Hydrogen-peroxide-induced oxidative stress responses in Desulfovibrio vulgaris Hildenborough

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, A.; He, Z.; Redding-Johanson, A.M.

2010-07-01

To understand how sulphate-reducing bacteria respond to oxidative stresses, the responses of Desulfovibrio vulgaris Hildenborough to H{sub 2}O{sub 2}-induced stresses were investigated with transcriptomic, proteomic and genetic approaches. H{sub 2}O{sub 2} and induced chemical species (e.g. polysulfide, ROS) and redox potential shift increased the expressions of the genes involved in detoxification, thioredoxin-dependent reduction system, protein and DNA repair, and decreased those involved in sulfate reduction, lactate oxidation and protein synthesis. A gene coexpression network analysis revealed complicated network interactions among differentially expressed genes, and suggested possible importance of several hypothetical genes in H{sub 2}O{sub 2} stress. Also, most of themore » genes in PerR and Fur regulons were highly induced, and the abundance of a Fur regulon protein increased. Mutant analysis suggested that PerR and Fur are functionally overlapped in response to stresses induced by H{sub 2}O{sub 2} and reaction products, and the upregulation of thioredoxin-dependent reduction genes was independent of PerR or Fur. It appears that induction of those stress response genes could contribute to the increased resistance of deletion mutants to H{sub 2}O{sub 2}-induced stresses. In addition, a conceptual cellular model of D. vulgaris responses to H{sub 2}O{sub 2} stress was constructed to illustrate that this bacterium may employ a complicated molecular mechanism to defend against the H{sub 2}O{sub 2}-induced stresses.« less

Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

PubMed

Swathy, Babu; Banerjee, Moinak

2017-01-01

Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission

Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells

PubMed Central

Swathy, Babu

2017-01-01

Introduction Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. Methods SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Results Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes

Honey bee foraging induces upregulation of early growth response protein 1, hormone receptor 38 and candidate downstream genes of the ecdysteroid signalling pathway.

PubMed

Singh, A S; Shah, A; Brockmann, A

2018-02-01

In honey bees, continuous foraging at an artificial feeder induced a sustained upregulation of the immediate early genes early growth response protein 1 (Egr-1) and hormone receptor 38 (Hr38). This gene expression response was accompanied by an upregulation of several Egr-1 candidate downstream genes: ecdysone receptor (EcR), dopamine/ecdysteroid receptor (DopEcR), dopamine decarboxylase and dopamine receptor 2. Hr38, EcR and DopEcR are components of the ecdysteroid signalling pathway, which is highly probably involved in learning and memory processes in honey bees and other insects. Time-trained foragers still showed an upregulation of Egr-1 when the feeder was presented at an earlier time of the day, suggesting that the genomic response is more dependent on the food reward than training time. However, presentation of the feeder at the training time without food was still capable of inducing a transient increase in Egr-1 expression. Thus, learnt feeder cues, or even training time, probably affect Egr-1 expression. In contrast, whole brain Egr-1 expression changes did not differ between dancing and nondancing foragers. On the basis of our results we propose that food reward induced continuous foraging ultimately elicits a genomic response involving Egr-1 and Hr38 and their downstream genes. Furthermore this genomic response is highly probably involved in foraging-related learning and memory responses. © 2017 The Royal Entomological Society.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

DNA sensing via the Stimulator of Interferon Genes (STING) adaptor in myeloid dendritic cells induces potent tolerogenic responses1

PubMed Central

Huang, Lei; Li, Lingqian; Lemos, Henrique; Chandler, Phillip R.; Pacholczyk, Gabriela; Baban, Babak; Barber, Glen N.; Hayakawa, Yoshihiro; McGaha, Tracy L.; Ravishankar, Buvana; Munn, David H.; Mellor, Andrew L.

2013-01-01

Cytosolic DNA sensing via the STING adaptor incites autoimmunity by inducing type I IFN (IFNαβ). Here we show that DNA is also sensed via STING to suppress immunity by inducing indoleamine 2,3 dioxygenase (IDO). STING gene ablation abolished IFNαβ and IDO induction by dendritic cells (DCs) after DNA nanoparticle (DNP) treatment. Marginal zone macrophages, some DCs and myeloid cells ingested DNPs but CD11b+ DCs were the only cells to express IFNβ, while CD11b+ non-DCs were major IL-1β producers. STING ablation also abolished DNP-induced regulatory responses by DCs and regulatory T cells (Tregs), and hallmark regulatory responses to apoptotic cells were also abrogated. Moreover, systemic cyclic diguanylate monophosphate (c-diGMP) treatment to activate STING induced selective IFNβ expression by CD11b+ DCs and suppressed Th1 responses to immunization. Thus, previously unrecognized functional diversity amongst physiologic innate immune cells regarding DNA sensing via STING is pivotal in driving immune responses to DNA. PMID:23986532

Data mining reveals a network of early-response genes as a consensus signature of drug-induced in vitro and in vivo toxicity.

PubMed

Zhang, J D; Berntenis, N; Roth, A; Ebeling, M

2014-06-01

Gene signatures of drug-induced toxicity are of broad interest, but they are often identified from small-scale, single-time point experiments, and are therefore of limited applicability. To address this issue, we performed multivariate analysis of gene expression, cell-based assays, and histopathological data in the TG-GATEs (Toxicogenomics Project-Genomics Assisted Toxicity Evaluation system) database. Data mining highlights four genes-EGR1, ATF3, GDF15 and FGF21-that are induced 2 h after drug administration in human and rat primary hepatocytes poised to eventually undergo cytotoxicity-induced cell death. Modelling and simulation reveals that these early stress-response genes form a functional network with evolutionarily conserved structure and intrinsic dynamics. This is underlined by the fact that early induction of this network in vivo predicts drug-induced liver and kidney pathology with high accuracy. Our findings demonstrate the value of early gene-expression signatures in predicting and understanding compound-induced toxicity. The identified network can empower first-line tests that reduce animal use and costs of safety evaluation.

Light-dependent expression of flg22-induced defense genes in Arabidopsis.

PubMed

Sano, Satoshi; Aoyama, Mayu; Nakai, Kana; Shimotani, Koji; Yamasaki, Kanako; Sato, Masa H; Tojo, Daisuke; Suwastika, I Nengah; Nomura, Hironari; Shiina, Takashi

2014-01-01

Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30%) genes strongly induced by flg22 (>4.0) require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid (SA), indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB). Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controlling the light-dependent expression of flg22-inducible defense genes.

Innate immune genes including a mucin-like gene, mul-1, induced by ionizing radiation in Caenorhabditis elegans.

PubMed

Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi

2012-10-01

The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.

Injury-induced immune responses in Hydra.

PubMed

Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

2014-08-01

The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

From the Cover: Interplay Between IFN-γ and IL-6 Impacts the Inflammatory Response and Expression of Interferon-Regulated Genes in Environmental-Induced Autoimmunity.

PubMed

Cauvi, David M; Cauvi, Gabrielle; Toomey, Christopher B; Jacquinet, Eric; Pollard, Kenneth Michael

2017-07-01

IFN-γ has been found to be robustly important to disease pathogenesis in both idiopathic and induced models of murine lupus. In transgenic mice, over production of IFN-γ in the skin results in an inflammatory response and autoimmunity. This suggests that localized exposure to environmental factors that induce autoimmunity may be associated with expression of an IFN-γ-dependent inflammatory response. Using murine mercury-induced autoimmunity (mHgIA), the severity of inflammation and proinflammatory cytokine expression, including the cellular source of IFN-γ, were assessed at the site of subcutaneous exposure and in secondary lymphoid organs. Exposure induced a localized chronic inflammation comprising both innate and adaptive immune cells but only CD8+ T and NK cells were reduced in the absence of IFN-γ. IFN-γ+ cells began to appear as early as day 1 and comprised both resident (γδ T) and infiltrating cells (CD8+ T, NKT, CD11c+). The requirements for inflammation were examined in mice deficient in genes required (Ifng, Il6) or not required (Casp1) for mHgIA. None of these genes were essential for induction of inflammation, however IFN-γ and IL-6 were required for exacerbation of other proinflammatory cytokines. Additionally, lack of IFN-γ or IL-6 impacted expression of genes regulated by either IFN-γ or type I IFN. Significantly, both IFN-γ and IL-6 were required for increased expression of IRF-1 which regulates IFN stimulated genes and is required for mHgIA. Thus IRF-1 may be at the nexus of the interplay between IFN-γ and IL-6 in exacerbating a xenobiotic-induced inflammatory response, regulation of interferon responsive genes and autoimmunity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Early transcriptomic changes induced by magnesium deficiency in Arabidopsis thaliana reveal the alteration of circadian clock gene expression in roots and the triggering of abscisic acid-responsive genes.

PubMed

Hermans, Christian; Vuylsteke, Marnik; Coppens, Frederik; Craciun, Adrian; Inzé, Dirk; Verbruggen, Nathalie

2010-07-01

*Plant growth and development ultimately depend on environmental variables such as the availability of essential minerals. Unravelling how nutrients affect gene expression will help to understand how they regulate plant growth. *This study reports the early transcriptomic response to magnesium (Mg) deprivation in Arabidopsis. Whole-genome transcriptome was studied in the roots and young mature leaves 4, 8 and 28 h after the removal of Mg from the nutrient solution. *The highest number of regulated genes was first observed in the roots. Contrary to other mineral deficiencies, Mg depletion did not induce a higher expression of annotated genes in Mg uptake. Remarkable responses include the perturbation of the central oscillator of the circadian clock in roots and the triggering of abscisic acid (ABA) signalling, with half of the up-regulated Mg genes in leaves being ABA-responsive. However, no change in ABA content was observed. *The specificity of the response of some Mg-regulated genes was challenged by studying their expression after other mineral deficiencies and environmental stresses. The possibility to develop markers for Mg incipient deficiency is discussed here.

Assessing the Role of ETHYLENE RESPONSE FACTOR Transcriptional Repressors in Salicylic Acid-Mediated Suppression of Jasmonic Acid-Responsive Genes.

PubMed

Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M

2017-02-01

Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Lead nitrate-induced development of hypercholesterolemia in rats: sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis.

PubMed

Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni

2004-12-01

Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.

Alcohol-Induced Histone Acetylation Reveals a Gene Network Involved in Alcohol Tolerance

PubMed Central

Ghezzi, Alfredo; Krishnan, Harish R.; Lew, Linda; Prado, Francisco J.; Ong, Darryl S.; Atkinson, Nigel S.

2013-01-01

Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol. PMID:24348266

Global gene expression analysis of the heat shock response in the phytopathogen Xylella fastidiosa.

PubMed

Koide, Tie; Vêncio, Ricardo Z N; Gomes, Suely L

2006-08-01

Xylella fastidiosa is a phytopathogenic bacterium that is responsible for diseases in many economically important crops. Although different strains have been studied, little is known about X. fastidiosa stress responses. One of the better characterized stress responses in bacteria is the heat shock response, which induces the expression of specific genes to prevent protein misfolding and aggregation and to promote degradation of the irreversibly denatured polypeptides. To investigate X. fastidiosa genes involved in the heat shock response, we performed a whole-genome microarray analysis in a time course experiment. Globally, 261 genes were induced (9.7%) and 222 genes were repressed (8.3%). The expression profiles of the differentially expressed genes were grouped, and their expression patterns were validated by quantitative reverse transcription-PCR experiments. We determined the transcription start sites of six heat shock-inducible genes and analyzed their promoter regions, which allowed us to propose a putative consensus for sigma(32) promoters in Xylella and to suggest additional genes as putative members of this regulon. Besides the induction of classical heat shock protein genes, we observed the up-regulation of virulence-associated genes such as vapD and of genes for hemagglutinins, hemolysin, and xylan-degrading enzymes, which may indicate the importance of heat stress to bacterial pathogenesis. In addition, we observed the repression of genes related to fimbriae, aerobic respiration, and protein biosynthesis and the induction of genes related to the extracytoplasmic stress response and some phage-related genes, revealing the complex network of genes that work together in response to heat shock.

Regulatory systems for hypoxia-inducible gene expression in ischemic heart disease gene therapy.

PubMed

Kim, Hyun Ah; Rhim, Taiyoun; Lee, Minhyung

2011-07-18

Ischemic heart diseases are caused by narrowed coronary arteries that decrease the blood supply to the myocardium. In the ischemic myocardium, hypoxia-responsive genes are up-regulated by hypoxia-inducible factor-1 (HIF-1). Gene therapy for ischemic heart diseases uses genes encoding angiogenic growth factors and anti-apoptotic proteins as therapeutic genes. These genes increase blood supply into the myocardium by angiogenesis and protect cardiomyocytes from cell death. However, non-specific expression of these genes in normal tissues may be harmful, since growth factors and anti-apoptotic proteins may induce tumor growth. Therefore, tight gene regulation is required to limit gene expression to ischemic tissues, to avoid unwanted side effects. For this purpose, various gene expression strategies have been developed for ischemic-specific gene expression. Transcriptional, post-transcriptional, and post-translational regulatory strategies have been developed and evaluated in ischemic heart disease animal models. The regulatory systems can limit therapeutic gene expression to ischemic tissues and increase the efficiency of gene therapy. In this review, recent progresses in ischemic-specific gene expression systems are presented, and their applications to ischemic heart diseases are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

The human haptoglobin gene promoter: interleukin-6-responsive elements interact with a DNA-binding protein induced by interleukin-6.

PubMed Central

Oliviero, S; Cortese, R

1989-01-01

Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245

Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance

PubMed Central

Ensminger, Stephan M.; Spriewald, Bernd M.

2012-01-01

Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401

Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.

PubMed

Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao

2009-11-01

Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.

Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp synthase

PubMed Central

Brockmann-Gretza, Olaf; Kalinowski, Jörn

2006-01-01

Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (p)ppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (p)ppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX) in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be responsible for the complex

An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

PubMed

Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2011-12-01

In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

Blood gene expression profiling of an early acetaminophen response.

PubMed

Bushel, P R; Fannin, R D; Gerrish, K; Watkins, P B; Paules, R S

2017-06-01

Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4 g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing, and 12 genes were detected with expression profiles significantly altered within 24 h. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure, and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration.

Blood Gene Expression Profiling of an Early Acetaminophen Response

PubMed Central

Bushel, Pierre R.; Fannin, Rick D.; Gerrish, Kevin; Watkins, Paul B.; Paules, Richard S.

2018-01-01

Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing and 12 genes were detected with expression profiles significantly altered within 24 hrs. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration. PMID:26927286

Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.

PubMed

Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L

2009-09-01

Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.

Cylindrospermopsin induced DNA damage and alteration in the expression of genes involved in the response to DNA damage, apoptosis and oxidative stress.

PubMed

Žegura, B; Gajski, G; Štraser, A; Garaj-Vrhovac, V

2011-11-01

Cylindrospermopsin (CYN), a potent cyanobacterial cytototoxin produced by certain freshwater cyanobacteria, is regularly found in water supplies in many parts of the world, and has been associated with the intoxication of humans and livestock. The few genotoxicity studies available indicate that CYN is genotoxic, generally implying that it is pro-genotoxic. In human peripheral blood lymphocytes (HPBLs) CYN (0, 0.05, 0.1 and 0.5 μg/ml) induced the formation of DNA single strand breaks, applying the comet assay. Time and dose dependent significant increase in the frequency of micronuclei and nuclear buds was observed after the exposure of HPBLs to CYN, while there was only slight increase in the number of nucleoplasmic bridges. For the first time the modulation of gene expression in HPBLs was studied after the exposure to CYN (0.5 μg/ml), using the quantitative real-time PCR. The genes presumably involved in CYN metabolism (CYP1A1 and CYP1A2) were up-regulated after the exposure. CYN induced changes in the mRNA expression of P53 and its downstream regulated DNA damage responsive genes MDM2, GADD45α and apoptosis genes, BCL-2 and BAX, as well as oxidative stress responsive genes (GPX1, SOD1, GSR, GCLC), while no changes in the expression of genes CDKN1A and CAT were observed. These results provide strong evidence that CYN should be considered as genotoxic and that lymphocytes can also be a target of cylindrospermopsin induced genotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.

Stat1-independent regulation of gene expression in response to IFN-γ

PubMed Central

Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.

2001-01-01

Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994

Local and systemic mycorrhiza-induced protection against the ectoparasitic nematode Xiphinema index involves priming of defence gene responses in grapevine.

PubMed

Hao, Zhipeng; Fayolle, Léon; van Tuinen, Diederik; Chatagnier, Odile; Li, Xiaolin; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne

2012-06-01

The ectoparasitic dagger nematode (Xiphinema index), vector of Grapevine fanleaf virus (GFLV), provokes gall formation and can cause severe damage to the root system of grapevines. Mycorrhiza formation by Glomus (syn. Rhizophagus) intraradices BEG141 reduced both gall formation on roots of the grapevine rootstock SO4 (Vitis berlandieri×V. riparia) and nematode number in the surrounding soil. Suppressive effects increased with time and were greater when the nematode was post-inoculated rather than co-inoculated with the arbuscular mycorrhizal (AM) fungus. Using a split-root system, decreased X. index development was shown in mycorrhizal and non-mycorrhizal parts of mycorrhizal root systems, indicating that both local and systemic induced bioprotection mechanisms were active against the ectoparasitic nematode. Expression analyses of ESTs (expressed sequence tags) generated in an SSH (subtractive suppressive hybridization) library, representing plant genes up-regulated during mycorrhiza-induced control of X. index, and of described grapevine defence genes showed activation of chitinase 1b, pathogenesis-related 10, glutathione S-transferase, stilbene synthase 1, 5-enolpyruvyl shikimate-3-phosphate synthase, and a heat shock proein 70-interacting protein in association with the observed local and/or systemic induced bioprotection against the nematode. Overall, the data suggest priming of grapevine defence responses by the AM fungus and transmission of a plant-mediated signal to non-mycorrhizal tissues. Grapevine gene responses during AM-induced local and systemic bioprotection against X. index point to biological processes that are related either to direct effects on the nematode or to protection against nematode-imposed stress to maintain root tissue integrity.

Local and systemic mycorrhiza-induced protection against the ectoparasitic nematode Xiphinema index involves priming of defence gene responses in grapevine

PubMed Central

Hao, Zhipeng; Fayolle, Léon; van Tuinen, Diederik; Chatagnier, Odile; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne

2012-01-01

The ectoparasitic dagger nematode (Xiphinema index), vector of Grapevine fanleaf virus (GFLV), provokes gall formation and can cause severe damage to the root system of grapevines. Mycorrhiza formation by Glomus (syn. Rhizophagus) intraradices BEG141 reduced both gall formation on roots of the grapevine rootstock SO4 (Vitis berlandieri×V. riparia) and nematode number in the surrounding soil. Suppressive effects increased with time and were greater when the nematode was post-inoculated rather than co-inoculated with the arbuscular mycorrhizal (AM) fungus. Using a split-root system, decreased X. index development was shown in mycorrhizal and non-mycorrhizal parts of mycorrhizal root systems, indicating that both local and systemic induced bioprotection mechanisms were active against the ectoparasitic nematode. Expression analyses of ESTs (expressed sequence tags) generated in an SSH (subtractive suppressive hybridization) library, representing plant genes up-regulated during mycorrhiza-induced control of X. index, and of described grapevine defence genes showed activation of chitinase 1b, pathogenesis-related 10, glutathione S-transferase, stilbene synthase 1, 5-enolpyruvyl shikimate-3-phosphate synthase, and a heat shock proein 70-interacting protein in association with the observed local and/or systemic induced bioprotection against the nematode. Overall, the data suggest priming of grapevine defence responses by the AM fungus and transmission of a plant-mediated signal to non-mycorrhizal tissues. Grapevine gene responses during AM-induced local and systemic bioprotection against X. index point to biological processes that are related either to direct effects on the nematode or to protection against nematode-imposed stress to maintain root tissue integrity. PMID:22407649

Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection.

PubMed

Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan

2015-01-01

The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only 'non-immune' genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria.

Evidence of an evolutionary hourglass pattern in herbivory-induced transcriptomic responses.

PubMed

Durrant, Matthew; Boyer, Justin; Zhou, Wenwu; Baldwin, Ian T; Xu, Shuqing

2017-08-01

Herbivory-induced defenses are specific and activated in plants when elicitors, frequently found in the herbivores' oral secretions, are introduced into wounds during attack. While complex signaling cascades are known to be involved, it remains largely unclear how natural selection has shaped the evolution of these induced defenses. We analyzed herbivory-induced transcriptomic responses in wild tobacco, Nicotiana attenuata, using a phylotranscriptomic approach that measures the origin and sequence divergence of herbivory-induced genes. Highly conserved and evolutionarily ancient genes of primary metabolism were activated at intermediate time points (2-6 h) after elicitation, while less constrained and young genes associated with defense signaling and biosynthesis of specialized metabolites were activated at early (before 2 h) and late (after 6 h) stages of the induced response, respectively - a pattern resembling the evolutionary hourglass pattern observed during embryogenesis in animals and the developmental process in plants and fungi. The hourglass patterns found in herbivory-induced defense responses and developmental process are both likely to be a result of signaling modularization and differential evolutionary constraints on the modules involved in the signaling cascade. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Metabolome response to temperature-induced virulence gene expression in two genotypes of pathogenic Vibrio parahaemolyticus.

PubMed

Feng, Bo; Guo, Zhuoran; Zhang, Weijia; Pan, Yingjie; Zhao, Yong

2016-04-26

Vibrio parahaemolyticus is a main causative agent of serious human seafood-borne gastroenteritis disease. Many researchers have investigated its pathogenesis by observing the alteration of its virulence factors in different conditions. It was previously known that culture conditions will influence the gene expression and the metabolic profile of V. parahaemolyticus, but little attention has been paid on the relationship between them. In this study, for the first time, the metabolomics response in relation to the expression of two major virulence genes, tdh and trh, induced at three temperatures (4, 25 and 37 °C) was examined in two genotypes of pathogenic Vibrio parahaemolyticus (ATCC33846 (tdh+/trh-/tlh+) and ATCC17802 (tdh-/trh+/tlh+)). Reverse transcription real-time PCR (RT-qPCR) analysis illustrated that the expression levels of tdh and trh induced at 25 °C in V. parahaemolyticus were significantly higher than those induced at 4 and 37 °C. Principal components analysis (PCA) based on the UPLC & Q-TOF MS data presented clearly distinct groups among the samples treated by different temperatures. Metabolic profiling demonstrated that 179 of 1,033 kinds of identified metabolites in ATCC33846 changed significantly (p <0.01) upon culturing at different temperatures, meanwhile 101 of 930 kinds of metabolites changed (p <0.01) in ATCC17802. Pearson's correlation analysis highlighted the correlation between metabolites and virulence gene expression levels. At the threshold of | r | = 1, p <0.01, 12 kinds of metabolites showed extremely significant correlations with tdh expression, and 4 kinds of metabolites significantly correlated with trh expression. It is interesting that 3D, 7D, 11D-Phytanic acid showed the same trend with pyrophosphate, whose derivative could activate the degradation of phytanic acid. Several metabolites could be sorted into the same class by the method of chemical taxonomy, by assuming that they are involved in the same metabolic pathways

Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

PubMed

Thiel, Gerald; Rössler, Oliver G

2017-03-01

Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

Downregulation of Midkine gene expression and its response to retinoic acid treatment in the nitrofen-induced hypoplastic lung.

PubMed

Doi, Takashi; Shintaku, Mika; Dingemann, Jens; Ruttenstock, Elke; Puri, Prem

2011-02-01

Nitrofen-induced congenital diaphragmatic hernia (CDH) model has been widely used to investigate the pathogenesis of pulmonary hypoplasia (PH) in CDH. Recent studies have suggested that retinoids may be involved in the molecular mechanisms of PH in CDH. Prenatal treatment with retinoic acid (RA) has been reported to improve the growth of hypoplastic lung in the nitrofen CDH model. Midkine (MK), a RA-responsive growth factor, plays key roles in various organogenesis including lung development. In fetal lung, MK mRNA expression has its peak at E13.5-E16.5 and is markedly decreased during mid-to-late gestation, indicating its important role in early lung morphogenesis. We designed this study to investigate the hypothesis that the pulmonary MK gene expression is downregulated in the early lung morphogenesis in the nitrofen-induced PH, and to evaluate the effect of prenatal RA treatment on pulmonary MK gene expression in the nitrofen-induced CDH model. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal lungs were harvested on D15, D18, and D21 and divided into control, nitrofen with or without CDH [CDH(+) or CDH(-)]. In addition, RA was given on days D18, D19, and D20 and fetal lungs were harvested on D21, and then divided into control + RA and nitrofen + RA. The pulmonary gene expression levels of MK were evaluated by real-time RT-PCR and statistically analyzed. Immunohistochemistry was also performed to examine protein expression/distribution of MK in fetal lung. The relative mRNA expression levels of MK were significantly downregulated in nitrofen group compared to controls at D15 ((§)p < 0.01), whereas there were no significant differences at D18 and D21. MK gene expression levels were significantly upregulated in nitrofen + RA (0.71 ± 0.17) compared to the control (0.35 ± 0.16), CDH(-) (0.24 ± 0.15), CDH(+) (0.39 ± 0.19) and control + RA (0.47 ± 0.13) (*p < 0.05). Immunoreactivity of MK was also markedly decreased in

Cellular responses to oxidative stress: the [Ah] gene battery as a paradigm.

PubMed Central

Nebert, D W; Petersen, D D; Fornace, A J

1990-01-01

A major source of oxidative stress in animals is plant stress metabolites, also termed phytoalexins. The aromatic hydrocarbon-responsive [Ah] gene battery is considered here as a model system in which we can study metabolically coordinated enzymes that respond to phytoalexin-induced oxidative stress. In the mouse, the [Ah] battery comprises at least six genes: two Phase I genes, CYP1A1 and CYP1A2; and four Phase II genes, Nmo-1, Aldh-1, Ugt-1, and Gt-1. All six genes appear to be regulated positively by inducers such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other ligands of the Ah receptor. In the absence of foreign inducer, the control of Nmo-1 gene expression is independent of the control of CYP1A1 and CYP1A2 gene expression. The radiation deletion homozygote c14CoS/c14CoS mouse is lacking about 1.1 centiMorgans of chromosome 7. Although having no detectable CYP1A1 or CYP1A2 activation, the untreated c14CoS/c14CoS mouse exhibits markedly elevated transcripts of the Nmo-1 gene and three growth arrest- and DNA damage-inducible (gadd) genes. These data suggest that the missing region on chromosome 7 in the c14CoS/c14CoS mouse contains a gene(s), which we propose to call Nmo-1n, encoding a trans-acting factor(s) that is a negative effector of the Nmo-1 and gadd genes. The three other [Ah] battery Phase II genes behave similarly to Nmo-1 in the c14CoS/c14CoS mouse. This coordinated response to oxidative stress and DNA damage, by way of the release of a mammalian battery of genes from negative control, bears an interesting resemblance to the SOS response in bacteria. PMID:2272308

Transient, Inducible, Placenta-Specific Gene Expression in Mice

PubMed Central

Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.

2012-01-01

Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919

Gene Expression Profiles of Chicken Embryo Fibroblasts in Response to Salmonella Enteritidis Infection

PubMed Central

Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan

2015-01-01

The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only ’non-immune’ genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria. PMID:26046914

Suppressors of systemin signaling identify genes in the tomato wound response pathway.

PubMed Central

Howe, G A; Ryan, C A

1999-01-01

In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469

Avian influenza rapidly induces antiviral genes in duck lung and intestine

PubMed Central

Vanderven, Hillary A.; Petkau, Kristina; Ryan-Jean, Kieran E. E.; Aldridge, Jerry R.; Webster, Robert G.; Magor, Katharine E.

2012-01-01

Ducks are the natural reservoir of influenza A and survive infection by most strains. To characterize the duck immune response to influenza, we sought to identify innate immune genes expressed early in an infection. We used suppressive subtractive hybridization (SSH) to construct 3 libraries enriched in differentially expressed genes from lung RNA of a duck infected with highly pathogenic avian influenza virus A/Vietnam/1203/04 (H5N1), or lung and intestine RNA of a duck infected with low pathogenic avian influenza A/mallard/BC/500/05 (H5N2) compared to a mock-infected duck. Sequencing of 1687 clones identified a transcription profile enriched in genes involved in antiviral defense and other cellular processes. Major histocompatibility complex class I (MHC I), interferon induced protein with tricopeptide repeats 5 (IFIT5), and 2′–5′oligoadenylate synthetase-like gene (OASL) were increased more than 1000-fold in relative transcript abundance in duck lung at 1 dpi with highly pathogenic VN1203. These genes were induced much less in lung or intestine following infection with low pathogenic BC500. The expression of these genes following infection suggests that ducks initiate an immediate and robust response to a potentially lethal influenza strain, and a minimal response a low pathogenic strain. PMID:22534314

Diurnal oscillations of soybean circadian clock and drought responsive genes.

PubMed

Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Bendix, Claire; Nakayama, Thiago Jonas; Celaya, Brandon; Molinari, Hugo Bruno Correa; de Oliveira, Maria Cristina Neves; Harmon, Frank G; Nepomuceno, Alexandre

2014-01-01

Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i) drought stress affects gene expression of circadian clock components and (ii) several stress responsive genes display diurnal oscillation in soybeans.

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Posttranscriptional regulation of adrenal TH gene expression contributes to the maladaptive responses triggered by insulin-induced recurrent hypoglycemia

PubMed Central

Kudrick, Necla; Chan, Owen; La Gamma, Edmund F; Kim, Juhye Lena; Tank, Arnold William; Sterling, Carol; Nankova, Bistra B

2015-01-01

Acute metabolic stress such as insulin-induced hypoglycemia triggers a counterregulatory response during which the release of catecholamines (epinephrine), the activation of tyrosine hydroxylase (TH) enzyme and subsequent compensatory catecholamine biosynthesis occur in the adrenal medulla. However, recurrent exposure to hypoglycemia (RH), a consequence of tight glycemic control in individuals with type 1 and type 2 diabetes compromises this physiological response. The molecular mechanisms underlying the maladaptive response to repeated glucose deprivation are incompletely understood. We hypothesize that impaired epinephrine release following RH reflects altered regulation of adrenal catecholamine biosynthesis. To test this hypothesis, we compared the effect of single daily (RH) and twice-daily episodes of insulin-induced hypoglycemia (2RH) on adrenal epinephrine release and production in normal rats. Control animals received saline injections under similar conditions (RS and 2RS, respectively). Following 3 days of treatment, we assessed the counterregulatory hormonal responses during a hypoglycemic clamp. Changes in adrenal TH gene expression were also analyzed. The counterregulatory responses, relative TH transcription and TH mRNA levels and Ser40-TH phosphorylation (marker for enzyme activation) were induced to a similar extent in RS, 2RS, and RH groups. In contrast, epinephrine and glucagon responses were attenuated in the 2RH group and this was associated with a limited elevation of adrenal TH mRNA, rapid inactivation of TH enzyme and no significant changes in TH protein. Our results suggest that novel posttranscriptional mechanisms controlling TH mRNA and activated TH enzyme turnover contribute to the impaired epinephrine responses and may provide new therapeutic targets to prevent HAAF. PMID:25713330

Adenovirus vector induced innate immune responses: impact upon efficacy and toxicity in gene therapy and vaccine applications.

PubMed

Hartman, Zachary C; Appledorn, Daniel M; Amalfitano, Andrea

2008-03-01

Extensively characterized, modified, and employed for a variety of purposes, adenovirus (Ad) vectors are generally regarded as having great potential by many applied virologists who wish to manipulate and use viral biology to achieve beneficial clinical outcomes. Despite widespread functional prominence and utility (i.e., Ad-based clinical trials have begun to progress to critical Phase III levels, it has recently become apparent that investigations regarding the innate immune response to Ads may reveal not only reasons behind previous failures, but also reveal novel insights that will allow for safer, more efficacious uses of this important gene transfer platform. Insights gained by the exploration of Ad induced innate immune responses will likely be most important to the fields of vaccine development, since Ad-based vaccines are regarded as one of the more promising vaccine platforms in development today. Adenovirus is currently known to interact with several different extracellular, intracellular, and membrane-bound innate immune sensing systems. Past and recent studies involving manipulation of the Ad infectious cycle as well as use of different mutants have shed light on some of the initiation mechanisms underlying Ad induced immune responses. More recent studies using microarray-based analyses, genetically modified cell lines and/or mouse mutants, and advanced generation Ad vectors have revealed important new insights into the scope and mechanism of this cellular defensive response. This review is an attempt to synthesize these studies, update Ad biologists to the current knowledge surrounding these increasingly important issues, as well as highlight areas where future research should be directed. It should also serve as a sobering reality to researchers exploring the use of any gene transfer vector, as to the complexities potentially involved when contemplating use of such vectors for human applications.

Adenovirus vector induced Innate Immune responses: Impact upon efficacy and toxicity in gene therapy and vaccine applications

PubMed Central

Hartman, Zachary C.; Appledorn, Daniel M.; Amalfitano, Andrea

2013-01-01

Extensively characterized, modified, and employed for a variety of purposes, Adenovirus (Ad) vectors are generally regarded as having great potential by many applied virologists who wish to manipulate and use viral biology to achieve beneficial clinical outcomes. Despite widespread functional prominence and utility, (i.e.: Ad based clinical trials have begun to progress to critical Phase III levels, it has recently become apparent that investigations regarding the innate immune response to Ads may reveal not only reasons behind previous failures, but also reveal novel insights that will allow for safer, more efficacious uses of this important gene transfer platform. Insights gained by the exploration of Ad induced innate immune responses will likely be most important to the fields of vaccine development, since Ad based vaccines are highly acknowledged as one of the more promising vaccine platforms in development today. Adenovirus is currently known to interact with several different extracellular, intracellular, and membrane bound innate immune sensing systems. Past and recent studies involving manipulation of the Ad infectious cycle as well as use of different mutants have shed light on some of the initiation mechanisms underlying Ad induced immune responses. More recent studies using microarray based analyses, genetically modified cell lines and/or mouse mutants, and advanced generation Ad vectors have revealed important new insights into the scope and mechanism of this cellular defensive response. This review is an attempt to synthesize these studies, update Ad biologists to the current knowledge surrounding these increasingly important issues, as well point areas where future research should be directed. It should also serve as a sobering reality to researchers exploring the use of any gene transfer vector, as to the complexities potentially involved when contemplating use of such vectors for human applications. PMID:18036698

Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

PubMed

Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

2018-02-01

In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

Early growth response gene 1 is essential for urban particulate matter-induced inflammation and mucus hyperproduction in airway epithelium.

PubMed

Xu, Feng; Cao, Jiaofei; Luo, Man; Che, Luanqing; Li, Wen; Ying, Songmin; Chen, Zhihua; Shen, Huahao

2018-05-19

Particulate matter (PM) has been implicated as a risk factor for human airway disorders. However, the biological mechanisms underlying the correlation between PM exposure and adverse airway effects have not yet been fully clarified. The objective of this study was to explore the possible role of early growth response gene 1 (Egr-1) in PM-induced toxic effects in pulmonary inflammation and mucus hyperproduction in vitro and in vivo. Particulate matter exposure induced a rapid Egr-1 expression in human bronchial epithelial (HBE) cells and in mouse lungs. Genetic blockage of Egr-1 markedly reduced PM-induced inflammatory cytokines, e.g., IL6 and IL8, and MUC5AC in HBE cells, and these effects were mechanistically mediated by the nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) pathways, respectively. Egr-1-knockout mice displayed significantly reduced airway inflammation and mucus hyperproduction in response to PM exposure in vivo. Moreover, polycyclic aromatic hydrocarbons (PAHs) contained in the PM also induced Egr-1 expression, and also played a role in the inflammatory responses and mucus production. Taken together, our data reveal novel Egr-1 signaling that mediates the NF-κB and AP-1 pathways to orchestrate PM-induced pulmonary inflammation and mucus hyperproduction, suggesting that Egr-1 inhibition could be an effective therapeutic approach for airway disorders or disease exacerbations induced by airborne particulate pollution. Copyright © 2018. Published by Elsevier B.V.

Cloning of soybean genes induced during hypersensitive cell death caused by syringolide elicitor.

PubMed

Hagihara, Takuya; Hashi, Masaru; Takeuchi, Yoji; Yamaoka, Naoto

2004-02-01

Syringolide elicitors produced by bacteria expressing Pseudomonas syringae pv. glycinea avirulence gene D (avrD) induce hypersensitive cell death (HCD) only in soybean (Glycine max [L.] Merr.) plants carrying the Rpg4 disease resistance gene. Employing a differential display method, we isolated 13 gene fragments induced in cultured cells of a soybean cultivar Harosoy (Rpg4) treated with syringolides. Several genes for isolated fragments were induced by syringolides in an rpg4 cultivar Acme as well as in Harosoy; however, the genes for seven fragments designated as SIH (for syringolide-induced/ HCD associated) were induced exclusively or strongly in Harosoy. cDNA clones for SIH genes were obtained from a cDNA library of Harosoy treated with syringolide. Several sequences are homologous to proteins associated with plant defense responses. The SIH genes did not respond to a non-specific beta-glucan elicitor, which induces phytoalexin accumulation but not HCD, suggesting that the induction of the SIH genes is specific for the syringolide-Harosoy interaction. HCD and the induction of SIH genes by syringolides were independent of H(2)O(2). On the other hand, Ca(2+) was required for HCD and the induction of some SIH genes. These results suggest that the induction of SIH genes by syringolides could be activated through the syringolide-specific signaling pathway and the SIH gene products may play an important role(s) in the processes of HCD induced by syringolides.

Diurnal Oscillations of Soybean Circadian Clock and Drought Responsive Genes

PubMed Central

Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Bendix, Claire; Nakayama, Thiago Jonas; Celaya, Brandon; Molinari, Hugo Bruno Correa; de Oliveira, Maria Cristina Neves; Harmon, Frank G.; Nepomuceno, Alexandre

2014-01-01

Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i) drought stress affects gene expression of circadian clock components and (ii) several stress responsive genes display diurnal oscillation in soybeans. PMID:24475115

Oxytocin receptor gene variation predicts subjective responses to MDMA.

PubMed

Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet

2016-12-01

3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.

Oxytocin receptor gene variation predicts subjective responses to MDMA

PubMed Central

Bershad, Anya K.; Weafer, Jessica J.; Kirkpatrick, Matthew G.; Wardle, Margaret C.; Miller, Melissa A.; de Wit, Harriet

2016-01-01

3,4-Methylenedioxymethamphetamine (MDMA, “ecstasy”) enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug. PMID:26787430

Transcriptional Response of Selenopolypeptide Genes and Selenocysteine Biosynthesis Machinery Genes in Escherichia coli during Selenite Reduction.

PubMed

Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua

2014-01-01

Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.

The acute phase response of cod (Gadus morhua L.): expression of immune response genes.

PubMed

Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th

2012-02-01

An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod. Copyright © 2011 Elsevier Ltd. All rights reserved.

Development of a tightly regulated and highly responsive copper-inducible gene expression system and its application to control of flowering time.

PubMed

Saijo, Takanori; Nagasawa, Akitsu

2014-01-01

A newly developed copper-inducible gene expression system overcame the mixed results reported earlier, worked well both in cultured cells and a whole plant, and enabled to control flowering timing. Copper is one of the essential microelements and is readily taken up by plants. However, to date, it has rarely been used to control the expression of genes of interest, probably due to the inefficiency of the gene expression systems. In this study, we successfully developed a copper-inducible gene expression system that is based on the regulation of the yeast metallothionein gene. This system can be applied in the field and regulated at approximately one-hundredth of the rate used for registered copper-based fungicides. In the presence of copper, a translational fusion of the ACE1 transcription factor with the VP16 activation domain (VP16AD) of herpes simplex virus strongly activated transcription of the GFP gene in transgenic Arabidopsis. Interestingly, insertion of the To71 sequence, a 5'-untranslated region of the 130k/180k gene of tomato mosaic virus, upstream of the GFP gene reduced the basal expression of GFP in the absence of copper to almost negligible levels, even in soil-grown plants that were supplemented with ordinary liquid nutrients. Exposure of plants to 100 μM copper resulted in an over 1,000-fold induction ratio at the transcriptional level of GFP. This induction was copper-specific and dose-dependent with rapid and reversible responses. Using this expression system, we also succeeded in regulating floral transition by copper treatment. These results indicate that our newly developed copper-inducible system can accelerate gene functional analysis in model plants and can be used to generate novel agronomic traits in crop species.

Responses of human cells to ZnO nanoparticles: a gene transcription study†

PubMed Central

Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.

2013-01-01

The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377

Lignification induced by pseudomonads harboring avirulent genes on Arabidopsis.

PubMed

Lee, S; Sharm, Y; Lee, T K; Chang, M; Davis, K R

2001-08-31

The responses of Arabidopsis thaliana ecotypes to the bacterial pathogen Pseudomonas syringae pv. maculicola 4326 (Psm4326) harboring cloned avirulence genes avrB and avrRpt2 from P. syringae pv. glycinea were examined. Psm4326 containing avirulent genes, avrB and avrRpt2 induced lignification and peroxidase activities in the bacteria infiltrated leaves of Col-O only and not in Mt-O, Bla-2 and Po-1. However, Arabidopsis ecotypes infiltrated with Psm4326 harboring with and without avirulent genes all showed differential induction of mRNA for peroxidase gene and lignin accumulation up to 24 h after infiltration. Only avrB gene in Col-O showed strong corelationship between peroxidase mRNA expression as well as lignification gradually up to 36 h after infiltration. These results extend previous observations that avirulence genes from pathogens of one host plant can be recognized by non-host plants and provide the genetic framework for analysis of the plant-specific response to the bacterial avirulent gene products in A. thaliana.

DELLA proteins modulate Arabidopsis defences induced in response to caterpillar herbivory

PubMed Central

Bede, Jacqueline C.

2014-01-01

Upon insect herbivory, many plant species change the direction of metabolic flux from growth into defence. Two key pathways modulating these processes are the gibberellin (GA)/DELLA pathway and the jasmonate pathway. In this study, the effect of caterpillar herbivory on plant-induced responses was compared between wild-type Arabidopsis thaliana (L.) Heynh. and quad-della mutants that have constitutively elevated GA responses. The labial saliva (LS) of caterpillars of the beet armyworm, Spodoptera exigua, is known to influence induced plant defence responses. To determine the role of this herbivore cue in determining metabolic shifts, plants were subject to herbivory by caterpillars with intact or impaired LS secretions. In both wild-type and quad-della plants, a jasmonate burst is an early response to caterpillar herbivory. Negative growth regulator DELLA proteins are required for the LS-mediated suppression of hormone levels. Jasmonate-dependent marker genes are induced in response to herbivory independently of LS, with the exception of AtPDF1.2 that showed LS-dependent expression in the quad-della mutant. Early expression of the salicylic acid (SA)-marker gene, AtPR1, was not affected by herbivory which also reflected SA hormone levels; however, this gene showed LS-dependent expression in the quad-della mutant. DELLA proteins may positively regulate glucosinolate levels and suppress laccase-like multicopper oxidase activity in response to herbivory. The present results show a link between DELLA proteins and early, induced plant defences in response to insect herbivory; in particular, these proteins are necessary for caterpillar LS-associated attenuation of defence hormones. PMID:24399173

Clinical significance of in vivo cytarabine-induced gene expression signature in AML.

PubMed

Lamba, Jatinder K; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R; Cogle, Christopher R; Bhise, Neha; Raimondi, Susana C; Downing, James R; Baker, Sharyn D; Ribeiro, Raul C; Rubnitz, Jeffrey E

2016-01-01

Despite initial remission, ∼60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML; however, the extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy, can trigger adaptive response by influencing leukemic cell transcriptome and, hence, development of resistance or refractory disease. It is, however, challenging to perform such a study due to lack of availability of specimens post-drug treatment. The primary objective of this study was to identify in vivo cytarabine-induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. The results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response.

Nitrate-induced genes in tomato roots. Array analysis reveals novel genes that may play a role in nitrogen nutrition.

PubMed

Wang, Y H; Garvin, D F; Kochian, L V

2001-09-01

A subtractive tomato (Lycopersicon esculentum) root cDNA library enriched in genes up-regulated by changes in plant mineral status was screened with labeled mRNA from roots of both nitrate-induced and mineral nutrient-deficient (-nitrogen [N], -phosphorus, -potassium [K], -sulfur, -magnesium, -calcium, -iron, -zinc, and -copper) tomato plants. A subset of cDNAs was selected from this library based on mineral nutrient-related changes in expression. Additional cDNAs were selected from a second mineral-deficient tomato root library based on sequence homology to known genes. These selection processes yielded a set of 1,280 mineral nutrition-related cDNAs that were arrayed on nylon membranes for further analysis. These high-density arrays were hybridized with mRNA from tomato plants exposed to nitrate at different time points after N was withheld for 48 h, for plants that were grown on nitrate/ammonium for 5 weeks prior to the withholding of N. One hundred-fifteen genes were found to be up-regulated by nitrate resupply. Among these genes were several previously identified as nitrate responsive, including nitrate transporters, nitrate and nitrite reductase, and metabolic enzymes such as transaldolase, transketolase, malate dehydrogenase, asparagine synthetase, and histidine decarboxylase. We also identified 14 novel nitrate-inducible genes, including: (a) water channels, (b) root phosphate and K(+) transporters, (c) genes potentially involved in transcriptional regulation, (d) stress response genes, and (e) ribosomal protein genes. In addition, both families of nitrate transporters were also found to be inducible by phosphate, K, and iron deficiencies. The identification of these novel nitrate-inducible genes is providing avenues of research that will yield new insights into the molecular basis of plant N nutrition, as well as possible networking between the regulation of N, phosphorus, and K nutrition.

Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.

PubMed

Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H

2009-05-01

Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.

Nicotinic acid modulates Legionella pneumophila gene expression and induces virulence traits.

PubMed

Edwards, Rachel L; Bryan, Andrew; Jules, Matthieu; Harada, Kaoru; Buchrieser, Carmen; Swanson, Michele S

2013-03-01

In response to environmental fluctuations or stresses, bacteria can activate transcriptional and phenotypic programs to coordinate an adaptive response. The intracellular pathogen Legionella pneumophila converts from a noninfectious replicative form to an infectious transmissive form when the bacterium encounters alterations in either amino acid concentrations or fatty acid biosynthesis. Here, we report that L. pneumophila differentiation is also triggered by nicotinic acid, a precursor of the central metabolite NAD(+). In particular, when replicative L. pneumophila are treated with 5 mM nicotinic acid, the bacteria induce numerous transmissive-phase phenotypes, including motility, cytotoxicity toward macrophages, sodium sensitivity, and lysosome avoidance. Transcriptional profile analysis determined that nicotinic acid induces the expression of a panel of genes characteristic of transmissive-phase L. pneumophila. Moreover, an additional 213 genes specific to nicotinic acid treatment were altered. Although nearly 25% of these genes lack an assigned function, the gene most highly induced by nicotinic acid treatment encodes a putative major facilitator superfamily transporter, Lpg0273. Indeed, lpg0273 protects L. pneumophila from toxic concentrations of nicotinic acid as judged by analyzing the growth of the corresponding mutant. The broad utility of the nicotinic acid pathway to couple central metabolism and cell fate is underscored by this small metabolite's modulation of gene expression by diverse microbes, including Candida glabrata, Bordetella pertussis, Escherichia coli, and L. pneumophila.

Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

NASA Astrophysics Data System (ADS)

Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.

2005-07-01

We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.

Halobenzoquinone-Induced Alteration of Gene Expression Associated with Oxidative Stress Signaling Pathways.

PubMed

Li, Jinhua; Moe, Birget; Liu, Yanming; Li, Xing-Fang

2018-06-05

Halobenzoquinones (HBQs) are emerging disinfection byproducts (DBPs) that effectively induce reactive oxygen species and oxidative damage in vitro. However, the impacts of HBQs on oxidative-stress-related gene expression have not been investigated. In this study, we examined alterations in the expression of 44 genes related to oxidative-stress-induced signaling pathways in human uroepithelial cells (SV-HUC-1) upon exposure to six HBQs. The results show the structure-dependent effects of HBQs on the studied gene expression. After 2 h of exposure, the expression levels of 9 to 28 genes were altered, while after 8 h of exposure, the expression levels of 29 to 31 genes were altered. Four genes ( HMOX1, NQO1, PTGS2, and TXNRD1) were significantly upregulated by all six HBQs at both exposure time points. Ingenuity pathway analysis revealed that the Nrf2 pathway was significantly responsive to HBQ exposure. Other canonical pathways responsive to HBQ exposure included GSH redox reductions, superoxide radical degradation, and xenobiotic metabolism signaling. This study has demonstrated that HBQs significantly alter the gene expression of oxidative-stress-related signaling pathways and contributes to the understanding of HBQ-DBP-associated toxicity.

Upregulated ATM gene expression and activated DNA crosslink-induced damage response checkpoint in Fanconi anemia: implications for carcinogenesis.

PubMed

Yamamoto, Kazuhiko; Nihrane, Abdallah; Aglipay, Jason; Sironi, Juan; Arkin, Steven; Lipton, Jeffrey M; Ouchi, Toru; Liu, Johnson M

2008-01-01

Fanconi anemia (FA) predisposes to hematopoietic failure, birth defects, leukemia, and squamous cell carcinoma of the head and neck (HNSCC) and cervix. The FA/BRCA pathway includes 8 members of a core complex and 5 downstream gene products closely linked with BRCA1 or BRCA2. Precancerous lesions are believed to trigger the DNA damage response (DDR), and we focused on the DDR in FA and its putative role as a checkpoint barrier to cancer. In primary fibroblasts with mutations in the core complex FANCA protein, we discovered that basal expression and phosphorylation of ATM (ataxia telangiectasia mutated) and p53 induced by irradiation (IR) or mitomycin C (MMC) were upregulated. This heightened response appeared to be due to increased basal levels of ATM in cultured FANCA-mutant cells, highlighting the new observation that ATM can be regulated at the transcriptional level in addition to its well-established activation by autophosphorylation. Functional analysis of this response using gamma-H2AX foci as markers of DNA double-stranded breaks (DSBs) demonstrated abnormal persistence of only MMC- and not IR-induced foci. Thus, we describe a processing defect that leads to general DDR upregulation but specific persistence of DNA crosslinker-induced damage response foci. Underscoring the significance of these findings, we found resistance to DNA crosslinker-induced cell cycle arrest and apoptosis in a TP53-mutant, patient-derived HNSCC cell line, whereas a lymphoblastoid cell line derived from this same individual was not mutated at TP53 and retained DNA crosslinker sensitivity. Our results suggest that cancer in FA may arise from selection for cells that escape from a chronically activated DDR checkpoint.

Identification of the Regulator Gene Responsible for the Acetone-Responsive Expression of the Binuclear Iron Monooxygenase Gene Cluster in Mycobacteria ▿

PubMed Central

Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki

2011-01-01

The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847

Clinical significance of In vivo Cytarabine Induced Gene Expression Signature in AML

PubMed Central

Lamba, Jatinder K.; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R.; Cogle, Christopher R.; Bhise, Neha; Raimondi, Susana C.; Downing, James R.; Baker, Sharyn D.; Ribeiro, Raul C.; Rubnitz, Jeffrey E.

2016-01-01

Despite initial remission, approximately 60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML, however extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy can trigger adaptive response by influencing leukemic cell transcriptome and hence development of resistance or refractory disease. It is however challenging to perform such a study due to lack of availability of specimens post-drug treatment. In this study our primary objective was to identify in vivo cytarabine induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. Our results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response. PMID:26366682

Soft mechanical stimulation induces a defense response against Botrytis cinerea in strawberry.

PubMed

Tomas-Grau, Rodrigo Hernán; Requena-Serra, Fernando José; Hael-Conrad, Verónica; Martínez-Zamora, Martín Gustavo; Guerrero-Molina, María Fernanda; Díaz-Ricci, Juan Carlos

2018-02-01

Genes associated with plant mechanical stimulation were found in strawberry genome. A soft mechanical stimulation (SMS) induces molecular and biochemical changes in strawberry plants, conferring protection against Botrytis cinerea. Plants have the capacity to induce a defense response after exposure to abiotic stresses acquiring resistance towards pathogens. It was reported that when leaves of Arabidopsis thaliana were wounded or treated with a soft mechanical stimulation (SMS), they could resist much better the attack of the fungal pathogen Botrytis cinerea, and this effect was accompanied by an oxidative burst and the expression of touch-inducible genes (TCH). However, no further work was carried out to better characterize the induced defense response. In this paper, we report that TCH genes were identified for first time in the genomes of the strawberry species Fragaria ananassa (e.g. FaTCH2, FaTCH3, FaTCH4 and FaCML39) and Fragaria vesca (e.g. FvTCH2, FvTCH3, FvTCH4 and FvCML39). Phylogenetic studies revealed that F. ananassa TCH genes exhibited high similarity with the orthologous of F. vesca and lower with A. thaliana ones. We also present evidence that after SMS treatment on strawberry leaves, plants activate a rapid oxidative burst, callose deposition, and the up-regulation of TCH genes as well as plant defense genes such as FaPR1, FaCHI2-2, FaCAT, FaACS1 and FaOGBG-5. The latter represents the first report showing that TCH- and defense-induced genes participate in SMS-induced resistance in plants, bringing a rational explanation why plants exposed to a SMS treatment acquired an enhance resistance toward B. cinerea.

Molecular Characterization of Hap Complex Components Responsible for Methanol-Inducible Gene Expression in the Methylotrophic Yeast Candida boidinii

PubMed Central

Oda, Saori; Yurimoto, Hiroya; Nitta, Nobuhisa; Sasano, Yu

2015-01-01

We identified genes encoding components of the Hap complex, CbHAP2, CbHAP3, and CbHAP5, as transcription factors regulating methanol-inducible gene expression in the methylotrophic yeast Candida boidinii. We found that the Cbhap2Δ, Cbhap3Δ, and Cbhap5Δ gene-disrupted strains showed severe growth defects on methanol but not on glucose and nonfermentable carbon sources such as ethanol and glycerol. In these disruptants, the transcriptional activities of methanol-inducible promoters were significantly decreased compared to those of the wild-type strain, indicating that CbHap2p, CbHap3p, and CbHap5p play indispensable roles in methanol-inducible gene expression. Further molecular and biochemical analyses demonstrated that CbHap2p, CbHap3p, and CbHap5p localized to the nucleus and bound to the promoter regions of methanol-inducible genes regardless of the carbon source, and heterotrimer formation was suggested to be necessary for binding to DNA. Unexpectedly, distinct from Saccharomyces cerevisiae, the Hap complex functioned in methanol-specific induction rather than glucose derepression in C. boidinii. Our results shed light on a novel function of the Hap complex in methanol-inducible gene expression in methylotrophic yeasts. PMID:25595445

Posttranscriptional regulation of adrenal TH gene expression contributes to the maladaptive responses triggered by insulin-induced recurrent hypoglycemia.

PubMed

Kudrick, Necla; Chan, Owen; La Gamma, Edmund F; Kim, Juhye Lena; Tank, Arnold William; Sterling, Carol; Nankova, Bistra B

2015-02-01

Acute metabolic stress such as insulin-induced hypoglycemia triggers a counterregulatory response during which the release of catecholamines (epinephrine), the activation of tyrosine hydroxylase (TH) enzyme and subsequent compensatory catecholamine biosynthesis occur in the adrenal medulla. However, recurrent exposure to hypoglycemia (RH), a consequence of tight glycemic control in individuals with type 1 and type 2 diabetes compromises this physiological response. The molecular mechanisms underlying the maladaptive response to repeated glucose deprivation are incompletely understood. We hypothesize that impaired epinephrine release following RH reflects altered regulation of adrenal catecholamine biosynthesis. To test this hypothesis, we compared the effect of single daily (RH) and twice-daily episodes of insulin-induced hypoglycemia (2RH) on adrenal epinephrine release and production in normal rats. Control animals received saline injections under similar conditions (RS and 2RS, respectively). Following 3 days of treatment, we assessed the counterregulatory hormonal responses during a hypoglycemic clamp. Changes in adrenal TH gene expression were also analyzed. The counterregulatory responses, relative TH transcription and TH mRNA levels and Ser40-TH phosphorylation (marker for enzyme activation) were induced to a similar extent in RS, 2RS, and RH groups. In contrast, epinephrine and glucagon responses were attenuated in the 2RH group and this was associated with a limited elevation of adrenal TH mRNA, rapid inactivation of TH enzyme and no significant changes in TH protein. Our results suggest that novel posttranscriptional mechanisms controlling TH mRNA and activated TH enzyme turnover contribute to the impaired epinephrine responses and may provide new therapeutic targets to prevent HAAF. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

PubMed

Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

2014-10-17

The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.

Timothy grass pollen extract-induced gene expression and signalling pathways in airway epithelial cells.

PubMed

Röschmann, K I L; Luiten, S; Jonker, M J; Breit, T M; Fokkens, W J; Petersen, A; van Drunen, C M

2011-06-01

Grass pollen allergy is one of the most common allergies worldwide and airborne allergens are the major cause of allergic rhinitis. Airway epithelial cells (AECs) are the first to encounter and respond to aeroallergens and are therefore interesting targets for the development of new therapeutics. Our understanding of the epithelial contribution to immune responses is limited as most studies focus on only a few individual genes or proteins. To describe in detail the Timothy grass pollen extract (GPE)-induced gene expression in AECs. NCI-H292 cells were exposed to GPE for 24 h, and isolated RNA and cell culture supernatants were used for microarray analysis and multiplex ELISA, respectively. Eleven thousand and seven hundred fifty-eight transcripts were affected after exposure to GPE, with 141 genes up-regulated and 121 genes down-regulated by more than threefold. The gene ontology group cell communication was among the most prominent categories. Network analysis revealed that a substantial part of regulated genes are related to the cytokines IL-6, IL-8, IL-1A, and the transcription factor FOS. After analysing significantly regulated signalling pathways, we found, among others, epidermal growth factor receptor 1, IL-1, Notch-, and Wnt-related signalling members. Unexpectedly, we found Jagged to be down-regulated and an increased release of IL-12, in line with a more Th1-biased response induced by GPE. Our data show that the stimulation of AECs with GPE results in the induction of a broad response on RNA and protein level by which they are able to affect the initiation and regulation of local immune responses. Detailed understanding of GPE-induced genes and signalling pathways will allow us to better define the pathogenesis of the allergic response and to identify new targets for treatment. © 2011 Blackwell Publishing Ltd.

Gene expression changes in female zebrafish (Danio rerio) brain in response to acute exposure to methylmercury

USGS Publications Warehouse

Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.

2011-01-01

Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of pgenes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.

Noradrenaline and alpha-adrenergic signaling induce the hsp70 gene promoter in mollusc immune cells.

PubMed

Lacoste, A; De Cian, M C; Cueff, A; Poulet, S A

2001-10-01

Expression of heat shock proteins (hsp) is a homeostatic mechanism induced in both prokaryotic and eukaryotic cells in response to metabolic and environmental insults. A growing body of evidence suggests that in mammals, the hsp response is integrated with physiological responses through neuroendocrine signaling. In the present study, we have examined the effect of noradrenaline (NA) on the hsp70 response in mollusc immune cells. Oyster and abalone hemocytes transfected with a gene construct containing a gastropod hsp70 gene promoter linked to the luciferase reporter-gene were exposed to physiological concentrations of NA, or to various alpha- and beta-adrenoceptor agonists and antagonists. Results show that NA and alpha-adrenergic stimulations induced the expression of luciferase in transfected mollusc immunocytes. Furthermore, exposure of hemocytes to NA or to the alpha-adrenoceptor agonist phenylephrine (PE) resulted in the expression of the inducible isoform of the hsp70 protein. Pertussis toxin (PTX), the phospholipase C (PLC) inhibitor U73122, the protein kinase C (PKC) inhibitor calphostin C, the Ca(2+)-dependent PKC inhibitor Gö 6976 and the phosphatidylinositol 3-kinase (PI 3-kinase) inhibitor LY294002 blocked the PE-mediated induction of the hsp70 gene promoter. These results suggest that alpha-adrenergic signaling induces the transcriptionnal upregulation of hsp70 in mollusc hemocytes through a PTX-sensitive G-protein, PLC, Ca(2+)-dependent PKC and PI 3-kinase. Thus, a functional link exists between neuroendocrine signaling and the hsp70 response in mollusc immune cells.

Identification of an attenuated barley stripe mosaic virus for the virus-induced gene silencing of pathogenesis-related wheat genes.

PubMed

Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C

2016-01-01

Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the

Silver nanoparticles induce endoplasmatic reticulum stress response in zebrafish

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christen, Verena; Capelle, Martinus; Fent, Karl, E-mail: karl.fent@fhnw.ch

2013-10-15

Silver nanoparticles (AgNPs) find increasing applications, and therefore humans and the environment are increasingly exposed to them. However, potential toxicological implications are not sufficiently known. Here we investigate effects of AgNPs (average size 120 nm) on zebrafish in vitro and in vivo, and compare them to human hepatoma cells (Huh7). AgNPs are incorporated in zebrafish liver cells (ZFL) and Huh7, and in zebrafish embryos. In ZFL cells AgNPs lead to induction of reactive oxygen species (ROS), endoplasmatic reticulum (ER) stress response, and TNF-α. Transcriptional alterations also occur in pro-apoptotic genes p53 and Bax. The transcriptional profile differed in ZFL andmore » Huh7 cells. In ZFL cells, the ER stress marker BiP is induced, concomitant with the ER stress marker ATF-6 and spliced XBP-1 after 6 h and 24 h exposure to 0.5 g/L and 0.05 g/L AgNPs, respectively. This indicates the induction of different pathways of the ER stress response. Moreover, AgNPs induce TNF-α. In zebrafish embryos exposed to 0.01, 0.1, 1 and 5 mg/L AgNPs hatching was affected and morphological defects occurred at high concentrations. ER stress related gene transcripts BiP and Synv are significantly up-regulated after 24 h at 0.1 and 5 mg/L AgNPs. Furthermore, transcriptional alterations occurred in the pro-apoptotic genes Noxa and p21. The ER stress response was strong in ZFL cells and occurred in zebrafish embryos as well. Our data demonstrate for the first time that AgNPs lead to induction of ER stress in zebrafish. The induction of ER stress can have several consequences including the activation of apoptotic and inflammatory pathways. - Highlights: • Effects of silver nanoparticles (120 nm AgNPs) are investigated in zebrafish. • AgNPs induce all ER stress reponses in vitro in zebrafish liver cells. • AgNPs induce weak ER stress in zebrafish embryos. • AgNPs induce oxidative stress and transcripts of pro-apoptosis genes.« less

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements.

PubMed

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-07-21

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress.

Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.

PubMed

Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L

2017-08-01

Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora.

PubMed

Norman-Setterblad, C; Vidal, S; Palva, E T

2000-04-01

We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.

UVB-induced gene expression in the skin of Xiphophorus maculatus Jp 163 B☆

PubMed Central

Yang, Kuan; Boswell, Mikki; Walter, Dylan J.; Downs, Kevin P.; Gaston-Pravia, Kimberly; Garcia, Tzintzuni; Shen, Yingjia; Mitchell, David L.; Walter, Ronald B.

2014-01-01

Xiphophorus fish and interspecies hybrids represent long-standing models to study the genetics underlying spontaneous and induced tumorigenesis. The recent release of the Xiphophorus maculatus genome sequence will allow global genetic regulation studies of genes involved in the inherited susceptibility to UVB-induced melanoma within select backcross hybrids. As a first step toward this goal, we report results of an RNA-Seq approach to identify genes and pathways showing modulated transcription within the skin of X. maculatus Jp 163 B upon UVB exposure. X. maculatus Jp 163 B were exposed to various doses of UVB followed by RNA-Seq analysis at each dose to investigate overall gene expression in each sample. A total of 357 genes with a minimum expression change of 4-fold (p-adj < 0.05) were identified as responsive to UVB. The molecular genetic response of Xiphophorus skin to UVB exposure permitted assessment of; (1) the basal expression level of each transcript for each skin sample, (2) the changes in expression levels for each gene in the transcriptome upon exposure to increasing doses of UVB, and (3) clusters of genes that exhibit similar patterns of change in expression upon UVB exposure. These data provide a foundation for understanding the molecular genetic response of fish skin to UVB exposure. PMID:24556253

Functional characterization of blue-light-induced responses and PHOTOTROPIN 1 gene in Welwitschia mirabilis.

PubMed

Ishishita, Kazuhiro; Suetsugu, Noriyuki; Hirose, Yuki; Higa, Takeshi; Doi, Michio; Wada, Masamitsu; Matsushita, Tomonao; Gotoh, Eiji

2016-03-01

The blue light (BL) receptor phototropin (phot) is specifically found in green plants; it regulates various BL-induced responses such as phototropism, chloroplast movement, stomatal opening, and leaf flattening. In Arabidopsis thaliana, two phototropins--phot1 and phot2--respond to blue light in overlapping but distinct ways. These BL-receptor-mediated responses enhance the photosynthetic activity of plants under weak light and minimize photodamage under strong light conditions. Welwitschia mirabilis Hook.f. found in the Namib Desert, and it has adapted to severe environmental stresses such as limiting water and strong sunlight. Although the plant has physiologically and ecologically unique features, it is unknown whether phototropin is functional in this plant. In this study, we assessed the functioning of phot-mediated BL responses in W. mirabilis. BL-dependent phototropism and stomatal opening was observed but light-dependent chloroplast movement was not detected. We performed a functional analysis of the PHOT1 gene of W. mirabilis, WmPHOT1, in Arabidopsis thaliana. We generated transgenic A. thaliana lines expressing WmPHOT1 in a phot1 phot2 double mutant background. Several Wmphot1 transgenic plants showed normal growth, although phot1 phot2 double mutant plants showed stunted growth. Furthermore, Wmphot1 transgenic plants showed normal phot1-mediated responses including phototropism, chloroplast accumulation, stomatal opening, and leaf flattening, but lacked the chloroplast avoidance response that is specifically mediated by phot2. Thus, our findings indicate that W. mirabilis possesses typical phot-mediated BL responses that were at least partially mediated by functional phototropin 1, an ortholog of Atphot1.

Induction of Senescence and Identification of Differentially Expressed Genes in Tomato in Response to Monoterpene

PubMed Central

Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis

2013-01-01

Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759

The Arabidopsis polyamine transporter LHR1/PUT3 modulates heat responsive gene expression by enhancing mRNA stability.

PubMed

Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong

2016-12-01

Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

Post-transcriptional inducible gene regulation by natural antisense RNA.

PubMed

Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori

2015-01-01

Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.

GAS6 is an estrogen-inducible gene in mammary epithelial cells

PubMed Central

Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun

2007-01-01

To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 mediates environmental stress responses in plants.

PubMed

Hong, Jeum Kyu; Hwang, Byung Kook

2009-01-01

The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.

Transcriptional Profiling of Sorghum Induced by Methyl Jasmonate, Salicylic Acid, and Aminocyclopropane Carboxylic Acid Reveals Cooperative Regulation and Novel Gene Responses1[w

PubMed Central

Salzman, Ron A.; Brady, Jeff A.; Finlayson, Scott A.; Buchanan, Christina D.; Summer, Elizabeth J.; Sun, Feng; Klein, Patricia E.; Klein, Robert R.; Pratt, Lee H.; Cordonnier-Pratt, Marie-Michèle; Mullet, John E.

2005-01-01

We have conducted a large-scale study of gene expression in the C4 monocot sorghum (Sorghum bicolor) L. Moench cv BTx623 in response to the signaling compounds salicylic acid (SA), methyl jasmonate (MeJA), and the ethylene precursor aminocyclopropane carboxylic acid. Expression profiles were generated from seedling root and shoot tissue at 3 and 27 h, using a microarray containing 12,982 nonredundant elements. Data from 102 slides and quantitative reverse transcription-PCR data on mRNA abundance from 171 genes were collected and analyzed and are here made publicly available. Numerous gene clusters were identified in which expression was correlated with particular signaling compound and tissue combinations. Many genes previously implicated in defense responded to the treatments, including numerous pathogenesis-related genes and most members of the phenylpropanoid pathway, and several other genes that may represent novel activities or pathways. Genes of the octadecanoic acid pathway of jasmonic acid (JA) synthesis were induced by SA as well as by MeJA. The resulting hypothesis that increased SA could lead to increased endogenous JA production was confirmed by measurement of JA content. Comparison of responses to SA, MeJA, and combined SA+MeJA revealed patterns of one-way and mutual antagonisms, as well as synergistic effects on regulation of some genes. These experiments thus help further define the transcriptional results of cross talk between the SA and JA pathways and suggest that a subset of genes coregulated by SA and JA may comprise a uniquely evolved sector of plant signaling responsive cascades. PMID:15863699

ML3: a novel regulator of herbivory-induced responses in Arabidopsis thaliana

PubMed Central

Bejai, Sarosh

2013-01-01

ML (MD2-related lipid recognition) proteins are known to enhance innate immune responses in mammals. This study reports the analysis of the putative ML gene family in Arabidopsis thaliana and suggests a role for the ML3 gene in herbivory-associated responses in plants. Feeding by larvae of the Lepidopteran generalist herbivore Spodoptera littoralis and larvae of the specialist herbivore Plutella xylostella activated ML3 transcription in leaf tissues. ML3 loss-of-function Arabidopsis plants were compromised in the upregulation of herbivory-induced genes and displayed a semi-dwarf phenotype. Herbivory bioassays showed that larvae of S. littoralis fed on ml3 mutant plants gained more weight compared to larvae fed on wild-type plants while larvae of P. xylostella did not show any significant difference. Virus-induced gene silencing of ML3 expression in plants compromised in jasmonic acid (JA) and salicylic acid (SA) signalling revealed a complex role of ML3 in JA/defence signalling affecting both JA- and SA-dependent responses. The data suggest that ML3 is involved in herbivory-mediated responses in Arabidopsis and that it has a potential role in herbivory-associated molecular pattern recognition. PMID:23314818

Transcriptional analysis of different stress response genes in Escherichia coli strains subjected to sodium chloride and lactic acid stress.

PubMed

Peng, Silvio; Stephan, Roger; Hummerjohann, Jörg; Tasara, Taurai

2014-12-01

Survival of Escherichia coli in food depends on its ability to adapt against encountered stress typically involving induction of stress response genes. In this study, the transcriptional induction of selected acid (cadA, speF) and salt (kdpA, proP, proW, otsA, betA) stress response genes was investigated among five E. coli strains, including three Shiga toxin-producing strains, exposed to sodium chloride or lactic acid stress. Transcriptional induction upon lactic acid stress exposure was similar in all but one E. coli strain, which lacked the lysine decarboxylase gene cadA. In response to sodium chloride stress exposure, proW and otsA were similarly induced, while significant differences were observed between the E. coli strains in induction of kdpA, proP and betA. The kdpA and betA genes were significantly induced in four and three strains, respectively, whereas one strain did not induce these genes. The proP gene was only induced in two E. coli strains. Interestingly, transcriptional induction differences in response to sodium chloride stress exposure were associated with survival phenotypes observed for the E. coli strains in cheese as the E. coli strain lacking significant induction in three salt stress response genes investigated also survived poorly compared to the other E. coli strains in cheese. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Role of Adrenal Glucocorticoid Signaling in Prefrontal Cortex Gene Expression and Acute Behavioral Responses to Ethanol

PubMed Central

Costin, Blair N.; Wolen, Aaron R.; Fitting, Sylvia; Shelton, Keith L.; Miles, Michael F.

2012-01-01

Background Glucocorticoid hormones modulate acute and chronic behavioral and molecular responses to drugs of abuse including psychostimulants and opioids. There is growing evidence that glucocorticoids might also modulate behavioral responses to ethanol. Acute ethanol activates the HPA axis, causing release of adrenal glucocorticoid hormones. Our prior genomic studies suggest glucocorticoids play a role in regulating gene expression in the prefrontal cortex (PFC) of DBA2/J (D2) mice following acute ethanol administration. However, few studies have analyzed the role of glucocorticoid signaling in behavioral responses to acute ethanol. Such work could be significant, given the predictive value for level of response to acute ethanol in the risk for alcoholism. Methods We studied whether the glucocorticoid receptor (GR) antagonist, RU-486, or adrenalectomy (ADX) altered male D2 mouse behavioral responses to acute (locomotor activation, anxiolysis or loss-of-righting reflex (LORR)) or repeated (sensitization) ethanol treatment. Whole genome microarray analysis and bioinformatics approaches were used to identify PFC candidate genes possibly responsible for altered behavioral responses to ethanol following ADX. Results ADX and RU-486 both impaired acute ethanol (2 g/kg) induced locomotor activation in D2 mice without affecting basal locomotor activity. However, neither ADX nor RU-486 altered initiation of ethanol sensitization (locomotor activation or jump counts), ethanol-induced anxiolysis or LORR. ADX mice showed microarray gene expression changes in PFC that significantly overlapped with acute ethanol-responsive gene sets derived by our prior microarray studies. Q-rtPCR analysis verified that ADX decreased PFC expression of Fkbp5 while significantly increasing Gpr6 expression. In addition, high dose RU-486 pre-treatment blunted ethanol-induced Fkbp5 expression. Conclusions Our studies suggest that ethanol’s activation of adrenal glucocorticoid release and subsequent

The characterization of six auxin-induced tomato GH3 genes uncovers a member, SlGH3.4, strongly responsive to arbuscular mycorrhizal symbiosis.

PubMed

Liao, Dehua; Chen, Xiao; Chen, Aiqun; Wang, Huimin; Liu, Jianjian; Liu, Junli; Gu, Mian; Sun, Shubin; Xu, Guohua

2015-04-01

In plants, the GH3 gene family is widely considered to be involved in a broad range of plant physiological processes, through modulation of hormonal homeostasis. Multiple GH3 genes have been functionally characterized in several plant species; however, to date, limited works to study the GH3 genes in tomato have been reported. Here, we characterize the expression and regulatory profiles of six tomato GH3 genes, SlGH3.2, SlGH3.3, SlGH3.4, SlGH3.7, SlGH3.9 and SlGH3.15, in response to different phytohormone applications and arbuscular mycorrhizal (AM) fungal colonization. All six GH3 genes showed inducible responses to external IAA, and three members were significantly up-regulated in response to AM symbiosis. In particular, SlGH3.4, the transcripts of which were barely detectable under normal growth conditions, was strongly activated in the IAA-treated and AM fungal-colonized roots. A comparison of the SlGH3.4 expression in wild-type plants and M161, a mutant with a defect in AM symbiosis, confirmed that SlGH3.4 expression is highly correlated to mycorrhizal colonization. Histochemical staining demonstrated that a 2,258 bp SlGH3.4 promoter fragment could drive β-glucuronidase (GUS) expression strongly in root tips, steles and cortical cells of IAA-treated roots, but predominantly in the fungal-colonized cells of mycorrhizal roots. A truncated 654 bp promoter failed to direct GUS expression in IAA-treated roots, but maintained the symbiosis-induced activity in mycorrhizal roots. In summary, our results suggest that a mycorrhizal signaling pathway that is at least partially independent of the auxin signaling pathway has evolved for the co-regulation of the auxin- and mycorrhiza-activated GH3 genes in plants. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Transcriptome analysis reveals key roles of AtLBR-2 in LPS-induced defense responses in plants.

PubMed

Iizasa, Sayaka; Iizasa, Ei'ichi; Watanabe, Keiichi; Nagano, Yukio

2017-12-29

Lipopolysaccharide (LPS) from Gram-negative bacteria cause innate immune responses in animals and plants. The molecules involved in LPS signaling in animals are well studied, whereas those in plants are not yet as well documented. Recently, we identified Arabidopsis AtLBR-2, which binds to LPS from Pseudomonas aeruginosa (pLPS) directly and regulates pLPS-induced defense responses, such as pathogenesis-related 1 (PR1) expression and reactive oxygen species (ROS) production. In this study, we investigated the pLPS-induced transcriptomic changes in wild-type (WT) and the atlbr-2 mutant Arabidopsis plants using RNA-Seq technology. RNA-Seq data analysis revealed that pLPS treatment significantly altered the expression of 2139 genes, with 605 up-regulated and 1534 down-regulated genes in WT. Gene ontology (GO) analysis on these genes showed that GO terms, "response to bacterium", "response to salicylic acid (SA) stimulus", and "response to abscisic acid (ABA) stimulus" were enriched amongst only in up-regulated genes, as compared to the genes that were down-regulated. Comparative analysis of differentially expressed genes between WT and the atlbr-2 mutant revealed that 65 genes were up-regulated in WT but not in the atlbr-2 after pLPS treatment. Furthermore, GO analysis on these 65 genes demonstrated their importance for the enrichment of several defense-related GO terms, including "response to bacterium", "response to SA stimulus", and "response to ABA stimulus". We also found reduced levels of pLPS-induced conjugated SA glucoside (SAG) accumulation in atlbr-2 mutants, and no differences were observed in the gene expression levels in SA-treated WT and the atlbr-2 mutants. These 65 AtLBR-2-dependent up-regulated genes appear to be important for the enrichment of some defense-related GO terms. Moreover, AtLBR-2 might be a key molecule that is indispensable for the up-regulation of defense-related genes and for SA signaling pathway, which is involved in defense against

Transcriptome Analysis Reveals Genes Commonly Induced by Botrytis cinerea Infection, Cold, Drought and Oxidative Stresses in Arabidopsis

PubMed Central

Al-Ameri, Salma; Al-Mahmoud, Bassam; Awwad, Falah; Al-Rawashdeh, Ahmed; Iratni, Rabah; AbuQamar, Synan

2014-01-01

Signaling pathways controlling biotic and abiotic stress responses may interact synergistically or antagonistically. To identify the similarities and differences among responses to diverse stresses, we analyzed previously published microarray data on the transcriptomic responses of Arabidopsis to infection with Botrytis cinerea (a biotic stress), and to cold, drought, and oxidative stresses (abiotic stresses). Our analyses showed that at early stages after B. cinerea inoculation, 1498 genes were up-regulated (B. cinerea up-regulated genes; BUGs) and 1138 genes were down-regulated (B. cinerea down-regulated genes; BDGs). We showed a unique program of gene expression was activated in response each biotic and abiotic stress, but that some genes were similarly induced or repressed by all of the tested stresses. Of the identified BUGs, 25%, 6% and 12% were also induced by cold, drought and oxidative stress, respectively; whereas 33%, 7% and 5.5% of the BDGs were also down-regulated by the same abiotic stresses. Coexpression and protein-protein interaction network analyses revealed a dynamic range in the expression levels of genes encoding regulatory proteins. Analysis of gene expression in response to electrophilic oxylipins suggested that these compounds are involved in mediating responses to B. cinerea infection and abiotic stress through TGA transcription factors. Our results suggest an overlap among genes involved in the responses to biotic and abiotic stresses in Arabidopsis. Changes in the transcript levels of genes encoding components of the cyclopentenone signaling pathway in response to biotic and abiotic stresses suggest that the oxylipin signal transduction pathway plays a role in plant defense. Identifying genes that are commonly expressed in response to environmental stresses, and further analyzing the functions of their encoded products, will increase our understanding of the plant stress response. This information could identify targets for genetic

Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

PubMed Central

Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

2015-01-01

Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.

PubMed

Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W

2006-02-01

A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.

Genotoxic chemical carcinogens target inducible genes in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamilton, J.W.; McCaffrey, J.; Caron, R.M.

1994-12-31

Our laboratory is interested in whether carcinogen-induced DNA damage is distributed nonrandomly in the genome - that is, {open_quotes}targeted{close_quotes} to specific genes or gene regions in vivo. As an indirect measure of whether targeting occurs at the gene level, we have examined whether carcinogens differentially alter the expression of individual genes. We have compared the effects of model genotoxic carcinogens that principally induce either strand breaks, simple alkylations, bulky lesions, or DNA cross-links on the expression of several constitutive and inducible genes in a simple in vivo system, the chick embryo. Each agent was examined for its effects on genemore » expression over a 24 hour period corresponding to the period of maximal DNA damage and repair induced by each compound. The doses used in these studies represented the maximum doses that caused no overt toxicity over a 96 hour period but that induced significant levels of DNA damage. Our results demonstrate that inducible genes are targeted by chemical carcinogens. We hypothesize that such effects may be a result of DNA damage specifically altering DNA-protein interactions within the promoters of inducible genes.« less

Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

PubMed

Wolter, R; Siede, W; Brendel, M

1996-02-05

The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

Radiation induced pulmonary fibrosis as a model of progressive fibrosis: Contributions of DNA damage, inflammatory response and cellular senescence genes.

PubMed

Beach, Tyler A; Johnston, Carl J; Groves, Angela M; Williams, Jacqueline P; Finkelstein, Jacob N

2017-04-01

Purpose/Aim of Study: Studies of pulmonary fibrosis (PF) have resulted in DNA damage, inflammatory response, and cellular senescence being widely hypothesized to play a role in the progression of the disease. Utilizing these aforementioned terms, genomics databases were interrogated along with the term, "pulmonary fibrosis," to identify genes common among all 4 search terms. Findings were compared to data derived from a model of radiation-induced progressive pulmonary fibrosis (RIPF) to verify that these genes are similarly expressed, supporting the use of radiation as a model for diseases involving PF, such as human idiopathic pulmonary fibrosis (IPF). In an established model of RIPF, C57BL/6J mice were exposed to 12.5 Gy thorax irradiation and sacrificed at 24 hours, 1, 4, 12, and 32 weeks following exposure, and lung tissue was compared to age-matched controls by RNA sequencing. Of 176 PF associated gene transcripts identified by database interrogation, 146 (>82%) were present in our experimental model, throughout the progression of RIPF. Analysis revealed that nearly 85% of PF gene transcripts were associated with at least 1 other search term. Furthermore, of 22 genes common to all four terms, 16 were present experimentally in RIPF. This illustrates the validity of RIPF as a model of progressive PF/IPF based on the numbers of transcripts reported in both literature and observed experimentally. Well characterized genes and proteins are implicated in this model, supporting the hypotheses that DNA damage, inflammatory response and cellular senescence are associated with the pathogenesis of PF.

Transposable elements contribute to activation of maize genes in response to abiotic stress.

PubMed

Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

2015-01-01

Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Requirement for STAT1 in LPS-induced gene expression in macrophages.

PubMed

Ohmori, Y; Hamilton, T A

2001-04-01

This study examines the role of the signal transducer and activator of transcription 1 (STAT1) in induction of lipopolysaccharide (LPS)-stimulated gene expression both in vitro and in vivo. LPS-induced expression of an interferon (IFN)-inducible 10-kDa protein (IP-10), IFN regulatory factor-1 (IRF-1), and inducible nitric oxide synthase (iNOS) mRNAs was severely impaired in macrophages prepared from Stat1-/- mice, whereas levels of tumor necrosis factor alpha and KC (a C-X-C chemokine) mRNA in LPS-treated cell cultures were unaffected. A similar deficiency in LPS-induced gene expression was observed in livers and spleens from Stat1-/- mice. The reduced LPS-stimulated gene expression seen in Stat1-/- macrophages was not the result of reduced activation of nuclear factor kappaB. LPS stimulated the delayed activation of both IFN-stimulated response element and IFN-gamma-activated sequence binding activity in macrophages from wild-type mice. Activation of these STAT1-containing transcription factors was mediated by the intermediate induction of type I IFNs, since the LPS-induced IP-10, IRF-1, and iNOS mRNA expression was markedly reduced in macrophages from IFN-alpha/betaR-/- mice and blocked by cotreatment with antibodies against type I IFN. These results indicate that indirect activation of STAT1 by LPS-induced type I IFN participates in promoting optimal expression of LPS-inducible genes, and they suggest that STAT1 may play a critical role in innate immunity against gram-negative bacterial infection.

Neonicotinoid insecticides induce salicylate-associated plant defense responses

PubMed Central

Ford, Kevin A.; Casida, John E.; Chandran, Divya; Gulevich, Alexander G.; Okrent, Rachel A.; Durkin, Kathleen A.; Sarpong, Richmond; Bunnelle, Eric M.; Wildermuth, Mary C.

2010-01-01

Neonicotinoid insecticides control crop pests based on their action as agonists at the insect nicotinic acetylcholine receptor, which accepts chloropyridinyl- and chlorothiazolyl-analogs almost equally well. In some cases, these compounds have also been reported to enhance plant vigor and (a)biotic stress tolerance, independent of their insecticidal function. However, this mode of action has not been defined. Using Arabidopsis thaliana, we show that the neonicotinoid compounds, imidacloprid (IMI) and clothianidin (CLO), via their 6-chloropyridinyl-3-carboxylic acid and 2-chlorothiazolyl-5-carboxylic acid metabolites, respectively, induce salicylic acid (SA)-associated plant responses. SA is a phytohormone best known for its role in plant defense against pathogens and as an inducer of systemic acquired resistance; however, it can also modulate abiotic stress responses. These neonicotinoids effect a similar global transcriptional response to that of SA, including genes involved in (a)biotic stress response. Furthermore, similar to SA, IMI and CLO induce systemic acquired resistance, resulting in reduced growth of a powdery mildew pathogen. The action of CLO induces the endogenous synthesis of SA via the SA biosynthetic enzyme ICS1, with ICS1 required for CLO-induced accumulation of SA, expression of the SA marker PR1, and fully enhanced resistance to powdery mildew. In contrast, the action of IMI does not induce endogenous synthesis of SA. Instead, IMI is further bioactivated to 6-chloro-2-hydroxypyridinyl-3-carboxylic acid, which is shown here to be a potent inducer of PR1 and inhibitor of SA-sensitive enzymes. Thus, via different mechanisms, these chloropyridinyl- and chlorothiazolyl-neonicotinoids induce SA responses associated with enhanced stress tolerance. PMID:20876120

Critical roles of DNA demethylation in the activation of ripening-induced genes and inhibition of ripening-repressed genes in tomato fruit

PubMed Central

Lang, Zhaobo; Wang, Yihai; Tang, Kai; Tang, Dengguo; Datsenka, Tatsiana; Cheng, Jingfei; Zhang, Yijing; Handa, Avtar K.

2017-01-01

DNA methylation is a conserved epigenetic mark important for genome integrity, development, and environmental responses in plants and mammals. Active DNA demethylation in plants is initiated by a family of 5-mC DNA glycosylases/lyases (i.e., DNA demethylases). Recent reports suggested a role of active DNA demethylation in fruit ripening in tomato. In this study, we generated loss-of-function mutant alleles of a tomato gene, SlDML2, which is a close homolog of the Arabidopsis DNA demethylase gene ROS1. In the fruits of the tomato mutants, increased DNA methylation was found in thousands of genes. These genes included not only hundreds of ripening-induced genes but also many ripening-repressed genes. Our results show that SlDML2 is critical for tomato fruit ripening and suggest that active DNA demethylation is required for both the activation of ripening-induced genes and the inhibition of ripening-repressed genes. PMID:28507144

Gene Profiles in a Smoke-Induced COPD Mouse Lung Model Following Treatment with Mesenchymal Stem Cells.

PubMed

Kim, You-Sun; Kokturk, Nurdan; Kim, Ji-Young; Lee, Sei Won; Lim, Jaeyun; Choi, Soo Jin; Oh, Wonil; Oh, Yeon-Mok

2016-10-01

Mesenchymal stem cells (MSCs) effectively reduce airway inflammation and regenerate the alveolus in cigarette- and elastase-induced chronic obstructive pulmonary disease (COPD) animal models. The effects of stem cells are thought to be paracrine and immune-modulatory because very few stem cells remain in the lung one day after their systemic injection, which has been demonstrated previously. In this report, we analyzed the gene expression profiles to compare mouse lungs with chronic exposure to cigarette smoke with non-exposed lungs. Gene expression profiling was also conducted in a mouse lung tissue with chronic exposure to cigarette smoke following the systemic injection of human cord blood-derived mesenchymal stem cells (hCB-MSCs). Globally, 834 genes were differentially expressed after systemic injection of hCB-MSCs. Seven and 21 genes, respectively, were up-and downregulated on days 1, 4, and 14 after HCB-MSC injection. The Hbb and Hba, genes with oxygen transport and antioxidant functions, were increased on days 1 and 14. A serine protease inhibitor was also increased at a similar time point after injection of hCB-MSCs. Gene Ontology analysis indicated that the levels of genes related to immune responses, metabolic processes, and blood vessel development were altered, indicating host responses after hCB-MSC injection. These gene expression changes suggest that MSCs induce a regeneration mechanism against COPD induced by cigarette smoke. These analyses provide basic data for understanding the regeneration mechanisms promoted by hCB-MSCs in cigarette smoke-induced COPD.

Mechanisms of radiation-induced gene responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woloschak, G.E.; Paunesku, T.

1996-10-01

In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less

[Regulation of heat shock gene expression in response to stress].

PubMed

Garbuz, D G

2017-01-01

Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS

Interleukin-10-induced gene expression and suppressive function are selectively modulated by the PI3K-Akt-GSK3 pathway

PubMed Central

Antoniv, Taras T; Ivashkiv, Lionel B

2011-01-01

Interleukin-10 (IL-10) is an immunosuppressive cytokine that inhibits inflammatory gene expression. Phosphatidylinositol 3-kinase (PI3K) -mediated signalling regulates inflammatory responses and can induce IL-10 production, but a role for PI3K signalling in cellular responses to IL-10 is not known. In this study we investigated the involvement of the PI3K-Akt-GSK3 signalling pathway in IL-10-induced gene expression and IL-10-mediated suppression of Toll-like receptor-induced gene expression in primary human macrophages. A combination of loss and gain of function approaches using kinase inhibitors, expression of constitutively active Akt, and RNA interference in primary human macrophages showed that expression of a subset of IL-10-inducible genes was dependent on PI3K-Akt signalling. The effects of PI3K-Akt signalling on IL-10 responses were mediated at least in part by glycogen synthase kinase 3 (GSK3). In accordance with a functional role for PI3K pathways in contributing to the suppressive actions of IL-10, PI3K signalling augmented IL-10-mediated inhibition of lipopolysaccharide-induced IL-1, IL-8 and cyclo-oxygenase-2 expression. The PI3K signalling selectively modulated IL-10 responses, as it was not required for inhibition of tumour necrosis factor expression or for induction of certain IL-10-inducible genes such as SOCS3. These findings identify a new mechanism by which PI3K-mediated signalling can suppress inflammation by regulating IL-10-mediated gene induction and anti-inflammatory function. PMID:21255011

Differential effects of multiplicity of infection on Helicobacter pylori-induced signaling pathways and interleukin-8 gene transcription.

PubMed

Ritter, Birgit; Kilian, Petra; Reboll, Marc Rene; Resch, Klaus; DiStefano, Johanna Kay; Frank, Ronald; Beil, Winfried; Nourbakhsh, Mahtab

2011-02-01

Interleukin-8 (IL-8) plays a central role in the pathogenesis of Helicobacter pylori infection. We used four different H. pylori strains isolated from patients with gastritis or duodenal ulcer disease to examine their differential effects on signaling pathways and IL-8 gene response in gastric epithelial cells. IL-8 mRNA level is elevated in response to high (100) multiplicity of infection (MOI) independent of cagA, vacA, and dupA gene characteristics. By lower MOIs (1 or 10), only cagA ( + ) strains significantly induce IL-8 gene expression. This is based on differential regulation of IL-8 promoter activity. Analysis of intracellular signaling pathways indicates that H. pylori clinical isolates induce IL-8 gene transcription through NF-κB p65, but by a MOI-dependent differential activation of MAPK pathways. Thus, the major virulence factors of H. pylori CagA, VacA, and DupA might play a minor role in the level of IL-8 gene response to a high bacterial load.

Enhancement of immune response induced by DNA vaccine cocktail expressing complete LACK and TSA genes against Leishmania major.

PubMed

Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei

2013-04-01

Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p < 0.05) following the immunization and after challenging with Leishmania major. Interleukin 4 values were decreased in all immunized groups, but only in DNA vaccine cocktail and single-gene vaccination with pc-LACK there were statistical differences with control groups (p > 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.

Persisting mild hypothermia suppresses hypoxia-inducible factor-1alpha protein synthesis and hypoxia-inducible factor-1-mediated gene expression.

PubMed

Tanaka, Tomoharu; Wakamatsu, Takuhiko; Daijo, Hiroki; Oda, Seiko; Kai, Shinichi; Adachi, Takehiko; Kizaka-Kondoh, Shinae; Fukuda, Kazuhiko; Hirota, Kiichi

2010-03-01

The transcription factor hypoxia-inducible factor-1 (HIF-1) plays an essential role in regulating gene expression in response to hypoxia-ischemia. Ischemia causes the tissue not only to be hypoxic but also to be hypothermic because of the hypoperfusion under certain circumstances. On the other hand, the induced hypothermia is one of the most common therapeutic modalities to extend tolerance to hypoxia. Although hypoxia elicits a variety of cellular and systemic responses at different organizational levels in the body, little is known about how hypoxia-induced responses are affected by low temperature. We examined the influence of mild hypothermic conditions (28-32 degrees C) on HIF-1 in both in vitro and in vivo settings. In vitro experiments adopting cultured cells elucidated that hypoxia-induced HIF-1 activation was resistant to 4-h exposure to the low temperature. In contrast, exposure to the low temperature as long as 24 h suppressed HIF-1 activation and the subsequent upregulation of HIF-1 target genes such as VEGF or GLUT-1. HIF-1alpha protein stability in the cell was not affected by hypothermic treatment. Furthermore, intracellular ATP content was reduced under 1% O(2) conditions but was not largely affected by hypothermic treatment. The evidence indicates that reduction of oxygen consumption is not largely involved in suppression of HIF-1. In addition, we demonstrated that HIF-1 DNA-binding activity and HIF-1-dependent gene expressions induced under 10% O(2) atmosphere in mouse brain were not influenced by treatment under 3-h hypothermic temperature but were inhibited under 5-h treatment. On the other hand, we indicated that warming ischemic legs of mice for 24 h preserved HIF-1 activity. In this report we describe for the first time that persisting low temperature significantly reduced HIF-1alpha neosynthesis under hypoxic conditions, leading to a decrease in gene expression for adaptation to hypoxia in both in vitro and in vivo settings.

Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

PubMed

Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

2017-03-01

Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

SGK is a primary glucocorticoid-induced gene in the human.

PubMed

Náray-Fejes-Tóth, A; Fejes-Tóth, G; Volk, K A; Stokes, J B

2000-12-01

Serum- and glucocorticoid-induced kinase (sgk) is transcriptionally regulated by corticosteroids in several cell types. Recent findings suggest that sgk is an important gene in the early action of corticosteroids on epithelial sodium reabsorption. Surprisingly, the human sgk was reported not to be transcriptionally regulated by corticosteroids in a hepatoma cell line, and thus far no glucocorticoid response element has been identified in the human SGK gene. Since humans clearly respond to both aldosterone and glucocorticoids in cells where sgk action seems to be important, in this study we determined sgk mRNA levels following dexamethasone treatment for various duration in five human cell lines. These cell lines included epithelial cells (H441, T84 and HT29) and lymphoid/monocyte (U937 and THP-1) lines. Using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we found that sgk mRNA levels are markedly induced by glucocorticoids in all of the five cell lines studied. Time course analyses revealed that sgk mRNA levels are elevated as early as 30 min after addition of the glucocorticoid, and remain elevated for several hours. Northern analysis in H441 cells confirmed that sgk is an early induced gene. The induction of sgk by dexamethasone was unaffected by cycloheximide, indicating that it does not require de novo protein synthesis. These results indicate that the human sgk, just like its counterparts in other species, is a primary glucocorticoid-induced gene.

Hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation system for cancer gene therapy

PubMed Central

Javan, Bita; Shahbazi, Majid

2017-01-01

Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809

The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

PubMed

Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

Transduction of a Foreign Histocompatibility Gene into the Arterial Wall Induces Vasculitis

NASA Astrophysics Data System (ADS)

Nabel, Elizabeth G.; Plautz, Gregory; Nabel, Gary J.

1992-06-01

Autoimmune vasculitis represents a disease characterized by focal inflammation within arteries at multiple sites in the vasculature. Therapeutic interventions in this disease are empirical and often unsuccessful, and the mechanisms of immune injury are not well-defined. The direct transfer of recombinant genes and their expression in the arterial wall provides an opportunity to explore the pathogenesis and treatment of vascular disease. In this report, an animal model for vasculitis has been developed. Inflammation has been elicited by direct gene transfer of a foreign class I major histocompatibility complex gene, HLA-B7, to specific sites in porcine arteries. Transfer and expression of this recombinant gene was confirmed by a polymerase chain reaction and immunohistochemistry, and cytolytic T cells specific for HLA-B7 were detected. These findings demonstrate that expression of a recombinant gene in the vessel wall can induce a focal immune response and suggest that vessel damage induced by cell-mediated immune injury can initiate vasculitis.

Cadmium-induced ethylene production and responses in Arabidopsis thaliana rely on ACS2 and ACS6 gene expression

PubMed Central

2014-01-01

Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and

The ovarian DNA damage repair response is induced prior to phosphoramide mustard-induced follicle depletion, and ataxia telangiectasia mutated inhibition prevents PM-induced follicle depletion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fishermore » 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96 h in medium containing DMSO ± 60 μM PM or KU 55933 (48 h; 10 nM). PM-induced activation of DNA damage repair genes was observed as early as 12 h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96 h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. - Highlights: • PM exposure induces DNA damage repair gene expression. • Inhibition of ATM prevented PM-induced follicle depletion. • PKCδ deficiency did not impact PM-induced ovotoxicity.« less

A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.

PubMed

Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna

2008-03-01

Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.

A functional polymorphism of the MAOA gene is associated with neural responses to induced anger control.

PubMed

Denson, Thomas F; Dobson-Stone, Carol; Ronay, Richard; von Hippel, William; Schira, Mark M

2014-07-01

Aggressiveness is highly heritable. Recent experimental work has linked individual differences in a functional polymorphism of the monoamine oxidase-A gene (MAOA) to anger-driven aggression. Other work has implicated the dorsal ACC (dACC) in cognitive-emotional control and the amygdala in emotional arousal. The present imaging genetics study investigated dACC and amygdala reactivity to induced anger control as a function of MAOA genotype. A research assistant asked 38 healthy male undergraduates to control their anger in response to an insult by a rude experimenter. Men with the low-expression allele showed increased dACC and amygdala activation after the insult, but men with the high-expression allele did not. Both dACC and amygdala activation independently mediated the relationship between MAOA genotype and self-reported anger control. Moreover, following the insult, men with the high-functioning allele showed functional decoupling between the amygdala and dACC, but men with the low-functioning allele did not. These results suggest that heightened dACC and amygdala activation and their connectivity are neuroaffective mechanisms underlying anger control in participants with the low-functioning allele of the MAOA gene.

Characterizing gene responses to drought stress in fourwing saltbush [Atriplex canescens (Pursh.) Nutt.)

Treesearch

Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon

1992-01-01

New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub

MRG1, the product of a melanocyte-specific gene related gene, is a cytokine-inducible transcription factor with transformation activity

PubMed Central

Sun, Hui Bin; Zhu, Yuan Xiao; Yin, Tinggui; Sledge, George; Yang, Yu-Chung

1998-01-01

Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors. PMID:9811838

Co-acting gene networks predict TRAIL responsiveness of tumour cells with high accuracy.

PubMed

O'Reilly, Paul; Ortutay, Csaba; Gernon, Grainne; O'Connell, Enda; Seoighe, Cathal; Boyce, Susan; Serrano, Luis; Szegezdi, Eva

2014-12-19

Identification of differentially expressed genes from transcriptomic studies is one of the most common mechanisms to identify tumor biomarkers. This approach however is not well suited to identify interaction between genes whose protein products potentially influence each other, which limits its power to identify molecular wiring of tumour cells dictating response to a drug. Due to the fact that signal transduction pathways are not linear and highly interlinked, the biological response they drive may be better described by the relative amount of their components and their functional relationships than by their individual, absolute expression. Gene expression microarray data for 109 tumor cell lines with known sensitivity to the death ligand cytokine tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) was used to identify genes with potential functional relationships determining responsiveness to TRAIL-induced apoptosis. The machine learning technique Random Forest in the statistical environment "R" with backward elimination was used to identify the key predictors of TRAIL sensitivity and differentially expressed genes were identified using the software GeneSpring. Gene co-regulation and statistical interaction was assessed with q-order partial correlation analysis and non-rejection rate. Biological (functional) interactions amongst the co-acting genes were studied with Ingenuity network analysis. Prediction accuracy was assessed by calculating the area under the receiver operator curve using an independent dataset. We show that the gene panel identified could predict TRAIL-sensitivity with a very high degree of sensitivity and specificity (AUC=0·84). The genes in the panel are co-regulated and at least 40% of them functionally interact in signal transduction pathways that regulate cell death and cell survival, cellular differentiation and morphogenesis. Importantly, only 12% of the TRAIL-predictor genes were differentially expressed highlighting the

Cutin monomer induces expression of the rice OsLTP5 lipid transfer protein gene.

PubMed

Kim, Tae Hyun; Park, Jong Ho; Kim, Moon Chul; Cho, Sung Ho

2008-01-01

Treatment with the cutin monomer 16-hydroxypalmitic acid (HPA), a major component of cutin, elicited the synthesis of hydrogen peroxide (H2O2) in rice leaves and induced the expression of the lipid transfer protein gene OsLTP5. Treatment with HPA also induced expression of OsLTP1, OsLTP2, and the pathogen-related PR-10 genes to a lesser extent. The OsLTP5 transcript was expressed prominently in stems and flowers, but was barely detectable in leaves. Expression of OsLTP5 was induced in shoots in response to ABA and salicylic acid. It is proposed that HPA is perceived by rice as a signal, inducing defense reactions.

Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

PubMed

Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

2016-07-01

Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

Soybean DREB1/CBF-type transcription factors function in heat and drought as well as cold stress-responsive gene expression.

PubMed

Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2015-02-01

Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Characterization of a lactose-responsive promoter of ATP-binding cassette (ABC) transporter gene from Lactobacillus acidophilus 05-172.

PubMed

Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu

2017-09-01

A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Global Gene-Expression Analysis to Identify Differentially Expressed Genes Critical for the Heat Stress Response in Brassica rapa

PubMed Central

Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang

2015-01-01

Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data

IL-1β-specific recruitment of GCN5 histone acetyltransferase induces the release of PAF1 from chromatin for the de-repression of inflammatory response genes.

PubMed

Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon

2013-04-01

To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.

Identification of genes involved in low aminoglycoside-induced SOS response in Vibrio cholerae: a role for transcription stalling and Mfd helicase

PubMed Central

Baharoglu, Zeynep; Babosan, Anamaria; Mazel, Didier

2014-01-01

Sub-inhibitory concentrations (sub-MIC) of antibiotics play a very important role in selection and development of resistances. Unlike Escherichia coli, Vibrio cholerae induces its SOS response in presence of sub-MIC aminoglycosides. A role for oxidized guanine residues was observed, but the mechanisms of this induction remained unclear. To select for V. cholerae mutants that do not induce low aminoglycoside-mediated SOS induction, we developed a genetic screen that renders induction of SOS lethal. We identified genes involved in this pathway using two strategies, inactivation by transposition and gene overexpression. Interestingly, we obtained mutants inactivated for the expression of proteins known to destabilize the RNA polymerase complex. Reconstruction of the corresponding mutants confirmed their specific involvement in induction of SOS by low aminoglycoside concentrations. We propose that DNA lesions formed on aminoglycoside treatment are repaired through the formation of single-stranded DNA intermediates, inducing SOS. Inactivation of functions that dislodge RNA polymerase leads to prolonged stalling on these lesions, which hampers SOS induction and repair and reduces viability under antibiotic stress. The importance of these mechanisms is illustrated by a reduction of aminoglycoside sub-MIC. Our results point to a central role for transcription blocking at DNA lesions in SOS induction, so far underestimated. PMID:24319148

Identification of genes involved in low aminoglycoside-induced SOS response in Vibrio cholerae: a role for transcription stalling and Mfd helicase.

PubMed

Baharoglu, Zeynep; Babosan, Anamaria; Mazel, Didier

2014-02-01

Sub-inhibitory concentrations (sub-MIC) of antibiotics play a very important role in selection and development of resistances. Unlike Escherichia coli, Vibrio cholerae induces its SOS response in presence of sub-MIC aminoglycosides. A role for oxidized guanine residues was observed, but the mechanisms of this induction remained unclear. To select for V. cholerae mutants that do not induce low aminoglycoside-mediated SOS induction, we developed a genetic screen that renders induction of SOS lethal. We identified genes involved in this pathway using two strategies, inactivation by transposition and gene overexpression. Interestingly, we obtained mutants inactivated for the expression of proteins known to destabilize the RNA polymerase complex. Reconstruction of the corresponding mutants confirmed their specific involvement in induction of SOS by low aminoglycoside concentrations. We propose that DNA lesions formed on aminoglycoside treatment are repaired through the formation of single-stranded DNA intermediates, inducing SOS. Inactivation of functions that dislodge RNA polymerase leads to prolonged stalling on these lesions, which hampers SOS induction and repair and reduces viability under antibiotic stress. The importance of these mechanisms is illustrated by a reduction of aminoglycoside sub-MIC. Our results point to a central role for transcription blocking at DNA lesions in SOS induction, so far underestimated.

Insulin Response Genes in Different Stages of Periodontal Disease

PubMed Central

Yu, N.; Barros, S.P.; Zhang, S.; Moss, K.L.; Phillips, S.T.; Offenbacher, S.

2015-01-01

Bacterial infections are known to alter glucose metabolism within tissues via mechanisms of inflammation. We conducted this study to examine whether insulin response genes are differentially expressed in gingival tissues, comparing samples from experimental gingivitis and periodontitis subjects to those from healthy individuals. Total RNA was extracted from gingival biopsies from 26 participants: 8 periodontally healthy, 9 experimental gingivitis, and 9 periodontitis subjects. Gene expression patterns were evaluated with a polymerase chain reaction array panel to examine 84 candidate genes involved with glucose metabolism, insulin resistance, and obesity. Array data were evaluated with a t test adjusted by the false discover rate (P < 0.05), and ingenuity pathway analysis was performed for statistical testing of pathways. Although tissue samples were not sufficient to enable protein quantification, we confirmed the upregulation of the key gene using lipopolysaccharide-stimulated primary gingival epithelial cells by Western blot. The mRNA expression patterns of genes that are associated with insulin response and glucose metabolism are markedly different in experimental gingivitis subjects compared with healthy controls. Thirty-two genes are upregulated significantly by at least 2-fold, adjusted for false discover rate (P < 0.05). Periodontitis subjects show similar but attenuated changes in gene expression patterns, and no genes meet the significance criteria. Ingenuity pathway analysis demonstrates significant activation of the carbohydrate metabolism network in experimental gingivitis but not in periodontitis. G6PD protein increases in response to lipopolysaccharide stimulation in primary gingival epithelial cells, which is in the same direction as upregulated mRNA in tissues. Acute gingival inflammation may be associated with tissue metabolism changes, but these changes are not evident in chronic periodontitis. This study suggests that acute gingival inflammation

De Novo Assembled Wheat Transcriptomes Delineate Differentially Expressed Host Genes in Response to Leaf Rust Infection.

PubMed

Chandra, Saket; Singh, Dharmendra; Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal

2016-01-01

Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants.

De Novo Assembled Wheat Transcriptomes Delineate Differentially Expressed Host Genes in Response to Leaf Rust Infection

PubMed Central

Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal

2016-01-01

Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants. PMID:26840746

Insulin-like growth factor-I gene delivery to astrocytes reduces their inflammatory response to lipopolysaccharide

PubMed Central

2011-01-01

Background Insulin-like growth factor-I (IGF-I) exerts neuroprotective actions in the central nervous system that are mediated at least in part by control of activation of astrocytes. In this study we have assessed the efficacy of exogenous IGF-I and IGF-I gene therapy in reducing the inflammatory response of astrocytes from cerebral cortex. Methods An adenoviral vector harboring the rat IGF-I gene and a control adenoviral vector harboring a hybrid gene encoding the herpes simplex virus type 1 thymidine kinase fused to Aequorea victoria enhanced green fluorescent protein were used in this study. Primary astrocytes from mice cerebral cortex were incubated for 24 h or 72 h with vehicle, IGF-I, the IGF-I adenoviral vector, or control vector; and exposed to bacterial lipopolysaccharide to induce an inflammatory response. IGF-I levels were measured by radioimmunoassay. Levels of interleukin 6, tumor necrosis factor-α, interleukin-1β and toll-like receptor 4 mRNA were assessed by quantitative real-time polymerase chain reaction. Levels of IGF-I receptor and IGF binding proteins 2 and 3 were assessed by western blotting. The subcellular distribution of nuclear factor κB (p65) was assessed by immunocytochemistry. Statistical significance was assessed by one way analysis of variance followed by the Bonferroni pot hoc test. Results IGF-I gene therapy increased IGF-I levels without affecting IGF-I receptors or IGF binding proteins. Exogenous IGF-I, and IGF-I gene therapy, decreased expression of toll-like receptor 4 and counteracted the lipopolysaccharide-induced inflammatory response of astrocytes. In addition, IGF-I gene therapy decreased lipopolysaccharide-induced translocation of nuclear factor κB (p65) to the cell nucleus. Conclusion These findings demonstrate efficacy of exogenous IGF-I and of IGF-I gene therapy in reducing the inflammatory response of astrocytes. IGF-I gene therapy may represent a new approach to reduce inflammatory reactions in glial cells. PMID

Identification of low Ca(2+) stress-induced embryo apoptosis response genes in Arachis hypogaea by SSH-associated library lift (SSHaLL).

PubMed

Chen, Hua; Zhang, Chong; Cai, Tie Cheng; Deng, Ye; Zhou, Shuangbiao; Zheng, Yixiong; Ma, Shiwei; Tang, Ronghua; Varshney, Rajeev K; Zhuang, Weijian

2016-02-01

Calcium is a universal signal in the regulation of wide aspects in biology, but few are known about the function of calcium in the control of early embryo development. Ca(2+) deficiency in soil induces early embryo abortion in peanut, producing empty pods, which is a general problem; however, the underlying mechanism remains unclear. In this study, embryo abortion was characterized to be caused by apoptosis marked with cell wall degradation. Using a method of SSH cDNA libraries associated with library lift (SSHaLL), 62 differentially expressed genes were isolated from young peanut embryos. These genes were classified to be stress responses, catabolic process, carbohydrate and lipid metabolism, embryo morphogenesis, regulation, etc. The cell retardation with cell wall degradation was caused by up-regulated cell wall hydrolases and down-regulated cellular synthases genes. HsfA4a, which was characterized to be important to embryo development, was significantly down-regulated under Ca(2+) -deficient conditions from 15 days after pegging (DAP) to 30 DAP. Two AhCYP707A4 genes, encoding abscisic acid (ABA) 8'-hydroxylases, key enzymes for ABA catabolism, were up-regulated by 21-fold under Ca(2+) -deficient conditions upstream of HsfA4a, reducing the ABA level in early embryos. Over-expression of AhCYP707A4 in Nicotiana benthamiana showed a phenotype of low ABA content with high numbers of aborted embryos, small pods and less seeds, which confirms that AhCYP707A4 is a key player in regulation of Ca(2+) deficiency-induced embryo abortion via ABA-mediated apoptosis. The results elucidated the mechanism of low Ca(2+) -induced embryo abortion and described the method for other fields of study. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Characterization of the Promoter Region of an Arabidopsis Gene for 9-cis-Epoxycarotenoid Dioxygenase Involved in Dehydration-Inducible Transcription

PubMed Central

Behnam, Babak; Iuchi, Satoshi; Fujita, Miki; Fujita, Yasunari; Takasaki, Hironori; Osakabe, Yuriko; Yamaguchi-Shinozaki, Kazuko; Kobayashi, Masatomo; Shinozaki, Kazuo

2013-01-01

Plants respond to dehydration stress and tolerate water-deficit status through complex physiological and cellular processes. Many genes are induced by water deficit. Abscisic acid (ABA) plays important roles in tolerance to dehydration stress by inducing many stress genes. ABA is synthesized de novo in response to dehydration. Most of the genes involved in ABA biosynthesis have been identified, and they are expressed mainly in leaf vascular tissues. Of the products of such genes, 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis. One of the five NCED genes in Arabidopsis, AtNCED3, is significantly induced by dehydration. To understand the regulatory mechanism of the early stages of the dehydration stress response, it is important to analyse the transcriptional regulatory systems of AtNCED3. In the present study, we found that an overlapping G-box recognition sequence (5′-CACGTG-3′) at −2248 bp from the transcriptional start site of AtNCED3 is an important cis-acting element in the induction of the dehydration response. We discuss the possible transcriptional regulatory system of dehydration-responsive AtNCED3 expression, and how this may control the level of ABA under water-deficit conditions. PMID:23604098

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

PubMed

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Photorhabdus luminescens genes induced upon insect infection

PubMed Central

Münch, Anna; Stingl, Lavinia; Jung, Kirsten; Heermann, Ralf

2008-01-01

of toxin genes, including tccC1 (encoding an insecticidal toxin complex), and others encoding putative toxins. A comparably high number of metabolic genes or operons were observed to be induced upon infection; among these were eutABC, hutUH, and agaZSVCD, which encode proteins involved in ethanolamine, histidine and tagatose degradation, respectively. The results reflect rearrangements in metabolism and the use of other metabolites available from the insect. Furthermore, enhanced activity of promoters controlling the expression of genes encoding enzymes linked to antibiotic production and/or resistance was observed. Antibiotic production and resistance may influence competition with other bacteria, and thus might be important for a successful infection. Lastly, several genes of unknown function were identified that may represent novel pathogenicity factors. Conclusion We show that a DFI screen is useful for identifying genes or operons induced by chemical stimuli, such as diluted insect homogenate. A bioinformatics comparison of motifs similar to known promoters is a powerful tool for identifying regulated genes or operons. We conclude that signals for the regulation of those genes or operons induced in P. luminescens upon insect infection may represent a wide variety of compounds that make up the insect host. Our results provide insight into the complex response to the host that occurs in a bacterial pathogen, particularly reflecting the potential for metabolic shifts and other specific changes associated with virulence. PMID:18489737

Cytogenetic Response to Ionizing Radiation Exposure in Human Fibroblasts with Suppressed Expression of Non-DSB Repair Genes

NASA Technical Reports Server (NTRS)

Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Hammond, Dianne; Mehta, Satish K.; Jeevarajan, Antony S.; Pierson, Duane L.; Wu, Honglu

2009-01-01

Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in double-strand break (DSB) repair, and its impact on cytogenetic responses has not been well studied. The purpose of this study is to identify new roles of IR inducible genes in radiation-induced chromosome aberrations and micronuclei formation. In the study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by small interfering RNA in human fibroblast cells. Frequencies of micronuclei (MN) formation and chromosome aberrations were measured to determine the efficiency of cytogenetic repair, and the fraction of bi-nucleated cells in the MN analysis was used as a marker for cell cycle progression. In response to gamma radiation, the formation of MN was significantly increased by suppressed expression of five genes: Ku70 (DSB repair pathway), XPA (nucleotide excision repair pathway), RPA1 (mismatch repair pathway), RAD17 and RBBP8 (cell cycle control). Knocked-down expression of four genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Moreover, decreased XPA, p21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Nine of these eleven genes, whose knock-down expression affected cytogenetic repair, were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate IR-induced

Quantitative expression profiling of immune response genes in rainbow trout following infectious haematopoietic necrosis virus (IHNV) infection or DNA vaccination

USGS Publications Warehouse

Purcell, Maureen K.; Kurath, Gael; Garver, Kyle A.; Herwig, Russell P.; Winton, James R.

2004-01-01

Infectious haematopoietic necrosis virus (IHNV) is a well-studied virus of salmonid fishes. A highly efficacious DNA vaccine has been developed against this virus and studies have demonstrated that this vaccine induces both an early and transient non-specific anti-viral phase as well as long-term specific protection. The mechanisms of the early anti-viral phase are not known, but previous studies noted changes in Mx gene expression, suggesting a role for type I interferon. This study used quantitative real-time reverse transcriptase PCR methodology to compare expression changes over time of a number of cytokine or cytokine-related genes in the spleen of rainbow trout following injection with poly I:C, live IHNV, the IHNV DNA vaccine or a control plasmid encoding the non-antigenic luciferase gene. The target genes included Mx-1, viral haemorrhagic septicaemia virus induced gene 8 (Vig-8), TNF-α1, TNF-α2, IL-1β1, IL-8, TGF-β1 and Hsp70. Poly I:C stimulation induced several genes but the strongest and significant response was observed in the Mx-1 and Vig-8 genes. The live IHN virus induced a significant response in all genes examined except TGF-β1. The control plasmid construct and the IHNV DNA vaccine marginally induced a number of genes, but the main difference between these two groups was a statistically significant induction of the Mx-1 and Vig-8 genes by the IHNV vaccine only. The gene expression profiles elicited by the live virus and the IHNV DNA vaccine differed in a number of aspects but this study confirms the clear role for a type I interferon-like response in early anti-viral defence.

Gene transfer of constitutively active protein kinase C into striatal neurons accelerates onset of levodopa-induced motor response alterations in parkinsonian rats

PubMed Central

Oh, Justin D.; Geller, Alfred I.; Zhang, Guo-rong; Chase, Thomas N.

2006-01-01

Alterations in motor response that complicate levodopa treatment of Parkinson’s disease appear to involve sensitization of striatal ionotropic glutamate receptors. Since protein kinase C (PKC)-mediated phosphorylation regulates glutamatergic receptors of the α-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA) subtype and has been linked to several forms of behavioral plasticity, activation of PKC signaling in striatal spiny neurons may also contribute to the motor plasticity changes associated with chronic levodopa therapy. To evaluate this possibility, we sought to augment PKC signaling by using Herpes Simplex Virus type 1 vectors (pHSVpkcΔ) to directly transfer the catalytic domain of the PKCβII gene into striatal neurons of parkinsonian rats. Microinjection of pHSVpkcΔ vectors lead to the persistent expression of PkcΔ (35% loss over 21 days) in medium spiny neurons together with an increase in serine 831 phosphorylation on AMPA receptor GluR1 subunits and hastened the appearance of the shortened response duration produced by chronic levodopa treatment (P<0.05). In pHSVpkcΔ-infected animals, intrastriatal injection of the PKC inhibitor NPC-15437 (1.0 μg) attenuated both the increased GluR1 phosphorylation (P<0.01) and the accelerated onset of the levodopa-induced response modifications (P<0.01). However, in rats that received levodopa treatment for 21 days without the gene transfer, intrastriatal NPC-15437 had no effect on the response shortening or on GluR1 S831 phosphorylation. The results suggest that an increase in PKC-mediated signaling, including, in part, phosphorylation of AMPA receptors, on striatal spiny neurons may be sufficient to promote the initial appearance, but not necessary the ultimate expression, of the levodopa-induced motor response changes occurring in a rodent model of the human motor complication syndrome. PMID:12691833

Two rice GRAS family genes responsive to N -acetylchitooligosaccharide elicitor are induced by phytoactive gibberellins: evidence for cross-talk between elicitor and gibberellin signaling in rice cells.

PubMed

Day, R Bradley; Tanabe, Shigeru; Koshioka, Masaji; Mitsui, Toshiaki; Itoh, Hironori; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto; Kaku, Hanae; Shibuya, Naoto; Minami, Eiichi

2004-01-01

In this study, we present data showing that two members of the GRAS family of genes from rice, CIGR1 and CIGR2 (chitin-inducible gibberellin-responsive), inducible by the potent elicitor N -acetylchitooligosaccharide (GN), are rapidly induced by exogenous gibberellins. The pattern of mRNA accumulation was dependent on the dose and biological activity of the gibberellins, suggesting that the induction of the genes by gibberellin is mediated by a biological receptor capable of specific recognition and signal transduction upon perception of the phytoactive compounds. Further pharmacological analysis revealed that the CIGR1 and CIGR2 mRNA accumulation by treatment with gibberellin is dependent upon protein phosphorylation/dephosphorylation events. In rice calli derived from slender rice 1, a constitutive gibberellin-responsive mutant, or d1, a mutant deficient in the alpha -subunit of the heterotrimeric G-protein, CIGR1 and CIGR2 were induced by a GN elicitor, yet not by gibberellin. Neither gibberellin nor GN showed related activities in defense or development, respectively. These results strongly suggested that the signal transduction cascade from gibberellin is independent of that from GN, and further implied that CIGR1 and CIGR2 have dual, distinct roles in defense and development.

Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.

PubMed

Fonseca, Luciane S; da Silva, Josefa B; Milanez, Juliana S; Monteiro-Vitorello, Claudia B; Momo, Leonardo; de Morais, Zenaide M; Vasconcellos, Silvio A; Marques, Marilis V; Ho, Paulo L; da Costa, Renata M A

2013-01-01

Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.

Leptospira interrogans serovar Copenhageni Harbors Two lexA Genes Involved in SOS Response

PubMed Central

Fonseca, Luciane S.; da Silva, Josefa B.; Milanez, Juliana S.; Monteiro-Vitorello, Claudia B.; Momo, Leonardo; de Morais, Zenaide M.; Vasconcellos, Silvio A.; Marques, Marilis V.; Ho, Paulo L.; da Costa, Renata M. A.

2013-01-01

Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN 10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence. PMID:24098496

Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles.

PubMed

Niazi, Javed H; Sang, Byoung-In; Kim, Yeon Seok; Gu, Man Bock

2011-08-01

Silver nanoparticles (AgNPs), exhibiting a broad size range and morphologies with highly reactive facets, which are widely applicable in real-life but not fully verified for biosafety and ecotoxicity, were subjected to report transcriptome profile in yeast Saccharomyces cerevisiae. A large number of genes accounted for ∼3% and ∼5% of the genome affected by AgNPs and Ag-ions, respectively. Principal component and cluster analysis suggest that the different physical forms of Ag were the major cause in differential expression profile. Among 90 genes affected by both AgNPs and Ag-ions, metalloprotein mediating high resistance to copper (CUP1-1 and CUP1-2) were strongly induced by AgNPs (∼45-folds) and Ag-ions (∼22-folds), respectively. A total of 17 genes, responsive to chemical stimuli, stress, and transport processes, were differentially induced by AgNPs. The differential expression was also seen with Ag-ions that affected 73 up- and 161 down-regulating genes, and most of these were involved in ion transport and homeostasis. This study provides new information on the knowledge for impact of nanoparticles on living microorganisms that can be extended to other nanoparticles.

Osmolality/salinity-responsive enhancers (OSREs) control induction of osmoprotective genes in euryhaline fish

PubMed Central

Wang, Xiaodan; Kültz, Dietmar

2017-01-01

Fish respond to salinity stress by transcriptional induction of many genes, but the mechanism of their osmotic regulation is unknown. We developed a reporter assay using cells derived from the brain of the tilapia Oreochromis mossambicus (OmB cells) to identify osmolality/salinity-responsive enhancers (OSREs) in the genes of O. mossambicus. Genomic DNA comprising the regulatory regions of two strongly salinity-induced genes, inositol monophosphatase 1 (IMPA1.1) and myo-inositol phosphate synthase (MIPS), was isolated and analyzed with dual luciferase enhancer trap reporter assays. We identified five sequences (two in IMPA1.1 and three in MIPS) that share a common consensus element (DDKGGAAWWDWWYDNRB), which we named “OSRE1.” Additional OSREs that were less effective in conferring salinity-induced trans-activation and do not match the OSRE1 consensus also were identified in both MIPS and IMPA1.1. Although OSRE1 shares homology with the mammalian osmotic-response element/tonicity-responsive enhancer (ORE/TonE) enhancer, the latter is insufficient to confer osmotic induction in fish. Like other enhancers, OSRE1 trans-activates genes independent of orientation. We conclude that OSRE1 is a cis-regulatory element (CRE) that enhances the hyperosmotic induction of osmoregulated genes in fish. Our study also shows that tailored reporter assays developed for OmB cells facilitate the identification of CREs in fish genomes. Knowledge of the OSRE1 motif allows affinity-purification of the corresponding transcription factor and computational approaches for enhancer screening of fish genomes. Moreover, our study enables targeted inactivation of OSRE1 enhancers, a method superior to gene knockout for functional characterization because it confines impairment of gene function to a specific context (salinity stress) and eliminates pitfalls of constitutive gene knockouts (embryonic lethality, developmental compensation). PMID:28289196

RNAseq reveals weed-induced PIF3-like as a candidate target to manipulate weed stress response in soybean.

PubMed

Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A

2015-07-01

Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.

Investigating Proteome and Transcriptome Defense Response of Apples Induced by Yarrowia lipolytica.

PubMed

Zhang, Hongyin; Chen, Liangliang; Sun, Yiwen; Zhao, Lina; Zheng, Xiangfeng; Yang, Qiya; Zhang, Xiaoyun

2017-04-01

A better understanding of the mode of action of postharvest biocontrol agents on fruit surfaces is critical for the advancement of successful implementation of postharvest biocontrol products. This is due to the increasing importance of biological control of postharvest diseases over chemical and other control methods. However, most of the mechanisms involved in biological control remain unknown and need to be explored. Yarrowia lipolytica significantly inhibited blue mold decay of apples caused by Penicillium expansum. The findings also demonstrated that Y. lipolytica stimulated the activities of polyphenoloxidase, peroxidase, chitinase, l-phenylalanine ammonia lyase involved in enhancing defense responses in apple fruit tissue. Proteomic and transcriptomic analysis revealed a total of 35 proteins identified as up- and down-regulated in response to the Y. lipolytica inducement. These proteins were related to defense, biotic stimulus, and stress responses, such as pathogenesis-related proteins and dehydrin. The analysis of the transcriptome results proved that the induced resistance was mediated by a crosstalk between salicylic acid (SA) and ethylene/jasmonate (ET/JA) pathways. Y. lipolytica treatment activated the expression of isochorismate synthase gene in the SA pathway, which up-regulates the expression of PR4 in apple. The expression of 1-aminocyclopropane-1-carboxylate oxidase gene and ET-responsive transcription factors 2 and 4, which are involved in the ET pathway, were also activated. In addition, cytochrome oxidase I, which plays an important role in JA signaling for resistance acquisition, was also activated. However, not all of the genes had a positive effect on the SA and ET/JA signal pathways. As transcriptional repressors in JA signaling, TIFY3B and TIFY11B were triggered by the yeast, but the gene expression levels were relatively low. Taken together, Y. lipolytica induced the SA and ET/JA signal mediating the defense pathways by stimulating

DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

PubMed Central

Polato, Federica; Rusconi, Paolo

2014-01-01

Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

Ca(2+) regulates fluid shear-induced cytoskeletal reorganization and gene expression in osteoblasts

NASA Technical Reports Server (NTRS)

Chen, N. X.; Ryder, K. D.; Pavalko, F. M.; Turner, C. H.; Burr, D. B.; Qiu, J.; Duncan, R. L.

2000-01-01

Osteoblasts subjected to fluid shear increase the expression of the early response gene, c-fos, and the inducible isoform of cyclooxygenase, COX-2, two proteins linked to the anabolic response of bone to mechanical stimulation, in vivo. These increases in gene expression are dependent on shear-induced actin stress fiber formation. Here, we demonstrate that MC3T3-E1 osteoblast-like cells respond to shear with a rapid increase in intracellular Ca(2+) concentration ([Ca(2+)](i)) that we postulate is important to subsequent cellular responses to shear. To test this hypothesis, MC3T3-E1 cells were grown on glass slides coated with fibronectin and subjected to laminar fluid flow (12 dyn/cm(2)). Before application of shear, cells were treated with two Ca(2+) channel inhibitors or various blockers of intracellular Ca(2+) release for 0. 5-1 h. Although gadolinium, a mechanosensitive channel blocker, significantly reduced the [Ca(2+)](i) response, neither gadolinium nor nifedipine, an L-type channel Ca(2+) channel blocker, were able to block shear-induced stress fiber formation and increase in c-fos and COX-2 in MC3T3-E1 cells. However, 1, 2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid-AM, an intracellular Ca(2+) chelator, or thapsigargin, which empties intracellular Ca(2+) stores, completely inhibited stress fiber formation and c-fos/COX-2 production in sheared osteoblasts. Neomycin or U-73122 inhibition of phospholipase C, which mediates D-myo-inositol 1,4,5-trisphosphate (IP(3))-induced intracellular Ca(2+) release, also completely suppressed actin reorganization and c-fos/COX-2 production. Pretreatment of MC3T3-E1 cells with U-73343, the inactive isoform of U-73122, did not inhibit these shear-induced responses. These results suggest that IP(3)-mediated intracellular Ca(2+) release is required for modulating flow-induced responses in MC3T3-E1 cells.

A Pipeline for High-Throughput Concentration Response Modeling of Gene Expression for Toxicogenomics

PubMed Central

House, John S.; Grimm, Fabian A.; Jima, Dereje D.; Zhou, Yi-Hui; Rusyn, Ivan; Wright, Fred A.

2017-01-01

Cell-based assays are an attractive option to measure gene expression response to exposure, but the cost of whole-transcriptome RNA sequencing has been a barrier to the use of gene expression profiling for in vitro toxicity screening. In addition, standard RNA sequencing adds variability due to variable transcript length and amplification. Targeted probe-sequencing technologies such as TempO-Seq, with transcriptomic representation that can vary from hundreds of genes to the entire transcriptome, may reduce some components of variation. Analyses of high-throughput toxicogenomics data require renewed attention to read-calling algorithms and simplified dose–response modeling for datasets with relatively few samples. Using data from induced pluripotent stem cell-derived cardiomyocytes treated with chemicals at varying concentrations, we describe here and make available a pipeline for handling expression data generated by TempO-Seq to align reads, clean and normalize raw count data, identify differentially expressed genes, and calculate transcriptomic concentration–response points of departure. The methods are extensible to other forms of concentration–response gene-expression data, and we discuss the utility of the methods for assessing variation in susceptibility and the diseased cellular state. PMID:29163636

Inducible in vivo DNA footprints define sequences necessary for UV light activation of the parsley chalcone synthase gene.

PubMed Central

Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W

1989-01-01

We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481

Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.

PubMed

An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin

2016-05-01

Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

PubMed

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

A targeted gene expression platform allows for rapid analysis of chemical-induced antioxidant mRNA expression in zebrafish larvae.

PubMed

Mills, Margaret G; Gallagher, Evan P

2017-01-01

Chemical-induced oxidative stress and the biochemical pathways that protect against oxidative damage are of particular interest in the field of toxicology. To rapidly identify oxidative stress-responsive gene expression changes in zebrafish, we developed a targeted panel of antioxidant genes using the Affymetrix QuantiGene Plex (QGP) platform. The genes contained in our panel include eight putative Nrf2 (Nfe2l2a)-dependent antioxidant genes (hmox1a, gstp1, gclc, nqo1, prdx1, gpx1a, sod1, sod2), a stress response gene (hsp70), an inducible DNA damage repair gene (gadd45bb), and three reference genes (actb1, gapdh, hprt1). We tested this platform on larval zebrafish exposed to tert-butyl hydroperoxide (tBHP) and cadmium (Cd), two model oxidative stressors with different modes of action, and compared our results with those obtained using the more common quantitative PCR (qPCR) method. Both methods showed that exposure to tBHP and Cd induced expression of prdx1, gstp1, and hmox1a (2- to 12-fold increase via QGP), indicative of an activated Nrf2 response in larval zebrafish. Both compounds also elicited a general stress response as reflected by elevation of hsp70 and gadd45bb, with Cd being the more potent inducer. Transient changes were observed in sod2 and gpx1a expression, whereas nqo1, an Nrf2-responsive gene in mammalian cells, was minimally affected by either tBHP or Cd chemical exposures. Developmental expression analysis of the target genes by QGP revealed marked upregulation of sod2 between 0-96hpf, and to a lesser extent, of sod1 and gstp1. Once optimized, QGP analysis of these experiments was accomplished more rapidly, using far less tissue, and at lower total costs than qPCR analysis. In summary, the QGP platform as applied to higher-throughput zebrafish studies provides a reasonable cost-effective alternative to qPCR or more comprehensive transcriptomics approaches to rapidly assess the potential for chemicals to elicit oxidative stress as a mechanism of

De Novo Foliar Transcriptome of Chenopodium amaranticolor and Analysis of Its Gene Expression During Virus-Induced Hypersensitive Response

PubMed Central

Zhang, Yongqiang; Pei, Xinwu; Zhang, Chao; Lu, Zifeng; Wang, Zhixing; Jia, Shirong; Li, Weimin

2012-01-01

Background The hypersensitive response (HR) system of Chenopodium spp. confers broad-spectrum virus resistance. However, little knowledge exists at the genomic level for Chenopodium, thus impeding the advanced molecular research of this attractive feature. Hence, we took advantage of RNA-seq to survey the foliar transcriptome of C. amaranticolor, a Chenopodium species widely used as laboratory indicator for pathogenic viruses, in order to facilitate the characterization of the HR-type of virus resistance. Methodology and Principal Findings Using Illumina HiSeq™ 2000 platform, we obtained 39,868,984 reads with 3,588,208,560 bp, which were assembled into 112,452 unigenes (3,847 clusters and 108,605 singletons). BlastX search against the NCBI NR database identified 61,698 sequences with a cut-off E-value above 10−5. Assembled sequences were annotated with gene descriptions, GO, COG and KEGG terms, respectively. A total number of 738 resistance gene analogs (RGAs) and homology sequences of 6 key signaling proteins within the R proteins-directed signaling pathway were identified. Based on this transcriptome data, we investigated the gene expression profiles over the stage of HR induced by Tobacco mosaic virus and Cucumber mosaic virus by using digital gene expression analysis. Numerous candidate genes specifically or commonly regulated by these two distinct viruses at early and late stages of the HR were identified, and the dynamic changes of the differently expressed genes enriched in the pathway of plant-pathogen interaction were particularly emphasized. Conclusions To our knowledge, this study is the first description of the genetic makeup of C. amaranticolor, providing deep insight into the comprehensive gene expression information at transcriptional level in this species. The 738 RGAs as well as the differentially regulated genes, particularly the common genes regulated by both TMV and CMV, are suitable candidates which merit further functional characterization

Gene expression profiling of the effects of organic dust in lung epithelial and THP-1 cells reveals inductive effects on inflammatory and immune response genes

PubMed Central

Loose, David S.; Gottipati, Koteswara R.; Natarajan, Kartiga; Mitchell, Courtney T.

2016-01-01

The intensification and concentration of animal production operations expose workers to high levels of organic dusts in the work environment. Exposure to organic dusts is a risk factor for the development of acute and chronic respiratory symptoms and diseases. Lung epithelium plays important roles in the control of immune and inflammatory responses to environmental agents to maintain lung health. To better understand the effects of organic dust on lung inflammatory responses, we characterized the gene expression profiles of A549 alveolar and Beas2B bronchial epithelial and THP-1 monocytic cells influenced by exposure to poultry dust extract by DNA microarray analysis using Illumina Human HT-12 v4 Expression BeadChip. We found that A549 alveolar and Beas2B bronchial epithelial and THP-1 cells responded with unique changes in the gene expression profiles with regulation of genes encoding inflammatory cytokines, chemokines, and other inflammatory proteins being common to all the three cells. Significantly induced genes included IL-8, IL-6, IL-1β, ICAM-1, CCL2, CCL5, TLR4, and PTGS2. Validation by real-time qRT-PCR, ELISA, Western immunoblotting, and immunohistochemical staining of lung sections from mice exposed to dust extract validated DNA microarray results. Pathway analysis indicated that dust extract induced changes in gene expression influenced functions related to cellular growth and proliferation, cell death and survival, and cellular development. These data show that a broad range of inflammatory mediators produced in response to poultry dust exposure can modulate lung immune and inflammatory responses. This is the first report on organic dust induced changes in expression profiles in lung epithelial and THP-1 monocytic cells. PMID:26884459

A gene expression profile indicative of early stage HER2 targeted therapy response.

PubMed

O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert

2013-07-01

Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.

The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

PubMed Central

Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

Evaluation of a nanotechnology-based approach to induce gene-expression in human THP-1 macrophages under inflammatory conditions.

PubMed

Bernal, Laura; Alvarado-Vázquez, Abigail; Ferreira, David Wilson; Paige, Candler A; Ulecia-Morón, Cristina; Hill, Bailey; Caesar, Marina; Romero-Sandoval, E Alfonso

2017-02-01

Macrophages orchestrate the initiation and resolution of inflammation by producing pro- and anti-inflammatory products. An imbalance in these mediators may originate from a deficient or excessive immune response. Therefore, macrophages are valid therapeutic targets to restore homeostasis under inflammatory conditions. We hypothesize that a specific mannosylated nanoparticle effectively induces gene expression in human macrophages under inflammatory conditions without undesirable immunogenic responses. THP-1 macrophages were challenged with lipopolysaccharide (LPS, 5μg/mL). Polyethylenimine (PEI) nanoparticles grafted with a mannose receptor ligand (Man-PEI) were used as a gene delivery method. Nanoparticle toxicity, Man-PEI cellular uptake rate and gene induction efficiency (GFP, CD14 or CD68) were studied. Potential immunogenic responses were evaluated by measuring the production of tumor necrosis factor-alpha (TNF-α), Interleukin (IL)-6 and IL-10. Man-PEI did not produce cytotoxicity, and it was effectively up-taken by THP-1 macrophages (69%). This approach produced a significant expression of GFP (mRNA and protein), CD14 and CD68 (mRNA), and transiently and mildly reduced IL-6 and IL-10 levels in LPS-challenged macrophages. Our results indicate that Man-PEI is suitable for inducing an efficient gene overexpression in human macrophages under inflammatory conditions with limited immunogenic responses. Our promising results set the foundation to test this technology to induce functional anti-inflammatory genes. Copyright © 2016 Elsevier GmbH. All rights reserved.

Analysis of gene expression during parabolic flights reveals distinct early gravity responses in Arabidopsis roots.

PubMed

Aubry-Hivet, D; Nziengui, H; Rapp, K; Oliveira, O; Paponov, I A; Li, Y; Hauslage, J; Vagt, N; Braun, M; Ditengou, F A; Dovzhenko, A; Palme, K

2014-01-01

Plant roots are among most intensively studied biological systems in gravity research. Altered gravity induces asymmetric cell growth leading to root bending. Differential distribution of the phytohormone auxin underlies root responses to gravity, being coordinated by auxin efflux transporters from the PIN family. The objective of this study was to compare early transcriptomic changes in roots of Arabidopsis thaliana wild type, and pin2 and pin3 mutants under parabolic flight conditions and to correlate these changes to auxin distribution. Parabolic flights allow comparison of transient 1-g, hypergravity and microgravity effects in living organisms in parallel. We found common and mutation-related genes differentially expressed in response to transient microgravity phases. Gene ontology analysis of common genes revealed lipid metabolism, response to stress factors and light categories as primarily involved in response to transient microgravity phases, suggesting that fundamental reorganisation of metabolic pathways functions upstream of a further signal mediating hormonal network. Gene expression changes in roots lacking the columella-located PIN3 were stronger than in those deprived of the epidermis and cortex cell-specific PIN2. Moreover, repetitive exposure to microgravity/hypergravity and gravity/hypergravity flight phases induced an up-regulation of auxin responsive genes in wild type and pin2 roots, but not in pin3 roots, suggesting a critical function of PIN3 in mediating auxin fluxes in response to transient microgravity phases. Our study provides important insights towards understanding signal transduction processes in transient microgravity conditions by combining for the first time the parabolic flight platform with the transcriptome analysis of different genetic mutants in the model plant, Arabidopsis. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

In vitro expression of hard metal dust (WC-Co) - responsive genes in human peripheral blood mononucleated cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lombaert, Nooemi; Lison, Dominique; Van Hummelen, Paul

Hard metals consist of tungsten carbide (WC) and metallic cobalt (Co) particles and are important industrial materials produced for their extreme hardness and high wear resistance properties. While occupational exposure to metallic Co alone is apparently not associated with an increased risk of cancer, the WC-Co particle mixture was shown to be carcinogenic in exposed workers. The in vitro mutagenic/apoptogenic potential of WC-Co in human peripheral blood mononucleated cells was previously demonstrated by us. This study aimed at obtaining a broader view of the pathways responsible for WC-Co induced carcinogenicity, and in particular genotoxicity and apoptosis. We analyzed the profilemore » of gene expression induced in vitro by WC-Co versus control (24 h treatment) in human PBMC and monocytes using microarrays. The most significantly up-regulated pathways for WC-Co treated PBMC were apoptosis and stress/defense response; the most down-regulated was immune response. For WC-Co treated monocytes the most significantly up- and down-regulated pathways were nucleosome/chromatin assembly and immune response respectively. Quantitative RT-PCR data for a selection of the most strongly modulated genes (HMOX1, HSPA1A, HSPA1L, BNIP3, BNIP3L, ADORA2B, MT3, PLA2G7, TNFAIP6), and some additionally chosen apoptosis related genes (BCL2, BAX, FAS, FASL, TNF{alpha}), confirmed the microarray data after WC-Co exposure and demonstrated limited differences between the Co-containing compounds. Overall, this study provides the first analysis of gene expression induced by the WC-Co mixture showing a large profile of gene modulation and giving a preliminary indication for a hypoxia mimicking environment induced by WC-Co exposure.« less

Apoptotic activity and gene responses in Drosophila melanogaster S2 cells, induced by azadirachtin A.

PubMed

Xu, Lin; Li, Sheng; Ran, Xueqin; Liu, Chang; Lin, Rutao; Wang, Jiafu

2016-09-01

Azadirachtin has been used as an antifeedant and growth disruption agent for many insect species. Previous investigations have reported the apoptotic effects of azadirachtin on some insect cells, but the molecular mechanisms are still not clear. This study investigated the underlying molecular mechanisms for the apoptotic effects induced by azadirachtin on Drosophila melanogaster S2 cells in vitro. The results of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay demonstrated that azadirachtin exhibited significant cytotoxicity to S2 cells in a time- and dose-dependent manner. The changes in cellular morphology and the DNA fragmentation demonstrated that azadirachtin induced remarkable apoptosis of S2 cells. Expression levels of 276 genes were found to be significantly changed in S2 cells after exposure to azadirachtin, as detected by Drosophila genome array. Among these genes, calmodulin (CaM) was the most highly upregulated gene. Azadirachtin was further demonstrated to trigger intracellular Ca(2+) release in S2 cells. The genes related to the apoptosis pathway, determined from chip data, were validated by the real-time quantitative polymerase chain reaction method. The results showed that azadirachtin-mediated intracellular Ca(2+) release was the primary event that triggered apoptosis in Drosophila S2 cells through both pathways of the Ca(2+) -CaM and EcR/Usp signalling cascade. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Expression Profiling-Based Identification of CO2-Responsive Genes Regulated by CCM1 Controlling a Carbon-Concentrating Mechanism in Chlamydomonas reinhardtii1

PubMed Central

Miura, Kenji; Yamano, Takashi; Yoshioka, Satoshi; Kohinata, Tsutomu; Inoue, Yoshihiro; Taniguchi, Fumiya; Asamizu, Erika; Nakamura, Yasukazu; Tabata, Satoshi; Yamato, Katsuyuki T.; Ohyama, Kanji; Fukuzawa, Hideya

2004-01-01

Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM. PMID:15235119

Structurally distinct polycyclic aromatic hydrocarbons induce differential transcriptional responses in developing zebrafish

PubMed Central

Goodale, Britton C.; Tilton, Susan C.; Wilson, Glenn; Corvi, Margaret M.; Janszen, Derek B.; Anderson, Kim A.; Waters, Katrina M.; Tanguay, Robert L.

2014-01-01

Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous in the environment as components of fossil fuels and by-products of combustion. These multi-ring chemicals differentially activate the Aryl Hydrocarbon Receptor (AHR) in a structurally dependent manner, and induce toxicity via both AHR-dependent and-independent mechanisms. PAH exposure is known to induce developmental malformations in zebrafish embryos, and recent studies have shown cardiac toxicity induced by compounds with low AHR affinity. Unraveling the potentially diverse molecular mechanisms of PAH toxicity is essential for understanding the hazard posed by complex PAH mixtures present in the environment. We analyzed transcriptional responses to PAH exposure in zebrafish embryos exposed to benz(a)anthracene (BAA), dibenzothiophene (DBT) and pyrene (PYR) at concentrations that induced developmental malformations by 120 hours post-fertilization (hpf). Whole genome microarray analysis of mRNA expression at 24 and 48 hpf identified genes that were differentially regulated over time and in response to the three PAH structures. PAH body burdens were analyzed at both time points using GC-MS, and demonstrated differences in PAH uptake into the embryos. This was important for discerning dose-related differences from those that represented unique molecular mechanisms. While BAA misregulated the least number of transcripts, it caused strong induction of cyp1a and other genes known to be downstream of the AHR, which were not induced by the other two PAHs. Analysis of functional roles of misregulated genes and their predicted regulatory transcription factors also distinguished the BAA response from regulatory networks disrupted by DBT and PYR exposure. These results indicate that systems approaches can be used to classify the toxicity of PAHs based on the networks perturbed following exposure, and may provide a path for unraveling the toxicity of complex PAH mixtures. PMID:23656968

Tailoring the Immune Response via Customization of Pathogen Gene Expression.

PubMed

Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

2014-01-01

The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

Tailoring the Immune Response via Customization of Pathogen Gene Expression

PubMed Central

Runco, Lisa M.; Stauft, Charles B.

2014-01-01

The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

Environmentally induced responses co-opted for reproductive altruism

PubMed Central

Nedelcu, Aurora M.

2009-01-01

Reproductive altruism is an extreme form of altruism best typified by sterile castes in social insects and somatic cells in multicellular organisms. Although reproductive altruism is central to the evolution of multicellularity and eusociality, the mechanistic basis for the evolution of this behaviour is yet to be deciphered. Here, we report that the gene responsible for the permanent suppression of reproduction in the somatic cells of the multicellular green alga, Volvox carteri, evolved from a gene that in its unicellular relative, Chlamydomonas reinhardtii, is part of the general acclimation response to various environmental stress factors, which includes the temporary suppression of reproduction. Furthermore, we propose a model for the evolution of soma, in which by simulating the acclimation signal (i.e. a change in cellular redox status) in a developmental rather than environmental context, responses beneficial to a unicellular individual can be co-opted into an altruistic behaviour at the group level. The co-option of environmentally induced responses for reproductive altruism can contribute to the stability of this behaviour, as the loss of such responses would be costly for the individual. This hypothesis also predicts that temporally varying environments, which will select for more efficient acclimation responses, are likely to be more conducive to the evolution of reproductive altruism. PMID:19578098

Environmentally induced responses co-opted for reproductive altruism.

PubMed

Nedelcu, Aurora M

2009-12-23

Reproductive altruism is an extreme form of altruism best typified by sterile castes in social insects and somatic cells in multicellular organisms. Although reproductive altruism is central to the evolution of multicellularity and eusociality, the mechanistic basis for the evolution of this behaviour is yet to be deciphered. Here, we report that the gene responsible for the permanent suppression of reproduction in the somatic cells of the multicellular green alga, Volvox carteri, evolved from a gene that in its unicellular relative, Chlamydomonas reinhardtii, is part of the general acclimation response to various environmental stress factors, which includes the temporary suppression of reproduction. Furthermore, we propose a model for the evolution of soma, in which by simulating the acclimation signal (i.e. a change in cellular redox status) in a developmental rather than environmental context, responses beneficial to a unicellular individual can be co-opted into an altruistic behaviour at the group level. The co-option of environmentally induced responses for reproductive altruism can contribute to the stability of this behaviour, as the loss of such responses would be costly for the individual. This hypothesis also predicts that temporally varying environments, which will select for more efficient acclimation responses, are likely to be more conducive to the evolution of reproductive altruism.

Ethylene-induced differential gene expression during abscission of citrus leaves

PubMed Central

Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel

2008-01-01

The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267

Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity

PubMed Central

2010-01-01

Background Activation of Toll-like receptors (TLRs) is widely accepted as an essential event for defence against infection. Many TLRs utilize a common signalling pathway that relies on activation of the kinase IRAK4 and the transcription factor NFκB for the rapid expression of immunity genes. Methods 21 K DNA microarray technology was used to evaluate LPS-induced (TLR4) gene responses in blood monocytes from a child with an IRAK4-deficiency. In vitro responsiveness to LPS was confirmed by real-time PCR and ELISA and compared to the clinical predisposition of the child and IRAK4-deficient mice to Gram negative infection. Results We demonstrated that the vast majority of LPS-responsive genes in IRAK4-deficient monocytes were greatly suppressed, an observation that is consistent with the described role for IRAK4 as an essential component of TLR4 signalling. The severely impaired response to LPS, however, is inconsistent with a remarkably low incidence of Gram negative infections observed in this child and other children with IRAK4-deficiency. This unpredicted clinical phenotype was validated by demonstrating that IRAK4-deficient mice had a similar resistance to infection with Gram negative S. typhimurium as wildtype mice. A number of immunity genes, such as chemokines, were expressed at normal levels in human IRAK4-deficient monocytes, indicating that particular IRAK4-independent elements within the repertoire of TLR4-induced responses are expressed. Conclusions Sufficient defence to Gram negative immunity does not require IRAK4 or a robust, 'classic' inflammatory and immune response. PMID:20105294

Ketamine and Imipramine Reverse Transcriptional Signatures of Susceptibility and Induce Resilience-Specific Gene Expression Profiles.

PubMed

Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Vialou, Vincent; Heller, Elizabeth A; Yieh, Lynn; LaBonté, Benoit; Peña, Catherine J; Shen, Li; Wittenberg, Gayle M; Nestler, Eric J

2017-02-15

Examining transcriptional regulation by antidepressants in key neural circuits implicated in depression and understanding the relation to transcriptional mechanisms of susceptibility and natural resilience may help in the search for new therapeutic agents. Given the heterogeneity of treatment response in human populations, examining both treatment response and nonresponse is critical. We compared the effects of a conventional monoamine-based tricyclic antidepressant, imipramine, and a rapidly acting, non-monoamine-based antidepressant, ketamine, in mice subjected to chronic social defeat stress, a validated depression model, and used RNA sequencing to analyze transcriptional profiles associated with susceptibility, resilience, and antidepressant response and nonresponse in the prefrontal cortex (PFC), nucleus accumbens, hippocampus, and amygdala. We identified similar numbers of responders and nonresponders after ketamine or imipramine treatment. Ketamine induced more expression changes in the hippocampus; imipramine induced more expression changes in the nucleus accumbens and amygdala. Transcriptional profiles in treatment responders were most similar in the PFC. Nonresponse reflected both the lack of response-associated gene expression changes and unique gene regulation. In responders, both drugs reversed susceptibility-associated transcriptional changes and induced resilience-associated transcription in the PFC. We generated a uniquely large resource of gene expression data in four interconnected limbic brain regions implicated in depression and its treatment with imipramine or ketamine. Our analyses highlight the PFC as a key site of common transcriptional regulation by antidepressant drugs and in both reversing susceptibility- and inducing resilience-associated molecular adaptations. In addition, we found region-specific effects of each drug, suggesting both common and unique effects of imipramine versus ketamine. Copyright © 2016 Society of Biological

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Aging-dependent alterations in gene expression and a mitochondrial signature of responsiveness to human influenza vaccination.

PubMed

Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C

2015-01-01

To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.

Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island

PubMed Central

Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao

2016-01-01

Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICEAc) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICEAc-located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity. PMID:27849579

Plant nodulation inducers enhance horizontal gene transfer of Azorhizobium caulinodans symbiosis island.

PubMed

Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun

2016-11-29

Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.

Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.

PubMed

Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C

2016-05-01

Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.

Cis-regulatory element based targeted gene finding: genome-wide identification of abscisic acid- and abiotic stress-responsive genes in Arabidopsis thaliana.

PubMed

Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S

2005-07-15

A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.

Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

PubMed Central

Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

2009-01-01

Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

Effects of mannose-binding lectin on pulmonary gene expression and innate immune inflammatory response to ozone

PubMed Central

Ciencewicki, Jonathan M.; Verhein, Kirsten C.; Gerrish, Kevin; McCaw, Zachary R.; Li, Jianying; Bushel, Pierre R.

2016-01-01

Ozone is a common, potent oxidant pollutant in industrialized nations. Ozone exposure causes airway hyperreactivity, lung hyperpermeability, inflammation, and cell damage in humans and laboratory animals, and exposure to ozone has been associated with exacerbation of asthma, altered lung function, and mortality. The mechanisms of ozone-induced lung injury and differential susceptibility are not fully understood. Ozone-induced lung inflammation is mediated, in part, by the innate immune system. We hypothesized that mannose-binding lectin (MBL), an innate immunity serum protein, contributes to the proinflammatory events caused by ozone-mediated activation of the innate immune system. Wild-type (Mbl+/+) and MBL-deficient (Mbl−/−) mice were exposed to ozone (0.3 ppm) for up to 72 h, and bronchoalveolar lavage fluid was examined for inflammatory markers. Mean numbers of eosinophils and neutrophils and levels of the neutrophil attractants C-X-C motif chemokines 2 [Cxcl2 (major intrinsic protein 2)] and 5 [Cxcl5 (limb expression, LIX)] in the bronchoalveolar lavage fluid were significantly lower in Mbl−/− than Mbl+/+ mice exposed to ozone. Using genome-wide mRNA microarray analyses, we identified significant differences in transcript response profiles and networks at baseline [e.g., nuclear factor erythroid-related factor 2 (NRF2)-mediated oxidative stress response] and after exposure (e.g., humoral immune response) between Mbl+/+ and Mbl−/− mice. The microarray data were further analyzed to discover several informative differential response patterns and subsequent gene sets, including the antimicrobial response and the inflammatory response. We also used the lists of gene transcripts to search the LINCS L1000CDS2 data sets to identify agents that are predicted to perturb ozone-induced changes in gene transcripts and inflammation. These novel findings demonstrate that targeted deletion of Mbl caused differential levels of inflammation-related gene sets at

Different gene-specific mechanisms determine the 'revised-response' memory transcription patterns of a subset of A. thaliana dehydration stress responding genes.

PubMed

Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya

2014-05-01

Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

PubMed

Panwar, Vinay; Bakkeren, Guus

2017-01-01

Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

CD8 single-cell gene coexpression reveals three different effector types present at distinct phases of the immune response

PubMed Central

Peixoto, António; Evaristo, César; Munitic, Ivana; Monteiro, Marta; Charbit, Alain; Rocha, Benedita; Veiga-Fernandes, Henrique

2007-01-01

To study in vivo CD8 T cell differentiation, we quantified the coexpression of multiple genes in single cells throughout immune responses. After in vitro activation, CD8 T cells rapidly express effector molecules and cease their expression when the antigen is removed. Gene behavior after in vivo activation, in contrast, was quite heterogeneous. Different mRNAs were induced at very different time points of the response, were transcribed during different time periods, and could decline or persist independently of the antigen load. Consequently, distinct gene coexpression patterns/different cell types were generated at the various phases of the immune responses. During primary stimulation, inflammatory molecules were induced and down-regulated shortly after activation, generating early cells that only mediated inflammation. Cytotoxic T cells were generated at the peak of the primary response, when individual cells simultaneously expressed multiple killer molecules, whereas memory cells lost killer capacity because they no longer coexpressed killer genes. Surprisingly, during secondary responses gene transcription became permanent. Secondary cells recovered after antigen elimination were more efficient killers than cytotoxic T cells present at the peak of the primary response. Thus, primary responses produced two transient effector types. However, after boosting, CD8 T cells differentiate into long-lived killer cells that persist in vivo in the absence of antigen. PMID:17485515

RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.

PubMed

Maldonado-Mendoza, Ignacio E; Harrison, Maria J

Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.

Mycobacterium tuberculosis ESAT6 induces IFN-β gene expression in Macrophages via TLRs-mediated signaling.

PubMed

Jang, Ah-Ra; Choi, Joo-Hee; Shin, Sung Jae; Park, Jong-Hwan

2018-04-01

Mycobacterium tuberculosis is a highly virulent bacterium that causes tuberculosis. It infects about one third of the world's population. Type I interferons (IFNs) play a detrimental role in host defense against M. tuberculosis infection. Proteins secreted by M. tuberculosis through ESX-1 secretion system contribute to type I IFNs production. However, the precise mechanism by which 6-kDa early secretory antigen target (ESAT6), one of ESX-1-mediated secretory proteins, induces type I IFNs production in host cells is currently unclear. Therefore, the objective of the present study was to determine the underlying molecular mechanism regulating ESAT6-mediated gene expression of IFN-β in macrophages. Recombinant ESAT6 produced from E. coli expression system induced IFN-β gene expression in various types of macrophages such as mouse bone marrow-derived macrophages (BMDMs), peritoneal macrophages, and MH-S cells (murine alveolar macrophage cell line). Deficiency of TLR4 and TRIF absolutely abrogated ESAT6-induced IFN-β gene expression. TLR2 and MyD88 were partially involved in IFN-β gene expression in response to low dose of ESAT6. Another recombinant ESAT6 produced from baculovirus system also upregulated IFN-β gene expression via TLR4-dependent pathway. Polymyxin B (PMB) treatment impaired LPS-induced IFN-β expression. However, IFN-β expression induced by ESAT6 was not influenced by PMB. This suggests that ESAT6-mediated IFN-β expression is not due to LPS contamination. Treatment with ESAT6 resulted in activation of TBK1 and IRF3 in macrophages. Such activation was abolished in TLR4- and TRIF-deficient cells. Moreover, inhibition of IRF3 and TBK1 suppressed IFN-β gene expression in response to ESAT6. Our results suggest that ESAT6 might contribute to virulence of M. tuberculosis by regulating type I IFNs production through TLR4-TRIF signaling pathway. Copyright © 2017 Elsevier Ltd. All rights reserved.

Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

PubMed

van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

2011-01-01

Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

A gene expression profile indicative of early stage HER2 targeted therapy response

PubMed Central

2013-01-01

Background Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Results Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. Conclusions In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor. Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents. PMID:23816254

Response of marine bacterioplankton pH homeostasis gene expression to elevated CO2

NASA Astrophysics Data System (ADS)

Bunse, Carina; Lundin, Daniel; Karlsson, Christofer M. G.; Akram, Neelam; Vila-Costa, Maria; Palovaara, Joakim; Svensson, Lovisa; Holmfeldt, Karin; González, José M.; Calvo, Eva; Pelejero, Carles; Marrasé, Cèlia; Dopson, Mark; Gasol, Josep M.; Pinhassi, Jarone

2016-05-01

Human-induced ocean acidification impacts marine life. Marine bacteria are major drivers of biogeochemical nutrient cycles and energy fluxes; hence, understanding their performance under projected climate change scenarios is crucial for assessing ecosystem functioning. Whereas genetic and physiological responses of phytoplankton to ocean acidification are being disentangled, corresponding functional responses of bacterioplankton to pH reduction from elevated CO2 are essentially unknown. Here we show, from metatranscriptome analyses of a phytoplankton bloom mesocosm experiment, that marine bacteria responded to lowered pH by enhancing the expression of genes encoding proton pumps, such as respiration complexes, proteorhodopsin and membrane transporters. Moreover, taxonomic transcript analysis showed that distinct bacterial groups expressed different pH homeostasis genes in response to elevated CO2. These responses were substantial for numerous pH homeostasis genes under low-chlorophyll conditions (chlorophyll a <2.5 μg l-1) however, the changes in gene expression under high-chlorophyll conditions (chlorophyll a >20 μg l-1) were low. Given that proton expulsion through pH homeostasis mechanisms is energetically costly, these findings suggest that bacterioplankton adaptation to ocean acidification could have long-term effects on the economy of ocean ecosystems.

Keap1 redox-dependent regulation of doxorubicin-induced oxidative stress response in cardiac myoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nordgren, Kendra K.S., E-mail: knordgre@d.umn.edu; Wallace, Kendall B., E-mail: kwallace@d.umn.edu

Doxorubicin (DOX) is a widely prescribed treatment for a broad scope of cancers, but clinical utility is limited by the cumulative, dose-dependent cardiomyopathy that occurs with repeated administration. DOX-induced cardiotoxicity is associated with the production of reactive oxygen species (ROS) and oxidation of lipids, DNA and proteins. A major cellular defense mechanism against such oxidative stress is activation of the Keap1/Nrf2-antioxidant response element (ARE) signaling pathway, which transcriptionally regulates expression of antioxidant genes such as Nqo1 and Gstp1. In the present study, we address the hypothesis that an initial event associated with DOX-induced oxidative stress is activation of the Keap1/Nrf2-dependentmore » expression of antioxidant genes and that this is regulated through drug-induced changes in redox status of the Keap1 protein. Incubation of H9c2 rat cardiac myoblasts with DOX resulted in a time- and dose-dependent decrease in non-protein sulfhydryl groups. Associated with this was a near 2-fold increase in Nrf2 protein content and enhanced transcription of several of the Nrf2-regulated down-stream genes, including Gstp1, Ugt1a1, and Nqo1; the expression of Nfe2l2 (Nrf2) itself was unaltered. Furthermore, both the redox status and the total amount of Keap1 protein were significantly decreased by DOX, with the loss of Keap1 being due to both inhibited gene expression and increased autophagic, but not proteasomal, degradation. These findings identify the Keap1/Nrf2 pathway as a potentially important initial response to acute DOX-induced oxidative injury, with the primary regulatory events being the oxidation and autophagic degradation of the redox sensor Keap1 protein. - Highlights: • DOX caused a ∼2-fold increase in Nrf2 protein content. • DOX enhanced transcription of several Nrf2-regulated down-stream genes. • Redox status and total amount of Keap1 protein were significantly decreased by DOX. • Loss of Keap1 protein was

Concurrent synthesis and release of nod-gene-inducing flavonoids from alfalfa roots. [Medicago sativa L. ; Rhizobium meliloti

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, C.A.; Phillips, D.A.

Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and releasemore » of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.« less

Inhibition of p38 mitogen-activated protein kinase impairs influenza virus-induced primary and secondary host gene responses and protects mice from lethal H5N1 infection.

PubMed

Börgeling, Yvonne; Schmolke, Mirco; Viemann, Dorothee; Nordhoff, Carolin; Roth, Johannes; Ludwig, Stephan

2014-01-03

Highly pathogenic avian influenza viruses (HPAIV) induce severe inflammation in poultry and men. One characteristic of HPAIV infections is the induction of a cytokine burst that strongly contributes to viral pathogenicity. This cell-intrinsic hypercytokinemia seems to involve hyperinduction of p38 mitogen-activated protein kinase. Here we investigate the role of p38 MAPK signaling in the antiviral response against HPAIV in mice as well as in human endothelial cells, the latter being a primary source of cytokines during systemic infections. Global gene expression profiling of HPAIV-infected endothelial cells in the presence of the p38-specific inhibitor SB 202190 revealed that inhibition of p38 MAPK leads to reduced expression of IFNβ and other cytokines after H5N1 and H7N7 infection. More than 90% of all virus-induced genes were either partially or fully dependent on p38 signaling. Moreover, promoter analysis confirmed a direct impact of p38 on the IFNβ promoter activity. Furthermore, upon treatment with IFN or conditioned media from HPAIV-infected cells, p38 controls interferon-stimulated gene expression by coregulating STAT1 by phosphorylation at serine 727. In vivo inhibition of p38 MAPK greatly diminishes virus-induced cytokine expression concomitant with reduced viral titers, thereby protecting mice from lethal infection. These observations show that p38 MAPK acts on two levels of the antiviral IFN response. Initially the kinase regulates IFN induction and, at a later stage, p38 controls IFN signaling and thereby expression of IFN-stimulated genes. Thus, inhibition of MAP kinase p38 may be an antiviral strategy that protects mice from lethal influenza by suppressing excessive cytokine expression.

Ancient genes establish stress-induced mutation as a hallmark of cancer.

PubMed

Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

Ancient genes establish stress-induced mutation as a hallmark of cancer

PubMed Central

Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

2017-01-01

Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

RNAseq analysis reveals pathways and candidate genes associated with salinity tolerance in a spaceflight-induced wheat mutant.

PubMed

Xiong, Hongchun; Guo, Huijun; Xie, Yongdun; Zhao, Linshu; Gu, Jiayu; Zhao, Shirong; Li, Junhui; Liu, Luxiang

2017-06-02

Salinity stress has become an increasing threat to food security worldwide and elucidation of the mechanism for salinity tolerance is of great significance. Induced mutation, especially spaceflight mutagenesis, is one important method for crop breeding. In this study, we show that a spaceflight-induced wheat mutant, named salinity tolerance 1 (st1), is a salinity-tolerant line. We report the characteristics of transcriptomic sequence variation induced by spaceflight, and show that mutations in genes associated with sodium ion transport may directly contribute to salinity tolerance in st1. Furthermore, GO and KEGG enrichment analysis of differentially expressed genes (DEGs) between salinity-treated st1 and wild type suggested that the homeostasis of oxidation-reduction process is important for salt tolerance in st1. Through KEGG pathway analysis, "Butanoate metabolism" was identified as a new pathway for salinity responses. Additionally, key genes for salinity tolerance, such as genes encoding arginine decarboxylase, polyamine oxidase, hormones-related, were not only salt-induced in st1 but also showed higher expression in salt-treated st1 compared with salt-treated WT, indicating that these genes may play important roles in salinity tolerance in st1. This study presents valuable genetic resources for studies on transcriptome variation caused by induced mutation and the identification of salt tolerance genes in crops.

Acetylation of hMOF Modulates H4K16ac to Regulate DNA Repair Genes in Response to Oxidative Stress.

PubMed

Zhong, Jianing; Ji, Liying; Chen, Huiqian; Li, Xianfeng; Zhang, Jian'an; Wang, Xingxing; Wu, Weilin; Xu, Ying; Huang, Fei; Cai, Wanshi; Sun, Zhong Sheng

2017-01-01

Oxidative stress is considered to be a key risk state for a variety of human diseases. In response to oxidative stress, the regulation of transcriptional expression of DNA repair genes would be important to DNA repair and genomic stability. However, the overall pattern of transcriptional expression of DNA repair genes and the underlying molecular response mechanism to oxidative stress remain unclear. Here, by employing colorectal cancer cell lines following exposure to hydrogen peroxide, we generated expression profiles of DNA repair genes via RNA-seq and identified gene subsets that are induced or repressed following oxidative stress exposure. RRBS-seq analyses further indicated that transcriptional regulation of most of the DNA repair genes that were induced or repressed is independent of their DNA methylation status. Our analyses also indicate that hydrogen peroxide induces deacetylase SIRT1 which decreases chromatin affinity and the activity of histone acetyltransferase hMOF toward H4K16ac and results in decreased transcriptional expression of DNA repair genes. Taken together, our findings provide a potential mechanism by which oxidative stress suppresses DNA repair genes which is independent of the DNA methylation status of their promoters.

Chlorhexidine Induces VanA-Type Vancomycin Resistance Genes in Enterococci

PubMed Central

Bhardwaj, Pooja; Ziegler, Elizabeth

2016-01-01

Chlorhexidine is a bisbiguanide antiseptic used for infection control. Vancomycin-resistant E. faecium (VREfm) is among the leading causes of hospital-acquired infections. VREfm may be exposed to chlorhexidine at supra- and subinhibitory concentrations as a result of chlorhexidine bathing and chlorhexidine-impregnated central venous catheter use. We used RNA sequencing to investigate how VREfm responds to chlorhexidine gluconate exposure. Among the 35 genes upregulated ≥10-fold after 15 min of exposure to the MIC of chlorhexidine gluconate were those encoding VanA-type vancomycin resistance (vanHAX) and those associated with reduced daptomycin susceptibility (liaXYZ). We confirmed that vanA upregulation was not strain or species specific by querying other VanA-type VRE. VanB-type genes were not induced. The vanH promoter was found to be responsive to subinhibitory chlorhexidine gluconate in VREfm, as was production of the VanX protein. Using vanH reporter experiments with Bacillus subtilis and deletion analysis in VREfm, we found that this phenomenon is VanR dependent. Deletion of vanR did not result in increased chlorhexidine susceptibility, demonstrating that vanHAX induction is not protective against chlorhexidine. As expected, VanA-type VRE is more susceptible to ceftriaxone in the presence of sub-MIC chlorhexidine. Unexpectedly, VREfm is also more susceptible to vancomycin in the presence of subinhibitory chlorhexidine, suggesting that chlorhexidine-induced gene expression changes lead to additional alterations in cell wall synthesis. We conclude that chlorhexidine induces expression of VanA-type vancomycin resistance genes and genes associated with daptomycin nonsusceptibility. Overall, our results indicate that the impacts of subinhibitory chlorhexidine exposure on hospital-associated pathogens should be further investigated in laboratory studies. PMID:26810654

Comparative analysis of TCDD-induced AhR-mediated gene expression in human, mouse and rat primary B cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kovalova, Natalia, E-mail: kovalova@msu.edu

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a persistent environmental pollutant that activates the aryl hydrocarbon receptor (AhR) resulting in altered gene expression. In vivo, in vitro, and ex vivo studies have demonstrated that B cells are directly impaired by TCDD, and are a sensitive target as evidenced by suppression of antibody responses. The window of sensitivity to TCDD-induced suppression of IgM secretion among mouse, rat and human B cells is similar. Specifically, TCDD must be present within the initial 12 h post B cell stimulation, indicating that TCDD disrupts early signaling network(s) necessary for B lymphocyte activation and differentiation. Therefore, we hypothesized thatmore » TCDD treatment across three different species (mouse, rat and human) triggers a conserved, B cell-specific mechanism that is involved in TCDD-induced immunosuppression. RNA sequencing (RNA-Seq) was used to identify B cell-specific orthologous genes that are differentially expressed in response to TCDD in primary mouse, rat and human B cells. Time course studies identified TCDD-elicited differential expression of 515 human, 2371 mouse and 712 rat orthologous genes over the 24-h period. 28 orthologs were differentially expressed in response to TCDD in all three species. Overrepresented pathways enriched in all three species included cytokine-cytokine receptor interaction, ECM-receptor interaction, focal adhesion, regulation of actin cytoskeleton and pathways in cancer. Differentially expressed genes functionally associated with cell-cell signaling in humans, immune response in mice, and oxidation reduction in rats. Overall, these results suggest that despite the conservation of the AhR and its signaling mechanism, TCDD elicits species-specific gene expression changes. - Highlights: • Kovalova TAAP Highlights Nov. 2016 • RNA-Seq identified TCDD-induced gene expression in PWM-activated primary B cells. • TCDD elicited differential expression of 515 human, 2371 mouse

Candidacy of a chitin-inducible gibberellin-responsive gene for a major locus affecting plant height in rice that is closely linked to Green Revolution gene sd1.

PubMed

Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong

2011-09-01

Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.

Comparison of gene expression responses to hypoxia in viviparous (Xiphophorus) and oviparous (Oryzias) fishes using a medaka microarray.

PubMed

Boswell, Mikki G; Wells, Melissa C; Kirk, Lyndsey M; Ju, Zhenlin; Zhang, Ziping; Booth, Rachell E; Walter, Ronald B

2009-03-01

Gene expression profiling using DNA microarray technology is a useful tool for assessing gene transcript level responses after an organism is exposed to environmental stress. Herein, we detail results from studies using an 8 k medaka (Oryzias latipes) microarray to assess modulated gene expression patterns upon hypoxia exposure of the live-bearing aquaria fish, Xiphophorus maculatus. To assess the reproducibility and reliability of using the medaka array in cross-genus hybridization, a two-factor ANOVA analysis of gene expression was employed. The data show the tissue source of the RNA used for array hybridization contributed more to the observed response of modulated gene targets than did the species source of the RNA. In addition, hierarchical clustering via heat map analyses of groupings of tissues and species (Xiphophorus and medaka) suggests that hypoxia induced similar responses in the same tissues from these two diverse aquatic model organisms. Our Xiphophorus results indicate 206 brain, 37 liver, and 925 gill gene targets exhibit hypoxia induced expression changes. Analysis of the Xiphophorus data to determine those features exhibiting a significant (p<0.05)+/-3 fold change produced only two gene targets within brain tissue and 80 features within gill tissue. Of these 82 characterized features, 39 were identified via homology searching (cut-off E-value of 1 x 10(-5)) and placed into one or more biological process gene ontology groups. Among these 39 genes, metabolic energy changes and manipulation was the most affected biological pathway (13 genes).

Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.

PubMed

Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi

2013-01-01

In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

PubMed

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Tissue-Specific Autoregulation of the stat3 Gene and Its Role in Interleukin-6-Induced Survival Signals in T Cells

PubMed Central

Narimatsu, Masahiro; Maeda, Hisoka; Itoh, Shousaku; Atsumi, Toru; Ohtani, Takuya; Nishida, Keigo; Itoh, Motoyuki; Kamimura, Daisuke; Park, Sung-Joo; Mizuno, Katsunori; Miyazaki, Jun-ichi; Hibi, Masahiko; Ishihara, Katsuhiko; Nakajima, Koichi; Hirano, Toshio

2001-01-01

Signal transducer and activator of transcription 3 (STAT3) mediates signals of various growth factors and cytokines, including interleukin-6 (IL-6). In certain IL-6-responsive cell lines, the stat3 gene is autoregulated by STAT3 through a composite IL-6 response element in its promoter that contains a STAT3-binding element (SBE) and a cyclic AMP-responsive element. To reveal the nature and roles of the stat3 autoregulation in vivo, we generated mice that harbor a mutation in the SBE (stat3mSBE). The intact SBE was crucial for IL-6-induced stat3 gene activation in the spleen, especially in the red pulp region, the kidney, and both mature and immature T lymphocytes. The SBE was not required, however, for IL-6-induced stat3 gene activation in hepatocytes. T lymphocytes from the stat3mSBE/mSBE mice were more susceptible to apoptosis despite the presence of IL-6 than those from wild-type mice. Consistent with this, IL-6-dependent activation of the Pim-1 and junB genes, direct target genes for STAT3, was attenuated in T lymphocytes of the stat3mSBE/mSBE mice. Thus, the tissue-specific autoregulation of the stat3 gene operates in vivo and plays a role in IL-6-induced antiapoptotic signaling in T cells. PMID:11533249

Probiotic lactobacillus and estrogen effects on vaginal epithelial gene expression responses to Candida albicans.

PubMed

Wagner, R Doug; Johnson, Shemedia J

2012-06-20

Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic

Adrenergic Receptor Stimulation Prevents Radiation-Induced DNA Strand Breaks, Apoptosis and Gene Expression in Simulated Microgravity

NASA Technical Reports Server (NTRS)

Moreno-Villanueva, Maria; Krieger, Stephanie; Feiveson, Alan; Kovach, Annie Marie; Buerkle, Alexander; Wu, Honglu

2017-01-01

Under Earth gravity conditions cellular damage can be counteracted by activation of the physiological defense mechanisms or through medical interventions. The mode of action of both, physiological response and medical interventions can be affected by microgravity leading to failure in repairing the damage. There are many studies reporting the effects of microgravity and/or radiation on cellular functions. However, little is known about the synergistic effects on cellular response to radiation when other endogenous cellular stress-response pathways are previously activated. Here, we investigated whether previous stimulation of the adrenergic receptor, which modulates immune response, affects radiation-induced apoptosis in immune cells under simulated microgravity conditions. Peripheral blood mononuclear cells (PBMCs) were stimulated with isoproterenol (a sympathomimetic drug) and exposed to 0.8 or 2Gy gamma-radiation in simulated microgravity versus Earth gravity. Expression of genes involved in adrenergic receptor pathways, DNA repair and apoptosis as well as the number of apoptotic cells and DNA strand breaks were determined. Our results showed that, under simulated microgravity conditions, previous treatment with isoproterenol prevented radiation-induced i) gene down regulation, ii) DNA strand breaks formation and iii) apoptosis induction. Interestedly, we found a radiation-induced increase of adrenergic receptor gene expression, which was also abolished in simulated microgravity. Understanding the mechanisms of isoproterenol-mediated radioprotection in simulated microgravity can help to develop countermeasures for space-associated health risks as well as radio-sensitizers for cancer therapy.

Distinct structural transitions of chromatin topological domains correlate with coordinated hormone-induced gene regulation

PubMed Central

Le Dily, François; Baù, Davide; Pohl, Andy; Vicent, Guillermo P.; Serra, François; Soronellas, Daniel; Castellano, Giancarlo; Wright, Roni H.G.; Ballare, Cecilia; Filion, Guillaume; Marti-Renom, Marc A.

2014-01-01

The human genome is segmented into topologically associating domains (TADs), but the role of this conserved organization during transient changes in gene expression is not known. Here we describe the distribution of progestin-induced chromatin modifications and changes in transcriptional activity over TADs in T47D breast cancer cells. Using ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing), Hi-C (chromosome capture followed by high-throughput sequencing), and three-dimensional (3D) modeling techniques, we found that the borders of the ∼2000 TADs in these cells are largely maintained after hormone treatment and that up to 20% of the TADs could be considered as discrete regulatory units where the majority of the genes are either transcriptionally activated or repressed in a coordinated fashion. The epigenetic signatures of the TADs are homogeneously modified by hormones in correlation with the transcriptional changes. Hormone-induced changes in gene activity and chromatin remodeling are accompanied by differential structural changes for activated and repressed TADs, as reflected by specific and opposite changes in the strength of intra-TAD interactions within responsive TADs. Indeed, 3D modeling of the Hi-C data suggested that the structure of TADs was modified upon treatment. The differential responses of TADs to progestins and estrogens suggest that TADs could function as “regulons” to enable spatially proximal genes to be coordinately transcribed in response to hormones. PMID:25274727

Diet-Induced Obesity Reprograms the Inflammatory Response of the Murine Lung to Inhaled Endotoxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tilton, Susan C.; Waters, Katrina M.; Karin, Norman J.

The co-occurrence of environmental factors is common in complex human diseases and, as such, understanding the molecular responses involved is essential to determine risk and susceptibility to disease. We have investigated the key biological pathways that define susceptibility for pulmonary infection during obesity in diet-induced obese (DIO) and regular weight (RW) C57BL/6 mice exposed to inhaled lipopolysaccharide (LPS). LPS induced a strong inflammatory response in all mice as indicated by elevated cell counts of macrophages and neutrophils and levels of proinflammatory cytokines (MDC, MIP-1γ, IL-12, RANTES) in the bronchoalveolar lavage fluid. Additionally, DIO mice exhibited 50% greater macrophage cell counts,more » but decreased levels of the cytokines, IL-6, TARC, TNF-α, and VEGF relative to RW mice. Microarray analysis of lung tissue showed over half of the LPS-induced expression in DIO mice consisted of genes unique for obese mice, suggesting that obesity reprograms how the lung responds to subsequent insult. In particular, we found that obese animals exposed to LPS have gene signatures showing increased inflammatory and oxidative stress response and decreased antioxidant capacity compared with RW. Because signaling pathways for these responses can be common to various sources of environmentally induced lung damage, we further identified biomarkers that are indicative of specific toxicant exposure by comparing gene signatures after LPS exposure to those from a parallel study with cigarette smoke. These data show obesity may increase sensitivity to further insult and that co-occurrence of environmental stressors result in complex biosignatures that are not predicted from analysis of individual exposures.« less

Metalloproteinases and their associated genes contribute to the functional integrity and noise-induced damage in the cochlear sensory epithelium

PubMed Central

Hu, Bo Hua; Cai, Qunfeng; Hu, Zihua; Patel, Minal; Bard, Jonathan; Jamison, Jennifer; Coling, Donald

2012-01-01

Matrix metalloproteinases (MMPs) and their related gene products regulate essential cellular functions. An imbalance in MMPs has been implicated in various neurological disorders, including traumatic injuries. Here, we report a role for MMPs and their related gene products in the modulation of cochlear responses to acoustic trauma in rats. The normal cochlea was shown to be enriched in MMP enzymatic activity, and this activity was reduced in a time-dependent fashion after traumatic noise injury. The analysis of gene expression by RNA-seq and qRT-PCR revealed the differential expression of MMPs and their related genes between functionally specialized regions of the sensory epithelium. The expression of these genes was dynamically regulated between the acute and chronic phases of noise-induced hearing loss. Moreover, noise-induced expression changes in two endogenous MMP inhibitors, Timp1 and Timp2, in sensory cells were dependent upon the stage of nuclear condensation, suggesting a specific role for MMP activity in sensory cell apoptosis. A short-term application of doxycycline, a broad-spectrum inhibitor of MMPs, prior to noise exposure reduced noise-induced hearing loss and sensory cell death. By contrast, a 7-day treatment compromised hearing sensitivity and potentiated noise-induced hearing loss. This detrimental effect of the long-term inhibition of MMPs on noise-induced hearing loss was further confirmed using targeted Mmp7 knockout mice. Together, these observations suggest that MMPs and their related genes participate in the regulation of cochlear responses to acoustic overstimulation and that the modulation of MMP activity can serve as a novel therapeutic target for the reduction of noise-induced cochlear damage. PMID:23100416

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

PubMed Central

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium).

PubMed

Xia, Xiaolong; Shao, Yafeng; Jiang, Jiafu; Ren, Liping; Chen, Fadi; Fang, Weimin; Guan, Zhiyong; Chen, Sumei

2014-12-02

Chrysanthemum is an important ornamental plant all over the world. It is easily attacked by aphid, Macrosiphoniella sanbourni. The molecular mechanisms of plant defense responses to aphid are only partially understood. Here, we investigate the gene expression changes in response to aphid feeding in chrysanthemum leaf by RNA-Seq technology. Three libraries were generated from pooled leaf tissues of Chrysanthemum morifolium 'nannongxunzhang' that were collected at different time points with (Y) or without (CK) aphid infestations and mock puncture treatment (Z), and sequenced using an Illumina HiSeqTM 2000 platform. A total of 7,363,292, 7,215,860 and 7,319,841 clean reads were obtained in library CK, Y and Z, respectively. The proportion of clean reads was >97.29% in each library. Approximately 76.35% of the clean reads were mapped to a reference gene database including all known chrysanthemum unigene sequences. 1,157, 527 and 340 differentially expressed genes (DEGs) were identified in the comparison of CK-VS-Y, CK-VS-Z and Z-VS-Y, respectively. These DEGs were involved in phytohormone signaling, cell wall biosynthesis, photosynthesis, reactive oxygen species (ROS) pathway and transcription factor regulatory networks, and so on. Changes in gene expression induced by aphid feeding are shown to be multifaceted. There are various forms of crosstalk between different pathways those genes belonging to, which would allow plants to fine-tune its defense responses.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

PubMed

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

Study of the Genes and Mechanism Involved in the Radioadaptive Response

NASA Technical Reports Server (NTRS)

Dasgupta, Pushan R.

2009-01-01

The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor

A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

PubMed Central

Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

2010-01-01

Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

[Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].

PubMed

Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi

2004-09-01

HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.

Rescue Effects and Underlying Mechanisms of Intragland Shh Gene Delivery on Irradiation-Induced Hyposalivation.

PubMed

Hai, Bo; Zhao, Qingguo; Qin, Lizheng; Rangaraj, Dharanipathy; Gutti, Veera R; Liu, Fei

2016-05-01

Irreversible hypofunction of salivary glands is common in head and neck cancer survivors treated with radiotherapy and can only be temporarily relieved with current treatments. We found in an inducible sonic hedgehog (Shh) transgenic mouse model that transient activation of the Hedgehog pathway after irradiation rescued salivary gland function in males by preserving salivary stem/progenitor cells and parasympathetic innervation. To translate these findings into feasible clinical application, we evaluated the effects of Shh gene transfer to salivary glands of wild-type mice on irradiation-induced hyposalivation. Shh or control GFP gene was delivered by noninvasive retrograde ductal instillation of corresponding adenoviral vectors. In both male and female mice, Shh gene delivery efficiently activated Hedgehog/Gli signaling, and significantly improved stimulated saliva secretion and preserved saliva-producing acinar cells after irradiation. In addition to preserving parasympathetic innervation through induction of neurotrophic factors, Shh gene delivery also alleviated the irradiation damage of the microvasculature, likely via inducing angiogenic factors, but did not expand the progeny of cells responsive to Hedgehog/Gli signaling. These data indicate that transient activation of the Hedgehog pathway by gene delivery is promising to rescue salivary function after irradiation in both sexes, and the Hedgehog/Gli pathway may function mainly in cell nonautonomous manners to achieve the rescue effect.

Pharmacogenetics of clozapine response and induced weight gain: A comprehensive review and meta-analysis.

PubMed

Gressier, Florence; Porcelli, Stefano; Calati, Raffaella; Serretti, Alessandro

2016-02-01

Clozapine (CLZ) is the prototype atypical antipsychotic and it has many advantages over other antipsychotic drugs. Several data suggest that both CLZ response and induced weight gain are strongly determined by genetic variability. However, results remain mainly inconclusive. We aim to review the literature data about pharmacogenetics studies on CLZ efficacy, focusing on pharmacodynamic genes. Further, we performed meta-analyses on response when at least three studies for each polymorphism were available. Sensitivity analyses were conducted on Caucasian population when feasible. Electronic literature search was performed to identify pertinent studies published until May 2014 using PubMed, ISI Web of Knowledge and PsycINFO databases. For meta-analyses, data were entered and analyzed through RevMan version 5.2 using a random-effect model. Our literature search yielded 9266 articles on CLZ; among these, we identified 59 pertinent pharmacogenetic studies. Genotype data were retrieved for 14 polymorphisms in 9 genes. Among these, we had available data from at least three independent samples for 8 SNPs in 6 genes to perform meta-analyses: DRD2 rs1799732, DRD3 rs6280, HTR2A rs6313, rs6311, rs6314, HTR2C rs6318, HTR3A rs1062613, TNFa rs1800629. Although literature review provided conflicting results, in meta-analyses three genetic variants within serotonin genes resulted associated to CLZ response: rs6313 and rs6314 within HTR2A gene and rs1062613 within HT3A gene. On the other hand, no clear finding emerged for CLZ-induced weight gain. Our results suggest a possible serotonergic modulation of CLZ clinical response. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

The Yeast Environmental Stress Response Regulates Mutagenesis Induced by Proteotoxic Stress

PubMed Central

Shor, Erika; Fox, Catherine A.; Broach, James R.

2013-01-01

Conditions of chronic stress are associated with genetic instability in many organisms, but the roles of stress responses in mutagenesis have so far been elucidated only in bacteria. Here, we present data demonstrating that the environmental stress response (ESR) in yeast functions in mutagenesis induced by proteotoxic stress. We show that the drug canavanine causes proteotoxic stress, activates the ESR, and induces mutagenesis at several loci in an ESR-dependent manner. Canavanine-induced mutagenesis also involves translesion DNA polymerases Rev1 and Polζ and non-homologous end joining factor Ku. Furthermore, under conditions of chronic sub-lethal canavanine stress, deletions of Rev1, Polζ, and Ku-encoding genes exhibit genetic interactions with ESR mutants indicative of ESR regulating these mutagenic DNA repair processes. Analyses of mutagenesis induced by several different stresses showed that the ESR specifically modulates mutagenesis induced by proteotoxic stress. Together, these results document the first known example of an involvement of a eukaryotic stress response pathway in mutagenesis and have important implications for mechanisms of evolution, carcinogenesis, and emergence of drug-resistant pathogens and chemotherapy-resistant tumors. PMID:23935537

The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.

PubMed

Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather

2012-07-01

• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

9-cis-retinoic acid represses estrogen-induced expression of the very low density apolipoprotein II gene.

PubMed

Schippers, I J; Kloppenburg, M; Snippe, L; Ab, G

1994-11-01

The chicken very low density apolipoprotein II (apoVLDLII) gene is estrogen-inducible and specifically expressed in liver. We examined the possible involvement of the retinoid X receptor (RXR) and its ligand 9-cis-retinoic acid (9-cis-RA) in the activation of the apoVLDLII promoter. We first concentrated on a potential RXR recognition site, which deviates at only one position from a perfect direct A/GGGTCA repeat spaced by one nucleotide (DR-1) and was earlier identified as a common HNF-4/COUP-TF recognition site. However, band shift analysis revealed that this imperfect DR-1 motif does not interact with RXR alpha-homodimers. In accordance with this observation we found that this regulatory element does not mediate transactivation through RXR alpha in the presence of 9-cis-RA. However, our experiments revealed another, unexpected, effect of 9-cis-RA. Instead of stimulating, 9-cis-RA attenuated estrogen-induced expression of transfected estrogen-responsive VLDL-CAT reporter plasmids. This repression appeared to take place through the main estrogen response element (ERE) of the gene. Importantly, 9-cis-RA also strongly repressed the estrogen-induced expression of the endogenous apoVLDLII gene in cultured chicken hepatoma cells.

Human native lipoprotein-induced de novo DNA methylation is associated with repression of inflammatory genes in THP-1 macrophages.

PubMed

Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio

2011-11-25

We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.

Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

PubMed

Mazzoni, C; Santori, F; Saliola, M; Falcone, C

2000-01-01

KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

Pathogen-induced elicitin production in transgenic tobacco generates a hypersensitive response and nonspecific disease resistance.

PubMed Central

Keller, H; Pamboukdjian, N; Ponchet, M; Poupet, A; Delon, R; Verrier, J L; Roby, D; Ricci, P

1999-01-01

The rapid and effective activation of disease resistance responses is essential for plant defense against pathogen attack. These responses are initiated when pathogen-derived molecules (elicitors) are recognized by the host. We have developed a strategy for creating novel disease resistance traits whereby transgenic plants respond to infection by a virulent pathogen with the production of an elicitor. To this end, we generated transgenic tobacco plants harboring a fusion between the pathogen-inducible tobacco hsr 203J gene promoter and a Phytophthora cryptogea gene encoding the highly active elicitor cryptogein. Under noninduced conditions, the transgene was silent, and no cryptogein could be detected in the transgenic plants. In contrast, infection by the virulent fungus P. parasitica var nicotianae stimulated cryptogein production that coincided with the fast induction of several defense genes at and around the infection sites. Induced elicitor production resulted in a localized necrosis that resembled a P. cryptogea-induced hypersensitive response and that restricted further growth of the pathogen. The transgenic plants displayed enhanced resistance to fungal pathogens that were unrelated to Phytophthora species, such as Thielaviopsis basicola, Erysiphe cichoracearum, and Botrytis cinerea. Thus, broad-spectrum disease resistance of a plant can be generated without the constitutive synthesis of a transgene product. PMID:9927640

Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens

PubMed Central

Hao, Hai-Ting; Zhao, Xia; Shang, Qian-Han; Wang, Yun; Guo, Zhi-Hong; Zhang, Yu-Bao; Xie, Zhong-Kui; Wang, Ruo-Yu

2016-01-01

Some plant growth-promoting rhizobacteria (PGPR) regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE) profiling of different growth stages (seedling and mature) and tissues (leaves and roots). Compared with the control, 1,507 and 820 differentially expressed genes (DEGs) were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation) with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response to biotic

Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression

DTIC Science & Technology

1998-05-01

Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method...termed subtractive display. The subtractive display screen identified 42 monoterpene -induced genes comprising 9 known genes and 33 unidentified genes...as well as 58 monoterpene -repressed genes comprising 1 known gene and 57 unidentified genes. Several of the identified differentially expressed

Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.

PubMed

Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae

2014-12-01

Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.

Hydrogen Peroxide-Induced Secreted Frizzled-Related Protein 1 Gene Demethylation Contributes to Hydrogen Peroxide-Induced Apoptosis in Human U251 Glioma Cells.

PubMed

Xing, Zhiguo; Ni, Yaping; Zhao, Junjie; Ma, Xudong

2017-05-01

Glioblastoma multiforme is a type of central nervous system tumor with extremely poor prognosis. Previously, hydrogen peroxide (H 2 O 2 ), which promotes the oxidative stress response, has been reported to induce the apoptosis of glioma cells. Recently, secreted frizzled-related protein 1 (SFRP1) has been shown to be associated with various types of malignant tumors and with H 2 O 2 -induced oxidative stress in cardiomyocytes by negatively regulating the Wnt signaling pathway. This study aimed to explore SFRP1 expression and its roles in H 2 O 2 -induced apoptosis in human glioma cells. We found that the SFRP1 level was decreased in several human glioma cell lines, including U87, U251, and SW1783 cells. In U251 cells, SFRP1 could function as a cancer suppressor gene, and the growth of U251 cells could be inhibited not only by H 2 O 2 but also by the overexpression of SFRP1. Furthermore, we demonstrated that H 2 O 2 -induced SFRP1 gene demethylation partially contributed to H 2 O 2 -induced U251 cell apoptosis, which was verified by studies using an SFRP inhibitor (WAY-316606). Our research identified that H 2 O 2 -induced SFRP1 gene demethylation contributes to H 2 O 2 -induced apoptosis in human U251 glioma cells.

Ultrasound-responsive gene-activated matrices for osteogenic gene therapy using matrix-assisted sonoporation.

PubMed

Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P

2018-01-01

Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

PubMed

Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

2009-10-01

To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the

Two Novel Anoxia-Induced Ethylene Response Factors That Interact with Promoters of Deastringency-Related Genes from Persimmon

PubMed Central

Min, Ting; Fang, Fang; Ge, Hang; Shi, Yan-na; Luo, Zheng-rong; Yao, Yun-cong; Grierson, Donald; Yin, Xue-ren; Chen, Kun-song

2014-01-01

A hypoxic environment is generally undesirable for most plants and stimulates anaerobic metabolism. It is a beneficial treatment, however, for the removal of astringency from persimmon to improve the fruit quality after harvest. High soluble tannins (SCTs) content is one of most important causes of astringency. High CO2 (95%) treatment effectively reduced SCTs in both “Mopan” and “Gongcheng-shuishi” persimmon fruit by causing increases in acetaldehyde. Using RNA-seq and realtime PCR, twelve ethylene response factor genes (DkERF11-22) were isolated and characterized, to determine those responsive to high CO2 treatment. Only two genes, DkERF19 and DkERF22, showed trans-activation effects on the promoters of deastringency-related genes pyruvate decarboxylase genes (DkPDC2 and DkPDC3) and the transcript levels of these genes was enhanced by hypoxia. Moreover, DkERF19 and the previously isolated DkERF9 had additive effects on activating the DkPDC2 promoter. Taken together, these results provide further evidence that transcriptome changes in the level of DkERF mRNAs regulate deastringency-related genes and their role in the mechanism of persimmon fruit deastringency is discussed. PMID:24805136

Trichostatin A Selectively Suppresses the Cold-Induced Transcription of the ZmDREB1 Gene in Maize

PubMed Central

Hu, Yong; Zhang, Lu; Zhao, Lin; Li, Jun; He, Shibin; Zhou, Kun; Yang, Fei; Huang, Min; Jiang, Li; Li, Lijia

2011-01-01

Post-translational modifications of histone proteins play a crucial role in responding to environmental stresses. Histone deacetylases (HDACs) catalyze the removal of an acetyl group from histones and are generally believed to be a transcriptional repressor. In this paper, we report that cold treatment highly induces the up-regulation of HDACs, leading to global deacetylation of histones H3 and H4. Treatment of maize with the HDAC inhibitor trichostatin A (TSA) under cold stress conditions strongly inhibits induction of the maize cold-responsive genes ZmDREB1 and ZmCOR413. However, up-regulation of the ZmICE1 gene in response to cold stress is less affected. The expression of drought and salt induced genes, ZmDBF1 and rab17, is almost unaffected by TSA treatment. Thus, these observations show that HDACs may selectively activate transcription. The time course of TSA effects on the expression of ZmDREB1 and ZmCOR413 genes indicates that HDACs appear to directly activate the ZmDREB1 gene, which in turn modulates ZmCOR413 expression. After cold treatment, histone hyperacetylation and DNA demethylation occurs in the ICE1 binding region, accompanied by an increase in accessibility to micrococcal nuclease (MNase). The two regions adjacent to the ICE1 binding site remain hypoacetylated and methylated. However, during cold acclimation, TSA treatment increases the acetylation status and accessibility of MNase and decreases DNA methylation at these two regions. However, TSA treatment does not affect histone hyperacetylation and DNA methylation levels at the ICE1 binding regions of the ZmDREB1 gene. Altogether, our findings indicate that HDACs positively regulate the expression of the cold-induced ZmDREB1 gene through histone modification and chromatin conformational changes and that this activation is both gene and site selective. PMID:21811564

Gene profiling reveals a role for stress hormones in the molecular and behavioral response to food restriction

PubMed Central

Guarnieri, Douglas J.; Brayton, Catherine E.; Richards, Sarah M.; Maldonado-Aviles, Jaime; Trinko, Joseph R.; Nelson, Jessica; Taylor, Jane R.; Gourley, Shannon L.; DiLeone, Ralph J.

2011-01-01

Background Food restriction is known to enhance learning and motivation. The neural mechanisms underlying these responses likely involve alterations in gene expression in brain regions mediating the motivation to feed. Methods Analysis of gene expression profiles in male C57BL6/J mice using whole-genome microarrays was completed in the medial prefrontal cortex, nucleus accumbens, ventral tegmental area, and the hypothalamus following a five day food restriction. Quantitative PCR was used to validate these findings and determine the time-course of expression changes. Plasma levels of the stress hormone corticosterone (CORT) were measured by ELISA. Expression changes were measured in adrenalectomized animals that underwent food restriction, as well as in animals receiving daily injections of CORT. Progressive ratio responding for food, a measure of motivated behavior, was assessed after CORT treatment in restricted and fed animals. Results Brief food restriction results in an upregulation of peripheral stress responsive genes in the mammalian brain. Time-course analysis demonstrated rapid and persistent expression changes in all four brain regions under study. Administration of CORT to non-restricted animals was sufficient to induce a subset of the genes, and alterations in gene expression after food restriction were dependent on intact adrenal glands. CORT can increase the motivation to work for food only in the restricted state. Conclusions These data demonstrate a central role for CORT in mediating both molecular and behavioral responses to food restriction. The stress hormone-induced alterations in gene expression described here may be relevant for both adaptive and pathological responses to stress. PMID:21855858

Mechanisms of crystalline silica-induced pulmonary toxicity revealed by global gene expression profiling

PubMed Central

Sellamuthu, Rajendran; Umbright, Christina; Li, Shengqiao; Kashon, Michael; Joseph, Pius

2015-01-01

A proper understanding of the mechanisms underlying crystalline silica-induced pulmonary toxicity has implications in the management and potential prevention of the adverse health effects associated with silica exposure including silicosis, cancer and several auto-immune diseases. Human lung type II epithelial cells and rat lungs exposed to crystalline silica were employed as experimental models to determine global gene expression changes in order to understand the molecular mechanisms underlying silica-induced pulmonary toxicity. The differential gene expression profile induced by silica correlated with its toxicity in the A549 cells. The biological processes perturbed by silica exposure in the A549 cells and rat lungs, as identified by the bioinformatics analysis of the differentially expressed genes, demonstrated significant similarity. Functional categorization of the differentially expressed genes identified cancer, cellular movement, cellular growth and proliferation, cell death, inflammatory response, cell cycle, cellular development, and genetic disorder as top ranking biological functions perturbed by silica exposure in A549 cells and rat lungs. Results of our study, in addition to confirming several previously identified molecular targets and mechanisms involved in silica toxicity, identified novel molecular targets and mechanisms potentially involved in silica-induced pulmonary toxicity. Further investigations, including those focused on the novel molecular targets and mechanisms identified in the current study may result in better management and, possibly, reduction and/or prevention of the potential adverse health effects associated with crystalline silica exposure. PMID:22087542

Gene Expression Analysis Reveals New Possible Mechanisms of Vancomycin-Induced Nephrotoxicity and Identifies Gene Markers Candidates

PubMed Central

Dieterich, Christine; Puey, Angela; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C.; Ng, Hanna H.

2009-01-01

Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and sacrificed on day 8. Clinical chemistry and histopathology demonstrated kidney injury at 400 mg/kg only. Hierarchical clustering analysis revealed that kidney gene expression profiles of all mice treated at 400 mg/kg clustered with those of mice administered 200 mg/kg iv. Transcriptional profiling might thus be more sensitive than current clinical markers for detecting kidney damage, though the profiles can differ with the route of administration. Analysis of transcripts whose expression was changed by at least twofold compared with vehicle saline after high iv and ip doses of vancomycin suggested the possibility of oxidative stress and mitochondrial damage in vancomycin-induced toxicity. In addition, our data showed changes in expression of several transcripts from the complement and inflammatory pathways. Such expression changes were confirmed by relative real-time reverse transcription–polymerase chain reaction. Finally, our results further substantiate the use of gene markers of kidney toxicity such as KIM-1/Havcr1, as indicators of renal injury. PMID:18930951

Gene expression analysis reveals new possible mechanisms of vancomycin-induced nephrotoxicity and identifies gene markers candidates.

PubMed

Dieterich, Christine; Puey, Angela; Lin, Sylvia; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C; Ng, Hanna H

2009-01-01

Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and sacrificed on day 8. Clinical chemistry and histopathology demonstrated kidney injury at 400 mg/kg only. Hierarchical clustering analysis revealed that kidney gene expression profiles of all mice treated at 400 mg/kg clustered with those of mice administered 200 mg/kg iv. Transcriptional profiling might thus be more sensitive than current clinical markers for detecting kidney damage, though the profiles can differ with the route of administration. Analysis of transcripts whose expression was changed by at least twofold compared with vehicle saline after high iv and ip doses of vancomycin suggested the possibility of oxidative stress and mitochondrial damage in vancomycin-induced toxicity. In addition, our data showed changes in expression of several transcripts from the complement and inflammatory pathways. Such expression changes were confirmed by relative real-time reverse transcription-polymerase chain reaction. Finally, our results further substantiate the use of gene markers of kidney toxicity such as KIM-1/Havcr1, as indicators of renal injury.

Mapping photothermally induced gene expression in living cells and tissues by nanorod-locked nucleic acid complexes.

PubMed

Riahi, Reza; Wang, Shue; Long, Min; Li, Na; Chiou, Pei-Yu; Zhang, Donna D; Wong, Pak Kin

2014-04-22

The photothermal effect of plasmonic nanostructures has numerous applications, such as cancer therapy, photonic gene circuit, large cargo delivery, and nanostructure-enhanced laser tweezers. The photothermal operation can also induce unwanted physical and biochemical effects, which potentially alter the cell behaviors. However, there is a lack of techniques for characterizing the dynamic cell responses near the site of photothermal operation with high spatiotemporal resolution. In this work, we show that the incorporation of locked nucleic acid probes with gold nanorods allows photothermal manipulation and real-time monitoring of gene expression near the area of irradiation in living cells and animal tissues. The multimodal gold nanorod serves as an endocytic delivery reagent to transport the probes into the cells, a fluorescence quencher and a binding competitor to detect intracellular mRNA, and a plasmonic photothermal transducer to induce cell ablation. We demonstrate the ability of the gold nanorod-locked nucleic acid complex for detecting the spatiotemporal gene expression in viable cells and tissues and inducing photothermal ablation of single cells. Using the gold nanorod-locked nucleic acid complex, we systematically characterize the dynamic cellular heat shock responses near the site of photothermal operation. The gold nanorod-locked nucleic acid complex enables mapping of intracellular gene expressions and analyzes the photothermal effects of nanostructures toward various biomedical applications.

Genomic Analysis Reveals Contrasting PIFq Contribution to Diurnal Rhythmic Gene Expression in PIF-Induced and -Repressed Genes.

PubMed

Martin, Guiomar; Soy, Judit; Monte, Elena

2016-01-01

Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.

phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

PubMed

Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

2015-09-17

Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

Variable transcriptional responsiveness of the P2X3 receptor gene during CFA-induced inflammatory hyperalgesia.

PubMed

Nuñez-Badinez, Paulina; Sepúlveda, Hugo; Diaz, Emilio; Greffrath, Wolfgang; Treede, Rolf-Detlef; Stehberg, Jimmy; Montecino, Martin; van Zundert, Brigitte

2018-05-01

The purinergic receptor P2X3 (P2X3-R) plays important roles in molecular pathways of pain, and reduction of its activity or expression effectively reduces chronic inflammatory and neuropathic pain sensation. Inflammation, nerve injury, and cancer-induced pain can increase P2X3-R mRNA and/or protein levels in dorsal root ganglia (DRG). However, P2X3-R expression is unaltered or even reduced in other pain studies. The reasons for these discrepancies are unknown and might depend on the applied traumatic intervention or on intrinsic factors such as age, gender, genetic background, and/or epigenetics. In this study, we sought to get insights into the molecular mechanisms responsible for inflammatory hyperalgesia by determining P2X3-R expression in DRG neurons of juvenile male rats that received a Complete Freund's Adjuvant (CFA) bilateral paw injection. We demonstrate that all CFA-treated rats showed inflammatory hyperalgesia, however, only a fraction (14-20%) displayed increased P2X3-R mRNA levels, reproducible across both sides. Immunostaining assays did not reveal significant increases in the percentage of P2X3-positive neurons, indicating that increased P2X3-R at DRG somas is not critical for inducing inflammatory hyperalgesia in CFA-treated rats. Chromatin immunoprecipitation (ChIP) assays showed a correlated (R 2  = 0.671) enrichment of the transcription factor Runx1 and the epigenetic active mark histone H3 acetylation (H3Ac) at the P2X3-R gene promoter in a fraction of the CFA-treated rats. These results suggest that animal-specific increases in P2X3-R mRNA levels are likely associated with the genetic/epigenetic context of the P2X3-R locus that controls P2X3-R gene transcription by recruiting Runx1 and epigenetic co-regulators that mediate histone acetylation. © 2017 Wiley Periodicals, Inc.

Combinatorial Control of Light Induced Chromatin Remodeling and Gene Activation in Neurospora

PubMed Central

Sancar, Cigdem; Ha, Nati; Yilmaz, Rüstem; Tesorero, Rafael; Fisher, Tamas; Brunner, Michael; Sancar, Gencer

2015-01-01

Light is an important environmental cue that affects physiology and development of Neurospora crassa. The light-sensing transcription factor (TF) WCC, which consists of the GATA-family TFs WC1 and WC2, is required for light-dependent transcription. SUB1, another GATA-family TF, is not a photoreceptor but has also been implicated in light-inducible gene expression. To assess regulation and organization of the network of light-inducible genes, we analyzed the roles of WCC and SUB1 in light-induced transcription and nucleosome remodeling. We show that SUB1 co-regulates a fraction of light-inducible genes together with the WCC. WCC induces nucleosome eviction at its binding sites. Chromatin remodeling is facilitated by SUB1 but SUB1 cannot activate light-inducible genes in the absence of WCC. We identified FF7, a TF with a putative O-acetyl transferase domain, as an interaction partner of SUB1 and show their cooperation in regulation of a fraction of light-inducible and a much larger number of non light-inducible genes. Our data suggest that WCC acts as a general switch for light-induced chromatin remodeling and gene expression. SUB1 and FF7 synergistically determine the extent of light-induction of target genes in common with WCC but have in addition a role in transcription regulation beyond light-induced gene expression. PMID:25822411

Tumor-targeted IL-2 amplifies T cell-mediated immune response induced by gene therapy with single-chain IL-12

PubMed Central

Lode, Holger N.; Xiang, Rong; Duncan, Steven R.; Theofilopoulos, Argyrios N.; Gillies, Stephen D.; Reisfeld, Ralph A.

1999-01-01

Induction, maintenance, and amplification of tumor-protective immunity after cytokine gene therapy is essential for the clinical success of immunotherapeutic approaches. We investigated whether this could be achieved by single-chain IL-12 (scIL-12) gene therapy followed by tumor-targeted IL-2 using a fusion protein containing a tumor-specific recombinant anti-ganglioside GD2 antibody and IL-2 (ch14.18-IL-2) in a poorly immunogenic murine neuroblastoma model. Herein, we demonstrate the absence of liver and bone marrow metastases after a lethal challenge with NXS2 wild-type cells only in mice (five of six animals) vaccinated with scIL-12-producing NXS2 cells and given a booster injection of low-dose ch14.18-IL-2 fusion protein. This tumor-protective immunity was effective 3 months after initial vaccination, in contrast to control animals treated with a nonspecific fusion protein or an equivalent mixture of antibody and IL-2. Only vaccinated mice receiving the tumor-specific ch14.18-IL-2 fusion protein revealed a reactivation of CD8+ T cells and subsequent MHC class I-restricted tumor target cell lysis in vitro. The sequential increase in the usage of TCR chains Vβ11 and -13 in mouse CD8+ T cells after vaccination and amplification with ch14.18-IL-2 suggests that the initial polyclonal CD8+ T cell response is effectively boosted by targeted IL-2. In conclusion, we demonstrate that a successful boost of a partially protective memory T cell immune response that is induced by scIL-12 gene therapy could be generated by tumor-specific targeting of IL-2 with a ch14.18-IL-2 fusion protein. This approach could increase success rates of clinical cancer vaccine trials. PMID:10411920

Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum

PubMed Central

2013-01-01

Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses

HLS7, a hemopoietic lineage switch gene homologous to the leukemia-inducing gene MLF1.

PubMed Central

Williams, J H; Daly, L N; Ingley, E; Beaumont, J G; Tilbrook, P A; Lalonde, J P; Stillitano, J P; Klinken, S P

1999-01-01

Hemopoietic lineage switching occurs when leukemic cells, apparently committed to one lineage, change and display the phenotype of another pathway. cDNA representational difference analysis was used to identify myeloid-specific genes that may be associated with an erythroid to myeloid lineage switch involving the murine J2E erythroleukemic cell line. One of the genes isolated (HLS7) is homologous to the novel human oncogene myeloid leukemia factor 1 (MLF1) involved in the t(3;5)(q25.1;q34) translocation associated with acute myeloid leukemia. Enforced expression of HLS7 in J2E cells induced a monoblastoid phenotype, thereby recapitulating the spontaneous erythroid to myeloid lineage switch. HLS7 also inhibited erythropoietin- or chemically-induced differentiation of erythroleukemic cell lines and suppressed development of erythropoietin-responsive colonies in semi-solid culture. However, intracellular signaling activated by erythropoietin was not impeded by ectopic expression of HLS7. In contrast, HLS7 promoted maturation of M1 monoblastoid cells and increased myeloid colony formation in vitro. These data show that HLS7 can influence erythroid/myeloid lineage switching and the development of normal hemopoietic cells. PMID:10523300

HLS7, a hemopoietic lineage switch gene homologous to the leukemia-inducing gene MLF1.

PubMed

Williams, J H; Daly, L N; Ingley, E; Beaumont, J G; Tilbrook, P A; Lalonde, J P; Stillitano, J P; Klinken, S P

1999-10-15

Hemopoietic lineage switching occurs when leukemic cells, apparently committed to one lineage, change and display the phenotype of another pathway. cDNA representational difference analysis was used to identify myeloid-specific genes that may be associated with an erythroid to myeloid lineage switch involving the murine J2E erythroleukemic cell line. One of the genes isolated (HLS7) is homologous to the novel human oncogene myeloid leukemia factor 1 (MLF1) involved in the t(3;5)(q25.1;q34) translocation associated with acute myeloid leukemia. Enforced expression of HLS7 in J2E cells induced a monoblastoid phenotype, thereby recapitulating the spontaneous erythroid to myeloid lineage switch. HLS7 also inhibited erythropoietin- or chemically-induced differentiation of erythroleukemic cell lines and suppressed development of erythropoietin-responsive colonies in semi-solid culture. However, intracellular signaling activated by erythropoietin was not impeded by ectopic expression of HLS7. In contrast, HLS7 promoted maturation of M1 monoblastoid cells and increased myeloid colony formation in vitro. These data show that HLS7 can influence erythroid/myeloid lineage switching and the development of normal hemopoietic cells.

20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.

PubMed

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-08-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.

20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body

PubMed Central

Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng

2013-01-01

Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061

Differential expression of poplar sucrose nonfermenting1-related protein kinase 2 genes in response to abiotic stress and abscisic acid.

PubMed

Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato

2017-09-01

Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.

Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

PubMed

Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

2008-05-01

Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor

DinB Upregulation Is the Sole Role of the SOS Response in Stress-Induced Mutagenesis in Escherichia coli

PubMed Central

Galhardo, Rodrigo S.; Do, Robert; Yamada, Masami; Friedberg, Errol C.; Hastings, P. J.; Nohmi, Takehiko; Rosenberg, Susan M.

2009-01-01

Stress-induced mutagenesis is a collection of mechanisms observed in bacterial, yeast, and human cells in which adverse conditions provoke mutagenesis, often under the control of stress responses. Control of mutagenesis by stress responses may accelerate evolution specifically when cells are maladapted to their environments, i.e., are stressed. It is therefore important to understand how stress responses increase mutagenesis. In the Escherichia coli Lac assay, stress-induced point mutagenesis requires induction of at least two stress responses: the RpoS-controlled general/starvation stress response and the SOS DNA-damage response, both of which upregulate DinB error-prone DNA polymerase, among other genes required for Lac mutagenesis. We show that upregulation of DinB is the only aspect of the SOS response needed for stress-induced mutagenesis. We constructed two dinB(oc) (operator-constitutive) mutants. Both produce SOS-induced levels of DinB constitutively. We find that both dinB(oc) alleles fully suppress the phenotype of constitutively SOS-“off” lexA(Ind−) mutant cells, restoring normal levels of stress-induced mutagenesis. Thus, dinB is the only SOS gene required at induced levels for stress-induced point mutagenesis. Furthermore, although spontaneous SOS induction has been observed to occur in only a small fraction of cells, upregulation of dinB by the dinB(oc) alleles in all cells does not promote a further increase in mutagenesis, implying that SOS induction of DinB, although necessary, is insufficient to differentiate cells into a hypermutable condition. PMID:19270270

An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis

PubMed Central

Guo, Hongyan; Zhang, Wei; Tian, Hainan; Zheng, Kaijie; Dai, Xuemei; Liu, Shanda; Hu, Qingnan; Wang, Xianling; Liu, Bao; Wang, Shucai

2015-01-01

Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance, and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa) CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION) gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid), a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice. Taken together, our results showed that OsCLE48 is an auxin responsive peptide hormone gene, and it regulates shoot apical

The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

PubMed

Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

2015-10-24

NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

An elm EST database for identifying leaf beetle egg-induced defense genes

PubMed Central

2012-01-01

Background Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Results Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and

An elm EST database for identifying leaf beetle egg-induced defense genes.

PubMed

Büchel, Kerstin; McDowell, Eric; Nelson, Will; Descour, Anne; Gershenzon, Jonathan; Hilker, Monika; Soderlund, Carol; Gang, David R; Fenning, Trevor; Meiners, Torsten

2012-06-15

Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and primary metabolism

Global identification and expression analysis of stress-responsive genes of the Argonaute family in apple.

PubMed

Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong

2016-12-01

Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.

Identification of cadmium-induced Agaricus blazei genes through suppression subtractive hybridization.

PubMed

Wang, Liling; Li, Haibo; Wei, Hailong; Wu, Xueqian; Ke, Leqin

2014-01-01

Cadmium (Cd) is one of the most serious environmental pollutants. Filamentous fungi are very promising organisms for controlling and reducing the amount of heavy metals released by human and industrial activities. However, the molecular mechanisms involved in Cd accumulation and tolerance of filamentous fungi are not fully understood. Agaricus blazei Murrill, an edible mushroom with medicinal properties, demonstrates high tolerance for heavy metals, especially Cd. To investigate the molecular mechanisms underlying the response of A. blazei after Cd exposure, we constructed a forward subtractive library that represents cadmium-induced genes in A. blazei under 4 ppm Cd stress for 14 days using suppression subtractive hybridization combined with mirror orientation selection. Differential screening allowed us to identify 39 upregulated genes, 26 of which are involved in metabolism, protein fate, cellular transport, transport facilitation and transport routes, cell rescue, defense and virulence, transcription, and the action of proteins with a binding function, and 13 are encoding hypothetical proteins with unknown functions. Induction of six A. blazei genes after Cd exposure was further confirmed by RT-qPCR. The cDNAs isolated in this study contribute to our understanding of genes involved in the biochemical pathways that participate in the response of filamentous fungi to Cd exposure. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Levetiracetam attenuates hippocampal expression of synaptic plasticity-related immediate early and late response genes in amygdala-kindled rats

PubMed Central

2010-01-01

Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316

Novel genes in brain tissues of EAE-induced normal and obese mice: Upregulation of metal ion-binding protein genes in obese-EAE mice.

PubMed

Hasan, Mahbub; Seo, Ji-Eun; Rahaman, Khandoker Asiqur; Min, Hophil; Kim, Ki Hun; Park, Ju-Hyung; Sung, Changmin; Son, Junghyun; Kang, Min-Jung; Jung, Byung Hwa; Park, Won Sang; Kwon, Oh-Seung

2017-02-20

Experimental autoimmune encephalomyelitis (EAE) is an inflammatory autoimmune disease of the central nervous system resulting from degeneration of the myelin sheath. This study is aimed to identify differentially expressed genes (DEGs) in the brain of EAE-induced normal diet (ND) mice and high-fat diet (HFD)-induced obese mice, and to identify novel genes responsible for elucidating the mechanism of the disease. Purified mRNA samples from the brain tissue were analyzed for gene microarray and validated by real-time RT-PCR. DEGs were identified if significant changes greater than 1.5-fold or less than 0.66-fold were observed (p<0.05). Pathway construction and functional categorization were performed using the Kyoto encyclopedia of genes and genomes pathways and gene ontology (GO) analysis. HFD-EAE mice showed more severe disease symptoms than ND-EAE mice. From GO study, fold changes of HFD-EAE to ND-EAE genes indicated that the genes were significantly associated to the pathways related with the immune response, antigen presentation, and complement activation. The genes related with metal ion-binding proteins were upregulated in HFD-EAE and ND-EAE mice. Upregulation of Cul9, Mast2, and C4b expression is significantly higher in HFD-EAE mice than ND-EAE mice. Cul9, Mast2, C4b, Psmb8, Ly86, and Ms4a6d were significantly upregulated in both ND- and HFD-EAE mice. Fcgr4, S3-12, Gca, and Zdhhc4 were upregulated only in ND-EAE, and Xlr4b was upregulated only in HFD-EAE mice. And significant upregulated genes of metal ion-binding proteins (Cul9 and Mast2) were observed in HFD-EAE mice. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.

Blood meal induced regulation of the chemosensory gene repertoire in the southern house mosquito.

PubMed

Taparia, Tanvi; Ignell, Rickard; Hill, Sharon Rose

2017-05-19

The southern house mosquito, Culex quinquefasciatus, is one of the most prevalent vectors of lymphatic filariasis and flavivirus-induced encephalitis. Its vectorial capacity is directly affected by its reproductive feeding behaviors, such as host seeking, blood feeding, resting, and egg laying. In mosquitoes, these gonotrophic behaviors are odor-mediated and regulated following blood feeding. Immediately after a blood meal, female mosquitoes show reduced olfactory responsiveness and flight activity, as they enter a resting state. Insights into antennal chemosensory gene regulation at this time period can provide a foundation to identify targets involved in the state switch between host seeking and resting. This study used quantitative gene expression analyses to explore blood meal induced regulation of chemosensory gene families in the antennae of 6 days post-emergence C. quinquefasciatus females. Improved annotations for multiple chemosensory gene families, and a quantitative differential gene expression analysis between host seeking and 24 h post- blood fed females of the same age, allowed for the detection of transcripts that potentially play a role in the switch from host seeking to resting, in C. quinquefasciatus. The expression profiles of chemosensory genes varied significantly between the two treatments. Annotations for chemosensory gene repertoires in C. quinquefasciatus have been manually curated and corrected for 3' exon choice and transcript length, through sequence and transcriptome analyses. The gene expression analyses identified various molecular components of the peripheral olfactory system in C. quinquefasciatus, including odorant receptors, ionotropic receptors, odorant binding proteins and chemosensory proteins, that are regulated in response to blood feeding, and could be critical for the behavioral switch from host seeking to resting. Functional characterization of these proteins in the future can identify targets essential for the females

Comparative Gene Expression Profiles Induced by PPARγ and PPARα/γ Agonists in Human Hepatocytes

PubMed Central

Rogue, Alexandra; Lambert, Carine; Jossé, Rozenn; Antherieu, Sebastien; Spire, Catherine; Claude, Nancy; Guillouzo, André

2011-01-01

Background Several glitazones (PPARγ agonists) and glitazars (dual PPARα/γ agonists) have been developed to treat hyperglycemia and, simultaneously, hyperglycemia and dyslipidemia, respectively. However, most have caused idiosyncratic hepatic or extrahepatic toxicities through mechanisms that remain largely unknown. Since the liver plays a key role in lipid metabolism, we analyzed changes in gene expression profiles induced by these two types of PPAR agonists in human hepatocytes. Methodology/Principal Findings Primary human hepatocytes and the well-differentiated human hepatoma HepaRG cells were exposed to different concentrations of two PPARγ (troglitazone and rosiglitazone) and two PPARα/γ (muraglitazar and tesaglitazar) agonists for 24 h and their transcriptomes were analyzed using human pangenomic Agilent microarrays. Principal Component Analysis, hierarchical clustering and Ingenuity Pathway Analysis® revealed large inter-individual variability in the response of the human hepatocyte populations to the different compounds. Many genes involved in lipid, carbohydrate, xenobiotic and cholesterol metabolism, as well as inflammation and immunity, were regulated by both PPARγ and PPARα/γ agonists in at least a number of human hepatocyte populations and/or HepaRG cells. Only a few genes were selectively deregulated by glitazars when compared to glitazones, indicating that PPARγ and PPARα/γ agonists share most of their target genes. Moreover, some target genes thought to be regulated only in mouse or to be expressed in Kupffer cells were also found to be responsive in human hepatocytes and HepaRG cells. Conclusions/Significance This first comprehensive analysis of gene regulation by PPARγ and PPARα/γ agonists favor the conclusion that glitazones and glitazars share most of their target genes and induce large differential changes in gene profiles in human hepatocytes depending on hepatocyte donor, the compound class and/or individual compound, thereby

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

Genome-Wide Transcriptome Analysis of Cotton (Gossypium hirsutum L.) Identifies Candidate Gene Signatures in Response to Aflatoxin Producing Fungus Aspergillus flavus.

PubMed

Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan

2015-01-01

Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.

The role of germline promoters and I exons in cytokine-induced gene-specific class switch recombination.

PubMed

Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T

2011-01-01

Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is <1% the wild-type level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.

Gene response in rice plants treated with continuous fog influenced by pH, was similar to that treated with biotic stress

PubMed Central

2014-01-01

Background Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Results Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. Conclusions These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species. PMID:24987489

Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings

PubMed Central

Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan

2010-01-01

In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125

Hijacking of RIG-I signaling proteins into virus-induced cytoplasmic structures correlates with the inhibition of type I interferon responses.

PubMed

Santiago, Felix W; Covaleda, Lina M; Sanchez-Aparicio, Maria T; Silvas, Jesus A; Diaz-Vizarreta, Ana C; Patel, Jenish R; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo; Aguilar, Patricia V

2014-04-01

Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions.

Hijacking of RIG-I Signaling Proteins into Virus-Induced Cytoplasmic Structures Correlates with the Inhibition of Type I Interferon Responses

PubMed Central

Santiago, Felix W.; Covaleda, Lina M.; Sanchez-Aparicio, Maria T.; Silvas, Jesus A.; Diaz-Vizarreta, Ana C.; Patel, Jenish R.; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo

2014-01-01

ABSTRACT Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. IMPORTANCE The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions. PMID:24478431

An inducible HSP70 gene from the midge Chironomus dilutus: Characterization and transcription profile under environmental stress

USGS Publications Warehouse

Karouna-Renier, N. K.; Rao, K.R.

2009-01-01

In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.

Molecular Structure-Based Large-Scale Prediction of Chemical-Induced Gene Expression Changes.

PubMed

Liu, Ruifeng; AbdulHameed, Mohamed Diwan M; Wallqvist, Anders

2017-09-25

The quantitative structure-activity relationship (QSAR) approach has been used to model a wide range of chemical-induced biological responses. However, it had not been utilized to model chemical-induced genomewide gene expression changes until very recently, owing to the complexity of training and evaluating a very large number of models. To address this issue, we examined the performance of a variable nearest neighbor (v-NN) method that uses information on near neighbors conforming to the principle that similar structures have similar activities. Using a data set of gene expression signatures of 13 150 compounds derived from cell-based measurements in the NIH Library of Integrated Network-based Cellular Signatures program, we were able to make predictions for 62% of the compounds in a 10-fold cross validation test, with a correlation coefficient of 0.61 between the predicted and experimentally derived signatures-a reproducibility rivaling that of high-throughput gene expression measurements. To evaluate the utility of the predicted gene expression signatures, we compared the predicted and experimentally derived signatures in their ability to identify drugs known to cause specific liver, kidney, and heart injuries. Overall, the predicted and experimentally derived signatures had similar receiver operating characteristics, whose areas under the curve ranged from 0.71 to 0.77 and 0.70 to 0.73, respectively, across the three organ injury models. However, detailed analyses of enrichment curves indicate that signatures predicted from multiple near neighbors outperformed those derived from experiments, suggesting that averaging information from near neighbors may help improve the signal from gene expression measurements. Our results demonstrate that the v-NN method can serve as a practical approach for modeling large-scale, genomewide, chemical-induced, gene expression changes.

Gene profiling reveals a role for stress hormones in the molecular and behavioral response to food restriction.

PubMed

Guarnieri, Douglas J; Brayton, Catherine E; Richards, Sarah M; Maldonado-Aviles, Jaime; Trinko, Joseph R; Nelson, Jessica; Taylor, Jane R; Gourley, Shannon L; DiLeone, Ralph J

2012-02-15

Food restriction is known to enhance learning and motivation. The neural mechanisms underlying these responses likely involve alterations in gene expression in brain regions mediating the motivation to feed. Analysis of gene expression profiles in male C57BL/6J mice using whole-genome microarrays was completed in the medial prefrontal cortex, nucleus accumbens, ventral tegmental area, and the hypothalamus following a 5-day food restriction. Quantitative polymerase chain reaction was used to validate these findings and determine the time course of expression changes. Plasma levels of the stress hormone corticosterone (CORT) were measured by enzyme-linked immunosorbent assay. Expression changes were measured in adrenalectomized animals that underwent food restriction, as well as in animals receiving daily injections of CORT. Progressive ratio responding for food, a measure of motivated behavior, was assessed after CORT treatment in restricted and fed animals. Brief food restriction results in an upregulation of peripheral stress responsive genes in the mammalian brain. Time-course analysis demonstrated rapid and persistent expression changes in all four brain regions under study. Administration of CORT to nonrestricted animals was sufficient to induce a subset of the genes, and alterations in gene expression after food restriction were dependent on intact adrenal glands. CORT can increase the motivation to work for food only in the restricted state. These data demonstrate a central role for CORT in mediating both molecular and behavioral responses to food restriction. The stress hormone-induced alterations in gene expression described here may be relevant for both adaptive and pathological responses to stress. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

ERK Oscillation-Dependent Gene Expression Patterns and Deregulation by Stress-Response

DOE Office of Scientific and Technical Information (OSTI.GOV)

Waters, Katrina M.; Cummings, Brian S.; Shankaran, Harish

2014-09-15

Studies were undertaken to determine whether ERK oscillations regulate a unique subset of genes in human keratinocytes and subsequently, whether the p38 stress response inhibits ERK oscillations. A DNA microarray identified many genes that were unique to ERK oscillations, and network reconstruction predicted an important role for the mediator complex subunit 1 (MED1) node in mediating ERK oscillation-dependent gene expression. Increased ERK-dependent phosphorylation of MED1 was observed in oscillating cells compared to non-oscillating counterparts as validation. Treatment of keratinocytes with a p38 inhibitor (SB203580) increased ERK oscillation amplitudes and MED1 and phospho-MED1 protein levels. Bromate is a probable human carcinogenmore » that activates p38. Bromate inhibited ERK oscillations in human keratinocytes and JB6 cells and induced an increase in phospho-p38 and decrease in phospho-MED1 protein levels. Treatment of normal rat kidney cells and primary salivary gland epithelial cells with bromate decreased phospho-MED1 levels in a reversible fashion upon treatment with p38 inhibitors (SB202190; SB203580). Our results indicate that oscillatory behavior in the ERK pathway alters homeostatic gene regulation patterns and that the cellular response to perturbation may manifest differently in oscillating vs non-oscillating cells.« less

Methionine sulfoxide reductase A protects against lipopolysaccharide-induced septic shock via negative regulation of the proinflammatory responses.

PubMed

Singh, Mahendra Pratap; Kim, Ki Young; Kwak, Geun-Hee; Baek, Suk-Hwan; Kim, Hwa-Young

2017-10-01

Methionine sulfoxide reductase A (MsrA) is a major antioxidant enzyme that specifically catalyzes the reduction of methionine S-sulfoxide. In this study, we used MsrA gene-knockout (MsrA -/- ) mice and bone marrow-derived macrophages (BMDMs) to investigate the role of MsrA in the regulation of inflammatory responses induced by lipopolysaccharide (LPS). MsrA -/- mice were more susceptible to LPS-induced lethal shock than wild-type (MsrA +/+ ) mice. Serum levels of the proinflammatory cytokines IL-6 and TNF-α induced by LPS were higher in MsrA -/- than in MsrA +/+ mice. MsrA deficiency in the BMDMs also increased the LPS-induced cytotoxicity as well as TNF-α level. Basal and LPS-induced reactive oxygen species (ROS) levels were higher in MsrA -/- than in MsrA +/+ BMDMs. Phosphorylation levels of p38, JNK, and ERK were higher in MsrA -/- than in MsrA +/+ BMDMs in response to LPS, suggesting that MsrA deficiency increases MAPK activation. Furthermore, MsrA deficiency increased the expression and nuclear translocation of NF-κB and the expression of inducible nitric oxide synthase, a target gene of NF-κB, in response to LPS. Taken together, our results suggest that MsrA protects against LPS-induced septic shock, and negatively regulates proinflammatory responses via inhibition of the ROS-MAPK-NF-κB signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.

Biomarker discovery and gene expression responses in Lycopersicon esculentum root exposed to lead.

PubMed

Hou, Jing; Bai, Lili; Xie, Yujia; Liu, Xinhui; Cui, Baoshan

2015-12-15

Gene expression analysis has shown particular promise for the identification of molecular biomarkers that can be used for further evaluation of potential toxicity of chemicals present in agricultural soil. In the study, we focused on the development of molecular markers to detect Pb toxicity in agricultural soil. Using the results obtained from microarray analysis, twelve Pb-responsive genes were selected and tested in different Pb concentrations to examine their concentration-response characteristics using real-time quantitative polymerase chain reaction (RT-qPCR). All the Pb treatments set in our study could generally induce the differential expression of the 12 genes, while the lowest observable adverse effect concentration (LOAEC) of Pb for seed germination, root elongation, biomass and structural modification derived from 1,297, 177, 177, and 1,297 mg Pb/kg soil, respectively, suggesting that the transcriptional approach was more sensitive than the traditional end points of death, growth, and morphology for the evaluation of Pb toxicity. The relative expression of glycoalkaloid metabolism 1 (P=-0.790), ethylene-responsive transcription factor ERF017 (P=-0.686) and CASP-like protein 4C2 (P=-0.652) demonstrates a dose-dependent response with Pb content in roots, implying that the three genes can be used as sensitive bioindicators of Pb stress in Lycopersicon esculentum. Copyright © 2015 Elsevier B.V. All rights reserved.

Roles of factorial noise in inducing bimodal gene expression

NASA Astrophysics Data System (ADS)

Liu, Peijiang; Yuan, Zhanjiang; Huang, Lifang; Zhou, Tianshou

2015-06-01

Some gene regulatory systems can exhibit bimodal distributions of mRNA or protein although the deterministic counterparts are monostable. This noise-induced bimodality is an interesting phenomenon and has important biological implications, but it is unclear how different sources of expression noise (each source creates so-called factorial noise that is defined as a component of the total noise) contribute separately to this stochastic bimodality. Here we consider a minimal model of gene regulation, which is monostable in the deterministic case. Although simple, this system contains factorial noise of two main kinds: promoter noise due to switching between gene states and transcriptional (or translational) noise due to synthesis and degradation of mRNA (or protein). To better trace the roles of factorial noise in inducing bimodality, we also analyze two limit models, continuous and adiabatic approximations, apart from the exact model. We show that in the case of slow gene switching, the continuous model where only promoter noise is considered can exhibit bimodality; in the case of fast switching, the adiabatic model where only transcriptional or translational noise is considered can also exhibit bimodality but the exact model cannot; and in other cases, both promoter noise and transcriptional or translational noise can cooperatively induce bimodality. Since slow gene switching and large protein copy numbers are characteristics of eukaryotic cells, whereas fast gene switching and small protein copy numbers are characteristics of prokaryotic cells, we infer that eukaryotic stochastic bimodality is induced mainly by promoter noise, whereas prokaryotic stochastic bimodality is induced primarily by transcriptional or translational noise.

Comparison of Timothy grass pollen extract- and single major allergen-induced gene expression and mediator release in airway epithelial cells: a meta-analysis.

PubMed

Röschmann, K I L; van Kuijen, A-M; Luiten, S; Jonker, M J; Breit, T M; Fokkens, W J; Petersen, A; van Drunen, C M

2012-10-01

Seasonal allergic rhinitis (AR) is a global health problem and its prevalence has increased considerably in the last decades. As the allergic response with its clinical manifestations is triggered by only a few proteins within natural extracts, there is an increasing tendency for single-component-resolved diagnosis and immunotherapy. As natural exposure is not to single proteins, but to complex mixtures of molecules, we were interested in comparing the activation of respiratory epithelial cells induced by the purified major allergen Phl p 1 with the induction caused by a complete extract of Timothy grass pollen (GPE). NCI-H292 cells were exposed to GPE or Ph1 p 1 for 24 h, isolated RNA and cell culture supernatants were used for microarray analysis, multiplex enzyme-linked immunosorbant assay (ELISA) and subsequent analysis. We found 262 genes that showed a GPE-induced change of at least 3-fold, whereas Ph1 p 1-stimulation resulted in 71 genes with a fold induction of more than 3-fold. Besides genes that were regulated by both stimuli, we also detected genes displaying an opposite response after stimulation, suggesting that GPE might be more than purified major allergens with regard to induced immune responses. Additional components within GPE and the resulting modulation of general processes affecting gene transcription and signalling pathways might be crucial to maintain/overcome the diseased phenotype and to induce the influx of cells contributing to late-phase allergic responses. When the initial process of sensitization is the matter of interest or late-phase allergic responses, one might miss important immune modulatory molecules and their interaction with allergens by applying single components only. © 2012 Blackwell Publishing Ltd.

Genome-wide analysis of drought induced gene expression changes in flax (Linum usitatissimum).

PubMed

Dash, Prasanta K; Cao, Yongguo; Jailani, Abdul K; Gupta, Payal; Venglat, Prakash; Xiang, Daoquan; Rai, Rhitu; Sharma, Rinku; Thirunavukkarasu, Nepolean; Abdin, Malik Z; Yadava, Devendra K; Singh, Nagendra K; Singh, Jas; Selvaraj, Gopalan; Deyholos, Mike; Kumar, Polumetla Ananda; Datla, Raju

2014-01-01

A robust phenotypic plasticity to ward off adverse environmental conditions determines performance and productivity in crop plants. Flax (linseed), is an important cash crop produced for natural textile fiber (linen) or oilseed with many health promoting products. This crop is prone to drought stress and yield losses in many parts of the world. Despite recent advances in drought research in a number of important crops, related progress in flax is very limited. Since, response of this plant to drought stress has not been addressed at the molecular level; we conducted microarray analysis to capture transcriptome associated with induced drought in flax. This study identified 183 differentially expressed genes (DEGs) associated with diverse cellular, biophysical and metabolic programs in flax. The analysis also revealed especially the altered regulation of cellular and metabolic pathways governing photosynthesis. Additionally, comparative transcriptome analysis identified a plethora of genes that displayed differential regulation both spatially and temporally. These results revealed co-regulated expression of 26 genes in both shoot and root tissues with implications for drought stress response. Furthermore, the data also showed that more genes are upregulated in roots compared to shoots, suggesting that roots may play important and additional roles in response to drought in flax. With prolonged drought treatment, the number of DEGs increased in both tissue types. Differential expression of selected genes was confirmed by qRT-PCR, thus supporting the suggested functional association of these intrinsic genes in maintaining growth and homeostasis in response to imminent drought stress in flax. Together the present study has developed foundational and new transcriptome data sets for drought stress in flax.

HRGFish: A database of hypoxia responsive genes in fishes

NASA Astrophysics Data System (ADS)

Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo

2017-02-01

Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.

The diphenylether herbicide lactofen induces cell death and expression of defense-related genes in soybean.

PubMed

Graham, Madge Y

2005-12-01

Lactofen belongs to the diphenylether class of herbicides, which targets protoporphyrinogen oxidase, which in turn causes singlet oxygen generation. In tolerant plants like soybean (Glycine max), the chemical nonetheless causes necrotic patches called "bronzing" in contact areas. Here it is shown that such bronzing is accompanied by cell death, which was quantified from digital microscopic images using Assess Software. Cellular autofluorescence accompanied cell death, and a homolog of the cell death marker gene, Hsr203j, was induced by lactofen in treated soybean tissues. Thus, this form of chemically induced cell death shares some hallmarks of certain types of programmed cell death. In addition to the cell death phenotype, lactofen caused enhanced expressions of chalcone synthase and chalcone reductase genes, mainly in the exposed and immediately adjacent (proximal) cells. Furthermore, isoflavone synthase genes, which are wound inducible in soybean, were up-regulated by lactofen in both proximal and distal cell zones in minimally wounded cotyledons and further enhanced in wounded tissues. Moreover, if the wall glucan elicitor from Phytophthora sojae was present during lactofen treatment, the induction of isoflavone synthase was even more rapid. These results are consistent with the fact that lactofen triggers massive isoflavone accumulations and activates the capacity for glyceollin elicitation competency. In addition, lactofen induces late expression of a selective set of pathogenesis-related (PR) protein genes, including PR-1a, PR-5, and PR-10, mainly in treated proximal tissues. These various results are discussed in the context of singlet oxygen-induced responses and lactofen's potential as a disease resistance-inducing agent.

Changes of gene expression of iron regulatory proteins during turpentine oil-induced acute-phase response in the rat.

PubMed

Sheikh, Nadeem; Dudas, Jozsef; Ramadori, Giuliano

2007-07-01

In the present study, turpentine oil was injected in the hind limb muscle of the rat to stimulate an acute-phase response (APR). The changes in the gene expression of cytokines and proteins known to be involved in the iron regulatory pathway were then studied in the liver and in extra-hepatic tissue. In addition to the strong upregulation of interleukin-6 (IL-6) and IL-1 beta observed in the inflamed muscle, an upregulation of the genes for IL1-beta and tumor necrosis factor-alpha, but not IL-6, were detectable in the liver. Hepatic Hepc gene expression increased to a maximum at 6 h after the onset of APR. An upregulation of transferrin, transferrin receptor 1 (TfR1), TfR2, ferritin-H, iron responsive element binding protein-1 (IRP1), IRP2 and divalent metal transporter gene expression was also found. Hemojuvelin (Hjv)-, ferroportin 1-, Dcytb-, hemochromatosis-gene- and hephaestin gene expression was downregulated. Hepcidin (Hepc) gene expression was not only detectable in extra-hepatic tissues such as heart, small intestine, colon, spleen and kidney but it was also upregulated under acute-phase conditions, with the Hjv gene being regulated antagonistically. Fpn-1 gene expression was downregulated significantly in heart, colon and spleen. Most of the genes of the known proteins involved in iron metabolism are expressed not only in the liver but also in extra-hepatic tissues. Under acute-phase conditions, acute-phase cytokines (eg IL-6) may modulate the gene expression of such proteins not only in the liver but also in other organs.

Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

PubMed

Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

2014-12-01

HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of

Norepinephrine genes predict response time variability and methylphenidate-induced changes in neuropsychological function in attention deficit hyperactivity disorder.

PubMed

Kim, Bung-Nyun; Kim, Jae-Won; Cummins, Tarrant D R; Bellgrove, Mark A; Hawi, Ziarih; Hong, Soon-Beom; Yang, Young-Hui; Kim, Hyo-Jin; Shin, Min-Sup; Cho, Soo-Churl; Kim, Ji-Hoon; Son, Jung-Woo; Shin, Yun-Mi; Chung, Un-Sun; Han, Doug-Hyun

2013-06-01

Noradrenergic dysfunction may be associated with cognitive impairments in attention-deficit/hyperactivity disorder (ADHD), including increased response time variability, which has been proposed as a leading endophenotype for ADHD. The aim of this study was to examine the relationship between polymorphisms in the α-2A-adrenergic receptor (ADRA2A) and norepinephrine transporter (SLC6A2) genes and attentional performance in ADHD children before and after pharmacological treatment.One hundred one medication-naive ADHD children were included. All subjects were administered methylphenidate (MPH)-OROS for 12 weeks. The subjects underwent a computerized comprehensive attention test to measure the response time variability at baseline before MPH treatment and after 12 weeks. Additive regression analyses controlling for ADHD symptom severity, age, sex, IQ, and final dose of MPH examined the association between response time variability on the comprehensive attention test measures and allelic variations in single-nucleotide polymorphisms of the ADRA2A and SLC6A2 before and after MPH treatment.Increasing possession of an A allele at the G1287A polymorphism of SLC6A2 was significantly related to heightened response time variability at baseline in the sustained (P = 2.0 × 10) and auditory selective attention (P = 1.0 × 10) tasks. Response time variability at baseline increased additively with possession of the T allele at the DraI polymorphism of the ADRA2A gene in the auditory selective attention task (P = 2.0 × 10). After medication, increasing possession of a G allele at the MspI polymorphism of the ADRA2A gene was associated with increased MPH-related change in response time variability in the flanker task (P = 1.0 × 10).Our study suggested an association between norepinephrine gene variants and response time variability measured at baseline and after MPH treatment in children with ADHD. Our results add to a growing body of evidence, suggesting that response time

Convergent evolution of heat-inducibility during subfunctionalization of the Hsp70 gene family

PubMed Central

2013-01-01

Background Heat-shock proteins of the 70 kDa family (Hsp70s) are essential chaperones required for key cellular functions. In eukaryotes, four subfamilies can be distinguished according to their function and localisation in different cellular compartments: cytosol, endoplasmic reticulum, mitochondria and chloroplasts. Generally, multiple cytosol-type Hsp70s can be found in metazoans that show either constitutive expression and/or stress-inducibility, arguing for the evolution of different tasks and functions. Information about the hsp70 copy number and diversity in microbial eukaryotes is, however, scarce, and detailed knowledge about the differential gene expression in most protists is lacking. Therefore, we have characterised the Hsp70 gene family of Paramecium caudatum to gain insight into the evolution and differential heat stress response of the distinct family members in protists and to investigate the diversification of eukaryotic hsp70s focusing on the evolution of heat-inducibility. Results Eleven putative hsp70 genes could be detected in P. caudatum comprising homologs of three major Hsp70-subfamilies. Phylogenetic analyses revealed five evolutionarily distinct Hsp70-groups, each with a closer relationship to orthologous sequences of Paramecium tetraurelia than to another P. caudatum Hsp70-group. These highly diverse, paralogous groups resulted from duplications preceding Paramecium speciation, underwent divergent evolution and were subject to purifying selection. Heat-shock treatments were performed to test for differential expression patterns among the five Hsp70-groups as well as for a functional conservation within Paramecium. These treatments induced exceptionally high mRNA up-regulations in one cytosolic group with a low basal expression, indicative for the major heat inducible hsp70s. All other groups showed comparatively high basal expression levels and moderate heat-inducibility, signifying constitutively expressed genes. Comparative EST analyses

Stress, and pathogen response gene expression in modeled microgravity

NASA Technical Reports Server (NTRS)

Sundaresan, Alamelu; Pellis, Neal R.

2006-01-01

Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and

Gene Profiling Characteristics of Radioadaptive Response in AG01522 Normal Human Fibroblasts

PubMed Central

Hou, Jue; Wang, Fan; Kong, Peizhong; Yu, Peter K. N.; Wang, Hongzhi; Han, Wei

2015-01-01

Radioadaptive response (RAR) in mammalian cells refers to the phenomenon where a low-dose ionizing irradiation alters the gene expression profiles, and protects the cells from the detrimental effects of a subsequent high dose exposure. Despite the completion of numerous experimental studies on RAR, the underlying mechanism has remained unclear. In this study, we aimed to have a comprehensive investigation on the RAR induced in the AG01522 human fibroblasts first exposed to 5 cGy (priming dose) and then followed by 2 Gy (challenge dose) of X-ray through comparisons to those cells that had only received a single 2 Gy dose. We studied how the priming dose affected the expression of gene transcripts, and to identify transcripts or pathways that were associated with the reduced chromosomal damages (in terms of the number of micronuclei) after application of the challenging dose. Through the mRNA and microRNA microarray analyses, the transcriptome alteration in AG01522 cells was examined, and the significantly altered genes were identified for different irradiation procedures using bioinformatics approaches. We observed that a low-dose X-ray exposure produced an alert, triggering and altering cellular responses to defend against subsequent high dose-induced damages, and accelerating the cell repair process. Moreover, the p53 signaling pathway was found to play critial roles in regulating DNA damage responses at the early stage after application of the challenging dose, particularly in the RAR group. Furthermore, microRNA analyses also revealed that cell communication and intercellular signaling transduction played important roles after low-dose irradiation. We conclude that RAR benefits from the alarm mechanisms triggered by a low-dose priming radation dose. PMID:25886619

PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.

PubMed

Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine

2009-01-01

To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.

A Self-Assembled Coumarin-Anchored Dendrimer for Efficient Gene Delivery and Light-Responsive Drug Delivery.

PubMed

Wang, Hui; Miao, Wujun; Wang, Fei; Cheng, Yiyun

2018-06-11

The assembly of low molecular weight polymers into highly efficient and nontoxic nanostructures has broad applicability in gene delivery. In this study, we reported the assembly of coumarin-anchored low generation dendrimers in aqueous solution via hydrophobic interactions. The synthesized material showed significantly improved DNA binding and gene delivery, and minimal toxicity on the transfected cells. Moreover, the coumarin moieties in the assembled nanostructures endow the materials with light-responsive drug delivery behaviors. The coumarin substitutes in the assembled nanostructures were cross-linked with each other upon irradiation at 365 nm, and the cross-linked assemblies were degraded upon further irradiation at 254 nm. As a result, the drug-loaded nanoparticle showed a light-responsive drug release behavior and light-enhanced anticancer activity. The assembled nanoparticle also exhibited a complementary anticancer activity through the codelivery of 5-fluorouracil and a therapeutic gene encoding tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). This study provided a facile strategy to develop light-responsive polymers for the codelivery of therapeutic genes and anticancer drugs.

Time-response characteristic and potential biomarker identification of heavy metal induced toxicity in zebrafish.

PubMed

Yin, Jian; Wang, Ai-Ping; Li, Wan-Fang; Shi, Rui; Jin, Hong-Tao; Wei, Jin-Feng

2018-01-01

The present work aims to explore the time-response (from 24 h to 96 h) characteristic and identify early potential sensitive biomarkers of copper (Cu) (as copper chloride dihydrate), cadmium (Cd) (as cadmium acetate), lead (Pb) (as lead nitrate) and chromium (Cr) (as potassium dichromate) exposure in adult zebrafish, focusing on reactive oxygen species (ROS), SOD activity, lipid peroxidation and gene expression related to oxidative stress and inflammatory response. Furthermore, the survival rate decreased apparently by a concentration-dependent manner after Cu, Cr, Cd and Pb exposure, and we selected non-lethal concentrations 0.05 mg/L for Cu, 15 mg/L for Cr, 3 mg/L for Cd and 93.75μg/L for Pb to test the effect on the following biological indicators. Under non-lethal concentration, the four heavy metals have no apparent histological change in adult zebrafish gills. Similar trends in ROS production, MDA level and SOD activity were up-regulated by the four heavy metals, while MDA level responded more sensitive to Pb by time-dependent manner than the other three heavy metals. In addition, mRNA levels related to antioxidant system (SOD1, SOD2 and Nrf2) were up-regulated by non-lethal concentration Cu, Cr, Cd and Pb exposure. MDA level and SOD1 gene have a more delayed response to heavy metals. Genes related to immunotoxicity were increased significantly after heavy metals exposure at non-lethal concentrations. TNF-α and IL-1β gene have similar sensibility to the four heavy metals, while IL-8 gene was more responsive to Cr, Cd and Pb exposure at 48 h groups and IFN-γ gene showed more sensitivity to Cu at 48 h groups than the other heavy metals. In conclusion, the present works have suggested that the IFN-γ gene may applied as early sensitive biomarker to identify Cu-induced toxicity, while MDA content and IL-8 gene may use as early sensitive biomarkers for evaluating the risk of Pb exposure. Moreover, IL-8 and IFN-γ gene were more responsive to heavy

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Oligonucleotide Microarray Analysis of Dietary-Induced Hyperlipidemia Gene Expression Profiles in Miniature Pigs

PubMed Central

Takahashi, Junko; Waki, Shiori; Matsumoto, Rena; Odake, Junji; Miyaji, Takayuki; Tottori, Junichi; Iwanaga, Takehiro; Iwahashi, Hitoshi

2012-01-01

Background Hyperlipidemia animal models have been established, but complete gene expression profiles of the transition from normal lipid levels have not been obtained. Miniature pigs are useful model animals for gene expression studies on dietary-induced hyperlipidemia because they have a similar anatomy and digestive physiology to humans, and blood samples can be obtained from them repeatedly. Methodology Two typical dietary treatments were used for dietary-induced hyperlipidemia models, by using specific pathogen-free (SPF) Clawn miniature pigs. One was a high-fat and high-cholesterol diet (HFCD) and the other was a high-fat, high-cholesterol, and high-sucrose diet (HFCSD). Microarray analyses were conducted from whole blood samples during the dietary period and from white blood cells at the end of the dietary period to evaluate the transition of expression profiles of the two dietary models. Principal Findings Variations in whole blood gene expression intensity within the HFCD or the HFCSD group were in the same range as the controls provide with normal diet at all periods. This indicates uniformity of dietary-induced hyperlipidemia for our dietary protocols. Gene ontology- (GO) based functional analyses revealed that characteristics of the common changes between HFCD and HFCSD were involved in inflammatory responses and reproduction. The correlation coefficient between whole blood and white blood cell expression profiles at 27 weeks with the HFCSD diet was significantly lower than that of the control and HFCD diet groups. This may be due to the effects of RNA originating from the tissues and/or organs. Conclusions No statistically significant differences in fasting plasma lipids and glucose levels between the HFCD and HFCSD groups were observed. However, blood RNA analyses revealed different characteristics corresponding to the dietary protocols. In this study, whole blood RNA analyses proved to be a useful tool to evaluate transitions in dietary-induced

Toxicological responses of environmental mixtures: Environmental metal mixtures display synergistic induction of metal-responsive and oxidative stress genes in placental cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adebambo, Oluwadamilare A.; Ray, Paul D.; Shea, Damian

Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one bymore » Cd. Six gene biomarkers were measured in order to evaluate the effects from the metal mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu{sup 2+} transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. - Highlights: • Toxicogenomic responses of environmental metal mixtures assessed • Induction of ATP7B, HO-1, MT1A, MT1F and MT1G by metal mixtures observed in placental cells • Higher gene induction in response to metal mixtures versus single metal treatments.« less

Salmonella induces prominent gene expression in the rat colon

PubMed Central

Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg MJ

2007-01-01

Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression

Salmonella induces prominent gene expression in the rat colon.

PubMed

Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg M J

2007-09-12

Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFN gamma and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression.

Nitrogen Supply Influences Herbivore-Induced Direct and Indirect Defenses and Transcriptional Responses in Nicotiana attenuata[w

PubMed Central

Lou, Yonggen; Baldwin, Ian T.

2004-01-01

Although nitrogen (N) availability is known to alter constitutive resistance against herbivores, its influence on herbivore-induced responses, including signaling pathways, transcriptional signatures, and the subsequently elicited chemical defenses is poorly understood. We used the native tobacco, Nicotiana attenuata, which germinates in the postfire environment and copes with large changes in soil N during postfire succession, to compare a suite of Manduca sexta- and elicitor-induced responses in plants grown under high- and low-N (LN) supply rates. LN supply decreased relative growth rates and biomass by 35% at 40 d compared to high-N plants; furthermore, it also attenuated (by 39 and 60%) the elicitor-induced jasmonate and salicylate bursts, two N-intensive direct defenses (nicotine and trypsin proteinase inhibitors, albeit by different mechanisms), and carbon-containing nonvolatile defenses (rutin, chlorogenic acid, and diterpene glycosides), but did not affect the induced release of volatiles (cis-α-bergamotene and germacrene A), which function as indirect defenses. M. sexta and methyl jasmonate-induced transcriptional responses measured with a microarray enriched in herbivore-induced genes were also substantially reduced in plants grown under LN supply rates. In M. sexta-attacked LN plants, only 36 (45%) up-regulated and 46 (58%) down-regulated genes showed the same regulation as those in attacked high-N plants. However, transcriptional responses frequently directly countered the observed metabolic changes. Changes in a leaf's sensitivity to elicitation, an attacked leaf's waning ability to export oxylipin wound signals, and/or resource limitations in LN plants can account for the observed results, underscoring the conclusion that defense activation is a resource-intensive response. PMID:15133153

Identifying key genes, pathways and screening therapeutic agents for manganese-induced Alzheimer disease using bioinformatics analysis.

PubMed

Ling, JunJun; Yang, Shengyou; Huang, Yi; Wei, Dongfeng; Cheng, Weidong

2018-06-01

Alzheimer disease (AD) is a progressive neurodegenerative disease, the etiology of which remains largely unknown. Accumulating evidence indicates that elevated manganese (Mn) in brain exerts toxic effects on neurons and contributes to AD development. Thus, we aimed to explore the gene and pathway variations through analysis of high through-put data in this process.To screen the differentially expressed genes (DEGs) that may play critical roles in Mn-induced AD, public microarray data regarding Mn-treated neurocytes versus controls (GSE70845), and AD versus controls (GSE48350), were downloaded and the DEGs were screened out, respectively. The intersection of the DEGs of each datasets was obtained by using Venn analysis. Then, gene ontology (GO) function analysis and KEGG pathway analysis were carried out. For screening hub genes, protein-protein interaction network was constructed. At last, DEGs were analyzed in Connectivity Map (CMAP) for identification of small molecules that overcome Mn-induced neurotoxicity or AD development.The intersection of the DEGs obtained 140 upregulated and 267 downregulated genes. The top 5 items of biological processes of GO analysis were taxis, chemotaxis, cell-cell signaling, regulation of cellular physiological process, and response to wounding. The top 5 items of KEGG pathway analysis were cytokine-cytokine receptor interaction, apoptosis, oxidative phosphorylation, Toll-like receptor signaling pathway, and insulin signaling pathway. Afterwards, several hub genes such as INSR, VEGFA, PRKACB, DLG4, and BCL2 that might play key roles in Mn-induced AD were further screened out. Interestingly, tyrphostin AG-825, an inhibitor of tyrosine phosphorylation, was predicted to be a potential agent for overcoming Mn-induced neurotoxicity or AD development.The present study provided a novel insight into the molecular mechanisms of Mn-induced neurotoxicity or AD development and screened out several small molecular candidates that might be

Live Attenuated Leishmania donovani Centrin Gene-Deleted Parasites Induce IL-23-Dependent IL-17-Protective Immune Response against Visceral Leishmaniasis in a Murine Model.

PubMed

Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L

2018-01-01

No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.

Abiotic and Biotic Stressors Causing Equivalent Mortality Induce Highly Variable Transcriptional Responses in the Soybean Aphid

PubMed Central

Enders, Laramy S.; Bickel, Ryan D.; Brisson, Jennifer A.; Heng-Moss, Tiffany M.; Siegfried, Blair D.; Zera, Anthony J.; Miller, Nicholas J.

2014-01-01

Environmental stress affects basic organismal functioning and can cause physiological, developmental, and reproductive impairment. However, in many nonmodel organisms, the core molecular stress response remains poorly characterized and the extent to which stress-induced transcriptional changes differ across qualitatively different stress types is largely unexplored. The current study examines the molecular stress response of the soybean aphid (Aphis glycines) using RNA sequencing and compares transcriptional responses to multiple stressors (heat, starvation, and plant defenses) at a standardized stress level (27% adult mortality). Stress-induced transcriptional changes showed remarkable variation, with starvation, heat, and plant defensive stress altering the expression of 3985, 510, and 12 genes, respectively. Molecular responses showed little overlap across all three stressors. However, a common transcriptional stress response was identified under heat and starvation, involved with up-regulation of glycogen biosynthesis and molecular chaperones and down-regulation of bacterial endosymbiont cellular and insect cuticular components. Stressor-specific responses indicated heat affected expression of heat shock proteins and cuticular components, whereas starvation altered a diverse set of genes involved in primary metabolism, oxidative reductive processes, nucleosome and histone assembly, and the regulation of DNA repair and replication. Exposure to host plant defenses elicited the weakest response, of which half of the genes were of unknown function. This study highlights the need for standardizing stress levels when comparing across stress types and provides a basis for understanding the role of general vs. stressor specific molecular responses in aphids. PMID:25538100

Sphingomonas wittichii Strain RW1 Genome-Wide Gene Expression Shifts in Response to Dioxins and Clay

PubMed Central

Tsoi, Tamara V.; Iwai, Shoko; Liu, Cun; Fish, Jordan A.; Gu, Cheng; Johnson, Timothy A.; Zylstra, Gerben; Teppen, Brian J.; Li, Hui; Hashsham, Syed A.; Boyd, Stephen A.; Cole, James R.; Tiedje, James M.

2016-01-01

Sphingomonas wittichii strain RW1 (RW1) is one of the few strains that can grow on dibenzo-p-dioxin (DD). We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF), and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC) as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes’ microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis. PMID:27309357

Serine Proteolytic Pathway Activation Reveals an Expanded Ensemble of Wound Response Genes in Drosophila

PubMed Central

Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William

2013-01-01

After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905

A maize landrace that emits defense volatiles in response to herbivore eggs possesses a strongly inducible terpene synthase gene.

PubMed

Tamiru, Amanuel; Bruce, Toby J A; Richter, Annett; Woodcock, Christine M; Midega, Charles A O; Degenhardt, Jörg; Kelemu, Segenet; Pickett, John A; Khan, Zeyaur R

2017-04-01

Maize ( Zea mays ) emits volatile terpenes in response to insect feeding and egg deposition to defend itself against harmful pests. However, maize cultivars differ strongly in their ability to produce the defense signal. To further understand the agroecological role and underlying genetic mechanisms for variation in terpene emission among maize cultivars, we studied the production of an important signaling component ( E )-caryophyllene in a South American maize landrace Braz1006 possessing stemborer Chilo partellus egg inducible defense trait, in comparison with the European maize line Delprim and North American inbred line B73. The ( E) - caryophyllene production level and transcript abundance of TPS23, terpene synthase responsible for ( E) - caryophyllene formation, were compared between Braz1006, Delprim, and B73 after mimicked herbivory. Braz1006-TPS23 was heterologously expressed in E. coli , and amino acid sequences were determined. Furthermore, electrophysiological and behavioral responses of a key parasitic wasp Cotesia sesamiae to C .  partellus egg-induced Braz1006 volatiles were determined using coupled gas chromatography electroantennography and olfactometer bioassay studies. After elicitor treatment, Braz1006 released eightfold higher ( E) -caryophyllene than Delprim, whereas no ( E) -caryophyllene was detected in B73. The superior (E)- caryophyllene production by Braz1006 was positively correlated with high transcript levels of TPS23 in the landrace compared to Delprim. TPS23 alleles from Braz1006 showed dissimilarities at different sequence positions with Delprim and B73 and encodes an active enzyme. Cotesia sesamiae was attracted to egg-induced volatiles from Braz1006 and synthetic (E)- caryophyllene. The variation in ( E) -caryophyllene emission between Braz1006 and Delprim is positively correlated with induced levels of TPS23 transcripts. The enhanced TPS23 activity and corresponding ( E) -caryophyllene production by the maize landrace could be

Mechanical Stress Induces Biotic and Abiotic Stress Responses via a Novel cis-Element

PubMed Central

Walley, Justin W; Coughlan, Sean; Hudson, Matthew E; Covington, Michael F; Kaspi, Roy; Banu, Gopalan; Harmer, Stacey L; Dehesh, Katayoon

2007-01-01

Plants are continuously exposed to a myriad of abiotic and biotic stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. To begin to identify primary stress signal transduction components, we have focused on genes that respond rapidly (within 5 min) to stress signals. Because it has been hypothesized that detection of physical stress is a mechanism common to mounting a response against a broad range of environmental stresses, we have utilized mechanical wounding as the stress stimulus and performed whole genome microarray analysis of Arabidopsis thaliana leaf tissue. This led to the identification of a number of rapid wound responsive (RWR) genes. Comparison of RWR genes with published abiotic and biotic stress microarray datasets demonstrates a large overlap across a wide range of environmental stresses. Interestingly, RWR genes also exhibit a striking level and pattern of circadian regulation, with induced and repressed genes displaying antiphasic rhythms. Using bioinformatic analysis, we identified a novel motif overrepresented in the promoters of RWR genes, herein designated as the Rapid Stress Response Element (RSRE). We demonstrate in transgenic plants that multimerized RSREs are sufficient to confer a rapid response to both biotic and abiotic stresses in vivo, thereby establishing the functional involvement of this motif in primary transcriptional stress responses. Collectively, our data provide evidence for a novel cis-element that is distributed across the promoters of an array of diverse stress-responsive genes, poised to respond immediately and coordinately to stress signals. This structure suggests that plants may have a transcriptional network resembling the general stress signaling pathway in yeast and that the RSRE element may provide the key to this coordinate regulation. PMID:17953483

Sequential infection with common pathogens promotes human-like immune gene expression and altered vaccine response

PubMed Central

Reese, Tiffany A.; Bi, Kevin; Kambal, Amal; Filali-Mouhim, Ali; Beura, Lalit K.; Bürger, Matheus C.; Pulendran, Bali; Sekaly, Rafick; Jameson, Stephen C.; Masopust, David; Haining, W. Nicholas; Virgin, Herbert W.

2016-01-01

Summary Immune responses differ between laboratory mice and humans. Chronic infection with viruses and parasites are common in humans, but are absent in laboratory mice, and thus represent potential contributors to inter-species differences in immunity. To test this, we sequentially infected laboratory mice with herpesviruses, influenza, and an intestinal helminth, and compared their blood immune signatures to mock-infected mice before and after vaccination against Yellow Fever Virus (YFV-17D). Sequential infection altered pre- and post-vaccination gene expression, cytokines, and antibodies in blood. Sequential pathogen exposure induced gene signatures that recapitulated those seen in blood from pet store-raised versus laboratory mice, and adult versus cord blood in humans. Therefore basal and vaccine-induced murine immune responses are altered by infection with agents common outside of barrier facilities. This raises the possibility that we can improve mouse models of vaccination and immunity by selective microbial exposure of laboratory animals to mimic that of humans. PMID:27107939

Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

NASA Technical Reports Server (NTRS)