG-palindromes. Based on the specific distribution and orientation of the repeated sequences, a simple possible evolutionary model of the palindromes is suggested, which may help us to better understand the evolutionary course of the genes and the symmetrical sequences. PMID:23084779

  15. Gene Conversion Violates the Stepwise Mutation Model for Microsatellites in Y-Chromosomal Palindromic Repeats

    PubMed Central

    Balaresque, Patricia; King, Turi E; Parkin, Emma J; Heyer, Evelyne; Carvalho-Silva, Denise; Kraaijenbrink, Thirsa; de Knijff, Peter; Tyler-Smith, Chris; Jobling, Mark A

    2014-01-01

    The male-specific region of the human Y chromosome (MSY) contains eight large inverted repeats (palindromes), in which high-sequence similarity between repeat arms is maintained by gene conversion. These palindromes also harbor microsatellites, considered to evolve via a stepwise mutation model (SMM). Here, we ask whether gene conversion between palindrome microsatellites contributes to their mutational dynamics. First, we study the duplicated tetranucleotide microsatellite DYS385a,b lying in palindrome P4. We show, by comparing observed data with simulated data under a SMM within haplogroups, that observed heteroallelic combinations in which the modal repeat number difference between copies was large, can give rise to homoallelic combinations with zero-repeats difference, equivalent to many single-step mutations. These are unlikely to be generated under a strict SMM, suggesting the action of gene conversion. Second, we show that the intercopy repeat number difference for a large set of duplicated microsatellites in all palindromes in the MSY reference sequence is significantly reduced compared with that for nonpalindrome-duplicated microsatellites, suggesting that the former are characterized by unusual evolutionary dynamics. These observations indicate that gene conversion violates the SMM for microsatellites in palindromes, homogenizing copies within individual Y chromosomes, but increasing overall haplotype diversity among chromosomes within related groups. PMID:24610746

  16. Telomere Dysfunction Triggers Palindrome Formation Independently of Double-Strand Break Repair Mechanisms

    PubMed Central

    Raykov, Vasil; Marvin, Marcus E.; Louis, Edward J.; Maringele, Laura

    2016-01-01

    Inverted chromosome duplications or palindromes are linked with genetic disorders and malignant transformation. They are considered by-products of DNA double-strand break (DSB) repair: the homologous recombination (HR) and the nonhomologous end joining (NHEJ). Palindromes near chromosome ends are often triggered by telomere losses. An important question is to what extent their formation depends upon DSB repair mechanisms. Here we addressed this question using yeast genetics and comparative genomic hybridization. We induced palindrome formation by passaging cells lacking any form of telomere maintenance (telomerase and telomere recombination). Surprisingly, we found that DNA ligase 4, essential for NHEJ, did not make a significant contribution to palindrome formation induced by telomere losses. Moreover RAD51, important for certain HR-derived mechanisms, had little effect. Furthermore RAD52, which is essential for HR in yeast, appeared to decrease the number of palindromes in cells proliferating without telomeres. This study also uncovered an important role for Rev3 and Rev7 (but not for Pol32) subunits of polymerase ζ in the survival of cells undergoing telomere losses and forming palindromes. We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis, rather than DSB repair, drives the inverted duplication triggered by telomere dysfunction. PMID:27334270

  17. Telomere Dysfunction Triggers Palindrome Formation Independently of Double-Strand Break Repair Mechanisms.

    PubMed

    Raykov, Vasil; Marvin, Marcus E; Louis, Edward J; Maringele, Laura

    2016-08-01

    Inverted chromosome duplications or palindromes are linked with genetic disorders and malignant transformation. They are considered by-products of DNA double-strand break (DSB) repair: the homologous recombination (HR) and the nonhomologous end joining (NHEJ). Palindromes near chromosome ends are often triggered by telomere losses. An important question is to what extent their formation depends upon DSB repair mechanisms. Here we addressed this question using yeast genetics and comparative genomic hybridization. We induced palindrome formation by passaging cells lacking any form of telomere maintenance (telomerase and telomere recombination). Surprisingly, we found that DNA ligase 4, essential for NHEJ, did not make a significant contribution to palindrome formation induced by telomere losses. Moreover RAD51, important for certain HR-derived mechanisms, had little effect. Furthermore RAD52, which is essential for HR in yeast, appeared to decrease the number of palindromes in cells proliferating without telomeres. This study also uncovered an important role for Rev3 and Rev7 (but not for Pol32) subunits of polymerase ζ in the survival of cells undergoing telomere losses and forming palindromes. We propose a model called short-inverted repeat-induced synthesis in which DNA synthesis, rather than DSB repair, drives the inverted duplication triggered by telomere dysfunction. PMID:27334270

  18. Gene conversion violates the stepwise mutation model for microsatellites in y-chromosomal palindromic repeats.

    PubMed

    Balaresque, Patricia; King, Turi E; Parkin, Emma J; Heyer, Evelyne; Carvalho-Silva, Denise; Kraaijenbrink, Thirsa; de Knijff, Peter; Tyler-Smith, Chris; Jobling, Mark A

    2014-05-01

    The male-specific region of the human Y chromosome (MSY) contains eight large inverted repeats (palindromes), in which high-sequence similarity between repeat arms is maintained by gene conversion. These palindromes also harbor microsatellites, considered to evolve via a stepwise mutation model (SMM). Here, we ask whether gene conversion between palindrome microsatellites contributes to their mutational dynamics. First, we study the duplicated tetranucleotide microsatellite DYS385a,b lying in palindrome P4. We show, by comparing observed data with simulated data under a SMM within haplogroups, that observed heteroallelic combinations in which the modal repeat number difference between copies was large, can give rise to homoallelic combinations with zero-repeats difference, equivalent to many single-step mutations. These are unlikely to be generated under a strict SMM, suggesting the action of gene conversion. Second, we show that the intercopy repeat number difference for a large set of duplicated microsatellites in all palindromes in the MSY reference sequence is significantly reduced compared with that for nonpalindrome-duplicated microsatellites, suggesting that the former are characterized by unusual evolutionary dynamics. These observations indicate that gene conversion violates the SMM for microsatellites in palindromes, homogenizing copies within individual Y chromosomes, but increasing overall haplotype diversity among chromosomes within related groups. PMID:24610746

  19. Palindromic Genes in the Linear Mitochondrial Genome of the Nonphotosynthetic Green Alga Polytomella magna

    PubMed Central

    Smith, David Roy; Hua, Jimeng; Archibald, John M.; Lee, Robert W.

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1–7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  20. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region.

    PubMed

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-01-01

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a 'palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance. PMID:26883548

  1. Deciphering the importance of the palindromic architecture of the immunoglobulin heavy-chain 3' regulatory region

    PubMed Central

    Saintamand, Alexis; Vincent-Fabert, Christelle; Garot, Armand; Rouaud, Pauline; Oruc, Zeliha; Magnone, Virginie; Cogné, Michel; Denizot, Yves

    2016-01-01

    The IgH 3' regulatory region (3'RR) controls class switch recombination (CSR) and somatic hypermutation (SHM) in B cells. The mouse 3'RR contains four enhancer elements with hs1,2 flanked by inverted repeated sequences and the centre of a 25-kb palindrome bounded by two hs3 enhancer inverted copies (hs3a and hs3b). hs4 lies downstream of the palindrome. In mammals, evolution maintained this unique palindromic arrangement, suggesting that it is functionally significant. Here we report that deconstructing the palindromic IgH 3'RR strongly affects its function even when enhancers are preserved. CSR and IgH transcription appear to be poorly dependent on the 3'RR architecture and it is more or less preserved, provided 3'RR enhancers are present. By contrast, a ‘palindromic effect' significantly lowers VH germline transcription, AID recruitment and SHM. In conclusion, this work indicates that the IgH 3'RR does not simply pile up enhancer units but also optimally exposes them into a functional architecture of crucial importance. PMID:26883548

  2. Palindromic genes in the linear mitochondrial genome of the nonphotosynthetic green alga Polytomella magna.

    PubMed

    Smith, David Roy; Hua, Jimeng; Archibald, John M; Lee, Robert W

    2013-01-01

    Organelle DNA is no stranger to palindromic repeats. But never has a mitochondrial or plastid genome been described in which every coding region is part of a distinct palindromic unit. While sequencing the mitochondrial DNA of the nonphotosynthetic green alga Polytomella magna, we uncovered precisely this type of genic arrangement. The P. magna mitochondrial genome is linear and made up entirely of palindromes, each containing 1-7 unique coding regions. Consequently, every gene in the genome is duplicated and in an inverted orientation relative to its partner. And when these palindromic genes are folded into putative stem-loops, their predicted translational start sites are often positioned in the apex of the loop. Gel electrophoresis results support the linear, 28-kb monomeric conformation of the P. magna mitochondrial genome. Analyses of other Polytomella taxa suggest that palindromic mitochondrial genes were present in the ancestor of the Polytomella lineage and lost or retained to various degrees in extant species. The possible origins and consequences of this bizarre genomic architecture are discussed. PMID:23940100

  3. Large palindromes in the lambda phage genome are preserved in a rec/sup +/ host by inhibiting lambda DNA replication

    SciTech Connect

    Shurvinton, C.E.; Stahl, M.M.; Stahl, F.W.

    1987-03-01

    A large palindrome carried by phage lambda has been shown to prevent growth of the phage on a rec/sup +/ strain of Escherichia coli. The phage do form plaques on recBC sbcB strains, but the palindrome is not stable - deletions that either destroy the palindrome or diminish its size overgrow the original engineered palindrome-containing phage. The authors have prepared stocks of lambda carrying a palindrome that is 2 x 4200 base pairs long. lambda phage were density labeled by UV induction of lysogens grown in minimal medium containing (/sup 13/C) glucose and /sup 15/NH/sub 4/Cl. These phage stocks are produced by induction of a lysogen in which the two halves of the palindrome are stored at opposite ends of the prophage and are of sufficient titer (10/sup 9/ phage per ml) to enable one-step growth experiments with replication-blocked phage. They find that the large palindrome as well as a lesser palindrome of 2 x 265 base pairs are recovered intact among particles carrying unreplicated chromosomes following such an infection of a rec/sup +/ host. they propose that DNA replication drives the extrusion of palindromic sequences in vivo, forming secondary structures that are substrates for the recBC and sbcB gene products.

  4. Repetitive Stress Injuries

    MedlinePlus

    ... any problems since. What Are Repetitive Stress Injuries? Repetitive stress injuries (RSIs) are injuries that happen when too much stress is placed on a part of the body, resulting in inflammation (pain and swelling), muscle strain, or tissue damage. This stress generally occurs from ...

  5. The Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2013-01-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and…

  6. Replicating repetitive DNA.

    PubMed

    Tognetti, Silvia; Speck, Christian

    2016-05-27

    The function and regulation of repetitive DNA, the 'dark matter' of the genome, is still only rudimentarily understood. Now a study investigating DNA replication of repetitive centromeric chromosome segments has started to expose a fascinating replication program that involves suppression of ATR signalling, in particular during replication stress. PMID:27230530

  7. An extragenic suppressor of the mitosis-defective bimD6 mutation of Aspergillus nidulans codes for a chromosome scaffold protein

    SciTech Connect

    Holt, C.L.; May, G.S.

    1996-03-01

    We previously identified a gene, bimD, that functions in chromosome segregation and contains sequences suggesting that it may be a DNA-binding protein. Two conditionally lethal mutations in bimD arrest with aberrant mitotic spindles at restrictive temperature. These spindles have one-third the normal number of microtubules, and the chromosomes never attach to the remaining microtubules. For this reason, we hypothesized that BIMD functioned in chromosome segregation, possibly as a component of the kinetochore. To identify other components that function with bimD, we conducted a screen for extragenic suppressors of the bimD5 and bimD6 mutations. We have isolated seven cold-sensitive extragenic suppressors of bimD6 heat sensitivity that represent three or possibly four separate sud genes. We have cloned one of the suppressor genes by complementation of the cold-sensitive phenotype of the sudA3 mutation. SUDA belongs to the DA-box protein family. DA-box proteins have been shown to function in chromosome structure and segregation. Thus bimD and the sud genes cooperatively function in chromosome segregation in Aspergillus nidulans. 40 refs., 5 figs., 2 tabs.

  8. Roles of repetitive sequences

    SciTech Connect

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  9. Schrödinger operators with Rudin-Shapiro potentials are not palindromic

    NASA Astrophysics Data System (ADS)

    Allouche, J.-P.

    1997-04-01

    We prove a conjecture of A. Hof, O. Knill and B. Simon [Commun. Math. Phys. 174, 149-159 (1995)] by showing that the Rudin-Shapiro sequence is not palindromic, i.e., does not contain arbitrarily long palindromes. We prove actually this property for all paperfolding sequences and all Rudin-Shapiro sequences deduced from paperfolding sequences. As a consequence and as guessed by the above authors, their method cannot be used for establishing that discrete Schrödinger operators with Rudin-Shapiro potentials have a purely singular continuous spectrum.

  10. Chromosome evolution with naked eye: Palindromic context of the life origin

    NASA Astrophysics Data System (ADS)

    Larionov, Sergei; Loskutov, Alexander; Ryadchenko, Eugeny

    2008-03-01

    Based on the representation of the DNA sequence as a two-dimensional (2D) plane walk, we consider the problem of identification and comparison of functional and structural organizations of chromosomes of different organisms. According to the characteristic design of 2D walks we identify telomere sites, palindromes of various sizes and complexity, areas of ribosomal RNA, transposons, as well as diverse satellite sequences. As an interesting result of the application of the 2D walk method, a new duplicated gigantic palindrome in the X human chromosome is detected. A schematic mechanism leading to the formation of such a duplicated palindrome is proposed. Analysis of a large number of the different genomes shows that some chromosomes (or their fragments) of various species appear as imperfect gigantic palindromes, which are disintegrated by many inversions and the mutation drift on different scales. A spread occurrence of these types of sequences in the numerous chromosomes allows us to develop a new insight of some accepted points of the genome evolution in the prebiotic phase.

  11. De novo-generated small palindromes are characteristic of amplicon boundary junction of double minutes.

    PubMed

    Zhu, Jing; Yu, Yang; Meng, Xiangning; Fan, Yihui; Zhang, Yu; Zhou, Chunshui; Yue, Zhichao; Jin, Yan; Zhang, Chunyu; Yu, Lisa; Ji, Wei; Jia, Xueyuan; Guan, Rongwei; Wu, Jie; Yu, Jingcui; Bai, Jing; Guan, Xin-Yuan; Wang, Mingrong; Lee, Ki-Young; Sun, Wenjing; Fu, Songbin

    2013-08-15

    Double minutes (DMs) are hallmarks of gene amplification. However, their molecular structure and the mechanisms of formation are largely unknown. To elucidate the structure and underlying molecular mechanism of DMs, we obtained and cloned DMs using microdissection; and degenerated oligonucleotide primed polymerase chain reaction (DOP-PCR) from the ovarian cancer cell line UACC-1598. Two large amplicons, the 284 kb AmpMYCN, originating from locus 2p24.3 and the 391 kb AmpEIF5A2, from locus 3q26.2, were found co-amplified on the same DMs. The two amplicons are joined through a complex 7 kb junction DNA sequence. Analysis of the junction has revealed three de novo created small palindromes surrounding the six breakpoints. Consistent with these observations, we further found that 70% of the 57 reported DM junction sequences have de novo creation of small palindromic sequences surrounding the breakpoints. Together, our findings indicate that de novo-generated small palindromic sequences are characteristic of amplicon boundary junctions on DMs. It is possible that the de novo-generated small palindromic sequences, which may be generated through non-homologous end joining in concert with a novel DNA repair machinery, play a common role in amplicon rejoining and gene amplification. PMID:23382041

  12. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes.

  13. Repetition priming in music.

    PubMed

    Hutchins, Sean; Palmer, Caroline

    2008-06-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance (measured in events). Experiment 1 used variable-length melodies, whereas Experiments 2 and 3 used fixed-length melodies. Experiment 3 changed the timbre of the target tone. In all experiments, fast-responding participants produced repeated tones faster than nonrepeated tones, and this repetition benefit decreased as prime-target distances increased. All participants produced expected tonic endings faster than less expected nontonic endings. Repetition and tonal priming effects are compared with harmonic priming effects in music and with repetition priming effects in language. PMID:18505332

  14. Indirect decentralized repetitive control

    NASA Technical Reports Server (NTRS)

    Lee, Soo Cheol; Longman, Richard W.

    1993-01-01

    Learning control refers to controllers that learn to improve their performance at executing a given task, based on experience performing this specific task. In a previous work, the authors presented a theory of indirect decentralized learning control based on use of indirect adaptive control concepts employing simultaneous identification and control. This paper extends these results to apply to the indirect repetitive control problem in which a periodic (i.e., repetitive) command is given to a control system. Decentralized indirect repetitive control algorithms are presented that have guaranteed convergence to zero tracking error under very general conditions. The original motivation of the repetitive control and learning control fields was learning in robots doing repetitive tasks such as on an assembly line. This paper starts with decentralized discrete time systems, and progresses to the robot application, modeling the robot as a time varying linear system in the neighborhood of the desired trajectory. Decentralized repetitive control is natural for this application because the feedback control for link rotations is normally implemented in a decentralized manner, treating each link as if it is independent of the other links.

  15. Characterizing temporal repetition

    SciTech Connect

    Cukierman, D.; Delgrande, J.

    1996-12-31

    We are investigating the representation and reasoning about schedulable, repeated activities, specified using calendars. Examples of such activities include meeting every Tuesday and Thursday during a semester and attending a seminar every first day of a month. This research provides for a valuable framework for scheduling systems, financial systems and, in general, date-based systems. Very recently work has been done related to reasoning about repetition in the Artificial Intelligence community and others. A partial reference list is provided here. However, to our knowledge no extensive taxonomy of repetition has been proposed in the literature. We believe that reasoning about repeated activities calls for a study and precise definition of the topological characteristics in a repetitive series. In this abstract we summarize a proposal to classify types of repetition according to parameters. The combination of all possible values of these parameters provides a complete taxonomy of repetitive classes with respect to the proposed parameters. Several notions of repetition are considered, some are extremely general, some are very specific.

  16. Detection of Replication Origin Sites in Herpesvirus Genomes by Clustering and Scoring of Palindromes with Quadratic Entropy Measures.

    PubMed

    Rizvi, Ahsan Z; Bhattacharya, C

    2014-01-01

    Replication in herpesvirus genomes is a major concern of public health as they multiply rapidly during the lytic phase of infection that cause maximum damage to the host cells. Earlier research has established that sites of replication origin are dominated by high concentration of rare palindrome sequences of DNA. Computational methods are devised based on scoring to determine the concentration of palindromes. In this paper, we propose both extraction and localization of rare palindromes in an automated manner. Discrete Cosine Transform (DCT-II), a widely recognized image compression algorithm is utilized here to extract palindromic sequences based on their reverse complimentary symmetry property of existence. We formulate a novel approach to localize the rare palindrome clusters by devising a Minimum Quadratic Entropy (MQE) measure based on the Renyi's Quadratic Entropy (RQE) function. Experimental results over a large number of herpesvirus genomes show that the RQE based scoring of rare palindromes have higher order of sensitivity, and lesser false alarm in detecting concentration of rare palindromes and thereby sites of replication origin. PMID:26357048

  17. The negative repetition effect.

    PubMed

    Mulligan, Neil W; Peterson, Daniel J

    2013-09-01

    A fundamental property of human memory is that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising negative repetition effect, in which participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once. Words within a pair rhymed, and across pairs, the target words were drawn from a small set of categories. In the repetition condition, the pairs were initially presented in a random order and then presented a 2nd time blocked by the category of the target words. In the single presentation condition, the pairs were presented only in the blocked order. Participants in the former condition recalled fewer target words on a free recall test despite having seen the word pairs twice (the negative repetition effect). This phenomenon is explored in a series of 5 experiments assessing 3 theoretical accounts of the effect. The experiments demonstrate that the negative repetition effect generalizes over multiple encoding conditions (reading and generative encoding), over different memory tests (free and cued recall), and over delay (5 min and 2 days). The results argue against a retrieval account and a levels-of-processing account but are consistent with the item-specific-relational account, the account upon which the effect was initially predicated. PMID:23421508

  18. Development of a novel molecular detection method for clustered regularly interspaced short palindromic repeats (CRISPRs) in Taylorella organisms.

    PubMed

    Hara, Yasushi; Nakajima, Takuya; Akamatsu, Marie; Yahiro, Motoki; Kagawa, Shizuko; Petry, Sandrine; Matsuda, Motoo; Moore, John E

    2015-07-01

    Contagious equine metritis is a bacterial infectious disease of horses caused by Taylorella equigenitalis, a Gram-negative eubacterium. The disease has been described in several continents, including Europe, North America and Asia. A novel molecular method was developed to detect clustered regularly interspaced short palindromic repeats (CRISPRs), which were separated by non-repetitive unique spacer regions (NRUSRs) of similar length, in the Taylorella equigenitalis EQ59 strain using a primer pair, f-/r-TeCRISPR-ladder, by PCR amplification. In total, 31 Taylorella isolates (17 T. equigenitalis and 14 Taylorella asinigenitalis) were examined. The T. equigenitalis isolates came from thoroughbred and cold-blooded horses from nine countries during 1980-1996, whilst the T. asinigenitalis isolates all originated from donkey jacks in France and the USA during 1997-2006. PAGE fractionated all of the 13 CRISPRs separated by 12 NRUSRs in T. equigenitalis EQ59. Permutation examples of CRISPRs, which were separated by NRUSRs for small-sized ladders, consisting of two doublet bands were shown. Putative CRISPRs separated by NRUSRs were amplified with 14/17 (82.4 %) geographically disparate T. equigenitalis isolates using the newly designed primer pair. Approximately 82.4 % of the T. equigenitalis isolates had CRISPRs separated by NRUSRs. The CRISPR locus was also found in the French T. asinigenitalis strain MCE3. Putative CRISPRs separated by NRUSRs were detected similarly in 4/14 (28.6 %) T. asinigenitalis isolates. Overall, a more detailed understanding of the molecular biology of CRISPRs within Taylorella organisms may help elucidate the pathogenic virulence and transmission mechanisms associated with this important equine pathogen. PMID:25934548

  19. Repetition through Successive Approximations.

    ERIC Educational Resources Information Center

    Littell, Katherine M.

    This study was conducted in an attempt to provide an alternative to the long-established method of tape listening and repetition drills, a method that has had disappointing results. It is suggested that the rate of speed of phonic presentation is not commensurate with the rate of comprehension. The proposed method seeks to prevent cognitive…

  20. Novel porcine repetitive elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An analysis of 220 fully sequenced porcine BACs generated by the Comparative Vertebrate Sequencing Initiative (http://www.nisc.nih.gov/) revealed 27 distinct, novel porcine repetitive elements ranging in length from 55 to 1059 nucleotides. This set of fully sequenced BACs covers approximately 1% of...

  1. Repetition Priming in Music

    ERIC Educational Resources Information Center

    Hutchins, Sean; Palmer, Caroline

    2008-01-01

    The authors explore priming effects of pitch repetition in music in 3 experiments. Musically untrained participants heard a short melody and sang the last pitch of the melody as quickly as possible. Each experiment manipulated (a) whether or not the tone to be sung (target) was heard earlier in the melody (primed) and (b) the prime-target distance…

  2. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability

    PubMed Central

    Antonacci, Francesca; Dennis, Megan Y.; Huddleston, John; Sudmant, Peter H.; Steinberg, Karyn Meltz; Rosenfeld, Jill A.; Miroballo, Mattia; Graves, Tina A.; Vives, Laura; Malig, Maika; Denman, Laura; Raja, Archana; Stuart, Andrew; Tang, Joyce; Munson, Brenton; Shaffer, Lisa G.; Amemiya, Chris T.; Wilson, Richard K.; Eichler, Evan E.

    2014-01-01

    Recurrent deletions of chromosome 15q13.3 associate with intellectual disability, schizophrenia, autism and epilepsy. To gain insight into its instability, we sequenced the region in patients, normal individuals and nonhuman primates. We discovered five structural configurations of the human chromosome 15q13.3 region ranging in size from 2 to 3 Mbp. These configurations arose recently (~0.5–0.9 million years ago) as a result of human-specific expansions of segmental duplications and two independent inversion events. All inversion breakpoints map near GOLGA8 core duplicons—a ~14 kbp primate-specific chromosome 15 repeat that became organized into larger palindromic structures. GOLGA8-flanked palindromes also demarcate the breakpoints of recurrent 15q13.3 microdeletions, the expansion of chromosome 15 segmental duplications in the human lineage, and independent structural changes in apes. The significant clustering (p=0.002) of breakpoints provides mechanistic evidence for the role of this core duplicon and its palindromic architecture in promoting evolutionary and disease-related instability of chromosome 15. PMID:25326701

  3. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability.

    PubMed

    Antonacci, Francesca; Dennis, Megan Y; Huddleston, John; Sudmant, Peter H; Steinberg, Karyn Meltz; Rosenfeld, Jill A; Miroballo, Mattia; Graves, Tina A; Vives, Laura; Malig, Maika; Denman, Laura; Raja, Archana; Stuart, Andrew; Tang, Joyce; Munson, Brenton; Shaffer, Lisa G; Amemiya, Chris T; Wilson, Richard K; Eichler, Evan E

    2014-12-01

    Recurrent deletions of chromosome 15q13.3 associate with intellectual disability, schizophrenia, autism and epilepsy. To gain insight into the instability of this region, we sequenced it in affected individuals, normal individuals and nonhuman primates. We discovered five structural configurations of the human chromosome 15q13.3 region ranging in size from 2 to 3 Mb. These configurations arose recently (∼0.5-0.9 million years ago) as a result of human-specific expansions of segmental duplications and two independent inversion events. All inversion breakpoints map near GOLGA8 core duplicons-a ∼14-kb primate-specific chromosome 15 repeat that became organized into larger palindromic structures. GOLGA8-flanked palindromes also demarcate the breakpoints of recurrent 15q13.3 microdeletions, the expansion of chromosome 15 segmental duplications in the human lineage and independent structural changes in apes. The significant clustering (P = 0.002) of breakpoints provides mechanistic evidence for the role of this core duplicon and its palindromic architecture in promoting the evolutionary and disease-related instability of chromosome 15. PMID:25326701

  4. Palindromic sequence artifacts generated during next generation sequencing library preparation from historic and ancient DNA.

    PubMed

    Star, Bastiaan; Nederbragt, Alexander J; Hansen, Marianne H S; Skage, Morten; Gilfillan, Gregor D; Bradbury, Ian R; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S; Jentoft, Sissel

    2014-01-01

    Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5' and 3'-ends of sequencing reads. The palindromic sequences themselves have specific properties - the bases at the 5'-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3'-end. The terminal 3' bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3'-end of DNA strands, with the 5'-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

  5. A perfect palindrome in the Escherichia coli chromosome forms DNA hairpins on both leading- and lagging-strands.

    PubMed

    Azeroglu, Benura; Lincker, Frédéric; White, Martin A; Jain, Devanshi; Leach, David R F

    2014-12-01

    DNA palindromes are hotspots for DNA double strand breaks, inverted duplications and intra-chromosomal translocations in a wide spectrum of organisms from bacteria to humans. These reactions are mediated by DNA secondary structures such as hairpins and cruciforms. In order to further investigate the pathways of formation and cleavage of these structures, we have compared the processing of a 460 base pair (bp) perfect palindrome in the Escherichia coli chromosome with the same construct interrupted by a 20 bp spacer to form a 480 bp interrupted palindrome. We show here that the perfect palindrome can form hairpin DNA structures on the templates of the leading- and lagging-strands in a replication-dependent reaction. In the presence of the hairpin endonuclease SbcCD, both copies of the replicated chromosome containing the perfect palindrome are cleaved, resulting in the formation of an unrepairable DNA double-strand break and cell death. This contrasts with the interrupted palindrome, which forms a hairpin on the lagging-strand template that is processed to form breaks, which can be repaired by homologous recombination. PMID:25389268

  6. Structural and functional evaluation of the palindromic alanine-rich antimicrobial peptide Pa-MAP2.

    PubMed

    Migliolo, Ludovico; Felício, Mário R; Cardoso, Marlon H; Silva, Osmar N; Xavier, Mary-Ann E; Nolasco, Diego O; de Oliveira, Adeliana Silva; Roca-Subira, Ignasi; Vila Estape, Jordi; Teixeira, Leandro D; Freitas, Sonia M; Otero-Gonzalez, Anselmo J; Gonçalves, Sónia; Santos, Nuno C; Franco, Octavio L

    2016-07-01

    Recently, several peptides have been studied regarding the defence process against pathogenic microorganisms, which are able to act against different targets, with the purpose of developing novel bioactive compounds. The present work focuses on the structural and functional evaluation of the palindromic antimicrobial peptide Pa-MAP2, designed based on the peptide Pa-MAP from Pleuronectes americanus. For a better structural understanding, molecular modelling analyses were carried out, together with molecular dynamics and circular dichroism, in different media. Antibacterial activity against Gram-negative and positive bacteria was evaluated, as well as cytotoxicity against human erythrocytes, RAW 264.7, Vero and L6 cells. In silico docking experiments, lipid vesicle studies, and atomic force microscopy (AFM) imaging were carried out to explore the activity of the peptide. In vivo studies on infected mice were also done. The palindromic primary sequence favoured an α-helix structure that was pH dependent, only present on alkaline environment, with dynamic N- and C-terminals that are stabilized in anionic media. Pa-MAP2 only showed activity against Gram-negative bacteria, with a MIC of 3.2 μM, and without any cytotoxic effect. In silico, lipid vesicles and AFM studies confirm the preference for anionic lipids (POPG, POPS, DPPE, DPPG and LPS), with the positively charged lysine residues being essential for the initial electrostatic interaction. In vivo studies showed that Pa-MAP2 increases to 100% the survival rate of mice infected with Escherichia coli. Data here reported indicated that palindromic Pa-MAP2 could be an alternative candidate for use in therapeutics against Gram-negative bacterial infections. PMID:27063608

  7. Novel Method Developed to Further the Understanding of DNA Palindromes | Poster

    Cancer.gov

    Editor's note: Platinum Highlight articles are noteworthy publications selected periodically by Dr. Craig Reynolds, associate director, National Cancer Institute, from among the most recently published Platinum Publications. When Alison Rattray and colleagues in the Gene Regulation and Chromosome Biology Laboratory (GRCBL) examined a mutant yeast cell they had isolated in a screen, they noticed something strange. The DNA exhibited a “very specific, but weird, rearrangement,” she explained. The arrangement turned out to be a DNA palindrome, “opening the door to studying these elusive DNA motifs,” she said.

  8. Heterogeneous Diversity of Spacers within CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)

    NASA Astrophysics Data System (ADS)

    He, Jiankui; Deem, Michael W.

    2010-09-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in bacterial and archaeal DNA have recently been shown to be a new type of antiviral immune system in these organisms. We here study the diversity of spacers in CRISPR under selective pressure. We propose a population dynamics model that explains the biological observation that the leader-proximal end of CRISPR is more diversified and the leader-distal end of CRISPR is more conserved. This result is shown to be in agreement with recent experiments. Our results show that the CRISPR spacer structure is influenced by and provides a record of the viral challenges that bacteria face.

  9. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRi) plasmids | Office of Cancer Genomics

    Cancer.gov

    CTD2 researchers at the University of California in San Francisco developed a modified Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) CRISPR/dCas9 system. Catalytically inactive dCas9 enables modular and programmable RNA-guided genome regulation in eukaryotes. The CRISPR/dCas9 system has several advantages:  i) enables robust gene repression (CRISPRi) or activation (CRISPRa) in human cells, ii) allows specific knockdown with minimal off-target effects in human cells, iii) works efficiently in human and yeast cells, and iv) does not cause  double-strand breaks.

  10. Clustered Regularly Interspaced Short Palindromic Repeats: Challenges in Treating Retinal Disease.

    PubMed

    Chrenek, Micah A; Nickerson, John M; Boatright, Jeffrey H

    2016-01-01

    Ophthalmic researchers and clinicians arguably have led the way for safe, effective gene therapy, most notably with adeno-associated viral gene supplementation in the treatment for patients with Leber congenital amaurosis type 2 with mutations in the RPE65 gene. These successes notwithstanding, most other genetic retinal disease will be refractory to supplementation. The ideal gene therapy approach would correct gene mutations to restore normal function in the affected cells. Gene editing in which a mutant allele is inactivated or converted to sequence that restores normal function is hypothetically one such approach. Such editing involves site-specific digestion of mutant genomic DNA followed by repair. Previous experimental approaches were hampered by inaccurate and high rates of off-site lesioning and by overall low digestion rates. A new tool, clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9, may address both shortcomings. Some of the many challenges that must be addressed in moving clustered regularly interspaced short palindromic repeats coupled with the nuclease Cas9 therapies to the ophthalmic clinic are discussed here. PMID:27488072

  11. Highly Iterated Palindromic Sequences (HIPs) and Their Relationship to DNA Methyltransferases

    PubMed Central

    Elhai, Jeff

    2015-01-01

    The sequence GCGATCGC (Highly Iterated Palindrome, HIP1) is commonly found in high frequency in cyanobacterial genomes. An important clue to its function may be the presence of two orphan DNA methyltransferases that recognize internal sequences GATC and CGATCG. An examination of genomes from 97 cyanobacteria, both free-living and obligate symbionts, showed that there are exceptional cases in which HIP1 is at a low frequency or nearly absent. In some of these cases, it appears to have been replaced by a different GC-rich palindromic sequence, alternate HIPs. When HIP1 is at a high frequency, GATC- and CGATCG-specific methyltransferases are generally present in the genome. When an alternate HIP is at high frequency, a methyltransferase specific for that sequence is present. The pattern of 1-nt deviations from HIP1 sequences is biased towards the first and last nucleotides, i.e., those distinguish CGATCG from HIP1. Taken together, the results point to a role of DNA methylation in the creation or functioning of HIP sites. A model is presented that postulates the existence of a GmeC-dependent mismatch repair system whose activity creates and maintains HIP sequences. PMID:25789551

  12. Repetitive resonant railgun power supply

    DOEpatents

    Honig, E.M.; Nunnally, W.C.

    1985-06-19

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  13. Repetitive resonant railgun power supply

    DOEpatents

    Honig, Emanuel M.; Nunnally, William C.

    1988-01-01

    A repetitive resonant railgun power supply provides energy for repetitively propelling projectiles from a pair of parallel rails. The supply comprises an energy storage capacitor, a storage inductor to form a resonant circuit with the energy storage capacitor and a magnetic switch to transfer energy between the resonant circuit and the pair of parallel rails for the propelling of projectiles.

  14. Palindromic unit-independent transposition of IS1397 in Yersinia pestis.

    PubMed

    Wilde, Caroline; Bachellier, Sophie; Hofnung, Maurice; Carniel, Elisabeth; Clément, Jean-Marie

    2002-09-01

    Palindromic units (PUs) are intergenic repeated sequences scattered over the chromosomes of Escherichia coli and several other enterobacteria. In the latter, IS1397, an E. coli insertion sequence specific to PUs, transposes into PUs with sequences close to the E. coli consensus. Reasons for this insertion specificity can relate to either a direct recognition of the target (by its sequence or its structure) by the transposase or an interaction between a specific host protein and the PU target DNA sequence. In this study, we show that for Yersinia pestis, a species deprived of PUs, IS1397 can transpose onto its chromosome, with transpositional hot spots. Our results are in favor of a direct recognition of target DNA by IS1397 transposase. PMID:12169598

  15. Perceptual Repetition Blindness Effects

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    The phenomenon of repetition blindness (RB) may reveal a new limitation on human perceptual processing. Recently, however, researchers have attributed RB to post-perceptual processes such as memory retrieval and/or reporting biases. The standard rapid serial visual presentation (RSVP) paradigm used in most RB studies is, indeed, open to such objections. Here we investigate RB using a "single-frame" paradigm introduced by Johnston and Hale (1984) in which memory demands are minimal. Subjects made only a single judgement about whether one masked target word was the same or different than a post-target probe. Confidence ratings permitted use of signal detection methods to assess sensitivity and bias effects. In the critical condition for RB a precue of the post-target word was provided prior to the target stimulus (identity precue), so that the required judgement amounted to whether the target did or did not repeat the precue word. In control treatments, the precue was either an unrelated word or a dummy.

  16. [Repetition Strain Injury

    PubMed

    Ribeiro

    1997-01-01

    Muscular-skeletal disorders of the upper limbs resulting from work involving repetition strain (RSI) are now the most frequent work-related diseases in early or late industrialized countries. The author maintains that in addition to being work-related diseases, RSIs are symbolic illnesses revealing the contradictions and social pathogenesis of the new cycle of development and crisis in capitalist production. Discussing the social and historical dimensions of this process, the author insists that the low efficacy of technical interventions by labor engineering, ergonomics, and clinical medicine in the prevention, early and adequate diagnosis, and treatment of such post-modern illnesses and the difficulty in rehabilitating and reincorporating such workers reflect precisely a broader determination of health and illness, since the appropriation, incorporation, and use of technological innovations and the new forms of work management are defined according to the exclusive interests of capital. Thus, a growing contingent of young workers (mainly females) from different labor categories are losing or under threat of losing their health and work capacity, two essential and closely linked public values. The solution to the SRI issue must be political and collective. PMID:10886940

  17. Ancient intron insertion sites and palindromic genomic duplication evolutionally shapes an elementally functioning membrane protein family

    PubMed Central

    Tanaka-Kunishima, Motoko; Ishida, Yoshihiro; Takahashi, Kunitaro; Honda, Motoo; Oonuma, Takashi

    2007-01-01

    Background In spite of the recent accumulation of genomic data, the evolutionary pathway in the individual genes of present-day living taxa is still elusive for most genes. Among ion channels, inward K+ rectifier (IRK) channels are the fundamental and well-defined protein group. We analyzed the genomic structures of this group and compared them among a phylogenetically wide range with our sequenced Halocynthia roretzi, a tunicate, IRK genomic genes. Results A total of 131 IRK genomic genes were analyzed. The phylogenic trees of amino acid sequences revealed a clear diversification of deuterostomic IRKs from protostomic IRKs and suggested that the tunicate IRKs are possibly representatives of the descendants of ancestor forms of three major groups of IRKs in the vertebrate. However, the exon-intron structures of the tunicate IRK genomes showed considerable similarities to those of Caenorhabditis. In the vertebrate clade, the members in each major group increased at least four times those in the tunicate by various types of global gene duplication. The generation of some major groups was inferred to be due to anti-tandem (palindromic) duplication in early history. The intron insertion points greatly decreased during the evolution of the vertebrates, remaining as a unique conservation of an intron insertion site in the portion of protein-protein interaction within the coding regions of all vertebrate G-protein-activated IRK genes. Conclusion From the genomic survey of a family of IRK genes, it was suggested that the ancient intron insertion sites and the unique palindromic genomic duplication evolutionally shaped this membrane protein family. PMID:17708769

  18. Conformational study of palindromic tripeptides (GPG, IPI and KPK) in HIV-1 protease--a density functional theory study.

    PubMed

    Abiram, A; Kolandaivel, P

    2007-03-01

    A comparative study has been carried out on three palindromic tripeptides Gly-Pro-Gly, Ile-Pro-Ile and Lys-Pro-Lys which were present in HIV protein along with their analogues applying density functional computation at B3LYP/6-31G* level of theory. Discrepancy from the structural analysis has been noted for all the systems and it was found to be more for amide capped structure at the C terminal of proline. The puckering amplitude A and Phase angle P of the pyrrolidine ring of proline in the chosen palindromic tripeptides and their analogues were calculated from the endocyclic torsion angles. The minimum energy conformers lying well within the prescribed region of proline were obtained for the derived compounds from potential energy surface scan mentioning that no role has been played by its terminal residues. This is further supported by the simulated amide bands identifying the helical structure for all three palindromic tripeptides signifying the importance of proline. The molecular properties such as stabilization energy, chemical hardness along with dipole moment were calculated and interpreted. The values of Calpha-H(s) and the peptide backbone N-Calpha-CO for all the selected conformers specify the three palindromic tripeptides to have a symmetrical achiral structure. PMID:17301006

  19. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    ERIC Educational Resources Information Center

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2010-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning…

  20. [Repetitive work and psychosomatic complaints].

    PubMed

    Liebrich, J; Geiger, L; Rupp, M

    1978-08-01

    200 workers of the Swiss watch industry were examined in an interdisciplinary study on the effect of repetitive work on the wellbeing of the worker. Women doing repetitive work with little autonomy complained more often about psychosomatic problems than the male workers doing non-repetitive work. This difference is interpreted as a difference of sexe rather than one of the work situation. However, there is a significant difference in the complaint about nervosity between women being paid monthly and women who were paid by piece or by hour with a premium. PMID:706840

  1. Neural repetition suppression reflects fulfilled perceptual expectations

    PubMed Central

    Summerfield, Christopher; Monti, Jim M.P.; Trittschuh, Emily H.; Mesulam, M.-Marsel; Egner, Tobias

    2009-01-01

    Stimulus-evoked neural activity is attenuated upon stimulus repetition (‘repetition suppression’), a phenomenon attributed to largely automatic processes in sensory neurons. By manipulating the likelihood of stimulus repetition, we show that repetition suppression in the human brain is reduced when stimulus repetitions are improbable (and thus, unexpected). These data suggest that repetition suppression reflects a relative reduction in top-down perceptual ‘prediction error’ when processing an expected compared to an unexpected stimulus. PMID:19160497

  2. Unusual structure of a human middle repetitive DNA

    SciTech Connect

    Ratnasinghe, D.D.

    1993-01-01

    The L2Hs sequences are a polymorphic, interspersed, middle repetitive DNA family unique to human genomes. Genomic fingerprinting indicates that these DNAs vary from one individual to another and between tissues of the same individual. Sequence analysis reveals that they are AT-rich (76%) and contain many unusual sequence arrangements (palindromes, inverted and direct repeats). These sequence properties confer on the L2Hs elements the potential to fold into non-B-form structures, a characteristic of recombination hot spots. To test this hypothesis carbodiimide, osmium tetroxide and S[sub 1] nuclease were used as single-strand specific probes to study a recombinant plasmid, pN6.4.39, containing a single L2Hs segment. Different forms of the plasmid substrate were analyzed, including linear molecules and circular forms of DNA in growing E. coli cells were analyzed. Modified plasmid DNA was analyzed by primer extension in a sequencing-type reaction format. These studies demonstrate that the L2Hs sequences: (1) assume non-B-form structures both in vitro and in vivo, (2) map to predicted cruciform structures, (3) behave as C-type extrusion sequences, and (4) that these unusual DNA structures are dependent on plasmid superhelicity.

  3. Emotional response to musical repetition.

    PubMed

    Livingstone, Steven R; Palmer, Caroline; Schubert, Emery

    2012-06-01

    Two experiments examined the effects of repetition on listeners' emotional response to music. Listeners heard recordings of orchestral music that contained a large section repeated twice. The music had a symmetric phrase structure (same-length phrases) in Experiment 1 and an asymmetric phrase structure (different-length phrases) in Experiment 2, hypothesized to alter the predictability of sensitivity to musical repetition. Continuous measures of arousal and valence were compared across music that contained identical repetition, variation (related), or contrasting (unrelated) structure. Listeners' emotional arousal ratings differed most for contrasting music, moderately for variations, and least for repeating musical segments. A computational model for the detection of repeated musical segments was applied to the listeners' emotional responses. The model detected the locations of phrase boundaries from the emotional responses better than from performed tempo or physical intensity in both experiments. These findings indicate the importance of repetition in listeners' emotional response to music and in the perceptual segmentation of musical structure. PMID:21707165

  4. Repetitively pumped electron beam device

    DOEpatents

    Schlitt, L.G.

    1979-07-24

    Disclosed is an apparatus for producing fast, repetitive pulses of controllable length of an electron beam by phased energy storage in a transmission line of length matched to the number of pulses and specific pulse lengths desired. 12 figs.

  5. Paucity of moderately repetitive sequences

    SciTech Connect

    Schmid, C.W.

    1991-01-01

    We examined clones of renatured repetitive human DNA to find novel repetitive DNAs. After eliminating known repeats, the remaining clones were subjected to sequence analysis. These clones also corresponded to known repeats, but with greater sequence diversity. This indicates that either these libraries were depleted of short interspersed repeats in construction, or these repeats are much less prevalent in the human genome than is indicated by data from {und Xenopus} or sea urchin studies. We directly investigated the sequence composition of human DNA through traditional renaturation techniques with the goal of estimating the limits of abundance of repetitive sequence classes in human DNA. Our results sharply limit the maximum possible abundance to 1--2% of the human genome. Our estimate, minus the known repeats in this fraction, leaves about 1% (3 {times} 10{sup 7} nucleotides) of the human genome for novel repetitive elements. 2 refs. (MHB)

  6. A Perceptual Repetition Blindness Effect

    NASA Technical Reports Server (NTRS)

    Hochhaus, Larry; Johnston, James C.; Null, Cynthia H. (Technical Monitor)

    1994-01-01

    Before concluding Repetition Blindness is a perceptual phenomenon, alternative explanations based on memory retrieval problems and report bias must be rejected. Memory problems were minimized by requiring a judgment about only a single briefly displayed field. Bias and sensitivity effects were empirically measured with an ROC-curve analysis method based on confidence ratings. Results from five experiments support the hypothesis that Repetition Blindness can be a perceptual phenomenon.

  7. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    PubMed

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  8. Correlations in a Mozart's music score (K-73x) with palindromic and upside-down structure

    NASA Astrophysics Data System (ADS)

    Dagdug, Leonardo; Alvarez-Ramirez, Jose; Lopez, Carlos; Moreno, Rodolfo; Hernandez-Lemus, Enrique

    2007-09-01

    In this work, we study long-range correlations in a “Scherzo-Duetto di Mozart” score (K-73x) for two violins. This is a fascinating piece, as the second violin part is upside down on the same sheet below the first violin, and some parts are like a palindrome. Given such ingenious structure, it is expected the existence of long-range correlations in the score structure. In order to quantify long-range correlations, we considered the music score as a sequence of integer numbers, each of them corresponding to last common denominator units of note. By using detrended fluctuation analysis (DFA), correlations are quantified by means of the scaling exponent that reflects the type of correlations for a given distance between neighbors note. The following conclusions can be drawn from the analysis: (a) For about 10-25 neighbor note distances, correlations are similar to 1/f-noise. This is an interesting finding since it has been shown that pleasant sounds for humans display a behavior similar to 1/f noise. (b) As the neighbor note distance increases, the long-range correlations decays continuously. For some score sections, the music score behaves like non-correlated (i.e., purely random) noise. Summing up, the results show that the studied Mozart's score contains a certain degree of correlation for relatively small note distances, and becomes close to non-correlated behavior for long note distances. We considered also the sequence constructed by considering the distance between the simultaneously played notes of the two violins. Interestingly, for relatively small neighbor note distances, a scaling behavior similar to that found for individual violins is also displayed. In some sense, this is an expression of the specific structure (palindromes plus upside down construction) used by Mozart in the composition of this music score. Although we focused on a particular high-art music score, our results suggest that modern methods borrowed from statistical physics can be

  9. Genome-Wide Screen Reveals Replication Pathway for Quasi-Palindrome Fragility Dependent on Homologous Recombination

    PubMed Central

    Zhang, Yu; Saini, Natalie; Sheng, Ziwei; Lobachev, Kirill S.

    2013-01-01

    Inverted repeats capable of forming hairpin and cruciform structures present a threat to chromosomal integrity. They induce double strand breaks, which lead to gross chromosomal rearrangements, the hallmarks of cancers and hereditary diseases. Secondary structure formation at this motif has been proposed to be the driving force for the instability, albeit the mechanisms leading to the fragility are not well-understood. We carried out a genome-wide screen to uncover the genetic players that govern fragility of homologous and homeologous Alu quasi-palindromes in the yeast Saccharomyces cerevisiae. We found that depletion or lack of components of the DNA replication machinery, proteins involved in Fe-S cluster biogenesis, the replication-pausing checkpoint pathway, the telomere maintenance complex or the Sgs1-Top3-Rmi1 dissolvasome augment fragility at Alu-IRs. Rad51, a component of the homologous recombination pathway, was found to be required for replication arrest and breakage at the repeats specifically in replication-deficient strains. These data demonstrate that Rad51 is required for the formation of breakage-prone secondary structures in situations when replication is compromised while another mechanism operates in DSB formation in replication-proficient strains. PMID:24339793

  10. Genome-wide screen reveals replication pathway for quasi-palindrome fragility dependent on homologous recombination.

    PubMed

    Zhang, Yu; Saini, Natalie; Sheng, Ziwei; Lobachev, Kirill S

    2013-01-01

    Inverted repeats capable of forming hairpin and cruciform structures present a threat to chromosomal integrity. They induce double strand breaks, which lead to gross chromosomal rearrangements, the hallmarks of cancers and hereditary diseases. Secondary structure formation at this motif has been proposed to be the driving force for the instability, albeit the mechanisms leading to the fragility are not well-understood. We carried out a genome-wide screen to uncover the genetic players that govern fragility of homologous and homeologous Alu quasi-palindromes in the yeast Saccharomyces cerevisiae. We found that depletion or lack of components of the DNA replication machinery, proteins involved in Fe-S cluster biogenesis, the replication-pausing checkpoint pathway, the telomere maintenance complex or the Sgs1-Top3-Rmi1 dissolvasome augment fragility at Alu-IRs. Rad51, a component of the homologous recombination pathway, was found to be required for replication arrest and breakage at the repeats specifically in replication-deficient strains. These data demonstrate that Rad51 is required for the formation of breakage-prone secondary structures in situations when replication is compromised while another mechanism operates in DSB formation in replication-proficient strains. PMID:24339793

  11. RNA∶DNA hybrids initiate quasi-palindrome-associated mutations in highly transcribed yeast DNA.

    PubMed

    Kim, Nayun; Cho, Jang-Eun; Li, Yue C; Jinks-Robertson, Sue

    2013-11-01

    RNase H enzymes promote genetic stability by degrading aberrant RNA:DNA hybrids and by removing ribonucleotide monophosphates (rNMPs) that are present in duplex DNA. Here, we report that loss of RNase H2 in yeast is associated with mutations that extend identity between the arms of imperfect inverted repeats (quasi-palindromes or QPs), a mutation type generally attributed to a template switch during DNA synthesis. QP events were detected using frameshift-reversion assays and were only observed under conditions of high transcription. In striking contrast to transcription-associated short deletions that also are detected by these assays, QP events do not require Top1 activity. QP mutation rates are strongly affected by the direction of DNA replication and, in contrast to their elevation in the absence of RNase H2, are reduced when RNase H1 is additionally eliminated. Finally, transcription-associated QP events are limited by components of the nucleotide excision repair pathway and are promoted by translesion synthesis DNA polymerases. We suggest that QP mutations reflect either a transcription-associated perturbation of Okazaki-fragment processing, or the use of a nascent transcript to resume replication following a transcription-replication conflict. PMID:24244191

  12. Phylogenetic analysis of heterocystous cyanobacteria (Subsections IV and V) using highly iterated palindromes as molecular markers.

    PubMed

    Singh, Prashant; Kaushik, Manish Singh; Srivastava, Meenakshi; Mishra, Arun Kumar

    2014-07-01

    Highly iterated palindromes (HIP) have been used as high resolution molecular markers for assessing the genetic variability and phylogenetic relatedness of heterocystous cyanobacteria (subsections IV and V) representing 12 genera of heterocystous cyanobacteria, collected from different geographical areas of India. DNA fingerprints generated using four HIP markers viz. HIP-AT, HIP-CA, HIP-GC, and HIP-TG showed 100 % polymorphism in all the heterocystous cyanobacteria studied and each marker produced unique and strain-specific banding pattern. Furthermore, phylogenetic affinities based on the dendrogram constructed using HIP DNA profiles of heterocystous cyanobacteria suggest the monophyletic origin of this entire heterocystous clade along with a clear illustration of the polyphyletic origin of the branched Stigonematalean order (Subsection V). In addition, phylogenetic affinities were validated by principal component analysis of the HIP fingerprints. The overall data obtained by both the phylogeny and principal component assessments proved that the entire heterocystous clade was intermixed, and there are immediate needs for classificatory reforms that satisfy morphological plasticity and environmental concerns. PMID:25049460

  13. Lactobacillus buchneri Genotyping on the Basis of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Locus Diversity

    PubMed Central

    Briner, Alexandra E.

    2014-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) in combination with associated sequences (cas) constitute the CRISPR-Cas immune system, which uptakes DNA from invasive genetic elements as novel “spacers” that provide a genetic record of immunization events. We investigated the potential of CRISPR-based genotyping of Lactobacillus buchneri, a species relevant for commercial silage, bioethanol, and vegetable fermentations. Upon investigating the occurrence and diversity of CRISPR-Cas systems in Lactobacillus buchneri genomes, we observed a ubiquitous occurrence of CRISPR arrays containing a 36-nucleotide (nt) type II-A CRISPR locus adjacent to four cas genes, including the universal cas1 and cas2 genes and the type II signature gene cas9. Comparative analysis of CRISPR spacer content in 26 L. buchneri pickle fermentation isolates associated with spoilage revealed 10 unique locus genotypes that contained between 9 and 29 variable spacers. We observed a set of conserved spacers at the ancestral end, reflecting a common origin, as well as leader-end polymorphisms, reflecting recent divergence. Some of these spacers showed perfect identity with phage sequences, and many spacers showed homology to Lactobacillus plasmid sequences. Following a comparative analysis of sequences immediately flanking protospacers that matched CRISPR spacers, we identified a novel putative protospacer-adjacent motif (PAM), 5′-AAAA-3′. Overall, these findings suggest that type II-A CRISPR-Cas systems are valuable for genotyping of L. buchneri. PMID:24271175

  14. Unintended imitation in nonword repetition.

    PubMed

    Kappes, Juliane; Baumgaertner, Annette; Peschke, Claudia; Ziegler, Wolfram

    2009-12-01

    Verbal repetition is conventionally considered to require motor-reproduction of only the phonologically relevant content of a perceived linguistic stimulus, while imitation of incidental acoustic properties of the stimulus is not an explicit part of this task. Exemplar-based theories of speech processing, however, would predict that imitation beyond linguistic reproduction may occur in word repetition. Five experiments were conducted in which verbal audio-motor translations had to be performed under different conditions. Nonwords varying in phonemic content, in vocal pitch (F(0)), and in speaking style (schwa-syllable expression) were presented. We experimentally varied the factors response delay (repetition vs. shadowing), intention-to-repeat (repetition vs. pseudo-naming), and phonological load (repetition vs. transformation). The responses of ten healthy participants were examined for phonemic accuracy and for traces of para-phonological imitation. Two aphasic patients with phonological impairments were also included, to find out if lesions to left anterior or posterior perisylvian cortex interfere with imitation. In the healthy participants, significant imitation of both F(0) and phonetic style was observed, with markedly stronger effects for the latter. Strong imitation was also found in an aphasic patient with a lesion to left anterior perisylvian cortex, whereas almost no imitation occurred in a patient with a lesion to the posterior language area. The degree of unintended imitation was modulated by each of the three independent factors introduced here. The results are discussed on the background of cognitive and neurolinguistic theories of imitation. PMID:19811813

  15. A novel palindromic triple-stranded structure formed by homopyrimidine dodecamer d-CTTCTCCTCTTC and homopurine hexamer d-GAAGAG.

    PubMed Central

    Bhaumik, S R; Chary, K V; Govil, G; Liu, K; Miles, H T

    1998-01-01

    We have carried out NMR and molecular mechanics studies on a complex formed when a palindromic homopyrimidine dodecamer (d-CTTCTCCTCTTC) and a homopurine hexamer (d-GAAGAG) are mixed in 1:1 molar ratio in aqueous solutions. Such studies unequivocally establish that two strands of each oligomer combine to form a triple-stranded DNA structure with a palindromic symmetry and with six T.A:T and six C+. G:C hydrogen-bonded base triads. The two purine strands are placed head to head, with their 3' ends facing each other in the center of the structure. One-half of each pyrimidine strand contains protonated and the other half contains non-protonated cytosines. The two half segments containing protonated cytosines are hydrogen bonded to each of the two purine hexamers through Hoogsteen T.A and C+.G base pairing. The segments containing non-protonated cytosines are involved in Watson-Crick (A:T and G:C) base pairing. This leads to a palindromic triplex with a C2-dyad symmetry with respect to the center of the structure. The complex is less stable at neutral pH, but the cytosines involved in Hoogsteen base pairing remain protonated even under these conditions. Molecular mechanics calculations using NMR constraints have provided a detailed three-dimensional structure of the complex. The entire stretches of purine, and the pyrimidine nucleotides have a conformation close to B-DNA. PMID:9611244

  16. A 140-Bp-Long Palindromic Sequence Induces Double-Strand Breaks during Meiosis in the Yeast Saccharomyces Cerevisiae

    PubMed Central

    Nag, D. K.; Kurst, A.

    1997-01-01

    Palindromic sequences have the potential to form hairpin or cruciform structures, which are putative substrates for several nucleases and mismatch repair enzymes. A genetic method was developed to detect such structures in vivo in the yeast Saccharomyces cerevisiae. Using this method we previously showed that short hairpin structures are poorly repaired by the mismatch repair system in S. cerevisiae. We show here that mismatches, when present in the stem of the hairpin structure, are not processed by the repair machinery, suggesting that they are treated differently than those in the interstrand base-paired duplex DNA. A 140-bp-long palindromic sequence, on the contrary, acts as a meiotic recombination hotspot by generating a site for a double-strand break, an initiator of meiotic recombination. We suggest that long palindromic sequences undergo cruciform extrusion more readily than short ones. This cruciform structure then acts as a substrate for structure-specific nucleases resulting in the formation of a double-strand break during meiosis in yeast. In addition, we show that residual repair of the short hairpin structure occurs in an MSH2-independent pathway. PMID:9215890

  17. Repetitively pulsed plasma illumination sources

    NASA Astrophysics Data System (ADS)

    Root, Robert G.; Falkos, Paul

    1997-12-01

    The acoustic environment created by turbulence in aircraft flight tests demands that illumination sources for high speed photography of munitions drops be extremely rugged. A repetitive pulsed surface discharge system has been developed to provide wide angle illumination in a bomb bay for photography at 250 - 500 Hertz. The lamp has a simple construction suitable for adverse environments and produces 100 mJ of visible light per pulse. The discharge parameters were selected to minimize the size and complexity of the power supply. The system is also capable of operating at high repetition rates; preliminary tests demonstrated 1000 pulses at 1 kHz, 200 pulses at 1.5 kHz, and 13 pulses at 2 kHz. A simple power supply capable of providing several amperes at 450 V is being completed; it will be used to extend the run times and to explore extensions to higher repetition rate.

  18. Neural Basis of Repetition Priming during Mathematical Cognition: Repetition Suppression or Repetition Enhancement?

    PubMed Central

    Salimpoor, Valorie N.; Chang, Catie; Menon, Vinod

    2015-01-01

    We investigated the neural basis of repetition priming (RP) during mathematical cognition. Previous studies of RP have focused on repetition suppression as the basis of behavioral facilitation, primarily using word and object identification and classification tasks. More recently, researchers have suggested associative stimulus-response learning as an alternate model for behavioral facilitation. We examined the neural basis of RP during mathematical problem solving in the context of these two models of learning. Brain imaging and behavioral data were acquired from 39 adults during novel and repeated presentation of three-operand mathematical equations. Despite widespread decreases in activation during repeat, compared with novel trials, there was no direct relation between behavioral facilitation and the degree of repetition suppression in any brain region. Rather, RT improvements were directly correlated with repetition enhancement in the hippocampus and the postero-medial cortex [posterior cingulate cortex, precuneus, and retro-splenial cortex; Brodmann’s areas (BAs) 23, 7, and 30, respectively], regions known to support memory formation and retrieval, and in the SMA (BA 6) and the dorsal midcingulate (“motor cingulate”) cortex (BA 24d), regions known to be important for motor learning. Furthermore, improvements in RT were also correlated with increased functional connectivity of the hippocampus with both the SMA and the dorsal midcingulate cortex. Our findings provide novel support for the hypothesis that repetition enhancement and associated stimulus-response learning may facilitate behavioral performance during problem solving. PMID:19366289

  19. Polarity of the ecdysone receptor complex interaction with the palindromic response element from the hsp27 gene promoter.

    PubMed

    Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2000-01-01

    The functional 20-hydroxyecdysone (20E) receptor is a heterodimer of two members of the nuclear hormone receptors superfamily; the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. As most of the natural 20E-response elements are highly degenerated palindromes, we were interested in determining whether or not such asymmetric elements could dictate the defined orientation of the Usp/EcR complex. We have investigated interaction of EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) with the palindromic response element from the hsp27 gene promoter (hsp27pal). The hsp27pal half-sites contribute differently to the binding of the heterodimer components; the 5' half-site exhibits higher affinity for both DBDs than the 3' half-site. This observation, along with data demonstrating that UspDBD exhibits approximate fourfold higher affinity to the 5' half-site than EcRDBD, suggest that UspDBD locates the EcRDBD/UspDBD heterocomplex in the defined orientation (5'-UspDBD-EcRDBD-3') on the hsp27pal sequence. The binding polarity onto hsp27pal is accompanied by different contribution of the UspDBD and EcRDBD C-terminal sequences to the DNA-binding and heterocomplex formation. This is supported by finding that deletion of the C-terminal of EcRDBD region corresponding to the putative A-helix severely decreased binding of the EcRDBD to the hsp27pal. In contrast, UspDBD in which corresponding residues were deleted exhibited the same hsp27pal binding pattern as the wild type UspDBD. Additional truncation comprising the putative T-box, resulted in a reduced binding of the mutated UspDBD. This truncation however, still allowed effective EcRDBD/UspDBD heterodimer formation. Finally we demonstrated that perfect palindromes, composed of two hsp27pal 5' half-sites (or of the related sequence) contain all of the structural information necessary for the anisotropic UspDBD/EcRDBD heterocomplex formation. However, the perfect palindromes bind isolated homomeric DBDs

  20. Intrastrand annealing leads to the formation of a large DNA palindrome and determines the boundaries of genomic amplification in human cancer.

    PubMed

    Tanaka, Hisashi; Cao, Yi; Bergstrom, Donald A; Kooperberg, Charles; Tapscott, Stephen J; Yao, Meng-Chao

    2007-03-01

    Amplification of large chromosomal regions (gene amplification) is a common somatic alteration in human cancer cells and often is associated with advanced disease. A critical event initiating gene amplification is a DNA double-strand break (DSB), which is immediately followed by the formation of a large DNA palindrome. Large DNA palindromes are frequent and nonrandomly distributed in the genomes of cancer cells and facilitate a further increase in copy number. Although the importance of the formation of large DNA palindromes as a very early event in gene amplification is widely recognized, it is not known how a DSB is resolved to form a large DNA palindrome and whether any local DNA structure determines the location of large DNA palindromes. We show here that intrastrand annealing following a DNA double-strand break leads to the formation of large DNA palindromes and that DNA inverted repeats in the genome determine the efficiency of this event. Furthermore, in human Colo320DM cancer cells, a DNA inverted repeat in the genome marks the border between amplified and nonamplified DNA. Therefore, an early step of gene amplification is a regulated process that is facilitated by DNA inverted repeats in the genome. PMID:17242211

  1. Insight into Microevolution of Yersinia pestis by Clustered Regularly Interspaced Short Palindromic Repeats

    PubMed Central

    Gorgé, Olivier; Platonov, Mikhail E.; Yan, Yanfeng; Guo, Zhaobiao; Pourcel, Christine; Dentovskaya, Svetlana V.; Balakhonov, Sergey V.; Wang, Xiaoyi; Song, Yajun; Anisimov, Andrey P.; Vergnaud, Gilles; Yang, Ruifu

    2008-01-01

    Background Yersinia pestis, the pathogen of plague, has greatly influenced human history on a global scale. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), an element participating in immunity against phages' invasion, is composed of short repeated sequences separated by unique spacers and provides the basis of the spoligotyping technology. In the present research, three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis. Methodology/Principal Findings Using PCR amplification, sequencing and online data processing, a high degree of genetic diversity was revealed in all three CRISPR elements. The distribution of spacers and their arrays in Y. pestis strains is strongly region and focus-specific, allowing the construction of a hypothetic evolutionary model of Y. pestis. This model suggests transmission route of microtus strains that encircled Takla Makan Desert and ZhunGer Basin. Starting from Tadjikistan, one branch passed through the Kunlun Mountains, and moved to the Qinghai-Tibet Plateau. Another branch went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Other Y. pestis lineages might be originated from certain areas along those routes. Conclusions/significance CRISPR can provide important information for genotyping and evolutionary research of bacteria, which will help to trace the source of outbreaks. The resulting data will make possible the development of very low cost and high-resolution assays for the systematic typing of any new isolate. PMID:18612419

  2. Unintended Imitation in Nonword Repetition

    ERIC Educational Resources Information Center

    Kappes, Juliane; Baumgaertner, Annette; Peschke, Claudia; Ziegler, Wolfram

    2009-01-01

    Verbal repetition is conventionally considered to require motor-reproduction of only the phonologically relevant content of a perceived linguistic stimulus, while imitation of incidental acoustic properties of the stimulus is not an explicit part of this task. Exemplar-based theories of speech processing, however, would predict that imitation…

  3. Constructive and Unconstructive Repetitive Thought

    ERIC Educational Resources Information Center

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive…

  4. Repetitive DNA in eukaryotic genomes.

    PubMed

    Biscotti, Maria Assunta; Olmo, Ettore; Heslop-Harrison, J S Pat

    2015-09-01

    Repetitive DNA--sequence motifs repeated hundreds or thousands of times in the genome--makes up the major proportion of all the nuclear DNA in most eukaryotic genomes. However, the significance of repetitive DNA in the genome is not completely understood, and it has been considered to have both structural and functional roles, or perhaps even no essential role. High-throughput DNA sequencing reveals huge numbers of repetitive sequences. Most bioinformatic studies focus on low-copy DNA including genes, and hence, the analyses collapse repeats in assemblies presenting only one or a few copies, often masking out and ignoring them in both DNA and RNA read data. Chromosomal studies are proving vital to examine the distribution and evolution of sequences because of the challenges of analysis of sequence data. Many questions are open about the origin, evolutionary mode and functions that repetitive sequences might have in the genome. Some, the satellite DNAs, are present in long arrays of similar motifs at a small number of sites, while others, particularly the transposable elements (DNA transposons and retrotranposons), are dispersed over regions of the genome; in both cases, sequence motifs may be located at relatively specific chromosome domains such as centromeres or subtelomeric regions. Here, we overview a range of works involving detailed characterization of the nature of all types of repetitive sequences, in particular their organization, abundance, chromosome localization, variation in sequence within and between chromosomes, and, importantly, the investigation of their transcription or expression activity. Comparison of the nature and locations of sequences between more, and less, related species is providing extensive information about their evolution and amplification. Some repetitive sequences are extremely well conserved between species, while others are among the most variable, defining differences between even closely relative species. These data suggest

  5. A versatile palindromic amphipathic repeat coding sequence horizontally distributed among diverse bacterial and eucaryotic microbes

    PubMed Central

    2010-01-01

    HGT and intra-genomic shuffling. Conclusions We describe novel features of PARCELs (Palindromic Amphipathic Repeat Coding ELements), a set of widely distributed repeat protein domains and coding sequences that were likely acquired through HGT by diverse unicellular microbes, further mobilized and diversified within genomes, and co-opted for expression in the membrane proteome of some taxa. Disseminated by multiple gene-centric vehicles, ORFs harboring these elements enhance accessory gene pools as part of the "mobilome" connecting genomes of various clades, in taxa sharing common niches. PMID:20626840

  6. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  7. Characterization of highly and moderately repetitive 500 bp Eco RI fragments from Xenopus laevis DNA.

    PubMed Central

    Hummel, S; Meyerhof, W; Korge, E; Knöchel, W

    1984-01-01

    Three different types of repetitive Eco RI fragments, which comigrate within a visible band of approximately 500 bp at gel electrophoresis of Xenopus laevis DNA Eco RI digests have been cloned and sequenced. These sequences are designated as Repetitive Eco RI Monomers: REM 1, REM 2 and REM 3. The sequences contain direct repeats, inverted repeats and palindromic elements. Genomic organization of the most abundant sequence (REM 1; 0.4% of total DNA) is that of an interspersed sequence. REM 2 (0.08%) is partly organized as an interspersed element and partly found in tandem arrangement, whereas REM 3 (0.02%) represents the tandemly repeated monomeric unit of a satellite DNA. In situ hybridization has shown that REM 1 and REM 2 sequences are found on most chromosomes, REM 1 being preferentially located on specific chromosomal loci. REM 3 is located near the centromere region of only one chromosome pair (presumably number 1). Hybridization of Northern blots from RNAs of different developmental stages revealed that REM 1, REM 2 and REM 3 sequences are transcribed and that transcription is under developmental control. Images PMID:6330690

  8. Using a color-coded ambigraphic nucleic acid notation to visualize conserved palindromic motifs within and across genomes

    PubMed Central

    2014-01-01

    Background Ambiscript is a graphically-designed nucleic acid notation that uses symbol symmetries to support sequence complementation, highlight biologically-relevant palindromes, and facilitate the analysis of consensus sequences. Although the original Ambiscript notation was designed to easily represent consensus sequences for multiple sequence alignments, the notation’s black-on-white ambiguity characters are unable to reflect the statistical distribution of nucleotides found at each position. We now propose a color-augmented ambigraphic notation to encode the frequency of positional polymorphisms in these consensus sequences. Results We have implemented this color-coding approach by creating an Adobe Flash® application ( http://www.ambiscript.org) that shades and colors modified Ambiscript characters according to the prevalence of the encoded nucleotide at each position in the alignment. The resulting graphic helps viewers perceive biologically-relevant patterns in multiple sequence alignments by uniquely combining color, shading, and character symmetries to highlight palindromes and inverted repeats in conserved DNA motifs. Conclusion Juxtaposing an intuitive color scheme over the deliberate character symmetries of an ambigraphic nucleic acid notation yields a highly-functional nucleic acid notation that maximizes information content and successfully embodies key principles of graphic excellence put forth by the statistician and graphic design theorist, Edward Tufte. PMID:24447494

  9. Circuit considerations for repetitive railguns

    SciTech Connect

    Honih, E.M.

    1986-01-01

    Railgun electromagnetic launchers have significant military and scientific potential. They provide direct conversion of electrical energy to projectile kinetic energy, and they offer the hope of achieving projectile velocities greatly exceeding the limits of conventional guns. With over 10 km/sec already demonstrated, railguns are attracting attention for tactical and strategic weapons systems and for scientific equation-of-state research. The full utilization of railguns will require significant improvements in every aspect of system design - projectile, barrel, and power source - to achieve operation on a large scale. This paper will review fundamental aspects of railguns, with emphasis on circuit considerations and repetitive operation.

  10. Neuroimaging in repetitive brain trauma

    PubMed Central

    2014-01-01

    Sports-related concussions are one of the major causes of mild traumatic brain injury. Although most patients recover completely within days to weeks, those who experience repetitive brain trauma (RBT) may be at risk for developing a condition known as chronic traumatic encephalopathy (CTE). While this condition is most commonly observed in athletes who experience repetitive concussive and/or subconcussive blows to the head, such as boxers, football players, or hockey players, CTE may also affect soldiers on active duty. Currently, the only means by which to diagnose CTE is by the presence of phosphorylated tau aggregations post-mortem. Non-invasive neuroimaging, however, may allow early diagnosis as well as improve our understanding of the underlying pathophysiology of RBT. The purpose of this article is to review advanced neuroimaging methods used to investigate RBT, including diffusion tensor imaging, magnetic resonance spectroscopy, functional magnetic resonance imaging, susceptibility weighted imaging, and positron emission tomography. While there is a considerable literature using these methods in brain injury in general, the focus of this review is on RBT and those subject populations currently known to be susceptible to RBT, namely athletes and soldiers. Further, while direct detection of CTE in vivo has not yet been achieved, all of the methods described in this review provide insight into RBT and will likely lead to a better characterization (diagnosis), in vivo, of CTE than measures of self-report. PMID:25031630

  11. Modeling repetitive, non-globular proteins.

    PubMed

    Basu, Koli; Campbell, Robert L; Guo, Shuaiqi; Sun, Tianjun; Davies, Peter L

    2016-05-01

    While ab initio modeling of protein structures is not routine, certain types of proteins are more straightforward to model than others. Proteins with short repetitive sequences typically exhibit repetitive structures. These repetitive sequences can be more amenable to modeling if some information is known about the predominant secondary structure or other key features of the protein sequence. We have successfully built models of a number of repetitive structures with novel folds using knowledge of the consensus sequence within the sequence repeat and an understanding of the likely secondary structures that these may adopt. Our methods for achieving this success are reviewed here. PMID:26914323

  12. Constructive and Unconstructive Repetitive Thought

    PubMed Central

    Watkins, Edward R.

    2008-01-01

    The author reviews research showing that repetitive thought (RT) can have constructive or unconstructive consequences. The main unconstructive consequences of RT are (a) depression, (b) anxiety, and (c) difficulties in physical health. The main constructive consequences of RT are (a) recovery from upsetting and traumatic events, (b) adaptive preparation and anticipatory planning, (c) recovery from depression, and (d) uptake of health-promoting behaviors. Several potential principles accounting for these distinct consequences of RT are identified within this review: (a) the valence of thought content, (b) the intrapersonal and situational context in which RT occurs, and (c) the level of construal (abstract vs. concrete processing) adopted during RT. Of the existing models of RT, it is proposed that an elaborated version of the control theory account provides the best theoretical framework to account for its distinct consequences. PMID:18298268

  13. Pressure rig for repetitive casting

    NASA Technical Reports Server (NTRS)

    Vasquez, Peter (Inventor); Hutto, William R. (Inventor); Philips, Albert R. (Inventor)

    1989-01-01

    The invention is a pressure rig for repetitive casting of metal. The pressure rig performs like a piston for feeding molten metal into a mold. Pressure is applied to an expandable rubber diaphragm which expands like a balloon to force the metal into the mold. A ceramic cavity which holds molten metal is lined with blanket-type insulating material, necessitating only a relining for subsequent use and eliminating the lengthy cavity preparation inherent in previous rigs. In addition, the expandable rubber diaphragm is protected by the insulating material thereby decreasing its vulnerability to heat damage. As a result of the improved design the life expectancy of the pressure rig contemplated by the present invention is more than doubled. Moreover, the improved heat protection has allowed the casting of brass and other alloys with higher melting temperatures than possible in the conventional pressure rigs.

  14. Information Density and Syntactic Repetition.

    PubMed

    Temperley, David; Gildea, Daniel

    2015-11-01

    In noun phrase (NP) coordinate constructions (e.g., NP and NP), there is a strong tendency for the syntactic structure of the second conjunct to match that of the first; the second conjunct in such constructions is therefore low in syntactic information. The theory of uniform information density predicts that low-information syntactic constructions will be counterbalanced by high information in other aspects of that part of the sentence, and high-information constructions will be counterbalanced by other low-information components. Three predictions follow: (a) lexical probabilities (measured by N-gram probabilities and head-dependent probabilities) will be lower in second conjuncts than first conjuncts; (b) lexical probabilities will be lower in matching second conjuncts (those whose syntactic expansions match the first conjunct) than nonmatching ones; and (c) syntactic repetition should be especially common for low-frequency NP expansions. Corpus analysis provides support for all three of these predictions. PMID:25557056

  15. The transcriptional regulator Hap1p (Cyp1p) is essential for anaerobic or heme-deficient growth of Saccharomyces cerevisiae: Genetic and molecular characterization of an extragenic suppressor that encodes a WD repeat protein.

    PubMed Central

    Chantrel, Y; Gaisne, M; Lions, C; Verdière, J

    1998-01-01

    We report here that Hap1p (originally named Cyp1p) has an essential function in anaerobic or heme-deficient growth. Analysis of intragenic revertants shows that this function depends on the amino acid preceding the first cysteine residue of the DNA-binding domain of Hap1p. Selection of recessive extragenic suppressors of a hap1-hem1- strain allowed the identification, cloning, and molecular analysis of ASC1 (Cyp1 Absence of growth Supressor). The sequence of ASC1 reveals that its ORF is interrupted by an intron that shelters the U24 snoRNA. Deletion of the intron, inactivation of the ORF, and molecular localization of the mutations show unambiguously that it is the protein and not the snoRNA that is involved in the suppressor phenotype. ASC1, which is constitutively transcribed, encodes an abundant, cytoplasmically localized 35-kD protein that belongs to the WD repeat family, which is found in a large variety of eucaryotic organisms. Polysome profile analysis supports the involvement of this protein in translation. We propose that the absence of functional Asc1p allows the growth of hap1-hem1- cells by reducing the efficiency of translation. Based on sequence comparisons, we discuss the possibility that the protein intervenes in a kinase-dependent signal transduction pathway involved in this last function. PMID:9504906

  16. Numerical taxonomy of the genus Pestivirus: new software for genotyping based on the palindromic nucleotide substitutions method.

    PubMed

    Giangaspero, Massimo; Apicella, Claudio; Harasawa, Ryô

    2013-09-01

    The genus Pestivirus from the family Flaviviridae is represented by four established species; Bovine viral diarrhea virus 1 (BVDV-1); Bovine viral diarrhea virus 2 (BVDV-2); Border disease virus (BDV); and Classical swine fever virus (CSFV); as well a tentative species from a Giraffe. The palindromic nucleotide substitutions (PNS) in the 5' untranslated region (UTR) of Pestivirus RNA has been described as a new, simple and practical method for genotyping. New software is described, also named PNS, that was prepared specifically for this PNS genotyping procedure. Pestivirus identification using PNS was evaluated on five hundred and forty-three sequences at genus, species and genotype level using this software. The software is freely available at www.pns-software.com. PMID:23684846

  17. Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

    SciTech Connect

    R Jauch; S Choo; C Ng; P Kolatkar

    2011-12-31

    POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternative configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.

  18. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    ERIC Educational Resources Information Center

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2009-01-01

    Purpose: Conceptual and methodological confounds occur when non(sense) word repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. In this article, the authors (a) describe a nonword repetition task, the Syllable Repetition Task…

  19. Socio-Economic Status Affects Sentence Repetition, but Not Non-Word Repetition, in Chilean Preschoolers

    ERIC Educational Resources Information Center

    Balladares, Jaime; Marshall, Chloë; Griffiths, Yvonne

    2016-01-01

    Sentence repetition and non-word repetition tests are widely used measures of language processing which are sensitive to language ability. Surprisingly little previous work has investigated whether children's socio-economic status (SES) affects their sentence and non-word repetition accuracy. This study investigates sentence and non-word…

  20. Serial Position Effects in Nonword Repetition

    ERIC Educational Resources Information Center

    Gupta, P.; Lipinski, J.; Abbs, B.; Lin, P.H.

    2005-01-01

    A growing body of research has emphasized the linkage between performance in immediate serial recall of lists, nonword repetition, and word learning. Recently, it has been reported that primacy and recency effects are obtained in repetition of individual syllables within nonwords (Gupta, in press). Five experiments examined whether such…

  1. Repetition priming results in sensitivity attenuation

    PubMed Central

    Allenmark, Fredrik; Hsu, Yi-Fang; Roussel, Cedric; Waszak, Florian

    2015-01-01

    Repetition priming refers to the change in the ability to perform a task on a stimulus as a consequence of a former encounter with that very same item. Usually, repetition results in faster and more accurate performance. In the present study, we used a contrast discrimination protocol to assess perceptual sensitivity and response bias of Gabor gratings that are either repeated (same orientation) or alternated (different orientation). We observed that contrast discrimination performance is worse, not better, for repeated than for alternated stimuli. In a second experiment, we varied the probability of stimulus repetition, thus testing whether the repetition effect is due to bottom-up or top-down factors. We found that it is top-down expectation that determines the effect. We discuss the implication of these findings for repetition priming and related phenomena as sensory attenuation. This article is part of a Special Issue entitled SI: Prediction and Attention. PMID:25819554

  2. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Z.; Falkowski, P.

    1997-02-11

    A fast repetition rate (FRR) flasher is described suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz. 14 figs.

  3. Fast repetition rate (FRR) flasher

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1997-02-11

    A fast repetition rate (FRR) flasher suitable for high flash photolysis including kinetic chemical and biological analysis. The flasher includes a power supply, a discharge capacitor operably connected to be charged by the power supply, and a flash lamp for producing a series of flashes in response to discharge of the discharge capacitor. A triggering circuit operably connected to the flash lamp initially ionizes the flash lamp. A current switch is operably connected between the flash lamp and the discharge capacitor. The current switch has at least one insulated gate bipolar transistor for switching current that is operable to initiate a controllable discharge of the discharge capacitor through the flash lamp. Control means connected to the current switch for controlling the rate of discharge of the discharge capacitor thereby to effectively keep the flash lamp in an ionized state between Successive discharges of the discharge capacitor. Advantageously, the control means is operable to discharge the discharge capacitor at a rate greater than 10,000 Hz and even up to a rate greater than about 250,000 Hz.

  4. Strategies for Using Repetition as a Powerful Teaching Tool

    ERIC Educational Resources Information Center

    Saville, Kirt

    2011-01-01

    Brain research indicates that repetition is of vital importance in the learning process. Repetition is an especially useful tool in the area of music education. The success of repetition can be enhanced by accurate and timely feedback. From "simple repetition" to "repetition with the addition or subtraction of degrees of freedom," there are many…

  5. Cross-modal nonspatial repetition inhibition.

    PubMed

    Wang, Lihui; Yue, Zhenzhu; Chen, Qi

    2012-07-01

    Although it has been well documented that the spatial inhibitory effect induced by repetition of location (i.e., spatial inhibition of return, or IOR) occurs cross-modally, we do not yet know whether nonspatial (e.g., color-based) repetition-induced inhibition occurs in a cross-modal fashion as well. In the present study, a novel cross-modal paradigm with regard to color-based repetition was adopted. An intervening neutral cue, whose semantic identity was different from those of both the prime and the target, was introduced between the prime and the target in a repetition-priming task. The modalities of the prime, the neutral cue, and the target could be either visual or auditory, and the prime and the target could refer either to the same or to different semantic identities. By adopting this paradigm, we aimed to answer two questions: (1) What are the specific conditions under which cross-modal semantic-based repetition inhibition occurs? (2) Are the representations inhibited in the semantic-based repetition inhibition effect supramodal or modality-specific? Our results suggested that semantic-based repetition inhibition occurs only when the prime and the neutral cue are from the same sensory modality, and it occurs irrespective of whether the modality of the target is cued and irrespective of whether the modality of the target is auditory or visual. Taken together, our results suggest that the occurrence of cross-modal nonspatial repetition inhibition is conditional and that the nonspatial representations inhibited by the repetition inhibition are supramodal. PMID:22415447

  6. Not all repetition is alike: different benefits of repetition in amnesia and normal memory.

    PubMed

    Verfaellie, Mieke; Rajaram, Suparna; Fossum, Karen; Williams, Lisa

    2008-05-01

    While it is well known that repetition can enhance memory in amnesia, little is known about which forms of repetition are most beneficial. This study compared the effect on recognition memory of repetition of words in the same semantic context and in varied semantic contexts. To gain insight into the mechanisms by which these forms of repetition affect performance, participants were asked to make Remember/Know judgments during recognition. These judgments were used to make inferences about the contribution of recollection and familiarity to performance. For individuals with intact memory, the two forms of repetition were equally beneficial to overall recognition, and were associated with both enhanced Remember and Know responses. However, varied repetition was associated with a higher likelihood of Remember responses than was fixed repetition. The two forms of repetition also conferred equivalent benefits on overall recognition in amnesia, but in both cases, this enhancement was manifest exclusively in enhanced Know responses. We conclude that the repetition of information, and especially repetition in varied contexts, enhances recollection in individuals with intact memory, but exclusively affects familiarity in patients with severe amnesia. PMID:18419835

  7. Developmental Norms for the Sentence Repetition Test.

    ERIC Educational Resources Information Center

    Carmichael, John A.; MacDonald, John W.

    1984-01-01

    Obtained developmental norms for the Sentence Repetition Test from children (N=1,081) ranging in age from three to 13 years. Utilized a substanially larger number of children in each age group than previous reports. (Author/LLL)

  8. Repetitive sequence environment distinguishes housekeeping genes

    PubMed Central

    Eller, C. Daniel; Regelson, Moira; Merriman, Barry; Nelson, Stan; Horvath, Steve; Marahrens, York

    2007-01-01

    Housekeeping genes are expressed across a wide variety of tissues. Since repetitive sequences have been reported to influence the expression of individual genes, we employed a novel approach to determine whether housekeeping genes can be distinguished from tissue-specific genes their repetitive sequence context. We show that Alu elements are more highly concentrated around housekeeping genes while various longer (>400-bp) repetitive sequences ("repeats"), including Long Interspersed Nuclear Element 1 (LINE-1) elements, are excluded from these regions. We further show that isochore membership does not distinguish housekeeping genes from tissue-specific genes and that repetitive sequence environment distinguishes housekeeping genes from tissue-specific genes in every isochore. The distinct repetitive sequence environment, in combination with other previously published sequence properties of housekeeping genes, were used to develop a method of predicting housekeeping genes on the basis of DNA sequence alone. Using expression across tissue types as a measure of success, we demonstrate that repetitive sequence environment is by far the most important sequence feature identified to date for distinguishing housekeeping genes. PMID:17141428

  9. Compact, repetitive, 6. 5 kilojoule Marx generator

    SciTech Connect

    Lancaster, K.T.; Clark, R.S.; Buttram, M.T.

    1988-01-01

    Repetitive Marx generator technology developed has been actively pursued for many years at Sandia National Laboratories. Four repetitive Marx generators with voltages to 1 MV, energies to 20 kJ and repetition rates to 50 Hz have been built, tested, and used in on-line experiments. These devices have proven to be reliable pulsed power energy sources. The 440 kV, 6 kJ, 1 Hz Marx generator in this report was designed using this existing technology base. The repetitive Marx generator is an attractive power source for many applications for a variety of reasons. Circuit-wise a Marx is simple, being essentially a capacitor and inductor in series. This permits its use in a variety of configurations ranging from a pulse-forming line charger to an element of a pulse-forming network. At slow repetition rates (1 Hz to 10 Hz) Marx generators can be fabricated almost entirely from commercial components making them both inexpensive and quick to build. Generally they can be easily reconfigured as requirements change, making them a flexible laboratory tool. When designed conservatively, they are also useful for some commercial applications outside the laboratory. In this paper we illustrate the latter point by discussing the design and development of a compact field-transportable, repetitive Marx generator that was designed and built in three months. The authors also review the options considered before choosing the Marx design, and the use of commercially-available hardware in the Marx generator's construction.

  10. Use of a small palindrome genetic marker to investigate mechanisms of double-strand-break repair in mammalian cells.

    PubMed Central

    Li, J; Baker, M D

    2000-01-01

    We examined mechanisms of mammalian homologous recombination using a gene targeting assay in which the vector-borne region of homology to the chromosome bore small palindrome insertions that frequently escape mismatch repair when encompassed within heteroduplex DNA (hDNA). Our assay permitted the product(s) of each independent recombination event to be recovered for molecular analysis. The results revealed the following: (i) vector-borne double-strand break (DSB) processing usually did not yield a large double-strand gap (DSG); (ii) in 43% of the recombinants, the results were consistent with crossover at or near the DSB; and (iii) in the remaining recombinants, hDNA was an intermediate. The sectored (mixed) genotypes observed in 38% of the recombinants provided direct evidence for involvement of hDNA, while indirect evidence was obtained from the patterns of mismatch repair (MMR). Individual hDNA tracts were either long or short and asymmetric or symmetric on the one side of the DSB examined. Clonal analysis of the sectored recombinants revealed how vector-borne and chromosomal markers were linked in each strand of individual hDNA intermediates. As expected, vector-borne and chromosomal markers usually resided on opposite strands. However, in one recombinant, they were linked on the same strand. The results are discussed with particular reference to the double-strand-break repair (DSBR) model of recombination. PMID:10757769

  11. Clustered Regularly Interspaced Short Palindromic Repeats Are emm Type-Specific in Highly Prevalent Group A Streptococci

    PubMed Central

    Zheng, Po-Xing; Chan, Yuen-Chi; Chiou, Chien-Shun; Chiang-Ni, Chuan; Wang, Shu-Ying; Tsai, Pei-Jane; Chuang, Woei-Jer; Lin, Yee-Shin; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2015-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) are the bacterial adaptive immune system against foreign nucleic acids. Given the variable nature of CRISPR, it could be a good marker for molecular epidemiology. Group A streptococcus is one of the major human pathogens. It has two CRISPR loci, including CRISPR01 and CRISPR02. The aim of this study was to analyze the distribution of CRISPR-associated gene cassettes (cas) and CRISPR arrays in highly prevalent emm types. The cas cassette and CRISPR array in two CRISPR loci were analyzed in a total of 332 strains, including emm1, emm3, emm4, emm12, and emm28 strains. The CRISPR type was defined by the spacer content of each CRISPR array. All strains had at least one cas cassette or CRISPR array. More than 90% of the spacers were found in one emm type, specifically. Comparing the consistency between emm and CRISPR types by Simpson’s index of diversity and the adjusted Wallace coefficient, CRISPR01 type was concordant to emm type, and CRISPR02 showed unidirectional congruence to emm type, suggesting that at least for the majority of isolates causing infection in high income countries, the emm type can be inferred from CRISPR analysis, which can further discriminate isolates sharing the same emm type. PMID:26710228

  12. A Novel Family of Sequence-specific Endoribonucleases Associated with the Clustered Regularly Interspaced Short Palindromic Repeats

    SciTech Connect

    Beloglazova, Natalia; Brown, Greg; Zimmerman, Matthew D.; Proudfoot, Michael; Makarova, Kira S.; Kudritska, Marina; Kochinyan, Samvel; Wang, Shuren; Chruszcz, Maksymilian; Minor, Wladek; Koonin, Eugene V.; Edwards, Aled M.; Savchenko, Alexei; Yakunin, Alexander F.

    2008-07-28

    Clustered regularly interspaced short palindromic repeats (CRISPRs) together with the associated CAS proteins protect microbial cells from invasion by foreign genetic elements using presently unknown molecular mechanisms. All CRISPR systems contain proteins of the CAS2 family, suggesting that these uncharacterized proteins play a central role in this process. Here we show that the CAS2 proteins represent a novel family of endoribonucleases. Six purified CAS2 proteins from diverse organisms cleaved single-stranded RNAs preferentially within U-rich regions. A representative CAS2 enzyme, SSO1404 from Sulfolobus solfataricus, cleaved the phosphodiester linkage on the 3'-side and generated 5'-phosphate- and 3'-hydroxyl-terminated oligonucleotides. The crystal structure of SSO1404 was solved at 1.6{angstrom} resolution revealing the first ribonuclease with a ferredoxin-like fold. Mutagenesis of SSO1404 identified six residues (Tyr-9, Asp-10, Arg-17, Arg-19, Arg-31, and Phe-37) that are important for enzymatic activity and suggested that Asp-10 might be the principal catalytic residue. Thus, CAS2 proteins are sequence-specific endoribonucleases, and we propose that their role in the CRISPR-mediated anti-phage defense might involve degradation of phage or cellular mRNAs.

  13. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System*

    PubMed Central

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-01-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

  14. Gene Repression in Haloarchaea Using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-Cas I-B System.

    PubMed

    Stachler, Aris-Edda; Marchfelder, Anita

    2016-07-15

    The clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system is used by bacteria and archaea to fend off foreign genetic elements. Since its discovery it has been developed into numerous applications like genome editing and regulation of transcription in eukaryotes and bacteria. For archaea currently no tools for transcriptional repression exist. Because molecular biology analyses in archaea become more and more widespread such a tool is vital for investigating the biological function of essential genes in archaea. Here we use the model archaeon Haloferax volcanii to demonstrate that its endogenous CRISPR-Cas system I-B can be harnessed to repress gene expression in archaea. Deletion of cas3 and cas6b genes results in efficient repression of transcription. crRNAs targeting the promoter region reduced transcript levels down to 8%. crRNAs targeting the reading frame have only slight impact on transcription. crRNAs that target the coding strand repress expression only down to 88%, whereas crRNAs targeting the template strand repress expression down to 8%. Repression of an essential gene results in reduction of transcription levels down to 22%. Targeting efficiencies can be enhanced by expressing a catalytically inactive Cas3 mutant. Genes can be targeted on plasmids or on the chromosome, they can be monocistronic or part of a polycistronic operon. PMID:27226589

  15. Transposases are responsible for the target specificity of IS1397 and ISKpn1 for two different types of palindromic units (PUs).

    PubMed

    Wilde, Caroline; Escartin, Frédéric; Kokeguchi, Susumu; Latour-Lambert, Patricia; Lectard, Aude; Clément, Jean-Marie

    2003-08-01

    Insertion sequences (IS)1397 and ISKpn1, found in Escherichia coli and Klebsiella pneumoniae, respectively, are IS3 family members that insert specifically into short palindromic repeated sequences (palindromic units or PUs). In this paper, we first show that although PUs are naturally absent from extrachromosomal elements, both ISs are able to transpose from the chromosome or from a plasmid into PUs artificially introduced into target plasmids. We also show that ISKpn1 target specificity is restricted to K.pneumoniae Z1 PU type, whereas IS1397 target specificity is less stringent since the IS targets the three E.coli Y, Z1 and Z2 PU types indifferently. Experiments of transposition of both ISs driven by both transposases demonstrate that the inverted repeats flanking the ISs are not responsible for this target specificity, which is entirely due to the transposase itself. Implications on ISs evolution are presented. PMID:12888493

  16. The Prevalence and Phenomenology of Repetitive Behavior in Genetic Syndromes

    ERIC Educational Resources Information Center

    Moss, Joanna; Oliver, Chris; Arron, Kate; Burbidge, Cheryl; Berg, Katy

    2009-01-01

    We investigated the prevalence and phenomenology of repetitive behavior in genetic syndromes to detail profiles of behavior. The Repetitive Behaviour Questionnaire (RBQ) provides fine-grained identification of repetitive behaviors. The RBQ was employed to examine repetitive behavior in Angelman (N = 104), Cornelia de Lange (N = 101), Cri-du-Chat…

  17. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  18. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  19. 21 CFR 882.5805 - Repetitive transcranial magnetic stimulation system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Repetitive transcranial magnetic stimulation....5805 Repetitive transcranial magnetic stimulation system. (a) Identification. A repetitive transcranial magnetic stimulation system is an external device that delivers transcranial repetitive pulsed...

  20. Manipulating Articulatory Demands in Non-Word Repetition: A "Late-8" Non-Word Repetition Task

    ERIC Educational Resources Information Center

    Moore, Michelle W.; Tompkins, Connie A.; Dollaghan, Christine A.

    2010-01-01

    The purpose of this paper was to examine the psychometric properties of a non-word repetition task (NRT), the Late-8 Non-word Repetition Task (L8NRT). This task was designed similarly to the NRT, but contains only Late-8 consonants to increase articulatory demands and avoid ceiling effects in studies with adolescents and adults. Thirty college…

  1. Repetition Priming and Repetition Suppression: A Case for Enhanced Efficiency Through Neural Synchronization

    PubMed Central

    Gotts, Stephen J.; Chow, Carson C.; Martin, Alex

    2012-01-01

    Stimulus repetition in identification tasks leads to improved behavioral performance ("repetition priming") but attenuated neural responses ("repetition suppression") throughout task-engaged cortical regions. While it's clear that this pervasive brain-behavior relationship reflects some form of improved processing efficiency, the exact form that it takes remains elusive. In this Discussion Paper, we review four different theoretical proposals that have the potential to link repetition suppression and priming, with a particular focus on a proposal that stimulus repetition affects improved efficiency through enhanced neural synchronization. We argue that despite exciting recent work on the role of neural synchronization in cognitive processes such as attention and perception, similar studies in the domain of learning and memory - and priming, in particular - have been lacking. We emphasize the need for new studies with adequate spatiotemporal resolution, formulate several novel predictions, and discuss our ongoing efforts to disentangle the current proposals. PMID:23144664

  2. Matriculation Research Report: Course Repetition Data & Analysis.

    ERIC Educational Resources Information Center

    Gerda, Joe

    Due to concerns that its policy on class repetition was not promoting student success, California's College of the Canyons (CoC) undertook a project to analyze student course-taking patterns and make recommendations to modify the policy. Existing college policy did not follow Section 58161 of the State Educational Code that allows colleges to…

  3. Using Repetition to Make Ideas Stick

    ERIC Educational Resources Information Center

    Lykins, Alicia N.

    2015-01-01

    In elementary school, the use of repetitive songs to help children remember concepts is commonplace and is usually very effective. Unfortunately for many students, this strategy is generally not used in later grades. A group of mathematics teachers at Westerville South High School in Westerville, Ohio, have taken this approach to a new creative…

  4. Repetition effects in human ERPs to faces.

    PubMed

    Schweinberger, Stefan R; Neumann, Markus F

    2016-07-01

    In the present paper, we review research conducted over the past 25 years addressing the effects of repeating various kinds of information in faces (e.g., pictorial, spatial configural, identity, semantic) on different components in human event-related brain potentials (ERPs). This body of evidence suggests that several ERP components are systematically linked to different functional components of face identity processing. Specifically, we argue (1) that repetition of the category of faces (categorical adaptation) strongly affects the occipitotemporal N170 amplitude, which is systematically suppressed when a face is preceded by another face, irrespective of its identity, whereas (2) the prototypicality of a face's second order spatial configuration has a prominent effect on the subsequent occipitotemporal P200. Longer-latency repetition effects are related to the processing of individual facial identities. These include (3) an ERP correlate of the transient activation of individual representations of repeated faces in the form of an enhanced occipitotemporal N250r as seen in repetition priming experiments, and (4) a correlate of the acquisition of individual face identity representations during learning as seen in a topographically similar long-lasting N250 effect. Finally, (5) the repetition of semantic information in familiar person recognition elicits a central-parietal N400 ERP effect. We hope that this overview will encourage researchers to further exploit the potential of ERPs to provide a continuous time window to neuronal correlates of multiple processes in face perception under comparatively natural viewing conditions. PMID:26672902

  5. FRB repetition and non-Poissonian statistics

    NASA Astrophysics Data System (ADS)

    Connor, Liam; Pen, Ue-Li; Oppermann, Niels

    2016-05-01

    We discuss some of the claims that have been made regarding the statistics of fast radio bursts (FRBs). In an earlier Letter, we conjectured that flicker noise associated with FRB repetition could show up in non-cataclysmic neutron star emission models, like supergiant pulses. We show how the current limits of repetition would be significantly weakened if their repeat rate really were non-Poissonian and had a pink or red spectrum. Repetition and its statistics have implications for observing strategy, generally favouring shallow wide-field surveys, since in the non-repeating scenario survey depth is unimportant. We also discuss the statistics of the apparent latitudinal dependence of FRBs, and offer a simple method for calculating the significance of this effect. We provide a generalized Bayesian framework for addressing this problem, which allows for direct model comparison. It is shown how the evidence for a steep latitudinal gradient of the FRB rate is less strong than initially suggested and simple explanations like increased scattering and sky temperature in the plane are sufficient to decrease the low-latitude burst rate, given current data. The reported dearth of bursts near the plane is further complicated if FRBs have non-Poissonian repetition, since in that case the event rate inferred from observation depends on observing strategy.

  6. Pressure wave charged repetitively pulsed gas laser

    DOEpatents

    Kulkarny, Vijay A.

    1982-01-01

    A repetitively pulsed gas laser in which a system of mechanical shutters bracketing the laser cavity manipulate pressure waves resulting from residual energy in the cavity gas following a lasing event so as to draw fresh gas into the cavity and effectively pump spent gas in a dynamic closed loop.

  7. Sentence Repetition: What Does the Task Measure?

    ERIC Educational Resources Information Center

    Polišenská, Kamila; Chiat, Shula; Roy, Penny

    2015-01-01

    Background: Sentence repetition is gaining increasing attention as a source of information about children's sentence-level abilities in clinical assessment, and as a clinical marker of specific language impairment. However, it is widely debated what the task is testing and therefore how informative it is. Aims: (1) To evaluate the effects of…

  8. Temporal Processing Capabilities in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; Ackermann, Hermann; Wannke, Michael; Hertrich, Ingo

    2010-01-01

    This study investigates the temporal resolution capacities of the central-auditory system in a subject (NP) suffering from repetition conduction aphasia. More specifically, the patient was asked to detect brief gaps between two stretches of broadband noise (gap detection task) and to evaluate the duration of two biphasic (WN-3) continuous noise…

  9. Social Interaction and Repetitive Motor Behaviors

    ERIC Educational Resources Information Center

    Loftin, Rachel L.; Odom, Samuel L.; Lantz, Johanna F.

    2008-01-01

    Students with autism have difficulty initiating social interactions and may exhibit repetitive motor behavior (e.g., body rocking, hand flapping). Increasing social interaction by teaching new skills may lead to reductions in problem behavior, such as motor stereotypies. Additionally, self-monitoring strategies can increase the maintenance of…

  10. Reducing Repetitive Speech: Effects of Strategy Instruction.

    ERIC Educational Resources Information Center

    Dipipi, Caroline M.; Jitendra, Asha K.; Miller, Judith A.

    2001-01-01

    This article describes an intervention with an 18-year-old young woman with mild mental retardation and a seizure disorder, which focused on her repetitive echolalic verbalizations. The intervention included time delay, differential reinforcement of other behaviors, and self-monitoring. Overall, the intervention was successful in facilitating…

  11. Verbal Repetitions and Echolalia in Alzheimer's Discourse

    ERIC Educational Resources Information Center

    Da Cruz, Fernanda Miranda

    2010-01-01

    This article reports on an investigation of echolalic repetition in Alzheimer's disease (AD). A qualitative analysis of data from spontaneous conversations with MHI, a woman with AD, is presented. The data come from the DALI Corpus, a corpus of spontaneous conversations involving subjects with AD. This study argues that echolalic effects can be…

  12. Large-scale detection of repetitions

    PubMed Central

    Smyth, W. F.

    2014-01-01

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ⋯TTT⋯ or ⋯CGACGA⋯ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel–Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output. PMID:24751872

  13. Nonword Repetition and Vocabulary Use in Toddlers

    ERIC Educational Resources Information Center

    Stokes, Stephanie F.; Moran, Catherine; George, Anjali

    2013-01-01

    Purpose: There is general consensus that the ability to repeat nonsense words is related to vocabulary size in young children, but there is considerable debate about the nature of the relationship and the mechanisms that underlie it. Research with adults has proposed a shared neural substrate for nonword repetition (NWR) and language production,…

  14. Large-scale detection of repetitions.

    PubMed

    Smyth, W F

    2014-05-28

    Combinatorics on words began more than a century ago with a demonstration that an infinitely long string with no repetitions could be constructed on an alphabet of only three letters. Computing all the repetitions (such as ∙∙∙TTT ∙∙∙ or ∙∙∙ CGACGA ∙∙∙ ) in a given string x of length n is one of the oldest and most important problems of computational stringology, requiring time in the worst case. About a dozen years ago, it was discovered that repetitions can be computed as a by-product of the Θ(n)-time computation of all the maximal periodicities or runs in x. However, even though the computation is linear, it is also brute force: global data structures, such as the suffix array, the longest common prefix array and the Lempel-Ziv factorization, need to be computed in a preprocessing phase. Furthermore, all of this effort is required despite the fact that the expected number of runs in a string is generally a small fraction of the string length. In this paper, I explore the possibility that repetitions (perhaps also other regularities in strings) can be computed in a manner commensurate with the size of the output. PMID:24751872

  15. Bystanders' Reactions to Witnessing Repetitive Abuse Experiences

    ERIC Educational Resources Information Center

    Janson, Gregory R.; Carney, JoLynn V.; Hazler, Richard J.; Oh, Insoo

    2009-01-01

    The Impact of Event Scale-Revised (D. S. Weiss & C. R. Marmar, 1997) was used to obtain self-reported trauma levels from 587 young adults recalling childhood or adolescence experiences as witnesses to common forms of repetitive abuse defined as bullying. Mean participant scores were in a range suggesting potential need for clinical assessment at…

  16. Nonword Repetition, Phonological Storage, and Multiple Determinations

    ERIC Educational Resources Information Center

    Gupta, Prahlad

    2006-01-01

    The proposals that (a) nonword repetition and word learning both rely on phonological storage and (b) both are multiply determined are two of the major foci of Gathercole's (2006) Keynote Article, which marshals considerable evidence in support of each. In my view, the importance of these proposals cannot be overstated: these two notions go to the…

  17. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response

    PubMed Central

    Bousios, Alexandros; Diez, Concepcion M.; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S.

    2016-01-01

    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host–TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  18. X-Linked Congenital Hypertrichosis Syndrome Is Associated with Interchromosomal Insertions Mediated by a Human-Specific Palindrome near SOX3

    PubMed Central

    Zhu, Hongwen; Shang, Dandan; Sun, Miao; Choi, Sunju; Liu, Qing; Hao, Jiajie; Figuera, Luis E.; Zhang, Feng; Choy, Kwong Wai; Ao, Yang; Liu, Yang; Zhang, Xiao-Lin; Yue, Fengzhen; Wang, Ming-Rong; Jin, Li; Patel, Pragna I.; Jing, Tao; Zhang, Xue

    2011-01-01

    X-linked congenital generalized hypertrichosis (CGH), an extremely rare condition characterized by universal overgrowth of terminal hair, was first mapped to chromosome Xq24-q27.1 in a Mexican family. However, the underlying genetic defect remains unknown. We ascertained a large Chinese family with an X-linked congenital hypertrichosis syndrome combining CGH, scoliosis, and spina bifida and mapped the disease locus to a 5.6 Mb critical region within the interval defined by the previously reported Mexican family. Through the combination of a high-resolution copy-number variation (CNV) scan and targeted genomic sequencing, we identified an interchromosomal insertion at Xq27.1 of a 125,577 bp intragenic fragment of COL23A1 on 5q35.3, with one X breakpoint within and the other very close to a human-specific short palindromic sequence located 82 kb downstream of SOX3. In the Mexican family, we found an interchromosomal insertion at the same Xq27.1 site of a 300,036 bp genomic fragment on 4q31.2, encompassing PRMT10 and TMEM184C and involving parts of ARHGAP10 and EDNRA. Notably, both of the two X breakpoints were within the short palindrome. The two palindrome-mediated insertions fully segregate with the CGH phenotype in each of the families, and the CNV gains of the respective autosomal genomic segments are not present in the public database and were not found in 1274 control individuals. Analysis of control individuals revealed deletions ranging from 173 bp to 9104 bp at the site of the insertions with no phenotypic consequence. Taken together, our results strongly support the pathogenicity of the identified insertions and establish X-linked congenital hypertrichosis syndrome as a genomic disorder. PMID:21636067

  19. A role for palindromic structures in the cis-region of maize Sirevirus LTRs in transposable element evolution and host epigenetic response.

    PubMed

    Bousios, Alexandros; Diez, Concepcion M; Takuno, Shohei; Bystry, Vojtech; Darzentas, Nikos; Gaut, Brandon S

    2016-02-01

    Transposable elements (TEs) proliferate within the genome of their host, which responds by silencing them epigenetically. Much is known about the mechanisms of silencing in plants, particularly the role of siRNAs in guiding DNA methylation. In contrast, little is known about siRNA targeting patterns along the length of TEs, yet this information may provide crucial insights into the dynamics between hosts and TEs. By focusing on 6456 carefully annotated, full-length Sirevirus LTR retrotransposons in maize, we show that their silencing associates with underlying characteristics of the TE sequence and also uncover three features of the host-TE interaction. First, siRNA mapping varies among families and among elements, but particularly along the length of elements. Within the cis-regulatory portion of the LTRs, a complex palindrome-rich region acts as a hotspot of both siRNA matching and sequence evolution. These patterns are consistent across leaf, tassel, and immature ear libraries, but particularly emphasized for floral tissues and 21- to 22-nt siRNAs. Second, this region has the ability to form hairpins, making it a potential template for the production of miRNA-like, hairpin-derived small RNAs. Third, Sireviruses are targeted by siRNAs as a decreasing function of their age, but the oldest elements remain highly targeted, partially by siRNAs that cross-map to the youngest elements. We show that the targeting of older Sireviruses reflects their conserved palindromes. Altogether, we hypothesize that the palindromes aid the silencing of active elements and influence transposition potential, siRNA targeting levels, and ultimately the fate of an element within the genome. PMID:26631490

  20. A Nonword Repetition Task for Speakers with Misarticulations: The Syllable Repetition Task (SRT)

    PubMed Central

    Shriberg, Lawrence D.; Lohmeier, Heather L.; Campbell, Thomas F.; Dollaghan, Christine A.; Green, Jordan R.; Moore, Christopher A.

    2010-01-01

    Purpose Conceptual and methodological confounds occur when non(sense) repetition tasks are administered to speakers who do not have the target speech sounds in their phonetic inventories or who habitually misarticulate targeted speech sounds. We describe a nonword repetition task, the Syllable Repetiton Task (SRT) that eliminates this confound and report findings from three validity studies. Method Ninety-five preschool children with Speech Delay and 63 with Typical Speech, completed an assessment battery that included the Nonword Repetition Task (NRT: Dollaghan & Campbell, 1998) and the SRT. SRT stimuli include only four of the earliest occurring consonants and one early occurring vowel. Results Study 1 findings indicated that the SRT eliminated the speech confound in nonword testing with speakers who misarticulate. Study 2 findings indicated that the accuracy of the SRT to identify expressive language impairment was comparable to findings for the NRT. Study 3 findings illustrated the SRT’s potential to interrogate speech processing constraints underlying poor nonword repetition accuracy. Results supported both memorial and auditory-perceptual encoding constraints underlying nonword repetition errors in children with speech-language impairment. Conclusion The SRT appears to be a psychometrically stable and substantively informative nonword repetition task for emerging genetic and other research with speakers who misarticulate. PMID:19635944

  1. Serotonin levels influence patterns of repetition priming.

    PubMed

    Burgund, E Darcy; Marsolek, Chad J; Luciana, Monica

    2003-01-01

    Repetition priming in a word-stem completion task was examined in a group of control subjects and in a group of experimental subjects under conditions of acute tryptophan depletion (T-) and tryptophan augmentation (T+). Experimental subjects ingested amino acid compounds that depleted or loaded the body with tryptophan, and word-stem completion priming performance was measured. Results indicate differential effects of T- and T+ manipulations on word-stem completion priming. In the control group, both specific-visual and amodal priming were observed. Conversely, in the T+ condition, specific-visual priming, but no amodal priming, was observed, whereas in the T- condition, amodal priming, but no specific-visual priming, was observed. The authors conclude that serotonin (5-hydroxytryptamine) plays a critical role in repetition priming by helping to modulate which neural systems contribute to priming effects. PMID:12597085

  2. Repetitive Elements in Genomes of Parasitic Protozoa

    PubMed Central

    Wickstead, Bill; Ersfeld, Klaus; Gull, Keith

    2003-01-01

    Repetitive DNA elements have been a part of the genomic fauna of eukaryotes perhaps since their very beginnings. Millions of years of coevolution have given repeats central roles in chromosome maintenance and genetic modulation. Here we review the genomes of parasitic protozoa in the context of the current understanding of repetitive elements. Particular reference is made to repeats in five medically important species with ongoing or completed genome sequencing projects: Plasmodium falciparum, Leishmania major, Trypanosoma brucei, Trypanosoma cruzi, and Giardia lamblia. These organisms are used to illustrate five thematic classes of repeats with different structures and genomic locations. We discuss how these repeat classes may interact with parasitic life-style and also how they can be used as experimental tools. The story which emerges is one of opportunism and upheaval which have been employed to add genetic diversity and genomic flexibility. PMID:12966140

  3. A repetitive elements perspective in Polycomb epigenetics

    PubMed Central

    Casa, Valentina; Gabellini, Davide

    2012-01-01

    Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non-functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression, and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome re-arrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental. Polycomb group (PcG) proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins. Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space. PMID:23060903

  4. Repetition probability effects for inverted faces.

    PubMed

    Grotheer, Mareike; Hermann, Petra; Vidnyánszky, Zoltán; Kovács, Gyula

    2014-11-15

    It has been shown, that the repetition related reduction of the blood-oxygen level dependent (BOLD) signal is modulated by the probability of repetitions (P(rep)) for faces (Summerfield et al., 2008), providing support for the predictive coding (PC) model of visual perception (Rao and Ballard, 1999). However, the stage of face processing where repetition suppression (RS) is modulated by P(rep) is still unclear. Face inversion is known to interrupt higher level configural/holistic face processing steps and if modulation of RS by P(rep) takes place at these stages of face processing, P(rep) effects are expected to be reduced for inverted when compared to upright faces. Therefore, here we aimed at investigating whether P(rep) effects on RS observed for face stimuli originate at the higher-level configural/holistic stages of face processing by comparing these effects for upright and inverted faces. Similarly to previous studies, we manipulated P(rep) for pairs of stimuli in individual blocks of fMRI recordings. This manipulation significantly influenced repetition suppression in the posterior FFA, the OFA and the LO, independently of stimulus orientation. Our results thus reveal that RS in the ventral visual stream is modulated by P(rep) even in the case of face inversion and hence strongly compromised configural/holistic face processing. An additional whole-brain analysis could not identify any areas where the modulatory effect of probability was orientation specific either. These findings imply that P(rep) effects on RS might originate from the earlier stages of face processing. PMID:25123974

  5. Can predictive coding explain repetition suppression?

    PubMed

    Grotheer, Mareike; Kovács, Gyula

    2016-07-01

    While in earlier work various local or bottom-up neural mechanisms were proposed to give rise to repetition suppression (RS), current theories suggest that top-down processes play a role in determining the repetition related reduction of the neural responses. In the current review we summarise those results, which support the role of these top-down processes, concentrating on the Bayesian models of predictive coding (PC). Such models assume that RS is related to the statistical probabilities of prior stimulus occurrences and to the future predictability of these stimuli. Here we review the current results that support or argue against this explanation. We point out that the heterogeneity of experimental manipulations that are thought to reflect predictive processes are likely to measure different processing steps, making their direct comparison difficult. In addition we emphasize the importance of identifying these sub-processes and clarifying their role in explaining RS. Finally, we propose a two-stage model for explaining the relationships of repetition and expectation phenomena in the human cortex. PMID:26861559

  6. Lsh, an epigenetic guardian of repetitive elements.

    PubMed

    Huang, Jiaqiang; Fan, Tao; Yan, Qingsheng; Zhu, Heming; Fox, Stephen; Issaq, Haleem J; Best, Lionel; Gangi, Lisa; Munroe, David; Muegge, Kathrin

    2004-01-01

    The genome is burdened with repetitive sequences that are generally embedded in silenced chromatin. We have previously demonstrated that Lsh (lymphoid-specific helicase) is crucial for the control of heterochromatin at pericentromeric regions consisting of satellite repeats. In this study, we searched for additional genomic targets of Lsh by examining the effects of Lsh deletion on repeat regions and single copy gene sequences. We found that the absence of Lsh resulted in an increased association of acetylated histones with repeat sequences and transcriptional reactivation of their silenced state. In contrast, selected single copy genes displayed no change in histone acetylation levels, and their transcriptional rate was indistinguishable compared to Lsh-deficient cells and wild-type controls. Microarray analysis of total RNA derived from brain and liver tissues revealed that <0.4% of the 15 247 examined loci were abnormally expressed in Lsh-/-embryos and almost two-thirds of these deregulated sequences contained repeats, mainly retroviral LTR (long terminal repeat) elements. Chromatin immunoprecipitation analysis demonstrated a direct interaction of Lsh with repetitive sites in the genome. These data suggest that the repetitive sites are direct targets of Lsh action and that Lsh plays an important role as 'epigenetic guardian' of the genome to protect against deregulation of parasitic retroviral elements. PMID:15448183

  7. The Dfam database of repetitive DNA families.

    PubMed

    Hubley, Robert; Finn, Robert D; Clements, Jody; Eddy, Sean R; Jones, Thomas A; Bao, Weidong; Smit, Arian F A; Wheeler, Travis J

    2016-01-01

    Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download. PMID:26612867

  8. Overview of repetitively pulsed photolytic iodine lasers

    NASA Astrophysics Data System (ADS)

    Schlie, L. A. V.

    1996-02-01

    The performance of a repetitively pulsed, 70 joule, closed cycle 1.3 (mu) M photolytic atomic iodine laser with excellent beam quality (BQ equals 1.15) is presented. This BQ was exhibited in the fundamental mode from a M equals 3.1 confocal unstable resonator at a 0.5 Hz repetition rate. A closed cycle scrubber/laser fuel system consisting of a condensative- evaporative section, two Cu wool I2 reactor regions, and an internal turbo-blower enabled the laser to operate very reliably with low maintenance. The fuel system provided C3F7I gas at 10 - 60 torr absent of the photolytic quenching by-product I2. Using a turbo- molecular blower longitudinal flow velocities greater than 10 m/s were achieved through the 150 cm long by 7.5 multiplied by 7.5 cm2 cross sectional photolytic iodine gain region. In addition to the high laser output and excellent BQ, the resulting 8 - 12 microsecond laser pulse had a coherence length greater than 45 meters and polarization extinction ratio better than 100:1. Projections from this pulsed photolytic atomic iodine laser technology to larger energies, higher repetition rates, and variable pulse widths are discussed.

  9. The Dfam database of repetitive DNA families

    PubMed Central

    Hubley, Robert; Finn, Robert D.; Clements, Jody; Eddy, Sean R.; Jones, Thomas A.; Bao, Weidong; Smit, Arian F.A.; Wheeler, Travis J.

    2016-01-01

    Repetitive DNA, especially that due to transposable elements (TEs), makes up a large fraction of many genomes. Dfam is an open access database of families of repetitive DNA elements, in which each family is represented by a multiple sequence alignment and a profile hidden Markov model (HMM). The initial release of Dfam, featured in the 2013 NAR Database Issue, contained 1143 families of repetitive elements found in humans, and was used to produce more than 100 Mb of additional annotation of TE-derived regions in the human genome, with improved speed. Here, we describe recent advances, most notably expansion to 4150 total families including a comprehensive set of known repeat families from four new organisms (mouse, zebrafish, fly and nematode). We describe improvements to coverage, and to our methods for identifying and reducing false annotation. We also describe updates to the website interface. The Dfam website has moved to http://dfam.org. Seed alignments, profile HMMs, hit lists and other underlying data are available for download. PMID:26612867

  10. Repetition Blindness: An Emergent Property of Inter-Item Competition

    ERIC Educational Resources Information Center

    Morris, Alison L.; Still, Mary L.; Caldwell-Harris, Catherine L.

    2009-01-01

    Repeating an item in a brief or rapid display usually produces faster or more accurate identification of the item (repetition priming), but sometimes produces the opposite effect (repetition blindness). We present a theory of short-term repetition effects, the "competition hypothesis," which explains these paradoxical outcomes. The central tenet…

  11. Lingual Kinematics during Rapid Syllable Repetition in Parkinson's Disease

    ERIC Educational Resources Information Center

    Wong, Min Ney; Murdoch, Bruce E.; Whelan, Brooke-Mai

    2012-01-01

    Background: Rapid syllable repetition tasks are commonly used in the assessment of motor speech disorders. However, little is known about the articulatory kinematics during rapid syllable repetition in individuals with Parkinson's disease (PD). Aims: To investigate and compare lingual kinematics during rapid syllable repetition in dysarthric…

  12. The Adult Repetitive Behaviours Questionnaire-2 (RBQ-2A): A Self-Report Measure of Restricted and Repetitive Behaviours

    ERIC Educational Resources Information Center

    Barrett, Sarah L.; Uljarevic, Mirko; Baker, Emma K.; Richdale, Amanda L.; Jones, Catherine R. G.; Leekam, Susan R.

    2015-01-01

    In two studies we developed and tested a new self-report measure of restricted and repetitive behaviours (RRB) suitable for adults. In Study 1, The Repetitive Behaviours Questionnaire-2 for adults (RBQ-2A) was completed by a sample of 163 neurotypical adults. Principal components analysis revealed two components: Repetitive Motor Behaviours and…

  13. [Guidelines for redesigning jobs with repetitive tasks].

    PubMed

    Colombini, D; Occhipinti, E; Meroni, M; Menoni, O; Bergamasco, R; Girola, C; Grea, V; Vendola, D

    1996-01-01

    Preventive measures aimed at minimising the occurrence of work-related musculo-skeletal disorders of the upper limbs (WMSDs) associated with repetitive tasks can be divided into 3 categories: structural, organisational and educational. Whenever specific risk and injury assessments have shown the need for preventive action, this is most often implemented within the framework of a range of assorted measures. In particular, structural measures pertain to optimising the layout of the work area and furnishings, and the "ergonomic" properties of work tools and equipment. Such measures serve to alleviate the problems caused by the use of excessive force and improper postures. The authors refer to the principles guiding such structural measures, in the light of the extensive literature that has been published on the subject. Organisational (or re-organisational) measures essentially relate to job design (i.e. distribution of tasks, speeds and pauses). They serve to alleviate problems connected with highly repetitive and frequent actions, excessively lengthy tasks and inadequate recovery periods. Very few relevant findings are available: the authors therefore illustrate in some detail a practical trial conducted in a major engineering firm. The objective was to lower to acceptable limits the frequency of certain repetitive tasks performed by workers using their upper limbs. The trial made it possible to identify a suitable plan and schedule of measures taking into due consideration the impact of the plan on production levels (and costs). The fundamental principles guiding the adoption of specific educational and training programmes for the workers and their supervisors are presented and discussed. PMID:9148129

  14. AUTOSIM: An automated repetitive software testing tool

    NASA Technical Reports Server (NTRS)

    Dunham, J. R.; Mcbride, S. E.

    1985-01-01

    AUTOSIM is a software tool which automates the repetitive run testing of software. This tool executes programming tasks previously performed by a programmer with one year of programming experience. Use of the AUTOSIM tool requires a knowledge base containing information about known faults, code fixes, and the fault diagnosis-correction process. AUTOSIM can be considered as an expert system which replaces a low level of programming expertise. Reference information about the design and implementation of the AUTOSIM software test tool provides flowcharts to assist in maintaining the software code and a description of how to use the tool.

  15. Software reliability: Repetitive run experimentation and modeling

    NASA Technical Reports Server (NTRS)

    Nagel, P. M.; Skrivan, J. A.

    1982-01-01

    A software experiment conducted with repetitive run sampling is reported. Independently generated input data was used to verify that interfailure times are very nearly exponentially distributed and to obtain good estimates of the failure rates of individual errors and demonstrate how widely they vary. This fact invalidates many of the popular software reliability models now in use. The log failure rate of interfailure time was nearly linear as a function of the number of errors corrected. A new model of software reliability is proposed that incorporates these observations.

  16. Animal models of restricted repetitive behavior in autism

    PubMed Central

    Lewis, Mark H.; Tanimura, Yoko; Lee, Linda W.; Bodfish, James W.

    2013-01-01

    Restricted, repetitive behavior, along with deficits in social reciprocity and communication, is diagnostic of autism. Animal models relevant to this domain generally fall into three classes: repetitive behavior associated with targeted insults to the CNS; repetitive behavior induced by pharmacological agents; and repetitive behavior associated with restricted environments and experience. The extant literature provides potential models of the repetitive behavioral phenotype in autism rather than attempts to model the etiology or pathophysiology of restricted, repetitive behavior, as these are poorly understood. This review focuses on our work with deer mice which exhibit repetitive behaviors associated with environmental restriction. Repetitive behaviors are the most common category of abnormal behavior observed in confined animals and larger, more complex environments substantially reduce the development and expression of such behavior. Studies with this model, including environmental enrichment effects, suggest alterations in cortical-basal ganglia circuitry in the development and expression of repetitive behavior. Considerably more work needs to be done in this area, particularly in modeling the development of aberrant repetitive behavior. As mutant mouse models continue to proliferate, there should be a number of promising genetic models to pursue. PMID:16997392

  17. Investigation of a repetitive pulsed electrothermal thruster

    NASA Technical Reports Server (NTRS)

    Burton, R. L.; Fleischer, D.; Goldstein, S. A.; Tidman, D. A.; Winsor, N. K.

    1986-01-01

    A pulsed electrothermal (PET) thruster with 1000:1 ratio nozzle is tested in a repetitive mode on water propellant. The thruster is driven by a 60J pulse forming network at repetition rates up to 10 Hz (600W). The pulse forming network has a .31 ohm impedance, well matched to the capillary discharge resistance of .40 ohm, and is directly coupled to the thruster electrodes without a switch. The discharge is initiated by high voltage breakdown, typically at 2500V, through the water vapor in the interelectrode gap. Water is injected as a jet through a .37 mm orifice on the thruster axis. Thruster voltage, current and impulse bit are recorded for several seconds at various power supply currents. Thruster to power ratio is typically T/P = .07 N/kW. Tank background pressure precludes direct measurement of exhaust velocity which is inferred from calculated pressure and temperature in the discharge to be about 14 km/sec. Efficiency, based on this velocity and measured T/P is .54 + or - .07. Thruster ablation is zero at the throat and becomes measurable further upstream, indicating that radiative ablation is occurring late in the pulse.

  18. Episodic repetitive thought: dimensions, correlates, and consequences.

    PubMed

    Segerstrom, Suzanne C; Stanton, Annette L; Flynn, Sarah McQueary; Roach, Abbey R; Testa, Jamie J; Hardy, Jaime K

    2012-01-01

    Repetitive thought (RT) - attentive, prolonged, or frequent thought about oneself and one's world - plays an important role in many models of psychological and physical ill health (e.g., rumination and worry), as well as models of recovery and well-being (e.g., processing and reminiscing). In these models, repetitive thought is typically treated as stable or trait-like. In contrast, episodic RT reflects what people have "on their minds" at a particular point in time. In four studies, young women (N=94), college students (N=166), first-year law students (N=73), and older adults (N=174) described their episodic RT, which was then rated for qualities including valence, purpose, and theme. Episodic RT valence was associated with mood and depressive symptoms both between (Studies 1-4) and within people (Studies 3-4), and it mediated the effects of dispositional coping through emotional approach (Study 1). The effect of episodic RT valence in turn was moderated by other properties of episodic RT, including purpose, "trait" valence, and theme (Studies 1-4). The study of episodic RT complements that of trait RT and allows for observations of how RT and psychological adjustment change in concert and in context, as well as examining how the RT qualities that are not reflected in trait measures affect adjustment. PMID:21861772

  19. Pull-production in repetitive remanufacturing

    SciTech Connect

    McCaskey, D.W. Jr.

    1992-09-01

    In the past, production activity control practices in most repetitive remanufacturing facilities resembled those used in intermittent production operations. These operations were characterized by large amounts of work-in-process (WIP), frequent work stoppages due to part shortages, excessive overtime, low product velocity, informal scheduling between dependent operations, low employee and management moral, and a lot of wasted time, material, labor, and space. Improvement in production activity control (PAC) methods for repetitive remanufactures has been hampered by uncertainty in: supply of incoming assets, configuration of assets, process times to refurbish assets, and yields in reclamation processes. collectively these uncertainties make shop floor operations seem uncontrollable. However, one United States Army depot has taken on the challenge. Through management supported, cross-functional teams, the Tooele Army Depot has designed and implemented pull-production systems for two of its major products, with several others to follow. This article presents a generalized version of Tooele`s pull-production system and highlights design characteristics which are specific to remanufacturing applications.

  20. Pull-production in repetitive remanufacturing

    SciTech Connect

    McCaskey, D.W. Jr.

    1992-09-01

    In the past, production activity control practices in most repetitive remanufacturing facilities resembled those used in intermittent production operations. These operations were characterized by large amounts of work-in-process (WIP), frequent work stoppages due to part shortages, excessive overtime, low product velocity, informal scheduling between dependent operations, low employee and management moral, and a lot of wasted time, material, labor, and space. Improvement in production activity control (PAC) methods for repetitive remanufactures has been hampered by uncertainty in: supply of incoming assets, configuration of assets, process times to refurbish assets, and yields in reclamation processes. collectively these uncertainties make shop floor operations seem uncontrollable. However, one United States Army depot has taken on the challenge. Through management supported, cross-functional teams, the Tooele Army Depot has designed and implemented pull-production systems for two of its major products, with several others to follow. This article presents a generalized version of Tooele's pull-production system and highlights design characteristics which are specific to remanufacturing applications.

  1. Episodic Repetitive Thought: Dimensions, Correlates, and Consequences

    PubMed Central

    Segerstrom, Suzanne C.; Stanton, Annette L.; Flynn, Sarah McQueary; Roach, Abbey R.; Testa, Jamie J.; Hardy, Jaime K.

    2011-01-01

    Repetitive thought (RT) – attentive, prolonged, or frequent thought about oneself and one’s world – plays an important role in many models of psychological and physical ill health (e.g., rumination and worry), as well as models of recovery and well-being (e.g., processing and reminiscing). In these models, repetitive thought is typically treated as stable or trait-like. In contrast, episodic RT reflects what people have “on their minds” at a particular point in time. In four studies, young women (N = 94), college students (N = 166), first-year law students (N = 73), and older adults (N = 174) described their episodic RT, which was then rated for qualities including valence, purpose, and theme. Episodic RT valence was associated with mood and depressive symptoms both between (Studies 1–4) and within people (Studies 3–4), and it mediated the effects of dispositional coping through emotional approach (Study 1). The effect of episodic RT valence in turn was moderated by other properties of episodic RT, including purpose, “trait” valence, and theme (Studies 1–4). The study of episodic RT complements that of trait RT and allows for observations of how RT and psychological adjustment change in concert and in context, as well as examining the RT qualities that are not reflected in trait measures affecting adjustment. PMID:21861772

  2. Transposition of IS1397 in the family Enterobacteriaceae and first characterization of ISKpn1, a new insertion sequence associated with Klebsiella pneumoniae palindromic units.

    PubMed

    Wilde, C; Bachellier, S; Hofnung, M; Clément, J M

    2001-08-01

    IS1397 and ISKpn1 are IS3 family members which are specifically inserted into the loop of palindromic units (PUs). IS1397 is shown to transpose into PUs with sequences close or identical to the Escherichia coli consensus, even in other enterobacteria (Salmonella enterica serovar Typhimurium, Klebsiella pneumoniae, and Klebsiella oxytoca). Moreover, we show that homologous intergenic regions containing PUs constitute IS1397 transpositional hot spots, despite bacterial interspersed mosaic element structures that differ among the three species. ISKpn1, described here for the first time, is specific for PUs from K. pneumoniae, in which we discovered it. A sequence comparison between the two insertion sequences allowed us to define a motif possibly accounting for their specificity. PMID:11443073

  3. Recombination dynamics of a human Y-chromosomal palindrome: rapid GC-biased gene conversion, multi-kilobase conversion tracts, and rare inversions.

    PubMed

    Hallast, Pille; Balaresque, Patricia; Bowden, Georgina R; Ballereau, Stéphane; Jobling, Mark A

    2013-01-01

    The male-specific region of the human Y chromosome (MSY) includes eight large inverted repeats (palindromes) in which arm-to-arm similarity exceeds 99.9%, due to gene conversion activity. Here, we studied one of these palindromes, P6, in order to illuminate the dynamics of the gene conversion process. We genotyped ten paralogous sequence variants (PSVs) within the arms of P6 in 378 Y chromosomes whose evolutionary relationships within the SNP-defined Y phylogeny are known. This allowed the identification of 146 historical gene conversion events involving individual PSVs, occurring at a rate of 2.9-8.4×10(-4) events per generation. A consideration of the nature of nucleotide change and the ancestral state of each PSV showed that the conversion process was significantly biased towards the fixation of G or C nucleotides (GC-biased), and also towards the ancestral state. Determination of haplotypes by long-PCR allowed likely co-conversion of PSVs to be identified, and suggested that conversion tract lengths are large, with a mean of 2068 bp, and a maximum in excess of 9 kb. Despite the frequent formation of recombination intermediates implied by the rapid observed gene conversion activity, resolution via crossover is rare: only three inversions within P6 were detected in the sample. An analysis of chimpanzee and gorilla P6 orthologs showed that the ancestral state bias has existed in all three species, and comparison of human and chimpanzee sequences with the gorilla outgroup confirmed that GC bias of the conversion process has apparently been active in both the human and chimpanzee lineages. PMID:23935520

  4. Possible functional co-operation of palindromes hr3 and hr4 in the genome of Cydia pomonella granulovirus affects viral replication capacity.

    PubMed

    Elmenofy, Wael H; Jehle, Johannes A

    2015-09-01

    After previous studies had shown that natural transposon insertion between the two homologous regions hr3 and hr4 of the genome of the Mexican (M) strain of Cydia pomonella granulovirus (CpGV-M) resulted in a loss of viral competitiveness, the function of these homologous regions was investigated. A CpGV-based bacmid (CpBAC) was constructed and mutants with deleted hr3 and hr4 palindromes (CpBAChr3/hr4KO) and a construct (CpBAChr3-kan-hr4) with physically separated hr3 and hr4 repeats were generated to investigate their involvement in in vivo replication. Based on median lethal concentration (LC50) and median survival time (ST50) of the mutant viruses vCpBAChr3/hr4KO and vCpBAChr3-kan-hr4 it was found that the infectivity of both mutants for codling moth Cydia pomonella L. (Lep.: Tortricidae) larvae was not influenced compared with the parental virus vCpBAC. Co-infection experiments with vCpBAChr3-kan-hr4 and vCpBAC using different virus ratios revealed that vCpBAChr3-kan-hr4 was efficiently out-competed by vCpBAC during in vivo replication. These findings suggested that the separation of hr3 and hr4 resulted in a replication disadvantage of the mutant similar to the observation made in previous co-infection experiments using the transposon-carrying mutant CpGV-MCp5 and WT CpGV-M. It was concluded that the palindromes hr3 and hr4 may play a non-essential but co-functional role in the replication of CpGV-M. PMID:26002301

  5. A phonetic approach to consonant repetition in early words.

    PubMed

    Kim, Namhee; Davis, Barbara L

    2015-08-01

    The goal of this study was to evaluate movement-based principles for understanding early speech output patterns. Consonant repetition patterns within children's actual productions of word forms were analyzed using spontaneous speech data from 10 typically developing American-English learning children between 12 and 36 months of age. Place of articulation, word level patterns, and developmental trends in CVC and CVCV repeated word forms were evaluated. Labial and coronal place repetitions dominated. Regressive repetition (e.g., [gag] for "dog") occurred frequently in CVC but not in CVCV word forms. Consonant repetition decreased over time. However, the children produced sound types available reported as being within young children's production system capabilities in consonant repetitions in all time periods. Findings suggest that a movement-based approach can provide a framework for comprehensively characterizing consonant place repetition patterns in early speech development. PMID:26176184

  6. A review of neuroimaging findings in repetitive brain trauma.

    PubMed

    Koerte, Inga K; Lin, Alexander P; Willems, Anna; Muehlmann, Marc; Hufschmidt, Jakob; Coleman, Michael J; Green, Isobel; Liao, Huijun; Tate, David F; Wilde, Elisabeth A; Pasternak, Ofer; Bouix, Sylvain; Rathi, Yogesh; Bigler, Erin D; Stern, Robert A; Shenton, Martha E

    2015-05-01

    Chronic traumatic encephalopathy (CTE) is a neurodegenerative disease confirmed at postmortem. Those at highest risk are professional athletes who participate in contact sports and military personnel who are exposed to repetitive blast events. All neuropathologically confirmed CTE cases, to date, have had a history of repetitive head impacts. This suggests that repetitive head impacts may be necessary for the initiation of the pathogenetic cascade that, in some cases, leads to CTE. Importantly, while all CTE appears to result from repetitive brain trauma, not all repetitive brain trauma results in CTE. Magnetic resonance imaging has great potential for understanding better the underlying mechanisms of repetitive brain trauma. In this review, we provide an overview of advanced imaging techniques currently used to investigate brain anomalies. We also provide an overview of neuroimaging findings in those exposed to repetitive head impacts in the acute/subacute and chronic phase of injury and in more neurodegenerative phases of injury, as well as in military personnel exposed to repetitive head impacts. Finally, we discuss future directions for research that will likely lead to a better understanding of the underlying mechanisms separating those who recover from repetitive brain trauma vs. those who go on to develop CTE. PMID:25904047

  7. The use of repetition suppression paradigms in developmental cognitive neuroscience.

    PubMed

    Nordt, Marisa; Hoehl, Stefanie; Weigelt, Sarah

    2016-07-01

    Repetition suppression paradigms allow a more detailed look at brain functioning than classical paradigms and have been applied vigorously in adult cognitive neuroscience. These paradigms are well suited for studies in the field of developmental cognitive neuroscience as they can be applied without collecting a behavioral response and across all age groups. Furthermore, repetition suppression paradigms can be employed in various neuroscience techniques, such as functional magnetic resonance imaging (fMRI), functional near-infrared spectroscopy (fNIRS), electroencephalography (EEG) and magnetoencephalography (MEG). In the present article we review studies using repetition suppression paradigms in developmental cognitive neuroscience covering the age range from infancy to adolescence. Our first goal is to point out characteristics of developmental repetition suppression effects. In doing so, we discuss the relationship of the direction of repetition effects (suppression vs enhancement) with developmental factors, and address the question how the direction of repetition effects might be related to looking-time effects in behavioral infant paradigms, the most prominently used behavioral measure in infant research. To highlight the potential of repetition suppression paradigms, our second goal is to provide an overview on the insights recently obtained by applying repetition paradigms in neurodevelopmental studies, including research on children with autism spectrum disorders (ASDs). We conclude that repetition suppression paradigms are valuable tools for investigating neurodevelopmental processes, while at the same time we highlight the necessity for further studies that disentangle methodological and developmental factors. PMID:27161033

  8. Low-Intensity Repetitive Exercise Induced Rhabdomyolysis

    PubMed Central

    Tran, Mina; Hayden, Nicholas; Garcia, Brandon; Tucci, Veronica

    2015-01-01

    Rhabdomyolysis is a rare condition caused by the proteins of damaged muscle cells entering the bloodstream and damaging the kidneys. Common symptoms of rhabdomyolysis are muscle pain and fatigue in conjunction with dark urine; kidney damage is a common symptom among these patients. We present a case of a 23-year-old woman who displayed myalgia in the upper extremities caused by low-intensity and high-repetition exercise. She was successfully diagnosed and treated for exertional rhabdomyolysis. This patient had no significant medical history that would induce this condition. We urge the emergency medical community to observe and monitor patients that complain of myalgia to ensure they are not suffering from rhabdomyolysis even in atypical cases. PMID:26693360

  9. Repetitive DNA sequences in Mycoplasma pneumoniae.

    PubMed Central

    Wenzel, R; Herrmann, R

    1988-01-01

    Two types of different repetitive DNA sequences called RepMP1 and RepMP2 were identified in the genome of Mycoplasma pneumoniae. The number of these repeated elements, their nucleotide sequence and their localization on a physical map of the M. pneumoniae genome were determined. The results show that RepMP1 appears at least 10 times and RepMP2 at least 8 times in the genome. The repeated elements are dispersed on the chromosome and, in three cases, linked to each other by a homologous DNA sequence of 400 bp. The elements themselves are 300 bp (for RepMP1) and 150 bp (for RepMP2) long showing a high degree of homology. One copy of RepMP2 is a translated part of the gene for the major cytadhesin protein P1 which is responsible for the adsorption of M. pneumoniae to its host cell. Images PMID:3138660

  10. Context and repetition in word learning

    PubMed Central

    Horst, Jessica S.

    2013-01-01

    Young children learn words from a variety of situations, including shared storybook reading. A recent study by Horst et al. (2011a) demonstrates that children learned more new words during shared storybook reading if they were read the same stories repeatedly than if they were read different stories that had the same number of target words. The current paper reviews this study and further examines the effect of contextual repetition on children's word learning in both shared storybook reading and other situations, including fast mapping by mutual exclusivity. The studies reviewed here suggest that the same cognitive mechanisms support word learning in a variety of situations. Both practical considerations for experimental design and directions for future research are discussed. PMID:23580347

  11. Visual identity and uncertainty in repetition blindness.

    PubMed

    Brill, Gary A; Glass, Arnold L; Rashid, Hanin; Hussey, Erika

    2008-01-01

    Repetition blindness (RB) was investigated in 6 experiments. In the first 3 experiments participants detected vowel targets in 11-letter sequences. When all letters were uppercase, detection was poorer for same (e.g., AA) than for different (e.g., AO) targets. However, when one target was uppercase and the other lowercase, RB was found only for targets visually identical except for size (e.g., Oo), not for visually different pairs (e.g., Aa). Experiment 4 found RB for visually identical versus different consonant-vowel-consonant words. Experiments 5 and 6 replicated Kanwisher's (1987) experiment in which RB was insensitive to word case but revealed these effects to be artifacts of poor recognition of 5-letter words coupled with a biased guessing strategy. Overall, these experiments found RB only at a low level of visual information processing. PMID:18792718

  12. Hairpin-duplex equilibrium reflected in the A-->B transition in an undecamer quasi-palindrome present in the locus control region of the human beta-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Ritushree; Grover, Deepak; Brahmachari, Samir K; Kukreti, Shrikant

    2003-12-01

    Our recent work on an A-->G single nucleotide polymorphism (SNP) at the quasi-palindromic sequence d(TGGGG[A/G]CCCCA) of HS4 of the human beta-globin locus control region in an Indian population showed a significant association between the G allele and the occurrence of beta-thalassemia. Using UV-thermal denaturation, gel assay, circular dichroism (CD) and nuclease digestion experiments we have demonstrated that the undecamer quasi- palindromic sequence d(TGGGGACCCCA) (HPA11) and its reported polymorphic (SNP) version d(TGG GGGCCCCA) (HPG11) exist in hairpin-duplex equilibria. The biphasic nature of the melting profiles for both the oligonucleotides persisted at low as well as high salt concentrations. The HPG11 hairpin showed a higher T(m) than HPA11. The presence of unimolecular and bimolecular species was also shown by non-denaturating gel electrophoresis experiments. The CD spectra of both oligonucleotides showed features of the A- as well as B-type conformations and, moreover, exhibited a concentration dependence. The disappearance of the 265 nm positive CD signal in an oligomer concentration-dependent manner is indicative of an A-->B transition. The results give unprecedented insight into the in vitro structure of the quasi-palindromic sequence and provide the first report in which a hairpin-duplex equilibrium has been correlated with an A-->B interconversion of DNA. The nuclease-dependent degradation suggests that HPG11 is more resistant to nuclease than HPA11. Multiple sequence alignment of the HS4 region of the beta-globin gene cluster from different organisms revealed that this quasi-palindromic stretch is unique to Homo sapiens. We propose that quasi-palindromic sequences may form stable mini- hairpins or cruciforms in the HS4 region and might play a role in regulating beta-globin gene expression by affecting the binding of transcription factors. PMID:14627823

  13. The Golden Ratio of Gait Harmony: Repetitive Proportions of Repetitive Gait Phases

    PubMed Central

    Iosa, Marco; Marchetti, Fabio; Morone, Giovanni; Caltagirone, Carlo; Paolucci, Stefano; Peppe, Antonella

    2013-01-01

    In nature, many physical and biological systems have structures showing harmonic properties. Some of them were found related to the irrational number ϕ known as the golden ratio that has important symmetric and harmonic properties. In this study, the spatiotemporal gait parameters of 25 healthy subjects were analyzed using a stereophotogrammetric system with 25 retroreflective markers located on their skin. The proportions of gait phases were compared with ϕ, the value of which is about 1.6180. The ratio between the entire gait cycle and stance phase resulted in 1.620 ± 0.058, that between stance and the swing phase was 1.629 ± 0.173, and that between swing and the double support phase was 1.684 ± 0.357. All these ratios did not differ significantly from each other (F = 0.870, P = 0.422, repeated measure analysis of variance) or from ϕ (P = 0.670, 0.820, 0.422, resp., t-tests). The repetitive gait phases of physiological walking were found in turn in repetitive proportions with each other, revealing an intrinsic harmonic structure. Harmony could be the key for facilitating the control of repetitive walking. Harmony is a powerful unifying factor between seemingly disparate fields of nature, including human gait. PMID:23862161

  14. Varieties of Repetitive Behavior in Autism: Comparisons to Mental Retardation.

    ERIC Educational Resources Information Center

    Bodfish, James W.; Symons, Frank J.; Parker, Dawn E.; Lewis, Mark H.

    2000-01-01

    A study compared specific repetitive behaviors in 32 adults with autism with 34 controls with mental retardation. The occurrence of each behavior category, except dyskinesias, was higher in individuals with autism and they showed a greater number of topographies of stereotypy and compulsions. Repetitive behavior severity also predicated autism…

  15. Repetitive and Stereotyped Behaviours in Pervasive Developmental Disorders

    ERIC Educational Resources Information Center

    Carcani-Rathwell, Iris; Rabe-Hasketh, Sophia; Santosh, Paramala J.

    2006-01-01

    Background: Repetitive and stereotyped behaviours are a heterogeneous group of behaviours present in many neuropsychiatric disorders. Despite their core significance in PDD, it is not clear whether there are distinct groups of these behaviours with different specificity to autism. Methods: A two-factor model of the repetitive behaviours, namely…

  16. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Combining licenses; elimination of repetition. 52.8... NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a) An applicant for a license under this part may combine in its application several applications for...

  17. Longitudinal Patterns of Repetitive Behavior in Toddlers with Autism

    PubMed Central

    Wolff, Jason J.; Botteron, Kelly N.; Dager, Stephen R.; Elison, Jed T.; Estes, Annette M.; Gu, Hongbin; Hazlett, Heather C.; Pandey, Juhi; Paterson, Sarah J.; Schultz, Robert T.; Zwaigenbaum, Lonnie; Piven, Joseph

    2014-01-01

    Background Recent evidence suggests that restricted and repetitive behaviors may differentiate children who develop autism spectrum disorder (ASD) by late infancy. How these core symptoms manifest early in life, particularly among infants at high-risk for the disorder, is not well characterized. Methods Prospective, longitudinal parent-report data (Repetitive Behavior Scales-Revised) were collected for 190 high-risk toddlers and 60 low-risk controls from 12 to 24 months age. Forty-one high-risk children were classified with ASD at age 2. Profiles of repetitive behavior were compared between groups using generalized estimating equations. Results Longitudinal profiles for children diagnosed with ASD differed significantly from high- and low-risk children without the disorder on all measures of repetitive behavior. High-risk toddlers without ASD were intermediate to low-risk and ASD positive counterparts. Toddlers with ASD showed significantly higher rates of repetitive behavior across subtypes at the 12 month time point. Repetitive behaviors were significantly correlated with adaptive behavior and socialization scores among children with ASD at 24 months-age but were largely unrelated to measures of general cognitive ability. Conclusions These findings suggest that as early as 12 months age, a broad range of repetitive behaviors are highly elevated in children who go on to develop ASD. While some degree of repetitive behavior is elemental to typical early development, the extent of these behaviors among children who develop ASD appears highly atypical. PMID:24552513

  18. Evidence-Based Behavioral Interventions for Repetitive Behaviors in Autism

    ERIC Educational Resources Information Center

    Boyd, Brian A.; McDonough, Stephen G.; Bodfish, James W.

    2012-01-01

    Restricted and repetitive behaviors (RRBs) are a core symptom of autism spectrum disorders (ASD). There has been an increased research emphasis on repetitive behaviors; however, this research primarily has focused on phenomenology and mechanisms. Thus, the knowledge base on interventions is lagging behind other areas of research. The literature…

  19. Pre-Lexical Disorders in Repetition Conduction Aphasia

    ERIC Educational Resources Information Center

    Sidiropoulos, Kyriakos; de Bleser, Ria; Ackermann, Hermann; Preilowski, Bruno

    2008-01-01

    At the level of clinical speech/language evaluation, the repetition type of conduction aphasia is characterized by repetition difficulties concomitant with reduced short-term memory capacities, in the presence of fluent spontaneous speech as well as unimpaired naming and reading abilities. It is still unsettled which dysfunctions of the…

  20. A Negative Effect of Repetition in Episodic Memory

    ERIC Educational Resources Information Center

    Peterson, Daniel J.; Mulligan, Neil W.

    2012-01-01

    One of the foundational principles of human memory is that repetition (i.e., being presented with a stimulus multiple times) improves recall. In the current study a group of participants who studied a list of cue-target pairs twice recalled fewer targets than a group who studied the pairs only once, a negative repetition effect. Such a…

  1. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  2. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  3. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  4. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  5. 10 CFR 63.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 63.23 Section 63.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN A GEOLOGIC REPOSITORY AT YUCCA MOUNTAIN, NEVADA Licenses License Application § 63.23 Elimination of repetition. In...

  6. Selecting appropriate designs and comparison conditions in repetition paradigms.

    PubMed

    Feuerriegel, Daniel

    2016-07-01

    The studies described by Vogels (this issue) demonstrate the complexity of repetition effects in the visual processing stream. In addition to signal suppression, findings of inherited effects from earlier processing, and discrepancies between the stimulus selectivity of cells before and after repetition, have informed the inferences that can be drawn from measures over larger scales such as functional magnetic resonance imaging (fMRI) or electroencephalography (EEG). This work also demonstrates that integration of evidence across recording methods is vital for understanding repetition effects in the brain. It is however difficult to integrate evidence across different recording methods and repetition paradigms. At the crux of this difficulty is the selection of comparison or unrepeated stimulus conditions within paradigms, which influence the observed strength, selectivity and even direction of repetition effects. This viewpoint highlights prevalent methodological issues with regard to repeated-unrepeated stimulus comparisons: inherited adaptation, stimulus specific expectations, concurrent memory retrieval, stimulus novelty and familiarity, attention, and changes in neuronal selectivity with repetition. The extent to which current conflicting and uncertain findings are due to selection of unrepeated stimulus conditions is unknown, but needs to be addressed to develop models of repetition spanning recording methods and repetition paradigms. PMID:26654854

  7. Conversational Characteristics of Children with Fragile X Syndrome: Repetitive Speech.

    ERIC Educational Resources Information Center

    Belser, Richard C.; Sudhalter, Vicki

    2001-01-01

    Comparison of the production of repetitive speech during conversations in 30 people with either fragile X syndrome, autistic disorder, or mental retardation not caused by fragile X found repetitive speech more prevalent among those with fragile X. Results support the hypothesis that such speech dysfluency reflects the effects of physiological…

  8. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  9. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  10. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  11. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  12. 10 CFR 60.23 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 60.23 Section 60.23 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) DISPOSAL OF HIGH-LEVEL RADIOACTIVE WASTES IN GEOLOGIC REPOSITORIES Licenses License Applications § 60.23 Elimination of repetition. In its application,...

  13. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  14. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 10 Energy 2 2014-01-01 2014-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  15. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 10 Energy 2 2012-01-01 2012-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  16. 10 CFR 52.8 - Combining licenses; elimination of repetition.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 10 Energy 2 2013-01-01 2013-01-01 false Combining licenses; elimination of repetition. 52.8 Section 52.8 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS General Provisions § 52.8 Combining licenses; elimination of repetition. (a)...

  17. Early Grade Repetition and Inattention Associated with Neurofibromatosis Type 1

    ERIC Educational Resources Information Center

    Coude, Francois X.; Mignot, Claire; Lyonnet, Stanislas; Munnich, Arnold

    2007-01-01

    Objective: The authors analyze the occurrence of grade repetition and inattention in children diagnosed with neurofibromatosis type 1 (NF1). Method: The participant group consisted of 310 patients with NF1 and a control group of 242 individuals. The number of grade repetitions for each participant during his or her time in elementary, middle, and…

  18. Nonword Repetition and Speech Motor Control in Children

    PubMed Central

    Reuterskiöld, Christina; Grigos, Maria I.

    2015-01-01

    This study examined how familiarity of word structures influenced articulatory control in children and adolescents during repetition of real words (RWs) and nonwords (NWs). A passive reflective marker system was used to track articulator movement. Measures of accuracy were obtained during repetition of RWs and NWs, and kinematic analysis of movement duration and variability was conducted. Participants showed greater consonant and vowel accuracy during RW than NW repetition. Jaw movement duration was longer in NWs compared to RWs across age groups, and younger children produced utterances with longer jaw movement duration compared to older children. Jaw movement variability was consistently greater during repetition of NWs than RWs in both groups of participants. The results indicate that increases in phonological short-term memory demands affect articulator movement. This effect is most pronounced in younger children. A range of skills may develop during childhood, which supports NW repetition skills. PMID:26557688

  19. Repetition priming of nonwords in young and older adults.

    PubMed

    Light, L L; La Voie, D; Kennison, R

    1995-03-01

    In 3 experiments, a pronunciation task was used to examine repetition priming of novel nonwords in young and older adults. The contributions of item and associative priming to the total repetition priming effect were assessed. In Experiment 1, age consistency was found in both components of repetition priming after 9 repetitions of nonwords. Experiment 2 established that young and older adults were similar in item and associative priming after as few as 2 repetitions of nonwords. Finally, Experiment 3 demonstrated that associative priming persists for at least 3 min and that it is dissociable from cued recall. The overall pattern of results strongly argues that elaborative processing is not necessary to obtain associative priming in indirect memory tasks and that young and older adults show similar magnitudes of associative priming. PMID:7738504

  20. Repetition suppression and its contextual determinants in predictive coding.

    PubMed

    Auksztulewicz, Ryszard; Friston, Karl

    2016-07-01

    This paper presents a review of theoretical and empirical work on repetition suppression in the context of predictive coding. Predictive coding is a neurobiologically plausible scheme explaining how biological systems might perform perceptual inference and learning. From this perspective, repetition suppression is a manifestation of minimising prediction error through adaptive changes in predictions about the content and precision of sensory inputs. Simulations of artificial neural hierarchies provide a principled way of understanding how repetition suppression - at different time scales - can be explained in terms of inference and learning implemented under predictive coding. This formulation of repetition suppression is supported by results of numerous empirical studies of repetition suppression and its contextual determinants. PMID:26861557

  1. Repetition and Emotive Communication in Music Versus Speech

    PubMed Central

    Margulis, Elizabeth Hellmuth

    2013-01-01

    Music and speech are often placed alongside one another as comparative cases. Their relative overlaps and disassociations have been well explored (e.g., Patel, 2008). But one key attribute distinguishing these two domains has often been overlooked: the greater preponderance of repetition in music in comparison to speech. Recent fMRI studies have shown that familiarity – achieved through repetition – is a critical component of emotional engagement with music (Pereira et al., 2011). If repetition is fundamental to emotional responses to music, and repetition is a key distinguisher between the domains of music and speech, then close examination of the phenomenon of repetition might help clarify the ways that music elicits emotion differently than speech. PMID:23576998

  2. Repetition is easy: Why repeated referents have reduced prominence

    PubMed Central

    Lam, Tuan Q.; Watson, Duane G.

    2011-01-01

    The repetition and predictability of a word in a conversation are two factors that are believed to affect whether or not it is emphasized: predictable, repeated words are less acoustically prominent than unpredictable, new words. However, because predictability and repetition are correlated, it is unclear whether speakers lengthen unpredictable words to facilitate comprehension or whether this lengthening is the result of difficulties in accessing a new (non-repeated) lexical item. In this paper, we investigate the relationship between acoustic prominence, repetition, and predictability in a description task. In Experiment 1, we find that repeated referents are produced with reduced prominence, even when these referents are unexpected. In Experiment 2, we find that predictability and repetition both have independent effects on duration and intensity. However, word duration was primarily determined by repetition, and intensity was primarily determined by predictability. The data are most consistent with an account in which multiple cognitive factors influence the acoustic prominence of a word. PMID:21156876

  3. Transgenerational effects of environmental enrichment on repetitive motor behavior development.

    PubMed

    Bechard, Allison R; Lewis, Mark H

    2016-07-01

    The favorable consequences of environmental enrichment (EE) on brain and behavior development are well documented. Much less is known, however, about transgenerational benefits of EE on non-enriched offspring. We explored whether transgenerational effects of EE might extend to the development of repetitive motor behaviors in deer mice. Repetitive motor behaviors are invariant patterns of movement that, across species, can be reduced by EE. We found that EE not only attenuated the development of repetitive behavior in dams, but also in their non-enriched offspring. Moreover, maternal behavior did not seem to mediate the transgenerational effect we found, although repetitive behavior was affected by reproductive experience. These data support a beneficial transgenerational effect of EE on repetitive behavior development and suggest a novel benefit of reproductive experience. PMID:27059336

  4. Large repetitively Q-switched oscillators

    NASA Astrophysics Data System (ADS)

    Epstein, H. M.; Dulaney, J. L.; O'Loughlin, J. F.; Altman, W. P.

    A versatile waveform laser which can operate in bursts from 5 to 160 ms long and deliver up to 30 kJ power burst has been constructed. This Nd:glass laser system consists of four oscillators in parallel. Each oscillator can be varied in length from about 3 to 10 m, and contains two pump heads 670 mm long by 64 mm in diameter phosphate glass laser rods. When trains of Q-switched pulses are required, 70 mm diameter Pockels cells and dielectric polarizers are added to the oscillator cavity. The basic burst duration of 5 ms can be stretched to 10, 20, 40, 80,and 160 ms by sequencing the firing of flashlamps, with the longest pulse length attained by sequentially firing 1/4 heads. Trains of Q-switched pulses up to 10 kHz in repetition rate and 50 to 900 ns wide can be obtained by varying the cavity configuration and Pockels cell firing rate. Spatial distributions are flat-topped within about 10 percent. Overall efficiency for the oscillator with a CW waveform can exceed 4.8 percent.

  5. The repetition of large-earthquake ruptures.

    PubMed Central

    Sieh, K

    1996-01-01

    This survey of well-documented repeated fault rupture confirms that some faults have exhibited a "characteristic" behavior during repeated large earthquakes--that is, the magnitude, distribution, and style of slip on the fault has repeated during two or more consecutive events. In two cases faults exhibit slip functions that vary little from earthquake to earthquake. In one other well-documented case, however, fault lengths contrast markedly for two consecutive ruptures, but the amount of offset at individual sites was similar. Adjacent individual patches, 10 km or more in length, failed singly during one event and in tandem during the other. More complex cases of repetition may also represent the failure of several distinct patches. The faults of the 1992 Landers earthquake provide an instructive example of such complexity. Together, these examples suggest that large earthquakes commonly result from the failure of one or more patches, each characterized by a slip function that is roughly invariant through consecutive earthquake cycles. The persistence of these slip-patches through two or more large earthquakes indicates that some quasi-invariant physical property controls the pattern and magnitude of slip. These data seem incompatible with theoretical models that produce slip distributions that are highly variable in consecutive large events. Images Fig. 3 Fig. 7 Fig. 9 PMID:11607662

  6. Repetitive Interrogation of 2-Level Quantum Systems

    NASA Technical Reports Server (NTRS)

    Prestage, John D.; Chung, Sang K.

    2010-01-01

    Trapped ion clocks derive information from a reference atomic transition by repetitive interrogations of the same quantum system, either a single ion or ionized gas of many millions of ions. Atomic beam frequency standards, by contrast, measure reference atomic transitions in a continuously replenished "flow through" configuration where initial ensemble atomic coherence is zero. We will describe some issues and problems that can arise when atomic state selection and preparation of the quantum atomic system is not completed, that is, optical pumping has not fully relaxed the coherence and also not fully transferred atoms to the initial state. We present a simple two-level density matrix analysis showing how frequency shifts during the state-selection process can cause frequency shifts of the measured clock transition. Such considerations are very important when a low intensity lamp light source is used for state selection, where there is relatively weak relaxation and re-pumping of ions to an initial state and much weaker 'environmental' relaxation of the atomic coherence set-up in the atomic sample.

  7. Repetitive elements regulate circular RNA biogenesis

    PubMed Central

    Wilusz, Jeremy E

    2015-01-01

    It was long assumed that eukaryotic precursor mRNAs (pre-mRNAs) are almost always spliced to generate a linear mRNA that is subsequently translated to produce a protein. However, it is now clear that thousands of protein-coding genes can be non-canonically spliced to produce circular noncoding RNAs, some of which are expressed at much higher levels than their associated linear mRNAs. How then does the splicing machinery decide whether to generate a linear mRNA or a circular RNA? Recent work has revealed that intronic repetitive elements, including sequences derived from transposons, are critical regulators of this decision. In most cases, circular RNA biogenesis appears to be initiated when complementary sequences from 2 different introns base pair to one another. This brings the splice sites from the intervening exon(s) into close proximity and facilitates the backsplicing event that generates the circular RNA. As many pre-mRNAs contain multiple intronic repeats, distinct circular transcripts can be produced depending on which repeats base pair to one another. Intronic repeats are thus critical regulatory sequences that control the functional output of their host genes, and potentially cause the functions of protein-coding genes to be highly divergent across species. PMID:26442181

  8. SI Engine with repetitive NS spark plug

    NASA Astrophysics Data System (ADS)

    Pancheshniy, Sergey; Nikipelov, Andrey; Anokhin, Eugeny; Starikovskiy, Andrey; Laplase Team; Mipt Team; Pu Team

    2013-09-01

    Now de-facto the only technology for fuel-air mixtures ignition in IC engines exists. It is a spark discharge of millisecond duration in a short discharge gap. The reason for such a small variety of methods of ignition initiation is very specific conditions of the engine operation. First, it is very high-pressure of fuel-air mixture - from 5-7 atmospheres in old-type engines and up to 40-50 atmospheres on the operating mode of HCCI. Second, it is a very wide range of variation of the oxidizer/fuel ratio in the mixture - from almost stoichiometric (0.8-0.9) at full load to very lean (φ = 0.3-0.5) mixtures at idle and/or economical cruising mode. Third, the high velocity of the gas in the combustion chamber (up to 30-50 m/s) resulting in a rapid compression of swirling inlet flow. The paper presents the results of tests of distributed spark ignition system powered by repetitive pulse nanosecond discharge. Dynamic pressure measurements show the increased pressure and frequency stability for nanosecond excitation in comparison with the standard spark plug. Excitation by single nanosecond high-voltage pulse and short train of pulses was examined. In all regimes the nanosecond pulsed excitation demonstrate a better performance.

  9. A chenopod extensin lacks repetitive tetrahydroxyproline blocks

    SciTech Connect

    Li, Xiongbiao; Kieliszewski, M.; Lamport, D.T.A. )

    1990-02-01

    An extensin isolated from sugar beet (Beta vulgaris) cell suspension cultures fulfills all criteria for membership of the extensin family save one, notably, lack of the diagnostic pentamer Ser-Hyp-Hyp-Hyp-Hyp. However, sequence analysis of the major tryptic peptides shows that sugar beet extensin shares a motif in common with tomato extensin P1 but differs by the position of an insertion sequence (X) or (Y) which, in sugar beet, splits the tetrahydroxyproline block: Ser-Hyp-Hyp-(X)-Hyp-Hyp-Thr-Hyp-Val-Tyr-Lys, where (X) is (Val-His-Glu/Lys-Tyr-Pro), while in tomato the insertion sequence (Y) = (Val-Lys-Pro-Tyr-His-Pro) and, when it occurs, immediately follows the tetrahydroxyproline block: Ser-Hyp-Hyp-Hyp-Hyp-(Y)-Thr-Hyp-Val-Tyr-Lys. Based on these data were reinterpret three highly repetitive cDNA sequences, including nodulin N75 from soybean and wound-induced P33 of carrot, as extensins with split tetra(hydroxy)proline blocks.

  10. Understanding communicative actions: a repetitive TMS study.

    PubMed

    Stolk, Arjen; Noordzij, Matthijs L; Volman, Inge; Verhagen, Lennart; Overeem, Sebastiaan; van Elswijk, Gijs; Bloem, Bas; Hagoort, Peter; Toni, Ivan

    2014-02-01

    Despite the ambiguity inherent in human communication, people are remarkably efficient in establishing mutual understanding. Studying how people communicate in novel settings provides a window into the mechanisms supporting the human competence to rapidly generate and understand novel shared symbols, a fundamental property of human communication. Previous work indicates that the right posterior superior temporal sulcus (pSTS) is involved when people understand the intended meaning of novel communicative actions. Here, we set out to test whether normal functioning of this cerebral structure is required for understanding novel communicative actions using inhibitory low-frequency repetitive transcranial magnetic stimulation (rTMS). A factorial experimental design contrasted two tightly matched stimulation sites (right pSTS vs left MT+, i.e., a contiguous homotopic task-relevant region) and tasks (a communicative task vs a visual tracking task that used the same sequences of stimuli). Overall task performance was not affected by rTMS, whereas changes in task performance over time were disrupted according to TMS site and task combinations. Namely, rTMS over pSTS led to a diminished ability to improve action understanding on the basis of recent communicative history, while rTMS over MT+ perturbed improvement in visual tracking over trials. These findings qualify the contributions of the right pSTS to human communicative abilities, showing that this region might be necessary for incorporating previous knowledge, accumulated during interactions with a communicative partner, to constrain the inferential process that leads to action understanding. PMID:24268321

  11. Development of a repetitive compact torus injector

    NASA Astrophysics Data System (ADS)

    Onchi, Takumi; McColl, David; Dreval, Mykola; Rohollahi, Akbar; Xiao, Chijin; Hirose, Akira; Zushi, Hideki

    2013-10-01

    A system for Repetitive Compact Torus Injection (RCTI) has been developed at the University of Saskatchewan. CTI is a promising fuelling technology to directly fuel the core region of tokamak reactors. In addition to fuelling, CTI has also the potential for (a) optimization of density profile and thus bootstrap current and (b) momentum injection. For steady-state reactor operation, RCTI is necessary. The approach to RCTI is to charge a storage capacitor bank with a large capacitance and quickly charge the CT capacitor bank through a stack of integrated-gate bipolar transistors (IGBTs). When the CT bank is fully charged, the IGBT stack will be turned off to isolate banks, and CT formation/acceleration sequence will start. After formation of each CT, the fast bank will be replenished and a new CT will be formed and accelerated. Circuits for the formation and the acceleration in University of Saskatchewan CT Injector (USCTI) have been modified. Three CT shots at 10 Hz or eight shots at 1.7 Hz have been achieved. This work has been sponsored by the CRC and NSERC, Canada.

  12. Identifying Host Sources of Fecal Pollution: Diversity of Escherichia coli in Confined Dairy and Swine Production Systems

    PubMed Central

    Lu, Zexun; Lapen, David; Scott, Andrew; Dang, Angela; Topp, Edward

    2005-01-01

    Repetitive extragenic palindromic PCR fingerprinting of Escherichia coli is one microbial source tracking approach for identifying the host source origin of fecal pollution in aquatic systems. The construction of robust known-source libraries is expensive and requires an informed sampling strategy. In many types of farming systems, waste is stored for several months before being released into the environment. In this study we analyzed, by means of repetitive extragenic palindromic PCR using the enterobacterial repetitive intergenic consensus primers and comparative analysis using the Bionumerics software, collections of E. coli obtained from a dairy farm and from a swine farm, both of which stored their waste as a slurry in holding tanks. In all fecal samples, obtained from either barns or holding tanks, the diversity of the E. coli populations was underrepresented by collections of 500 isolates. In both the dairy and the swine farms, the diversity of the E. coli community was greater in the manure holding tank than in the barn, when they were sampled on the same date. In both farms, a comparison of stored manure samples collected several months apart suggested that the community composition changed substantially in terms of the detected number, absolute identity, and relative abundance of genotypes. Comparison of E. coli populations obtained from 10 different locations in either holding tank suggested that spatial variability in the E. coli community should be accounted for when sampling. Overall, the diversity in E. coli populations in manure slurry storage facilities is significant and likely is problematic with respect to library construction for microbial source tracking applications. PMID:16204513

  13. Can the Edinburgh Risk of Repetition Scale Predict Repetition of Deliberate Self-Poisoning in an Australian Clinical Setting?

    ERIC Educational Resources Information Center

    Carter, Gregory Leigh; Clover, Kerrie Ann; Bryant, Jennifer Lynn; Whyte, Ian MacGregor

    2002-01-01

    Tests the ability of the Edinburgh Risk of Repetition Scale (ERRS) to identify patients at high risk for repeat deliberate self-poisoning (DSP). A statistically significant relationship between ERRS scores and repetition was observed; however, sensitivity and specificity were low. The ERRS had limited value in identifying patients at high risk of…

  14. Repetition suppression of faces is modulated by emotion

    NASA Astrophysics Data System (ADS)

    Ishai, Alumit; Pessoa, Luiz; Bikle, Philip C.; Ungerleider, Leslie G.

    2004-06-01

    Single-unit recordings and functional brain imaging studies have shown reduced neural responses to repeated stimuli in the visual cortex. By using event-related functional MRI, we compared the activation evoked by repetitions of neutral and fearful faces, which were either task relevant (targets) or irrelevant (distracters). We found that within the inferior occipital gyri, lateral fusiform gyri, superior temporal sulci, amygdala, and the inferior frontal gyri/insula, targets evoked stronger responses than distracters and their repetition was associated with significantly reduced responses. Repetition suppression, as manifested by the difference in response amplitude between the first and third repetitions of a target, was stronger for fearful than neutral faces. Distracter faces, regardless of their repetition or valence, evoked negligible activation, indicating top-down attenuation of behaviorally irrelevant stimuli. Our findings demonstrate a three-way interaction between emotional valence, repetition, and task relevance and suggest that repetition suppression is influenced by high-level cognitive processes in the human brain. face perception | functional MRI

  15. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    PubMed

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. PMID:27317429

  16. Clustered regulatory interspaced short palindromic repeats (CRISPR)-mediated mutagenesis and phenotype rescue by piggyBac transgenesis in a nonmodel Drosophila species.

    PubMed

    Tanaka, R; Murakami, H; Ote, M; Yamamoto, D

    2016-08-01

    How behavioural diversity emerged in evolution is an unexplored subject in biology. To tackle this problem, genes and circuits for a behaviour need to be determined in different species for phylogenetic comparisons. The recently developed clustered regulatory interspaced short palindromic repeats/CRISPR associated protein9 (CRISPR/Cas9) system made such a challenge possible by providing the means to induce mutations in a gene of interest in any organism. Aiming at elucidating diversification in genetic and neural networks for courtship behaviour, we attempted to generate a genetic tool kit in Drosophila subobscura, a nonmodel species distantly related to the genetic model Drosophila melanogaster. Here we report the generation of yellow (y) and white mutations with the aid of the CRISPR/Cas9 system, and the rescue of the y mutant phenotype by germline transformation of the newly established y mutant fly line with a y(+) -marked piggyBac vector. This successful mutagenesis and transformation in D. subobscura open up an avenue for comprehensive genetic analyses of higher functions in this and other nonmodel Drosophila species, representing a key step toward systematic comparisons of genes and circuitries underlying behaviour amongst species. PMID:27015359

  17. Crystal Structure of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated Csn2 Protein Revealed Ca[superscript 2+]-dependent Double-stranded DNA Binding Activity

    SciTech Connect

    Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong

    2012-05-22

    Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.

  18. Subtyping Salmonella enterica serovar enteritidis isolates from different sources by using sequence typing based on virulence genes and clustered regularly interspaced short palindromic repeats (CRISPRs).

    PubMed

    Liu, Fenyun; Kariyawasam, Subhashinie; Jayarao, Bhushan M; Barrangou, Rodolphe; Gerner-Smidt, Peter; Ribot, Efrain M; Knabel, Stephen J; Dudley, Edward G

    2011-07-01

    Salmonella enterica subsp. enterica serovar Enteritidis is a major cause of food-borne salmonellosis in the United States. Two major food vehicles for S. Enteritidis are contaminated eggs and chicken meat. Improved subtyping methods are needed to accurately track specific strains of S. Enteritidis related to human salmonellosis throughout the chicken and egg food system. A sequence typing scheme based on virulence genes (fimH and sseL) and clustered regularly interspaced short palindromic repeats (CRISPRs)-CRISPR-including multi-virulence-locus sequence typing (designated CRISPR-MVLST)-was used to characterize 35 human clinical isolates, 46 chicken isolates, 24 egg isolates, and 63 hen house environment isolates of S. Enteritidis. A total of 27 sequence types (STs) were identified among the 167 isolates. CRISPR-MVLST identified three persistent and predominate STs circulating among U.S. human clinical isolates and chicken, egg, and hen house environmental isolates in Pennsylvania, and an ST that was found only in eggs and humans. It also identified a potential environment-specific sequence type. Moreover, cluster analysis based on fimH and sseL identified a number of clusters, of which several were found in more than one outbreak, as well as 11 singletons. Further research is needed to determine if CRISPR-MVLST might help identify the ecological origins of S. Enteritidis strains that contaminate chickens and eggs. PMID:21571881

  19. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high-affinity interaction.

    PubMed

    Trainor, C D; Omichinski, J G; Vandergon, T L; Gronenborn, A M; Clore, G M; Felsenfeld, G

    1996-05-01

    GATA-1, a transcription factor essential for the development of the erythroid lineage, contains two adjacent highly conserved zinc finger motifs. The carboxy-terminal finger is necessary and sufficient for specific binding to the consensus GATA recognition sequence: mutant proteins containing only the amino-terminal finger do not bind. Here we identify a DNA sequence (GATApal) for which the GATA-1 amino-terminal finger makes a critical contribution to the strength of binding. The site occurs in the GATA-1 gene promoters of chickens, mice, and humans but occurs very infrequently in other vertebrate genes known to be regulated by GATA proteins. GATApal is a palindromic site composed of one complete [(A/T)GATA(A/G)] and one partial (GAT) canonical motif. Deletion of the partial motif changes the site to a normal GATA site and also reduces by as much as eightfold the activity of the GATA-1 promoter in an erythroid precursor cell. We propose that GATApal is important for positive regulation of GATA-1 expression in erythroid cells. PMID:8628290

  20. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  1. Use of cellular CRISPR (clusters of regularly interspaced short palindromic repeats) spacer-based microarrays for detection of viruses in environmental samples.

    PubMed

    Snyder, Jamie C; Bateson, Mary M; Lavin, Matthew; Young, Mark J

    2010-11-01

    It is currently difficult to detect unknown viruses in any given environment. The recent discovery of CRISPR (clusters of regularly interspaced short palindromic repeats) loci within bacterial and archaeal cellular genomes may provide an alternative approach to detect new viruses. It has been shown that the spacer sequences between the direct repeat units of the CRISPR loci are often derived from viruses and likely function as guide sequences to protect the cell from viral infection. The spacer sequences within the CRISPR loci may therefore serve as a record of the viruses that have replicated within the cell. We have cataloged the CRISPR spacer sequences from cellular metagenomic data from high-temperature (>80°C), acidic (pH < 4) hot spring environments located in Yellowstone National Park (YNP). We designed a microarray platform utilizing these CRISPR spacer sequences as potential probes to detect viruses present in YNP hot spring environments. We show that this microarray approach can detect viral sequences directly from virus-enriched environmental samples, detecting new viruses which have not been previously characterized. We further demonstrated that this microarray approach can be used to examine temporal changes in viral populations within the environment. Our results demonstrate that CRISPR spacer sequence-based microarrays will be useful tools for detecting and monitoring viruses from diverse environmental samples. PMID:20851987

  2. An active immune defense with a minimal CRISPR (clustered regularly interspaced short palindromic repeats) RNA and without the Cas6 protein.

    PubMed

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J; Backofen, Rolf; Marchfelder, Anita

    2015-02-13

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3' handle are still active in triggering an interference reaction. The complete 3' handle could be removed without loss of activity. However, manipulations of the 5' handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  3. An Active Immune Defense with a Minimal CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) RNA and without the Cas6 Protein*

    PubMed Central

    Maier, Lisa-Katharina; Stachler, Aris-Edda; Saunders, Sita J.; Backofen, Rolf; Marchfelder, Anita

    2015-01-01

    The prokaryotic immune system CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) is a defense system that protects prokaryotes against foreign DNA. The short CRISPR RNAs (crRNAs) are central components of this immune system. In CRISPR-Cas systems type I and III, crRNAs are generated by the endonuclease Cas6. We developed a Cas6b-independent crRNA maturation pathway for the Haloferax type I-B system in vivo that expresses a functional crRNA, which we termed independently generated crRNA (icrRNA). The icrRNA is effective in triggering degradation of an invader plasmid carrying the matching protospacer sequence. The Cas6b-independent maturation of the icrRNA allowed mutation of the repeat sequence without interfering with signals important for Cas6b processing. We generated 23 variants of the icrRNA and analyzed them for activity in the interference reaction. icrRNAs with deletions or mutations of the 3′ handle are still active in triggering an interference reaction. The complete 3′ handle could be removed without loss of activity. However, manipulations of the 5′ handle mostly led to loss of interference activity. Furthermore, we could show that in the presence of an icrRNA a strain without Cas6b (Δcas6b) is still active in interference. PMID:25512373

  4. Repetition enhancement and memory effects for duration.

    PubMed

    Wiener, Martin; Thompson, James C

    2015-06-01

    A remarkable aspect of conscious perception is that moments carryover from one to the next, also known as temporal continuity. This ability is thus crucial for detecting regularities, such as in speech and music, and may rely on an accurate perception of time. Investigations of human time perception have detailed two electroencephalographic (EEG) components associated with timing, the contingent negative variation (CNV) and late positive component of timing (LPCt); however, the precise roles of these components in timing remain elusive. Recently, we demonstrated that the perception of duration is influenced by durations presented on prior trials, which we explained by the creation of an implicit memory standard that adapts to local changes in sequence presentation. Here, we turn to the neural basis of this effect. Human participants performed a temporal bisection task in which they were required to classify the duration of auditory stimuli into short and long duration categories; crucially, the presentation order was first-order counterbalanced, allowing us to measure the effect of each presented duration on the next. EEG recordings revealed that the CNV and LPCt signals both covaried with the duration presented on the current trial, with CNV predicting reaction time and LPCt predicting choice. Additionally, both signals covaried with the duration presented in the prior trial but in different ways, with the CNV amplitude reflecting the change in the memory standard and the LPCt reflecting decision uncertainty. Furthermore, we observed a repetition enhancement effect of duration only for the CNV, suggesting that this signal additionally indexes the similarity of successive durations. These findings demonstrate dissociable roles for the CNV and LPCt, and demonstrate that both signals are continuously updated on a trial-by-trial basis that reflects shifts in temporal decisions. PMID:25818689

  5. Epithelial topography for repetitive tooth formation

    PubMed Central

    Gaete, Marcia; Fons, Juan Manuel; Popa, Elena Mădălina; Chatzeli, Lemonia; Tucker, Abigail S.

    2015-01-01

    ABSTRACT During the formation of repetitive ectodermally derived organs such as mammary glands, lateral line and teeth, the tissue primordium iteratively initiates new structures. In the case of successional molar development, new teeth appear sequentially in the posterior region of the jaw from Sox2+ cells in association with the posterior aspect of a pre-existing tooth. The sequence of molar development is well known, however, the epithelial topography involved in the formation of a new tooth is unclear. Here, we have examined the morphology of the molar dental epithelium and its development at different stages in the mouse in vivo and in molar explants. Using regional lineage tracing we show that within the posterior tail of the first molar the primordium for the second and third molar are organized in a row, with the tail remaining in connection with the surface, where a furrow is observed. The morphology and Sox2 expression of the tail retains characteristics reminiscent of the earlier stages of tooth development, such that position along the A-P axes of the tail correlates with different temporal stages. Sox9, a stem/progenitor cell marker in other organs, is expressed mainly in the suprabasal epithelium complementary with Sox2 expression. This Sox2 and Sox9 expressing molar tail contains actively proliferating cells with mitosis following an apico-basal direction. Snail2, a transcription factor implicated in cell migration, is expressed at high levels in the tip of the molar tail while E-cadherin and laminin are decreased. In conclusion, our studies propose a model in which the epithelium of the molar tail can grow by posterior movement of epithelial cells followed by infolding and stratification involving a population of Sox2+/Sox9+ cells. PMID:26538639

  6. Epithelial topography for repetitive tooth formation.

    PubMed

    Gaete, Marcia; Fons, Juan Manuel; Popa, Elena Mădălina; Chatzeli, Lemonia; Tucker, Abigail S

    2015-01-01

    During the formation of repetitive ectodermally derived organs such as mammary glands, lateral line and teeth, the tissue primordium iteratively initiates new structures. In the case of successional molar development, new teeth appear sequentially in the posterior region of the jaw from Sox2(+) cells in association with the posterior aspect of a pre-existing tooth. The sequence of molar development is well known, however, the epithelial topography involved in the formation of a new tooth is unclear. Here, we have examined the morphology of the molar dental epithelium and its development at different stages in the mouse in vivo and in molar explants. Using regional lineage tracing we show that within the posterior tail of the first molar the primordium for the second and third molar are organized in a row, with the tail remaining in connection with the surface, where a furrow is observed. The morphology and Sox2 expression of the tail retains characteristics reminiscent of the earlier stages of tooth development, such that position along the A-P axes of the tail correlates with different temporal stages. Sox9, a stem/progenitor cell marker in other organs, is expressed mainly in the suprabasal epithelium complementary with Sox2 expression. This Sox2 and Sox9 expressing molar tail contains actively proliferating cells with mitosis following an apico-basal direction. Snail2, a transcription factor implicated in cell migration, is expressed at high levels in the tip of the molar tail while E-cadherin and laminin are decreased. In conclusion, our studies propose a model in which the epithelium of the molar tail can grow by posterior movement of epithelial cells followed by infolding and stratification involving a population of Sox2(+)/Sox9(+) cells. PMID:26538639

  7. Repetitive XUV laser based on the fast capillary discharge

    NASA Astrophysics Data System (ADS)

    Schmidt, Jiri; Kolacek, Karel; Frolov, Oleksandr; Prukner, Vaclav; Straus, Jaroslav

    2011-09-01

    For testing and application purposes we have built a new small Marx generator capable to run in a repetitive regime. Its repeating frequency is currently up to 1 Hz. The generator is covered by metal sheets and feeds the CAPEX facility and ensures its full independence on the CAPEX-U machine (using another Marx generator). This paper reports on the first experimental results of a new experimental set-up of the CAPEX apparatus (repetitive lasing at 46.9 nm), mainly on set-up description, electrical parameters, and laser pulse stability in the repetitive regime.

  8. The non-palindromic adaptor-PCR method for the identification of the T-cell receptor genes of an interferon-gamma-secreting T-cell hybridomaspecific for trans-sialidase, an immunodominant Trypanosoma cruzi antigen.

    PubMed

    Hiyane, M I; Boscardin, S B; Rodrigues, M M

    2006-03-01

    Cloning of the T-cell receptor genes is a critical step when generating T-cell receptor transgenic mice. Because T-cell receptor molecules are clonotypical, isolation of their genes requires reverse transcriptase-assisted PCR using primers specific for each different Valpha or Vbeta genes or by the screening of cDNA libraries generated from RNA obtained from each individual T-cell clone. Although feasible, these approaches are laborious and costly. The aim of the present study was to test the application of the non-palindromic adaptor-PCR method as an alternative to isolate the genes encoding the T-cell receptor of an antigen-specific T-cell hybridoma. For this purpose, we established hybridomas specific for trans-sialidase, an immunodominant Trypanosoma cruzi antigen. These T-cell hybridomas were characterized with regard to their ability to secrete interferon-gamma, IL-4, and IL-10 after stimulation with the antigen. A CD3+, CD4+, CD8- interferon-gamma-producing hybridoma was selected for the identification of the variable regions of the T-cell receptor by the non-palindromic adaptor-PCR method. Using this methodology, we were able to rapidly and efficiently determine the variable regions of both T-cell receptor chains. The results obtained by the non-palindromic adaptor-PCR method were confirmed by the isolation and sequencing of the complete cDNA genes and by the recognition with a specific antibody against the T-cell receptor variable beta chain. We conclude that the non-palindromic adaptor-PCR method can be a valuable tool for the identification of the T-cell receptor transcripts of T-cell hybridomas and may facilitate the generation of T-cell receptor transgenic mice. PMID:16501814

  9. Distractibility during infants' examining and repetitive rhythmic activity.

    PubMed

    Doolittle, E J; Ruff, H A

    1998-05-01

    The goal of this study was to assess the role of examining and repetitive rhythmic activity in infants' exploration of novel objects. Sixteen 8-month-old infants played with novel toys as auditory-visual slide distractors occurred on one side at random intervals. The results showed that examining, but not repetitive activities, declined with exposure to the objects. They also showed that infants had different patterns of distractibility during examining and repetitive rhythmic activities. The infants were slower to turn to the distractor if they were examining the toy than if they were engaged in other activity, but the probability of a response did not differ. In contrast, when engaged in repetitive rhythmic activity, infants were less likely to respond to the distractor than when engaged in other activities, including examining; the speed with which they responded, however, did not differ. The results suggest that, during these two activities, the mechanisms for resisting distraction are quite different. PMID:9589216

  10. Fixture tests bellows reliability through repetitive pressure/temperature cycling

    NASA Technical Reports Server (NTRS)

    Levinson, C.

    1967-01-01

    Fixture explores the reliability of bellows used in precision in inertial systems. The fixture establishes the ability of the bellows to withstand repetitive over-stress pressure cycling at elevated temperatures. It is applicable in quality control and reliability programs.

  11. The Effect of Repetition on Tempo Preferences of Elementary Children.

    ERIC Educational Resources Information Center

    Moskovitz, Elisa M.

    1992-01-01

    Reports on a study of children's preferences between slow and fast tempo classical music excerpts. Finds that students preferred music with a slow tempo. Concludes that repetition had a positive effect on children's preferences. (CFR)

  12. Repetition in visual word identification: benefits and costs.

    PubMed

    Burt, Jennifer S; Kipps, Tahli J; Matthews, Julian R

    2014-10-01

    University students performed lexical tasks with visually presented target words after the presentation of an identical or unrelated prime, at short (80-120 ms) or longer (410-710 ms) prime-target stimulus onset asynchronies (SOAs). Experiment 1 showed perceptual identification benefits in vocal responding at a short SOA that were reduced (accuracy) or reversed (latency) at a longer SOA. Experiment 2 showed a transition from a repetition benefit to a cost over 3 SOAs in a target-masked version of the lexical decision task (LDT; target displayed for only 141 ms). In Experiment 3 the repetition cost was replicated at a 530-ms SOA in the LDT with masked targets, but a repetition benefit was observed in the conventional LDT (target displayed until response). The dependence of repetition costs on target masking is more consistent with biases based on episodic confusions than refractoriness of lexical representations. PMID:25248100

  13. Neural dynamics during repetitive visual stimulation

    NASA Astrophysics Data System (ADS)

    Tsoneva, Tsvetomira; Garcia-Molina, Gary; Desain, Peter

    2015-12-01

    Objective. Steady-state visual evoked potentials (SSVEPs), the brain responses to repetitive visual stimulation (RVS), are widely utilized in neuroscience. Their high signal-to-noise ratio and ability to entrain oscillatory brain activity are beneficial for their applications in brain-computer interfaces, investigation of neural processes underlying brain rhythmic activity (steady-state topography) and probing the causal role of brain rhythms in cognition and emotion. This paper aims at analyzing the space and time EEG dynamics in response to RVS at the frequency of stimulation and ongoing rhythms in the delta, theta, alpha, beta, and gamma bands. Approach.We used electroencephalography (EEG) to study the oscillatory brain dynamics during RVS at 10 frequencies in the gamma band (40-60 Hz). We collected an extensive EEG data set from 32 participants and analyzed the RVS evoked and induced responses in the time-frequency domain. Main results. Stable SSVEP over parieto-occipital sites was observed at each of the fundamental frequencies and their harmonics and sub-harmonics. Both the strength and the spatial propagation of the SSVEP response seem sensitive to stimulus frequency. The SSVEP was more localized around the parieto-occipital sites for higher frequencies (>54 Hz) and spread to fronto-central locations for lower frequencies. We observed a strong negative correlation between stimulation frequency and relative power change at that frequency, the first harmonic and the sub-harmonic components over occipital sites. Interestingly, over parietal sites for sub-harmonics a positive correlation of relative power change and stimulation frequency was found. A number of distinct patterns in delta (1-4 Hz), theta (4-8 Hz), alpha (8-12 Hz) and beta (15-30 Hz) bands were also observed. The transient response, from 0 to about 300 ms after stimulation onset, was accompanied by increase in delta and theta power over fronto-central and occipital sites, which returned to baseline

  14. The Influences of Number of Syllables and Wordlikeness on Children's Repetition of Nonwords.

    ERIC Educational Resources Information Center

    Gathercole, Susan E; And Others

    1991-01-01

    Investigates developmental association between nonword repetition performance and vocabulary knowledge by evaluating the role of phonological memory and linguistic factors in nonword repetition. (29 references) (GLR)

  15. Repetition of Attempted Suicide Among Immigrants in Europe

    PubMed Central

    Lipsicas, Cendrine Bursztein; Mäkinen, Ilkka Henrik; Wasserman, Danuta; Apter, Alan; Kerkhof, Ad; Michel, Konrad; Renberg, Ellinor Salander; van Heeringen, Kees; Värnik, Airi; Schmidtke, Armin

    2014-01-01

    Objectives To compare frequencies of suicide attempt repetition in immigrants and local European populations, and the timing of repetition in these groups. Method: Data from 7 European countries, comprising 10 574 local and 3032 immigrant subjects, were taken from the World Health Organization European Multicentre Study on Suicidal Behaviour and the ensuing Monitoring Suicidal Behaviour in Europe (commonly referred to as MONSUE) project. The relation between immigrant status and repetition of suicide attempt within 12-months following first registered attempt was analyzed with binary logistic regression, controlling for sex, age, and method of attempt. Timing of repetition was controlled for sex, age, and the recommended type of aftercare. Results: Lower odds of repeating a suicide attempt were found in Eastern European (OR 0.50; 95% CI 0.41 to 0.61, P < 0.001) and non-European immigrants (OR 0.68; 95% CI 0.51 to 0.90, P < 0.05), compared with the locals. Similar patterns were identified in the sex-specific analysis. Eastern European immigrants tended to repeat their attempt much later than locals (OR 0.58; 95% CI 0.35 to 0.93, P < 0.05). In general, 32% of all repetition occurred within 30 days. Repetition tended to decrease with age and was more likely in females using harder methods in their index attempt (OR 1.29; 95% CI 1.08 to 1.54, P < 0.01). Large variations in the general repetition frequency were identified between the collecting centres, thus influencing the results. Conclusions: The lower repetition frequencies in non-Western immigrants, compared with locals, in Europe stands in contrast to their markedly higher tendency to attempt suicide in general, possibly pointing to situational stress factors related to their suicidal crisis that are less persistent over time. Our findings also raise the possibility that suicide attempters and repeaters constitute only partially overlapping populations. PMID:25565687

  16. Negative effects of item repetition on source memory

    PubMed Central

    Yi, Do-Joon; Raye, Carol L.; Johnson, Marcia K.

    2013-01-01

    In the present study, we explored how item repetition affects source memory for new item–feature associations (picture–location or picture–color). We presented line drawings varying numbers of times in Phase 1. In Phase 2, each drawing was presented once with a critical new feature. In Phase 3, we tested memory for the new source feature of each item from Phase 2. Experiments 1 and 2 demonstrated and replicated the negative effects of item repetition on incidental source memory. Prior item repetition also had a negative effect on source memory when different source dimensions were used in Phases 1 and 2 (Experiment 3) and when participants were explicitly instructed to learn source information in Phase 2 (Experiments 4 and 5). Importantly, when the order between Phases 1 and 2 was reversed, such that item repetition occurred after the encoding of critical item–source combinations, item repetition no longer affected source memory (Experiment 6). Overall, our findings did not support predictions based on item predifferentiation, within-dimension source interference, or general interference from multiple traces of an item. Rather, the findings were consistent with the idea that prior item repetition reduces attention to subsequent presentations of the item, decreasing the likelihood that critical item–source associations will be encoded. PMID:22411165

  17. Naming and repetition in aphasia: Steps, routes, and frequency effects

    PubMed Central

    Nozari, Nazbanou; Kittredge, Audrey K.; Dell, Gary S.; Schwartz, Myrna F.

    2010-01-01

    This paper investigates the cognitive processes underlying picture naming and auditory word repetition. In the 2-step model of lexical access, both the semantic and phonological steps are involved in naming, but the former has no role in repetition. Assuming recognition of the to-be-repeated word, repetition could consist of retrieving the word’s output phonemes from the lexicon (the lexical-route model), retrieving the output phonology directly from input phonology (the nonlexical-route model) or employing both routes together (the summation dual-route model). We tested these accounts by comparing the size of the word frequency effect (an index of lexical retrieval) in naming and repetition data from 59 aphasic patients with simulations of naming and repetition models. The magnitude of the frequency effect (and the influence of other lexical variables) was found to be comparable in naming and repetition, and equally large for both the lexical and summation dual-route models. However, only the dual-route model was fully consistent with data from patients, suggesting that nonlexical input is added on top of a fully-utilized lexical route. PMID:21076661

  18. Properties of water surface discharge at different pulse repetition rates

    NASA Astrophysics Data System (ADS)

    Ruma, Hosseini, S. H. R.; Yoshihara, K.; Akiyama, M.; Sakugawa, T.; Lukeš, P.; Akiyama, H.

    2014-09-01

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H2O2) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H2O2 and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  19. Properties of water surface discharge at different pulse repetition rates

    SciTech Connect

    Ruma,; Yoshihara, K.; Hosseini, S. H. R. Sakugawa, T.; Akiyama, H.; Akiyama, M.; Lukeš, P.

    2014-09-28

    The properties of water surface discharge plasma for variety of pulse repetition rates are investigated. A magnetic pulse compression (MPC) pulsed power modulator able to deliver pulse repetition rates up to 1000 Hz, with 0.5 J per pulse energy output at 25 kV, was used as the pulsed power source. Positive pulse with a point-to-plane electrode configuration was used for the experiments. The concentration and production yield of hydrogen peroxide (H₂O₂) were quantitatively measured and orange II organic dye was treated, to evaluate the chemical properties of the discharge reactor. Experimental results show that the physical and chemical properties of water surface discharge are not influenced by pulse repetition rate, very different from those observed for under water discharge. The production yield of H₂O₂ and degradation rate per pulse of the dye did not significantly vary at different pulse repetition rates under a constant discharge mode on water surface. In addition, the solution temperature, pH, and conductivity for both water surface and underwater discharge reactors were measured to compare their plasma properties for different pulse repetition rates. The results confirm that surface discharge can be employed at high pulse repetition rates as a reliable and advantageous method for industrial and environmental decontamination applications.

  20. FMRI repetition suppression for voices is modulated by stimulus expectations.

    PubMed

    Andics, Attila; Gál, Viktor; Vicsi, Klára; Rudas, Gábor; Vidnyánszky, Zoltán

    2013-04-01

    According to predictive coding models of sensory processing, stimulus expectations have a profound effect on sensory cortical responses. This was supported by experimental results, showing that fMRI repetition suppression (fMRI RS) for face stimuli is strongly modulated by the probability of stimulus repetitions throughout the visual cortical processing hierarchy. To test whether processing of voices is also affected by stimulus expectations, here we investigated the effect of repetition probability on fMRI RS in voice-selective cortical areas. Changing ('alt') and identical ('rep') voice stimulus pairs were presented to the listeners in blocks, with a varying probability of alt and rep trials across blocks. We found auditory fMRI RS in the nonprimary voice-selective cortical regions, including the bilateral posterior STS, the right anterior STG and the right IFC, as well as in the IPL. Importantly, fMRI RS effects in all of these areas were strongly modulated by the probability of stimulus repetition: auditory fMRI RS was reduced or not present in blocks with low repetition probability. Our results revealed that auditory fMRI RS in higher-level voice-selective cortical regions is modulated by repetition probabilities and thus suggest that in audition, similarly to the visual modality, processing of sensory information is shaped by stimulus expectation processes. PMID:23268783

  1. Isolation of verotoxin-producing Escherichia coli O-rough:K1:H7 from two patients with traveler's diarrhea.

    PubMed Central

    Vila, J; Vargas, M; Ruiz, J; Gallardo, F; Jimenez de Anta, M T; Gascón, J

    1997-01-01

    Two Escherichia coli O-rough:K1:H7 strains producing verotoxin 1 that were isolated from stool samples of two travelers with diarrhea who consulted our clinic after trips to the Indian Subcontinent and Central America were characterized. Both strains were sorbitol negative, the same phenotype presented by E. coli O157:H7, but in contrast they were beta-glucuronidase positive. Low-frequency restriction analysis of chromosomal DNA and pulsed-field gel electrophoresis and repetitive extragenic palindrome-PCR showed that both strains were epidemiologically related. The illness was self-limited in both cases but involved long-duration, watery diarrhea (10 to 50 days) accompanied by abdominal cramps and flatulence. This serotype should be taken into account as a possible cause of traveler's diarrhea. PMID:9276402

  2. Genetic analyses of Xanthomonas axonopodis pv. dieffenbachiae strains reveal distinct phylogenetic groups.

    PubMed

    Donahoo, R S; Jones, J B; Lacy, G H; Stromberg, V K; Norman, D J

    2013-03-01

    A comprehensive analysis of 175 Xanthomonas axonopodis pv. dieffenbachiae strains isolated from 10 Araceae hosts was done to identify pathogen variation. The strains were subjected to repetitive extragenic palindromic sequence polymerase chain reaction and four major phylogenetic clusters were generated. A subset of 40 strains isolated from Anthurium, Dieffenbachia, and Syngonium was further defined by amplified fragment length polymorphism and fatty acid methyl ester analysis and the same four phylogenetic clusters were observed. Comparison of representative strains in the first three clusters using DNA-DNA hybridization and multilocus sequence analysis supports the previous reclassification of strains in cluster I, including the X. axonopodis pv. dieffenbachiae pathovar reference strain (LMG695), to X. citri. Our research findings indicate that strains in cluster I, isolated primarily from anthurium, probably represent an undescribed pathovar. Other phylogenetic subclusters consisting primarily of strains isolated from xanthosoma and philodendron in clusters III and IV, respectively, may yet represent other undescribed species or pathovars of Xanthomonas. PMID:23134337

  3. Dual routes for verbal repetition: articulation-based and acoustic-phonetic codes for pseudoword and word repetition, respectively.

    PubMed

    Yoo, Sejin; Chung, Jun-Young; Jeon, Hyeon-Ae; Lee, Kyoung-Min; Kim, Young-Bo; Cho, Zang-Hee

    2012-07-01

    Speech production is inextricably linked to speech perception, yet they are usually investigated in isolation. In this study, we employed a verbal-repetition task to identify the neural substrates of speech processing with two ends active simultaneously using functional MRI. Subjects verbally repeated auditory stimuli containing an ambiguous vowel sound that could be perceived as either a word or a pseudoword depending on the interpretation of the vowel. We found verbal repetition commonly activated the audition-articulation interface bilaterally at Sylvian fissures and superior temporal sulci. Contrasting word-versus-pseudoword trials revealed neural activities unique to word repetition in the left posterior middle temporal areas and activities unique to pseudoword repetition in the left inferior frontal gyrus. These findings imply that the tasks are carried out using different speech codes: an articulation-based code of pseudowords and an acoustic-phonetic code of words. It also supports the dual-stream model and imitative learning of vocabulary. PMID:22632812

  4. Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1.

    PubMed

    Rodems, S M; Friesen, P D

    1995-09-01

    The hr5 enhancer element stimulates early viral transcription and may function as an origin of DNA replication for Autographa californica nuclear polyhedrosis virus (AcMNPV). The smallest functional unit of hr5 is a 28-bp repeat consisting of an imperfect palindrome (28-mer). To identify essential sequences and examine the molecular basis of hr5 activity, the effects of site-directed mutations on transcriptional enhancement by the 28-mer and binding of the AcMNPV transregulator IE1 were investigated. In transfection assays and infections with AcMNPV recombinants, activation of a basal viral promoter required sequences within both halves of the 28-mer. Basal promoter activation also required a critical spacing between these half sites. Mobility shift assays indicated that hr5 probes containing a single 28-mer were bound by in vitro-synthesized IE1. Competition assays using DNA fragments that contained mutated 28-mers demonstrated that both half sites were required for optimal binding of IE1. Similar assays using mutated 28-mer DNAs and nuclear extracts indicated that the relative affinity with which AcMNPV infection-specific proteins bound to the 28-mer was similar to that of in vitro-synthesized IE1. By using a combination of DNA binding and antibody supershift assays, it was demonstrated that IE1 binds to the 28-mer as a dimer. Collectively, these findings support a model in which symmetrical IE1 binding and simultaneous interaction with each half site are required for IE1-mediated transcriptional enhancement by hr5. Thus, sequence-specific binding may be one of the mechanisms by which IE1 directly or indirectly transregulates baculovirus gene expression. PMID:7636981

  5. Generation of Hypertension-Associated STK39 Polymorphism Knockin Cell Lines With the Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 System.

    PubMed

    Mandai, Shintaro; Mori, Takayasu; Sohara, Eisei; Rai, Tatemitsu; Uchida, Shinichi

    2015-12-01

    Previous genome-wide association studies identified serine threonine kinase 39 (STK39), encoding STE20/SPS1-related proline/alanine-rich kinase, as one of a limited number of hypertension susceptibility genes. A recent meta-analysis confirmed the association of STK39 intronic polymorphism rs3754777 with essential hypertension, among previously reported hypertension-associated STK39 polymorphisms. However, the biochemical function of this polymorphism in the mechanism responsible for hypertension is yet to be clarified. We generated rs3754777G>A knockin human cell lines with clustered regularly interspaced short palindromic repeats-mediated genome engineering. Homozygous (A/A) and heterozygous (G/A) knockin human embryonic kidney cell lines were generated using a double nickase, single-guide RNAs targeting STK39 intron 5 around single-nucleotide polymorphism, and a 100-bp donor single-stranded DNA oligonucleotide. Reverse transcription polymerase chain reaction with sequencing analyses revealed the identical STK39 transcripts among the wild-type and both knockin cell lines. Quantitative reverse transcription polymerase chain reaction showed increased STK39 mRNA expression, and immunoblot analysis revealed increases in total and phosphorylated STE20/SPS1-related proline/alanine-rich kinase with increased phosphorylated Na-K-Cl cotransporter isoform 1 in both knockin cell lines. The largest increases in these molecules were observed in the homozygous cell line. These findings indicated that this intronic polymorphism increases STK39 transcription, leading to activation of the STE20/SPS1-related proline/alanine-rich kinase-solute carrier family 12A signaling cascade. Increased interactions between STE20/SPS1-related proline/alanine-rich kinase and the target cation-chloride cotransporters may be responsible for hypertension susceptibility in individuals with this polymorphism. PMID:26416847

  6. Crystal optimization and preliminary diffraction data analysis of the Smad1 MH1 domain bound to a palindromic SBE DNA element.

    PubMed

    Baburajendran, Nithya; Palasingam, Paaventhan; Ng, Calista Keow Leng; Jauch, Ralf; Kolatkar, Prasanna R

    2009-11-01

    The bone morphogenetic protein (BMP) signalling pathway regulates diverse processes such as cell differentiation, anterior/posterior axis specification, cell growth and the formation of extra-embryonic tissues. The transcription factor Smad1 relays the BMP signal from the cytoplasm to the nucleus, where it binds short DNA-sequence motifs and regulates gene expression. However, how Smad1 selectively targets particular genomic regions is poorly understood. In order to understand the physical basis of the specific interaction of Smad1 with DNA and to contrast it with the highly homologous but functionally distinct Smad3 protein, the DNA-binding Mad-homology 1 (MH1) domain of Smad1 was cocrystallized with a 17-mer palindromic Smad-binding element (SBE). The extensive optimizations of the length, binding-site spacing and terminal sequences of the DNA element in combination with the other crystallization parameters necessary for obtaining diffraction-quality crystals are described here. A 2.7 angstrom resolution native data set was collected at the National Synchrotron Radiation Research Centre, Taiwan, from crystals grown in a solution containing 0.2 M ammonium tartrate dibasic, 20% PEG 3350, 3% 2-propanol and 10% glycerol. The data set was indexed and merged in space group P222, with unit-cell parameters a = 73.94, b = 77.49, c = 83.78 angstrom, alpha = beta = gamma = 90 degrees. The solvent content in the unit cell is consistent with the presence of two Smad1 MH1 molecules bound to the duplex DNA in the asymmetric unit. PMID:19923727

  7. Clustered Regularly Interspaced Short Palindromic Repeat-Dependent, Biofilm-Specific Death of Pseudomonas aeruginosa Mediated by Increased Expression of Phage-Related Genes

    PubMed Central

    Heussler, Gary E.; Cady, Kyle C.; Koeppen, Katja; Bhuju, Sabin; Stanton, Bruce A.

    2015-01-01

    ABSTRACT The clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated (CRISPR/Cas) system is an adaptive immune system present in many archaea and bacteria. CRISPR/Cas systems are incredibly diverse, and there is increasing evidence of CRISPR/Cas systems playing a role in cellular functions distinct from phage immunity. Previously, our laboratory reported one such alternate function in which the type 1-F CRISPR/Cas system of the opportunistic pathogen Pseudomonas aeruginosa strain UCBPP-PA14 (abbreviated as P. aeruginosa PA14) inhibits both biofilm formation and swarming motility when the bacterium is lysogenized by the bacteriophage DMS3. In this study, we demonstrated that the presence of just the DMS3 protospacer and the protospacer-adjacent motif (PAM) on the P. aeruginosa genome is necessary and sufficient for this CRISPR-dependent loss of these group behaviors, with no requirement of additional DMS3 sequences. We also demonstrated that the interaction of the CRISPR system with the DMS3 protospacer induces expression of SOS-regulated phage-related genes, including the well-characterized pyocin operon, through the activity of the nuclease Cas3 and subsequent RecA activation. Furthermore, our data suggest that expression of the phage-related genes results in bacterial cell death on a surface due to the inability of the CRISPR-engaged strain to downregulate phage-related gene expression, while these phage-related genes have minimal impact on growth and viability under planktonic conditions. Deletion of the phage-related genes restores biofilm formation and swarming motility while still maintaining a functional CRISPR/Cas system, demonstrating that the loss of these group behaviors is an indirect effect of CRISPR self-targeting. PMID:25968642

  8. Interaction of HIF and USF signaling pathways in human genes flanked by hypoxia-response elements and E-box palindromes.

    PubMed

    Hu, Junmin; Stiehl, Daniel P; Setzer, Claudia; Wichmann, Daniela; Shinde, Dheeraj A; Rehrauer, Hubert; Hradecky, Pavel; Gassmann, Max; Gorr, Thomas A

    2011-11-01

    Rampant activity of the hypoxia-inducible factor (HIF)-1 in cancer is frequently associated with the malignant progression into a harder-to-treat, increasingly aggressive phenotype. Clearly, anti-HIF strategies in cancer cells are of considerable clinical interest. One way to fine-tune, or inhibit, HIF's transcriptional outflow independently of hydroxylase activities could be through competing transcription factors. A CACGTG-binding activity in human hepatoma cells was previously found to restrict HIF's access to hypoxia response cis-elements (HRE) in a Daphnia globin gene promoter construct (phb2). The CACGTG factor, and its impact on hypoxia-responsive human genes, was analyzed in this study by genome-wide computational scans as well as gene-specific quantitative PCR, reporter and DNA-binding assays in hepatoma (Hep3B), cervical carcinoma (HeLa), and breast carcinoma (MCF7) cells. Among six basic helix-loop-helix transcription factors known to target CACGTG palindromes, we identified upstream stimulatory factor (USF)-1/2 as predominant phb2 CACGTG constituents in Hep3B, HeLa, and MCF7 cells. Human genes with adjacent or overlapping HRE and CACGTG motifs included with lactate dehydrogenase A (LDHA) and Bcl-2/E1B 19 kDa interacting protein 3 (BNIP3) hypoxia-induced HIF-1 targets. Parallel recruitment of HIF-1α and USF1/2a to the respective promoter chromatin was verified for all cell lines investigated. Mutual complementing (LDHA) or moderating (BNIP3) cross-talk was seen upon overexpression or silencing of HIF-1α and USF1/2a. Distinct (LDHA) or overlapping (BNIP3) promoter-binding sites for HIF-1 and USFs were subsequently characterized. We propose that, depending on abundance or activity of its protein constituents, O(2)-independent USF signaling can function to fine-tune or interfere with HIF-mediated transcription in cancer cells. PMID:21984181

  9. Place field repetition and spatial learning in a multicompartment environment

    PubMed Central

    Grieves, Roddy M.; Jenkins, Bryan W.; Harland, Bruce C.

    2015-01-01

    Abstract Recent studies have shown that place cells in the hippocampus possess firing fields that repeat in physically similar, parallel environments. These results imply that it should be difficult for animals to distinguish parallel environments at a behavioral level. To test this, we trained rats on a novel odor‐location task in an environment with four parallel compartments which had previously been shown to yield place field repetition. A second group of animals was trained on the same task, but with the compartments arranged in different directions, an arrangement we hypothesised would yield less place field repetition. Learning of the odor‐location task in the parallel compartments was significantly impaired relative to learning in the radially arranged compartments. Fewer animals acquired the full discrimination in the parallel compartments compared to those trained in the radial compartments, and the former also required many more sessions to reach criterion compared to the latter. To confirm that the arrangement of compartments yielded differences in place cell repetition, in a separate group of animals we recorded from CA1 place cells in both environments. We found that CA1 place cells exhibited repeated fields across four parallel local compartments, but did not do so when the same compartments were arranged radially. To confirm that the differences in place field repetition across the parallel and radial compartments depended on their angular arrangement, and not incidental differences in access to an extra‐maze visual landmark, we repeated the recordings in a second set of rats in the absence of the orientation landmark. We found, once again, that place fields showed repetition in parallel compartments, and did not do so in radially arranged compartments. Thus place field repetition, or lack thereof, in these compartments was not dependent on extra‐maze cues. Together, these results imply that place field repetition constrains spatial learning

  10. Similarity Grouping and Repetition Blindness are Both Influenced by Attention

    PubMed Central

    de Haan, Bianca; Rorden, Chris

    2009-01-01

    Previous studies have reported seemingly conflicting results regarding how the amount of stimulus similarity between two simultaneously presented target stimuli impacts perceptual performance. There are many reports of ‘repetition blindness’, where individuals do worse when shown two similar stimuli relative to two different stimuli. On the other hand, there are reports of ‘similarity grouping’, where participants perform better when identifying two similar objects relative to two different objects. This manuscript posits that repetition blindness and similarity grouping coexist and can be elicited in the same subjects in a single task. This not only explains the previous opposite effects of stimulus similarity on task performance, but also provides a unique opportunity to directly compare these opposite effects of stimulus similarity with respect to susceptibility to a modulating factor. Since previous studies have provided inconclusive results on whether attentional relevance can modulate the effect of stimulus similarity on task performance, the current manuscript aims to compare repetition blindness and similarity grouping with respect to their susceptibility to attentional relevance. The results of the first experiment confirmed that both repetition blindness and similarity grouping can be elicited in the same experiment, suggesting that repetition blindness and similarity grouping coexist. The results of the second experiment suggest that both repetition blindness and similarity grouping can be modulated by attentional relevance. These results support the explanation of repetition blindness as a token individuation failure. Furthermore, these results suggest that supposedly pre-attentional grouping mechanisms might not operate as independently from top-down attentional modulations as traditionally thought. PMID:20300466

  11. Repetitive sequences: the hidden diversity of heterochromatin in prochilodontid fish

    PubMed Central

    Terencio, Maria L.; Schneider, Carlos H.; Gross, Maria C.; do Carmo, Edson Junior; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira; Vicari, Marcelo R.; Feldberg, Eliana

    2015-01-01

    Abstract The structure and organization of repetitive elements in fish genomes are still relatively poorly understood, although most of these elements are believed to be located in heterochromatic regions. Repetitive elements are considered essential in evolutionary processes as hotspots for mutations and chromosomal rearrangements, among other functions – thus providing new genomic alternatives and regulatory sites for gene expression. The present study sought to characterize repetitive DNA sequences in the genomes of Semaprochilodus insignis (Jardine & Schomburgk, 1841) and Semaprochilodus taeniurus (Valenciennes, 1817) and identify regions of conserved syntenic blocks in this genome fraction of three species of Prochilodontidae (Semaprochilodus insignis, Semaprochilodus taeniurus, and Prochilodus lineatus (Valenciennes, 1836) by cross-FISH using Cot-1 DNA (renaturation kinetics) probes. We found that the repetitive fractions of the genomes of Semaprochilodus insignis and Semaprochilodus taeniurus have significant amounts of conserved syntenic blocks in hybridization sites, but with low degrees of similarity between them and the genome of Prochilodus lineatus, especially in relation to B chromosomes. The cloning and sequencing of the repetitive genomic elements of Semaprochilodus insignis and Semaprochilodus taeniurus using Cot-1 DNA identified 48 fragments that displayed high similarity with repetitive sequences deposited in public DNA databases and classified as microsatellites, transposons, and retrotransposons. The repetitive fractions of the Semaprochilodus insignis and Semaprochilodus taeniurus genomes exhibited high degrees of conserved syntenic blocks in terms of both the structures and locations of hybridization sites, but a low degree of similarity with the syntenic blocks of the Prochilodus lineatus genome. Future comparative analyses of other prochilodontidae species will be needed to advance our understanding of the organization and evolution of

  12. The relationship between fMRI adaptation and repetition priming.

    PubMed

    Ganel, Tzvi; Gonzalez, Claudia L R; Valyear, Kenneth F; Culham, Jody C; Goodale, Melvyn A; Köhler, Stefan

    2006-09-01

    Neuroimaging investigations of the cortically defined fMRI adaptation effect and of the behaviorally defined repetition priming effect have provided useful insights into how visual information is perceived and stored in the brain. Yet, although both phenomena are typically associated with reduced activation in visually responsive brain regions as a result of stimulus repetition, it is presently unknown whether they rely on common or dissociable neural mechanisms. In an event-related fMRI experiment, we manipulated fMRI adaptation and repetition priming orthogonally. Subjects made comparative size judgments for pairs of stimuli that depicted either the same or different objects; some of the pairs presented during scanning had been shown previously and others were new. This design allowed us to examine whether object-selective regions in occipital and temporal cortex were sensitive to adaptation, priming, or both. Critically, it also allowed us to test whether any region showing sensitivity to both manipulations displayed interactive or additive effects. Only a partial overlap was found between areas that were sensitive to fMRI adaptation and those sensitive to repetition priming. Moreover, in most of the object-selective regions that showed both effects, the reduced activation associated with the two phenomena were additive rather than interactive. Together, these findings suggest that fMRI adaptation and repetition priming can be dissociated from one another in terms of their neural mechanisms. PMID:16854597

  13. Flexible high-repetition-rate ultrafast fiber laser

    PubMed Central

    Mao, Dong; Liu, Xueming; Sun, Zhipei; Lu, Hua; Han, Dongdong; Wang, Guoxi; Wang, Fengqiu

    2013-01-01

    High-repetition-rate pulses have widespread applications in the fields of fiber communications, frequency comb, and optical sensing. Here, we have demonstrated high-repetition-rate ultrashort pulses in an all-fiber laser by exploiting an intracavity Mach-Zehnder interferometer (MZI) as a comb filter. The repetition rate of the laser can be tuned flexibly from about 7 to 1100 GHz by controlling the optical path difference between the two arms of the MZI. The pulse duration can be reduced continuously from about 10.1 to 0.55 ps with the spectral width tunable from about 0.35 to 5.7 nm by manipulating the intracavity polarization controller. Numerical simulations well confirm the experimental observations and show that filter-driven four-wave mixing effect, induced by the MZI, is the main mechanism that governs the formation of the high-repetition-rate pulses. This all-fiber-based laser is a simple and low-cost source for various applications where high-repetition-rate pulses are necessary. PMID:24226153

  14. Selective scanpath repetition during memory-guided visual search

    PubMed Central

    Wynn, Jordana S.; Bone, Michael B.; Dragan, Michelle C.; Hoffman, Kari L.; Buchsbaum, Bradley R.; Ryan, Jennifer D.

    2016-01-01

    ABSTRACT Visual search efficiency improves with repetition of a search display, yet the mechanisms behind these processing gains remain unclear. According to Scanpath Theory, memory retrieval is mediated by repetition of the pattern of eye movements or “scanpath” elicited during stimulus encoding. Using this framework, we tested the prediction that scanpath recapitulation reflects relational memory guidance during repeated search events. Younger and older subjects were instructed to find changing targets within flickering naturalistic scenes. Search efficiency (search time, number of fixations, fixation duration) and scanpath similarity (repetition) were compared across age groups for novel (V1) and repeated (V2) search events. Younger adults outperformed older adults on all efficiency measures at both V1 and V2, while the search time benefit for repeated viewing (V1–V2) did not differ by age. Fixation-binned scanpath similarity analyses revealed repetition of initial and final (but not middle) V1 fixations at V2, with older adults repeating more initial V1 fixations than young adults. In young adults only, early scanpath similarity correlated negatively with search time at test, indicating increased efficiency, whereas the similarity of V2 fixations to middle V1 fixations predicted poor search performance. We conclude that scanpath compression mediates increased search efficiency by selectively recapitulating encoding fixations that provide goal-relevant input. Extending Scanpath Theory, results suggest that scanpath repetition varies as a function of time and memory integrity. PMID:27570471

  15. Repetitively Q-switched Nd:BeL lasers

    NASA Technical Reports Server (NTRS)

    Degnan, J.; Birnbaum, M.; Deshazer, L. G.

    1979-01-01

    The thermal and mechanical characteristics which will ultimately limit the performance of Nd:BeL at high average power levels were investigated. The output beam characteristics (pulse width, peak power, beam dimensions and collimation) were determined at high repetition rates for both Nd:BeL and Nd:YAG. The output of Nd:BeL was shown to exceed that of Nd:YAG by a factor of 2.7 at low Q-switched repetition rates (1 Hz). This result follows from the smaller stimulated emission cross section of x-axis Nb:BeL compared to that of NdYAG by the same factor. At high repetition rates (10 Hz) the output of Nd:Bel falls to a level of three-fifths of its low repetition rate value while under similar tests the output of Nd:YAG remains essentially constant. A comparison of the measured values of the elasto-optic coefficients, the dn/dT values and the linear expansion coefficients for BeL and YAG failed to provide an explanation for the performance of BeL; however, thermal lensing was observed in Nd:BeL. Results imply that the output of a high repetition rate Q-switched Nd:BeL laser (high thermal loading) could be dramatically increased by utilization of a resonator design to compensate for the thermal lensing effects.

  16. Characterizing exploration behavior in spatial neglect: omissions and repetitive search.

    PubMed

    Olk, Bettina; Harvey, Monika

    2006-11-01

    In search tasks, patients with spatial neglect typically fail to respond to stimuli on the contralesional side. Such behavior has been associated with hyperattention to the ipsilesional side and a deficit in disengaging from attended stimuli. The present study investigated whether such explanations can also account for a further kind of behavior frequently shown by neglect patients: repetitive returns to previously indicated stimuli, particularly on the ipsilesional side. A group of neglect patients was tested along with a group of healthy participants and a patient control group without neglect. Participants performed an exploration task in which they searched for targets defined by their shape or for all stimuli either with the aid of vision or blindfolded. The results showed differential effects of reducing the salience of visual stimuli by blindfolding. For a subgroup of patients, detection rate improved, while for others the percentage of omissions increased. However, contrary to the control groups, blindfolding had no effect on repetitive search in the neglect group, inconsistent with hyperattention, a disengage or impaired working memory deficits. The rate of repetitive returns to previously indicated locations did not seem to be associated with the percentage of omitted stimuli, suggesting that repetitive returns may be best explained by a disruption of systematic search and lack of volitional control in spatial neglect. The results further underline the importance of considering repetitive search behavior in addition to omissions in standard neglect assessments. PMID:16979143

  17. Quantifying Repetitive Speech in Autism Spectrum Disorders and Language Impairment

    PubMed Central

    van Santen, Jan P. H.; Sproat, Richard W.; Hill, Alison Presmanes

    2013-01-01

    We report on an automatic technique for quantifying two types of repetitive speech: repetitions of what the child says him/herself (self-repeats) and of what is uttered by an interlocutor (echolalia). We apply this technique to a sample of 111 children between the ages of four and eight: 42 typically developing children (TD), 19 children with specific language impairment (SLI), 25 children with autism spectrum disorders (ASD) plus language impairment (ALI), and 25 children with ASD with normal, non-impaired language (ALN). The results indicate robust differences in echolalia between the TD and ASD groups as a whole (ALN + ALI), and between TD and ALN children. There were no significant differences between ALI and SLI children for echolalia or self-repetitions. The results confirm previous findings that children with ASD repeat the language of others more than other populations of children. On the other hand, self-repetition does not appear to be significantly more frequent in ASD, nor does it matter whether the child’s echolalia occurred within one (immediate) or two turns (near-immediate) of the adult’s original utterance. Furthermore, non-significant differences between ALN and SLI, between TD and SLI, and between ALI and TD are suggestive that echolalia may not be specific to ALN or to ASD in general. One important innovation of this work is an objective fully automatic technique for assessing the amount of repetition in a transcript of a child’s utterances. PMID:23661504

  18. Verbal repetition in primary progressive aphasia and Alzheimer's disease.

    PubMed

    Leyton, Cristian E; Savage, Sharon; Irish, Muireann; Schubert, Samantha; Piguet, Olivier; Ballard, Kirrie J; Hodges, John R

    2014-01-01

    We aimed to explore the nature of verbal repetition deficits and infer the cognitive systems involved in primary progressive aphasia (PPA) and Alzheimer's disease (AD). A total of 63 patients (13 semantic variant (sv-PPA), 17 nonfluent/agrammatic variant (nfv-PPA), 10 logopenic variant (lv-PPA), 23 AD) and 13 matched healthy controls completed a battery of tests that included naming, word comprehension, digit span, repetition of multisyllabic single words, monosyllabic word span presented under similar and dissimilar phonological conditions, and sentence repetition. All patient groups displayed some level of impairment, however, specific patterns emerged in each variant. Participants with sv-PPA were the least impaired, showing marginal difficulties exclusively for sentence repetition, whereas those with lv-PPA had the worst overall performance. Cases with nfv-PPA showed compromised repetition of multisyllabic and phonologically similar words. The deficit in cases with AD was confined to span tasks. These distinctive patterns of language impairments can assist in the differential diagnosis of PPA variants and point toward the vulnerability of specific cognitive systems in each syndrome. PMID:24662100

  19. Physical chromosome mapping of repetitive DNA sequences in Nile tilapia Oreochromis niloticus: evidences for a differential distribution of repetitive elements in the sex chromosomes.

    PubMed

    Ferreira, Irani A; Martins, Cesar

    2008-06-01

    Repetitive DNAs have been extensively applied as physical chromosome markers on comparative studies, identification of chromosome rearrangements and sex chromosomes, chromosome evolution analysis, and applied genetics. Here we report the characterization of repetitive DNA sequences from the Nile tilapia (Oreochromis niloticus) genome by construction and screening of plasmid library enriched with repetitive DNAs, analysis of a BAC-based physical map, and hybridization to chromosomes. The physical mapping of BACs enriched with repetitive sequences and C(o)t-1 DNA (DNA enriched for highly and moderately repetitive DNA sequences) to chromosomes using FISH showed a predominant distribution of repetitive elements in the centromeric and telomeric regions and along the entire length of the largest chromosome pair (X and Y sex chromosomes) of the species. The distribution of repetitive DNAs differed significantly between the p arm of X and Y chromosomes. These findings suggest that repetitive DNAs have had an important role in the differentiation of sex chromosomes. PMID:17395473

  20. Repetition blindness for faces reflects identity coding but not emotion coding.

    PubMed

    Buttle, Heather

    2010-02-01

    Repetition blindness for visually presented stimuli occurs when only one of two similar items is available to a viewer's conscious awareness. The objective of this experiment was to investigate repetition blindness for faces and to observe whether encoding of similar emotions displayed on different individuals' faces produced repetition blindness. A further aim was to assess whether such an effect could be modulated by attentional task demands (sex judgment or expression judgment). Faces were presented so that four within-participant conditions could be compared: Complete repetition, same emotion/different Identity repetition, same identity/different Emotion repetition, and No repetition trials. The data revealed repetition blindness for Complete and same identity/different Emotion repetitions, but not for same emotion/different Identity repetitions. The lack of an "emotion blindness" effect supports previous reports that emotional expressions do not necessarily lead to automatic attentional biases. PMID:20391889

  1. Multiple cellular mechanisms prevent chromosomal rearrangements involving repetitive DNA

    PubMed Central

    George, Carolyn M.; Alani, Eric

    2012-01-01

    Repetitive DNA is present in the eukaryotic genome in the form of segmental duplications, tandem and interspersed repeats, and satellites. Repetitive sequences can be beneficial by serving specific cellular functions (e.g. centromeric and telomeric DNA) and by providing a rapid means for adaptive evolution. However, such elements are also substrates for deleterious chromosomal rearrangements that affect fitness and promote human disease. Recent studies analyzing the role of nuclear organization in DNA repair and factors that suppress non-allelic homologous recombination have provided insights into how genome stability is maintained in eukaryotes. In this review we outline the types of repetitive sequences seen in eukaryotic genomes and how recombination mechanisms are regulated at the DNA sequence, cell organization, chromatin structure, and cell cycle control levels to prevent chromosomal rearrangements involving these sequences. PMID:22494239

  2. Association between repetitive work and occupational cold exposure.

    PubMed

    Buzanello, Márcia Rosângela; Moro, Antônio Renato Pereira

    2012-01-01

    Occupational cold exposure is an important risk factor that increases stress at work and can induce many health effects like diseases and symptoms related to cold, including work-related musculoskeletal disorders. The methodological procedures were performed to measure these environmental variables as recommended by the ISO 7726/85. For the analysis of repetitiveness was used the OCRA checklist and evaluation of musculoskeletal morbidity conducted by the Nordic Musculoskeletal Questionnaire. So the objective of this study was to investigate the correlation between cold environmental variables and prevalence of musculoskeletal morbidity in the repetitive work. Was found association between work in cutting and boning sector (occupational cold and repetitive work) and the presence of musculoskeletal morbidity, with a significance of 99%. PMID:22317689

  3. [Repetitive facilitative exercise: recent evidence and development for combination therapy].

    PubMed

    Shimodozono, Megumi

    2013-01-01

    Repetitive facilitative exercise (RFE), a combination of high-dose (high frequency) of repetitions and neurofacilitation, is a recently developed approach to the rehabilitation of stroke-related limb impairment. We conducted a randomized controlled evaluation of RFE compared with a duration-matched conventional rehabilitation program in the treatment of subacute stroke-related upper extremity impairment (Shimodozono et al. 2013). RFE demonstrated both statistically and clinically significant benefits over conventional rehabilitation both on the Action Research Arm Test, which is designed to measure dexterity and function, and on the Fugl-Meyer Arm scores, which was chosen as measure of motor control. In the case-series study, the beneficial effect of RFE is also reported in the treatment of chronic phase of stroke. More research is needed, but RFE could conceivably be integrated with other approaches such as vibration, neuromuscular electrical stimulation, repetitive transcranial magnetic stimulation, botulinum toxin, and robotics to achieve further improvement in its capabilities. PMID:24291952

  4. Patterns of tandem repetition in plant whole genome assemblies.

    PubMed

    Navajas-Pérez, Rafael; Paterson, Andrew H

    2009-06-01

    Tandem repeats often confound large genome assemblies. A survey of tandemly arrayed repetitive sequences was carried out in whole genome sequences of the green alga Chlamydomonas reinhardtii, the moss Physcomitrella patens, the monocots rice and sorghum, and the dicots Arabidopsis thaliana, poplar, grapevine, and papaya, in order to test how these assemblies deal with this fraction of DNA. Our results suggest that plant genome assemblies preferentially include tandem repeats composed of shorter monomeric units (especially dinucleotide and 9-30-bp repeats), while higher repetitive units pose more difficulties to assemble. Nevertheless, notwithstanding that currently available sequencing technologies struggle with higher arrays of repeated DNA, major well-known repetitive elements including centromeric and telomeric repeats as well as high copy-number genes, were found to be reasonably well represented. A database including all tandem repeat sequences characterized here was created to benefit future comparative genomic analyses. PMID:19242726

  5. Repetition-based credibility enhancement of unfamiliar faces.

    PubMed

    Brown, Alan S; Brown, Lori A; Zoccoli, Sandy L

    2002-01-01

    This experiment demonstrated that rating the credibility of nonfamous faces results in a significant increase in rated credibility on a subsequent encounter relative to new nonfamous faces. The degree of credibility enhancement is comparable for both honesty and sincerity ratings and at both short (2-day) and long (14-day) interrating intervals. Furthermore, credibility enhancement was independent of recognition; ratings were significantly higher for repeated faces, regardless of whether they were remembered. Although female faces were rated more credible than male faces, there was no gender difference in the degree of credibility enhancement with repetition. Conditional analyses revealed that actual, rather than perceived, repetition formed the basis of credibility enhancement. Future research should compare repetition effects on both credibility and affect as well as the durability of such effects over time. PMID:12041008

  6. Oral Language Skills Moderate Nonword Repetition Skills in Children with Dyslexia: A Meta-Analysis of the Role of Nonword Repetition Skills in Dyslexia

    ERIC Educational Resources Information Center

    Melby-Lervag, Monica; Lervag, Arne

    2012-01-01

    We present a meta-analysis reviewing studies that have focused on the relationship between dyslexia and nonword repetition. The results show that children with dyslexia have poorer nonword repetition skills when compared to both chronological-age and reading-level controls. However, the severity of the nonword repetition problem varies…

  7. High-repetition-rate short-pulse gas discharge.

    PubMed

    Tulip, J; Seguin, H; Mace, P N

    1979-09-01

    A high-average-power short-pulse gas discharge is described. This consists of a volume-preionized transverse discharge of the type used in gas lasers driven by a Blumlein energy storage circuit. The Blumlein circuit is fabricated from coaxial cable, is pulse-charged from a high-repetition-rate Marx-bank generator, and is switched by a high-repetition-rate segmented rail gap. The operation of this discharge under conditions typical of rare-gas halide lasers is described. A maximum of 900 pps was obtained, giving a power flow into the discharge of 30 kW. PMID:18699678

  8. Short-cavity high-repetition-rate CO2 laser

    NASA Astrophysics Data System (ADS)

    Klopper, Wouter; Bagrova, Kalina; du Pisanie, Johan; Ronander, Einar; Meyer, Jan A.; von Bergmann, Hubertus M.

    1994-09-01

    We report on the construction and optimization of a TEA CO2 laser with a discharge volume of 15 cm3 and cavity length of 20 cm. Such a short cavity facilitates single longitudinal mode operation. A roots blower is employed to achieve the necessary gas flow rate for high-repetition-frequency operation in a compact design. Output has been obtained at 1 kHz and a stable discharge to a repetition rate of 2 kHz has been demonstrated. The laser is part of a program aimed at the development of an efficient laser system for molecular laser isotope separation. Additional applications in materials processing are envisioned.

  9. Prediction of Muscle Performance During Dynamic Repetitive Exercise

    NASA Technical Reports Server (NTRS)

    Byerly, D. L.; Byerly, K. A.; Sognier, M. A.; Squires, W. G.

    2002-01-01

    A method for predicting human muscle performance was developed. Eight test subjects performed a repetitive dynamic exercise to failure using a Lordex spinal machine. Electromyography (EMG) data was collected from the erector spinae. Evaluation of the EMG data using a 5th order Autoregressive (AR) model and statistical regression analysis revealed that an AR parameter, the mean average magnitude of AR poles, can predict performance to failure as early as the second repetition of the exercise. Potential applications to the space program include evaluating on-orbit countermeasure effectiveness, maximizing post-flight recovery, and future real-time monitoring capability during Extravehicular Activity.

  10. Interaction of repetitively pulsed high energy laser radiation with matter

    NASA Astrophysics Data System (ADS)

    Hugenschmidt, M.

    1986-05-01

    Laser target interaction processes and methods of improving the overall energy balance are discussed. This can be achieved with high repetition rate pulsed lasers even for initially highly reflecting materials, such as metals. Experiments were performed using a pulsed CO2 laser at mean powers up to 2 KW and repetition rates up to 100 Hz. The rates of temperature rise of aluminum for example are increased by more than a factor of 3 as compared to cw-radiation of comparable power density. Similar improvements are found for the overall absorptivities, that are increased by more than an order of magnitude.

  11. Repetitive breath-hold diving causes serious brain injury.

    PubMed

    Tamaki, Hideki; Kohshi, Kiyotaka; Sajima, Shuichi; Takeyama, Junichiro; Nakamura, Takashi; Ando, Hideo; Ishitake, Tatsuya

    2010-01-01

    We report on a Japanese male professional breath-hold diver (Ama) who developed neurological disorders during repetitive dives to 22 meters of sea water. Each diving duration and surface interval were 40-80 seconds and 20-30 seconds, respectively. He suffered from sensory numbness of the right cheek, hand and foot, and double vision after more than two hours of consecutive dives. Magnetic resonance images of his brain showed multiple cerebral infarcts, and one of the lesions was situated in the brainstem. There is a possibility that repetitive deep breath-hold dives with short surface intervals can induce fatal accidents for divers. PMID:20369648

  12. Do Stimulus-Action Associations Contribute to Repetition Priming?

    ERIC Educational Resources Information Center

    Dennis, Ian; Perfect, Timothy J.

    2013-01-01

    Despite evidence that response learning makes a major contribution to repetition priming, the involvement of response representations at the level of motor actions remains uncertain. Levels of response representation were investigated in 4 experiments that used different tasks at priming and test. Priming for stimuli that required congruent…

  13. Context-Dependent Repetition Effects on Recognition Memory

    ERIC Educational Resources Information Center

    Opitz, Bertram

    2010-01-01

    One widely acknowledged way to improve our memory performance is to repeatedly study the to be learned material. One aspect that has received little attention in past research regards the context sensitivity of this repetition effect, that is whether the item is repeated within the same or within different contexts. The predictions of a…

  14. Repetitive Behaviors in Autism: Relationships with Associated Clinical Features

    ERIC Educational Resources Information Center

    Gabriels, Robin L.; Cuccaro, Michael L.; Hill, Dina E.; Ivers, Bonnie J.; Goldson, Edward

    2005-01-01

    Relationships between repetitive behaviors (RBs) and associated clinical features (i.e., cognitive and adaptive functioning levels, sleep problems, medication use, and other behavioral problems) were examined in two groups (High nonverbal IQ greater than or equal to 97 versus Low nonverbal IQ less than or equal to 56) of children with autism…

  15. Rock Climbing Injuries: Acute and Chronic Repetitive Trauma.

    PubMed

    Chang, Connie Y; Torriani, Martin; Huang, Ambrose J

    2016-01-01

    Rock climbing has increased in popularity as a sport, and specific injuries related to its practice are becoming more common. Chronic repetitive injuries are more common than acute injuries, although acute injuries tend to be more severe. We review both acute and chronic upper and lower extremity injuries. Understanding the injury pattern in rock climbers is important for accurate diagnosis. PMID:26360057

  16. Repetitive Domain-Referenced Testing Using Computers: the TITA System.

    ERIC Educational Resources Information Center

    Olympia, P. L., Jr.

    The TITA (Totally Interactive Testing and Analysis) System algorithm for the repetitive construction of domain-referenced tests utilizes a compact data bank, is highly portable, is useful in any discipline, requires modest computer hardware, and does not present a security problem. Clusters of related keyphrases, statement phrases, and distractors…

  17. Visual recognition memory in Alzheimer's disease: repetition-lag effects.

    PubMed

    Viggiano, Maria Pia; Galli, Giulia; Righi, Stefania; Brancati, Claudia; Gori, Guido; Cincotta, Massimo

    2008-01-01

    There is considerable evidence that visual recognition memory is largely affected by Alzheimer's disease (AD). Deficits might concern the forming, maintaining, and matching of the memory representation of the visual stimulus, especially when long interitem lags occur. The aim of the present study was to assess the effect of repetition lag on picture identification in mild- and moderate-AD patients, as well as in elderly controls. Participants underwent an old/new paradigm. To manipulate the temporal gradient, short and long lags were introduced between the first and second presentations. Pictures were presented at different levels of spatial filtering, following a coarse-to-fine order. This allowed for the measurement of the amount of physical information required for the identification of stimuli as a function of prior exposure and repetition lag. In the elderly, the magnitude of repetition priming did not differ as a function of interitem lag. Instead, repetition-lag effects interacted with dementia severity, and the capacity to retain memory traces for longer intervals worsened as the disease progresses. Current findings suggest that severe cortical degeneration may render AD patients unable to maintain their perceptual memories, and that dementia severity is a critical variable in the visual recognition memory assessment. PMID:18568983

  18. Repetition across Successive Sentences Facilitates Young Children's Word Learning

    ERIC Educational Resources Information Center

    Schwab, Jessica F.; Lew-Williams, Casey

    2016-01-01

    Young children who hear more child-directed speech (CDS) tend to have larger vocabularies later in childhood, but the specific characteristics of CDS underlying this link are currently underspecified. The present study sought to elucidate how the structure of language input boosts learning by investigating whether repetition of object labels in…

  19. Autism and exergaming: effects on repetitive behaviors and cognition

    PubMed Central

    Anderson-Hanley, Cay; Tureck, Kimberly; Schneiderman, Robyn L

    2011-01-01

    Autism is a neurodevelopmental disorder that leads to impairment in social skills and delay in language development, and results in repetitive behaviors and restricted interests that impede academic and social involvement. Physical exercise has been shown to decrease repetitive behaviors in autistic children and improve cognitive function across the life-span. Exergaming combines physical and mental exercise simultaneously by linking physical activity movements to video game control and may yield better compliance with exercise. In this investigation, two pilot studies explored the potential behavioral and cognitive benefits of exergaming. In Pilot I, twelve children with autism spectrum disorders completed a control task and an acute bout of Dance Dance Revolution (DDR); in Pilot II, ten additional youths completed an acute bout of cyber cycling. Repetitive behaviors and executive function were measured before and after each activity. Repetitive behaviors significantly decreased, while performance on Digits Backwards improved following the exergaming conditions compared with the control condition. Additional research is needed to replicate these findings, and to explore the application of exergaming for the management of behavioral disturbance and to increase cognitive control in children on the autism spectrum. PMID:22114543

  20. A gigawatt level repetitive rate adjustable magnetic pulse compressor

    NASA Astrophysics Data System (ADS)

    Li, Song; Gao, Jing-Ming; Yang, Han-Wu; Qian, Bao-Liang; Li, Ze-Xin

    2015-08-01

    In this paper, a gigawatt level repetitive rate adjustable magnetic pulse compressor is investigated both numerically and experimentally. The device has advantages of high power level, high repetitive rate achievability, and long lifetime reliability. Importantly, dominate parameters including the saturation time, the peak voltage, and even the compression ratio can be potentially adjusted continuously and reliably, which significantly expands the applicable area of the device and generators based on it. Specifically, a two-stage adjustable magnetic pulse compressor, utilized for charging the pulse forming network of a high power pulse generator, is designed with different compression ratios of 25 and 18 through an optimized design process. Equivalent circuit analysis shows that the modification of compression ratio can be achieved by just changing the turn number of the winding. At the same time, increasing inductance of the grounded inductor will decrease the peak voltage and delay the charging process. Based on these analyses, an adjustable compressor was built and studied experimentally in both the single shot mode and repetitive rate mode. Pulses with peak voltage of 60 kV and energy per pulse of 360 J were obtained in the experiment. The rise times of the pulses were compressed from 25 μs to 1 μs and from 18 μs to 1 μs, respectively, at repetitive rate of 20 Hz with good repeatability. Experimental results show reasonable agreement with analyses.

  1. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 2 2011-01-01 2011-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  2. Gender Differences in Repetitive Language in Fragile X Syndrome

    ERIC Educational Resources Information Center

    Murphy, M. M.; Abbeduto, L.

    2007-01-01

    Background: Verbal perseveration (i.e. excessive self-repetition) is a characteristic of male individuals with fragile X syndrome; however, little is known about its occurrence among females or its underlying causes. This project examined the relationship between perseveration and (1) gender, (2) cognitive and linguistic ability, and (3) language…

  3. Electrophysiological Evidence for Size Invariance in Masked Picture Repetition Priming

    ERIC Educational Resources Information Center

    Eddy, Marianna D.; Holcomb, Phillip J.

    2009-01-01

    This experiment examined invariance in object representations through measuring event-related potentials (ERPs) to pictures in a masked repetition priming paradigm. Pairs of pictures were presented where the prime was either the same size or half the size of the target object and the target was either presented in a normal orientation or was a…

  4. A gigawatt level repetitive rate adjustable magnetic pulse compressor.

    PubMed

    Li, Song; Gao, Jing-Ming; Yang, Han-Wu; Qian, Bao-Liang; Li, Ze-Xin

    2015-08-01

    In this paper, a gigawatt level repetitive rate adjustable magnetic pulse compressor is investigated both numerically and experimentally. The device has advantages of high power level, high repetitive rate achievability, and long lifetime reliability. Importantly, dominate parameters including the saturation time, the peak voltage, and even the compression ratio can be potentially adjusted continuously and reliably, which significantly expands the applicable area of the device and generators based on it. Specifically, a two-stage adjustable magnetic pulse compressor, utilized for charging the pulse forming network of a high power pulse generator, is designed with different compression ratios of 25 and 18 through an optimized design process. Equivalent circuit analysis shows that the modification of compression ratio can be achieved by just changing the turn number of the winding. At the same time, increasing inductance of the grounded inductor will decrease the peak voltage and delay the charging process. Based on these analyses, an adjustable compressor was built and studied experimentally in both the single shot mode and repetitive rate mode. Pulses with peak voltage of 60 kV and energy per pulse of 360 J were obtained in the experiment. The rise times of the pulses were compressed from 25 μs to 1 μs and from 18 μs to 1 μs, respectively, at repetitive rate of 20 Hz with good repeatability. Experimental results show reasonable agreement with analyses. PMID:26329219

  5. Deterioration Process of Sintered Material by Impact Repetition

    SciTech Connect

    Shirakashi, Takahiro

    2007-04-07

    For prediction of time dependent tool breakage of sintered carbide tool in interrupted turning operation, the special impact stressing set-up is prepared. A change of fracture stress-deterioration process-of a sintered carbide tool material with both tensile and compressive impact stressing repetition is discussed and the process is evaluated through the fracture stress criterion superposed by Weibull's distribution. The reliability of fracture stress is decreased with the repetition, the maximum fracture stress, however, is not decreased. The equivalency between compressive and tensile stresses on the process is also discussed and the process is shown as change of probabilistic fracture locus with impact repetition times. Finally a deterioration state of sintered carbide tool under interrupted turning operation with the so called parallel entry and a very soft exit condition is estimated based on the deterioration process and the probability map of breakage occurrence on tool surface is shown under given cutting condition. The tool life based on breakage occurrence is also shown by fracture probability change with impact repetition and evaluated by experiments.

  6. The Repetition of Collocations in EFL Textbooks: A Corpus Study

    ERIC Educational Resources Information Center

    Wang, Jui-hsin Teresa; Good, Robert L.

    2007-01-01

    The importance of repetition in the acquisition of lexical items has been widely acknowledged in single-word vocabulary research but has been relatively neglected in collocation studies. Since collocations are considered one key to achieving language fluency, and because learners spend a great amount of time interacting with their textbooks, the…

  7. Efficient sequential repetitive gene deletions in Neurospora crassa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Despite its long-standing history as a model organism, Neurospora crassa has limited tools for repetitive gene deletions utilizing recyclable self-excising marker systems. Here we describe, for the first time, the functionality of a bacterial recombination system employing ß-recombinase acting on si...

  8. 10 CFR 72.18 - Elimination of repetition.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Elimination of repetition. 72.18 Section 72.18 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE...

  9. Memory, emotion, and pupil diameter: Repetition of natural scenes.

    PubMed

    Bradley, Margaret M; Lang, Peter J

    2015-09-01

    Recent studies have suggested that pupil diameter, like the "old-new" ERP, may be a measure of memory. Because the amplitude of the old-new ERP is enhanced for items encoded in the context of repetitions that are distributed (spaced), compared to massed (contiguous), we investigated whether pupil diameter is similarly sensitive to repetition. Emotional and neutral pictures of natural scenes were viewed once or repeated with massed (contiguous) or distributed (spaced) repetition during incidental free viewing and then tested on an explicit recognition test. Although an old-new difference in pupil diameter was found during successful recognition, pupil diameter was not enhanced for distributed, compared to massed, repetitions during either recognition or initial free viewing. Moreover, whereas a significant old-new difference was found for erotic scenes that had been seen only once during encoding, this difference was absent when erotic scenes were repeated. Taken together, the data suggest that pupil diameter is not a straightforward index of prior occurrence for natural scenes. PMID:25943211

  10. The Effects of Syntactic Simplification and Repetition on Listening Comprehension.

    ERIC Educational Resources Information Center

    Cervantes, Raoul; Gainer, Glenn

    1992-01-01

    Two experiments with native Japanese-speaking English majors are reported that explored the absolute and relative effectiveness of syntactic simplification and repetition on listening comprehension. Results of both experiments indicate that syntactic simplification is an aid to comprehension. (seven references) (Author/LB)

  11. The cancellation of repetitive noise and vibration by active nethods

    NASA Astrophysics Data System (ADS)

    Eghtesadi, Kh.; Chaplin, G. B. B.

    The active attenuation of diesel engine noise is discussed as well as the active control of vibration. The system used is found to work best with repetitive sources of noise. Applications of active noise attentuation include noise inside helicopters and propellor aircraft, auxilliary generators and large compressors, and noise on emergency vehicles such as fire engines and snow cats.

  12. Auditory Repetition Priming Is Impaired in Pure Alexic Patients

    ERIC Educational Resources Information Center

    Swick, Diane; Miller, Kimberly M.; Larsen, Jary

    2004-01-01

    Alexia without agraphia, or ''pure'' alexia, is an acquired impairment in reading that leaves writing skills intact. Repetition priming for visually presented words is diminished in pure alexia. However, it is not possible to verify whether this priming deficit is modality-specific or modality independent because reading abilities are compromised.…

  13. The Repetition of Chunks in Korean Middle School English Textbooks

    ERIC Educational Resources Information Center

    Lee, Jinkyong

    2015-01-01

    The current study aims to examine the use of chunks and the extent of repetition in Korean middle school English textbooks. Also, the number of chunks shared by three publishers is examined. To create the corpora, 9 textbooks from three publishers were filed and processed by Simple Concordance Program. The results showed that chunk expressions…

  14. Repetition priming-induced changes in sensorimotor transmission.

    PubMed

    Svensson, Erik; Evans, Colin G; Cropper, Elizabeth C

    2016-03-01

    When a behavior is repeated performance often improves, i.e., repetition priming occurs. Although repetition priming is ubiquitous, mediating mechanisms are poorly understood. We address this issue in the feeding network ofAplysia Similar to the priming observed elsewhere, priming inAplysiais stimulus specific, i.e., it can be either "ingestive" or "egestive." Previous studies demonstrated that priming alters motor and premotor activity. Here we sought to determine whether sensorimotor transmission is also modified. We report that changes in sensorimotor transmission do occur. We ask how they are mediated and obtain data that strongly suggest a presynaptic mechanism that involves changes in the "background" intracellular Ca(2+)concentration ([Ca(2+)]i) in primary afferents themselves. This form of plasticity has previously been described and generated interest due to its potentially graded nature. Manipulations that alter the magnitude of the [Ca(2+)]iimpact the efficacy of synaptic transmission. It is, however, unclear how graded control is exerted under physiologically relevant conditions. In the feeding system changes in the background [Ca(2+)]iare mediated by the induction of a nifedipine-sensitive current. We demonstrate that the extent to which this current is induced is altered by peptides (i.e., increased by a peptide released during the repetition priming of ingestive activity and decreased by a peptide released during the repetition priming of egestive activity). We suggest that this constitutes a behaviorally relevant mechanism for the graded control of synaptic transmission via the regulation of the [Ca(2+)]iin a neuron. PMID:26763783

  15. Processing Speaker Variability in Repetition and Semantic/Associative Priming

    ERIC Educational Resources Information Center

    Lee, Chao-Yang; Zhang, Yu

    2015-01-01

    The effect of speaker variability on accessing the form and meaning of spoken words was evaluated in two short-term priming experiments. In the repetition priming experiment, participants listened to repeated or unrelated prime-target pairs, in which the prime and target were produced by the same speaker or different speakers. The results showed…

  16. Simple repetitive sequences in the genome: structure and functional significance.

    PubMed

    Brahmachari, S K; Meera, G; Sarkar, P S; Balagurumoorthy, P; Tripathi, J; Raghavan, S; Shaligram, U; Pataskar, S

    1995-09-01

    The current explosion of DNA sequence information has generated increasing evidence for the claim that noncoding repetitive DNA sequences present within and around different genes could play an important role in genetic control processes, although the precise role and mechanism by which these sequences function are poorly understood. Several of the simple repetitive sequences which occur in a large number of loci throughout the human and other eukaryotic genomes satisfy the sequence criteria for forming non-B DNA structures in vitro. We have summarized some of the features of three different types of simple repeats that highlight the importance of repetitive DNA in the control of gene expression and chromatin organization. (i) (TG/CA)n repeats are widespread and conserved in many loci. These sequences are associated with nucleosomes of varying linker length and may play a role in chromatin organization. These Z-potential sequences can help absorb superhelical stress during transcription and aid in recombination. (ii) Human telomeric repeat (TTAGGG)n adopts a novel quadruplex structure and exhibits unusual chromatin organization. This unusual structural motif could explain chromosome pairing and stability. (iii) Intragenic amplification of (CTG)n/(CAG)n trinucleotide repeat, which is now known to be associated with several genetic disorders, could down-regulate gene expression in vivo. The overall implications of these findings vis-à-vis repetitive sequences in the genome are summarized. PMID:8582360

  17. Piriform Spider Silk Sequences Reveal Unique Repetitive Elements

    PubMed Central

    Perry, David J.; Bittencourt, Daniela; Siltberg-Liberles, Jessica; Rech, Elibio L.; Lewis, Randolph V.

    2010-01-01

    Orb-weaving spider silk fibers are assembled from very large, highly repetitive proteins. The repeated segments contain, in turn, short, simple repetitive amino acid motifs that account for the physical and mechanical properties of the assembled fiber. Of the six orb-weaver silk fibroins, the piriform silk that makes the attachment discs, which lashes the joints of the web and attaches dragline silk to surfaces has not been previously characterized. Piriform silk protein cDNAs were isolated from phage libraries of three species, A. trifasciata, N. clavipes, and N. cruentata. The deduced amino acid sequences from these genes revealed two new repetitive motifs: an alternating proline motif where every other amino acid is proline, and a glutamine-rich motif of 6 to 8 amino acids. Similar to other spider silk proteins, the repeated segments are large (>200 amino acids) and highly homogenized within a species. There is also substantial sequence similarity across the genes from the three species with particular conservation of the repetitive motifs. Northern blot analysis revealed that the messenger RNA is larger than 11kb and is expressed exclusively in the piriform glands of the spider. Phylogenetic analysis of the C-terminal regions of the new proteins with published spidroins robustly shows that the pirifom sequences form an ortholog group. PMID:20954740

  18. Decomposition of Repetition Priming Components in Picture Naming

    ERIC Educational Resources Information Center

    Francis, Wendy S.; Corral, Nuvia I.; Jones, Mary L.; Saenz, Silvia P.

    2008-01-01

    Cognitive mechanisms underlying repetition priming in picture naming were decomposed in several experiments. Sets of encoding manipulations meant to selectively prime or reduce priming in object identification or word production components of picture naming were combined factorially to dissociate processes underlying priming in picture naming.…

  19. Decomposition of Repetition Priming Processes in Word Translation

    ERIC Educational Resources Information Center

    Francis, Wendy S.; Duran, Gabriela; Augustini, Beatriz K.; Luevano, Genoveva; Arzate, Jose C.; Saenz, Silvia P.

    2011-01-01

    Translation in fluent bilinguals requires comprehension of a stimulus word and subsequent production, or retrieval and articulation, of the response word. Four repetition-priming experiments with Spanish-English bilinguals (N = 274) decomposed these processes using selective facilitation to evaluate their unique priming contributions and factorial…

  20. Practicing Novel, Praxis-Like Movements: Physiological Effects of Repetition.

    PubMed

    Ewen, Joshua B; Pillai, Ajay S; McAuliffe, Danielle; Lakshmanan, Balaji M; Ament, Katarina; Hallett, Mark; Crone, Nathan E; Mostofsky, Stewart H

    2016-01-01

    Our primary goal was to develop and validate a task that could provide evidence about how humans learn praxis gestures, such as those involving the use of tools. To that end, we created a video-based task in which subjects view a model performing novel, meaningless one-handed actions with kinematics similar to praxis gestures. Subjects then imitated the movements with their right hand. Trials were repeated six times to examine practice effects. EEG was recorded during the task. As a control, subjects watched videos of a model performing a well-established (over learned) tool-use gesture. These gestures were also imitated six times. Demonstrating convergent validity, EEG measures of task-related cortical activation were similar in topography and frequency between the novel gesture task and the overlearned, praxis gesture task. As in studies assessing motor skill learning with simpler tasks, cortical activation during novel gesture learning decreased as the same gestures were repeated. In the control condition, repetition of overlearned tool-use gestures were also associated with reductions in activation, though to a lesser degree. Given that even overlearned, praxis gestures show constriction of EEG activity with repetition, it is possible that that attentional effects drive some of the repetition effects seen in EEG measures of activation during novel gesture repetition. PMID:26903835

  1. Repetitive peptide boosting progressively enhances functional memory CTLs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Induction of functional memory CTLs holds promise for fighting critical infectious diseases through vaccination, but so far, no effective regime has been identified. We show here that memory CTLs can be enhanced progressively to high levels by repetitive intravenous boosting with peptide and adjuvan...

  2. Practicing Novel, Praxis-Like Movements: Physiological Effects of Repetition

    PubMed Central

    Ewen, Joshua B.; Pillai, Ajay S.; McAuliffe, Danielle; Lakshmanan, Balaji M.; Ament, Katarina; Hallett, Mark; Crone, Nathan E.; Mostofsky, Stewart H.

    2016-01-01

    Our primary goal was to develop and validate a task that could provide evidence about how humans learn praxis gestures, such as those involving the use of tools. To that end, we created a video-based task in which subjects view a model performing novel, meaningless one-handed actions with kinematics similar to praxis gestures. Subjects then imitated the movements with their right hand. Trials were repeated six times to examine practice effects. EEG was recorded during the task. As a control, subjects watched videos of a model performing a well-established (over learned) tool-use gesture. These gestures were also imitated six times. Demonstrating convergent validity, EEG measures of task-related cortical activation were similar in topography and frequency between the novel gesture task and the overlearned, praxis gesture task. As in studies assessing motor skill learning with simpler tasks, cortical activation during novel gesture learning decreased as the same gestures were repeated. In the control condition, repetition of overlearned tool-use gestures were also associated with reductions in activation, though to a lesser degree. Given that even overlearned, praxis gestures show constriction of EEG activity with repetition, it is possible that that attentional effects drive some of the repetition effects seen in EEG measures of activation during novel gesture repetition. PMID:26903835

  3. Autism and exergaming: effects on repetitive behaviors and cognition.

    PubMed

    Anderson-Hanley, Cay; Tureck, Kimberly; Schneiderman, Robyn L

    2011-01-01

    Autism is a neurodevelopmental disorder that leads to impairment in social skills and delay in language development, and results in repetitive behaviors and restricted interests that impede academic and social involvement. Physical exercise has been shown to decrease repetitive behaviors in autistic children and improve cognitive function across the life-span. Exergaming combines physical and mental exercise simultaneously by linking physical activity movements to video game control and may yield better compliance with exercise. In this investigation, two pilot studies explored the potential behavioral and cognitive benefits of exergaming. In Pilot I, twelve children with autism spectrum disorders completed a control task and an acute bout of Dance Dance Revolution (DDR); in Pilot II, ten additional youths completed an acute bout of cyber cycling. Repetitive behaviors and executive function were measured before and after each activity. Repetitive behaviors significantly decreased, while performance on Digits Backwards improved following the exergaming conditions compared with the control condition. Additional research is needed to replicate these findings, and to explore the application of exergaming for the management of behavioral disturbance and to increase cognitive control in children on the autism spectrum. PMID:22114543

  4. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  5. Exact Repetition as Input Enhancement in Second Language Acquisition.

    ERIC Educational Resources Information Center

    Jensen, Eva Dam; Vinther, Thora

    2003-01-01

    Reports on two studies on input enhancement used to support learners' selection of focus of attention in Spanish second language listening material. Input consisted of video recordings of dialogues between native speakers. Exact repetition and speech rate reduction were examined for effect on comprehension, acquisition of decoding strategies, and…

  6. Investigating repetition and change in musical rhythm by functional MRI.

    PubMed

    Danielsen, A; Otnæss, M K; Jensen, J; Williams, S C R; Ostberg, B C

    2014-09-01

    Groove-based rhythm is a basic and much appreciated feature of Western popular music. It is commonly associated with dance, movement and pleasure and is characterized by the repetition of a basic rhythmic pattern. At various points in the musical course, drum breaks occur, representing a change compared to the repeated pattern of the groove. In the present experiment, we investigated the brain response to such drum breaks in a repetitive groove. Participants were scanned with functional magnetic resonance imaging (fMRI) while listening to a previously unheard naturalistic groove with drum breaks at uneven intervals. The rhythmic pattern and the timing of its different parts as performed were the only aspects that changed from the repetitive sections to the breaks. Differences in blood oxygen level-dependent activation were analyzed. In contrast to the repetitive parts, the drum breaks activated the left cerebellum, the right inferior frontal gyrus (RIFG), and the superior temporal gyri (STG) bilaterally. A tapping test using the same stimulus showed an increase in the standard deviation of inter-tap-intervals in the breaks versus the repetitive parts, indicating extra challenges for auditory-motor integration in the drum breaks. Both the RIFG and STG have been associated with structural irregularity and increase in musical-syntactical complexity in several earlier studies, whereas the left cerebellum is known to play a part in timing. Together these areas may be recruited in the breaks due to a prediction error process whereby the internal model is being updated. This concurs with previous research suggesting a network for predictive feed-forward control that comprises the cerebellum and the cortical areas that were activated in the breaks. PMID:24972303

  7. Dual Routes for Verbal Repetition: Articulation-Based and Acoustic-Phonetic Codes for Pseudoword and Word Repetition, Respectively

    ERIC Educational Resources Information Center

    Yoo, Sejin; Chung, Jun-Young; Jeon, Hyeon-Ae; Lee, Kyoung-Min; Kim, Young-Bo; Cho, Zang-Hee

    2012-01-01

    Speech production is inextricably linked to speech perception, yet they are usually investigated in isolation. In this study, we employed a verbal-repetition task to identify the neural substrates of speech processing with two ends active simultaneously using functional MRI. Subjects verbally repeated auditory stimuli containing an ambiguous vowel…

  8. Synesthesia in twins: incomplete concordance in monozygotes suggests extragenic factors.

    PubMed

    Bosley, Hannah G; Eagleman, David M

    2015-06-01

    Colored-sequence synesthesia (CSS) is a neurological condition in which sequential stimuli such as letters, numbers, or days of the week trigger simultaneous, involuntary color perception. Although the condition appears to run in families and several studies have sought a genetic link, the genetic contribution to synesthesia remains unclear. We conducted the first comparative twin study of CSS and found that CSS has a pairwise concordance of 73.9% in monozygotic twins, and a pairwise concordance of 36.4% in dizygotic twins. In line with previous studies, our results suggest a heritable element of synesthesia. However, consonant with the findings of previous single-pair case studies, our large sample size verifies that synesthesia is not completely conferred by genetics; if it were, monozygotic twins should have 100% concordance. These findings implicate a genetic mechanism of CSS that may work differently than previously thought: collectively, our data suggest that synesthesia is a heritable condition with incomplete penetrance that is substantially influenced by epigenetic and environmental factors. PMID:25704836

  9. Annoyance and loudness of repetitive type noise sources: a review

    SciTech Connect

    Sutherland, L.C.

    1982-01-01

    Repetitive impulsive noises are a consistent and frequently annoying ingredient of outdoor and indoor noise environments. Examples of such noise sources are jack hammers, unmuffled two-cycle engines, and helicopter blade slap. To aid in the development of more consistent methods for quantifying annoyance from such noise sources, the Environmental Protection Agency funded a review of the literature on the topic. This is a very abbreviated summary of that review and the reader is referred to the original document for detailed references. The review specifically excluded consideration of non-repetitive high-level impulse sounds such as blast noise which has been recently addressed by CHABA Working Group 84(2). Helicopter blade slap was briefly included in the review in order to reflect some of the trends appearing in the very extensive current work in this area.

  10. High repetition rate plasma mirror device for attosecond science

    SciTech Connect

    Borot, A.; Douillet, D.; Iaquaniello, G.; Lefrou, T.; Lopez-Martens, R.; Audebert, P.; Geindre, J.-P.

    2014-01-15

    This report describes an active solid target positioning device for driving plasma mirrors with high repetition rate ultra-high intensity lasers. The position of the solid target surface with respect to the laser focus is optically monitored and mechanically controlled on the nm scale to ensure reproducible interaction conditions for each shot at arbitrary repetition rate. We demonstrate the target capabilities by driving high-order harmonic generation from plasma mirrors produced on glass targets with a near-relativistic intensity few-cycle pulse laser system operating at 1 kHz. During experiments, residual target surface motion can be actively stabilized down to 47 nm (root mean square), which ensures sub-300-as relative temporal stability of the plasma mirror as a secondary source of coherent attosecond extreme ultraviolet radiation in pump-probe experiments.

  11. Transfer of processing in repetition priming: some inappropriate findings.

    PubMed

    Brown, A S; Neblett, D R; Jones, T C; Mitchell, D B

    1991-05-01

    Transfer effects in repetition priming were found with both picture and word naming, but varied with the type of prime list. Unmixed lists of word or picture primes produced equivalent intra-modal and cross-modal repetition priming in both picture-naming (Experiment 1) and word-naming (Experiment 5) tasks. However, mixing word and picture primes resulted in greater intra-modal than cross-modal priming for both picture-naming (Experiment 2) and word-naming (Experiment 6) tasks. This mixed-list difference between intra-modal and cross-modal priming was reduced by blocking prime types at input (Experiment 3). These findings suggest that differences in priming as a function of prime stimulus format should be cautiously interpreted when mixed prime lists are used. PMID:1829475

  12. Skill learning and repetition priming in Alzheimer's disease.

    PubMed

    Grober, E; Ausubel, R; Sliwinski, M; Gordon, B

    1992-10-01

    While perceptual-motor learning occurs normally in Alzheimer's disease (AD) patients, their ability to acquire the skill of reading transformed text has not been well delineated. AD patients and matched controls were timed as they read two blocks of words presented in mirror image. Control subjects displayed both skill learning and repetition priming, whereas AD patients displayed only repetition priming. Skill learning in AD patients was associated with their ability to complete verbal analogies. They displayed the expected impairment in recognition for the words from the mirror reading task. The failure of AD patients to acquire the mirror reading skill can be understood through a task analysis and may reflect an underlying deficit in abstract reasoning that precludes the development of appropriate pattern analyzing strategies needed to transform rotated text. PMID:1436432

  13. High repetition rate plasma mirror device for attosecond science

    NASA Astrophysics Data System (ADS)

    Borot, A.; Douillet, D.; Iaquaniello, G.; Lefrou, T.; Audebert, P.; Geindre, J.-P.; Lopez-Martens, R.

    2014-01-01

    This report describes an active solid target positioning device for driving plasma mirrors with high repetition rate ultra-high intensity lasers. The position of the solid target surface with respect to the laser focus is optically monitored and mechanically controlled on the nm scale to ensure reproducible interaction conditions for each shot at arbitrary repetition rate. We demonstrate the target capabilities by driving high-order harmonic generation from plasma mirrors produced on glass targets with a near-relativistic intensity few-cycle pulse laser system operating at 1 kHz. During experiments, residual target surface motion can be actively stabilized down to 47 nm (root mean square), which ensures sub-300-as relative temporal stability of the plasma mirror as a secondary source of coherent attosecond extreme ultraviolet radiation in pump-probe experiments.

  14. High repetition rate plasma mirror device for attosecond science.

    PubMed

    Borot, A; Douillet, D; Iaquaniello, G; Lefrou, T; Audebert, P; Geindre, J-P; Lopez-Martens, R

    2014-01-01

    This report describes an active solid target positioning device for driving plasma mirrors with high repetition rate ultra-high intensity lasers. The position of the solid target surface with respect to the laser focus is optically monitored and mechanically controlled on the nm scale to ensure reproducible interaction conditions for each shot at arbitrary repetition rate. We demonstrate the target capabilities by driving high-order harmonic generation from plasma mirrors produced on glass targets with a near-relativistic intensity few-cycle pulse laser system operating at 1 kHz. During experiments, residual target surface motion can be actively stabilized down to 47 nm (root mean square), which ensures sub-300-as relative temporal stability of the plasma mirror as a secondary source of coherent attosecond extreme ultraviolet radiation in pump-probe experiments. PMID:24517742

  15. Bubble Phenomena caused by High Repetitive Plasmas in Water

    NASA Astrophysics Data System (ADS)

    Akiyama, Masahiro; Oikawa, Takuma; Fue, Masatoshi; Ogata, Ryoma; Takaki, Koich; Akiyama, Hidenori; Iwate Univ Team; Kumamoto Univ Collaboration

    2015-09-01

    Streamer discharges in water were generated by a pulsed power generator. The streamer shape changed depending on pulse repetition rate. Streamer discharges at 500 pulses per second (pps) resulted in a ball shape. Under this formation, small bubbles gather near the electrode tip. Our aims are the analysis and discussion of the bubble phenomena caused by high repetitive plasmas produced in water. Pulsed power with a maximum output of 1 J/pulse was applied to an electrode of 0.8 mm in diameter covered by an insulator of 2 mm thickness. The electrode was inserted into tap water with conductivity of 170 uS/cm. The polarity was positive. Phenomena, in which the resulting gas bubbles oscillate and gather, were found to have an important role in producing ball shape streamer discharges.

  16. Closed cycle high-repetition-rate pulsed HF laser

    NASA Astrophysics Data System (ADS)

    Harris, Michael R.; Morris, A. V.; Gorton, Eric K.

    1997-04-01

    The design and performance of a closed cycle high repetition rate HF laser is described. A short pulse, glow discharge is formed in a 10 SF6:1 H2 gas mixture at a total pressure of approximately 110 torr within a 15 by 0.5 by 0.5 cm3 volume. Transverse, recirculated gas flow adequate to enable repetitive operation up to 3 kHz is imposed by a centrifugal fan. The fan also forces the gas through a scrubber cell to eliminate ground state HF from the gas stream. An automated gas make-up system replenishes spent gas removed by the scrubber. Typical mean laser output powers up to 3 W can be maintained for extended periods of operation.

  17. Coreference and Lexical Repetition: Mechanisms of Discourse Integration

    PubMed Central

    Ledoux, Kerry; Gordon, Peter C.; Camblin, C. Christine; Swaab, Tamara Y.

    2006-01-01

    The use of repeated expressions to establish coreference allows an investigation of the relationship between basic processes of word recognition and higher-level language processes that involve the integration of information into a discourse model. In two experiments on reading, we used eye tracking and event-related potentials (ERPs) to examine whether repeated expressions that are coreferential within a local discourse context show the kind of repetition priming that is shown in lists of words. In both experiments, effects of lexical repetition were modulated by effects of local discourse context that arose from manipulations of the linguistic prominence of the antecedent of a coreferentially repeated name. These results are interpreted within the context of discourse prominence theory, which suggests that processes of coreferential interpretation interact with basic mechanisms of memory integration during the construction of a model of discourse. PMID:17848036

  18. How familiarization and repetition modulate the picture naming network

    PubMed Central

    Llorens, Anaïs; Trébuchon, Agnès; Riès, Stéphanie; Liégeois-Chauvel, Catherine; Alario, F.-Xavier

    2014-01-01

    A common strategy to reveal the components of the speech production network is to use psycholinguistic manipulations previously tested in behavioral protocols. This often disregards how implementation aspects that are nonessential for interpreting behavior may affect the neural response. We compared the electrophysiological (EEG) signature of two popular picture naming protocols involving either unfamiliar pictures without repetitions or repeated familiar pictures. We observed significant semantic interference effects in behavior but not in the EEG, contrary to some previous findings. Remarkably, the two protocols elicited clearly distinct EEG responses. These were not due to naming latency differences nor did they reflect a homogeneous modulation of amplitude over the trial time-window. The effect of protocol is attributed to the familiarization induced by the first encounter with the materials. Picture naming processes can be substantially modulated by specific protocol requirements controlled by familiarity and, to a much lesser degree, the repetition of materials. PMID:24785306

  19. Interaction of Repetitively Pulsed High Energy Laser Radiation With Matter

    NASA Astrophysics Data System (ADS)

    Hugenschmidt, Manfred

    1986-10-01

    The paper is concerned with laser target interaction processes involving new methods of improving the overall energy balance. As expected theoretically, this can be achieved with high repetition rate pulsed lasers even for initially highly reflecting materials, such as metals. Experiments were performed by using a pulsed CO2 laser at mean powers up to 2 kW and repetition rates up to 100 Hz. The rates of temperature rise of aluminium for example were thereby increased by lore than a factor of 3 as compared to cw-radiation of comparable power density. Similar improvements were found for the overall absorptivities that were increased by this method by more than an order of magnitude.

  20. MOS-Gated Thyristors (MCTs) for Repetitive High Power Switching

    SciTech Connect

    BAYNE,S.B.; PORTNOY,W.M.; ROHWEIN,G.J.; HEFNER,A.R.

    2000-01-13

    Certain applications for pulse power require narrow, high current pulses for their implementation. This work was performed to determine if MCTS (MOS Controlled Thyristors) could be used for these applications. The MCTS were tested as discharge switches in a low inductance circuit delivering 1 {micro}s pulses at currents between roughly 3 kA and 11 kA, single shot and repetitively at 1, 10 and 50 Hz. Although up to 9000 switching events could be obtained, all the devices failed at some combination of current and repetition rate. Failure was attributed to temperature increases caused by average power dissipated in the thyristor during the switching sequence. A simulation was performed to confirm that the temperature rise was sufficient to account for failure. Considerable heat sinking, and perhaps a better thermal package, would be required before the MCT could be considered for pulse power applications.

  1. The Role of Memory Processes in Repetition Blindness

    NASA Technical Reports Server (NTRS)

    Johnston, James C.; Hochhaus, Larry; Null, Cynthia H. (Technical Monitor)

    1995-01-01

    We investigated whether Repetition Blindness (RB) in processing RSVP strings depends critically on memory demands. When all items in the sequence had to be reported, strong RB was found. When only the 2 critical items (cued by color) had to be reported, no RB was found. Preliminary results show that imposing a separate memory load, while reporting only the critical items, also produces little RB. Implications for the processing locus of RB will be discussed.

  2. The Effect of Syllable Repetition Rate on Vocal Characteristics

    ERIC Educational Resources Information Center

    Topbas, Oya; Orlikoff, Robert F.; St. Louis, Kenneth O.

    2012-01-01

    This study examined whether mean vocal fundamental frequency ("F"[subscript 0]) or speech sound pressure level (SPL) varies with changes in syllable repetition rate. Twenty-four young adults (12 M and 12 F) repeated the syllables/p[inverted v]/,/p[inverted v]t[schwa]/, and/p[inverted v]t[schwa]k[schwa]/at a modeled "slow" rate of approximately one…

  3. Forward and Backward Repetition Blindness in Speed and Accuracy

    ERIC Educational Resources Information Center

    Wong, Kin Fai Ellick; Chen, Hsuan-Chih

    2009-01-01

    Repetition blindness (RB) was investigated in a new paradigm in which effects could stem from items preceding or following a target. Speeded-response tasks in which 3 critical items (C1, C2, and C3) were sequentially presented on each trial. In Experiments 1 and 2, participants were asked to judge whether C2 (the target) was present on each trial.…

  4. Paleoclimate controls on stratigraphic repetition of chemical and siliciclastic rocks

    SciTech Connect

    Cecil, C.B. )

    1990-06-01

    Climate is a primary control on sediment flux from continental sources into sedimentary systems. In warm climates, siliciclastic input is greatest under highly seasonal rainfall. Nonseasonal conditions favor formation of end member chemical rocks; perennially wet climates are conductive to coal formation, whereas dry climates produce carbonates and/or evaporites. Stratigraphic repetition of siliciclastic and chemical rocks therefore appears to be related to paleoclimate cycles as well as to transgressive-regressive events and tectonics.

  5. Repetitively pulsed Cr:LiSAF laser for lidar applications

    SciTech Connect

    Shimada, Tsutomu; Early, J.W.; Lester, C.S.; Cockroft, N.J.

    1994-03-01

    A Cr:LiSAF laser has been successfully operated at time averaged powers up to 11 W and at pulse repetition rates to 12 Hz. During Q-switch operation, output energy as high as 450 mJ (32 ns FWHM) was obtained. Finally, line narrowed Q-switched pulses (< 0.1 nm) from the Cr:LiSAF laser were successfully used as a tunable light source for lidar to measure atmospheric water content.

  6. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, Emanuel M.

    1987-01-01

    A high-power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime.

  7. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1987-02-10

    A high-power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime. 10 figs.

  8. Reversing-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1984-06-05

    A high power reversing-counterpulse repetitive-pulse inductive storage and transfer circuit includes an opening switch, a main energy storage coil, a counterpulse capacitor and a small inductor. After counterpulsing the opening switch off, the counterpulse capacitor is recharged by the main energy storage coil before the load pulse is initiated. This gives the counterpulse capacitor sufficient energy for the next counterpulse operation, although the polarity of the capacitor's voltage must be reversed before that can occur. By using a current-zero switch as the counterpulse start switch, the capacitor is disconnected from the circuit (with a full charge) when the load pulse is initiated, preventing the capacitor from depleting its energy store by discharging through the load. After the load pulse is terminated by reclosing the main opening switch, the polarity of the counterpulse capacitor voltage is reversed by discharging the capacitor through a small inductor and interrupting the discharge current oscillation at zero current and peak reversed voltage. The circuit enables high-power, high-repetition-rate operation with reusable switches and features total control (pulse-to-pulse) over output pulse initiation, duration, repetition rate, and, to some extent, risetime.

  9. Repetitive motor behavior: further characterization of development and temporal dynamics.

    PubMed

    Muehlmann, Amber M; Bliznyuk, Nikolay; Duerr, Isaac; Lewis, Mark H

    2015-03-01

    Repetitive behaviors are diagnostic for autism spectrum disorders, common in related neurodevelopmental disorders, and normative in typical development. In order to identify factors that mediate repetitive behavior development, it is necessary to characterize the expression of these behaviors from an early age. Extending previous findings, we characterized further the ontogeny of stereotyped motor behavior both in terms of frequency and temporal organization in deer mice. A three group trajectory model provided a good fit to the frequencies of stereotyped behavior across eight developmental time points. Group based trajectory analysis using a measure of temporal organization of stereotyped behavior also resulted in a three group solution. Additionally, as the frequency of stereotyped behavior increased with age, the temporal distribution of stereotyped responses became increasingly regular or organized indicating a strong association between these measures. Classification tree and principal components analysis showed that accurate classification of trajectory group could be done with fewer observations. This ability to identify trajectory group membership earlier in development allows for examination of a wide range of variables, both experiential and biological, to determine their impact on altering the expected trajectory of repetitive behavior across development. Such studies would have important implications for treatment efforts in neurodevelopmental disorders such as autism. PMID:25631623

  10. Storage and retrieval of highly repetitive sequence collections.

    PubMed

    Mäkinen, Veli; Navarro, Gonzalo; Sirén, Jouni; Välimäki, Niko

    2010-03-01

    A repetitive sequence collection is a set of sequences which are small variations of each other. A prominent example are genome sequences of individuals of the same or close species, where the differences can be expressed by short lists of basic edit operations. Flexible and efficient data analysis on such a typically huge collection is plausible using suffix trees. However, the suffix tree occupies much space, which very soon inhibits in-memory analyses. Recent advances in full-text indexing reduce the space of the suffix tree to, essentially, that of the compressed sequences, while retaining its functionality with only a polylogarithmic slowdown. However, the underlying compression model considers only the predictability of the next sequence symbol given the k previous ones, where k is a small integer. This is unable to capture longer-term repetitiveness. For example, r identical copies of an incompressible sequence will be incompressible under this model. We develop new static and dynamic full-text indexes that are able of capturing the fact that a collection is highly repetitive, and require space basically proportional to the length of one typical sequence plus the total number of edit operations. The new indexes can be plugged into a recent dynamic fully-compressed suffix tree, achieving full functionality for sequence analysis, while retaining the reduced space and the polylogarithmic slowdown. Our experimental results confirm the practicality of our proposal. PMID:20377446

  11. [Trauma repetition and revictimization following physical and sexual abuse].

    PubMed

    Wöller, W

    2005-02-01

    The tendency of victims of physical or sexual childhood abuse to become revictimized in later life has well been documented empirically. Moreover, there is a high stability of violent and abusive relationships. The aim of this paper was to summarize perspectives from psychodynamic theory, attachment theory, and posttraumatic stress research to explain revictimization phenomena. The term repetition compulsion has little explanatory value without additional theoretical assumptions. Within the psychodynamic framework, an ego-psychological view conceives trauma repetition as an attempt to master traumatic experience, while in the object relations perspective, revictimization is explained by the influence of traumatic introjects. Negative cognitions of being worthless, bad and guilty can endorse the conviction that abuse is justified and reduce the capacity of self-care. Negative learning experiences from traumatic helplessness and powerlessness account for low self-efficacy expectations and prevent the establishment of self-boundaries. Trauma repetition can also be understood as an enactment in the service of affect regulation. Research in the field of attachment theory identified attachment styles predisposing to revictimization. Research dealing with posttraumatic stress disorder emphasizes the importance of traumatic affects recurring in daily life and, consequently, the tendency of abuse victims to actively produce dangerous situations in order to cope with these affects, furthermore, the role of dissociation in missing warning signals of impending traumatization. For therapeutically addressing revictimization, a detailed analysis of underlying phenomena is required. PMID:15685492

  12. Prediction of muscle performance during dynamic repetitive movement

    NASA Technical Reports Server (NTRS)

    Byerly, D. L.; Byerly, K. A.; Sognier, M. A.; Squires, W. G.

    2003-01-01

    BACKGROUND: During long-duration spaceflight, astronauts experience progressive muscle atrophy and often perform strenuous extravehicular activities. Post-flight, there is a lengthy recovery period with an increased risk for injury. Currently, there is a critical need for an enabling tool to optimize muscle performance and to minimize the risk of injury to astronauts while on-orbit and during post-flight recovery. Consequently, these studies were performed to develop a method to address this need. METHODS: Eight test subjects performed a repetitive dynamic exercise to failure at 65% of their upper torso weight using a Lordex spinal machine. Surface electromyography (SEMG) data was collected from the erector spinae back muscle. The SEMG data was evaluated using a 5th order autoregressive (AR) model and linear regression analysis. RESULTS: The best predictor found was an AR parameter, the mean average magnitude of AR poles, with r = 0.75 and p = 0.03. This parameter can predict performance to failure as early as the second repetition of the exercise. CONCLUSION: A method for predicting human muscle performance early during dynamic repetitive exercise was developed. The capability to predict performance to failure has many potential applications to the space program including evaluating countermeasure effectiveness on-orbit, optimizing post-flight recovery, and potential future real-time monitoring capability during extravehicular activity.

  13. Impact of repetitive DNA on sex chromosome evolution in plants.

    PubMed

    Hobza, Roman; Kubat, Zdenek; Cegan, Radim; Jesionek, Wojciech; Vyskot, Boris; Kejnovsky, Eduard

    2015-09-01

    Structurally and functionally diverged sex chromosomes have evolved in many animals as well as in some plants. Sex chromosomes represent a specific genomic region(s) with locally suppressed recombination. As a consequence, repetitive sequences involving transposable elements, tandem repeats (satellites and microsatellites), and organellar DNA accumulate on the Y (W) chromosomes. In this paper, we review the main types of repetitive elements, their gathering on the Y chromosome, and discuss new findings showing that not only accumulation of various repeats in non-recombining regions but also opposite processes form Y chromosome. The aim of this review is also to discuss the mechanisms of repetitive DNA spread involving (retro) transposition, DNA polymerase slippage or unequal crossing-over, as well as modes of repeat removal by ectopic recombination. The intensity of these processes differs in non-recombining region(s) of sex chromosomes when compared to the recombining parts of genome. We also speculate about the relationship between heterochromatinization and the formation of heteromorphic sex chromosomes. PMID:26474787

  14. Repetitive, small-bore two-stage light gas gun

    SciTech Connect

    Combs, S.K.; Foust, C.R.; Fehling, D.T.; Gouge, M.J.; Milora, S.L.

    1991-01-01

    A repetitive two-stage light gas gun for high-speed pellet injection has been developed at Oak Ridge National Laboratory. In general, applications of the two-stage light gas gun have been limited to only single shots, with a finite time (at least minutes) needed for recovery and preparation for the next shot. The new device overcomes problems associated with repetitive operation, including rapidly evacuating the propellant gases, reloading the gun breech with a new projectile, returning the piston to its initial position, and refilling the first- and second-stage gas volumes to the appropriate pressure levels. In addition, some components are subjected to and must survive severe operating conditions, which include rapid cycling to high pressures and temperatures (up to thousands of bars and thousands of kelvins) and significant mechanical shocks. Small plastic projectiles (4-mm nominal size) and helium gas have been used in the prototype device, which was equipped with a 1-m-long pump tube and a 1-m-long gun barrel, to demonstrate repetitive operation (up to 1 Hz) at relatively high pellet velocities (up to 3000 m/s). The equipment is described, and experimental results are presented. 124 refs., 6 figs., 5 tabs.

  15. Detection of acoustic repetition for very long stochastic patterns.

    PubMed

    Warren, R M; Bashford, J A; Cooley, J M; Brubaker, B S

    2001-01-01

    Guttman and Julesz (1963) employed recycling frozen noise segments (RFNs) as model stimuli in their classic study of the lower limits for periodicity detection and short-term auditory memory. They reported that listeners can hear iteration of these stochastic signals effortlessly as "motorboating" for repetition periods ranging from 50 to 250 msec and as "whooshing" from 250 msec to 1 sec. Both motorboating and whooshing RFNs are global percepts encompassing the entire period, as are RFNs in the pitch range (repetition periods shorter than 50 msec). However, with continued listening to whooshing (but not motorboating) RFNs, individuals hear recurrent brief components such as clanks and thumps that are characteristic of the particular waveform. Experiment 1 of the present study describes a cross-modal cuing procedure that enables listeners to store and then recognize the recurrence of portions of frozen noise waveforms that are repeated after intervals of 10 sec or more. Experiment 2 compares the relative saliencies of different spectral regions in enabling listeners to detect repetition of these long-period patterns. Special difficulty was encountered with the 6-kHz band of RFNs, possibly due to the lack of fine-structure phase locking at this frequency range. In addition, a similarity is noted between the organizational principles operating over particular durational ranges of stochastic patterns and the characteristics of traditional hierarchical units of speech having corresponding durations. PMID:11304013

  16. Serial Assessment of Physiological Evaluation Indices for Repetitive Mental Workload

    NASA Astrophysics Data System (ADS)

    Nozawa, Akio; Karita, Keita

    The objective of this study is to evaluate the effect of daily repetitive mental workload on physiological indices. Especially, the index derived from the nasal skin temperature(NST) measured by the infrared thermography was focused. The NST was the physiological index representing the sympathetic nervous system activity. The NST declines with the sympathetic nervous system's activation. The mental workload causes sympathetic nervous system's activation, so the mental workload can be measured by NST as a declining temperature. We have found that the relationship between the amount of mental workload and the NST declining under time pressure, even more complex stimuli. However, there's no study on evaluating the NST measured for the repetitive mental workload for certain period of time. In this paper, the NST and other physiological indices, which were Fmθ wave component of Electroencephalograms(EEG) and high frequency component(HF) of R-wave interval time series of Electrocardiograms(ECG) were serially measured and evaluated on repetitive mental workload. Significant difference was found between those NST indices in each experiment by paired t-test. A stability of NST as an evaluation index for MWL was proved.

  17. Repetition suppression: a means to index neural representations using BOLD?

    PubMed

    Barron, Helen C; Garvert, Mona M; Behrens, Timothy E J

    2016-10-01

    Understanding how the human brain gives rise to complex cognitive processes remains one of the biggest challenges of contemporary neuroscience. While invasive recording in animal models can provide insight into neural processes that are conserved across species, our understanding of cognition more broadly relies upon investigation of the human brain itself. There is therefore an imperative to establish non-invasive tools that allow human brain activity to be measured at high spatial and temporal resolution. In recent years, various attempts have been made to refine the coarse signal available in functional magnetic resonance imaging (fMRI), providing a means to investigate neural activity at the meso-scale, i.e. at the level of neural populations. The most widely used techniques include repetition suppression and multivariate pattern analysis. Human neuroscience can now use these techniques to investigate how representations are encoded across neural populations and transformed by relevant computations. Here, we review the physiological basis, applications and limitations of fMRI repetition suppression with a brief comparison to multivariate techniques. By doing so, we show how fMRI repetition suppression holds promise as a tool to reveal complex neural mechanisms that underlie human cognitive function.This article is part of the themed issue 'Interpreting BOLD: a dialogue between cognitive and cellular neuroscience'. PMID:27574308

  18. Bipolar high-repetition-rate high-voltage nanosecond pulser

    SciTech Connect

    Tian Fuqiang; Wang Yi; Shi Hongsheng; Lei Qingquan

    2008-06-15

    The pulser designed is mainly used for producing corona plasma in waste water treatment system. Also its application in study of dielectric electrical properties will be discussed. The pulser consists of a variable dc power source for high-voltage supply, two graded capacitors for energy storage, and the rotating spark gap switch. The key part is the multielectrode rotating spark gap switch (MER-SGS), which can ensure wider range modulation of pulse repetition rate, longer pulse width, shorter pulse rise time, remarkable electrical field distortion, and greatly favors recovery of the gap insulation strength, insulation design, the life of the switch, etc. The voltage of the output pulses switched by the MER-SGS is in the order of 3-50 kV with pulse rise time of less than 10 ns and pulse repetition rate of 1-3 kHz. An energy of 1.25-125 J per pulse and an average power of up to 10-50 kW are attainable. The highest pulse repetition rate is determined by the driver motor revolution and the electrode number of MER-SGS. Even higher voltage and energy can be switched by adjusting the gas pressure or employing N{sub 2} as the insulation gas or enlarging the size of MER-SGS to guarantee enough insulation level.

  19. The infogram: Entropic evidence of the signature of repetitive transients

    NASA Astrophysics Data System (ADS)

    Antoni, Jerome

    2016-06-01

    A classical symptom of rotating machines faults in vibration signals is the presence of repetitive transients, whose distinctive signature is both impulsive and cyclostationary. Typical approaches for their detection proceed in the time or frequency domains, with tools such as the spectral kurtosis, the kurtogram, or the envelope spectrum. The object of this paper is to extend and somehow connect these concepts in order to capture the signature of repetitive transients in both domains. Motivated by ideas borrowed from the field of thermodynamics where transients are seen as departures from a state of equilibrium, it is proposed to measure the negentropy of the squared envelope (SE) and of the squared envelope spectrum (SES) of the signal. This defines the SE infogram, the SES infogram, and their average which is theoretically maximum for a Dirac comb according to Hirschman's uncertainty principle. It is demonstrated that the joint consideration of the infograms significantly extends the domain of applicability of the kurtogram, in particular to situations corrupted with impulsive noise or when the relaxation time of the transients is low as compared to their rate of repetition. This is illustrated on both synthetic and actual vibration signals. This paper is part of a special issue in honor of Professor Simon Braun and pays tribute to his early contribution to the field of mechanical signature analysis.

  20. A repetitive sequence assembler based on next-generation sequencing.

    PubMed

    Lian, S; Tu, Y; Wang, Y; Chen, X; Wang, L

    2016-01-01

    Repetitive sequences of variable length are common in almost all eukaryotic genomes, and most of them are presumed to have important biomedical functions and can cause genomic instability. Next-generation sequencing (NGS) technologies provide the possibility of identifying capturing these repetitive sequences directly from the NGS data. In this study, we assessed the performances in identifying capturing repeats of leading assemblers, such as Velvet, SOAPdenovo, SGA, MSR-CA, Bambus2, ALLPATHS-LG, and AByss using three real NGS datasets. Our results indicated that most of them performed poorly in capturing the repeats. Consequently, we proposed a repetitive sequence assembler, named NGSReper, for capturing repeats from NGS data. Simulated datasets were used to validate the feasibility of NGSReper. The results indicate that the completeness of capturing repeat is up to 99%. Cross validation was performed in three real NGS datasets, and extensive comparisons indicate that NGSReper performed best in terms of completeness and accuracy in capturing repeats. In conclusion, NGSReper is an appropriate and suitable tool for capturing repeats directly from NGS data. PMID:27525861

  1. Peculiarities of RFLP of highly repetitive DNA in crow genomes

    SciTech Connect

    Chelomina, G.N.; Kryukov, A.P.; Ivanov, S.V.

    1995-02-01

    We present a study of the structural organization of highly repetitive DNA in genomes of hooded crow Corvus cornix L., carrion crow C. corone L., and jungle crow C. macrorhynchos Wagl. RFLP and blot-hybridization with {sup 32}P-labeled Msp I fragment from hooded crow nDNA suggest the interspecific structural conservatism of the most repetitive DNA. The family of repeats we studied had tandem organization and the same (210 bp) period of reiteration for a set of restriction enzymes. However, in parallel to the general similarity of restriction patterns, there are species-specific peculiarities. The repetitive family revealed (Alu I, BsuR I, and Msp I fragments) has quantitative RFLP of nDNA and interspecific differences in the extent of the multimer {open_quotes}ladder{close_quotes} pattern of Msp I fragments. The latter is more pronounced in nDNA of carrion crow than in that of phylogenetically distant jungle crow and closely related hooded crow. This suggests a recent amplification event for highly organized homological repeats in crow genomes. 10 refs., 2 figs.

  2. High-pulse-repetition-rate HF laser with plate electrodes

    SciTech Connect

    Andramanov, A V; Kabaev, S A; Lazhintsev, B V; Nor-Arevyan, V A; Pisetskaya, A V; Selemir, Victor D

    2006-03-31

    A high-pulse-repetition-rate electric-discharge HF laser with inductive-capacitive discharge stabilisation in the active H{sub 2}-SF{sub 6}-He mixture is studied. The multisectional discharge gap with a total length of 250 mm is formed by pairs of anode-cathode plates arranged in a zigzag pattern. The width of the discharge gap between each pair of plates is {approx}1 mm and its height is {approx}12 mm. The laser-beam cross section at the output cavity mirror is {approx}9 mm x 11 mm. The maximum laser pulse energy and the maximum laser efficiency for the H{sub 2}-SF{sub 6} mixture are 14.3 mJ and 2.1%, respectively. The addition of He to the mixture reduced the laser pulse energy by 10%-15%. The maximum gas velocity in the gap between the electrodes achieves 20 m s{sup -1}. The limiting pulse repetition rate f{sub lim} for which a decrease in the laser pulse energy is still not observed is {approx}2kHz for the H{sub 2}-SF{sub 6} mixture and {approx}2.4kHz for the H{sub 2}-SF{sub 6}-He mixture. The average output power {approx}27 W is obtained for a pulse repetition rate of 2.4 kHz. (lasers)

  3. A compact, repetitive accelerator for military and industrial applications

    SciTech Connect

    Zutavern, F.J.; O`Malley, M.W.; Ruebush, M.H.; Rinehart, L.F.; Loubriel, G.M.; Babcock, S.R.; Denison, G.J.

    1998-04-01

    A compact, short pulse, repetitive accelerator has many useful military and commercial applications in biological counter proliferation, materials processing, radiography, and sterilization (medical instruments, waste, and food). The goal of this project was to develop and demonstrate a small, 700 kV accelerator, which can produce 7 kA particle beams with pulse lengths of 10--30 ns at rates up to 50 Hz. At reduced power levels, longer pulses or higher repetition rates (up to 10 kHz) could be achieved. Two switching technologies were tested: (1) spark gaps, which have been used to build low repetition rate accelerators for many years; and (2) high gain photoconductive semiconductor switches (PCSS), a new solid state switching technology. This plan was economical, because it used existing hardware for the accelerator, and the PCSS material and fabrication for one module was relatively inexpensive. It was research oriented, because it provided a test bed to examine the utility of other emerging switching technologies, such as magnetic switches. At full power, the accelerator will produce 700 kV and 7 kA with either the spark gap or PCSS pulser.

  4. Sound Segregation via Embedded Repetition Is Robust to Inattention

    PubMed Central

    2015-01-01

    The segregation of sound sources from the mixture of sounds that enters the ear is a core capacity of human hearing, but the extent to which this process is dependent on attention remains unclear. This study investigated the effect of attention on the ability to segregate sounds via repetition. We utilized a dual task design in which stimuli to be segregated were presented along with stimuli for a “decoy” task that required continuous monitoring. The task to assess segregation presented a target sound 10 times in a row, each time concurrent with a different distractor sound. McDermott, Wrobleski, and Oxenham (2011) demonstrated that repetition causes the target sound to be segregated from the distractors. Segregation was queried by asking listeners whether a subsequent probe sound was identical to the target. A control task presented similar stimuli but probed discrimination without engaging segregation processes. We present results from 3 different decoy tasks: a visual multiple object tracking task, a rapid serial visual presentation (RSVP) digit encoding task, and a demanding auditory monitoring task. Load was manipulated by using high- and low-demand versions of each decoy task. The data provide converging evidence of a small effect of attention that is nonspecific, in that it affected the segregation and control tasks to a similar extent. In all cases, segregation performance remained high despite the presence of a concurrent, objectively demanding decoy task. The results suggest that repetition-based segregation is robust to inattention. PMID:26480248

  5. Analysis of the Encoding Factors That Produce the Negative Repetition Effect

    ERIC Educational Resources Information Center

    Mulligan, Neil W.; Peterson, Daniel J.

    2014-01-01

    Perhaps the most basic finding in memory research is the repetition effect--the fact that repetition enhances memory. Peterson and Mulligan (2012) recently documented a surprising "negative repetition effect," in which participants who studied a list of cue-target pairs twice recalled "fewer" targets than a group who studied…

  6. Don't Throw out the Baby with the Bathwater: Verbal Repetition, Mnemonics, and Active Learning

    ERIC Educational Resources Information Center

    Saber, Jane Lee; Johnson, Richard D.

    2008-01-01

    The effectiveness of using verbal repetition and first-letter acronyms to teach a common marketing framework was examined in two experiments. In Experiment 1, 345 undergraduate students were exposed to the framework using one of four conditions: control, verbal repetition, acronym, and verbal repetition plus acronym in a traditional learning…

  7. Does Practice Make Perfect? The Effects of Repetition on Student Learning.

    ERIC Educational Resources Information Center

    Annis, Linda F.; Annis, David B.

    Past research shows that repetition results in increased learning. However, it is not clear whether repetition adds more information to memory (quantitative hypothesis), or allows the learner to use a more sophisticated method of encoding (qualitative hypothesis). This study investigates the process and effectiveness of repetition as a study…

  8. Examining Restricted and Repetitive Behaviors in Young Children with Autism Spectrum Disorder during Two Observational Contexts

    ERIC Educational Resources Information Center

    Stronach, Sheri; Wetherby, Amy M.

    2014-01-01

    This prospective study of the FIRST WORDS® Project examined restricted and repetitive behaviors in a sample of 55 toddlers at a mean age of 20 months who were later diagnosed with autism spectrum disorder. Restricted and repetitive behaviors were coded using the Repetitive Movement and Restricted Interest Scales in two video-recorded observation…

  9. Nonword Repetition Performance in School-Age Children with and without Language Impairment.

    ERIC Educational Resources Information Center

    Weismer, Susan Ellis; Tomblin, J. Bruce; Zhang, Xuyang; Buckwalter, Paula

    2000-01-01

    This study examined nonword repetition performance in 581 second graders participating in a longitudinal investigation of specific language impairment. Results indicated that children with language impairments, as well as those in intervention, exhibited deficient nonword repetition skills and that the Nonword Repetition Task is a culturally…

  10. Repetitive Behaviour in Children with High Functioning Autism and Obsessive Compulsive Disorder

    ERIC Educational Resources Information Center

    Zandt, Fiona; Prior, Margot; Kyrios, Michael

    2007-01-01

    Children with Autism Spectrum Disorders (ASD) and children with Obsessive Compulsive Disorder (OCD) were compared on a range of repetitive behaviours. Parents reported similar levels of sameness behaviour and repetitive movements in the clinical groups, although children with OCD engaged in more repetitive behaviour focussed around routines and…

  11. The Effect of Repetition Types on Listening Tests in an EFL Setting

    ERIC Educational Resources Information Center

    Horness, Paul

    2013-01-01

    This study was an investigation into the effects of repetition on a listening comprehension test for second language learners. Repetition has been previously examined in a cursory way, usually as a secondary question to a primary treatment. Additionally, the method of repetition was limited to one way and to one treatment condition; therefore, it…

  12. Effects of Spaced Repetition on Long-Term Map Knowledge Recall

    ERIC Educational Resources Information Center

    Zirkle, David M.; Ellis, Arthur K.

    2010-01-01

    Sixth-grade students studying Latin America were placed in experimental and comparison groups to test the effects of map-study repetition on long-term memory. Mean scores on place-name repetition indicated that the experimental (repetition) group out-performed the comparison group at a statistically significant level with respect to both posttest…

  13. Characterizing Caregiver Responses to Restricted and Repetitive Behaviors in Toddlers with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Harrop, Clare; Gulsrud, Amanda; Shih, Wendy; Hovsepyan, Lilit; Kasari, Connie

    2016-01-01

    Restricted and repetitive behaviors are a core feature of autism spectrum disorder. This descriptive study documented the presence of restricted and repetitive behaviors in 85 toddlers with autism spectrum disorder as they interacted with their caregiver in a play interaction. For each child restricted and repetitive behavior, a caregiver…

  14. Repetition suppression and repetition enhancement underlie auditory memory-trace formation in the human brain: an MEG study.

    PubMed

    Recasens, Marc; Leung, Sumie; Grimm, Sabine; Nowak, Rafal; Escera, Carles

    2015-03-01

    The formation of echoic memory traces has traditionally been inferred from the enhanced responses to its deviations. The mismatch negativity (MMN), an auditory event-related potential (ERP) elicited between 100 and 250ms after sound deviation is an indirect index of regularity encoding that reflects a memory-based comparison process. Recently, repetition positivity (RP) has been described as a candidate ERP correlate of direct memory trace formation. RP consists of repetition suppression and enhancement effects occurring in different auditory components between 50 and 250ms after sound onset. However, the neuronal generators engaged in the encoding of repeated stimulus features have received little interest. This study intends to investigate the neuronal sources underlying the formation and strengthening of new memory traces by employing a roving-standard paradigm, where trains of different frequencies and different lengths are presented randomly. Source generators of repetition enhanced (RE) and suppressed (RS) activity were modeled using magnetoencephalography (MEG) in healthy subjects. Our results show that, in line with RP findings, N1m (~95-150ms) activity is suppressed with stimulus repetition. In addition, we observed the emergence of a sustained field (~230-270ms) that showed RE. Source analysis revealed neuronal generators of RS and RE located in both auditory and non-auditory areas, like the medial parietal cortex and frontal areas. The different timing and location of neural generators involved in RS and RE points to the existence of functionally separated mechanisms devoted to acoustic memory-trace formation in different auditory processing stages of the human brain. PMID:25528656

  15. [Relationship to Carcinogenesis of Repetitive Low-Dose Radiation Exposure].

    PubMed

    Ootsuyama, Akira

    2016-06-01

    We studied the carcinogenic effects caused by repetitive irradiation at a low dose, which has received attention in recent years, and examined the experimental methods used to evaluate radiation-induced carcinogenesis. For this experiment, we selected a mouse with as few autochthonous cancers as possible. Skin cancer was selected as the target for analysis, because it is a rare cancer in mice. Beta-rays were selected as the radiation source. The advantage of using beta-rays is weaker penetration power into tissues, thus protecting organs, such as the digestive and hematogenous organs. The benefit of our experimental method is that only skin cancer requires monitoring, and it is possible to perform long-term experiments. The back skin of mice was exposed repetitively to beta-rays three times a week until the occurrence of cancer or death, and the dose per exposure ranged from 0.5 to 11.8 Gy. With the high-dose range (2.5-11.8 Gy), the latency period and carcinogenic rate were almost the same in each experimental group. When the dose was reduced to 1-1.5 Gy, the latency period increased, but the carcinogenic rate remained. When the dose was further reduced to 0.5 Gy, skin cancer never happened, even though we continued irradiation until death of the last mouse in this group. The lifespan of 0.5 Gy group mice was the same as that of the controls. We showed that the 0.5 Gy dose did not cause cancer, even in mice exposed repetitively throughout their life span, and thus refer to 0.5 Gy as the threshold-like dose. PMID:27302731

  16. Repetitive Pulsed X-Ray Generator Utilizing A Triode

    NASA Astrophysics Data System (ADS)

    Sato, Eiichi; Kawasaki, Satoshi; Isobe, Hiroshi; Tamakawa, Yoshiharu; Yanagisawa, Toru

    1990-01-01

    A repetitive pulsed x-ray generator utilizing a triode for biomedical radiography is described. This generator consisted of the following components: a high-voltage power supply, a cable condenser with a length of 10m and a capacity of about 1000pF, a repetitive impulse switching system, a turbo molecular pump, and a pulsed x-ray tube having a cold cathode. The x-ray tube was of the triode type which was connected to the turbo molecular pump and consisted of the following components: a rod-shaped anode tip made of tungsten, a ring cathode made of molybdenum, a ring trigger electrode made of iron and other parts. The trigger electrode was attached to the cathode electrode just inside of the x-ray window and the space between the cathode and trigger electrodes was less than 0.5mm. The anode-cathode (A-C) space was adjusted outside of the x-ray window for controlling the A-C impedance. The cable condenser was charged from 30 to 100kV by the constant voltage generator and was discharged repetitively by the impulse switching system utilizing a frequency control system with a high time resolution. The maximum frequencies varied according to the charging voltage, the condenser capacity which was determined by the length of the cable condenser, and the current capacity of the high-voltage power supply. The frequencies of this generator were less than 100Hz, and the pulse widths of the pulsed x-rays were less than 300ns. The time integrated x-ray intensity was less than 5.0pC/kg at 0.5m per pulse, and the effective focal spot size ranged from 0.5 to 3.0mm.

  17. An Experiment on Repetitive Pulse Operation of Microwave Rocket

    SciTech Connect

    Oda, Yasuhisa; Shibata, Teppei; Komurasaki, Kimiya; Takahashi, Koji; Kasugai, Atsushi; Sakamoto, Keishi

    2008-04-28

    Microwave Rocket was operated with repetitive pulses. The microwave rocket model with forced breathing system was used. The pressure history in the thruster was measured and the thrust impulse was deduced. As a result, the impulse decreased at second pulse and impulses at latter pulses were constant. The dependence of the thrust performance on the partial filling rate of the thruster was compared to the thrust generation model based on the shock wave driven by microwave plasma. The experimental results showed good agreement to the predicted dependency.

  18. High voltage high repetition rate pulse using Marx topology

    NASA Astrophysics Data System (ADS)

    Hakki, A.; Kashapov, N.

    2015-06-01

    The paper describes Marx topology using MOSFET transistors. Marx circuit with 10 stages has been done, to obtain pulses about 5.5KV amplitude, and the width of the pulses was about 30μsec with a high repetition rate (PPS > 100), Vdc = 535VDC is the input voltage for supplying the Marx circuit. Two Ferrite ring core transformers were used to control the MOSFET transistors of the Marx circuit (the first transformer to control the charging MOSFET transistors, the second transformer to control the discharging MOSFET transistors).

  19. Background music for repetitive task performance of severely retarded individuals.

    PubMed

    Richman, J S

    1976-11-01

    Environmental manipulation in the form of specific tempo background music was used to assist in the habilitation of severely retarded persons. Thirty institutionalized retarded males were tested on a repetitive manual performance task judged to be similar to the type of tasks found in sheltered workshops. Each subject received each of the background treatments noncontingently: no music, slow tempo music, regular tempo music, fast tempo music. The results indicated that the regular tempo of background music facilitated the greatest improvement in performance, suggesting that the effect of music on performance is more complex than the issue of contingent presentation. PMID:998661

  20. Arrangement of repetitive sequences in the genome of herpesvirus Sylvilagus.

    PubMed

    Medveczky, M M; Geck, P; Clarke, C; Byrnes, J; Sullivan, J L; Medveczky, P G

    1989-02-01

    Herpesvirus sylvilagus is a lymphotropic (type gamma) herpesvirus of cottontail rabbits (Sylvilagus floridanus). Analysis of virion DNA of herpesvirus sylvilagus has revealed that the genome consists of one stretch of about 120 kilobase pairs of internal, unique DNA flanked by a variable number of 553-base-pair tandem repeats. The G + C content of the repetitive DNA is extremely high (83%), as determined by sequencing. The organization of the herpesvirus sylvilagus genome is, therefore, similar to that of the primate lymphotropic viruses herpesvirus saimiri and herpesvirus ateles. PMID:2911114

  1. High-repetition-rate CF/sub 4/ laser

    SciTech Connect

    Telle, J.

    1981-01-01

    A 16 ..mu..m CF/sub 4/ laser oscillator has operated at 1 kHz in a cooled static cell. Threshold pump energies required from the low pressure, Q-switched, cw discharge CO/sub 2/ laser were as low as 60 ..mu..J. The laser cavity employed the multiple-pass off-axis path resonator in a ring configuration. CF/sub 4/ laser power at 615 cm/sup -1/ and a 1 kHz repetition rate exceeded 300 ..mu..W.

  2. 1-kHz-repetition-rate femtosecond Raman laser

    NASA Astrophysics Data System (ADS)

    Didenko, N. V.; Konyashchenko, A. V.; Kostryukov, P. V.; Losev, L. L.; Pazyuk, V. S.; Tenyakov, S. Yu

    2016-07-01

    A femtosecond Raman laser utilising compressed hydrogen is experimentally investigated under pumping by radiation from a 1-kHz-repetition-rate Ti : sapphire laser. In the regime of double-pulse pumping, the conditions are determined, which correspond to the minimal energy dispersion of Stokes pulses. The optical scheme is realised, which is capable of ensuring the long-term stability of the average power of the first Stokes component with a variation of less than 2%. The Stokes pulses are produced with a pulse duration of 60 fs and energy of 0.26 mJ at a conversion efficiency of 14%.

  3. On the relationship between persistent delay activity, repetition enhancement and priming

    PubMed Central

    Tartaglia, Elisa M.; Mongillo, Gianluigi; Brunel, Nicolas

    2015-01-01

    Human efficiency in processing incoming stimuli (in terms of speed and/or accuracy) is typically enhanced by previous exposure to the same, or closely related stimuli—a phenomenon referred to as priming. In spite of the large body of knowledge accumulated in behavioral studies about the conditions conducive to priming, and its relationship with other forms of memory, the underlying neuronal correlates of priming are still under debate. The idea has repeatedly been advanced that a major neuronal mechanism supporting behaviorally-expressed priming is repetition suppression, a widespread reduction of spiking activity upon stimulus repetition which has been routinely exposed by single-unit recordings in non-human primates performing delayed-response, as well as passive fixation tasks. This proposal is mainly motivated by the observation that, in human fMRI studies, priming is associated to a significant reduction of the BOLD signal (widely interpreted as a proxy of the level of spiking activity) upon stimulus repetition. Here, we critically re-examine a large part of the electrophysiological literature on repetition suppression in non-human primates and find that repetition suppression is systematically accompanied by stimulus-selective delay period activity, together with repetition enhancement, an increase of spiking activity upon stimulus repetition in small neuronal populations. We argue that repetition enhancement constitutes a more viable candidate for a putative neuronal substrate of priming, and propose a minimal framework that links together, mechanistically and functionally, repetition suppression, stimulus-selective delay activity and repetition enhancement. PMID:25657630

  4. PROCESSING OF NANOSTRUCTURED COPPER BY REPETITIVE CORRUGATION AND STRAIGHTENING (RCS)

    SciTech Connect

    Zhu, Y.T.; Jiang, H.

    2000-10-01

    A new process, Repetitive Corrugation and Straightening (RCS), has been developed to create bulk, nanostructured copper. In this investigation, a high purity (99.99%). copper bar measuring 6 x 6 x 50 mm with an average grain size of 765 {micro}m was used as the starting material. It was repetitively corrugated and straightened for 14 times with 90{degree} rotations along its longitudinal axis between consecutive corrugation-straightening cycles. The copper was cooled to below room temperature before each RCS cycle. The grain size obtained after the RCS process was in the range of twenty to a few hundred nanometers, and microhardness was increased by 100%. Both equilibrium and non-equilibrium grain boundaries are observed. This work demonstrates the capability of the RCS process in refining grain size of metal materials. The RCS process can be easily adapted to large-scale industrial production and has the potential to pave the way to large-scale structural applications of nanostructured materials.

  5. Resistance to change of operant variation and repetition.

    PubMed Central

    Doughty, A H; Lattal, K A

    2001-01-01

    A multiple chained schedule was used to compare the relative resistance to change of variable and fixed four-peck response sequences in pigeons. In one terminal link, a response sequence produced food only if it occurred infrequently relative to 15 other response sequences (vary). In the other terminal link, a single response sequence produced food (repeat). Identical variable-interval schedules operated in the initial links. During baseline, lower response rates generally occurred in the vary initial link, and similar response and reinforcement rates occurred in each terminal link. Resistance of responding to prefeeding and three rates of response-independent food delivered during the intercomponent intervals then was compared between components. During each disruption condition, initial- and terminal-link response rates generally were more resistant in the vary component than in the repeat component. During the response-independent food conditions, terminal-link response rates were more resistant than initial-link response rates in each component, but this did not occur during prefeeding. Variation (in vary) and repetition (in repeat) both decreased during the response-independent food conditions in the respective components, but with relatively greater disruption in repeat. These results extend earlier findings demonstrating that operant variation is more resistant to disruption than is operant repetition and suggest that theories of response strength, such as behavioral momentum theory, must consider factors other than reinforcement rate. The implications of the results for understanding operant response classes are discussed. PMID:11599639

  6. Repetitive magnetic stimulation induces plasticity of inhibitory synapses

    PubMed Central

    Lenz, Maximilian; Galanis, Christos; Müller-Dahlhaus, Florian; Opitz, Alexander; Wierenga, Corette J.; Szabó, Gábor; Ziemann, Ulf; Deller, Thomas; Funke, Klaus; Vlachos, Andreas

    2016-01-01

    Repetitive transcranial magnetic stimulation (rTMS) is used as a therapeutic tool in neurology and psychiatry. While repetitive magnetic stimulation (rMS) has been shown to induce plasticity of excitatory synapses, it is unclear whether rMS can also modify structural and functional properties of inhibitory inputs. Here we employed 10-Hz rMS of entorhinohippocampal slice cultures to study plasticity of inhibitory neurotransmission on CA1 pyramidal neurons. Our experiments reveal a rMS-induced reduction in GABAergic synaptic strength (2–4 h after stimulation), which is Ca2+-dependent and accompanied by the remodelling of postsynaptic gephyrin scaffolds. Furthermore, we present evidence that 10-Hz rMS predominantly acts on dendritic, but not somatic inhibition. Consistent with this finding, a reduction in clustered gephyrin is detected in CA1 stratum radiatum of rTMS-treated anaesthetized mice. These results disclose that rTMS induces coordinated Ca2+-dependent structural and functional changes of specific inhibitory postsynapses on principal neurons. PMID:26743822

  7. Sex chromosome evolution: life, death and repetitive DNA

    PubMed Central

    Deshpande, Nikita; Meller, Victoria H

    2014-01-01

    Dimorphic sex chromosomes create problems. Males of many species, including Drosophila, are heterogametic, with dissimilar X and Y chromosomes. The essential process of dosage compensation modulates the expression of X-linked genes in one sex to maintain a constant ratio of X to autosomal expression. This involves the regulation of hundreds of dissimilar genes whose only shared property is chromosomal address. Drosophila males dosage compensate by up regulating X-linked genes 2 fold. This is achieved by the Male Specific Lethal (MSL) complex, which is recruited to genes on the X chromosome and modifies chromatin to increase expression. How the MSL complex is restricted to X-linked genes remains unknown. Recent studies of sex chromosome evolution have identified a central role for 2 types of repetitive elements in X recognition. Helitrons carrying sites that recruit the MSL complex have expanded across the X chromosome in at least one Drosophila species.1 Our laboratory found that siRNA from an X-linked satellite repeat promotes X recognition by a yet unknown mechanism.2 The recurring adoption of repetitive elements as X-identify elements suggests that the large and mysterious fraction of the genome called “junk” DNA is actually instrumental in the evolution of sex chromosomes. PMID:25751570

  8. Sex chromosome evolution: life, death and repetitive DNA.

    PubMed

    Deshpande, Nikita; Meller, Victoria H

    2014-01-01

    Dimorphic sex chromosomes create problems. Males of many species, including Drosophila, are heterogametic, with dissimilar X and Y chromosomes. The essential process of dosage compensation modulates the expression of X-linked genes in one sex to maintain a constant ratio of X to autosomal expression. This involves the regulation of hundreds of dissimilar genes whose only shared property is chromosomal address. Drosophila males dosage compensate by up regulating X-linked genes 2 fold. This is achieved by the Male Specific Lethal (MSL) complex, which is recruited to genes on the X chromosome and modifies chromatin to increase expression. How the MSL complex is restricted to X-linked genes remains unknown. Recent studies of sex chromosome evolution have identified a central role for 2 types of repetitive elements in X recognition. Helitrons carrying sites that recruit the MSL complex have expanded across the X chromosome in at least one Drosophila species. (1) Our laboratory found that siRNA from an X-linked satellite repeat promotes X recognition by a yet unknown mechanism. (2) The recurring adoption of repetitive elements as X-identify elements suggests that the large and mysterious fraction of the genome called "junk" DNA is actually instrumental in the evolution of sex chromosomes. PMID:25751570

  9. Unstable high molecular weight inverted repetitive DNA in human lymphocytes.

    PubMed Central

    Rogers, J C; Rucinsky, T E

    1982-01-01

    About 1% of newly synthesized DNA from PHA-stimulated human lymphocytes can be isolated as large (up to 90 kilobase pairs) double stranded fragments that resist sequential alkali and heat denaturation steps but are not closed circular. By electron microscopy about 1% have single-strand hairpin loops at one end and therefore present inverted repetitive sequences (IR-DNA). Most of the remainder have a blunt-appearing double-strand terminus at both ends (78%) or one end (18%). Indirect evidence indicates that these also are inverted complementary structures with terminal hairpin loops too small to be visualized: (1) Treatment with either a 5' or 3' single-strand exonuclease generates essentially only fragments with a single strand at one end; (2) with partial denaturation, the number of fragments with identifiable single-strand hairpin loops increases (to about 20%); (3) after S1 nuclease digestion, greater than 95% can be fully heat denatured. Cot analysis indicates that these fragments are derived from dispersed sites throughout the genome. Up to 25% of DNA released from lymphocytes during growth similarly resists denaturation, and released DNA and IR-DNA are both enriched in the same set of repetitive sequences. Thus at least a portion of IR-DNA appears to be unstable. Images PMID:7145706

  10. Maximum acceptable forces for repetitive ulnar deviation of the wrist.

    PubMed

    Snook, S H; Vaillancourt, D R; Ciriello, V M; Webster, B S

    1997-07-01

    The purpose of this experiment was to quantify maximum acceptable forces for ulnar deviation motions of the wrist at various repetition rates. Subjects grasped a handle with a power grip and moved it through a 1.40 rad (80 degrees) ulnar deviation wrist motion (similar to a knife cutting task). A psychophysical methodology was used in which the subject adjusted the resistance on the handle and the experiment manipulated or controlled all other variables. Two series of experiments were conducted. Thirteen subjects completed the first series, which investigated repetition rates of 15 and 20 motions per minute. Eleven subjects completed the second series, which investigated 15, 20, and 25 motions per minute. Subjects performed for 7 hours per day, 5 days per week, for 4 weeks in the first series and 5 weeks in the second series. The subjects were instructed to work as if they were on an incentive basis, getting paid for the amount of work they performed. Symptoms were recorded by the subjects during the last 5 minutes of each hour. The results are presented and compared with maximum acceptable forces for wrist flexion and extension. PMID:9208467

  11. Decomposition of repetition priming processes in word translation.

    PubMed

    Francis, Wendy S; Durán, Gabriela; Augustini, Beatriz K; Luévano, Genoveva; Arzate, José C; Sáenz, Silvia P

    2011-01-01

    Translation in fluent bilinguals requires comprehension of a stimulus word and subsequent production, or retrieval and articulation, of the response word. Four repetition-priming experiments with Spanish–English bilinguals (N = 274) decomposed these processes using selective facilitation to evaluate their unique priming contributions and factorial combination to evaluate the degree of process overlap or dependence. In Experiment 1, symmetric priming between semantic classification and translation tasks indicated that bilinguals do not covertly translate words during semantic classification. In Experiments 2 and 3, semantic classification of words and word-cued picture drawing facilitated word-comprehension processes of translation, and picture naming facilitated word-production processes. These effects were independent, consistent with a sequential model and with the conclusion that neither semantic classification nor word-cued picture drawing elicits covert translation. Experiment 4 showed that 2 tasks involving word-retrieval processes--written word translation and picture naming--had subadditive effects on later translation. Incomplete transfer from written translation to spoken translation indicated that preparation for articulation also benefited from repetition in the less-fluent language. PMID:21058875

  12. Repetitive magnetic stimulation induces plasticity of inhibitory synapses.

    PubMed

    Lenz, Maximilian; Galanis, Christos; Müller-Dahlhaus, Florian; Opitz, Alexander; Wierenga, Corette J; Szabó, Gábor; Ziemann, Ulf; Deller, Thomas; Funke, Klaus; Vlachos, Andreas

    2016-01-01

    Repetitive transcranial magnetic stimulation (rTMS) is used as a therapeutic tool in neurology and psychiatry. While repetitive magnetic stimulation (rMS) has been shown to induce plasticity of excitatory synapses, it is unclear whether rMS can also modify structural and functional properties of inhibitory inputs. Here we employed 10-Hz rMS of entorhinohippocampal slice cultures to study plasticity of inhibitory neurotransmission on CA1 pyramidal neurons. Our experiments reveal a rMS-induced reduction in GABAergic synaptic strength (2-4 h after stimulation), which is Ca(2+)-dependent and accompanied by the remodelling of postsynaptic gephyrin scaffolds. Furthermore, we present evidence that 10-Hz rMS predominantly acts on dendritic, but not somatic inhibition. Consistent with this finding, a reduction in clustered gephyrin is detected in CA1 stratum radiatum of rTMS-treated anaesthetized mice. These results disclose that rTMS induces coordinated Ca(2+)-dependent structural and functional changes of specific inhibitory postsynapses on principal neurons. PMID:26743822

  13. Application of repetitive pulsed power technology to chemical processing

    SciTech Connect

    Kaye, R.J.; Hamil, R.

    1995-12-31

    The numerous sites of soil and water contaminated with organic chemicals present an urgent environmental concern that continues to grow. Electron and x-ray irradiation have been shown to be effective methods to destroy a wide spectrum of organic chemicals, nitrates, nitrites, and cyanide in water by breaking molecules to non-toxic products or entirely mineralizing the by-products to gas, water, and salts. Sandia National Laboratories is developing Repetitive High Energy Pulsed Power (RHEPP) technology capable of producing high average power, broad area electron or x-ray beams. The 300 kW RHEPP-II facility accelerates electrons to 2.5 MeV at 25 kA over 1,000 cm{sup 2} in 60 ns pulses at repetition rates of over 100 Hz. Linking this modular treatment capability with the rapid optical-sensing diagnostics and neutral network characterization software algorithms will provide a Smart Waste Treatment (SWaT) system. Such a system would also be applicable for chemical manufacture and processing of industrial waste for reuse or disposal. This talk describes both the HREPP treatment capability and sensing technologies. Measurements of the propagated RHEPP-II beam and dose profiles are presented. Sensors and rapid detection software are discussed with application toward chemical treatment.

  14. Candida albicans repetitive elements display epigenetic diversity and plasticity

    PubMed Central

    Freire-Benéitez, Verónica; Price, R. Jordan; Tarrant, Daniel; Berman, Judith; Buscaino, Alessia

    2016-01-01

    Transcriptionally silent heterochromatin is associated with repetitive DNA. It is poorly understood whether and how heterochromatin differs between different organisms and whether its structure can be remodelled in response to environmental signals. Here, we address this question by analysing the chromatin state associated with DNA repeats in the human fungal pathogen Candida albicans. Our analyses indicate that, contrary to model systems, each type of repetitive element is assembled into a distinct chromatin state. Classical Sir2-dependent hypoacetylated and hypomethylated chromatin is associated with the rDNA locus while telomeric regions are assembled into a weak heterochromatin that is only mildly hypoacetylated and hypomethylated. Major Repeat Sequences, a class of tandem repeats, are assembled into an intermediate chromatin state bearing features of both euchromatin and heterochromatin. Marker gene silencing assays and genome-wide RNA sequencing reveals that C. albicans heterochromatin represses expression of repeat-associated coding and non-coding RNAs. We find that telomeric heterochromatin is dynamic and remodelled upon an environmental change. Weak heterochromatin is associated with telomeres at 30 °C, while robust heterochromatin is assembled over these regions at 39 °C, a temperature mimicking moderate fever in the host. Thus in C. albicans, differential chromatin states controls gene expression and epigenetic plasticity is linked to adaptation. PMID:26971880

  15. Physical mapping of human chromosomes by repetitive sequence fingerprinting.

    PubMed Central

    Stallings, R L; Torney, D C; Hildebrand, C E; Longmire, J L; Deaven, L L; Jett, J H; Doggett, N A; Moyzis, R K

    1990-01-01

    We have developed an approach for identifying overlapping cosmid clones by exploiting the high density of repetitive sequences in complex genomes. Individual clones are fingerprinted, using a combination of restriction enzyme digestions followed by hybridization with selected classes of repetitive sequences. This "repeat fingerprinting" technique allows small regions of clone overlap (10-20%) to be unambiguously assigned. We demonstrate the utility of this approach, using the fingerprinting of 3145 cosmid clones (1.25 x coverage), containing one or more (GT)n repeats, from human chromosome 16. A statistical analysis was used to link these clones into 460 contiguous sequences (contigs), averaging 106 kilobases (kb) in length and representing approximately 54% (48.7 Mb) of the euchromatic arms of this chromosome. These values are consistent with theoretical calculations and indicate that 150- to 200-kb contigs can be generated with 1.5 x coverage. This strategy requires the fingerprinting of approximately one-fourth as many cosmids as random strategies requiring 50% minimum overlap for overlap detection. By "nucleating" at specific regions in the human genome, and exploiting the high density of interspersed sequences, this approach allows (i) the rapid generation of large (greater than 100-kb) contigs in the early stages of contig mapping and (ii) the production of a contig map with useful landmarks for rapid integration of the genetic and physical maps. Images PMID:2385591

  16. Improved Limits on Gamma-Ray Burst Repetition from BATSE

    NASA Technical Reports Server (NTRS)

    Tegmark, Max; Hartmann, Dieter H.; Briggs, Michael S.; Hakkila, Jon; Meegan, Charles A.

    1996-01-01

    We tighten previous upper limits on gamma-ray burst repetition by analyzing the angular power spectrum of the BATSE 3B catalog of 1122 bursts. At 95% confidence, we find that no more than 2% of all observed bursts can be labeled as repeaters, even if no sources are observed to repeat more than once. If a fraction f of all observed bursts can be labeled as repeaters that are observed to burst upsilon times each, then all models with (upsilon - 1)f greater than or equal to 0.05 are ruled out at 99% confidence, as compared to the best previous 99% limit (upsilon - 1)f greater than or equal to 0.27. At 95% confidence, our new limit is (upsilon - 1)f greater than or equal to 0.02. Thus, even a cluster of six events from a single source would have caused excess power above that present in the 3B catalog. We conclude that the current BATSE data are consistent with no repetition of classical gamma-ray bursts and that any repeater model is severely constrained by the near-perfect isotropy of their angular distribution.

  17. Improved Limits on Gamma-Ray Burst Repetition from BATSE

    NASA Technical Reports Server (NTRS)

    Tegmark, Max; Hartmann, Dieter H.; Briggs, Michael S.; Meegan, Charles A.; Hakkila, Jon

    1996-01-01

    We tighten previous upper limits on gamma-ray burst repetition by analyzing the angular power spectrum of the BATSE 3B catalog of 1122 bursts. At 95% confidence, we find that no more than 2% of all observed bursts can be labeled as repeaters, even if no sources are observed to repeat more than once. If a fraction f of all observed bursts can be labeled as repeaters that are observed to burst nu times each, then all models with (nu - 1)f greater than or equal to 0.05 are ruled out at 99% confidence, as compared to the best previous 99% limit (nu - 1)f greater than or equal to 0.27. At 95% confidence, our new limit is (nu - 1)f greater than or equal to 0.02. Thus, even a cluster of six events from a single source would have caused excess power above that present in the 3B catalog. We conclude that the current BATSE data are consistent with no repetition of classical gamma-ray bursts and that any repeater model is severely constrained by the near-perfect isotropy of their angular dis- tribution.

  18. Repetitive Transcranial Magnetic Stimulation Activates Specific Regions in Rat Brain

    NASA Astrophysics Data System (ADS)

    Ji, Ru-Rong; Schlaepfer, Thomas E.; Aizenman, Carlos D.; Epstein, Charles M.; Qiu, Dike; Huang, Justin C.; Rupp, Fabio

    1998-12-01

    Repetitive transcranial magnetic stimulation (rTMS) is a noninvasive technique to induce electric currents in the brain. Although rTMS is being evaluated as a possible alternative to electroconvulsive therapy for the treatment of refractory depression, little is known about the pattern of activation induced in the brain by rTMS. We have compared immediate early gene expression in rat brain after rTMS and electroconvulsive stimulation, a well-established animal model for electroconvulsive therapy. Our result shows that rTMS applied in conditions effective in animal models of depression induces different patterns of immediate-early gene expression than does electroconvulsive stimulation. In particular, rTMS evokes strong neural responses in the paraventricular nucleus of the thalamus (PVT) and in other regions involved in the regulation of circadian rhythms. The response in PVT is independent of the orientation of the stimulation probe relative to the head. Part of this response is likely because of direct activation, as repetitive magnetic stimulation also activates PVT neurons in brain slices.

  19. A Repetitional Pulsed X-Ray Generator For Biomedical Radiography

    NASA Astrophysics Data System (ADS)

    Isobe, Hiroshi; Sato, Eiichi; Tamakawa, Yoshiharu; Yanagisawa, Toru

    1989-06-01

    A repetitional pulsed x-ray generator in conjunction with an image intensifier system for biomedical radiography is described. This generator consisted of the following components: a high-speed power supply, various capacities of pulse condensers, a turbo molecular pump, and an oil-cooled x-ray tube. The pulse condensers were charged to the optimum voltage of less than 100kV, and the electric charges were discharged repeatedly by using the flashover mechanism. The pulse width tended to decrease when the capacity and the anode-cathode(A-C) space were reduced, and their values were less than 200ns. The current of the power supply determined the repetitional rates for the pulses, which were limited by the charging resistor, the condenser capacity, the charging voltage, and the electric power of the power supply. The maximum value was less than 20Hz due to the ripples of the charging current of 50Hz. The x-ray quality primarily became hard by increasing the charging voltage, and inserting metal filters. The effective focal spot size primarily varied according to the diameter of anode tip, and its size was less than 3.0mm in diameter. Pulsed x-ray fluoro-scopy was performed by using an image intensifier system utilizing a CRT for medical use.

  20. Laser stimulation of auditory neurons at high repetition rate

    NASA Astrophysics Data System (ADS)

    Izzo, Agnella D.; Littlefield, Philip; Walsh, Joseph T., Jr.; Webb, Jim; Ralph, Heather; Bendett, Mark; Jansen, E. Duco; Richter, Claus-Peter

    2007-02-01

    Pulsed, mid-infrared lasers can evoke neural activity from motor as well as sensory neurons in vivo. Lasers allow more selective spatial resolution of stimulation than the conventional electrical stimulation. To date, few studies have examined pulsed, mid-infrared neural stimulation and very little of the available optical parameter space has been studied. We found that pulse durations as short as 20 ?s elicit a compound action potential from the gerbil cochlea. Moreover, stimulation thresholds are not a function of absolute energy or absolute power deposited. Compound action potential peak-to-peak amplitude remained constant over extended periods of stimulation. Stimulation occurred up six hours continuously and up to 50 Hz in repetition rate. Single fiber experiments were made using repetition rates of up to 1 kHz. Action potentials occurred 2.5-4 ms after the laser pulse. Maximum rates of discharge were up to 250 action potentials per second. With increasing stimulation rate (300 Hz), the action potentials did not respond strictly after the light pulse. The results from these experiments are important for designing the next generation of neuroprostheses, specifically cochlear implants.

  1. Improving child compliance on a computer administered nonword repetition task.

    PubMed

    Polišenská, Kamila; Kapalková, Svetlana

    2014-06-01

    Purpose: A range of nonword repetition (NWR) tasks are used in research and clinical applications, but compliance rates among young children remain low. Live presentation is usually used to improve compliance rates, but this lacks the consistency of recorded stimuli. In this study, the authors examined whether a novel delivery of NWR stimuli based on recorded material could provide improved compliance rates in young children, thereby reducing research bias.Method: The novel NWR task with 26 recorded items was administered to 391 typically developing children ages 2–6 years. The children were presented with a story that they could influence by repeating “magic” words. Results: From the 384 children who completed the task, the authors found a noncompliance rate related to age. In line with previous research, no effect of demographic factors was found,but there was a significant main effect of age, syllable length,and phonological complexity on repetition accuracy. Test–retest and interrater scoring showed high levels of reliability.Conclusion: The task described in this study offers an objective delivery of recorded stimuli that engages young children and provides high compliance rates. The task is inexpensive, requires minimal training, and can be adapted to other languages. PMID:25667943

  2. Effect of Airflows on Repetitive Nanosecond Volume Discharges

    NASA Astrophysics Data System (ADS)

    Tang, Jingfeng; Wei, Liqiu; Huo, Yuxin; Song, Jian; Yu, Daren; Zhang, Chaohai

    2016-03-01

    Atmospheric pressure discharges excited by repetitive nanosecond pulses have attracted significant attention for various applications. In this paper, a plate-plate discharge with airflows is excited by a repetitive nanosecond pulse generator. Under different experiment conditions, the applied voltages, discharge currents, and discharge images are recorded. The plasma images presented here indicate that the volume discharge modes vary with airflow speeds, and a diffuse and homogeneous volume discharge occurs at the speed of more than 35 m/s. The role of airflows provides different effects on the 2-stage pulse discharges. The 1st pulse currents nearly maintain consistency for different airflow speeds. However, the 2nd pulse current has a change trend of first decreasing and then rapidly increasing, and the value difference for 2nd pulse currents is about 20 A under different airflows. In addition, the experimental results are discussed according to the electrical parameters and discharge images. supported by National Natural Science Foundation of China (Nos. 51006027, 51437002, and 51477035)

  3. Rotated balance in humans due to repetitive rotational movement

    NASA Astrophysics Data System (ADS)

    Zakynthinaki, M. S.; Madera Milla, J.; López Diaz De Durana, A.; Cordente Martínez, C. A.; Rodríguez Romo, G.; Sillero Quintana, M.; Sampedro Molinuevo, J.

    2010-03-01

    We show how asymmetries in the movement patterns during the process of regaining balance after perturbation from quiet stance can be modeled by a set of coupled vector fields for the derivative with respect to time of the angles between the resultant ground reaction forces and the vertical in the anteroposterior and mediolateral directions. In our model, which is an adaption of the model of Stirling and Zakynthinaki (2004), the critical curve, defining the set of maximum angles one can lean to and still correct to regain balance, can be rotated and skewed so as to model the effects of a repetitive training of a rotational movement pattern. For the purposes of our study a rotation and a skew matrix is applied to the critical curve of the model. We present here a linear stability analysis of the modified model, as well as a fit of the model to experimental data of two characteristic "asymmetric" elite athletes and to a "symmetric" elite athlete for comparison. The new adapted model has many uses not just in sport but also in rehabilitation, as many work place injuries are caused by excessive repetition of unaligned and rotational movement patterns.

  4. Obesity-related changes in prolonged repetitive lifting performance.

    PubMed

    Ghesmaty Sangachin, Mahboobeh; Cavuoto, Lora A

    2016-09-01

    Despite the rising prevalence of obesity, little is known about its moderating effects on injury risk factors, such as fatigue, in occupational settings. This study investigated the effect of obesity, prolonged repetitive lifting and their interaction on lifting performance of 14 participants, 7 obese (mean body mass index (BMI): 33.2 kg m(-2)) and 7 non-obese (mean BMI: 22.2 kg m(-2)) subjects. To present a physically challenging task, subjects performed repetitive lifting for 1 h at 120% of their maximum acceptable weight of lift. Generalized linear mixed models were fit to posture and acceleration data. The obese group bent to a ∼10° lower peak trunk sagittal flexion angle, had 17% lower root mean square (RMS) jerk and took 0.8 s longer per lift. Over time, the obese group increased their trunk transverse and sagittal posterior accelerations while the non-obese maintained theirs. Although the majority of lifting variables were unaffected by BMI or its interaction with prolonged lifting duration, the observed differences, combined with a greater upper body mass, necessitate a more cautious use of existing psychophysical lifting limits for individuals who are obese, particularly when fatigued. PMID:27184307

  5. Spatiotemporal Brain Maps of Delayed Word Repetition and Recognition

    PubMed Central

    Dhond, Rupali P.; Witzel, Thomas; Dale, Anders M.; Halgren, Eric

    2006-01-01

    Whole-head magnetoencephalography (MEG) was used to spatiotemporally map the brain response underlying episodic retrieval of words studied a single time following a long delay (~40min.) Recognition following a long delay occurs as a strong, sustained, differential response, within bilateral, ventral and lateral prefrontal cortex, anterior temporal and medial parietal regions from ~500ms onward, as well as ventral occipitotemporal regions from ~700ms onward. In comparison with previous tasks using multiple repetitions at short delays, these effects were centered within the same areas (anteroventral temporal and ventral prefrontal), but were shifted to longer latencies (~500ms vs. ~200ms), were less left-lateralized, and appear more in anterolateral prefrontal regions and less in lateral temporal cortex. Furthermore, comparison of correctly classified words with misclassified, novel and repeated words, suggests that these frontotemporal-parietocingulate responses are sensitive to actual as well as perceived repetition. The results also suggest that lateral prefrontal regions may participate more in controlled, effortful retrieval while left ventral frontal and anterior temporal responses may support sustained lexicosemantic processing. Additionally, left ventromedial temporal sites may be relatively more involved in episodic retrieval, while lateral temporal sites may participate more in automatic priming. PMID:16084111

  6. A repetitive probe for FISH analysis of bovine interphase nuclei

    PubMed Central

    Slimane, Wafa; Vaiman, Daniel; Godard, Sophie; Vaiman, Anne; Cribiu, Edmond; Renard, Jean-Paul

    2000-01-01

    The purpose of this study was to generate repetitive DNA sequence probes for the analysis of interphase nuclei by fluorescent in situ hybridisation (FISH). Such probes are useful for the diagnosis of chromosomal abnormalities in bovine preimplanted embryos. Of the seven probes (E1A, E4A, Ba, H1A, W18, W22, W5) that were generated and partially sequenced, five corresponded to previously described Bos taurus repetitive DNA (E1A, E4A, Ba, W18, W5), one probe (W22) shared no homology with other DNA sequences and one (H1A) displayed a significant homology with Rattus norvegicus mRNA for secretin receptor transmembrane domain 3. Fluorescent in situ hybridisation was performed on metaphase bovine fibroblast cells and showed that five of the seven probes hybridised most centromeres (E1A, E4A, Ba, W18, W22), one labelled the arms of all chromosomes (W5) and the H1A probe was specific to three chromosomes (ch14, ch20, and ch25). Moreover, FISH with H1A resulted in interpretable signals on interphase nuclei in 88% of the cases, while the other probes yielded only dispersed overlapping signals. PMID:14736403

  7. Final Report, Photocathodes for High Repetition Rate Light Sources

    SciTech Connect

    Ben-Zvi, Ilan

    2014-04-20

    This proposal brought together teams at Brookhaven National Laboratory (BNL), Lawrence Berkeley National Laboratory (LBNL) and Stony Brook University (SBU) to study photocathodes for high repetition rate light sources such as Free Electron Lasers (FEL) and Energy Recovery Linacs (ERL). The work done under this grant comprises a comprehensive program on critical aspects of the production of the electron beams needed for future user facilities. Our program pioneered in situ and in operando diagnostics for alkali antimonide growth. The focus is on development of photocathodes for high repetition rate Free Electron Lasers (FELs) and Energy Recovery Linacs (ERLs), including testing SRF photoguns, both normal-conducting and superconducting. Teams from BNL, LBNL and Stony Brook University (SBU) led this research, and coordinated their work over a range of topics. The work leveraged a robust infrastructure of existing facilities and the support was used for carrying out the research at these facilities. The program concentrated in three areas: a) Physics and chemistry of alkali-antimonide cathodes b) Development and testing of a diamond amplifier for photocathodes c) Tests of both cathodes in superconducting RF photoguns and copper RF photoguns

  8. Neural mechanisms of repetition priming of familiar and globally unfamiliar visual objects.

    PubMed

    Soldan, Anja; Habeck, Christian; Gazes, Yunglin; Stern, Yaakov

    2010-07-01

    Functional magnetic resonance imaging (fMRI) studies have shown that repetition priming of visual objects is typically accompanied by a reduction in activity for repeated compared to new stimuli (repetition suppression). However, the spatial distribution and direction (suppression vs. enhancement) of neural repetition effects can depend on the pre-experimental familiarity of stimuli. The first goal of this study was to further probe the link between repetition priming and repetition suppression/enhancement for visual objects and how this link is affected by stimulus familiarity. A second goal was to examine whether priming of familiar and unfamiliar objects following a single stimulus repetition is supported by the same processes as priming following multiple repetitions within the same task. In this endeavor, we examined both between and within-subject correlations between priming and fMRI repetition effects for familiar and globally unfamiliar visual objects during the first and third repetitions of the stimuli. We included reaction time of individual trials as a linear regressor to identify brain regions whose repetition effects varied with response facilitation on a trial-by-trial basis. The results showed that repetition suppression in bilateral fusiform gyrus, was selectively correlated with priming of familiar objects that had been repeated once, likely reflecting facilitated perceptual processing or the sharpening of perceptual representations. Priming during the third repetition was correlated with repetition suppression in prefrontal and parietal areas for both familiar and unfamiliar stimuli, possibly reflecting a shift from top-down controlled to more automatic processing that occurs for both item types. PMID:20450898

  9. An Adapting Auditory-motor Feedback Loop Can Contribute to Generating Vocal Repetition.

    PubMed

    Wittenbach, Jason D; Bouchard, Kristofer E; Brainard, Michael S; Jin, Dezhe Z

    2015-10-01

    Consecutive repetition of actions is common in behavioral sequences. Although integration of sensory feedback with internal motor programs is important for sequence generation, if and how feedback contributes to repetitive actions is poorly understood. Here we study how auditory feedback contributes to generating repetitive syllable sequences in songbirds. We propose that auditory signals provide positive feedback to ongoing motor commands, but this influence decays as feedback weakens from response adaptation during syllable repetitions. Computational models show that this mechanism explains repeat distributions observed in Bengalese finch song. We experimentally confirmed two predictions of this mechanism in Bengalese finches: removal of auditory feedback by deafening reduces syllable repetitions; and neural responses to auditory playback of repeated syllable sequences gradually adapt in sensory-motor nucleus HVC. Together, our results implicate a positive auditory-feedback loop with adaptation in generating repetitive vocalizations, and suggest sensory adaptation is important for feedback control of motor sequences. PMID:26448054

  10. Neuronal mechanisms and circuits underlying repetitive behaviors in mouse models of autism spectrum disorder.

    PubMed

    Kim, Hyopil; Lim, Chae-Seok; Kaang, Bong-Kiun

    2016-01-01

    Autism spectrum disorder (ASD) refers to a broad spectrum of neurodevelopmental disorders characterized by three central behavioral symptoms: impaired social interaction, impaired social communication, and restricted and repetitive behaviors. However, the symptoms are heterogeneous among patients and a number of ASD mouse models have been generated containing mutations that mimic the mutations found in human patients with ASD. Each mouse model was found to display a unique set of repetitive behaviors. In this review, we summarize the repetitive behaviors of the ASD mouse models and variations found in their neural mechanisms including molecular and electrophysiological features. We also propose potential neuronal mechanisms underlying these repetitive behaviors, focusing on the role of the cortico-basal ganglia-thalamic circuits and brain regions associated with both social and repetitive behaviors. Further understanding of molecular and circuitry mechanisms of the repetitive behaviors associated with ASD is necessary to aid the development of effective treatments for these disorders. PMID:26790724

  11. Repetitive speech disorder resulting from infarcts in the paramedian thalami and midbrain.

    PubMed Central

    Abe, K; Yokoyama, R; Yorifuji, S

    1993-01-01

    A repetitive speech disorder resulting from infarcts in the paramedian thalami and the midbrain is reported. Although the speech disorder seemed like stuttering, the compulsive repetitions, constant rate and monotonous tone were not associated with ordinary stuttering. Since repetition was restricted to the first syllable, the speech disorder in our patient could be distinguished from palilalia. The extrapyramidal system is considered responsible for repetitive speech disorders resulting from infarcts in the paramedian thalami and the midbrain but without good reason. Repetitive speech disorder in patients with infarcts in the supplementary motor area (SMA) have similar clinical features to our patient. It is suggested that interruption in the projective system to the SMA is a possible cause of "stuttering like repetition". Images PMID:8410027

  12. An Adapting Auditory-motor Feedback Loop Can Contribute to Generating Vocal Repetition

    PubMed Central

    Brainard, Michael S.; Jin, Dezhe Z.

    2015-01-01

    Consecutive repetition of actions is common in behavioral sequences. Although integration of sensory feedback with internal motor programs is important for sequence generation, if and how feedback contributes to repetitive actions is poorly understood. Here we study how auditory feedback contributes to generating repetitive syllable sequences in songbirds. We propose that auditory signals provide positive feedback to ongoing motor commands, but this influence decays as feedback weakens from response adaptation during syllable repetitions. Computational models show that this mechanism explains repeat distributions observed in Bengalese finch song. We experimentally confirmed two predictions of this mechanism in Bengalese finches: removal of auditory feedback by deafening reduces syllable repetitions; and neural responses to auditory playback of repeated syllable sequences gradually adapt in sensory-motor nucleus HVC. Together, our results implicate a positive auditory-feedback loop with adaptation in generating repetitive vocalizations, and suggest sensory adaptation is important for feedback control of motor sequences. PMID:26448054

  13. Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

    PubMed

    Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

    2012-01-01

    Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR. PMID:23028972

  14. Effects of response and trial repetition on sight-word training for students with learning disabilities.

    PubMed

    Belfiore, P J; Skinner, C H; Ferkis, M A

    1995-01-01

    Alternating treatments designs were used to compare the effects of trial repetition (one response within five trials per word) versus response repetition (five response repetitions within one trial per word) on sight-word acquisition for 3 elementary students diagnosed with specific learning disabilities in reading. Although both interventions occasioned the same number of accurate responses per word during training, the trial-repetition condition, which involved complete antecedent-response-feedback sequences, resulted in more words mastered for all 3 students. PMID:7592153

  15. Fast repetition rate (FRR) fluorometer and method for measuring fluorescence and photosynthetic parameters

    DOEpatents

    Kolber, Z.; Falkowski, P.

    1995-06-20

    A fast repetition rate fluorometer device and method for measuring in vivo fluorescence of phytoplankton or higher plants chlorophyll and photosynthetic parameters of phytoplankton or higher plants is revealed. The phytoplankton or higher plants are illuminated with a series of fast repetition rate excitation flashes effective to bring about and measure resultant changes in fluorescence yield of their Photosystem II. The series of fast repetition rate excitation flashes has a predetermined energy per flash and a rate greater than 10,000 Hz. Also, disclosed is a flasher circuit for producing the series of fast repetition rate flashes. 14 figs.

  16. Imaging distributed and massed repetitions of natural scenes: Spontaneous retrieval and maintenance

    PubMed Central

    Bradley, Margaret M.; Costa, Vincent D.; Ferrari, Vera; Codispoti, Maurizio; Fitzsimmons, Jeffrey R.; Lang, Peter J.

    2015-01-01

    Repetitions that are distributed (spaced) across time prompt enhancement of a memory-related event-related potential, compared to when repetitions are massed (contiguous). Here, we employed fMRI to investigate neural enhancement and suppression effects during free viewing of natural scenes that were either novel or repeated four times with massed or distributed repetitions. Distributed repetition was uniquely associated with a repetition enhancement effect in a bilateral posterior parietal cluster that included the precuneus and posterior cingulate and which has previously been implicated in episodic memory retrieval. Unique to massed repetition, on the other hand, was enhancement in a right dorsolateral prefrontal cluster that has been implicated in short-term maintenance. Repetition suppression effects for both types of spacing were widespread in regions activated during novel picture processing. Taken together, the data are consistent with a hypothesis that distributed repetition prompts spontaneous retrieval of prior occurrences, whereas massed repetitions prompts short-term maintenance of the episodic representation, due to contiguous presentation. These processing differences may mediate the classic spacing effect in learning and memory. PMID:25504854

  17. Electrodermal and behavioral responses of children with autism spectrum disorders to sensory and repetitive stimuli.

    PubMed

    McCormick, Carolyn; Hessl, David; Macari, Suzanne L; Ozonoff, Sally; Green, Cherie; Rogers, Sally J

    2014-08-01

    Parents frequently report that their children with autism spectrum disorders (ASD) respond atypically to sensory stimuli. Repetitive behaviors are also part of the ASD behavioral profile. Abnormal physiological arousal may underlie both of these symptoms. Electrodermal activity (EDA) is an index of sympathetic nervous system arousal. The goals of this study were twofold: (1) to pilot methods for collecting EDA data in young children and (2) to examine hypothesized relationships among EDA, and sensory symptoms and repetitive behaviors in children with ASD as compared with children with typical development. EDA was recorded on 54 young children with ASD and on 33 children with typical development (TD) during a protocol that included baseline, exposure to sensory and repetitive stimuli, and play. Parents completed standardized questionnaires regarding their child's sensory symptoms and repetitive behaviors. Frequency and type of repetitive behavior during play was coded offline. Comparisons between EDA data for ASD and TD groups indicated no significant between-group differences in any measures. Parents of children with ASD reported more abnormal responses to sensory stimuli and more repetitive behaviors, but scores on these measures were not significantly correlated with EDA or with frequency of observed repetitive behaviors. Parent report of frequency and severity of sensory symptoms was significantly correlated with reports of repetitive behaviors in both groups. Although parents of children with ASD report high levels of sensory symptoms and repetitive behaviors, these differences are not related to measured EDA arousal or reactivity. PMID:24788961

  18. Fast repetition rate (FRR) fluorometer and method for measuring fluorescence and photosynthetic parameters

    DOEpatents

    Kolber, Zbigniew; Falkowski, Paul

    1995-06-20

    A fast repetition rate fluorometer device and method for measuring in vivo fluorescence of phytoplankton or higher plants chlorophyll and photosynthetic parameters of phytoplankton or higher plants by illuminating the phytoplankton or higher plants with a series of fast repetition rate excitation flashes effective to bring about and measure resultant changes in fluorescence yield of their Photosystem II. The series of fast repetition rate excitation flashes has a predetermined energy per flash and a rate greater than 10,000 Hz. Also, disclosed is a flasher circuit for producing the series of fast repetition rate flashes.

  19. Response of rabbit Achilles tendon to chronic repetitive loading.

    PubMed

    Archambault, J M; Hart, D A; Herzog, W

    2001-01-01

    The objective of this work was to assess the response of tendon to chronic repetitive loading. Controlled muscle stimulation was used to load the rabbit Achilles tendon at a frequency of 1.25 Hz for two hours per day, three days per week for a period of 11 weeks. Average peak tendon force was 26 N during the protocol. The loading protocol did not modify the gross morphology of the tissue, nor its water content or cellularity. Increases in mRNA expression of collagen Type III and MMPs were observed, but no signs of injury were detected by histologic examination of tendon and paratenon structures. The lack of a detectable injury response suggests that the tendons were not loaded beyond their capacity for repair. Factors additional to mechanical loading such as aging, illness or stress may be necessary to produce pathology. PMID:11696985

  20. Repetition blindness and homophone blindness in young and older adults.

    PubMed

    Tyrrell, Caitlin J; James, Lori E; Noble, Paula M

    2016-11-01

    We tested age effects on repetition blindness (RB), defined as the reduced probability of reporting a target word following presentation of the same word in a rapidly presented list. We also tested age effects on homophone blindness (HB), in which the first word is a homophone of the target word rather than a repeated word. Thirty young and 28 older adults viewed rapidly presented lists of words containing repeated, homophone, or unrepeated word pairs and reported all of the words immediately after each list. Older adults exhibited a greater degree of RB and HB than young adults using a conditional scoring method that provides certainty that blindness has occurred. The existence of RB and HB for both age groups, and increased blindness for older compared to young adults, supports predictions of a binding theory that has successfully accounted for a wide range of phenomena in cognitive aging. PMID:26982878

  1. BANSHEE: High-voltage repetitively pulsed electron-beam driver

    SciTech Connect

    VanHaaften, F.

    1992-08-01

    BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-{mu}s pulse width driving a load of {approximately}100 {Omega}, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 {Omega}, up to a level of {approximately}650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of {approximately}100 {Omega}.

  2. BANSHEE: High-voltage repetitively pulsed electron-beam driver

    SciTech Connect

    VanHaaften, F.

    1992-01-01

    BANSHEE (Beam Accelerator for a New Source of High-Energy Electrons) this is a high-voltage modulator is used to produce a high-current relativistic electron beam for high-power microwave tube development. The goal of the BANSHEE research is first to achieve a voltage pulse of 700--750 kV with a 1-{mu}s pulse width driving a load of {approximately}100 {Omega}, the pulse repetition frequency (PRF) of a few hertz. The ensuing goal is to increase the pulse amplitude to a level approaching 1 MV. We conducted tests using half the modulator with an output load of 200 {Omega}, up to a level of {approximately}650 kV at a PRF of 1 Hz and 525 kV at a PRF of 5 Hz. We then conducted additional testing using the complete system driving a load of {approximately}100 {Omega}.

  3. Functionalization of Repetitive Polypeptides for Molecular Interconnect Applications

    NASA Astrophysics Data System (ADS)

    Carlsen, A.; Rana, N.; Kossow, C.; Cheng, D.; Wells, C.; Bousman, K.; Ngo, S.; Higashiya, S.; Welch, J.; Raynolds, J.; Dunn, K.; Eisenbraun, E.; Geer, R.; Kaloyeros, A.

    2004-03-01

    This study focuses on the functionalization of a genetically engineered molecule consisting of a repetitive polypeptide sequence [(GA)_3GY(GA)_3GE(GA)_3GH(GA)_3GK where G=glycine, A=alanine, Y=tyrosine, E=glutamic acid, H=histidine, and K=lysine] drawn into a β -pleated sheet formation.^ The polyhistidinyl tracts decorating this β -sheet ``scaffolding'' act as a repeating array of functional moieties for the attachment of metallic ions to facilitate charge transport. A second functionalization approach investigated utilizes the electrostatic interaction between anionic portions of the molecule and cationic Au nanoparticles. The facility of these approaches was demonstrated using scanning probe microscopy, circular dichroism, and Raman spectroscopy. ^dag S. Higashiya, S. Ngo, K. Bousman, J. Welch, N. Rana, A. Carlsen, E. Eisenbraun, R. Geer, A. Kaloyeros. Polym Mat Sci Engin. 89, 466-7 (2003).

  4. Long-life power sources for continuous and repetitive loads

    SciTech Connect

    Young, T.J.

    1982-03-01

    Long life electrical power sources compatible with continuous and repetitive pulse loads are of increasing interest for Sandia systems. Both primary chemical batteries and radioisotopic thermoelectric generators (RTG) are capable of supplying power for long periods of time. However, each has its particular advantages and disadvantages and neither alone may represent a good match to the system constraints. The purpose of this report is to provide some insight into the power, volume, and cost trade-offs between either of these sources alone and between hybrids consisting of RTGs with primary batteries, secondary batteries, or capacitors. These trade-offs suggest that the hybrid power sources may have significant volume and cost advantages for many applications.

  5. Repetition Blindness for Natural Images of Objects with Viewpoint Changes

    PubMed Central

    Buffat, Stéphane; Plantier, Justin; Roumes, Corinne; Lorenceau, Jean

    2013-01-01

    When stimuli are repeated in a rapid serial visual presentation (RSVP), observers sometimes fail to report the second occurrence of a target. This phenomenon is referred to as “repetition blindness” (RB). We report an RSVP experiment with photographs in which we manipulated object viewpoints between the first and second occurrences of a target (0°, 45°, or 90° changes), and spatial frequency (SF) content. Natural images were spatially filtered to produce low, medium, or high SF stimuli. RB was observed for all filtering conditions. Surprisingly, for full-spectrum (FS) images, RB increased significantly as the viewpoint reached 90°. For filtered images, a similar pattern of results was found for all conditions except for medium SF stimuli. These findings suggest that object recognition in RSVP are subtended by viewpoint-specific representations for all spatial frequencies except medium ones. PMID:23346069

  6. Methodological considerations when assessing restricted and repetitive behaviors and aggression

    PubMed Central

    Keefer, A.J.; Kalb, L.; Mazurek, M.O.; Kanne, S.M.; Freedman, B.; Vasa, R.A.

    2016-01-01

    Methodological issues impacting the relationship between aggression and restricted, repetitive, and stereotyped behaviors and interests (RRSBI) were examined in 2648 children and adolescents with autism spectrum disorders (ASD) using a multi-method, multi-informant analysis model to assess the effects of informant, assessment method, and aggression phenotype. Overall, a significant, but small relationship was found between RRSBI and aggression (p < .05). There was significant heterogeneity of estimates with large effect sizes observed when utilizing teacher report and a broad phenotype of aggression. Variance in estimates was attributed to differences in informant and assessment method with two times greater effect attributed to informant. Results suggest strategies to optimize future investigations of the relationship between RRSBI and aggression. Findings also provide the opportunity for the development of targeted interventions for aggression in youth with ASD. PMID:27239223

  7. Multiterawatt femtosecond laser system with kilohertz pulse repetition rate

    SciTech Connect

    Petrov, V V; Pestryakov, E V; Laptev, A V; Petrov, V A; Kuptsov, G V; Trunov, V I; Frolov, S A

    2014-05-30

    The basic principles, layout and components are presented for a multiterawatt femtosecond laser system with a kilohertz pulse repetition rate f, based on their parametric amplification and laser amplification of picosecond radiation that pumps the stages of the parametric amplifier. The results of calculations for a step-by-step increase in the output power from the LBO crystal parametric amplifier channel up to the multiterawatt level are presented. By using the developed components in the pump channel of the laser system, the parameters of the regenerative amplifier with the output energy ∼1 mJ at the wavelength 1030 nm and with f = 1 kHz are experimentally studied. The optical scheme of the diode-pumped multipass cryogenic Yb:Y{sub 2}O{sub 3} laser ceramic amplifier is developed and its characteristics are determined that provide the output energy within the range 0.25 – 0.35 J. (lasers)

  8. Repetitive transcranial magnetic stimulation in anorexia nervosa: a pilot study.

    PubMed

    Van den Eynde, F; Guillaume, S; Broadbent, H; Campbell, I C; Schmidt, U

    2013-02-01

    The search for new treatments to improve outcome in people with anorexia nervosa continues. This pilot study investigated whether one session of high frequency repetitive transcranial magnetic stimulation (rTMS) delivered to the left dorsolateral prefrontal cortex reduces eating disorder related symptoms following exposure to visual and real food stimuli. Safety and tolerability were also assessed. Ten right-handed people with anorexia nervosa underwent one session of rTMS. Subjective experiences related to the eating disorder (e.g. urge to restrict, feeling full etc.) were assessed before and after rTMS. Non-parametric repeated measures tests were used. rTMS was safe and well-tolerated, and resulted in reduced levels of feeling full, feeling fat and feeling anxious. Thus, rTMS may reduce core symptoms of anorexia nervosa. Future research should establish the therapeutic potential of rTMS in anorexia nervosa. PMID:21880470

  9. CAVITATION DAMAGE STUDY VIA A NOVEL REPETITIVE PRESSURE PULSE APPROACH

    SciTech Connect

    Wang, Jy-An John; Ren, Fei; Wang, Hong

    2010-01-01

    Cavitation damage can significantly affect system performance. Thus, there is great interest in characterizing cavitation damage and improving materials resistance to cavitation damage. In this paper, we present a novel methodology to simulate cavitation environment. A pulsed laser is utilized to induce optical breakdown in the cavitation media, with the emission of shock wave and the generation of bubbles. The pressure waves induced by the optical breakdown fluctuate/propagate within the media, which enables the cavitation to occur and to further develop cavitation damage at the solid boundary. Using the repetitive pulsed-pressure apparatus developed in the current study, cavitation damage in water media was verified on stainless steel and aluminum samples. Characteristic cavitation damages such as pitting and indentation are observed on sample surfaces using scanning electron microscopy.

  10. Series-counterpulse repetitive-pulse inductive storage circuit

    DOEpatents

    Honig, E.M.

    1984-06-05

    A high-power series-counterpulse repetitive-pulse inductive energy storage and transfer circuit includes an opening switch, a main energy storage coil, and a counterpulse capacitor. The local pulse is initiated simultaneously with the initiation of the counterpulse used to turn the opening switch off. There is no delay from command to output pulse. During the load pulse, the counterpulse capacitor is automatically charged with sufficient energy to accomplish the load counterpulse which terminates the load pulse and turns the load switch off. When the main opening switch is reclosed to terminate the load pulse, the counterpulse capacitor discharges through the load, causing a rapid, sharp cutoff of the load pulse as well as recovering any energy remaining in the load inductance. The counterpulse capacitor is recharged to its original condition by the main energy storage coil after the load pulse is over, not before it begins.

  11. Briefly Assessing Repetitive Thought Dimensions: Valence, Purpose, and Total.

    PubMed

    Segerstrom, Suzanne C; Hardy, Jaime K; Evans, Daniel R; Boggero, Ian A; Alden, Lynn E; Stanton, Annette L

    2016-10-01

    Discrete forms of repetitive thought (RT), such as worry and reflection, can be characterized along basic dimensions of valence (positive vs. negative) and purpose (searching vs. solving). In addition, people can be characterized as high or low in their tendency to engage in RT. This dimensional model has been demanding to assess, and a smaller number of items that could stand in for a large battery would make measurement more accessible. Using four samples (N = 1,588), eight items that assess RT valence, purpose, and total in a circumplex model were identified. Across these and other samples, the dimensions were adequately reliable and valid with regard to assessment via large RT battery, other measures of RT, and depressive symptoms. The accessibility of dimensional assessment of RT using this smaller number of items should facilitate work on questions about the qualities of RT that predict mental and physical health. PMID:26019299

  12. Multiterawatt femtosecond laser system with kilohertz pulse repetition rate

    NASA Astrophysics Data System (ADS)

    Petrov, V. V.; Pestryakov, E. V.; Laptev, A. V.; Petrov, V. A.; Kuptsov, G. V.; Trunov, V. I.; Frolov, S. A.

    2014-05-01

    The basic principles, layout and components are presented for a multiterawatt femtosecond laser system with a kilohertz pulse repetition rate f, based on their parametric amplification and laser amplification of picosecond radiation that pumps the stages of the parametric amplifier. The results of calculations for a step-by-step increase in the output power from the LBO crystal parametric amplifier channel up to the multiterawatt level are presented. By using the developed components in the pump channel of the laser system, the parameters of the regenerative amplifier with the output energy ~1 mJ at the wavelength 1030 nm and with f = 1 kHz are experimentally studied. The optical scheme of the diode-pumped multipass cryogenic Yb:Y2O3 laser ceramic amplifier is developed and its characteristics are determined that provide the output energy within the range 0.25 - 0.35 J.

  13. Pathway to a lower cost high repetition rate ignition facility

    SciTech Connect

    Obenschain, S.P.; Colombant, D.G.; Schmitt, A.J.; Sethian, J.D.; McGeoch, M. W.

    2006-05-15

    An approach to a high-repetition ignition facility based on direct drive with the krypton-fluoride laser is presented. The objective is development of a 'Fusion Test Facility' that has sufficient fusion power to be useful as a development test bed for power plant materials and components. Calculations with modern pellet designs indicate that laser energies well below a megajoule may be sufficient. A smaller driver would result in an overall smaller, less complex and lower cost facility. While this facility might appear to have most direct utility to inertial fusion energy, the high flux of neutrons would also be able to address important issues concerning materials and components for other approaches to fusion energy. The physics and technological basis for the Fusion Test Facility are presented along with a discussion of its applications.

  14. Scalable in-situ qubit calibration during repetitive error detection

    NASA Astrophysics Data System (ADS)

    Kelly, J.; Barends, R.; Fowler, A.; Mutus, J.; Campbell, B.; Chen, Y.; Chen, Z.; Chiaro, B.; Dunsworth, A.; Jeffrey, E.; Lucero, E.; Megrant, A.; Neeley, M.; Neill, C.; O'Malley, P. J. J.; Roushan, P.; Sank, D.; Quintana, C.; Vainsencher, A.; Wenner, J.; White, T.; Martinis, J. M.

    A quantum computer protects a quantum state from the environment through the careful manipulations of thousands or millions of physical qubits. However, operating such quantities of qubits at the necessary level of precision is an open challenge, as optimal control parameters can vary between qubits and drift in time. We present a method to optimize physical qubit parameters while error detection is running using a nine qubit system performing the bit-flip repetition code. We demonstrate how gate optimization can be parallelized in a large-scale qubit array and show that the presented method can be used to simultaneously compensate for independent or correlated qubit parameter drifts. Our method is O(1) scalable to systems of arbitrary size, providing a path towards controlling the large numbers of qubits needed for a fault-tolerant quantum computer.

  15. Report on computation of repetitive hyperbaric-hypobaric decompression tables

    NASA Technical Reports Server (NTRS)

    Edel, P. O.

    1975-01-01

    The tables were constructed specifically for NASA's simulated weightlessness training program; they provide for 8 depth ranges covering depths from 7 to 47 FSW, with exposure times of 15 to 360 minutes. These tables were based up on an 8 compartment model using tissue half-time values of 5 to 360 minutes and Workmanline M-values for control of the decompression obligation resulting from hyperbaric exposures. Supersaturation ratios of 1.55:1 to 2:1 were used for control of ascents to altitude following such repetitive dives. Adequacy of the method and the resultant tables were determined in light of past experience with decompression involving hyperbaric-hypobaric interfaces in human exposures. Using these criteria, the method showed conformity with empirically determined values. In areas where a discrepancy existed, the tables would err in the direction of safety.

  16. Energy coupling to the plasma in repetitive nanosecond pulse discharges

    SciTech Connect

    Adamovich, Igor V.; Nishihara, Munetake; Choi, Inchul; Uddi, Mruthunjaya; Lempert, Walter R.

    2009-11-15

    A new analytic quasi-one-dimensional model of energy coupling to nanosecond pulse discharge plasmas in plane-to-plane geometry has been developed. The use of a one-dimensional approach is based on images of repetitively pulsed nanosecond discharge plasmas in dry air demonstrating that the plasma remains diffuse and uniform on a nanosecond time scale over a wide range of pressures. The model provides analytic expressions for the time-dependent electric field and electron density in the plasma, electric field in the sheath, sheath boundary location, and coupled pulse energy. The analytic model predictions are in very good agreement with numerical calculations. The model demonstrates that (i) the energy coupled to the plasma during an individual nanosecond discharge pulse is controlled primarily by the capacitance of the dielectric layers and by the breakdown voltage and (ii) the pulse energy coupled to the plasma during a burst of nanosecond pulses decreases as a function of the pulse number in the burst. This occurs primarily because of plasma temperature rise and resultant reduction in breakdown voltage, such that the coupled pulse energy varies approximately proportionally to the number density. Analytic expression for coupled pulse energy scaling has been incorporated into the air plasma chemistry model, validated previously by comparing with atomic oxygen number density measurements in nanosecond pulse discharges. The results of kinetic modeling using the modified air plasma chemistry model are compared with time-resolved temperature measurements in a repetitively pulsed nanosecond discharge in air, by emission spectroscopy, and purely rotational coherent anti-Stokes Raman spectroscopy showing good agreement.

  17. Energy coupling to the plasma in repetitive nanosecond pulse discharges

    NASA Astrophysics Data System (ADS)

    Adamovich, Igor V.; Nishihara, Munetake; Choi, Inchul; Uddi, Mruthunjaya; Lempert, Walter R.

    2009-11-01

    A new analytic quasi-one-dimensional model of energy coupling to nanosecond pulse discharge plasmas in plane-to-plane geometry has been developed. The use of a one-dimensional approach is based on images of repetitively pulsed nanosecond discharge plasmas in dry air demonstrating that the plasma remains diffuse and uniform on a nanosecond time scale over a wide range of pressures. The model provides analytic expressions for the time-dependent electric field and electron density in the plasma, electric field in the sheath, sheath boundary location, and coupled pulse energy. The analytic model predictions are in very good agreement with numerical calculations. The model demonstrates that (i) the energy coupled to the plasma during an individual nanosecond discharge pulse is controlled primarily by the capacitance of the dielectric layers and by the breakdown voltage and (ii) the pulse energy coupled to the plasma during a burst of nanosecond pulses decreases as a function of the pulse number in the burst. This occurs primarily because of plasma temperature rise and resultant reduction in breakdown voltage, such that the coupled pulse energy varies approximately proportionally to the number density. Analytic expression for coupled pulse energy scaling has been incorporated into the air plasma chemistry model, validated previously by comparing with atomic oxygen number density measurements in nanosecond pulse discharges. The results of kinetic modeling using the modified air plasma chemistry model are compared with time-resolved temperature measurements in a repetitively pulsed nanosecond discharge in air, by emission spectroscopy, and purely rotational coherent anti-Stokes Raman spectroscopy showing good agreement.

  18. Nonword Repetition in Children and Adults: Effects on Movement Coordination

    PubMed Central

    Sasisekaran, Jayanthi; Smith, Anne; Sadagopan, Neeraja; Weber-Fox, Christine

    2009-01-01

    Hearing and repeating novel phonetic sequences, or novel nonwords, is a task that taps many levels of processing, including auditory decoding, phonological processing, working memory, speech motor planning and execution. Investigations of nonword repetition abilities have been framed within models of psycholinguistic processing, while the motor aspects, which also are critical for task performance, have been largely ignored. We focused our investigation on both the behavioral and speech motor performance characteristics of this task as performed in a learning paradigm by 9- and-10 year-old children and young adults. Behavioral (percent correct productions) and kinematic (movement duration, lip aperture variability -an index of the consistency of inter-articulator coordination on repeated trials) measures were obtained in order to investigate the short-term (Day 1, first 5 vs. next 5 trials) and longer-term (Day 1 vs. Day 2, first 5 vs. next 5 trials) changes associated with practice within and between sessions. Overall, as expected, young adults showed higher levels of behavioral accuracy and greater levels of coordinative consistency than the children. Both groups, however, showed a learning effect, such that in general, later Day 1 trials and Day 2 trials were shorter in duration and more consistent in coordination patterns than Day 1 early trials. Phonemic complexity of the nonwords had a profound effect on both the behavioral and speech motor aspects of performance. The children showed marked learning effects on all nonwords that they could produce accurately, while adults’ performance improved only when challenged by the more complex nonword stimuli in the set. The findings point to a critical role for speech motor processes within models of nonword repetition and suggest that young adults, similar to children, show short- and longer-term improvements in coordinative consistency with repeated production of complex nonwords. There is also a clear

  19. High repetition nanosecond Ti:sapphire laser for photoacoustic microscopy

    NASA Astrophysics Data System (ADS)

    Yang, Timothy K.; Kim, Min Ju; Choi, Seul Ki; Bae, Sung Chul

    2015-03-01

    High resolution optical imaging technologies, such as optical coherence tomography or multiphoton microscopy has given us an opportunity to do in vivo imaging noninvasively. However, due to the high laser scattering, these optical imaging techniques were prohibited from obtaining high resolution in the diffusive regime. Photoacoustic microscopy (PAM) can overcome this soft depth limit and maintain high resolution at the same time. In the past, PAM was limited to using an Nd:YAG laser, which requires an optical parametric oscillator (OPO) to obtain wavelengths selectively other than the second harmonic. However, OPO is unstable and cumbersome to control. We replaced the Nd:YAG laser and the OPO with a nanosecond pulsed Ti:Sapphire laser to give PAM more flexibility in the speed and the input wavelength while reducing the footprint of our system. This also increased our stability by removing OPO. Using a Ti:Sapphire laser allowed us to increase the pulse repetition rate to 100-500 kHz. Normally, micro-lasers with this pulse repetition rate will suffer from a significant decrease in pulse energy, but we were able to maintain stable pulses with a few hundreds nJ. Also, a well-known advantage of a Ti:Sapphire laser is its tunability from 650 to 1100 nm. For our PAM application, we used a range from 700 to 900 nm to obtain significant functional images. This added flexibility can help acquire functional images such as the angiogenesis process with better contrast. Here, we present a nanosecond Ti:Sapphire laser designated for PAM applications with increased contrast imaging.

  20. Dissecting the functional anatomy of auditory word repetition

    PubMed Central

    Hope, Thomas M. H.; Prejawa, Susan; Parker Jones, ‘Ōiwi; Oberhuber, Marion; Seghier, Mohamed L.; Green, David W.; Price, Cathy J.

    2013-01-01

    This fMRI study used a single, multi-factorial, within-subjects design to dissociate multiple linguistic and non-linguistic processing areas that are all involved in repeating back heard words. The study compared: (1) auditory to visual inputs; (2) phonological to non-phonological inputs; (3) semantic to non-semantic inputs; and (4) speech production to finger-press responses. The stimuli included words (semantic and phonological inputs), pseudowords (phonological input), pictures and sounds of animals or objects (semantic input), and colored patterns and hums (non-semantic and non-phonological). The speech production tasks involved auditory repetition, reading, and naming while the finger press tasks involved one-back matching. The results from the main effects and interactions were compared to predictions from a previously reported functional anatomical model of language based on a meta-analysis of many different neuroimaging experiments. Although many findings from the current experiment replicated many of those predicted, our within-subject design also revealed novel results by providing sufficient anatomical precision to dissect several different regions within the anterior insula, pars orbitalis, anterior cingulate, SMA, and cerebellum. For example, we found one part of the pars orbitalis was involved in phonological processing and another in semantic processing. We also dissociated four different types of phonological effects in the left superior temporal sulcus (STS), left putamen, left ventral premotor cortex, and left pars orbitalis. Our findings challenge some of the commonly-held opinions on the functional anatomy of language, and resolve some previously conflicting findings about specific brain regions—and our experimental design reveals details of the word repetition process that are not well captured by current models. PMID:24834043

  1. A mouse model of human repetitive mild traumatic brain injury

    PubMed Central

    Kane, Michael J.; Pérez, Mariana Angoa; Briggs, Denise I.; Viano, David C.; Kreipke, Christian W.; Kuhn, Donald M.

    2011-01-01

    A novel method for the study of repetitive mild traumatic brain injury (rmTBI) that models the most common form of head injury in humans is presented. Existing animal models of TBI impart focal, severe damage unlike that seen in repeated and mild concussive injuries, and few are configured for repetitive application. Our model is a modification of the Marmarou weight drop method and allows repeated head impacts to lightly anesthetized mice. A key facet of this method is the delivery of an impact to the cranium of an unrestrained subject allowing rapid acceleration of the free-moving head and torso, an essential characteristic known to be important for concussive injury in humans, and a factor that is missing from existing animal models of TBI. Our method does not require scalp incision, emplacement of protective skull helmets or surgery and the procedure can be completed in 1-2 minutes. Mice spontaneously recover the righting reflex and show no evidence of seizures, paralysis or impaired behavior. Skull fractures and intracranial bleeding are very rare. Minor deficits in motor coordination and locomotor hyperactivity recover over time. Histological analyses reveal mild astrocytic reactivity (increased expression of GFAP) and increased phospho-tau but a lack of blood-brain-barrier disruption, edema and microglial activation. This new animal model is simple and cost-effective and will facilitate characterization of the neurobiological and behavioral consequences of rmTBI. It is also ideal for high throughput screening of potential new therapies for mild concussive injuries as experienced by athletes and military personnel. PMID:21930157

  2. Repetitive Pediatric Anesthesia in a Non-Hospital Setting

    SciTech Connect

    Buchsbaum, Jeffrey C.; McMullen, Kevin P.; Douglas, James G.; Jackson, Jeffrey L.; Simoneaux, R. Victor; Hines, Matthew; Bratton, Jennifer; Kerstiens, John; Johnstone, Peter A.S.

    2013-04-01

    Purpose: Repetitive sedation/anesthesia (S/A) for children receiving fractionated radiation therapy requires induction and recovery daily for several weeks. In the vast majority of cases, this is accomplished in an academic center with direct access to pediatric faculty and facilities in case of an emergency. Proton radiation therapy centers are more frequently free-standing facilities at some distance from specialized pediatric care. This poses a potential dilemma in the case of children requiring anesthesia. Methods and Materials: The records of the Indiana University Health Proton Therapy Center were reviewed for patients requiring anesthesia during proton beam therapy (PBT) between June 1, 2008, and April 12, 2012. Results: A total of 138 children received daily anesthesia during this period. A median of 30 fractions (range, 1-49) was delivered over a median of 43 days (range, 1-74) for a total of 4045 sedation/anesthesia procedures. Three events (0.0074%) occurred, 1 fall from a gurney during anesthesia recovery and 2 aspiration events requiring emergency department evaluation. All 3 children did well. One aspiration patient needed admission to the hospital and mechanical ventilation support. The other patient returned the next day for treatment without issue. The patient who fell was not injured. No patient required cessation of therapy. Conclusions: This is the largest reported series of repetitive pediatric anesthesia in radiation therapy, and the only available data from the proton environment. Strict adherence to rigorous protocols and a well-trained team can safely deliver daily sedation/anesthesia in free-standing proton centers.

  3. Repetition priming in selective attention: A TVA analysis.

    PubMed

    Ásgeirsson, Árni Gunnar; Kristjánsson, Árni; Bundesen, Claus

    2015-09-01

    Current behavior is influenced by events in the recent past. In visual attention, this is expressed in many variations of priming effects. Here, we investigate color priming in a brief exposure digit-recognition task. Observers performed a masked odd-one-out singleton recognition task where the target-color either repeated or changed between subsequent trials. Performance was measured by recognition accuracy over exposure durations. The purpose of the study was to replicate earlier findings of perceptual priming in brief displays and to model those results based on a Theory of Visual Attention (TVA; Bundesen, 1990). We tested 4 different definitions of a generic TVA-model and assessed their explanatory power. Our hypothesis was that priming effects could be explained by selective mechanisms, and that target-color repetitions would only affect the selectivity parameter (α) of our models. Repeating target colors enhanced performance for all 12 observers. As predicted, this was only true under conditions that required selection of a target among distractors, but not when a target was presented alone. Model fits by TVA were obtained with a trial-by-trial maximum likelihood estimation procedure that estimated 4-15 free parameters, depending on the particular model. We draw two main conclusions. Color priming can be modeled simply as a change in selectivity between conditions of repetition or swap of target color. Depending on the desired resolution of analysis; priming can accurately be modeled by a simple four parameter model, where VSTM capacity and spatial biases of attention are ignored, or more fine-grained by a 10 parameter model that takes these aspects into account. PMID:26163225

  4. Hemispheric Asymmetries in Repetition Enhancement and Suppression Effects in the Newborn Brain

    PubMed Central

    Bouchon, Camillia; Nazzi, Thierry; Gervain, Judit

    2015-01-01

    Background The repeated presentation of stimuli typically attenuates neural responses (repetition suppression) or, less commonly, increases them (repetition enhancement) when stimuli are highly complex, degraded or presented under noisy conditions. In adult functional neuroimaging research, these repetition effects are considered as neural correlates of habituation. The development and respective functional significance of these effects in infancy remain largely unknown. Objective This study investigates repetition effects in newborns using functional near-infrared spectroscopy, and specifically the role of stimulus complexity in evoking a repetition enhancement vs. a repetition suppression response, following up on Gervain et al. (2008). In that study, abstract rule-learning was found at birth in cortical areas specific to speech processing, as evidenced by a left-lateralized repetition enhancement of the hemodynamic response to highly variable speech sequences conforming to a repetition-based ABB artificial grammar, but not to a random ABC grammar. Methods Here, the same paradigm was used to investigate how simpler stimuli (12 different sequences per condition as opposed to 140), and simpler presentation conditions (blocked rather than interleaved) would influence repetition effects at birth. Results Results revealed that the two grammars elicited different dynamics in the two hemispheres. In left fronto-temporal areas, we reproduce the early perceptual discrimination of the two grammars, with ABB giving rise to a greater response at the beginning of the experiment than ABC. In addition, the ABC grammar evoked a repetition enhancement effect over time, whereas a stable response was found for the ABB grammar. Right fronto-temporal areas showed neither initial discrimination, nor change over time to either pattern. Conclusion Taken together with Gervain et al. (2008), this is the first evidence that manipulating methodological factors influences the presence or

  5. Nonword Repetition with Spectrally Reduced Speech: Some Developmental and Clinical Findings from Pediatric Cochlear Implantation

    ERIC Educational Resources Information Center

    Burkholder-Juhasz, Rose A.; Levi, Susannah V.; Dillon, Caitlin M.; Pisoni, David B.

    2007-01-01

    Nonword repetition skills were examined in 24 pediatric cochlear implant (CI) users and 18 normal-hearing (NH) adult listeners listening through a CI simulator. Two separate groups of NH adult listeners assigned accuracy ratings to the nonword responses of the pediatric CI users and the NH adult speakers. Overall, the nonword repetitions of…

  6. Word Repetition, Masked Orthographic Priming, and Language Switching: Bilingual Studies and BIA+ Simulations

    ERIC Educational Resources Information Center

    Lam, Kevin J. Y.; Dijkstra, Ton

    2010-01-01

    Daily conversations contain many repetitions of identical and similar word forms. For bilinguals, the words can even come from the same or different languages. How do such repetitions affect the human word recognition system? The Bilingual Interactive Activation Plus (BIA+) model provides a theoretical and computational framework for understanding…

  7. Effects of Repetitions and Questions at Varying Lags during Self-Paced Learning from Text.

    ERIC Educational Resources Information Center

    Hayes-Roth, Barbara

    The present study investigated the effects of repetitions and questions (without feedback) at varying lags during self-paced learning from text. High school students read a series of unrelated paragraphs, each of which was repeated or tested after a variable lag. In a mixed condition, texts and repetitions of particular sentences were combined…

  8. Repetition of Lesson Presentation as a Tool for Improving Teaching Efficiency

    ERIC Educational Resources Information Center

    Klein, Joseph

    2012-01-01

    Studies in industry link routine in work to efficiency level. Routine may contribute to boredom and decline in efficiency for some workers; others cope well with repetitive tasks and improve output. This study was conducted to determine whether repetition of a lesson by the same teacher to a second class within a week increases or decreases…

  9. A Comparison of Repetitive Behaviors in Aspergers Disorder and High Functioning Autism

    ERIC Educational Resources Information Center

    Cuccaro, Michael L.; Nations, Laura; Brinkley, Jason; Abramson, Ruth K.; Wright, Harry H.; Hall, Alicia; Gilbert, John; Pericak-Vance, Margaret A.

    2007-01-01

    In this study we compared 33 IQ and age matched pairs of individuals with Aspergers Disorder (ASP) and high functioning autism (HFA) on measures of repetitive behavior. On the Repetitive Behavior Scale-Revised (RBS-R), the ASP and HFA groups showed no differences in RBS-R Intensity score (severity) score or Frequency score (number of problems…

  10. Target-to-Target Repetition Cost and Location Negative Priming Are Dissociable: Evidence for Different Mechanisms

    ERIC Educational Resources Information Center

    Chao, Hsuan-Fu

    2011-01-01

    In a location-selection task, the repetition of a prior distractor location as the target location would slow down the response. This effect is termed the location negative priming (NP) effect. Recently, it has been demonstrated that repetition of a prior target location as the current target location would also slow down response. Because such…

  11. Repetition Strengthens Target Recognition but Impairs Similar Lure Discrimination: Evidence for Trace Competition

    ERIC Educational Resources Information Center

    Reagh, Zachariah M.; Yassa, Michael A.

    2014-01-01

    Most theories of memory assume that representations are strengthened with repetition. We recently proposed Competitive Trace Theory, building on the hippocampus' powerful capacity to orthogonalize inputs into distinct outputs. We hypothesized that repetition elicits a similar but nonidentical memory trace, and that contextual details of…

  12. Nonword Repetition and Serial Recall: Equivalent Measures of Verbal Short-Term Memory?

    ERIC Educational Resources Information Center

    Archibald, Lisa M. D.; Gathercole, Susan E.

    2007-01-01

    Evidence that the abilities to repeat nonwords and to learn language are very closely related to one another has led to widespread interest in the cognitive processes underlying nonword repetition. One suggestion is that nonword repetition is a relatively pure measure of phonological short-term memory closely associated with other measures of…

  13. Repetitive and Ritualistic Behaviour in Children with Prader-Willi Syndrome and Children with Autism

    ERIC Educational Resources Information Center

    Greaves, N.; Prince, E.; Evans, D. W.; Charman, T.

    2006-01-01

    Background: Recent research has shown that the range of repetitive behaviour seen in individuals with Prader-Willi syndrome (PWS) extends beyond food-related behaviour. Methods: The presence and intensity of repetitive, rigid and routinized behaviour in children with PWS was compared with that seen in children with another neurodevelopmental…

  14. Method for generating high-energy and high repetition rate laser pulses from CW amplifiers

    DOEpatents

    Zhang, Shukui

    2013-06-18

    A method for obtaining high-energy, high repetition rate laser pulses simultaneously using continuous wave (CW) amplifiers is described. The method provides for generating micro-joule level energy in pico-second laser pulses at Mega-hertz repetition rates.

  15. Comparing Communicative Competence in Child and Chimp: The Pragmatics of Repetition.

    ERIC Educational Resources Information Center

    Greenfield, Patricia M.; Savage-Rumbaugh, E. Sue

    1993-01-01

    Through analysis of chimpanzee-human discourse, study shows that four chimpanzees exposed to humanly devised symbol system use partial or complete repetition of others' symbols. They do not produce rote imitations but use repetition to fulfill variety of pragmatic functions in discourse. Theories are advanced regarding meaning of two differences…

  16. Repetitive Sequences in Plant Nuclear DNA: Types, Distribution, Evolution and Function

    PubMed Central

    Mehrotra, Shweta; Goyal, Vinod

    2014-01-01

    Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150–400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as “tuning knobs” in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. PMID:25132181

  17. Randomization of Symbol Repetition of Punch Cards with Superimposed Coding in Information-Search Systems.

    ERIC Educational Resources Information Center

    Pirovich, L. Ya

    The article shows the effect of the irregularity of using separate symbols on search noise on punch cards with superimposed symbol coding in information-search system (IPS). A binomial law of random value distribution of repetition of each symbol is established and analyzed. A method of determining the maximum value of symbol repetition is…

  18. Repetition suppression for visual actions in the macaque superior temporal sulcus.

    PubMed

    Kuravi, Pradeep; Caggiano, Vittorio; Giese, Martin; Vogels, Rufin

    2016-03-01

    In many brain areas, repetition of a stimulus usually weakens the neural response. This "adaptation" or repetition suppression effect has been observed with mass potential measures such as event-related potentials (ERPs), in fMRI BOLD responses, and locally with local field potentials (LFPs) and spiking activity. Recently, it has been reported that macaque F5 mirror neurons do not show repetition suppression of their spiking activity for single repetitions of hand actions, which disagrees with human fMRI adaptation studies. This finding also contrasts with numerous studies showing repetition suppression in macaque inferior temporal cortex, including the rostral superior temporal sulcus (STS). Since the latter studies employed static stimuli, we assessed here whether the use of dynamic action stimuli abolishes repetition suppression in the awake macaque STS. To assess adaptation effects in the STS, we employed the same hand action movies as used when examining adaptation in F5. The upper bank STS neurons showed repetition suppression during the approaching phase of the hand action, which corresponded to the phase of the action for which these neurons responded overall the strongest. The repetition suppression was present for the spiking activity measured in independent single-unit and multiunit recordings as well as for the LFP power at frequencies > 50 Hz. Together with previous data in F5, these findings suggest that adaptation effects differ between F5 mirror neurons and the STS neurons. PMID:26745246

  19. The Relationship between Anxiety and Repetitive Behaviours in Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Rodgers, J.; Glod, M.; Connolly, B.; McConachie, H.

    2012-01-01

    Children with Autism Spectrum Disorder are vulnerable to anxiety. Repetitive behaviours are a core feature of Autism Spectrum Disorder (ASD) and have been associated with anxiety. This study examined repetitive behaviours and anxiety in two groups of children with autism spectrum disorder, those with high anxiety and those with lower levels of…

  20. Repetition of Words and Non-Words in Typically Developing Children: The Role of Prosody

    ERIC Educational Resources Information Center

    Sundström, Simon; Samuelsson, Christina; Lyxell, Björn

    2014-01-01

    In this study, segmental and prosodic aspects of word repetition and non-word repetition in typically developing children aged four to six years were investigated. Focus was on developmental differences, and on how tonal word accent and word length affect segment production accuracy. Prosodically controlled words and non-words were repeated by 44…

  1. The Function of Repeating: The Relation between Word Class and Repetition Type in Developmental Stuttering

    ERIC Educational Resources Information Center

    Buhr, Anthony P.; Jones, Robin M.; Conture, Edward G.; Kelly, Ellen M.

    2016-01-01

    Background: It is already known that preschool-age children who stutter (CWS) tend to stutter on function words at the beginning of sentences. It is also known that phonological errors potentially resulting in part-word repetitions tend to occur on content words. However, the precise relation between word class and repetition type in preschool-age…

  2. Repetitive Behavior in Rubinstein-Taybi Syndrome: Parallels with Autism Spectrum Phenomenology

    ERIC Educational Resources Information Center

    Waite, Jane; Moss, Joanna; Beck, Sarah R.; Richards, Caroline; Nelson, Lisa; Arron, Kate; Burbidge, Cheryl; Berg, Katy; Oliver, Chris

    2015-01-01

    Syndrome specific repetitive behavior profiles have been described previously. A detailed profile is absent for Rubinstein-Taybi syndrome (RTS). The Repetitive Behaviour Questionnaire and Social Communication Questionnaire were completed for children and adults with RTS (N = 87), Fragile-X (N = 196) and Down (N = 132) syndromes, and individuals…

  3. Evidence for a Non-Lexical Influence on Children's Auditory Repetition of Familiar Words

    ERIC Educational Resources Information Center

    Budd, Mary-Jane; Hanley, J. Richard; Nozari, Nazbanou

    2012-01-01

    This paper examines evidence for a nonlexical influence on children's repetition of real words. We investigate the extent to which two computational models of auditory repetition can simulate the performance of 68 children aged between 5 and 11 years-old when they are attempting to repeat familiar words. Both computational accounts were derived…

  4. The Effect of Muscle Hypoperfusion-Hyperemia on Repetitive Vertical Jump Performance.

    ERIC Educational Resources Information Center

    Howell, Amy K.; Gaughan, John P.; Cairns, Marilyn A.; Faigenbaum, Avery D.; Libonati, Joseph R.

    2001-01-01

    Determined the effects of brief hypoperfusion-hyperemia (by femoral cuff occlusion) on repetitive vertical jump performance among recreationally trained men and women. Results indicated that in a protocol of maximal repetitive vertical jumps, the power output declined by approximately 20 percent. Hypoperfusion- hyperemia had no significant effect…

  5. Validation of the Repetitive Behaviour Questionnaire for Use with Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Honey, Emma; McConachie, Helen; Turner, Michelle; Rodgers, Jacqui

    2012-01-01

    The repetitive behaviour questionnaire (RBQ) (Turner, 1995) is one of the three most commonly used interview/questionnaire measures of repetitive behaviour (Honey et al., in preparation). Despite this there is a scarcity of information concerning its structure, reliability and validity. The psychometric properties of the RBQ were examined when…

  6. Measuring Repetitive Behaviors as a Treatment Endpoint in Youth with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Scahill, Lawrence; Aman, Michael G.; Lecavalier, Luc; Halladay, Alycia K.; Bishop, Somer L.; Bodfish, James W.; Grondhuis, Sabrina; Jones, Nancy; Horrigan, Joseph P.; Cook, Edwin H.; Handen, Benjamin L.; King, Bryan H.; Pearson, Deborah A.; McCracken, James T.; Sullivan, Katherine Anne; Dawson, Geraldine

    2015-01-01

    Restricted interests and repetitive behaviors vary widely in type, frequency, and intensity among children and adolescents with autism spectrum disorder. They can be stigmatizing and interfere with more constructive activities. Accordingly, restricted interests and repetitive behaviors may be a target of intervention. Several standardized…

  7. Analysis of repetitive DNA distribution patterns in the Tribolium castaneum genome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insect genomes vary widely in size, in part because of a sometimes large and variable repetitive DNA component. Prior to the determination of the genome sequence of the red flour beetle Tribolium castaneum, reassociation kinetics had indicated that up to 42% of this genome is composed of repetitive ...

  8. Feature Integration and Task Switching: Diminished Switch Costs after Controlling for Stimulus, Response, and Cue Repetitions

    PubMed Central

    Schmidt, James R.; Liefooghe, Baptist

    2016-01-01

    This report presents data from two versions of the task switching procedure in which the separate influence of stimulus repetitions, response key repetitions, conceptual response repetitions, cue repetitions, task repetitions, and congruency are considered. Experiment 1 used a simple alternating runs procedure with parity judgments of digits and consonant/vowel decisions of letters as the two tasks. Results revealed sizable effects of stimulus and response repetitions, and controlling for these effects reduced the switch cost. Experiment 2 was a cued version of the task switch paradigm with parity and magnitude judgments of digits as the two tasks. Results again revealed large effects of stimulus and response repetitions, in addition to cue repetition effects. Controlling for these effects again reduced the switch cost. Congruency did not interact with our novel “unbiased” measure of switch costs. We discuss how the task switch paradigm might be thought of as a more complex version of the feature integration paradigm and propose an episodic learning account of the effect. We further consider to what extent appeals to higher-order control processes might be unnecessary and propose that controls for feature integration biases should be standard practice in task switching experiments. PMID:26964102

  9. High-repetition-rate, recirculating hydrogen fluoride/deuterium fluoride laser

    SciTech Connect

    Rudko, R.I.; Drozdowicz, Z.; Linhares, S.; Bua, D.

    1982-04-01

    A compact, gas-efficient, pulsed chemical laser operated with HF, DF, or HF and DF simultaneously, is described. This laser produced over 1 mJ/pulse up to over 4000 pps repetition rates with maximum average power over 4.5 W. Maximum repetition rate was 10 000 pulse/s.

  10. Motor Control and Nonword Repetition in Specific Working Memory Impairment and SLI

    ERIC Educational Resources Information Center

    Archibald, Lisa M. D.; Joanisse, Marc F.; Munson, Benjamin

    2013-01-01

    Purpose: Debate around the underlying cognitive factors leading to poor performance in the repetition of nonwords by children with developmental impairments in language has centered around phonological short-term memory, lexical knowledge, and other factors. This study examines the impact of motor control demands on nonword repetition in groups of…

  11. The Influence of Lexical Status and Neighborhood Density on Children's Nonword Repetition

    ERIC Educational Resources Information Center

    Metsala, Jamie L.; Chisholm, Gina M.

    2010-01-01

    This study examined effects of lexical status and neighborhood density of constituent syllables on children's nonword repetition and interactions with nonword length. Lexical status of the target syllable impacted repetition accuracy for the longest nonwords. In addition, children made more errors that changed a nonword syllable to a word syllable…

  12. Altered Brain Activities Associated with Neural Repetition Effects in Mild Cognitive Impairment Patients.

    PubMed

    Yu, Jing; Li, Rui; Jiang, Yang; Broster, Lucas S; Li, Juan

    2016-05-11

    Older adults with mild cognitive impairment (MCI) manifest impaired explicit memory. However, studies on implicit memory such as repetition effects in persons with MCI have been limited. In the present study, 17 MCI patients and 16 healthy normal controls (NC) completed a modified delayed-match-to-sample task while undergoing functional magnetic resonance imaging. We aim to examine the neural basis of repetition; specifically, to elucidate whether and how repetition-related brain responses are altered in participants with MCI. When repeatedly rejecting distracters, both NC and MCI showed similar behavioral repetition effects; however, in both whole-brain and region-of-interest analyses of functional data, persons with MCI showed reduced repetition-driven suppression in the middle occipital and middle frontal gyrus. Further, individual difference analysis found that activation in the left middle occipital gyrus was positively correlated with rejecting reaction time and negatively correlated with accuracy rate, suggesting a predictor of repetition behavioral performance. These findings provide new evidence to support the view that neural mechanisms of repetition effect are altered in MCI who manifests compensatory repetition-related brain activities along with their neuropathology. PMID:27176074

  13. Nonword Repetition and Phoneme Elision in Adults Who Do and Do Not Stutter

    ERIC Educational Resources Information Center

    Byrd, Courtney T.; Vallely, Megann; Anderson, Julie D.; Sussman, Harvey

    2012-01-01

    The purpose of the present study was to explore the phonological working memory of adults who stutter through the use of a non-word repetition and a phoneme elision task. Participants were 14 adults who stutter (M = 28 years) and 14 age/gender matched adults who do not stutter (M = 28 years). For the non-word repetition task, the participants had…

  14. Brief Report: Repetitive Behaviours in Greek Individuals with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Georgiades, Stelios; Papageorgiou, Vaya; Anagnostou, Evdokia

    2010-01-01

    The main objective of this study was to examine the factor structure of restricted repetitive behaviours (RRBs) in a sample of 205 Greek individuals with Autism Spectrum Disorder (ASD), using the Repetitive Behavior Scale-Revised (RBS-R). Results show that the structure of RRBs in this Greek sample can be described using a 2-factor solution. The…

  15. Subcategories of Restricted and Repetitive Behaviors in Children with Autism Spectrum Disorders

    ERIC Educational Resources Information Center

    Bishop, Somer L.; Hus, Vanessa; Duncan, Amie; Huerta, Marisela; Gotham, Katherine; Pickles, Andrew; Kreiger, Abba; Buja, Andreas; Lund, Sabata; Lord, Catherine

    2013-01-01

    Research suggests that restricted and repetitive behaviors (RRBs) can be subdivided into Repetitive Sensory Motor (RSM) and Insistence on Sameness (IS) behaviors. However, because the majority of previous studies have used the Autism Diagnostic Interview-Revised (ADI-R), it is not clear whether these subcategories reflect the actual organization…

  16. On the Road to Science Literacy: Building Confidence and Competency in Technical Language through Choral Repetition

    ERIC Educational Resources Information Center

    Hohenshell, Liesl M.; Woller, Michael J.; Sherlock, Wallace

    2013-01-01

    In order to be successful, students must acquire the language of science for both oral and written communication. In this article we examine an oral language learning technique called choral repetition for its role in building literacy in the context of an animal physiology course. For 3 weeks, the instructor conducted choral repetitions of nine…

  17. Feature Integration and Task Switching: Diminished Switch Costs after Controlling for Stimulus, Response, and Cue Repetitions.

    PubMed

    Schmidt, James R; Liefooghe, Baptist

    2016-01-01

    This report presents data from two versions of the task switching procedure in which the separate influence of stimulus repetitions, response key repetitions, conceptual response repetitions, cue repetitions, task repetitions, and congruency are considered. Experiment 1 used a simple alternating runs procedure with parity judgments of digits and consonant/vowel decisions of letters as the two tasks. Results revealed sizable effects of stimulus and response repetitions, and controlling for these effects reduced the switch cost. Experiment 2 was a cued version of the task switch paradigm with parity and magnitude judgments of digits as the two tasks. Results again revealed large effects of stimulus and response repetitions, in addition to cue repetition effects. Controlling for these effects again reduced the switch cost. Congruency did not interact with our novel "unbiased" measure of switch costs. We discuss how the task switch paradigm might be thought of as a more complex version of the feature integration paradigm and propose an episodic learning account of the effect. We further consider to what extent appeals to higher-order control processes might be unnecessary and propose that controls for feature integration biases should be standard practice in task switching experiments. PMID:26964102

  18. Changes of the Prefrontal EEG (Electroencephalogram) Activities According to the Repetition of Audio-Visual Learning.

    ERIC Educational Resources Information Center

    Kim, Yong-Jin; Chang, Nam-Kee

    2001-01-01

    Investigates the changes of neuronal response according to a four time repetition of audio-visual learning. Obtains EEG data from the prefrontal (Fp1, Fp2) lobe from 20 subjects at the 8th grade level. Concludes that the habituation of neuronal response shows up in repetitive audio-visual learning and brain hemisphericity can be changed by…

  19. The Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9 (CRISPR/Cas9)-created MDM2 T309G Mutation Enhances Vitreous-induced Expression of MDM2 and Proliferation and Survival of Cells.

    PubMed

    Duan, Yajian; Ma, Gaoen; Huang, Xionggao; D'Amore, Patricia A; Zhang, Feng; Lei, Hetian

    2016-07-29

    The G309 allele of SNPs in the mouse double minute (MDM2) promoter locus is associated with a higher risk of cancer and proliferative vitreoretinopathy (PVR), but whether SNP G309 contributes to the pathogenesis of PVR is to date unknown. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease (Cas) 9 from Streptococcus pyogenes (SpCas9) can be harnessed to manipulate a single or multiple nucleotides in mammalian cells. Here we delivered SpCas9 and guide RNAs using dual adeno-associated virus-derived vectors to target the MDM2 genomic locus together with a homologous repair template for creating the mutation of MDM2 T309G in human primary retinal pigment epithelial (hPRPE) cells whose genotype is MDM2 T309T. The next-generation sequencing results indicated that there was 42.51% MDM2 G309 in the edited hPRPE cells using adeno-associated viral CRISPR/Cas9. Our data showed that vitreous induced an increase in MDM2 and subsequent attenuation of p53 expression in MDM2 T309G hPRPE cells. Furthermore, our experimental results demonstrated that MDM2 T309G in hPRPE cells enhanced vitreous-induced cell proliferation and survival, suggesting that this SNP contributes to the pathogenesis of PVR. PMID:27246850

  20. Serial rapists and their victims: reenactment and repetition.

    PubMed

    Burgess, A W; Hazelwood, R R; Rokous, F E; Hartman, C R; Burgess, A G

    1988-01-01

    The major finding in this study of 41 serial rapists is the large numbers of reported and unreported victims. For over 1200 attempted and completed rapes, there were 200 convictions. The hidden rapes or earliest nonreported victims of these men as boys and adolescents were identified from their families, their neighborhood, and their schools. Examining the possible link between childhood sexual abuse and criminal behavior in this sample of 41 serial rapists, 56.1% were judged to have at least one forced or exploitive abuse experience in boyhood, as compared to a study of 2,972 college males reporting 7.3% experiencing boyhood sexual abuse. Looking within the abused samples, 56.1% of the rapists reported forced sex, compared to the college sample's 30.4%. Also, the rapist sample revealed higher rates of family member as abuser (48.4%), compared to 22.2% for the college sample. Retrospective reconstruction of the sexual activities and assertive behaviors of these men as boys reveals that 51% of the boys reenact the abuse as a preadolescent with their earliest victims being known to them (48% as neighborhood girls), family (25% as sisters), or girlfriend (25%). The onset of rape fantasies in midadolescence (mean age 16.9) crystalizes the earlier sexually initiated behaviors into juvenile behaviors of spying, fetish burglaries, molestations, and rapes. Repetition of these juvenile behaviors set their criminal patters on strangers--their next group of victims. To reduce victimization, serial rapists need to be identified early and stopped. This means acknowledging and reporting boy sexual abuse. This includes being sensitive to the reenactment behaviors noted in the initiated activities of abused children, which in turn need to be differentiated from peer play. Closer attention needs to be paid to families with incest behavior to insure that younger children are protected. Adolescents showing early repetitive juvenile delinquent behaviors must be assessed for physical