DOE Office of Scientific and Technical Information (OSTI.GOV)
Cairney, J.; Hays, D.; Stockand, J.D.
1991-05-01
The rangeland shrub Atriplex canescens (saltbush) is extremely drought-tolerant and is capable of growing at water potentials below {minus}40 bar. To discover the molecular basis of this tolerance, the authors have isolated a number of cDNA clones of drought-stress induced genes. Analysis of the nucleotide sequence and expression of these genes in different tissues and in response to different stresses reveals the diversity of the stress response. Members of a drought-induced, multi-gene family, have been sequenced. Although 95% homologous, non-conservative substitutions result in proteins of different tertiary structure. Additionally, the genes are expressed through a number of mature forms ofmore » mRNA which may arise by alternative RNA processing.« less
Uchiyama, Taku; Miyazaki, Kentaro
2010-11-01
A reporter assay-based screening method for enzymes, which we named product-induced gene expression (PIGEX), was developed and used to screen a metagenomic library for amidases. A benzoate-responsive transcriptional activator, BenR, was placed upstream of the gene encoding green fluorescent protein and used as a sensor. Escherichia coli sensor cells carrying the benR-gfp gene cassette fluoresced in response to benzoate concentrations as low as 10 μM but were completely unresponsive to the substrate benzamide. An E. coli metagenomic library consisting of 96,000 clones was grown in 96-well format in LB medium containing benzamide. The library cells were then cocultivated with sensor cells. Eleven amidase genes were recovered from 143 fluorescent wells; eight of these genes were homologous to known bacterial amidase genes while three were novel genes. In addition to their activity toward benzamide, the enzymes were active toward various substrates, including d- and l-amino acid amides, and displayed enantioselectivity. Thus, we demonstrated that PIGEX is an effective approach for screening novel enzymes based on product detection.
Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho
2006-06-01
Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.
Barry, Kevin C; Ingolia, Nicholas T; Vance, Russell E
2017-01-01
The inducible innate immune response to infection requires a concerted process of gene expression that is regulated at multiple levels. Most global analyses of the innate immune response have focused on transcription induced by defined immunostimulatory ligands, such as lipopolysaccharide. However, the response to pathogens involves additional complexity, as pathogens interfere with virtually every step of gene expression. How cells respond to pathogen-mediated disruption of gene expression to nevertheless initiate protective responses remains unclear. We previously discovered that a pathogen-mediated blockade of host protein synthesis provokes the production of specific pro-inflammatory cytokines. It remains unclear how these cytokines are produced despite the global pathogen-induced block of translation. We addressed this question by using parallel RNAseq and ribosome profiling to characterize the response of macrophages to infection with the intracellular bacterial pathogen Legionella pneumophila. Our results reveal that mRNA superinduction is required for the inducible immune response to a bacterial pathogen. DOI: http://dx.doi.org/10.7554/eLife.22707.001 PMID:28383283
Miyabayashi, Sachiko; Sugita, Tomoki; Kobayashi, Akie; Yamazaki, Chiaki; Miyazawa, Yutaka; Kamada, Motoshi; Kasahara, Haruo; Osada, Ikuko; Shimazu, Toru; Fusejima, Yasuo; Higashibata, Akira; Yamazaki, Takashi; Ishioka, Noriaki; Takahashi, Hideyuki
2018-01-01
In cucumber seedlings, gravitropism interferes with hydrotropism, which results in the nearly complete inhibition of hydrotropism under stationary conditions. However, hydrotropic responses are induced when the gravitropic response in the root is nullified by clinorotation. Columella cells in the root cap sense gravity, which induces the gravitropic response. In this study, we found that removing the root tip induced hydrotropism in cucumber roots under stationary conditions. The application of auxin transport inhibitors to cucumber seedlings under stationary conditions suppressed the hydrotropic response induced by the removal of the root tip. To investigate the expression of genes related to hydrotropism in de-tipped cucumber roots, we conducted transcriptome analysis of gene expression by RNA-Seq using seedlings exhibiting hydrotropic and gravitropic responses. Of the 21 and 45 genes asymmetrically expressed during hydrotropic and gravitropic responses, respectively, five genes were identical. Gene ontology (GO) analysis indicated that the category auxin-inducible genes was significantly enriched among genes that were more highly expressed in the concave side of the root than the convex side during hydrotropic or gravitropic responses. Reverse transcription followed by quantitative polymerase chain reaction (RT-qPCR) analysis revealed that root hydrotropism induced under stationary conditions (by removing the root tip) was accompanied by the asymmetric expression of several auxin-inducible genes. However, intact roots did not exhibit the asymmetric expression patterns of auxin-inducible genes under stationary conditions, even in the presence of a moisture gradient. These results suggest that the root tip inhibits hydrotropism by suppressing the induction of asymmetric auxin distribution. Auxin transport and distribution not mediated by the root tip might play a role in hydrotropism in cucumber roots. PMID:29324818
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Zheng; Jin, Bo; Jin, Yaqiong
Androgens (AR) play an important role in initiation and progression of prostate cancer. It has been shown that AR exert their effects mainly through the androgen-activated AR which binds to androgen response elements (AREs) in the regulatory regions of target genes to regulate the transcription of androgen-responsive genes, thus, identification of AR downstream target gene is critical to understand androgen function in prostate cancer. In this study, our results showed that androgen treatment of LNCaP cells induced PTTG1 expression, which was blocked by the androgen receptor antagonist, Casodex. Bioinformatics analysis and experiments using PTTG1 promoter deletion mutants showed that themore » PTTG1 promoter contains a putative androgen response element (ARE), which localizes in the −851 to −836 region of the promoter. Androgen activated androgen receptor (AR) binding to this ARE was confirmed by Chromatin immunoprecipitation (ChIP) assay. Furthermore, Knockdown of PTTG1 expression using short hairpin RNA significantly reduced androgen-induced LNCaP cell growth and invasion. In addition, we showed PTTG1 is highly expressed in metastasis prostate cancer tissue. These results suggest that PTTG1 is a novel downstream target gene of androgen receptor and take part in prostate cancer proliferation and metastasis. - Highlights: • Androgen treatment of LNCaP cells induced PTTG1 expression. • Knockdown of PTTG1 expression significantly reduced androgen-induced LNCaP cell growth and invasion. • PTTG1 is highly expressed in metastasis prostate cancer tissue. • PTTG1 is a novel downstream target gene of androgen receptor.« less
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure.
Strafella, Elisabetta; Bracci, Massimo; Staffolani, Sara; Manzella, Nicola; Giantomasi, Daniele; Valentino, Matteo; Amati, Monica; Tomasetti, Marco; Santarelli, Lory
2013-01-01
Objective The aim of this study was to evaluate the expression of a panel of genes involved in toxicology in response to styrene exposure at levels below the occupational standard setting. Methods Workers in a fiber glass boat industry were evaluated for a panel of stress- and toxicity-related genes and associated with biochemical parameters related to hepatic injury. Urinary styrene metabolites (MA+PGA) of subjects and environmental sampling data collected for air at workplace were used to estimate styrene exposure. Results Expression array analysis revealed massive upregulation of genes encoding stress-responsive proteins (HSPA1L, EGR1, IL-6, IL-1β, TNSF10 and TNFα) in the styrene-exposed group; the levels of cytokines released were further confirmed in serum. The exposed workers were then stratified by styrene exposure levels. EGR1 gene upregulation paralleled the expression and transcriptional protein levels of IL-6, TNSF10 and TNFα in styrene exposed workers, even at low level. The activation of the EGR1 pathway observed at low-styrene exposure was associated with a slight increase of hepatic markers found in highly exposed subjects, even though they were within normal range. The ALT and AST levels were not affected by alcohol consumption, and positively correlated with urinary styrene metabolites as evaluated by multiple regression analysis. Conclusion The pro-inflammatory cytokines IL-6 and TNFα are the primary mediators of processes involved in the hepatic injury response and regeneration. Here, we show that styrene induced stress responsive genes involved in cytoprotection and cytotoxicity at low-exposure, that proceed to a mild subclinical hepatic toxicity at high-styrene exposure. PMID:24086524
Comparative transcriptional profiling-based identification of raphanusanin-inducible genes
2010-01-01
Background Raphanusanin (Ra) is a light-induced growth inhibitor involved in the inhibition of hypocotyl growth in response to unilateral blue-light illumination in radish seedlings. Knowledge of the roles of Ra still remains elusive. To understand the roles of Ra and its functional coupling to light signalling, we constructed the Ra-induced gene library using the Suppression Subtractive Hybridisation (SSH) technique and present a comparative investigation of gene regulation in radish seedlings in response to short-term Ra and blue-light exposure. Results The predicted gene ontology (GO) term revealed that 55% of the clones in the Ra-induced gene library were associated with genes involved in common defence mechanisms, including thirty four genes homologous to Arabidopsis genes implicated in R-gene-triggered resistance in the programmed cell death (PCD) pathway. Overall, the library was enriched with transporters, hydrolases, protein kinases, and signal transducers. The transcriptome analysis revealed that, among the fifty genes from various functional categories selected from 88 independent genes of the Ra-induced library, 44 genes were up-regulated and 4 were down-regulated. The comparative analysis showed that, among the transcriptional profiles of 33 highly Ra-inducible genes, 25 ESTs were commonly regulated by different intensities and duration of blue-light irradiation. The transcriptional profiles, coupled with the transcriptional regulation of early blue light, have provided the functional roles of many genes expected to be involved in the light-mediated defence mechanism. Conclusions This study is the first comprehensive survey of transcriptional regulation in response to Ra. The results described herein suggest a link between Ra and cellular defence and light signalling, and thereby contribute to further our understanding of how Ra is involved in light-mediated mechanisms of plant defence. PMID:20553608
Hirotani, Tomonori; Yamamoto, Masahiro; Kumagai, Yutaro; Uematsu, Satoshi; Kawase, Ichiro; Takeuchi, Osamu; Akira, Shizuo
2005-03-11
Macrophages recognize lipopolysaccharide (LPS) by Toll-like receptor 4 and activate inflammatory responses by inducing expression of various genes. TLR4 activates intracellular signaling pathways via TIR domain containing adaptor molecules, MyD88, and Toll/IL-1 domain containing adaptor inducing IFN-beta (TRIF). Although macrophages lacking MyD88 or TRIF showed impaired cytokine production, activation of intracellular signaling molecules still occurred in response to LPS in these cells. In the present study, we implemented cDNA microarrays to investigate the contribution of MyD88 and TRIF in gene expression induced by LPS stimulation. Whereas wild-type macrophages induced 148 genes in response to LPS, macrophages lacking both MyD88 and TRIF did not upregulate any genes in response to LPS. Surprisingly, 80 LPS-inducible genes were redundantly regulated by either MyD88 or TRIF. In contrast, proinflammatory cytokines and chemokines were critically regulated by MyD88 or TRIF alone. Genes critically regulated by MyD88 alone tend to be induced quickly after LPS stimulation and regulated by mRNA stability as well as transcription. Genes known to be induced by type I interferons were simply dependent on TRIF for their expression. Taken together, MyD88 and TRIF play both redundant and distinct roles in LPS-induced gene expression.
Tang, Bin; Liu, Xiao-Jun; Shi, Zuo-Kun; Shen, Qi-Da; Xu, Yan-Xia; Wang, Su; Zhang, Fan; Wang, Shi-Gui
2017-06-01
Harmonia axyridis is an important predatory lady beetle that is a natural enemy of agricultural and forestry pests. In this research, the cold hardiness induced genes and their expression changes in H. axyridis were screened and detected by the way of the transcriptome and qualitative real-time PCR under normal and low temperatures, using high-throughput transcriptome and digital gene-expression-tag technologies. We obtained a 10Gb transcriptome and an 8Mb gene expression tag pool using Illumina deep sequencing technology and RNA-Seq analysis (accession number SRX540102). Of the 46,980 non-redundant unigenes identified, 28,037 (59.7%) were matched to known genes in GenBank, 21,604 (46.0%) in Swiss-Prot, 19,482 (41.5%) in Kyoto Encyclopedia of Genes and Genomes and 13,193 (28.1%) in Gene Ontology databases. Seventy-five percent of the unigene sequences had top matches with gene sequences from Tribolium castaneum. Results indicated that 60 genes regulated the entire cold-acclimation response, and, of these, seven genes were always up-regulated and five genes always down-regulated. Further screening revealed that six cold-resistant genes, E3 ubiquitin-protein ligase, transketolase, trehalase, serine/arginine repetitive matrix protein 2, glycerol kinase and sugar transporter SWEET1-like, play key roles in the response. Expression from a number of the differentially expressed genes was confirmed with quantitative real-time PCR (HaCS_Trans). The paper attempted to identify cold-resistance response genes, and study the potential mechanism by which cold acclimation enhances the insect's cold endurance. Information on these cold-resistance response genes will improve the development of low-temperature storage technology of natural enemy insects for future use in biological control. Copyright © 2017 Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)
1998-01-01
Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.
Ozone-induced gene expression occurs via ethylene-dependent and -independent signalling.
Grimmig, Bernhard; Gonzalez-Perez, Maria N; Leubner-Metzger, Gerhard; Vögeli-Lange, Regina; Meins, Fred; Hain, Rüdiger; Penuelas, Josep; Heidenreich, Bernd; Langebartels, Christian; Ernst, Dieter; Sandermann, Heinrich
2003-03-01
Recent studies suggest that ethylene is involved in signalling ozone-induced gene expression. We show here that application of ozone increased glucuronidase (GUS) expression of chimeric reporter genes regulated by the promoters of the tobacco class I beta-1,3-glucanases (GLB and Gln2) and the grapevine resveratrol synthase (Vst1) genes in transgenic tobacco leaves. 5'-deletion analysis of the class I beta-1,3-glucanase promoter revealed that ozone-induced gene regulation is mainly mediated by the distal enhancer region containing the positively acting ethylene-responsive element (ERE). In addition, application of 1-methylcyclopropene (1-MCP), an inhibitor of ethylene action, blocked ozone-induced class I beta-1,3-glucanase promoter activity. Enhancer activity and ethylene-responsiveness depended on the integrity of the GCC boxes, cis-acting elements present in the ERE of the class I beta-1,3-glucanase and the basic-type pathogenesis-related PR-1 protein (PRB-1b) gene promoters. The minimal PRB-1b promoter containing only the ERE with intact GCC boxes, was sufficient to confer 10-fold ozone inducibility to a GUS-reporter gene, while a substitution mutation in the GCC box abolished ozone responsiveness. The ERE region of the class I beta-1,3-glucanase promoter containing two intact GCC boxes confered strong ozone inducibility to a minimal cauliflower mosaic virus (CaMV) 35S RNA promoter, whereas two single-base substitution in the GCC boxes resulted in a complete loss of ozone inducibility. Taken together, these datastrongly suggest that ethylene is signalling ozone-induced expression of class I beta-l,3-glucanase and PRB-1b genes. Promoter analysis of the stilbene synthase Vst1 gene unravelled different regions for ozone and ethylene-responsiveness. Application of 1-MCP blocked ethylene-induced Vst1 induction, but ozone induction was not affected. This shows that ozone-induced gene expression occurs via at least two different signalling mechanisms and suggests an
Holzman, L B; Marks, R M; Dixit, V M
1990-11-01
We have previously described the cloning of a group of novel cellular immediate-early response genes whose expression in human umbilical vein endothelial cells is induced by tumor necrosis factor alpha in the presence of cycloheximide. These genes are likely to participate in mediating the response of the vascular endothelium to proinflammatory cytokines. In this study, we further characterized one of these novel gene products named B61. Sequence analysis of cDNA clones encoding B61 revealed that its protein product has no significant homology to previously described proteins. Southern analysis suggested that B61 is an evolutionarily conserved single-copy gene. B61 is primarily a hydrophilic molecule but contains both a hydrophobic N-terminal and a hydrophobic C-terminal region. The N-terminal region is typical of a signal peptide, which is consistent with the secreted nature of the protein. The mature form of the predicted protein consists of 187 amino acid residues and has a molecular weight of 22,000. Immunoprecipitation of metabolically labeled human umbilical vein endothelial cell preparations revealed that B61 is a 25-kilodalton secreted protein which is markedly induced by tumor necrosis factor.
Holzman, L B; Marks, R M; Dixit, V M
1990-01-01
We have previously described the cloning of a group of novel cellular immediate-early response genes whose expression in human umbilical vein endothelial cells is induced by tumor necrosis factor alpha in the presence of cycloheximide. These genes are likely to participate in mediating the response of the vascular endothelium to proinflammatory cytokines. In this study, we further characterized one of these novel gene products named B61. Sequence analysis of cDNA clones encoding B61 revealed that its protein product has no significant homology to previously described proteins. Southern analysis suggested that B61 is an evolutionarily conserved single-copy gene. B61 is primarily a hydrophilic molecule but contains both a hydrophobic N-terminal and a hydrophobic C-terminal region. The N-terminal region is typical of a signal peptide, which is consistent with the secreted nature of the protein. The mature form of the predicted protein consists of 187 amino acid residues and has a molecular weight of 22,000. Immunoprecipitation of metabolically labeled human umbilical vein endothelial cell preparations revealed that B61 is a 25-kilodalton secreted protein which is markedly induced by tumor necrosis factor. Images PMID:2233719
Coordinate Intracellular Expression of Salmonella Genes Induced during Infection
Heithoff, Douglas M.; Conner, Christopher P.; Hentschel, Ute; Govantes, Fernando; Hanna, Philip C.; Mahan, Michael J.
1999-01-01
Salmonella typhimurium in vivo-induced (ivi) genes were grouped by their coordinate behavior in response to a wide variety of environmental and genetic signals, including pH, Mg2+, Fe2+, and PhoPQ. All of the seven ivi fusions that are induced by both low pH and low Mg2+ (e.g., iviVI-A) are activated by the PhoPQ regulatory system. Iron-responsive ivi fusions include those induced under iron limitation (e.g., entF) as well as one induced by iron excess but only in the absence of PhoP (pdu). Intracellular expression studies showed that each of the pH- and Mg2+-responsive fusions is induced upon entry into and growth within three distinct mammalian cell lines: RAW 264.7 murine macrophages and two cultured human epithelial cell lines: HEp-2 and Henle-407. Each ivi fusion has a characteristic level of induction consistent within all three cell types, suggesting that this class of coordinately expressed ivi genes responds to general intracellular signals that are present both in initial and in progressive stages of infection and may reflect their responses to similar vacuolar microenvironments in these cell types. Investigation of ivi expression patterns reveals not only the inherent versatility of pathogens to express a given gene(s) at various host sites but also the ability to modify their expression within the context of different animal hosts, tissues, cell types, or subcellular compartments. PMID:9922242
DOE Office of Scientific and Technical Information (OSTI.GOV)
Verma, Saguna; Ziegler, Katja; Ananthula, Praveen
2006-02-20
Human polyomavirus JC (JCV) infects 80% of the population worldwide. Primary infection, typically occurring during childhood, is asymptomatic in immunocompetent individuals and results in lifelong latency and persistent infection. However, among the severely immunocompromised, JCV may cause a fatal demyelinating disease, progressive multifocal leukoencephalopathy (PML). Virus-host interactions influencing persistence and pathogenicity are not well understood, although significant regulation of JCV activity is thought to occur at the level of transcription. Regulation of the JCV early and late promoters during the lytic cycle is a complex event that requires participation of both viral and cellular factors. We have used cDNA microarraymore » technology to analyze global alterations in gene expression in JCV-permissive primary human fetal glial cells (PHFG). Expression of more than 400 cellular genes was altered, including many that influence cell proliferation, cell communication and interferon (IFN)-mediated host defense responses. Genes in the latter category included signal transducer and activator of transcription 1 (STAT1), interferon stimulating gene 56 (ISG56), myxovirus resistance 1 (MxA), 2'5'-oligoadenylate synthetase (OAS), and cig5. The expression of these genes was further confirmed in JCV-infected PHFG cells and the human glioblastoma cell line U87MG to ensure the specificity of JCV in inducing this strong antiviral response. Results obtained by real-time RT-PCR and Western blot analyses supported the microarray data and provide temporal information related to virus-induced changes in the IFN response pathway. Our data indicate that the induction of an antiviral response may be one of the cellular factors regulating/controlling JCV replication in immunocompetent hosts and therefore constraining the development of PML.« less
Transcriptome analysis of trichothecene-induced gene expression in barley.
Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J
2007-11-01
Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.
Walia, Vishakh; Kumar, Rohit; Mitra, Abhijit
2015-01-01
Monocyte derived macrophages (MDMs), as an in vitro model in pathogen challenge studies, are generally induced with lipopolysaccharide (LPS) and concanavalin A (ConA) to assay cellular immunity. General immune responses to LPS and ConA have been studied in a wide range of species, but similar studies are limited to goats. In the present study, caprine MDMs were induced with LPS and ConA and the expression profile of immune response (IR) genes, namely, Tumor Necrosis Factor Alpha (TNFA), Interferon Gamma (IFNG), Interleukin 2 (IL2), Granulocyte Macrophage Colony Stimulating Factor (GMCSF), Interleukin 10 (IL10), Transforming Growth Factor Beta (TGFB), Natural Resistance-Associated Macrophage Protein-1 (NRAMP1), inducible nitric oxide synthase (NOS2), and caspase1 (CASP1) were studied to compare the potential of LPS and ConA in initiating immune responses in goat macrophages. Real Time quantitative PCR (RT-qPCR) analysis revealed that both LPS and ConA caused an upregulation (p < 0.05) of GMCSF, TGFB1, IL10, and IFNG and down-regulation of NRAMP1. TNFA and IL2, and NOS2 were upregulated (p < 0.05) by ConA and LPS, respectively. Whereas, the expression of CASP1 remain unaltered. Comparatively, the effect of ConA was more pronounced (p < 0.05) in regulating the expression of IR genes suggesting its suitability for studying the general immune responses in caprine MDM.
Hydrogen-peroxide-induced oxidative stress responses in Desulfovibrio vulgaris Hildenborough
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, A.; He, Z.; Redding-Johanson, A.M.
2010-07-01
To understand how sulphate-reducing bacteria respond to oxidative stresses, the responses of Desulfovibrio vulgaris Hildenborough to H{sub 2}O{sub 2}-induced stresses were investigated with transcriptomic, proteomic and genetic approaches. H{sub 2}O{sub 2} and induced chemical species (e.g. polysulfide, ROS) and redox potential shift increased the expressions of the genes involved in detoxification, thioredoxin-dependent reduction system, protein and DNA repair, and decreased those involved in sulfate reduction, lactate oxidation and protein synthesis. A gene coexpression network analysis revealed complicated network interactions among differentially expressed genes, and suggested possible importance of several hypothetical genes in H{sub 2}O{sub 2} stress. Also, most of themore » genes in PerR and Fur regulons were highly induced, and the abundance of a Fur regulon protein increased. Mutant analysis suggested that PerR and Fur are functionally overlapped in response to stresses induced by H{sub 2}O{sub 2} and reaction products, and the upregulation of thioredoxin-dependent reduction genes was independent of PerR or Fur. It appears that induction of those stress response genes could contribute to the increased resistance of deletion mutants to H{sub 2}O{sub 2}-induced stresses. In addition, a conceptual cellular model of D. vulgaris responses to H{sub 2}O{sub 2} stress was constructed to illustrate that this bacterium may employ a complicated molecular mechanism to defend against the H{sub 2}O{sub 2}-induced stresses.« less
Swathy, Babu; Banerjee, Moinak
2017-01-01
Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission
Swathy, Babu
2017-01-01
Introduction Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. Methods SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Results Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes
Singh, A S; Shah, A; Brockmann, A
2018-02-01
In honey bees, continuous foraging at an artificial feeder induced a sustained upregulation of the immediate early genes early growth response protein 1 (Egr-1) and hormone receptor 38 (Hr38). This gene expression response was accompanied by an upregulation of several Egr-1 candidate downstream genes: ecdysone receptor (EcR), dopamine/ecdysteroid receptor (DopEcR), dopamine decarboxylase and dopamine receptor 2. Hr38, EcR and DopEcR are components of the ecdysteroid signalling pathway, which is highly probably involved in learning and memory processes in honey bees and other insects. Time-trained foragers still showed an upregulation of Egr-1 when the feeder was presented at an earlier time of the day, suggesting that the genomic response is more dependent on the food reward than training time. However, presentation of the feeder at the training time without food was still capable of inducing a transient increase in Egr-1 expression. Thus, learnt feeder cues, or even training time, probably affect Egr-1 expression. In contrast, whole brain Egr-1 expression changes did not differ between dancing and nondancing foragers. On the basis of our results we propose that food reward induced continuous foraging ultimately elicits a genomic response involving Egr-1 and Hr38 and their downstream genes. Furthermore this genomic response is highly probably involved in foraging-related learning and memory responses. © 2017 The Royal Entomological Society.
The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.
Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon
2012-12-01
The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.
Huang, Lei; Li, Lingqian; Lemos, Henrique; Chandler, Phillip R.; Pacholczyk, Gabriela; Baban, Babak; Barber, Glen N.; Hayakawa, Yoshihiro; McGaha, Tracy L.; Ravishankar, Buvana; Munn, David H.; Mellor, Andrew L.
2013-01-01
Cytosolic DNA sensing via the STING adaptor incites autoimmunity by inducing type I IFN (IFNαβ). Here we show that DNA is also sensed via STING to suppress immunity by inducing indoleamine 2,3 dioxygenase (IDO). STING gene ablation abolished IFNαβ and IDO induction by dendritic cells (DCs) after DNA nanoparticle (DNP) treatment. Marginal zone macrophages, some DCs and myeloid cells ingested DNPs but CD11b+ DCs were the only cells to express IFNβ, while CD11b+ non-DCs were major IL-1β producers. STING ablation also abolished DNP-induced regulatory responses by DCs and regulatory T cells (Tregs), and hallmark regulatory responses to apoptotic cells were also abrogated. Moreover, systemic cyclic diguanylate monophosphate (c-diGMP) treatment to activate STING induced selective IFNβ expression by CD11b+ DCs and suppressed Th1 responses to immunization. Thus, previously unrecognized functional diversity amongst physiologic innate immune cells regarding DNA sensing via STING is pivotal in driving immune responses to DNA. PMID:23986532
Zhang, J D; Berntenis, N; Roth, A; Ebeling, M
2014-06-01
Gene signatures of drug-induced toxicity are of broad interest, but they are often identified from small-scale, single-time point experiments, and are therefore of limited applicability. To address this issue, we performed multivariate analysis of gene expression, cell-based assays, and histopathological data in the TG-GATEs (Toxicogenomics Project-Genomics Assisted Toxicity Evaluation system) database. Data mining highlights four genes-EGR1, ATF3, GDF15 and FGF21-that are induced 2 h after drug administration in human and rat primary hepatocytes poised to eventually undergo cytotoxicity-induced cell death. Modelling and simulation reveals that these early stress-response genes form a functional network with evolutionarily conserved structure and intrinsic dynamics. This is underlined by the fact that early induction of this network in vivo predicts drug-induced liver and kidney pathology with high accuracy. Our findings demonstrate the value of early gene-expression signatures in predicting and understanding compound-induced toxicity. The identified network can empower first-line tests that reduce animal use and costs of safety evaluation.
Light-dependent expression of flg22-induced defense genes in Arabidopsis.
Sano, Satoshi; Aoyama, Mayu; Nakai, Kana; Shimotani, Koji; Yamasaki, Kanako; Sato, Masa H; Tojo, Daisuke; Suwastika, I Nengah; Nomura, Hironari; Shiina, Takashi
2014-01-01
Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30%) genes strongly induced by flg22 (>4.0) require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid (SA), indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB). Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controlling the light-dependent expression of flg22-inducible defense genes.
Kimura, Takafumi; Takanami, Takako; Sakashita, Tetsuya; Wada, Seiichi; Kobayashi, Yasuhiko; Higashitani, Atsushi
2012-10-01
The effect of radiation on the intestine has been studied for more than one hundred years. It remains unclear, however, whether this organ uses specific defensive mechanisms against ionizing radiation. The infection with Pseudomonas aeruginosa (PA14) in Caenorhabditis elegans induces up-regulation of innate immune response genes. Here, we found that exposure to ionizing radiation also induces certain innate immune response genes such as F49F1.6 (termed mul-1), clec-4, clec-67, lys-1 and lys-2 in the intestine. Moreover, pre-treatment with ionizing radiation before seeding on PA14 lawn plate significantly increased survival rate in the nematode. We also studied transcription pathway of the mul-1 in response to ionizing radiation. Induction of mul-1 gene was highly dependent on the ELT-2 transcription factor and p38 MAPK. Moreover, the insulin/IGF-1 signal pathway works to enhance induction of this gene. The mul-1 gene showed a different induction pattern from the DNA damage response gene, ced-13, which implies that the expression of this gene might be triggered as an indirect effect of radiation. Silencing of the mul-1 gene led to growth retardation after treatment with ionizing radiation. We describe the cross-tolerance between the response to radiation exposure and the innate immune system.
Injury-induced immune responses in Hydra.
Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte
2014-08-01
The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights
Cauvi, David M; Cauvi, Gabrielle; Toomey, Christopher B; Jacquinet, Eric; Pollard, Kenneth Michael
2017-07-01
IFN-γ has been found to be robustly important to disease pathogenesis in both idiopathic and induced models of murine lupus. In transgenic mice, over production of IFN-γ in the skin results in an inflammatory response and autoimmunity. This suggests that localized exposure to environmental factors that induce autoimmunity may be associated with expression of an IFN-γ-dependent inflammatory response. Using murine mercury-induced autoimmunity (mHgIA), the severity of inflammation and proinflammatory cytokine expression, including the cellular source of IFN-γ, were assessed at the site of subcutaneous exposure and in secondary lymphoid organs. Exposure induced a localized chronic inflammation comprising both innate and adaptive immune cells but only CD8+ T and NK cells were reduced in the absence of IFN-γ. IFN-γ+ cells began to appear as early as day 1 and comprised both resident (γδ T) and infiltrating cells (CD8+ T, NKT, CD11c+). The requirements for inflammation were examined in mice deficient in genes required (Ifng, Il6) or not required (Casp1) for mHgIA. None of these genes were essential for induction of inflammation, however IFN-γ and IL-6 were required for exacerbation of other proinflammatory cytokines. Additionally, lack of IFN-γ or IL-6 impacted expression of genes regulated by either IFN-γ or type I IFN. Significantly, both IFN-γ and IL-6 were required for increased expression of IRF-1 which regulates IFN stimulated genes and is required for mHgIA. Thus IRF-1 may be at the nexus of the interplay between IFN-γ and IL-6 in exacerbating a xenobiotic-induced inflammatory response, regulation of interferon responsive genes and autoimmunity. © The Author 2017. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Hermans, Christian; Vuylsteke, Marnik; Coppens, Frederik; Craciun, Adrian; Inzé, Dirk; Verbruggen, Nathalie
2010-07-01
*Plant growth and development ultimately depend on environmental variables such as the availability of essential minerals. Unravelling how nutrients affect gene expression will help to understand how they regulate plant growth. *This study reports the early transcriptomic response to magnesium (Mg) deprivation in Arabidopsis. Whole-genome transcriptome was studied in the roots and young mature leaves 4, 8 and 28 h after the removal of Mg from the nutrient solution. *The highest number of regulated genes was first observed in the roots. Contrary to other mineral deficiencies, Mg depletion did not induce a higher expression of annotated genes in Mg uptake. Remarkable responses include the perturbation of the central oscillator of the circadian clock in roots and the triggering of abscisic acid (ABA) signalling, with half of the up-regulated Mg genes in leaves being ABA-responsive. However, no change in ABA content was observed. *The specificity of the response of some Mg-regulated genes was challenged by studying their expression after other mineral deficiencies and environmental stresses. The possibility to develop markers for Mg incipient deficiency is discussed here.
Caarls, Lotte; Van der Does, Dieuwertje; Hickman, Richard; Jansen, Wouter; Verk, Marcel C Van; Proietti, Silvia; Lorenzo, Oscar; Solano, Roberto; Pieterse, Corné M J; Van Wees, Saskia C M
2017-02-01
Salicylic acid (SA) and jasmonic acid (JA) cross-communicate in the plant immune signaling network to finely regulate induced defenses. In Arabidopsis, SA antagonizes many JA-responsive genes, partly by targeting the ETHYLENE RESPONSE FACTOR (ERF)-type transcriptional activator ORA59. Members of the ERF transcription factor family typically bind to GCC-box motifs in the promoters of JA- and ethylene-responsive genes, thereby positively or negatively regulating their expression. The GCC-box motif is sufficient for SA-mediated suppression of JA-responsive gene expression. Here, we investigated whether SA-induced ERF-type transcriptional repressors, which may compete with JA-induced ERF-type activators for binding at the GCC-box, play a role in SA/JA antagonism. We selected ERFs that are transcriptionally induced by SA and/or possess an EAR transcriptional repressor motif. Several of the 16 ERFs tested suppressed JA-dependent gene expression, as revealed by enhanced JA-induced PDF1.2 or VSP2 expression levels in the corresponding erf mutants, while others were involved in activation of these genes. However, SA could antagonize JA-induced PDF1.2 or VSP2 in all erf mutants, suggesting that the tested ERF transcriptional repressors are not required for SA/JA cross-talk. Moreover, a mutant in the co-repressor TOPLESS, that showed reduction in repression of JA signaling, still displayed SA-mediated antagonism of PDF1.2 and VSP2. Collectively, these results suggest that SA-regulated ERF transcriptional repressors are not essential for antagonism of JA-responsive gene expression by SA. We further show that de novo SA-induced protein synthesis is required for suppression of JA-induced PDF1.2, pointing to SA-stimulated production of an as yet unknown protein that suppresses JA-induced transcription. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Kojima, Misaki; Masui, Toshimitsu; Nemoto, Kiyomitsu; Degawa, Masakuni
2004-12-01
Changes in the gene expressions of hepatic enzymes responsible for cholesterol homeostasis were examined during the process of lead nitrate (LN)-induced development of hypercholesterolemia in male rats. Total cholesterol levels in the liver and serum were significantly increased at 3-72 h and 12-72 h, respectively, after LN-treatment (100 micromol/kg, i.v.). Despite the development of hypercholesterolemia, the genes for hepatic 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and other enzymes (FPPS, farnesyl diphosphate synthase; SQS, squalene synthase; CYP51, lanosterol 14alpha-demethylase) responsible for cholesterol biosynthesis were activated at 3-24 h and 12-18 h, respectively. On the other hand, the gene expression of cholesterol 7alpha-hydroxylase (CYP7A1), a catabolic enzyme of cholesterol, was remarkably suppressed at 3-72 h. The gene expression levels of cytokines interleukin-1beta (IL-1beta) and TNF-alpha, which activate the HMGR gene and suppress the CYP7A1 gene, were significantly increased at 1-3 h and 3-24 h, respectively. Furthermore, gene activation of SREBP-2, a gene activator of several cholesterogenic enzymes, occurred before the gene activations of FPPS, SQS and CYP51. This is the first report demonstrating sterol-independent gene regulation of hepatic enzymes responsible for cholesterol homeostasis in LN-treated male rats. The mechanisms for the altered-gene expressions of hepatic enzymes in LN-treated rats are discussed.
Alcohol-Induced Histone Acetylation Reveals a Gene Network Involved in Alcohol Tolerance
Ghezzi, Alfredo; Krishnan, Harish R.; Lew, Linda; Prado, Francisco J.; Ong, Darryl S.; Atkinson, Nigel S.
2013-01-01
Sustained or repeated exposure to sedating drugs, such as alcohol, triggers homeostatic adaptations in the brain that lead to the development of drug tolerance and dependence. These adaptations involve long-term changes in the transcription of drug-responsive genes as well as an epigenetic restructuring of chromosomal regions that is thought to signal and maintain the altered transcriptional state. Alcohol-induced epigenetic changes have been shown to be important in the long-term adaptation that leads to alcohol tolerance and dependence endophenotypes. A major constraint impeding progress is that alcohol produces a surfeit of changes in gene expression, most of which may not make any meaningful contribution to the ethanol response under study. Here we used a novel genomic epigenetic approach to find genes relevant for functional alcohol tolerance by exploiting the commonalities of two chemically distinct alcohols. In Drosophila melanogaster, ethanol and benzyl alcohol induce mutual cross-tolerance, indicating that they share a common mechanism for producing tolerance. We surveyed the genome-wide changes in histone acetylation that occur in response to these drugs. Each drug induces modifications in a large number of genes. The genes that respond similarly to either treatment, however, represent a subgroup enriched for genes important for the common tolerance response. Genes were functionally tested for behavioral tolerance to the sedative effects of ethanol and benzyl alcohol using mutant and inducible RNAi stocks. We identified a network of genes that are essential for the development of tolerance to sedation by alcohol. PMID:24348266
Global gene expression analysis of the heat shock response in the phytopathogen Xylella fastidiosa.
Koide, Tie; Vêncio, Ricardo Z N; Gomes, Suely L
2006-08-01
Xylella fastidiosa is a phytopathogenic bacterium that is responsible for diseases in many economically important crops. Although different strains have been studied, little is known about X. fastidiosa stress responses. One of the better characterized stress responses in bacteria is the heat shock response, which induces the expression of specific genes to prevent protein misfolding and aggregation and to promote degradation of the irreversibly denatured polypeptides. To investigate X. fastidiosa genes involved in the heat shock response, we performed a whole-genome microarray analysis in a time course experiment. Globally, 261 genes were induced (9.7%) and 222 genes were repressed (8.3%). The expression profiles of the differentially expressed genes were grouped, and their expression patterns were validated by quantitative reverse transcription-PCR experiments. We determined the transcription start sites of six heat shock-inducible genes and analyzed their promoter regions, which allowed us to propose a putative consensus for sigma(32) promoters in Xylella and to suggest additional genes as putative members of this regulon. Besides the induction of classical heat shock protein genes, we observed the up-regulation of virulence-associated genes such as vapD and of genes for hemagglutinins, hemolysin, and xylan-degrading enzymes, which may indicate the importance of heat stress to bacterial pathogenesis. In addition, we observed the repression of genes related to fimbriae, aerobic respiration, and protein biosynthesis and the induction of genes related to the extracytoplasmic stress response and some phage-related genes, revealing the complex network of genes that work together in response to heat shock.
Regulatory systems for hypoxia-inducible gene expression in ischemic heart disease gene therapy.
Kim, Hyun Ah; Rhim, Taiyoun; Lee, Minhyung
2011-07-18
Ischemic heart diseases are caused by narrowed coronary arteries that decrease the blood supply to the myocardium. In the ischemic myocardium, hypoxia-responsive genes are up-regulated by hypoxia-inducible factor-1 (HIF-1). Gene therapy for ischemic heart diseases uses genes encoding angiogenic growth factors and anti-apoptotic proteins as therapeutic genes. These genes increase blood supply into the myocardium by angiogenesis and protect cardiomyocytes from cell death. However, non-specific expression of these genes in normal tissues may be harmful, since growth factors and anti-apoptotic proteins may induce tumor growth. Therefore, tight gene regulation is required to limit gene expression to ischemic tissues, to avoid unwanted side effects. For this purpose, various gene expression strategies have been developed for ischemic-specific gene expression. Transcriptional, post-transcriptional, and post-translational regulatory strategies have been developed and evaluated in ischemic heart disease animal models. The regulatory systems can limit therapeutic gene expression to ischemic tissues and increase the efficiency of gene therapy. In this review, recent progresses in ischemic-specific gene expression systems are presented, and their applications to ischemic heart diseases are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.
Oliviero, S; Cortese, R
1989-01-01
Transcription of the human haptoglobin (Hp) gene is induced by interleukin-6 (IL-6) in the human hepatoma cell line Hep3B. Cis-acting elements responsible for this response are localized within the first 186 bp of the 5'-flanking region. Site-specific mutants of the Hp promoter fused to the chloramphenicol acetyl transferase (CAT) gene were analysed by transient transfection into uninduced and IL-6-treated Hep3B cells. We identified three regions, A, B and C, defined by mutation, which are important for the IL-6 response. Band shift experiments using nuclear extracts from untreated or IL-6-treated cells revealed the presence of IL-6-inducible DNA binding activities when DNA fragments containing the A or the C sequences were used. Competition experiments showed that both sequences bind to the same nuclear factors. Polymers of oligonucleotides containing either the A or the C regions confer IL-6 responsiveness to a truncated SV40 promoter. The B region forms several complexes with specific DNA-binding proteins different from those which bind to the A and C region. The B region complexes are identical in nuclear extracts from IL-6-treated and untreated cells. While important for IL-6 induction in the context of the haptoglobin promoter, the B site does not confer IL-6 inducibility to the SV40 promoter. Our results indicate that the IL-6 response of the haptoglobin promoter is dependent on the presence of multiple, partly redundant, cis-acting elements. Images PMID:2787245
Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance
Ensminger, Stephan M.; Spriewald, Bernd M.
2012-01-01
Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401
Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.
Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao
2009-11-01
Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.
Brockmann-Gretza, Olaf; Kalinowski, Jörn
2006-01-01
Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (p)ppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (p)ppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX) in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be responsible for the complex
Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2011-12-01
In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.
Blood gene expression profiling of an early acetaminophen response.
Bushel, P R; Fannin, R D; Gerrish, K; Watkins, P B; Paules, R S
2017-06-01
Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4 g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing, and 12 genes were detected with expression profiles significantly altered within 24 h. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure, and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration.
Blood Gene Expression Profiling of an Early Acetaminophen Response
Bushel, Pierre R.; Fannin, Rick D.; Gerrish, Kevin; Watkins, Paul B.; Paules, Richard S.
2018-01-01
Acetaminophen can adversely affect the liver especially when overdosed. We used whole blood as a surrogate to identify genes as potential early indicators of an acetaminophen-induced response. In a clinical study, healthy human subjects were dosed daily with 4g of either acetaminophen or placebo pills for 7 days and evaluated over the course of 14 days. Alanine aminotransferase (ALT) levels for responders to acetaminophen increased between days 4 and 9 after dosing and 12 genes were detected with expression profiles significantly altered within 24 hrs. The early responsive genes separated the subjects by class and dose period. In addition, the genes clustered patients who overdosed on acetaminophen apart from controls and also predicted the exposure classifications with 100% accuracy. The responsive genes serve as early indicators of an acetaminophen exposure and their gene expression profiles can potentially be evaluated as molecular indicators for further consideration. PMID:26927286
Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.
Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L
2009-09-01
Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.
Žegura, B; Gajski, G; Štraser, A; Garaj-Vrhovac, V
2011-11-01
Cylindrospermopsin (CYN), a potent cyanobacterial cytototoxin produced by certain freshwater cyanobacteria, is regularly found in water supplies in many parts of the world, and has been associated with the intoxication of humans and livestock. The few genotoxicity studies available indicate that CYN is genotoxic, generally implying that it is pro-genotoxic. In human peripheral blood lymphocytes (HPBLs) CYN (0, 0.05, 0.1 and 0.5 μg/ml) induced the formation of DNA single strand breaks, applying the comet assay. Time and dose dependent significant increase in the frequency of micronuclei and nuclear buds was observed after the exposure of HPBLs to CYN, while there was only slight increase in the number of nucleoplasmic bridges. For the first time the modulation of gene expression in HPBLs was studied after the exposure to CYN (0.5 μg/ml), using the quantitative real-time PCR. The genes presumably involved in CYN metabolism (CYP1A1 and CYP1A2) were up-regulated after the exposure. CYN induced changes in the mRNA expression of P53 and its downstream regulated DNA damage responsive genes MDM2, GADD45α and apoptosis genes, BCL-2 and BAX, as well as oxidative stress responsive genes (GPX1, SOD1, GSR, GCLC), while no changes in the expression of genes CDKN1A and CAT were observed. These results provide strong evidence that CYN should be considered as genotoxic and that lymphocytes can also be a target of cylindrospermopsin induced genotoxicity. Copyright © 2011 Elsevier Ltd. All rights reserved.
Stat1-independent regulation of gene expression in response to IFN-γ
Ramana, Chilakamarti V.; Gil, M. Pilar; Han, Yulong; Ransohoff, Richard M.; Schreiber, Robert D.; Stark, George R.
2001-01-01
Although Stat1 is essential for cells to respond fully to IFN-γ, there is substantial evidence that, in the absence of Stat1, IFN-γ can still regulate the expression of some genes, induce an antiviral state and affect cell growth. We have now identified many genes that are regulated by IFN-γ in serum-starved Stat1-null mouse fibroblasts. The proteins induced by IFN-γ in Stat1-null cells can account for the substantial biological responses that remain. Some genes are induced in both wild-type and Stat1-null cells and thus are truly Stat1-independent. Others are subject to more complex regulation in response to IFN-γ, repressed by Stat1 in wild-type cells and activated in Stat1-null cells. Many genes induced by IFN-γ in Stat1-null fibroblasts also are induced by platelet-derived growth factor in wild-type cells and thus are likely to be involved in cell proliferation. In mouse cells expressing the docking site mutant Y440F of human IFN-γ receptor subunit 1, the mouse Stat1 is not phosphorylated in response to human IFN-γ, but c-myc and c-jun are still induced, showing that the Stat1 docking site is not required for Stat1-independent signaling. PMID:11390994
Hao, Zhipeng; Fayolle, Léon; van Tuinen, Diederik; Chatagnier, Odile; Li, Xiaolin; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne
2012-06-01
The ectoparasitic dagger nematode (Xiphinema index), vector of Grapevine fanleaf virus (GFLV), provokes gall formation and can cause severe damage to the root system of grapevines. Mycorrhiza formation by Glomus (syn. Rhizophagus) intraradices BEG141 reduced both gall formation on roots of the grapevine rootstock SO4 (Vitis berlandieri×V. riparia) and nematode number in the surrounding soil. Suppressive effects increased with time and were greater when the nematode was post-inoculated rather than co-inoculated with the arbuscular mycorrhizal (AM) fungus. Using a split-root system, decreased X. index development was shown in mycorrhizal and non-mycorrhizal parts of mycorrhizal root systems, indicating that both local and systemic induced bioprotection mechanisms were active against the ectoparasitic nematode. Expression analyses of ESTs (expressed sequence tags) generated in an SSH (subtractive suppressive hybridization) library, representing plant genes up-regulated during mycorrhiza-induced control of X. index, and of described grapevine defence genes showed activation of chitinase 1b, pathogenesis-related 10, glutathione S-transferase, stilbene synthase 1, 5-enolpyruvyl shikimate-3-phosphate synthase, and a heat shock proein 70-interacting protein in association with the observed local and/or systemic induced bioprotection against the nematode. Overall, the data suggest priming of grapevine defence responses by the AM fungus and transmission of a plant-mediated signal to non-mycorrhizal tissues. Grapevine gene responses during AM-induced local and systemic bioprotection against X. index point to biological processes that are related either to direct effects on the nematode or to protection against nematode-imposed stress to maintain root tissue integrity.
Hao, Zhipeng; Fayolle, Léon; van Tuinen, Diederik; Chatagnier, Odile; Gianinazzi, Silvio; Gianinazzi-Pearson, Vivienne
2012-01-01
The ectoparasitic dagger nematode (Xiphinema index), vector of Grapevine fanleaf virus (GFLV), provokes gall formation and can cause severe damage to the root system of grapevines. Mycorrhiza formation by Glomus (syn. Rhizophagus) intraradices BEG141 reduced both gall formation on roots of the grapevine rootstock SO4 (Vitis berlandieri×V. riparia) and nematode number in the surrounding soil. Suppressive effects increased with time and were greater when the nematode was post-inoculated rather than co-inoculated with the arbuscular mycorrhizal (AM) fungus. Using a split-root system, decreased X. index development was shown in mycorrhizal and non-mycorrhizal parts of mycorrhizal root systems, indicating that both local and systemic induced bioprotection mechanisms were active against the ectoparasitic nematode. Expression analyses of ESTs (expressed sequence tags) generated in an SSH (subtractive suppressive hybridization) library, representing plant genes up-regulated during mycorrhiza-induced control of X. index, and of described grapevine defence genes showed activation of chitinase 1b, pathogenesis-related 10, glutathione S-transferase, stilbene synthase 1, 5-enolpyruvyl shikimate-3-phosphate synthase, and a heat shock proein 70-interacting protein in association with the observed local and/or systemic induced bioprotection against the nematode. Overall, the data suggest priming of grapevine defence responses by the AM fungus and transmission of a plant-mediated signal to non-mycorrhizal tissues. Grapevine gene responses during AM-induced local and systemic bioprotection against X. index point to biological processes that are related either to direct effects on the nematode or to protection against nematode-imposed stress to maintain root tissue integrity. PMID:22407649
Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan
2015-01-01
The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only 'non-immune' genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria.
Evidence of an evolutionary hourglass pattern in herbivory-induced transcriptomic responses.
Durrant, Matthew; Boyer, Justin; Zhou, Wenwu; Baldwin, Ian T; Xu, Shuqing
2017-08-01
Herbivory-induced defenses are specific and activated in plants when elicitors, frequently found in the herbivores' oral secretions, are introduced into wounds during attack. While complex signaling cascades are known to be involved, it remains largely unclear how natural selection has shaped the evolution of these induced defenses. We analyzed herbivory-induced transcriptomic responses in wild tobacco, Nicotiana attenuata, using a phylotranscriptomic approach that measures the origin and sequence divergence of herbivory-induced genes. Highly conserved and evolutionarily ancient genes of primary metabolism were activated at intermediate time points (2-6 h) after elicitation, while less constrained and young genes associated with defense signaling and biosynthesis of specialized metabolites were activated at early (before 2 h) and late (after 6 h) stages of the induced response, respectively - a pattern resembling the evolutionary hourglass pattern observed during embryogenesis in animals and the developmental process in plants and fungi. The hourglass patterns found in herbivory-induced defense responses and developmental process are both likely to be a result of signaling modularization and differential evolutionary constraints on the modules involved in the signaling cascade. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Feng, Bo; Guo, Zhuoran; Zhang, Weijia; Pan, Yingjie; Zhao, Yong
2016-04-26
Vibrio parahaemolyticus is a main causative agent of serious human seafood-borne gastroenteritis disease. Many researchers have investigated its pathogenesis by observing the alteration of its virulence factors in different conditions. It was previously known that culture conditions will influence the gene expression and the metabolic profile of V. parahaemolyticus, but little attention has been paid on the relationship between them. In this study, for the first time, the metabolomics response in relation to the expression of two major virulence genes, tdh and trh, induced at three temperatures (4, 25 and 37 °C) was examined in two genotypes of pathogenic Vibrio parahaemolyticus (ATCC33846 (tdh+/trh-/tlh+) and ATCC17802 (tdh-/trh+/tlh+)). Reverse transcription real-time PCR (RT-qPCR) analysis illustrated that the expression levels of tdh and trh induced at 25 °C in V. parahaemolyticus were significantly higher than those induced at 4 and 37 °C. Principal components analysis (PCA) based on the UPLC & Q-TOF MS data presented clearly distinct groups among the samples treated by different temperatures. Metabolic profiling demonstrated that 179 of 1,033 kinds of identified metabolites in ATCC33846 changed significantly (p <0.01) upon culturing at different temperatures, meanwhile 101 of 930 kinds of metabolites changed (p <0.01) in ATCC17802. Pearson's correlation analysis highlighted the correlation between metabolites and virulence gene expression levels. At the threshold of | r | = 1, p <0.01, 12 kinds of metabolites showed extremely significant correlations with tdh expression, and 4 kinds of metabolites significantly correlated with trh expression. It is interesting that 3D, 7D, 11D-Phytanic acid showed the same trend with pyrophosphate, whose derivative could activate the degradation of phytanic acid. Several metabolites could be sorted into the same class by the method of chemical taxonomy, by assuming that they are involved in the same metabolic pathways
Thiel, Gerald; Rössler, Oliver G
2017-03-01
Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems. Copyright © 2016 Elsevier Ltd. All rights reserved.
Doi, Takashi; Shintaku, Mika; Dingemann, Jens; Ruttenstock, Elke; Puri, Prem
2011-02-01
Nitrofen-induced congenital diaphragmatic hernia (CDH) model has been widely used to investigate the pathogenesis of pulmonary hypoplasia (PH) in CDH. Recent studies have suggested that retinoids may be involved in the molecular mechanisms of PH in CDH. Prenatal treatment with retinoic acid (RA) has been reported to improve the growth of hypoplastic lung in the nitrofen CDH model. Midkine (MK), a RA-responsive growth factor, plays key roles in various organogenesis including lung development. In fetal lung, MK mRNA expression has its peak at E13.5-E16.5 and is markedly decreased during mid-to-late gestation, indicating its important role in early lung morphogenesis. We designed this study to investigate the hypothesis that the pulmonary MK gene expression is downregulated in the early lung morphogenesis in the nitrofen-induced PH, and to evaluate the effect of prenatal RA treatment on pulmonary MK gene expression in the nitrofen-induced CDH model. Pregnant rats were exposed to either olive oil or nitrofen on day 9 of gestation (D9). Fetal lungs were harvested on D15, D18, and D21 and divided into control, nitrofen with or without CDH [CDH(+) or CDH(-)]. In addition, RA was given on days D18, D19, and D20 and fetal lungs were harvested on D21, and then divided into control + RA and nitrofen + RA. The pulmonary gene expression levels of MK were evaluated by real-time RT-PCR and statistically analyzed. Immunohistochemistry was also performed to examine protein expression/distribution of MK in fetal lung. The relative mRNA expression levels of MK were significantly downregulated in nitrofen group compared to controls at D15 ((§)p < 0.01), whereas there were no significant differences at D18 and D21. MK gene expression levels were significantly upregulated in nitrofen + RA (0.71 ± 0.17) compared to the control (0.35 ± 0.16), CDH(-) (0.24 ± 0.15), CDH(+) (0.39 ± 0.19) and control + RA (0.47 ± 0.13) (*p < 0.05). Immunoreactivity of MK was also markedly decreased in
Cellular responses to oxidative stress: the [Ah] gene battery as a paradigm.
Nebert, D W; Petersen, D D; Fornace, A J
1990-01-01
A major source of oxidative stress in animals is plant stress metabolites, also termed phytoalexins. The aromatic hydrocarbon-responsive [Ah] gene battery is considered here as a model system in which we can study metabolically coordinated enzymes that respond to phytoalexin-induced oxidative stress. In the mouse, the [Ah] battery comprises at least six genes: two Phase I genes, CYP1A1 and CYP1A2; and four Phase II genes, Nmo-1, Aldh-1, Ugt-1, and Gt-1. All six genes appear to be regulated positively by inducers such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and other ligands of the Ah receptor. In the absence of foreign inducer, the control of Nmo-1 gene expression is independent of the control of CYP1A1 and CYP1A2 gene expression. The radiation deletion homozygote c14CoS/c14CoS mouse is lacking about 1.1 centiMorgans of chromosome 7. Although having no detectable CYP1A1 or CYP1A2 activation, the untreated c14CoS/c14CoS mouse exhibits markedly elevated transcripts of the Nmo-1 gene and three growth arrest- and DNA damage-inducible (gadd) genes. These data suggest that the missing region on chromosome 7 in the c14CoS/c14CoS mouse contains a gene(s), which we propose to call Nmo-1n, encoding a trans-acting factor(s) that is a negative effector of the Nmo-1 and gadd genes. The three other [Ah] battery Phase II genes behave similarly to Nmo-1 in the c14CoS/c14CoS mouse. This coordinated response to oxidative stress and DNA damage, by way of the release of a mammalian battery of genes from negative control, bears an interesting resemblance to the SOS response in bacteria. PMID:2272308
Transient, Inducible, Placenta-Specific Gene Expression in Mice
Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.
2012-01-01
Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919
Szmolka, Ama; Wiener, Zoltán; Matulova, Marta Elsheimer; Varmuzova, Karolina; Rychlik, Ivan
2015-01-01
The response of chicken to non-typhoidal Salmonella infection is becoming well characterised but the role of particular cell types in this response is still far from being understood. Therefore, in this study we characterised the response of chicken embryo fibroblasts (CEFs) to infection with two different S. Enteritidis strains by microarray analysis. The expression of chicken genes identified as significantly up- or down-regulated (≥3-fold) by microarray analysis was verified by real-time PCR followed by functional classification of the genes and prediction of interactions between the proteins using Gene Ontology and STRING Database. Finally the expression of the newly identified genes was tested in HD11 macrophages and in vivo in chickens. Altogether 19 genes were induced in CEFs after S. Enteritidis infection. Twelve of them were also induced in HD11 macrophages and thirteen in the caecum of orally infected chickens. The majority of these genes were assigned different functions in the immune response, however five of them (LOC101750351, K123, BU460569, MOBKL2C and G0S2) have not been associated with the response of chicken to Salmonella infection so far. K123 and G0S2 were the only ’non-immune’ genes inducible by S. Enteritidis in fibroblasts, HD11 macrophages and in the caecum after oral infection. The function of K123 is unknown but G0S2 is involved in lipid metabolism and in β-oxidation of fatty acids in mitochondria. PMID:26046914
Suppressors of systemin signaling identify genes in the tomato wound response pathway.
Howe, G A; Ryan, C A
1999-01-01
In tomato plants, systemic induction of defense genes in response to herbivory or mechanical wounding is regulated by an 18-amino-acid peptide signal called systemin. Transgenic plants that overexpress prosystemin, the systemin precursor, from a 35S::prosystemin (35S::prosys) transgene exhibit constitutive expression of wound-inducible defense proteins including proteinase inhibitors and polyphenol oxidase. To study further the role of (pro)systemin in the wound response pathway, we isolated and characterized mutations that suppress 35S::prosys-mediated phenotypes. Ten recessive, extragenic suppressors were identified. Two of these define new alleles of def-1, a previously identified mutation that blocks both wound- and systemin-induced gene expression and renders plants susceptible to herbivory. The remaining mutants defined four loci designated Spr-1, Spr-2, Spr-3, and Spr-4 (for Suppressed in 35S::prosystemin-mediated responses). spr-3 and spr-4 mutants were not significantly affected in their response to either systemin or mechanical wounding. In contrast, spr-1 and spr-2 plants lacked systemic wound responses and were insensitive to systemin. These results confirm the function of (pro)systemin in the transduction of systemic wound signals and further establish that wounding, systemin, and 35S::prosys induce defensive gene expression through a common signaling pathway defined by at least three genes (Def-1, Spr-1, and Spr-2). PMID:10545469
Avian influenza rapidly induces antiviral genes in duck lung and intestine
Vanderven, Hillary A.; Petkau, Kristina; Ryan-Jean, Kieran E. E.; Aldridge, Jerry R.; Webster, Robert G.; Magor, Katharine E.
2012-01-01
Ducks are the natural reservoir of influenza A and survive infection by most strains. To characterize the duck immune response to influenza, we sought to identify innate immune genes expressed early in an infection. We used suppressive subtractive hybridization (SSH) to construct 3 libraries enriched in differentially expressed genes from lung RNA of a duck infected with highly pathogenic avian influenza virus A/Vietnam/1203/04 (H5N1), or lung and intestine RNA of a duck infected with low pathogenic avian influenza A/mallard/BC/500/05 (H5N2) compared to a mock-infected duck. Sequencing of 1687 clones identified a transcription profile enriched in genes involved in antiviral defense and other cellular processes. Major histocompatibility complex class I (MHC I), interferon induced protein with tricopeptide repeats 5 (IFIT5), and 2′–5′oligoadenylate synthetase-like gene (OASL) were increased more than 1000-fold in relative transcript abundance in duck lung at 1 dpi with highly pathogenic VN1203. These genes were induced much less in lung or intestine following infection with low pathogenic BC500. The expression of these genes following infection suggests that ducks initiate an immediate and robust response to a potentially lethal influenza strain, and a minimal response a low pathogenic strain. PMID:22534314
Diurnal oscillations of soybean circadian clock and drought responsive genes.
Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Bendix, Claire; Nakayama, Thiago Jonas; Celaya, Brandon; Molinari, Hugo Bruno Correa; de Oliveira, Maria Cristina Neves; Harmon, Frank G; Nepomuceno, Alexandre
2014-01-01
Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i) drought stress affects gene expression of circadian clock components and (ii) several stress responsive genes display diurnal oscillation in soybeans.
Transposon integration enhances expression of stress response genes.
Feng, Gang; Leem, Young-Eun; Levin, Henry L
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.
Transposon integration enhances expression of stress response genes
Feng, Gang; Leem, Young-Eun; Levin, Henry L.
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295
Kudrick, Necla; Chan, Owen; La Gamma, Edmund F; Kim, Juhye Lena; Tank, Arnold William; Sterling, Carol; Nankova, Bistra B
2015-01-01
Acute metabolic stress such as insulin-induced hypoglycemia triggers a counterregulatory response during which the release of catecholamines (epinephrine), the activation of tyrosine hydroxylase (TH) enzyme and subsequent compensatory catecholamine biosynthesis occur in the adrenal medulla. However, recurrent exposure to hypoglycemia (RH), a consequence of tight glycemic control in individuals with type 1 and type 2 diabetes compromises this physiological response. The molecular mechanisms underlying the maladaptive response to repeated glucose deprivation are incompletely understood. We hypothesize that impaired epinephrine release following RH reflects altered regulation of adrenal catecholamine biosynthesis. To test this hypothesis, we compared the effect of single daily (RH) and twice-daily episodes of insulin-induced hypoglycemia (2RH) on adrenal epinephrine release and production in normal rats. Control animals received saline injections under similar conditions (RS and 2RS, respectively). Following 3 days of treatment, we assessed the counterregulatory hormonal responses during a hypoglycemic clamp. Changes in adrenal TH gene expression were also analyzed. The counterregulatory responses, relative TH transcription and TH mRNA levels and Ser40-TH phosphorylation (marker for enzyme activation) were induced to a similar extent in RS, 2RS, and RH groups. In contrast, epinephrine and glucagon responses were attenuated in the 2RH group and this was associated with a limited elevation of adrenal TH mRNA, rapid inactivation of TH enzyme and no significant changes in TH protein. Our results suggest that novel posttranscriptional mechanisms controlling TH mRNA and activated TH enzyme turnover contribute to the impaired epinephrine responses and may provide new therapeutic targets to prevent HAAF. PMID:25713330
Hartman, Zachary C; Appledorn, Daniel M; Amalfitano, Andrea
2008-03-01
Extensively characterized, modified, and employed for a variety of purposes, adenovirus (Ad) vectors are generally regarded as having great potential by many applied virologists who wish to manipulate and use viral biology to achieve beneficial clinical outcomes. Despite widespread functional prominence and utility (i.e., Ad-based clinical trials have begun to progress to critical Phase III levels, it has recently become apparent that investigations regarding the innate immune response to Ads may reveal not only reasons behind previous failures, but also reveal novel insights that will allow for safer, more efficacious uses of this important gene transfer platform. Insights gained by the exploration of Ad induced innate immune responses will likely be most important to the fields of vaccine development, since Ad-based vaccines are regarded as one of the more promising vaccine platforms in development today. Adenovirus is currently known to interact with several different extracellular, intracellular, and membrane-bound innate immune sensing systems. Past and recent studies involving manipulation of the Ad infectious cycle as well as use of different mutants have shed light on some of the initiation mechanisms underlying Ad induced immune responses. More recent studies using microarray-based analyses, genetically modified cell lines and/or mouse mutants, and advanced generation Ad vectors have revealed important new insights into the scope and mechanism of this cellular defensive response. This review is an attempt to synthesize these studies, update Ad biologists to the current knowledge surrounding these increasingly important issues, as well as highlight areas where future research should be directed. It should also serve as a sobering reality to researchers exploring the use of any gene transfer vector, as to the complexities potentially involved when contemplating use of such vectors for human applications.
Hartman, Zachary C.; Appledorn, Daniel M.; Amalfitano, Andrea
2013-01-01
Extensively characterized, modified, and employed for a variety of purposes, Adenovirus (Ad) vectors are generally regarded as having great potential by many applied virologists who wish to manipulate and use viral biology to achieve beneficial clinical outcomes. Despite widespread functional prominence and utility, (i.e.: Ad based clinical trials have begun to progress to critical Phase III levels, it has recently become apparent that investigations regarding the innate immune response to Ads may reveal not only reasons behind previous failures, but also reveal novel insights that will allow for safer, more efficacious uses of this important gene transfer platform. Insights gained by the exploration of Ad induced innate immune responses will likely be most important to the fields of vaccine development, since Ad based vaccines are highly acknowledged as one of the more promising vaccine platforms in development today. Adenovirus is currently known to interact with several different extracellular, intracellular, and membrane bound innate immune sensing systems. Past and recent studies involving manipulation of the Ad infectious cycle as well as use of different mutants have shed light on some of the initiation mechanisms underlying Ad induced immune responses. More recent studies using microarray based analyses, genetically modified cell lines and/or mouse mutants, and advanced generation Ad vectors have revealed important new insights into the scope and mechanism of this cellular defensive response. This review is an attempt to synthesize these studies, update Ad biologists to the current knowledge surrounding these increasingly important issues, as well point areas where future research should be directed. It should also serve as a sobering reality to researchers exploring the use of any gene transfer vector, as to the complexities potentially involved when contemplating use of such vectors for human applications. PMID:18036698
Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid
2018-02-01
In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.
Xu, Feng; Cao, Jiaofei; Luo, Man; Che, Luanqing; Li, Wen; Ying, Songmin; Chen, Zhihua; Shen, Huahao
2018-05-19
Particulate matter (PM) has been implicated as a risk factor for human airway disorders. However, the biological mechanisms underlying the correlation between PM exposure and adverse airway effects have not yet been fully clarified. The objective of this study was to explore the possible role of early growth response gene 1 (Egr-1) in PM-induced toxic effects in pulmonary inflammation and mucus hyperproduction in vitro and in vivo. Particulate matter exposure induced a rapid Egr-1 expression in human bronchial epithelial (HBE) cells and in mouse lungs. Genetic blockage of Egr-1 markedly reduced PM-induced inflammatory cytokines, e.g., IL6 and IL8, and MUC5AC in HBE cells, and these effects were mechanistically mediated by the nuclear factor-κB (NF-κB) and activator protein-1 (AP-1) pathways, respectively. Egr-1-knockout mice displayed significantly reduced airway inflammation and mucus hyperproduction in response to PM exposure in vivo. Moreover, polycyclic aromatic hydrocarbons (PAHs) contained in the PM also induced Egr-1 expression, and also played a role in the inflammatory responses and mucus production. Taken together, our data reveal novel Egr-1 signaling that mediates the NF-κB and AP-1 pathways to orchestrate PM-induced pulmonary inflammation and mucus hyperproduction, suggesting that Egr-1 inhibition could be an effective therapeutic approach for airway disorders or disease exacerbations induced by airborne particulate pollution. Copyright © 2018. Published by Elsevier B.V.
Cloning of soybean genes induced during hypersensitive cell death caused by syringolide elicitor.
Hagihara, Takuya; Hashi, Masaru; Takeuchi, Yoji; Yamaoka, Naoto
2004-02-01
Syringolide elicitors produced by bacteria expressing Pseudomonas syringae pv. glycinea avirulence gene D (avrD) induce hypersensitive cell death (HCD) only in soybean (Glycine max [L.] Merr.) plants carrying the Rpg4 disease resistance gene. Employing a differential display method, we isolated 13 gene fragments induced in cultured cells of a soybean cultivar Harosoy (Rpg4) treated with syringolides. Several genes for isolated fragments were induced by syringolides in an rpg4 cultivar Acme as well as in Harosoy; however, the genes for seven fragments designated as SIH (for syringolide-induced/ HCD associated) were induced exclusively or strongly in Harosoy. cDNA clones for SIH genes were obtained from a cDNA library of Harosoy treated with syringolide. Several sequences are homologous to proteins associated with plant defense responses. The SIH genes did not respond to a non-specific beta-glucan elicitor, which induces phytoalexin accumulation but not HCD, suggesting that the induction of the SIH genes is specific for the syringolide-Harosoy interaction. HCD and the induction of SIH genes by syringolides were independent of H(2)O(2). On the other hand, Ca(2+) was required for HCD and the induction of some SIH genes. These results suggest that the induction of SIH genes by syringolides could be activated through the syringolide-specific signaling pathway and the SIH gene products may play an important role(s) in the processes of HCD induced by syringolides.
Diurnal Oscillations of Soybean Circadian Clock and Drought Responsive Genes
Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Bendix, Claire; Nakayama, Thiago Jonas; Celaya, Brandon; Molinari, Hugo Bruno Correa; de Oliveira, Maria Cristina Neves; Harmon, Frank G.; Nepomuceno, Alexandre
2014-01-01
Rhythms produced by the endogenous circadian clock play a critical role in allowing plants to respond and adapt to the environment. While there is a well-established regulatory link between the circadian clock and responses to abiotic stress in model plants, little is known of the circadian system in crop species like soybean. This study examines how drought impacts diurnal oscillation of both drought responsive and circadian clock genes in soybean. Drought stress induced marked changes in gene expression of several circadian clock-like components, such as LCL1-, GmELF4- and PRR-like genes, which had reduced expression in stressed plants. The same conditions produced a phase advance of expression for the GmTOC1-like, GmLUX-like and GmPRR7-like genes. Similarly, the rhythmic expression pattern of the soybean drought-responsive genes DREB-, bZIP-, GOLS-, RAB18- and Remorin-like changed significantly after plant exposure to drought. In silico analysis of promoter regions of these genes revealed the presence of cis-elements associated both with stress and circadian clock regulation. Furthermore, some soybean genes with upstream ABRE elements were responsive to abscisic acid treatment. Our results indicate that some connection between the drought response and the circadian clock may exist in soybean since (i) drought stress affects gene expression of circadian clock components and (ii) several stress responsive genes display diurnal oscillation in soybeans. PMID:24475115
Oxytocin receptor gene variation predicts subjective responses to MDMA.
Bershad, Anya K; Weafer, Jessica J; Kirkpatrick, Matthew G; Wardle, Margaret C; Miller, Melissa A; de Wit, Harriet
2016-12-01
3,4-Methylenedioxymethamphetamine (MDMA, "ecstasy") enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug.
Oxytocin receptor gene variation predicts subjective responses to MDMA
Bershad, Anya K.; Weafer, Jessica J.; Kirkpatrick, Matthew G.; Wardle, Margaret C.; Miller, Melissa A.; de Wit, Harriet
2016-01-01
3,4-Methylenedioxymethamphetamine (MDMA, “ecstasy”) enhances desire to socialize and feelings of empathy, which are thought to be related to increased oxytocin levels. Thus, variation in the oxytocin receptor gene (OXTR) may influence responses to the drug. Here, we examined the influence of a single OXTR nucleotide polymorphism (SNP) on responses to MDMA in humans. Based on findings that carriers of the A allele at rs53576 exhibit reduced sensitivity to oxytocin-induced social behavior, we hypothesized that these individuals would show reduced subjective responses to MDMA, including sociability. In this three-session, double blind, within-subjects study, healthy volunteers with past MDMA experience (N = 68) received a MDMA (0, 0.75 mg/kg, and 1.5 mg/kg) and provided self-report ratings of sociability, anxiety, and drug effects. These responses were examined in relation to rs53576. MDMA (1.5 mg/kg) did not increase sociability in individuals with the A/A genotype as it did in G allele carriers. The genotypic groups did not differ in responses at the lower MDMA dose, or in cardiovascular or other subjective responses. These findings are consistent with the idea that MDMA-induced sociability is mediated by oxytocin, and that variation in the oxytocin receptor gene may influence responses to the drug. PMID:26787430
Tetteh, Antonia Y; Sun, Katherine H; Hung, Chiu-Yueh; Kittur, Farooqahmed S; Ibeanu, Gordon C; Williams, Daniel; Xie, Jiahua
2014-01-01
Bacteria can reduce toxic selenite into less toxic, elemental selenium (Se(0)), but the mechanism on how bacterial cells reduce selenite at molecular level is still not clear. We used Escherichia coli strain K12, a common bacterial strain, as a model to study its growth response to sodium selenite (Na2SeO3) treatment and then used quantitative real-time PCR (qRT-PCR) to quantify transcript levels of three E. coli selenopolypeptide genes and a set of machinery genes for selenocysteine (SeCys) biosynthesis and incorporation into polypeptides, whose involvements in the selenite reduction are largely unknown. We determined that 5 mM Na2SeO3 treatment inhibited growth by ∼ 50% while 0.001 to 0.01 mM treatments stimulated cell growth by ∼ 30%. Under 50% inhibitory or 30% stimulatory Na2SeO3 concentration, selenopolypeptide genes (fdnG, fdoG, and fdhF) whose products require SeCys but not SeCys biosynthesis machinery genes were found to be induced ≥2-fold. In addition, one sulfur (S) metabolic gene iscS and two previously reported selenite-responsive genes sodA and gutS were also induced ≥2-fold under 50% inhibitory concentration. Our findings provide insight about the detoxification of selenite in E. coli via induction of these genes involved in the selenite reduction process.
The acute phase response of cod (Gadus morhua L.): expression of immune response genes.
Audunsdottir, Sigridur S; Magnadottir, Bergljot; Gisladottir, Berglind; Jonsson, Zophonias O; Bragason, Birkir Th
2012-02-01
An acute phase response (APR) was experimentally induced in Atlantic cod (Gadus morhua L.) by intramuscular injection of turpentine oil. The change in the expression of immune related genes was monitored in the anterior kidney and the spleen over a period of 7 days. The genes examined were two types of pentraxins, apolipoprotein A1 (ApoA-I), the complement component C3, interleukin-1β (IL-1β), transferrin, cathelicidin, and hepcidin. All genes were constitutively expressed in both organs and their expression amplified by the turpentine injection. A pattern of response was observed both with respect to the organ preference and to the timing of a maximum response. The increased gene expression of the pentraxins, ApoA-I and C3 was restricted to the anterior kidney, the gene expression of IL-1β, cathelicidin, and transferrin increased in both organs, while hepcidin gene expression was only significantly increased in the spleen. The pentraxins and ApoA-I appear to be early mediators of APR in cod, possibly stimulating C3 and IL-1β response, while the antimicrobial peptides may play a minor role. The increase in transferrin gene expression in both organs, and apparent indifference to cortisol release associated with the turpentine injection, suggests that this could be a typical acute phase protein in cod. Copyright © 2011 Elsevier Ltd. All rights reserved.
Saijo, Takanori; Nagasawa, Akitsu
2014-01-01
A newly developed copper-inducible gene expression system overcame the mixed results reported earlier, worked well both in cultured cells and a whole plant, and enabled to control flowering timing. Copper is one of the essential microelements and is readily taken up by plants. However, to date, it has rarely been used to control the expression of genes of interest, probably due to the inefficiency of the gene expression systems. In this study, we successfully developed a copper-inducible gene expression system that is based on the regulation of the yeast metallothionein gene. This system can be applied in the field and regulated at approximately one-hundredth of the rate used for registered copper-based fungicides. In the presence of copper, a translational fusion of the ACE1 transcription factor with the VP16 activation domain (VP16AD) of herpes simplex virus strongly activated transcription of the GFP gene in transgenic Arabidopsis. Interestingly, insertion of the To71 sequence, a 5'-untranslated region of the 130k/180k gene of tomato mosaic virus, upstream of the GFP gene reduced the basal expression of GFP in the absence of copper to almost negligible levels, even in soil-grown plants that were supplemented with ordinary liquid nutrients. Exposure of plants to 100 μM copper resulted in an over 1,000-fold induction ratio at the transcriptional level of GFP. This induction was copper-specific and dose-dependent with rapid and reversible responses. Using this expression system, we also succeeded in regulating floral transition by copper treatment. These results indicate that our newly developed copper-inducible system can accelerate gene functional analysis in model plants and can be used to generate novel agronomic traits in crop species.
Responses of human cells to ZnO nanoparticles: a gene transcription study†
Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.
2013-01-01
The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377
Lignification induced by pseudomonads harboring avirulent genes on Arabidopsis.
Lee, S; Sharm, Y; Lee, T K; Chang, M; Davis, K R
2001-08-31
The responses of Arabidopsis thaliana ecotypes to the bacterial pathogen Pseudomonas syringae pv. maculicola 4326 (Psm4326) harboring cloned avirulence genes avrB and avrRpt2 from P. syringae pv. glycinea were examined. Psm4326 containing avirulent genes, avrB and avrRpt2 induced lignification and peroxidase activities in the bacteria infiltrated leaves of Col-O only and not in Mt-O, Bla-2 and Po-1. However, Arabidopsis ecotypes infiltrated with Psm4326 harboring with and without avirulent genes all showed differential induction of mRNA for peroxidase gene and lignin accumulation up to 24 h after infiltration. Only avrB gene in Col-O showed strong corelationship between peroxidase mRNA expression as well as lignification gradually up to 36 h after infiltration. These results extend previous observations that avirulence genes from pathogens of one host plant can be recognized by non-host plants and provide the genetic framework for analysis of the plant-specific response to the bacterial avirulent gene products in A. thaliana.
DELLA proteins modulate Arabidopsis defences induced in response to caterpillar herbivory
Bede, Jacqueline C.
2014-01-01
Upon insect herbivory, many plant species change the direction of metabolic flux from growth into defence. Two key pathways modulating these processes are the gibberellin (GA)/DELLA pathway and the jasmonate pathway. In this study, the effect of caterpillar herbivory on plant-induced responses was compared between wild-type Arabidopsis thaliana (L.) Heynh. and quad-della mutants that have constitutively elevated GA responses. The labial saliva (LS) of caterpillars of the beet armyworm, Spodoptera exigua, is known to influence induced plant defence responses. To determine the role of this herbivore cue in determining metabolic shifts, plants were subject to herbivory by caterpillars with intact or impaired LS secretions. In both wild-type and quad-della plants, a jasmonate burst is an early response to caterpillar herbivory. Negative growth regulator DELLA proteins are required for the LS-mediated suppression of hormone levels. Jasmonate-dependent marker genes are induced in response to herbivory independently of LS, with the exception of AtPDF1.2 that showed LS-dependent expression in the quad-della mutant. Early expression of the salicylic acid (SA)-marker gene, AtPR1, was not affected by herbivory which also reflected SA hormone levels; however, this gene showed LS-dependent expression in the quad-della mutant. DELLA proteins may positively regulate glucosinolate levels and suppress laccase-like multicopper oxidase activity in response to herbivory. The present results show a link between DELLA proteins and early, induced plant defences in response to insect herbivory; in particular, these proteins are necessary for caterpillar LS-associated attenuation of defence hormones. PMID:24399173
Clinical significance of in vivo cytarabine-induced gene expression signature in AML.
Lamba, Jatinder K; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R; Cogle, Christopher R; Bhise, Neha; Raimondi, Susana C; Downing, James R; Baker, Sharyn D; Ribeiro, Raul C; Rubnitz, Jeffrey E
2016-01-01
Despite initial remission, ∼60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML; however, the extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy, can trigger adaptive response by influencing leukemic cell transcriptome and, hence, development of resistance or refractory disease. It is, however, challenging to perform such a study due to lack of availability of specimens post-drug treatment. The primary objective of this study was to identify in vivo cytarabine-induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. The results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response.
Wang, Y H; Garvin, D F; Kochian, L V
2001-09-01
A subtractive tomato (Lycopersicon esculentum) root cDNA library enriched in genes up-regulated by changes in plant mineral status was screened with labeled mRNA from roots of both nitrate-induced and mineral nutrient-deficient (-nitrogen [N], -phosphorus, -potassium [K], -sulfur, -magnesium, -calcium, -iron, -zinc, and -copper) tomato plants. A subset of cDNAs was selected from this library based on mineral nutrient-related changes in expression. Additional cDNAs were selected from a second mineral-deficient tomato root library based on sequence homology to known genes. These selection processes yielded a set of 1,280 mineral nutrition-related cDNAs that were arrayed on nylon membranes for further analysis. These high-density arrays were hybridized with mRNA from tomato plants exposed to nitrate at different time points after N was withheld for 48 h, for plants that were grown on nitrate/ammonium for 5 weeks prior to the withholding of N. One hundred-fifteen genes were found to be up-regulated by nitrate resupply. Among these genes were several previously identified as nitrate responsive, including nitrate transporters, nitrate and nitrite reductase, and metabolic enzymes such as transaldolase, transketolase, malate dehydrogenase, asparagine synthetase, and histidine decarboxylase. We also identified 14 novel nitrate-inducible genes, including: (a) water channels, (b) root phosphate and K(+) transporters, (c) genes potentially involved in transcriptional regulation, (d) stress response genes, and (e) ribosomal protein genes. In addition, both families of nitrate transporters were also found to be inducible by phosphate, K, and iron deficiencies. The identification of these novel nitrate-inducible genes is providing avenues of research that will yield new insights into the molecular basis of plant N nutrition, as well as possible networking between the regulation of N, phosphorus, and K nutrition.
Functional dissection of drought-responsive gene expression patterns in Cynodon dactylon L.
Kim, Changsoo; Lemke, Cornelia; Paterson, Andrew H
2009-05-01
Water deficit is one of the main abiotic factors that affect plant productivity in subtropical regions. To identify genes induced during the water stress response in Bermudagrass (Cynodon dactylon), cDNA macroarrays were used. The macroarray analysis identified 189 drought-responsive candidate genes from C. dactylon, of which 120 were up-regulated and 69 were down-regulated. The candidate genes were classified into seven groups by cluster analysis of expression levels across two intensities and three durations of imposed stress. Annotation using BLASTX suggested that up-regulated genes may be involved in proline biosynthesis, signal transduction pathways, protein repair systems, and removal of toxins, while down-regulated genes were mostly related to basic plant metabolism such as photosynthesis and glycolysis. The functional classification of gene ontology (GO) was consistent with the BLASTX results, also suggesting some crosstalk between abiotic and biotic stress. Comparative analysis of cis-regulatory elements from the candidate genes implicated specific elements in drought response in Bermudagrass. Although only a subset of genes was studied, Bermudagrass shared many drought-responsive genes and cis-regulatory elements with other botanical models, supporting a strategy of cross-taxon application of drought-responsive genes, regulatory cues, and physiological-genetic information.
Nicotinic acid modulates Legionella pneumophila gene expression and induces virulence traits.
Edwards, Rachel L; Bryan, Andrew; Jules, Matthieu; Harada, Kaoru; Buchrieser, Carmen; Swanson, Michele S
2013-03-01
In response to environmental fluctuations or stresses, bacteria can activate transcriptional and phenotypic programs to coordinate an adaptive response. The intracellular pathogen Legionella pneumophila converts from a noninfectious replicative form to an infectious transmissive form when the bacterium encounters alterations in either amino acid concentrations or fatty acid biosynthesis. Here, we report that L. pneumophila differentiation is also triggered by nicotinic acid, a precursor of the central metabolite NAD(+). In particular, when replicative L. pneumophila are treated with 5 mM nicotinic acid, the bacteria induce numerous transmissive-phase phenotypes, including motility, cytotoxicity toward macrophages, sodium sensitivity, and lysosome avoidance. Transcriptional profile analysis determined that nicotinic acid induces the expression of a panel of genes characteristic of transmissive-phase L. pneumophila. Moreover, an additional 213 genes specific to nicotinic acid treatment were altered. Although nearly 25% of these genes lack an assigned function, the gene most highly induced by nicotinic acid treatment encodes a putative major facilitator superfamily transporter, Lpg0273. Indeed, lpg0273 protects L. pneumophila from toxic concentrations of nicotinic acid as judged by analyzing the growth of the corresponding mutant. The broad utility of the nicotinic acid pathway to couple central metabolism and cell fate is underscored by this small metabolite's modulation of gene expression by diverse microbes, including Candida glabrata, Bordetella pertussis, Escherichia coli, and L. pneumophila.
Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis
NASA Astrophysics Data System (ADS)
Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.
2005-07-01
We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.
Li, Jinhua; Moe, Birget; Liu, Yanming; Li, Xing-Fang
2018-06-05
Halobenzoquinones (HBQs) are emerging disinfection byproducts (DBPs) that effectively induce reactive oxygen species and oxidative damage in vitro. However, the impacts of HBQs on oxidative-stress-related gene expression have not been investigated. In this study, we examined alterations in the expression of 44 genes related to oxidative-stress-induced signaling pathways in human uroepithelial cells (SV-HUC-1) upon exposure to six HBQs. The results show the structure-dependent effects of HBQs on the studied gene expression. After 2 h of exposure, the expression levels of 9 to 28 genes were altered, while after 8 h of exposure, the expression levels of 29 to 31 genes were altered. Four genes ( HMOX1, NQO1, PTGS2, and TXNRD1) were significantly upregulated by all six HBQs at both exposure time points. Ingenuity pathway analysis revealed that the Nrf2 pathway was significantly responsive to HBQ exposure. Other canonical pathways responsive to HBQ exposure included GSH redox reductions, superoxide radical degradation, and xenobiotic metabolism signaling. This study has demonstrated that HBQs significantly alter the gene expression of oxidative-stress-related signaling pathways and contributes to the understanding of HBQ-DBP-associated toxicity.
Yamamoto, Kazuhiko; Nihrane, Abdallah; Aglipay, Jason; Sironi, Juan; Arkin, Steven; Lipton, Jeffrey M; Ouchi, Toru; Liu, Johnson M
2008-01-01
Fanconi anemia (FA) predisposes to hematopoietic failure, birth defects, leukemia, and squamous cell carcinoma of the head and neck (HNSCC) and cervix. The FA/BRCA pathway includes 8 members of a core complex and 5 downstream gene products closely linked with BRCA1 or BRCA2. Precancerous lesions are believed to trigger the DNA damage response (DDR), and we focused on the DDR in FA and its putative role as a checkpoint barrier to cancer. In primary fibroblasts with mutations in the core complex FANCA protein, we discovered that basal expression and phosphorylation of ATM (ataxia telangiectasia mutated) and p53 induced by irradiation (IR) or mitomycin C (MMC) were upregulated. This heightened response appeared to be due to increased basal levels of ATM in cultured FANCA-mutant cells, highlighting the new observation that ATM can be regulated at the transcriptional level in addition to its well-established activation by autophosphorylation. Functional analysis of this response using gamma-H2AX foci as markers of DNA double-stranded breaks (DSBs) demonstrated abnormal persistence of only MMC- and not IR-induced foci. Thus, we describe a processing defect that leads to general DDR upregulation but specific persistence of DNA crosslinker-induced damage response foci. Underscoring the significance of these findings, we found resistance to DNA crosslinker-induced cell cycle arrest and apoptosis in a TP53-mutant, patient-derived HNSCC cell line, whereas a lymphoblastoid cell line derived from this same individual was not mutated at TP53 and retained DNA crosslinker sensitivity. Our results suggest that cancer in FA may arise from selection for cells that escape from a chronically activated DDR checkpoint.
Furuya, Toshiki; Hirose, Satomi; Semba, Hisashi; Kino, Kuniki
2011-01-01
The mimABCD gene cluster encodes the binuclear iron monooxygenase that oxidizes propane and phenol in Mycobacterium smegmatis strain MC2 155 and Mycobacterium goodii strain 12523. Interestingly, expression of the mimABCD gene cluster is induced by acetone. In this study, we investigated the regulator gene responsible for this acetone-responsive expression. In the genome sequence of M. smegmatis strain MC2 155, the mimABCD gene cluster is preceded by a gene designated mimR, which is divergently transcribed. Sequence analysis revealed that MimR exhibits amino acid similarity with the NtrC family of transcriptional activators, including AcxR and AcoR, which are involved in acetone and acetoin metabolism, respectively. Unexpectedly, many homologs of the mimR gene were also found in the sequenced genomes of actinomycetes. A plasmid carrying a transcriptional fusion of the intergenic region between the mimR and mimA genes with a promoterless green fluorescent protein (GFP) gene was constructed and introduced into M. smegmatis strain MC2 155. Using a GFP reporter system, we confirmed by deletion and complementation analyses that the mimR gene product is the positive regulator of the mimABCD gene cluster expression that is responsive to acetone. M. goodii strain 12523 also utilized the same regulatory system as M. smegmatis strain MC2 155. Although transcriptional activators of the NtrC family generally control transcription using the σ54 factor, a gene encoding the σ54 factor was absent from the genome sequence of M. smegmatis strain MC2 155. These results suggest the presence of a novel regulatory system in actinomycetes, including mycobacteria. PMID:21856847
Clinical significance of In vivo Cytarabine Induced Gene Expression Signature in AML
Lamba, Jatinder K.; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R.; Cogle, Christopher R.; Bhise, Neha; Raimondi, Susana C.; Downing, James R.; Baker, Sharyn D.; Ribeiro, Raul C.; Rubnitz, Jeffrey E.
2016-01-01
Despite initial remission, approximately 60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML, however extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy can trigger adaptive response by influencing leukemic cell transcriptome and hence development of resistance or refractory disease. It is however challenging to perform such a study due to lack of availability of specimens post-drug treatment. In this study our primary objective was to identify in vivo cytarabine induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. Our results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response. PMID:26366682
Soft mechanical stimulation induces a defense response against Botrytis cinerea in strawberry.
Tomas-Grau, Rodrigo Hernán; Requena-Serra, Fernando José; Hael-Conrad, Verónica; Martínez-Zamora, Martín Gustavo; Guerrero-Molina, María Fernanda; Díaz-Ricci, Juan Carlos
2018-02-01
Genes associated with plant mechanical stimulation were found in strawberry genome. A soft mechanical stimulation (SMS) induces molecular and biochemical changes in strawberry plants, conferring protection against Botrytis cinerea. Plants have the capacity to induce a defense response after exposure to abiotic stresses acquiring resistance towards pathogens. It was reported that when leaves of Arabidopsis thaliana were wounded or treated with a soft mechanical stimulation (SMS), they could resist much better the attack of the fungal pathogen Botrytis cinerea, and this effect was accompanied by an oxidative burst and the expression of touch-inducible genes (TCH). However, no further work was carried out to better characterize the induced defense response. In this paper, we report that TCH genes were identified for first time in the genomes of the strawberry species Fragaria ananassa (e.g. FaTCH2, FaTCH3, FaTCH4 and FaCML39) and Fragaria vesca (e.g. FvTCH2, FvTCH3, FvTCH4 and FvCML39). Phylogenetic studies revealed that F. ananassa TCH genes exhibited high similarity with the orthologous of F. vesca and lower with A. thaliana ones. We also present evidence that after SMS treatment on strawberry leaves, plants activate a rapid oxidative burst, callose deposition, and the up-regulation of TCH genes as well as plant defense genes such as FaPR1, FaCHI2-2, FaCAT, FaACS1 and FaOGBG-5. The latter represents the first report showing that TCH- and defense-induced genes participate in SMS-induced resistance in plants, bringing a rational explanation why plants exposed to a SMS treatment acquired an enhance resistance toward B. cinerea.
Oda, Saori; Yurimoto, Hiroya; Nitta, Nobuhisa; Sasano, Yu
2015-01-01
We identified genes encoding components of the Hap complex, CbHAP2, CbHAP3, and CbHAP5, as transcription factors regulating methanol-inducible gene expression in the methylotrophic yeast Candida boidinii. We found that the Cbhap2Δ, Cbhap3Δ, and Cbhap5Δ gene-disrupted strains showed severe growth defects on methanol but not on glucose and nonfermentable carbon sources such as ethanol and glycerol. In these disruptants, the transcriptional activities of methanol-inducible promoters were significantly decreased compared to those of the wild-type strain, indicating that CbHap2p, CbHap3p, and CbHap5p play indispensable roles in methanol-inducible gene expression. Further molecular and biochemical analyses demonstrated that CbHap2p, CbHap3p, and CbHap5p localized to the nucleus and bound to the promoter regions of methanol-inducible genes regardless of the carbon source, and heterotrimer formation was suggested to be necessary for binding to DNA. Unexpectedly, distinct from Saccharomyces cerevisiae, the Hap complex functioned in methanol-specific induction rather than glucose derepression in C. boidinii. Our results shed light on a novel function of the Hap complex in methanol-inducible gene expression in methylotrophic yeasts. PMID:25595445
Kudrick, Necla; Chan, Owen; La Gamma, Edmund F; Kim, Juhye Lena; Tank, Arnold William; Sterling, Carol; Nankova, Bistra B
2015-02-01
Acute metabolic stress such as insulin-induced hypoglycemia triggers a counterregulatory response during which the release of catecholamines (epinephrine), the activation of tyrosine hydroxylase (TH) enzyme and subsequent compensatory catecholamine biosynthesis occur in the adrenal medulla. However, recurrent exposure to hypoglycemia (RH), a consequence of tight glycemic control in individuals with type 1 and type 2 diabetes compromises this physiological response. The molecular mechanisms underlying the maladaptive response to repeated glucose deprivation are incompletely understood. We hypothesize that impaired epinephrine release following RH reflects altered regulation of adrenal catecholamine biosynthesis. To test this hypothesis, we compared the effect of single daily (RH) and twice-daily episodes of insulin-induced hypoglycemia (2RH) on adrenal epinephrine release and production in normal rats. Control animals received saline injections under similar conditions (RS and 2RS, respectively). Following 3 days of treatment, we assessed the counterregulatory hormonal responses during a hypoglycemic clamp. Changes in adrenal TH gene expression were also analyzed. The counterregulatory responses, relative TH transcription and TH mRNA levels and Ser40-TH phosphorylation (marker for enzyme activation) were induced to a similar extent in RS, 2RS, and RH groups. In contrast, epinephrine and glucagon responses were attenuated in the 2RH group and this was associated with a limited elevation of adrenal TH mRNA, rapid inactivation of TH enzyme and no significant changes in TH protein. Our results suggest that novel posttranscriptional mechanisms controlling TH mRNA and activated TH enzyme turnover contribute to the impaired epinephrine responses and may provide new therapeutic targets to prevent HAAF. © 2015 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
Röschmann, K I L; Luiten, S; Jonker, M J; Breit, T M; Fokkens, W J; Petersen, A; van Drunen, C M
2011-06-01
Grass pollen allergy is one of the most common allergies worldwide and airborne allergens are the major cause of allergic rhinitis. Airway epithelial cells (AECs) are the first to encounter and respond to aeroallergens and are therefore interesting targets for the development of new therapeutics. Our understanding of the epithelial contribution to immune responses is limited as most studies focus on only a few individual genes or proteins. To describe in detail the Timothy grass pollen extract (GPE)-induced gene expression in AECs. NCI-H292 cells were exposed to GPE for 24 h, and isolated RNA and cell culture supernatants were used for microarray analysis and multiplex ELISA, respectively. Eleven thousand and seven hundred fifty-eight transcripts were affected after exposure to GPE, with 141 genes up-regulated and 121 genes down-regulated by more than threefold. The gene ontology group cell communication was among the most prominent categories. Network analysis revealed that a substantial part of regulated genes are related to the cytokines IL-6, IL-8, IL-1A, and the transcription factor FOS. After analysing significantly regulated signalling pathways, we found, among others, epidermal growth factor receptor 1, IL-1, Notch-, and Wnt-related signalling members. Unexpectedly, we found Jagged to be down-regulated and an increased release of IL-12, in line with a more Th1-biased response induced by GPE. Our data show that the stimulation of AECs with GPE results in the induction of a broad response on RNA and protein level by which they are able to affect the initiation and regulation of local immune responses. Detailed understanding of GPE-induced genes and signalling pathways will allow us to better define the pathogenesis of the allergic response and to identify new targets for treatment. © 2011 Blackwell Publishing Ltd.
Richter, Catherine A.; Garcia-Reyero, Natàlia; Martyniuk, Chris; Knoebl, Iris; Pope, Marie; Wright-Osment, Maureen K.; Denslow, Nancy D.; Tillitt, Donald E.
2011-01-01
Methylmercury (MeHg) is a potent neurotoxicant and endocrine disruptor that accumulates in aquatic systems. Previous studies have shown suppression of hormone levels in both male and female fish, suggesting effects on gonadotropin regulation in the brain. The gene expression profile in adult female zebrafish whole brain induced by acute (96 h) MeHg exposure was investigated. Fish were exposed by injection to 0 or 0.5(mu or u)g MeHg/g. Gene expression changes in the brain were examined using a 22,000-feature zebrafish microarray. At a significance level of p0.01, 79 genes were up-regulated and 76 genes were down-regulated in response to MeHg exposure. Individual genes exhibiting altered expression in response to MeHg exposure implicate effects on glutathione metabolism in the mechanism of MeHg neurotoxicity. Gene ontology (GO) terms significantly enriched among altered genes included protein folding, cell redox homeostasis, and steroid biosynthetic process. The most affected biological functions were related to nervous system development and function, as well as lipid metabolism and molecular transport. These results support the involvement of oxidative stress and effects on protein structure in the mechanism of action of MeHg in the female brain. Future studies will compare the gene expression profile induced in response to MeHg with that induced by other toxicants and will investigate responsive genes as potential biomarkers of MeHg exposure.
Noradrenaline and alpha-adrenergic signaling induce the hsp70 gene promoter in mollusc immune cells.
Lacoste, A; De Cian, M C; Cueff, A; Poulet, S A
2001-10-01
Expression of heat shock proteins (hsp) is a homeostatic mechanism induced in both prokaryotic and eukaryotic cells in response to metabolic and environmental insults. A growing body of evidence suggests that in mammals, the hsp response is integrated with physiological responses through neuroendocrine signaling. In the present study, we have examined the effect of noradrenaline (NA) on the hsp70 response in mollusc immune cells. Oyster and abalone hemocytes transfected with a gene construct containing a gastropod hsp70 gene promoter linked to the luciferase reporter-gene were exposed to physiological concentrations of NA, or to various alpha- and beta-adrenoceptor agonists and antagonists. Results show that NA and alpha-adrenergic stimulations induced the expression of luciferase in transfected mollusc immunocytes. Furthermore, exposure of hemocytes to NA or to the alpha-adrenoceptor agonist phenylephrine (PE) resulted in the expression of the inducible isoform of the hsp70 protein. Pertussis toxin (PTX), the phospholipase C (PLC) inhibitor U73122, the protein kinase C (PKC) inhibitor calphostin C, the Ca(2+)-dependent PKC inhibitor Gö 6976 and the phosphatidylinositol 3-kinase (PI 3-kinase) inhibitor LY294002 blocked the PE-mediated induction of the hsp70 gene promoter. These results suggest that alpha-adrenergic signaling induces the transcriptionnal upregulation of hsp70 in mollusc hemocytes through a PTX-sensitive G-protein, PLC, Ca(2+)-dependent PKC and PI 3-kinase. Thus, a functional link exists between neuroendocrine signaling and the hsp70 response in mollusc immune cells.
Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C
2016-01-01
Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the
Silver nanoparticles induce endoplasmatic reticulum stress response in zebrafish
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christen, Verena; Capelle, Martinus; Fent, Karl, E-mail: karl.fent@fhnw.ch
2013-10-15
Silver nanoparticles (AgNPs) find increasing applications, and therefore humans and the environment are increasingly exposed to them. However, potential toxicological implications are not sufficiently known. Here we investigate effects of AgNPs (average size 120 nm) on zebrafish in vitro and in vivo, and compare them to human hepatoma cells (Huh7). AgNPs are incorporated in zebrafish liver cells (ZFL) and Huh7, and in zebrafish embryos. In ZFL cells AgNPs lead to induction of reactive oxygen species (ROS), endoplasmatic reticulum (ER) stress response, and TNF-α. Transcriptional alterations also occur in pro-apoptotic genes p53 and Bax. The transcriptional profile differed in ZFL andmore » Huh7 cells. In ZFL cells, the ER stress marker BiP is induced, concomitant with the ER stress marker ATF-6 and spliced XBP-1 after 6 h and 24 h exposure to 0.5 g/L and 0.05 g/L AgNPs, respectively. This indicates the induction of different pathways of the ER stress response. Moreover, AgNPs induce TNF-α. In zebrafish embryos exposed to 0.01, 0.1, 1 and 5 mg/L AgNPs hatching was affected and morphological defects occurred at high concentrations. ER stress related gene transcripts BiP and Synv are significantly up-regulated after 24 h at 0.1 and 5 mg/L AgNPs. Furthermore, transcriptional alterations occurred in the pro-apoptotic genes Noxa and p21. The ER stress response was strong in ZFL cells and occurred in zebrafish embryos as well. Our data demonstrate for the first time that AgNPs lead to induction of ER stress in zebrafish. The induction of ER stress can have several consequences including the activation of apoptotic and inflammatory pathways. - Highlights: • Effects of silver nanoparticles (120 nm AgNPs) are investigated in zebrafish. • AgNPs induce all ER stress reponses in vitro in zebrafish liver cells. • AgNPs induce weak ER stress in zebrafish embryos. • AgNPs induce oxidative stress and transcripts of pro-apoptosis genes.« less
Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan
2015-07-21
Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress.
Superoxide-responsive gene expression in Arabidopsis thaliana and Zea mays.
Xu, Junhuan; Tran, Thu; Padilla Marcia, Carmen S; Braun, David M; Goggin, Fiona L
2017-08-01
Superoxide (O 2 - ) and other reactive oxygen species (ROS) are generated in response to numerous biotic and abiotic stresses. Different ROS have been reported to elicit different transcriptional responses in plants, and so ROS-responsive marker genes and promoter::reporter gene fusions have been proposed as indirect means of detecting ROS and discriminating among different species. However, further information about the specificity of transcriptional responses to O 2 - is needed in order to assess potential markers for this critical stress-responsive signaling molecule. Using qRT-PCR, the expression of 12 genes previously reported to be upregulated by O 2 - was measured in Arabidopsis thaliana plants exposed to elicitors of common stress-responsive ROS: methyl viologen (an inducer of O 2 - ), rose bengal (an inducer of singlet oxygen, 1 ΔO 2 ), and exogenous hydrogen peroxide (H 2 O 2 ). Surprisingly, Zinc-Finger Protein 12 (AtZAT12), which had previously been used as a reporter for H 2 O 2 , responded more strongly to O 2 - than to H 2 O 2 ; moreover, the expression of an AtZAT12 promoter-reporter fusion (AtZAT12::Luc) was enhanced by diethyldithiocarbamate, which inhibits dismutation of O 2 - to H 2 O 2 . These results suggest that AtZAT12 is transcriptionally upregulated in response to O 2 - , and that AtZAT12::Luc may be a useful biosensor for detecting O 2 - generation in vivo. In addition, transcripts encoding uncoupling proteins (AtUCPs) showed selectivity for O 2 - in Arabidopsis, and an AtUCP homolog upregulated by methyl viologen was also identified in maize (Zea mays L.), indicating that there are O 2 - -responsive members of this family in monocots. These results expand our limited knowledge of ROS-responsive gene expression in monocots, as well as O 2 - -selective responses in dicots. Copyright © 2017 The Authors. Published by Elsevier Masson SAS.. All rights reserved.
Norman-Setterblad, C; Vidal, S; Palva, E T
2000-04-01
We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.
UVB-induced gene expression in the skin of Xiphophorus maculatus Jp 163 B☆
Yang, Kuan; Boswell, Mikki; Walter, Dylan J.; Downs, Kevin P.; Gaston-Pravia, Kimberly; Garcia, Tzintzuni; Shen, Yingjia; Mitchell, David L.; Walter, Ronald B.
2014-01-01
Xiphophorus fish and interspecies hybrids represent long-standing models to study the genetics underlying spontaneous and induced tumorigenesis. The recent release of the Xiphophorus maculatus genome sequence will allow global genetic regulation studies of genes involved in the inherited susceptibility to UVB-induced melanoma within select backcross hybrids. As a first step toward this goal, we report results of an RNA-Seq approach to identify genes and pathways showing modulated transcription within the skin of X. maculatus Jp 163 B upon UVB exposure. X. maculatus Jp 163 B were exposed to various doses of UVB followed by RNA-Seq analysis at each dose to investigate overall gene expression in each sample. A total of 357 genes with a minimum expression change of 4-fold (p-adj < 0.05) were identified as responsive to UVB. The molecular genetic response of Xiphophorus skin to UVB exposure permitted assessment of; (1) the basal expression level of each transcript for each skin sample, (2) the changes in expression levels for each gene in the transcriptome upon exposure to increasing doses of UVB, and (3) clusters of genes that exhibit similar patterns of change in expression upon UVB exposure. These data provide a foundation for understanding the molecular genetic response of fish skin to UVB exposure. PMID:24556253
Ishishita, Kazuhiro; Suetsugu, Noriyuki; Hirose, Yuki; Higa, Takeshi; Doi, Michio; Wada, Masamitsu; Matsushita, Tomonao; Gotoh, Eiji
2016-03-01
The blue light (BL) receptor phototropin (phot) is specifically found in green plants; it regulates various BL-induced responses such as phototropism, chloroplast movement, stomatal opening, and leaf flattening. In Arabidopsis thaliana, two phototropins--phot1 and phot2--respond to blue light in overlapping but distinct ways. These BL-receptor-mediated responses enhance the photosynthetic activity of plants under weak light and minimize photodamage under strong light conditions. Welwitschia mirabilis Hook.f. found in the Namib Desert, and it has adapted to severe environmental stresses such as limiting water and strong sunlight. Although the plant has physiologically and ecologically unique features, it is unknown whether phototropin is functional in this plant. In this study, we assessed the functioning of phot-mediated BL responses in W. mirabilis. BL-dependent phototropism and stomatal opening was observed but light-dependent chloroplast movement was not detected. We performed a functional analysis of the PHOT1 gene of W. mirabilis, WmPHOT1, in Arabidopsis thaliana. We generated transgenic A. thaliana lines expressing WmPHOT1 in a phot1 phot2 double mutant background. Several Wmphot1 transgenic plants showed normal growth, although phot1 phot2 double mutant plants showed stunted growth. Furthermore, Wmphot1 transgenic plants showed normal phot1-mediated responses including phototropism, chloroplast accumulation, stomatal opening, and leaf flattening, but lacked the chloroplast avoidance response that is specifically mediated by phot2. Thus, our findings indicate that W. mirabilis possesses typical phot-mediated BL responses that were at least partially mediated by functional phototropin 1, an ortholog of Atphot1.
Kumar, Vinay; Kumar, Anil; Irfan, Mohammad; Chakraborty, Niranjan; Chakraborty, Subhra; Datta, Asis
2013-01-01
Monoterpenes, which are among the major components of plant essential oils, are known for their ecological roles as well for pharmaceutical properties. Geraniol, an acyclic monoterpene induces cell cycle arrest and apoptosis/senescence in various cancer cells and plants; however, the genes involved in the process and the underlying molecular mechanisms are not well understood. In this study, we demonstrate that treatment of tomato plants with geraniol results in induction of senescence due to a substantial alteration in transcriptome. We have identified several geraniol-responsive protein encoding genes in tomato using suppression subtractive hybridization (SSH) approach. These genes comprise of various components of signal transduction, cellular metabolism, reactive oxygen species (ROS), ethylene signalling, apoptosis and DNA damage response. Upregulation of NADPH oxidase and antioxidant genes, and increase in ROS level after geraniol treatment point towards the involvement of ROS in geraniol-mediated senescence. The delayed onset of seedling death and induced expression of geraniol-responsive genes in geraniol-treated ethylene receptor mutant (Nr) suggest that geraniol-mediated senescence involves both ethylene dependent and independent pathways. Moreover, expression analysis during tomato ripening revealed that geraniol-responsive genes are also associated with the natural organ senescence process. PMID:24098759
Shen, Yun; Ruan, Qingxia; Chai, Haoxi; Yuan, Yongze; Yang, Wannian; Chen, Junping; Xin, Zhanguo; Shi, Huazhong
2016-12-01
Polyamines involve in gene regulation by interacting with and modulating the functions of various anionic macromolecules such as DNA, RNA and proteins. In this study, we identified an important function of the polyamine transporter LHR1 (LOWER EXPRESSION OF HEAT RESPONSIVE GENE1) in heat-inducible gene expression in Arabidopsis thaliana. The lhr1 mutant was isolated through a forward genetic screening for altered expression of the luciferase reporter gene driven by the promoter from the heat-inducible gene AtHSP18.2. The lhr1 mutant showed reduced induction of the luciferase gene in response to heat stress and was more sensitive to high temperature than the wild type. Map-based cloning identified that the LHR1 gene encodes the polyamine transporter PUT3 (POLYAMINE UPTAKE TRANSPORTER 3) localized in the plasma membrane. The LHR1/PUT3 is required for the uptake of extracellular polyamines and plays an important role in stabilizing the mRNAs of several crucial heat stress responsive genes under high temperature. Genome-wide gene expression analysis using RNA-seq identified an array of differentially expressed genes, among which the transcript levels of some of the heat shock protein genes significantly reduced in response to prolonged heat stress in the lhr1 mutant. Our findings revealed an important heat stress response and tolerance mechanism involving polyamine influx which modulates mRNA stability of heat-inducible genes under heat stress conditions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Post-transcriptional inducible gene regulation by natural antisense RNA.
Nishizawa, Mikio; Ikeya, Yukinobu; Okumura, Tadayoshi; Kimura, Tominori
2015-01-01
Accumulating data indicate the existence of natural antisense transcripts (asRNAs), frequently transcribed from eukaryotic genes and do not encode proteins in many cases. However, their importance has been overlooked due to their heterogeneity, low expression level, and unknown function. Genes induced in responses to various stimuli are transcriptionally regulated by the activation of a gene promoter and post-transcriptionally regulated by controlling mRNA stability and translatability. A low-copy-number asRNA may post-transcriptionally regulate gene expression with cis-controlling elements on the mRNA. The asRNA itself may act as regulatory RNA in concert with trans-acting factors, including various RNA-binding proteins that bind to cis-controlling elements, microRNAs, and drugs. A novel mechanism that regulates mRNA stability includes the interaction of asRNA with mRNA by hybridization to loops in secondary structures. Furthermore, recent studies have shown that the functional network of mRNAs, asRNAs, and microRNAs finely tunes the levels of mRNA expression. The post-transcriptional mechanisms via these RNA-RNA interactions may play pivotal roles to regulate inducible gene expression and present the possibility of the involvement of asRNAs in various diseases.
GAS6 is an estrogen-inducible gene in mammary epithelial cells
Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun
2007-01-01
To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935
Hong, Jeum Kyu; Hwang, Byung Kook
2009-01-01
The promoter of the pepper pathogen-induced membrane protein gene CaPIMP1 was analyzed by an Agrobacterium-mediated transient expression assay in tobacco leaves. Several stress-related cis-acting elements (GT-1, W-box and ABRE) are located within the CaPIMP1 promoter. In tobacco leaf tissues transiently transformed with a CaPIMP1 promoter-beta-glucuronidase (GUS) gene fusion, serially 5'-deleted CaPIMP1 promoters were differentially activated by Pseudomonas syringae pv. tabaci, ethylene, methyl jasmonate, abscisic acid, and nitric oxide. The -1,193 bp region of the CaPIMP1 gene promoter sequence exhibited full promoter activity. The -417- and -593 bp promoter regions were sufficient for GUS gene activation by ethylene and methyl jasmonate treatments, respectively. However, CaPIMP1 promoter sequences longer than -793 bp were required for promoter activation by abscisic acid and sodium nitroprusside treatments. CaPIMP1 expression was activated in pepper leaves by treatment with ethylene, methyl jasmonate, abscisic acid, beta-amino-n-butyric acid, NaCl, mechanical wounding, and low temperature, but not with salicylic acid. Overexpression of CaPIMP1 in Arabidopsis conferred hypersensitivity to mannitol, NaCl, and ABA during seed germination but not during seedling development. In contrast, transgenic plants overexpressing CaPIMP1 exhibited enhanced tolerance to oxidative stress induced by methyl viologen during germination and early seedling stages. These results suggest that CaPIMP1 expression may alter responsiveness to environmental stress, as well as to pathogen infection.
Salzman, Ron A.; Brady, Jeff A.; Finlayson, Scott A.; Buchanan, Christina D.; Summer, Elizabeth J.; Sun, Feng; Klein, Patricia E.; Klein, Robert R.; Pratt, Lee H.; Cordonnier-Pratt, Marie-Michèle; Mullet, John E.
2005-01-01
We have conducted a large-scale study of gene expression in the C4 monocot sorghum (Sorghum bicolor) L. Moench cv BTx623 in response to the signaling compounds salicylic acid (SA), methyl jasmonate (MeJA), and the ethylene precursor aminocyclopropane carboxylic acid. Expression profiles were generated from seedling root and shoot tissue at 3 and 27 h, using a microarray containing 12,982 nonredundant elements. Data from 102 slides and quantitative reverse transcription-PCR data on mRNA abundance from 171 genes were collected and analyzed and are here made publicly available. Numerous gene clusters were identified in which expression was correlated with particular signaling compound and tissue combinations. Many genes previously implicated in defense responded to the treatments, including numerous pathogenesis-related genes and most members of the phenylpropanoid pathway, and several other genes that may represent novel activities or pathways. Genes of the octadecanoic acid pathway of jasmonic acid (JA) synthesis were induced by SA as well as by MeJA. The resulting hypothesis that increased SA could lead to increased endogenous JA production was confirmed by measurement of JA content. Comparison of responses to SA, MeJA, and combined SA+MeJA revealed patterns of one-way and mutual antagonisms, as well as synergistic effects on regulation of some genes. These experiments thus help further define the transcriptional results of cross talk between the SA and JA pathways and suggest that a subset of genes coregulated by SA and JA may comprise a uniquely evolved sector of plant signaling responsive cascades. PMID:15863699
ML3: a novel regulator of herbivory-induced responses in Arabidopsis thaliana
Bejai, Sarosh
2013-01-01
ML (MD2-related lipid recognition) proteins are known to enhance innate immune responses in mammals. This study reports the analysis of the putative ML gene family in Arabidopsis thaliana and suggests a role for the ML3 gene in herbivory-associated responses in plants. Feeding by larvae of the Lepidopteran generalist herbivore Spodoptera littoralis and larvae of the specialist herbivore Plutella xylostella activated ML3 transcription in leaf tissues. ML3 loss-of-function Arabidopsis plants were compromised in the upregulation of herbivory-induced genes and displayed a semi-dwarf phenotype. Herbivory bioassays showed that larvae of S. littoralis fed on ml3 mutant plants gained more weight compared to larvae fed on wild-type plants while larvae of P. xylostella did not show any significant difference. Virus-induced gene silencing of ML3 expression in plants compromised in jasmonic acid (JA) and salicylic acid (SA) signalling revealed a complex role of ML3 in JA/defence signalling affecting both JA- and SA-dependent responses. The data suggest that ML3 is involved in herbivory-mediated responses in Arabidopsis and that it has a potential role in herbivory-associated molecular pattern recognition. PMID:23314818
Peng, Silvio; Stephan, Roger; Hummerjohann, Jörg; Tasara, Taurai
2014-12-01
Survival of Escherichia coli in food depends on its ability to adapt against encountered stress typically involving induction of stress response genes. In this study, the transcriptional induction of selected acid (cadA, speF) and salt (kdpA, proP, proW, otsA, betA) stress response genes was investigated among five E. coli strains, including three Shiga toxin-producing strains, exposed to sodium chloride or lactic acid stress. Transcriptional induction upon lactic acid stress exposure was similar in all but one E. coli strain, which lacked the lysine decarboxylase gene cadA. In response to sodium chloride stress exposure, proW and otsA were similarly induced, while significant differences were observed between the E. coli strains in induction of kdpA, proP and betA. The kdpA and betA genes were significantly induced in four and three strains, respectively, whereas one strain did not induce these genes. The proP gene was only induced in two E. coli strains. Interestingly, transcriptional induction differences in response to sodium chloride stress exposure were associated with survival phenotypes observed for the E. coli strains in cheese as the E. coli strain lacking significant induction in three salt stress response genes investigated also survived poorly compared to the other E. coli strains in cheese. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Costin, Blair N.; Wolen, Aaron R.; Fitting, Sylvia; Shelton, Keith L.; Miles, Michael F.
2012-01-01
Background Glucocorticoid hormones modulate acute and chronic behavioral and molecular responses to drugs of abuse including psychostimulants and opioids. There is growing evidence that glucocorticoids might also modulate behavioral responses to ethanol. Acute ethanol activates the HPA axis, causing release of adrenal glucocorticoid hormones. Our prior genomic studies suggest glucocorticoids play a role in regulating gene expression in the prefrontal cortex (PFC) of DBA2/J (D2) mice following acute ethanol administration. However, few studies have analyzed the role of glucocorticoid signaling in behavioral responses to acute ethanol. Such work could be significant, given the predictive value for level of response to acute ethanol in the risk for alcoholism. Methods We studied whether the glucocorticoid receptor (GR) antagonist, RU-486, or adrenalectomy (ADX) altered male D2 mouse behavioral responses to acute (locomotor activation, anxiolysis or loss-of-righting reflex (LORR)) or repeated (sensitization) ethanol treatment. Whole genome microarray analysis and bioinformatics approaches were used to identify PFC candidate genes possibly responsible for altered behavioral responses to ethanol following ADX. Results ADX and RU-486 both impaired acute ethanol (2 g/kg) induced locomotor activation in D2 mice without affecting basal locomotor activity. However, neither ADX nor RU-486 altered initiation of ethanol sensitization (locomotor activation or jump counts), ethanol-induced anxiolysis or LORR. ADX mice showed microarray gene expression changes in PFC that significantly overlapped with acute ethanol-responsive gene sets derived by our prior microarray studies. Q-rtPCR analysis verified that ADX decreased PFC expression of Fkbp5 while significantly increasing Gpr6 expression. In addition, high dose RU-486 pre-treatment blunted ethanol-induced Fkbp5 expression. Conclusions Our studies suggest that ethanol’s activation of adrenal glucocorticoid release and subsequent
Liao, Dehua; Chen, Xiao; Chen, Aiqun; Wang, Huimin; Liu, Jianjian; Liu, Junli; Gu, Mian; Sun, Shubin; Xu, Guohua
2015-04-01
In plants, the GH3 gene family is widely considered to be involved in a broad range of plant physiological processes, through modulation of hormonal homeostasis. Multiple GH3 genes have been functionally characterized in several plant species; however, to date, limited works to study the GH3 genes in tomato have been reported. Here, we characterize the expression and regulatory profiles of six tomato GH3 genes, SlGH3.2, SlGH3.3, SlGH3.4, SlGH3.7, SlGH3.9 and SlGH3.15, in response to different phytohormone applications and arbuscular mycorrhizal (AM) fungal colonization. All six GH3 genes showed inducible responses to external IAA, and three members were significantly up-regulated in response to AM symbiosis. In particular, SlGH3.4, the transcripts of which were barely detectable under normal growth conditions, was strongly activated in the IAA-treated and AM fungal-colonized roots. A comparison of the SlGH3.4 expression in wild-type plants and M161, a mutant with a defect in AM symbiosis, confirmed that SlGH3.4 expression is highly correlated to mycorrhizal colonization. Histochemical staining demonstrated that a 2,258 bp SlGH3.4 promoter fragment could drive β-glucuronidase (GUS) expression strongly in root tips, steles and cortical cells of IAA-treated roots, but predominantly in the fungal-colonized cells of mycorrhizal roots. A truncated 654 bp promoter failed to direct GUS expression in IAA-treated roots, but maintained the symbiosis-induced activity in mycorrhizal roots. In summary, our results suggest that a mycorrhizal signaling pathway that is at least partially independent of the auxin signaling pathway has evolved for the co-regulation of the auxin- and mycorrhiza-activated GH3 genes in plants. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Transcriptome analysis reveals key roles of AtLBR-2 in LPS-induced defense responses in plants.
Iizasa, Sayaka; Iizasa, Ei'ichi; Watanabe, Keiichi; Nagano, Yukio
2017-12-29
Lipopolysaccharide (LPS) from Gram-negative bacteria cause innate immune responses in animals and plants. The molecules involved in LPS signaling in animals are well studied, whereas those in plants are not yet as well documented. Recently, we identified Arabidopsis AtLBR-2, which binds to LPS from Pseudomonas aeruginosa (pLPS) directly and regulates pLPS-induced defense responses, such as pathogenesis-related 1 (PR1) expression and reactive oxygen species (ROS) production. In this study, we investigated the pLPS-induced transcriptomic changes in wild-type (WT) and the atlbr-2 mutant Arabidopsis plants using RNA-Seq technology. RNA-Seq data analysis revealed that pLPS treatment significantly altered the expression of 2139 genes, with 605 up-regulated and 1534 down-regulated genes in WT. Gene ontology (GO) analysis on these genes showed that GO terms, "response to bacterium", "response to salicylic acid (SA) stimulus", and "response to abscisic acid (ABA) stimulus" were enriched amongst only in up-regulated genes, as compared to the genes that were down-regulated. Comparative analysis of differentially expressed genes between WT and the atlbr-2 mutant revealed that 65 genes were up-regulated in WT but not in the atlbr-2 after pLPS treatment. Furthermore, GO analysis on these 65 genes demonstrated their importance for the enrichment of several defense-related GO terms, including "response to bacterium", "response to SA stimulus", and "response to ABA stimulus". We also found reduced levels of pLPS-induced conjugated SA glucoside (SAG) accumulation in atlbr-2 mutants, and no differences were observed in the gene expression levels in SA-treated WT and the atlbr-2 mutants. These 65 AtLBR-2-dependent up-regulated genes appear to be important for the enrichment of some defense-related GO terms. Moreover, AtLBR-2 might be a key molecule that is indispensable for the up-regulation of defense-related genes and for SA signaling pathway, which is involved in defense against
Al-Ameri, Salma; Al-Mahmoud, Bassam; Awwad, Falah; Al-Rawashdeh, Ahmed; Iratni, Rabah; AbuQamar, Synan
2014-01-01
Signaling pathways controlling biotic and abiotic stress responses may interact synergistically or antagonistically. To identify the similarities and differences among responses to diverse stresses, we analyzed previously published microarray data on the transcriptomic responses of Arabidopsis to infection with Botrytis cinerea (a biotic stress), and to cold, drought, and oxidative stresses (abiotic stresses). Our analyses showed that at early stages after B. cinerea inoculation, 1498 genes were up-regulated (B. cinerea up-regulated genes; BUGs) and 1138 genes were down-regulated (B. cinerea down-regulated genes; BDGs). We showed a unique program of gene expression was activated in response each biotic and abiotic stress, but that some genes were similarly induced or repressed by all of the tested stresses. Of the identified BUGs, 25%, 6% and 12% were also induced by cold, drought and oxidative stress, respectively; whereas 33%, 7% and 5.5% of the BDGs were also down-regulated by the same abiotic stresses. Coexpression and protein-protein interaction network analyses revealed a dynamic range in the expression levels of genes encoding regulatory proteins. Analysis of gene expression in response to electrophilic oxylipins suggested that these compounds are involved in mediating responses to B. cinerea infection and abiotic stress through TGA transcription factors. Our results suggest an overlap among genes involved in the responses to biotic and abiotic stresses in Arabidopsis. Changes in the transcript levels of genes encoding components of the cyclopentenone signaling pathway in response to biotic and abiotic stresses suggest that the oxylipin signal transduction pathway plays a role in plant defense. Identifying genes that are commonly expressed in response to environmental stresses, and further analyzing the functions of their encoded products, will increase our understanding of the plant stress response. This information could identify targets for genetic
Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan
2015-01-01
Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146
Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.
Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W
2006-02-01
A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.
Genotoxic chemical carcinogens target inducible genes in vivo
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hamilton, J.W.; McCaffrey, J.; Caron, R.M.
1994-12-31
Our laboratory is interested in whether carcinogen-induced DNA damage is distributed nonrandomly in the genome - that is, {open_quotes}targeted{close_quotes} to specific genes or gene regions in vivo. As an indirect measure of whether targeting occurs at the gene level, we have examined whether carcinogens differentially alter the expression of individual genes. We have compared the effects of model genotoxic carcinogens that principally induce either strand breaks, simple alkylations, bulky lesions, or DNA cross-links on the expression of several constitutive and inducible genes in a simple in vivo system, the chick embryo. Each agent was examined for its effects on genemore » expression over a 24 hour period corresponding to the period of maximal DNA damage and repair induced by each compound. The doses used in these studies represented the maximum doses that caused no overt toxicity over a 96 hour period but that induced significant levels of DNA damage. Our results demonstrate that inducible genes are targeted by chemical carcinogens. We hypothesize that such effects may be a result of DNA damage specifically altering DNA-protein interactions within the promoters of inducible genes.« less
Wolter, R; Siede, W; Brendel, M
1996-02-05
The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.
Beach, Tyler A; Johnston, Carl J; Groves, Angela M; Williams, Jacqueline P; Finkelstein, Jacob N
2017-04-01
Purpose/Aim of Study: Studies of pulmonary fibrosis (PF) have resulted in DNA damage, inflammatory response, and cellular senescence being widely hypothesized to play a role in the progression of the disease. Utilizing these aforementioned terms, genomics databases were interrogated along with the term, "pulmonary fibrosis," to identify genes common among all 4 search terms. Findings were compared to data derived from a model of radiation-induced progressive pulmonary fibrosis (RIPF) to verify that these genes are similarly expressed, supporting the use of radiation as a model for diseases involving PF, such as human idiopathic pulmonary fibrosis (IPF). In an established model of RIPF, C57BL/6J mice were exposed to 12.5 Gy thorax irradiation and sacrificed at 24 hours, 1, 4, 12, and 32 weeks following exposure, and lung tissue was compared to age-matched controls by RNA sequencing. Of 176 PF associated gene transcripts identified by database interrogation, 146 (>82%) were present in our experimental model, throughout the progression of RIPF. Analysis revealed that nearly 85% of PF gene transcripts were associated with at least 1 other search term. Furthermore, of 22 genes common to all four terms, 16 were present experimentally in RIPF. This illustrates the validity of RIPF as a model of progressive PF/IPF based on the numbers of transcripts reported in both literature and observed experimentally. Well characterized genes and proteins are implicated in this model, supporting the hypotheses that DNA damage, inflammatory response and cellular senescence are associated with the pathogenesis of PF.
Transposable elements contribute to activation of maize genes in response to abiotic stress.
Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M
2015-01-01
Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
NASA Astrophysics Data System (ADS)
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Requirement for STAT1 in LPS-induced gene expression in macrophages.
Ohmori, Y; Hamilton, T A
2001-04-01
This study examines the role of the signal transducer and activator of transcription 1 (STAT1) in induction of lipopolysaccharide (LPS)-stimulated gene expression both in vitro and in vivo. LPS-induced expression of an interferon (IFN)-inducible 10-kDa protein (IP-10), IFN regulatory factor-1 (IRF-1), and inducible nitric oxide synthase (iNOS) mRNAs was severely impaired in macrophages prepared from Stat1-/- mice, whereas levels of tumor necrosis factor alpha and KC (a C-X-C chemokine) mRNA in LPS-treated cell cultures were unaffected. A similar deficiency in LPS-induced gene expression was observed in livers and spleens from Stat1-/- mice. The reduced LPS-stimulated gene expression seen in Stat1-/- macrophages was not the result of reduced activation of nuclear factor kappaB. LPS stimulated the delayed activation of both IFN-stimulated response element and IFN-gamma-activated sequence binding activity in macrophages from wild-type mice. Activation of these STAT1-containing transcription factors was mediated by the intermediate induction of type I IFNs, since the LPS-induced IP-10, IRF-1, and iNOS mRNA expression was markedly reduced in macrophages from IFN-alpha/betaR-/- mice and blocked by cotreatment with antibodies against type I IFN. These results indicate that indirect activation of STAT1 by LPS-induced type I IFN participates in promoting optimal expression of LPS-inducible genes, and they suggest that STAT1 may play a critical role in innate immunity against gram-negative bacterial infection.
Neonicotinoid insecticides induce salicylate-associated plant defense responses
Ford, Kevin A.; Casida, John E.; Chandran, Divya; Gulevich, Alexander G.; Okrent, Rachel A.; Durkin, Kathleen A.; Sarpong, Richmond; Bunnelle, Eric M.; Wildermuth, Mary C.
2010-01-01
Neonicotinoid insecticides control crop pests based on their action as agonists at the insect nicotinic acetylcholine receptor, which accepts chloropyridinyl- and chlorothiazolyl-analogs almost equally well. In some cases, these compounds have also been reported to enhance plant vigor and (a)biotic stress tolerance, independent of their insecticidal function. However, this mode of action has not been defined. Using Arabidopsis thaliana, we show that the neonicotinoid compounds, imidacloprid (IMI) and clothianidin (CLO), via their 6-chloropyridinyl-3-carboxylic acid and 2-chlorothiazolyl-5-carboxylic acid metabolites, respectively, induce salicylic acid (SA)-associated plant responses. SA is a phytohormone best known for its role in plant defense against pathogens and as an inducer of systemic acquired resistance; however, it can also modulate abiotic stress responses. These neonicotinoids effect a similar global transcriptional response to that of SA, including genes involved in (a)biotic stress response. Furthermore, similar to SA, IMI and CLO induce systemic acquired resistance, resulting in reduced growth of a powdery mildew pathogen. The action of CLO induces the endogenous synthesis of SA via the SA biosynthetic enzyme ICS1, with ICS1 required for CLO-induced accumulation of SA, expression of the SA marker PR1, and fully enhanced resistance to powdery mildew. In contrast, the action of IMI does not induce endogenous synthesis of SA. Instead, IMI is further bioactivated to 6-chloro-2-hydroxypyridinyl-3-carboxylic acid, which is shown here to be a potent inducer of PR1 and inhibitor of SA-sensitive enzymes. Thus, via different mechanisms, these chloropyridinyl- and chlorothiazolyl-neonicotinoids induce SA responses associated with enhanced stress tolerance. PMID:20876120
Lang, Zhaobo; Wang, Yihai; Tang, Kai; Tang, Dengguo; Datsenka, Tatsiana; Cheng, Jingfei; Zhang, Yijing; Handa, Avtar K.
2017-01-01
DNA methylation is a conserved epigenetic mark important for genome integrity, development, and environmental responses in plants and mammals. Active DNA demethylation in plants is initiated by a family of 5-mC DNA glycosylases/lyases (i.e., DNA demethylases). Recent reports suggested a role of active DNA demethylation in fruit ripening in tomato. In this study, we generated loss-of-function mutant alleles of a tomato gene, SlDML2, which is a close homolog of the Arabidopsis DNA demethylase gene ROS1. In the fruits of the tomato mutants, increased DNA methylation was found in thousands of genes. These genes included not only hundreds of ripening-induced genes but also many ripening-repressed genes. Our results show that SlDML2 is critical for tomato fruit ripening and suggest that active DNA demethylation is required for both the activation of ripening-induced genes and the inhibition of ripening-repressed genes. PMID:28507144
Kim, You-Sun; Kokturk, Nurdan; Kim, Ji-Young; Lee, Sei Won; Lim, Jaeyun; Choi, Soo Jin; Oh, Wonil; Oh, Yeon-Mok
2016-10-01
Mesenchymal stem cells (MSCs) effectively reduce airway inflammation and regenerate the alveolus in cigarette- and elastase-induced chronic obstructive pulmonary disease (COPD) animal models. The effects of stem cells are thought to be paracrine and immune-modulatory because very few stem cells remain in the lung one day after their systemic injection, which has been demonstrated previously. In this report, we analyzed the gene expression profiles to compare mouse lungs with chronic exposure to cigarette smoke with non-exposed lungs. Gene expression profiling was also conducted in a mouse lung tissue with chronic exposure to cigarette smoke following the systemic injection of human cord blood-derived mesenchymal stem cells (hCB-MSCs). Globally, 834 genes were differentially expressed after systemic injection of hCB-MSCs. Seven and 21 genes, respectively, were up-and downregulated on days 1, 4, and 14 after HCB-MSC injection. The Hbb and Hba, genes with oxygen transport and antioxidant functions, were increased on days 1 and 14. A serine protease inhibitor was also increased at a similar time point after injection of hCB-MSCs. Gene Ontology analysis indicated that the levels of genes related to immune responses, metabolic processes, and blood vessel development were altered, indicating host responses after hCB-MSC injection. These gene expression changes suggest that MSCs induce a regeneration mechanism against COPD induced by cigarette smoke. These analyses provide basic data for understanding the regeneration mechanisms promoted by hCB-MSCs in cigarette smoke-induced COPD.
Mechanisms of radiation-induced gene responses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woloschak, G.E.; Paunesku, T.
1996-10-01
In the process of identifying genes differentially expressed in cells exposed ultraviolet radiation, we have identified a transcript having a 26-bp region that is highly conserved in a variety of species including Bacillus circulans, yeast, pumpkin, Drosophila, mouse, and man. When the 5` region (flanking region or UTR) of a gene, the sequence is predominantly in +/+ orientation with respect to the coding DNA strand; while in the coding region and the 3` region (UTR), the sequence is most frequently in the +/-orientation with respect to the coding DNA strand. In two genes, the element is split into two parts;more » however, in most cases, it is found only once but with a minimum of 11 consecutive nucleotides precisely depicting the original sequence. The element is found in a large number of different genes with diverse functions (from human ras p21 to B. circulans chitonase). Gel shift assays demonstrated the presence of a protein in HeLa cell extracts that binds to the sense and antisense single-stranded consensus oligomers, as well as to the double- stranded oligonucleotide. When double-stranded oligomer was used, the size shift demonstrated as additional protein-oligomer complex larger than the one bound to either sense or antisense single-stranded consensus oligomers alone. It is speculated either that this element binds to protein(s) important in maintaining DNA is a single-stranded orientation for transcription or, alternatively that this element is important in the transcription-coupled DNA repair process.« less
[Regulation of heat shock gene expression in response to stress].
Garbuz, D G
2017-01-01
Heat shock (HS) genes, or stress genes, code for a number of proteins that collectively form the most ancient and universal stress defense system. The system determines the cell capability of adaptation to various adverse factors and performs a variety of auxiliary functions in normal physiological conditions. Common stress factors, such as higher temperatures, hypoxia, heavy metals, and others, suppress transcription and translation for the majority of genes, while HS genes are upregulated. Transcription of HS genes is controlled by transcription factors of the HS factor (HSF) family. Certain HSFs are activated on exposure to higher temperatures or other adverse factors to ensure stress-induced HS gene expression, while other HSFs are specifically activated at particular developmental stages. The regulation of the main mammalian stress-inducible factor HSF1 and Drosophila melanogaster HSF includes many components, such as a variety of early warning signals indicative of abnormal cell activity (e.g., increases in intracellular ceramide, cytosolic calcium ions, or partly denatured proteins); protein kinases, which phosphorylate HSFs at various Ser residues; acetyltransferases; and regulatory proteins, such as SUMO and HSBP1. Transcription factors other than HSFs are also involved in activating HS gene transcription; the set includes D. melanogaster GAF, mammalian Sp1 and NF-Y, and other factors. Transcription of several stress genes coding for molecular chaperones of the glucose-regulated protein (GRP) family is predominantly regulated by another stress-detecting system, which is known as the unfolded protein response (UPR) system and is activated in response to massive protein misfolding in the endoplasmic reticulum and mitochondrial matrix. A translational fine tuning of HS protein expression occurs via changing the phosphorylation status of several proteins involved in translation initiation. In addition, specific signal sequences in the 5'-UTRs of some HS
Antoniv, Taras T; Ivashkiv, Lionel B
2011-01-01
Interleukin-10 (IL-10) is an immunosuppressive cytokine that inhibits inflammatory gene expression. Phosphatidylinositol 3-kinase (PI3K) -mediated signalling regulates inflammatory responses and can induce IL-10 production, but a role for PI3K signalling in cellular responses to IL-10 is not known. In this study we investigated the involvement of the PI3K-Akt-GSK3 signalling pathway in IL-10-induced gene expression and IL-10-mediated suppression of Toll-like receptor-induced gene expression in primary human macrophages. A combination of loss and gain of function approaches using kinase inhibitors, expression of constitutively active Akt, and RNA interference in primary human macrophages showed that expression of a subset of IL-10-inducible genes was dependent on PI3K-Akt signalling. The effects of PI3K-Akt signalling on IL-10 responses were mediated at least in part by glycogen synthase kinase 3 (GSK3). In accordance with a functional role for PI3K pathways in contributing to the suppressive actions of IL-10, PI3K signalling augmented IL-10-mediated inhibition of lipopolysaccharide-induced IL-1, IL-8 and cyclo-oxygenase-2 expression. The PI3K signalling selectively modulated IL-10 responses, as it was not required for inhibition of tumour necrosis factor expression or for induction of certain IL-10-inducible genes such as SOCS3. These findings identify a new mechanism by which PI3K-mediated signalling can suppress inflammation by regulating IL-10-mediated gene induction and anti-inflammatory function. PMID:21255011
Ritter, Birgit; Kilian, Petra; Reboll, Marc Rene; Resch, Klaus; DiStefano, Johanna Kay; Frank, Ronald; Beil, Winfried; Nourbakhsh, Mahtab
2011-02-01
Interleukin-8 (IL-8) plays a central role in the pathogenesis of Helicobacter pylori infection. We used four different H. pylori strains isolated from patients with gastritis or duodenal ulcer disease to examine their differential effects on signaling pathways and IL-8 gene response in gastric epithelial cells. IL-8 mRNA level is elevated in response to high (100) multiplicity of infection (MOI) independent of cagA, vacA, and dupA gene characteristics. By lower MOIs (1 or 10), only cagA ( + ) strains significantly induce IL-8 gene expression. This is based on differential regulation of IL-8 promoter activity. Analysis of intracellular signaling pathways indicates that H. pylori clinical isolates induce IL-8 gene transcription through NF-κB p65, but by a MOI-dependent differential activation of MAPK pathways. Thus, the major virulence factors of H. pylori CagA, VacA, and DupA might play a minor role in the level of IL-8 gene response to a high bacterial load.
Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei
2013-04-01
Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p < 0.05) following the immunization and after challenging with Leishmania major. Interleukin 4 values were decreased in all immunized groups, but only in DNA vaccine cocktail and single-gene vaccination with pc-LACK there were statistical differences with control groups (p > 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.
Tanaka, Tomoharu; Wakamatsu, Takuhiko; Daijo, Hiroki; Oda, Seiko; Kai, Shinichi; Adachi, Takehiko; Kizaka-Kondoh, Shinae; Fukuda, Kazuhiko; Hirota, Kiichi
2010-03-01
The transcription factor hypoxia-inducible factor-1 (HIF-1) plays an essential role in regulating gene expression in response to hypoxia-ischemia. Ischemia causes the tissue not only to be hypoxic but also to be hypothermic because of the hypoperfusion under certain circumstances. On the other hand, the induced hypothermia is one of the most common therapeutic modalities to extend tolerance to hypoxia. Although hypoxia elicits a variety of cellular and systemic responses at different organizational levels in the body, little is known about how hypoxia-induced responses are affected by low temperature. We examined the influence of mild hypothermic conditions (28-32 degrees C) on HIF-1 in both in vitro and in vivo settings. In vitro experiments adopting cultured cells elucidated that hypoxia-induced HIF-1 activation was resistant to 4-h exposure to the low temperature. In contrast, exposure to the low temperature as long as 24 h suppressed HIF-1 activation and the subsequent upregulation of HIF-1 target genes such as VEGF or GLUT-1. HIF-1alpha protein stability in the cell was not affected by hypothermic treatment. Furthermore, intracellular ATP content was reduced under 1% O(2) conditions but was not largely affected by hypothermic treatment. The evidence indicates that reduction of oxygen consumption is not largely involved in suppression of HIF-1. In addition, we demonstrated that HIF-1 DNA-binding activity and HIF-1-dependent gene expressions induced under 10% O(2) atmosphere in mouse brain were not influenced by treatment under 3-h hypothermic temperature but were inhibited under 5-h treatment. On the other hand, we indicated that warming ischemic legs of mice for 24 h preserved HIF-1 activity. In this report we describe for the first time that persisting low temperature significantly reduced HIF-1alpha neosynthesis under hypoxic conditions, leading to a decrease in gene expression for adaptation to hypoxia in both in vitro and in vivo settings.
Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming
2017-03-01
Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.
SGK is a primary glucocorticoid-induced gene in the human.
Náray-Fejes-Tóth, A; Fejes-Tóth, G; Volk, K A; Stokes, J B
2000-12-01
Serum- and glucocorticoid-induced kinase (sgk) is transcriptionally regulated by corticosteroids in several cell types. Recent findings suggest that sgk is an important gene in the early action of corticosteroids on epithelial sodium reabsorption. Surprisingly, the human sgk was reported not to be transcriptionally regulated by corticosteroids in a hepatoma cell line, and thus far no glucocorticoid response element has been identified in the human SGK gene. Since humans clearly respond to both aldosterone and glucocorticoids in cells where sgk action seems to be important, in this study we determined sgk mRNA levels following dexamethasone treatment for various duration in five human cell lines. These cell lines included epithelial cells (H441, T84 and HT29) and lymphoid/monocyte (U937 and THP-1) lines. Using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we found that sgk mRNA levels are markedly induced by glucocorticoids in all of the five cell lines studied. Time course analyses revealed that sgk mRNA levels are elevated as early as 30 min after addition of the glucocorticoid, and remain elevated for several hours. Northern analysis in H441 cells confirmed that sgk is an early induced gene. The induction of sgk by dexamethasone was unaffected by cycloheximide, indicating that it does not require de novo protein synthesis. These results indicate that the human sgk, just like its counterparts in other species, is a primary glucocorticoid-induced gene.
Javan, Bita; Shahbazi, Majid
2017-01-01
Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809
Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather
2014-01-01
The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.
Transduction of a Foreign Histocompatibility Gene into the Arterial Wall Induces Vasculitis
NASA Astrophysics Data System (ADS)
Nabel, Elizabeth G.; Plautz, Gregory; Nabel, Gary J.
1992-06-01
Autoimmune vasculitis represents a disease characterized by focal inflammation within arteries at multiple sites in the vasculature. Therapeutic interventions in this disease are empirical and often unsuccessful, and the mechanisms of immune injury are not well-defined. The direct transfer of recombinant genes and their expression in the arterial wall provides an opportunity to explore the pathogenesis and treatment of vascular disease. In this report, an animal model for vasculitis has been developed. Inflammation has been elicited by direct gene transfer of a foreign class I major histocompatibility complex gene, HLA-B7, to specific sites in porcine arteries. Transfer and expression of this recombinant gene was confirmed by a polymerase chain reaction and immunohistochemistry, and cytolytic T cells specific for HLA-B7 were detected. These findings demonstrate that expression of a recombinant gene in the vessel wall can induce a focal immune response and suggest that vessel damage induced by cell-mediated immune injury can initiate vasculitis.
2014-01-01
Background Anthropogenic activities cause metal pollution worldwide. Plants can absorb and accumulate these metals through their root system, inducing stress as a result of excess metal concentrations inside the plant. Ethylene is a regulator of multiple plant processes, and is affected by many biotic and abiotic stresses. Increased ethylene levels have been observed after exposure to excess metals but it remains unclear how the increased ethylene levels are achieved at the molecular level. In this study, the effects of cadmium (Cd) exposure on the production of ethylene and its precursor 1-aminocyclopropane-1-carboxylic acid (ACC), and on the expression of the ACC Synthase (ACS) and ACC Oxidase (ACO) multigene families were investigated in Arabidopsis thaliana. Results Increased ethylene release after Cd exposure was directly measurable in a system using rockwool-cultivated plants; enhanced levels of the ethylene precursor ACC together with higher mRNA levels of ethylene responsive genes: ACO2, ETR2 and ERF1 also indicated increased ethylene production in hydroponic culture. Regarding underlying mechanisms, it was found that the transcript levels of ACO2 and ACO4, the most abundantly expressed members of the ACO multigene family, were increased upon Cd exposure. ACC synthesis is the rate-limiting step in ethylene biosynthesis, and transcript levels of both ACS2 and ACS6 showed the highest increase and became the most abundant isoforms after Cd exposure, suggesting their importance in the Cd-induced increase of ethylene production. Conclusions Cadmium induced the biosynthesis of ACC and ethylene in Arabidopsis thaliana plants mainly via the increased expression of ACS2 and ACS6. This was confirmed in the acs2-1acs6-1 double knockout mutants, which showed a decreased ethylene production, positively affecting leaf biomass and resulting in a delayed induction of ethylene responsive gene expressions without significant differences in Cd contents between wild-type and
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu
Phosphoramide mustard (PM) is an ovotoxic metabolite of cyclophosphamide and destroys primordial and primary follicles potentially by DNA damage induction. The temporal pattern by which PM induces DNA damage and initiation of the ovarian response to DNA damage has not yet been well characterized. This study investigated DNA damage initiation, the DNA repair response, as well as induction of follicular demise using a neonatal rat ovarian culture system. Additionally, to delineate specific mechanisms involved in the ovarian response to PM exposure, utility was made of PKC delta (PKCδ) deficient mice as well as an ATM inhibitor (KU 55933; AI). Fishermore » 344 PND4 rat ovaries were cultured for 12, 24, 48 or 96 h in medium containing DMSO ± 60 μM PM or KU 55933 (48 h; 10 nM). PM-induced activation of DNA damage repair genes was observed as early as 12 h post-exposure. ATM, PARP1, E2F7, P73 and CASP3 abundance were increased but RAD51 and BCL2 protein decreased after 96 h of PM exposure. PKCδ deficiency reduced numbers of all follicular stages, but did not have an additive impact on PM-induced ovotoxicity. ATM inhibition protected all follicle stages from PM-induced depletion. In conclusion, the ovarian DNA damage repair response is active post-PM exposure, supporting that DNA damage contributes to PM-induced ovotoxicity. - Highlights: • PM exposure induces DNA damage repair gene expression. • Inhibition of ATM prevented PM-induced follicle depletion. • PKCδ deficiency did not impact PM-induced ovotoxicity.« less
A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.
Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna
2008-03-01
Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.
Denson, Thomas F; Dobson-Stone, Carol; Ronay, Richard; von Hippel, William; Schira, Mark M
2014-07-01
Aggressiveness is highly heritable. Recent experimental work has linked individual differences in a functional polymorphism of the monoamine oxidase-A gene (MAOA) to anger-driven aggression. Other work has implicated the dorsal ACC (dACC) in cognitive-emotional control and the amygdala in emotional arousal. The present imaging genetics study investigated dACC and amygdala reactivity to induced anger control as a function of MAOA genotype. A research assistant asked 38 healthy male undergraduates to control their anger in response to an insult by a rude experimenter. Men with the low-expression allele showed increased dACC and amygdala activation after the insult, but men with the high-expression allele did not. Both dACC and amygdala activation independently mediated the relationship between MAOA genotype and self-reported anger control. Moreover, following the insult, men with the high-functioning allele showed functional decoupling between the amygdala and dACC, but men with the low-functioning allele did not. These results suggest that heightened dACC and amygdala activation and their connectivity are neuroaffective mechanisms underlying anger control in participants with the low-functioning allele of the MAOA gene.
Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon
1992-01-01
New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub
Sun, Hui Bin; Zhu, Yuan Xiao; Yin, Tinggui; Sledge, George; Yang, Yu-Chung
1998-01-01
Identification of cytokine-inducible genes is imperative for determining the mechanisms of cytokine action. A cytokine-inducible gene, mrg1 [melanocyte-specific gene (msg1) related gene], was identified through mRNA differential display of interleukin (IL) 9-stimulated and unstimulated mouse helper T cells. In addition to IL-9, mrg1 can be induced by other cytokines and biological stimuli, including IL-1α, -2, -4, -6, and -11, granulocyte/macrophage colony-stimulating factor, interferon γ, platelet-derived growth factor, insulin, serum, and lipopolysaccharide in diverse cell types. The induction of mrg1 by these stimuli appears to be transient, with induction kinetics similar to other primary response genes, implicating its role in diverse biological processes. Deletion or point mutations of either the Box1 motif (binds Janus kinase 1) or the signal transducer and activator of transcription 3 binding site-containing region within the intracellular domain of the IL-9 receptor ligand binding subunit abolished or greatly reduced mrg1 induction by IL-9, suggesting that the Janus kinase/signal transducer and activator of transcription signaling pathway is required for mrg1 induction, at least in response to IL-9. Transfection of mrg1 cDNA into TS1, an IL-9-dependent mouse T cell line, converted these cells to IL-9-independent growth through a nonautocrine mechanism. Overexpression of mrg1 in Rat1 cells resulted in loss of cell contact inhibition, anchorage-independent growth in soft agar, and tumor formation in nude mice, demonstrating that mrg1 is a transforming gene. MRG1 is a transcriptional activator and may represent a founding member of an additional family of transcription factors. PMID:9811838
Co-acting gene networks predict TRAIL responsiveness of tumour cells with high accuracy.
O'Reilly, Paul; Ortutay, Csaba; Gernon, Grainne; O'Connell, Enda; Seoighe, Cathal; Boyce, Susan; Serrano, Luis; Szegezdi, Eva
2014-12-19
Identification of differentially expressed genes from transcriptomic studies is one of the most common mechanisms to identify tumor biomarkers. This approach however is not well suited to identify interaction between genes whose protein products potentially influence each other, which limits its power to identify molecular wiring of tumour cells dictating response to a drug. Due to the fact that signal transduction pathways are not linear and highly interlinked, the biological response they drive may be better described by the relative amount of their components and their functional relationships than by their individual, absolute expression. Gene expression microarray data for 109 tumor cell lines with known sensitivity to the death ligand cytokine tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) was used to identify genes with potential functional relationships determining responsiveness to TRAIL-induced apoptosis. The machine learning technique Random Forest in the statistical environment "R" with backward elimination was used to identify the key predictors of TRAIL sensitivity and differentially expressed genes were identified using the software GeneSpring. Gene co-regulation and statistical interaction was assessed with q-order partial correlation analysis and non-rejection rate. Biological (functional) interactions amongst the co-acting genes were studied with Ingenuity network analysis. Prediction accuracy was assessed by calculating the area under the receiver operator curve using an independent dataset. We show that the gene panel identified could predict TRAIL-sensitivity with a very high degree of sensitivity and specificity (AUC=0·84). The genes in the panel are co-regulated and at least 40% of them functionally interact in signal transduction pathways that regulate cell death and cell survival, cellular differentiation and morphogenesis. Importantly, only 12% of the TRAIL-predictor genes were differentially expressed highlighting the
Cutin monomer induces expression of the rice OsLTP5 lipid transfer protein gene.
Kim, Tae Hyun; Park, Jong Ho; Kim, Moon Chul; Cho, Sung Ho
2008-01-01
Treatment with the cutin monomer 16-hydroxypalmitic acid (HPA), a major component of cutin, elicited the synthesis of hydrogen peroxide (H2O2) in rice leaves and induced the expression of the lipid transfer protein gene OsLTP5. Treatment with HPA also induced expression of OsLTP1, OsLTP2, and the pathogen-related PR-10 genes to a lesser extent. The OsLTP5 transcript was expressed prominently in stems and flowers, but was barely detectable in leaves. Expression of OsLTP5 was induced in shoots in response to ABA and salicylic acid. It is proposed that HPA is perceived by rice as a signal, inducing defense reactions.
Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K
2016-07-01
Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.
Kidokoro, Satoshi; Watanabe, Keitaro; Ohori, Teppei; Moriwaki, Takashi; Maruyama, Kyonoshin; Mizoi, Junya; Myint Phyu Sin Htwe, Nang; Fujita, Yasunari; Sekita, Sachiko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2015-02-01
Soybean (Glycine max) is a globally important crop, and its growth and yield are severely reduced by abiotic stresses, such as drought, heat, and cold. The cis-acting element DRE (dehydration-responsive element)/CRT plays an important role in activating gene expression in response to these stresses. The Arabidopsis DREB1/CBF genes that encode DRE-binding proteins function as transcriptional activators in the cold stress responsive gene expression. In this study, we identified 14 DREB1-type transcription factors (GmDREB1s) from a soybean genome database. The expression of most GmDREB1 genes in soybean was strongly induced by a variety of abiotic stresses, such as cold, drought, high salt, and heat. The GmDREB1 proteins activated transcription via DREs (dehydration-responsive element) in Arabidopsis and soybean protoplasts. Transcriptome analyses using transgenic Arabidopsis plants overexpressing GmDREB1s indicated that many of the downstream genes are cold-inducible and overlap with those of Arabidopsis DREB1A. We then comprehensively analyzed the downstream genes of GmDREB1B;1, which is closely related to DREB1A, using a transient expression system in soybean protoplasts. The expression of numerous genes induced by various abiotic stresses were increased by overexpressing GmDREB1B;1 in soybean, and DREs were the most conserved element in the promoters of these genes. The downstream genes of GmDREB1B;1 included numerous soybean-specific stress-inducible genes that encode an ABA receptor family protein, GmPYL21, and translation-related genes, such as ribosomal proteins. We confirmed that GmDREB1B;1 directly activates GmPYL21 expression and enhances ABRE-mediated gene expression in an ABA-independent manner. These results suggest that GmDREB1 proteins activate the expression of numerous soybean-specific stress-responsive genes under diverse abiotic stress conditions. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Zeng, Zhu; Zuo, Fanglei; Yu, Rui; Zhang, Bo; Ma, Huiqin; Chen, Shangwu
2017-09-01
A novel lactose-responsive promoter of the ATP-binding cassette (ABC) transporter gene Lba1680 of Lactobacillus acidophilus strain 05-172 isolated from a traditionally fermented dairy product koumiss was characterized. In L. acidophilus 05-172, expression of Lba1680 was induced by lactose, with lactose-induced transcription of Lba1680 being 6.1-fold higher than that induced by glucose. This is in contrast to L. acidophilus NCFM, a strain isolated from human feces, in which expression of Lba1680 and Lba1679 is induced by glucose. Both gene expression and enzyme activity assays in L. paracasei transformed with a vector containing the inducible Lba1680 promoter (PLba1680) of strain 05-172 and a heme-dependent catalase gene as reporter confirmed that PLba1680 is specifically induced by lactose. Its regulatory expression could not be repressed by glucose, and was independent of cAMP receptor protein. This lactose-responsive promoter might be used in the expression of functional genes in L. paracasei incorporated into a lactose-rich environment, such as dairy products. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Dong, Xiangshu; Yi, Hankuil; Lee, Jeongyeo; Nou, Ill-Sup; Han, Ching-Tack; Hur, Yoonkang
2015-01-01
Genome-wide dissection of the heat stress response (HSR) is necessary to overcome problems in crop production caused by global warming. To identify HSR genes, we profiled gene expression in two Chinese cabbage inbred lines with different thermotolerances, Chiifu and Kenshin. Many genes exhibited >2-fold changes in expression upon exposure to 0.5– 4 h at 45°C (high temperature, HT): 5.2% (2,142 genes) in Chiifu and 3.7% (1,535 genes) in Kenshin. The most enriched GO (Gene Ontology) items included ‘response to heat’, ‘response to reactive oxygen species (ROS)’, ‘response to temperature stimulus’, ‘response to abiotic stimulus’, and ‘MAPKKK cascade’. In both lines, the genes most highly induced by HT encoded small heat shock proteins (Hsps) and heat shock factor (Hsf)-like proteins such as HsfB2A (Bra029292), whereas high-molecular weight Hsps were constitutively expressed. Other upstream HSR components were also up-regulated: ROS-scavenging genes like glutathione peroxidase 2 (BrGPX2, Bra022853), protein kinases, and phosphatases. Among heat stress (HS) marker genes in Arabidopsis, only exportin 1A (XPO1A) (Bra008580, Bra006382) can be applied to B. rapa for basal thermotolerance (BT) and short-term acquired thermotolerance (SAT) gene. CYP707A3 (Bra025083, Bra021965), which is involved in the dehydration response in Arabidopsis, was associated with membrane leakage in both lines following HS. Although many transcription factors (TF) genes, including DREB2A (Bra005852), were involved in HS tolerance in both lines, Bra024224 (MYB41) and Bra021735 (a bZIP/AIR1 [Anthocyanin-Impaired-Response-1]) were specific to Kenshin. Several candidate TFs involved in thermotolerance were confirmed as HSR genes by real-time PCR, and these assignments were further supported by promoter analysis. Although some of our findings are similar to those obtained using other plant species, clear differences in Brassica rapa reveal a distinct HSR in this species. Our data
Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon
2013-04-01
To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.
Baharoglu, Zeynep; Babosan, Anamaria; Mazel, Didier
2014-01-01
Sub-inhibitory concentrations (sub-MIC) of antibiotics play a very important role in selection and development of resistances. Unlike Escherichia coli, Vibrio cholerae induces its SOS response in presence of sub-MIC aminoglycosides. A role for oxidized guanine residues was observed, but the mechanisms of this induction remained unclear. To select for V. cholerae mutants that do not induce low aminoglycoside-mediated SOS induction, we developed a genetic screen that renders induction of SOS lethal. We identified genes involved in this pathway using two strategies, inactivation by transposition and gene overexpression. Interestingly, we obtained mutants inactivated for the expression of proteins known to destabilize the RNA polymerase complex. Reconstruction of the corresponding mutants confirmed their specific involvement in induction of SOS by low aminoglycoside concentrations. We propose that DNA lesions formed on aminoglycoside treatment are repaired through the formation of single-stranded DNA intermediates, inducing SOS. Inactivation of functions that dislodge RNA polymerase leads to prolonged stalling on these lesions, which hampers SOS induction and repair and reduces viability under antibiotic stress. The importance of these mechanisms is illustrated by a reduction of aminoglycoside sub-MIC. Our results point to a central role for transcription blocking at DNA lesions in SOS induction, so far underestimated. PMID:24319148
Baharoglu, Zeynep; Babosan, Anamaria; Mazel, Didier
2014-02-01
Sub-inhibitory concentrations (sub-MIC) of antibiotics play a very important role in selection and development of resistances. Unlike Escherichia coli, Vibrio cholerae induces its SOS response in presence of sub-MIC aminoglycosides. A role for oxidized guanine residues was observed, but the mechanisms of this induction remained unclear. To select for V. cholerae mutants that do not induce low aminoglycoside-mediated SOS induction, we developed a genetic screen that renders induction of SOS lethal. We identified genes involved in this pathway using two strategies, inactivation by transposition and gene overexpression. Interestingly, we obtained mutants inactivated for the expression of proteins known to destabilize the RNA polymerase complex. Reconstruction of the corresponding mutants confirmed their specific involvement in induction of SOS by low aminoglycoside concentrations. We propose that DNA lesions formed on aminoglycoside treatment are repaired through the formation of single-stranded DNA intermediates, inducing SOS. Inactivation of functions that dislodge RNA polymerase leads to prolonged stalling on these lesions, which hampers SOS induction and repair and reduces viability under antibiotic stress. The importance of these mechanisms is illustrated by a reduction of aminoglycoside sub-MIC. Our results point to a central role for transcription blocking at DNA lesions in SOS induction, so far underestimated.
Insulin Response Genes in Different Stages of Periodontal Disease
Yu, N.; Barros, S.P.; Zhang, S.; Moss, K.L.; Phillips, S.T.; Offenbacher, S.
2015-01-01
Bacterial infections are known to alter glucose metabolism within tissues via mechanisms of inflammation. We conducted this study to examine whether insulin response genes are differentially expressed in gingival tissues, comparing samples from experimental gingivitis and periodontitis subjects to those from healthy individuals. Total RNA was extracted from gingival biopsies from 26 participants: 8 periodontally healthy, 9 experimental gingivitis, and 9 periodontitis subjects. Gene expression patterns were evaluated with a polymerase chain reaction array panel to examine 84 candidate genes involved with glucose metabolism, insulin resistance, and obesity. Array data were evaluated with a t test adjusted by the false discover rate (P < 0.05), and ingenuity pathway analysis was performed for statistical testing of pathways. Although tissue samples were not sufficient to enable protein quantification, we confirmed the upregulation of the key gene using lipopolysaccharide-stimulated primary gingival epithelial cells by Western blot. The mRNA expression patterns of genes that are associated with insulin response and glucose metabolism are markedly different in experimental gingivitis subjects compared with healthy controls. Thirty-two genes are upregulated significantly by at least 2-fold, adjusted for false discover rate (P < 0.05). Periodontitis subjects show similar but attenuated changes in gene expression patterns, and no genes meet the significance criteria. Ingenuity pathway analysis demonstrates significant activation of the carbohydrate metabolism network in experimental gingivitis but not in periodontitis. G6PD protein increases in response to lipopolysaccharide stimulation in primary gingival epithelial cells, which is in the same direction as upregulated mRNA in tissues. Acute gingival inflammation may be associated with tissue metabolism changes, but these changes are not evident in chronic periodontitis. This study suggests that acute gingival inflammation
Chandra, Saket; Singh, Dharmendra; Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal
2016-01-01
Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants.
Pathak, Jyoti; Kumari, Supriya; Kumar, Manish; Poddar, Raju; Balyan, Harindra Singh; Gupta, Puspendra Kumar; Prabhu, Kumble Vinod; Mukhopadhyay, Kunal
2016-01-01
Pathogens like Puccinia triticina, the causal organism for leaf rust, extensively damages wheat production. The interaction at molecular level between wheat and the pathogen is complex and less explored. The pathogen induced response was characterized using mock- or pathogen inoculated near-isogenic wheat lines (with or without seedling leaf rust resistance gene Lr28). Four Serial Analysis of Gene Expression libraries were prepared from mock- and pathogen inoculated plants and were subjected to Sequencing by Oligonucleotide Ligation and Detection, which generated a total of 165,767,777 reads, each 35 bases long. The reads were processed and multiple k-mers were attempted for de novo transcript assembly; 22 k-mers showed the best results. Altogether 21,345 contigs were generated and functionally characterized by gene ontology annotation, mining for transcription factors and resistance genes. Expression analysis among the four libraries showed extensive alterations in the transcriptome in response to pathogen infection, reflecting reorganizations in major biological processes and metabolic pathways. Role of auxin in determining pathogenesis in susceptible and resistant lines were imperative. The qPCR expression study of four LRR-RLK (Leucine-rich repeat receptor-like protein kinases) genes showed higher expression at 24 hrs after inoculation with pathogen. In summary, the conceptual model of induced resistance in wheat contributes insights on defense responses and imparts knowledge of Puccinia triticina-induced defense transcripts in wheat plants. PMID:26840746
2011-01-01
Background Insulin-like growth factor-I (IGF-I) exerts neuroprotective actions in the central nervous system that are mediated at least in part by control of activation of astrocytes. In this study we have assessed the efficacy of exogenous IGF-I and IGF-I gene therapy in reducing the inflammatory response of astrocytes from cerebral cortex. Methods An adenoviral vector harboring the rat IGF-I gene and a control adenoviral vector harboring a hybrid gene encoding the herpes simplex virus type 1 thymidine kinase fused to Aequorea victoria enhanced green fluorescent protein were used in this study. Primary astrocytes from mice cerebral cortex were incubated for 24 h or 72 h with vehicle, IGF-I, the IGF-I adenoviral vector, or control vector; and exposed to bacterial lipopolysaccharide to induce an inflammatory response. IGF-I levels were measured by radioimmunoassay. Levels of interleukin 6, tumor necrosis factor-α, interleukin-1β and toll-like receptor 4 mRNA were assessed by quantitative real-time polymerase chain reaction. Levels of IGF-I receptor and IGF binding proteins 2 and 3 were assessed by western blotting. The subcellular distribution of nuclear factor κB (p65) was assessed by immunocytochemistry. Statistical significance was assessed by one way analysis of variance followed by the Bonferroni pot hoc test. Results IGF-I gene therapy increased IGF-I levels without affecting IGF-I receptors or IGF binding proteins. Exogenous IGF-I, and IGF-I gene therapy, decreased expression of toll-like receptor 4 and counteracted the lipopolysaccharide-induced inflammatory response of astrocytes. In addition, IGF-I gene therapy decreased lipopolysaccharide-induced translocation of nuclear factor κB (p65) to the cell nucleus. Conclusion These findings demonstrate efficacy of exogenous IGF-I and of IGF-I gene therapy in reducing the inflammatory response of astrocytes. IGF-I gene therapy may represent a new approach to reduce inflammatory reactions in glial cells. PMID
Chen, Hua; Zhang, Chong; Cai, Tie Cheng; Deng, Ye; Zhou, Shuangbiao; Zheng, Yixiong; Ma, Shiwei; Tang, Ronghua; Varshney, Rajeev K; Zhuang, Weijian
2016-02-01
Calcium is a universal signal in the regulation of wide aspects in biology, but few are known about the function of calcium in the control of early embryo development. Ca(2+) deficiency in soil induces early embryo abortion in peanut, producing empty pods, which is a general problem; however, the underlying mechanism remains unclear. In this study, embryo abortion was characterized to be caused by apoptosis marked with cell wall degradation. Using a method of SSH cDNA libraries associated with library lift (SSHaLL), 62 differentially expressed genes were isolated from young peanut embryos. These genes were classified to be stress responses, catabolic process, carbohydrate and lipid metabolism, embryo morphogenesis, regulation, etc. The cell retardation with cell wall degradation was caused by up-regulated cell wall hydrolases and down-regulated cellular synthases genes. HsfA4a, which was characterized to be important to embryo development, was significantly down-regulated under Ca(2+) -deficient conditions from 15 days after pegging (DAP) to 30 DAP. Two AhCYP707A4 genes, encoding abscisic acid (ABA) 8'-hydroxylases, key enzymes for ABA catabolism, were up-regulated by 21-fold under Ca(2+) -deficient conditions upstream of HsfA4a, reducing the ABA level in early embryos. Over-expression of AhCYP707A4 in Nicotiana benthamiana showed a phenotype of low ABA content with high numbers of aborted embryos, small pods and less seeds, which confirms that AhCYP707A4 is a key player in regulation of Ca(2+) deficiency-induced embryo abortion via ABA-mediated apoptosis. The results elucidated the mechanism of low Ca(2+) -induced embryo abortion and described the method for other fields of study. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Behnam, Babak; Iuchi, Satoshi; Fujita, Miki; Fujita, Yasunari; Takasaki, Hironori; Osakabe, Yuriko; Yamaguchi-Shinozaki, Kazuko; Kobayashi, Masatomo; Shinozaki, Kazuo
2013-01-01
Plants respond to dehydration stress and tolerate water-deficit status through complex physiological and cellular processes. Many genes are induced by water deficit. Abscisic acid (ABA) plays important roles in tolerance to dehydration stress by inducing many stress genes. ABA is synthesized de novo in response to dehydration. Most of the genes involved in ABA biosynthesis have been identified, and they are expressed mainly in leaf vascular tissues. Of the products of such genes, 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis. One of the five NCED genes in Arabidopsis, AtNCED3, is significantly induced by dehydration. To understand the regulatory mechanism of the early stages of the dehydration stress response, it is important to analyse the transcriptional regulatory systems of AtNCED3. In the present study, we found that an overlapping G-box recognition sequence (5′-CACGTG-3′) at −2248 bp from the transcriptional start site of AtNCED3 is an important cis-acting element in the induction of the dehydration response. We discuss the possible transcriptional regulatory system of dehydration-responsive AtNCED3 expression, and how this may control the level of ABA under water-deficit conditions. PMID:23604098
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
Photorhabdus luminescens genes induced upon insect infection
Münch, Anna; Stingl, Lavinia; Jung, Kirsten; Heermann, Ralf
2008-01-01
of toxin genes, including tccC1 (encoding an insecticidal toxin complex), and others encoding putative toxins. A comparably high number of metabolic genes or operons were observed to be induced upon infection; among these were eutABC, hutUH, and agaZSVCD, which encode proteins involved in ethanolamine, histidine and tagatose degradation, respectively. The results reflect rearrangements in metabolism and the use of other metabolites available from the insect. Furthermore, enhanced activity of promoters controlling the expression of genes encoding enzymes linked to antibiotic production and/or resistance was observed. Antibiotic production and resistance may influence competition with other bacteria, and thus might be important for a successful infection. Lastly, several genes of unknown function were identified that may represent novel pathogenicity factors. Conclusion We show that a DFI screen is useful for identifying genes or operons induced by chemical stimuli, such as diluted insect homogenate. A bioinformatics comparison of motifs similar to known promoters is a powerful tool for identifying regulated genes or operons. We conclude that signals for the regulation of those genes or operons induced in P. luminescens upon insect infection may represent a wide variety of compounds that make up the insect host. Our results provide insight into the complex response to the host that occurs in a bacterial pathogen, particularly reflecting the potential for metabolic shifts and other specific changes associated with virulence. PMID:18489737
NASA Technical Reports Server (NTRS)
Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Hammond, Dianne; Mehta, Satish K.; Jeevarajan, Antony S.; Pierson, Duane L.; Wu, Honglu
2009-01-01
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in double-strand break (DSB) repair, and its impact on cytogenetic responses has not been well studied. The purpose of this study is to identify new roles of IR inducible genes in radiation-induced chromosome aberrations and micronuclei formation. In the study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by small interfering RNA in human fibroblast cells. Frequencies of micronuclei (MN) formation and chromosome aberrations were measured to determine the efficiency of cytogenetic repair, and the fraction of bi-nucleated cells in the MN analysis was used as a marker for cell cycle progression. In response to gamma radiation, the formation of MN was significantly increased by suppressed expression of five genes: Ku70 (DSB repair pathway), XPA (nucleotide excision repair pathway), RPA1 (mismatch repair pathway), RAD17 and RBBP8 (cell cycle control). Knocked-down expression of four genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Moreover, decreased XPA, p21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Nine of these eleven genes, whose knock-down expression affected cytogenetic repair, were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate IR-induced
Purcell, Maureen K.; Kurath, Gael; Garver, Kyle A.; Herwig, Russell P.; Winton, James R.
2004-01-01
Infectious haematopoietic necrosis virus (IHNV) is a well-studied virus of salmonid fishes. A highly efficacious DNA vaccine has been developed against this virus and studies have demonstrated that this vaccine induces both an early and transient non-specific anti-viral phase as well as long-term specific protection. The mechanisms of the early anti-viral phase are not known, but previous studies noted changes in Mx gene expression, suggesting a role for type I interferon. This study used quantitative real-time reverse transcriptase PCR methodology to compare expression changes over time of a number of cytokine or cytokine-related genes in the spleen of rainbow trout following injection with poly I:C, live IHNV, the IHNV DNA vaccine or a control plasmid encoding the non-antigenic luciferase gene. The target genes included Mx-1, viral haemorrhagic septicaemia virus induced gene 8 (Vig-8), TNF-α1, TNF-α2, IL-1β1, IL-8, TGF-β1 and Hsp70. Poly I:C stimulation induced several genes but the strongest and significant response was observed in the Mx-1 and Vig-8 genes. The live IHN virus induced a significant response in all genes examined except TGF-β1. The control plasmid construct and the IHNV DNA vaccine marginally induced a number of genes, but the main difference between these two groups was a statistically significant induction of the Mx-1 and Vig-8 genes by the IHNV vaccine only. The gene expression profiles elicited by the live virus and the IHNV DNA vaccine differed in a number of aspects but this study confirms the clear role for a type I interferon-like response in early anti-viral defence.
Oh, Justin D.; Geller, Alfred I.; Zhang, Guo-rong; Chase, Thomas N.
2006-01-01
Alterations in motor response that complicate levodopa treatment of Parkinson’s disease appear to involve sensitization of striatal ionotropic glutamate receptors. Since protein kinase C (PKC)-mediated phosphorylation regulates glutamatergic receptors of the α-amino-3-hydroxyl-5-methyl-4-isoxazole propionic acid (AMPA) subtype and has been linked to several forms of behavioral plasticity, activation of PKC signaling in striatal spiny neurons may also contribute to the motor plasticity changes associated with chronic levodopa therapy. To evaluate this possibility, we sought to augment PKC signaling by using Herpes Simplex Virus type 1 vectors (pHSVpkcΔ) to directly transfer the catalytic domain of the PKCβII gene into striatal neurons of parkinsonian rats. Microinjection of pHSVpkcΔ vectors lead to the persistent expression of PkcΔ (35% loss over 21 days) in medium spiny neurons together with an increase in serine 831 phosphorylation on AMPA receptor GluR1 subunits and hastened the appearance of the shortened response duration produced by chronic levodopa treatment (P<0.05). In pHSVpkcΔ-infected animals, intrastriatal injection of the PKC inhibitor NPC-15437 (1.0 μg) attenuated both the increased GluR1 phosphorylation (P<0.01) and the accelerated onset of the levodopa-induced response modifications (P<0.01). However, in rats that received levodopa treatment for 21 days without the gene transfer, intrastriatal NPC-15437 had no effect on the response shortening or on GluR1 S831 phosphorylation. The results suggest that an increase in PKC-mediated signaling, including, in part, phosphorylation of AMPA receptors, on striatal spiny neurons may be sufficient to promote the initial appearance, but not necessary the ultimate expression, of the levodopa-induced motor response changes occurring in a rodent model of the human motor complication syndrome. PMID:12691833
Day, R Bradley; Tanabe, Shigeru; Koshioka, Masaji; Mitsui, Toshiaki; Itoh, Hironori; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto; Kaku, Hanae; Shibuya, Naoto; Minami, Eiichi
2004-01-01
In this study, we present data showing that two members of the GRAS family of genes from rice, CIGR1 and CIGR2 (chitin-inducible gibberellin-responsive), inducible by the potent elicitor N -acetylchitooligosaccharide (GN), are rapidly induced by exogenous gibberellins. The pattern of mRNA accumulation was dependent on the dose and biological activity of the gibberellins, suggesting that the induction of the genes by gibberellin is mediated by a biological receptor capable of specific recognition and signal transduction upon perception of the phytoactive compounds. Further pharmacological analysis revealed that the CIGR1 and CIGR2 mRNA accumulation by treatment with gibberellin is dependent upon protein phosphorylation/dephosphorylation events. In rice calli derived from slender rice 1, a constitutive gibberellin-responsive mutant, or d1, a mutant deficient in the alpha -subunit of the heterotrimeric G-protein, CIGR1 and CIGR2 were induced by a GN elicitor, yet not by gibberellin. Neither gibberellin nor GN showed related activities in defense or development, respectively. These results strongly suggested that the signal transduction cascade from gibberellin is independent of that from GN, and further implied that CIGR1 and CIGR2 have dual, distinct roles in defense and development.
Leptospira interrogans serovar copenhageni harbors two lexA genes involved in SOS response.
Fonseca, Luciane S; da Silva, Josefa B; Milanez, Juliana S; Monteiro-Vitorello, Claudia B; Momo, Leonardo; de Morais, Zenaide M; Vasconcellos, Silvio A; Marques, Marilis V; Ho, Paulo L; da Costa, Renata M A
2013-01-01
Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence.
Leptospira interrogans serovar Copenhageni Harbors Two lexA Genes Involved in SOS Response
Fonseca, Luciane S.; da Silva, Josefa B.; Milanez, Juliana S.; Monteiro-Vitorello, Claudia B.; Momo, Leonardo; de Morais, Zenaide M.; Vasconcellos, Silvio A.; Marques, Marilis V.; Ho, Paulo L.; da Costa, Renata M. A.
2013-01-01
Bacteria activate a regulatory network in response to the challenges imposed by DNA damage to genetic material, known as the SOS response. This system is regulated by the RecA recombinase and by the transcriptional repressor lexA. Leptospira interrogans is a pathogen capable of surviving in the environment for weeks, being exposed to a great variety of stress agents and yet retaining its ability to infect the host. This study aims to investigate the behavior of L. interrogans serovar Copenhageni after the stress induced by DNA damage. We show that L. interrogans serovar Copenhageni genome contains two genes encoding putative LexA proteins (lexA1 and lexA2) one of them being potentially acquired by lateral gene transfer. Both genes are induced after DNA damage, but the steady state levels of both LexA proteins drop, probably due to auto-proteolytic activity triggered in this condition. In addition, seven other genes were up-regulated following UV-C irradiation, recA, recN, dinP, and four genes encoding hypothetical proteins. This set of genes is potentially regulated by LexA1, as it showed binding to their promoter regions. All these regions contain degenerated sequences in relation to the previously described SOS box, TTTGN 5CAAA. On the other hand, LexA2 was able to bind to the palindrome TTGTAN 10TACAA, found in its own promoter region, but not in the others. Therefore, the L. interrogans serovar Copenhageni SOS regulon may be even more complex, as a result of LexA1 and LexA2 binding to divergent motifs. New possibilities for DNA damage response in Leptospira are expected, with potential influence in other biological responses such as virulence. PMID:24098496
Global gene response in Saccharomyces cerevisiae exposed to silver nanoparticles.
Niazi, Javed H; Sang, Byoung-In; Kim, Yeon Seok; Gu, Man Bock
2011-08-01
Silver nanoparticles (AgNPs), exhibiting a broad size range and morphologies with highly reactive facets, which are widely applicable in real-life but not fully verified for biosafety and ecotoxicity, were subjected to report transcriptome profile in yeast Saccharomyces cerevisiae. A large number of genes accounted for ∼3% and ∼5% of the genome affected by AgNPs and Ag-ions, respectively. Principal component and cluster analysis suggest that the different physical forms of Ag were the major cause in differential expression profile. Among 90 genes affected by both AgNPs and Ag-ions, metalloprotein mediating high resistance to copper (CUP1-1 and CUP1-2) were strongly induced by AgNPs (∼45-folds) and Ag-ions (∼22-folds), respectively. A total of 17 genes, responsive to chemical stimuli, stress, and transport processes, were differentially induced by AgNPs. The differential expression was also seen with Ag-ions that affected 73 up- and 161 down-regulating genes, and most of these were involved in ion transport and homeostasis. This study provides new information on the knowledge for impact of nanoparticles on living microorganisms that can be extended to other nanoparticles.
Wang, Xiaodan; Kültz, Dietmar
2017-01-01
Fish respond to salinity stress by transcriptional induction of many genes, but the mechanism of their osmotic regulation is unknown. We developed a reporter assay using cells derived from the brain of the tilapia Oreochromis mossambicus (OmB cells) to identify osmolality/salinity-responsive enhancers (OSREs) in the genes of O. mossambicus. Genomic DNA comprising the regulatory regions of two strongly salinity-induced genes, inositol monophosphatase 1 (IMPA1.1) and myo-inositol phosphate synthase (MIPS), was isolated and analyzed with dual luciferase enhancer trap reporter assays. We identified five sequences (two in IMPA1.1 and three in MIPS) that share a common consensus element (DDKGGAAWWDWWYDNRB), which we named “OSRE1.” Additional OSREs that were less effective in conferring salinity-induced trans-activation and do not match the OSRE1 consensus also were identified in both MIPS and IMPA1.1. Although OSRE1 shares homology with the mammalian osmotic-response element/tonicity-responsive enhancer (ORE/TonE) enhancer, the latter is insufficient to confer osmotic induction in fish. Like other enhancers, OSRE1 trans-activates genes independent of orientation. We conclude that OSRE1 is a cis-regulatory element (CRE) that enhances the hyperosmotic induction of osmoregulated genes in fish. Our study also shows that tailored reporter assays developed for OmB cells facilitate the identification of CREs in fish genomes. Knowledge of the OSRE1 motif allows affinity-purification of the corresponding transcription factor and computational approaches for enhancer screening of fish genomes. Moreover, our study enables targeted inactivation of OSRE1 enhancers, a method superior to gene knockout for functional characterization because it confines impairment of gene function to a specific context (salinity stress) and eliminates pitfalls of constitutive gene knockouts (embryonic lethality, developmental compensation). PMID:28289196
Horvath, David P; Hansen, Stephanie A; Moriles-Miller, Janet P; Pierik, Ronald; Yan, Changhui; Clay, David E; Scheffler, Brian; Clay, Sharon A
2015-07-01
Weeds reduce yield in soybeans (Glycine max) through incompletely defined mechanisms. The effects of weeds on the soybean transcriptome were evaluated in field conditions during four separate growing seasons. RNASeq data were collected from six biological samples of soybeans growing with or without weeds. Weed species and the methods to maintain weed-free controls varied between years to mitigate treatment effects, and to allow detection of general soybean weed responses. Soybean plants were not visibly nutrient- or water-stressed. We identified 55 consistently downregulated genes in weedy plots. Many of the downregulated genes were heat shock genes. Fourteen genes were consistently upregulated. Several transcription factors including a PHYTOCHROME INTERACTING FACTOR 3-like gene (PIF3) were included among the upregulated genes. Gene set enrichment analysis indicated roles for increased oxidative stress and jasmonic acid signaling responses during weed stress. The relationship of this weed-induced PIF3 gene to genes involved in shade avoidance responses in Arabidopsis provide evidence that this gene may be important in the response of soybean to weeds. These results suggest that the weed-induced PIF3 gene will be a target for manipulating weed tolerance in soybean. No claim to original US government works New Phytologist © 2015 New Phytologist Trust.
Investigating Proteome and Transcriptome Defense Response of Apples Induced by Yarrowia lipolytica.
Zhang, Hongyin; Chen, Liangliang; Sun, Yiwen; Zhao, Lina; Zheng, Xiangfeng; Yang, Qiya; Zhang, Xiaoyun
2017-04-01
A better understanding of the mode of action of postharvest biocontrol agents on fruit surfaces is critical for the advancement of successful implementation of postharvest biocontrol products. This is due to the increasing importance of biological control of postharvest diseases over chemical and other control methods. However, most of the mechanisms involved in biological control remain unknown and need to be explored. Yarrowia lipolytica significantly inhibited blue mold decay of apples caused by Penicillium expansum. The findings also demonstrated that Y. lipolytica stimulated the activities of polyphenoloxidase, peroxidase, chitinase, l-phenylalanine ammonia lyase involved in enhancing defense responses in apple fruit tissue. Proteomic and transcriptomic analysis revealed a total of 35 proteins identified as up- and down-regulated in response to the Y. lipolytica inducement. These proteins were related to defense, biotic stimulus, and stress responses, such as pathogenesis-related proteins and dehydrin. The analysis of the transcriptome results proved that the induced resistance was mediated by a crosstalk between salicylic acid (SA) and ethylene/jasmonate (ET/JA) pathways. Y. lipolytica treatment activated the expression of isochorismate synthase gene in the SA pathway, which up-regulates the expression of PR4 in apple. The expression of 1-aminocyclopropane-1-carboxylate oxidase gene and ET-responsive transcription factors 2 and 4, which are involved in the ET pathway, were also activated. In addition, cytochrome oxidase I, which plays an important role in JA signaling for resistance acquisition, was also activated. However, not all of the genes had a positive effect on the SA and ET/JA signal pathways. As transcriptional repressors in JA signaling, TIFY3B and TIFY11B were triggered by the yeast, but the gene expression levels were relatively low. Taken together, Y. lipolytica induced the SA and ET/JA signal mediating the defense pathways by stimulating
Polato, Federica; Rusconi, Paolo
2014-01-01
Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652
Ca(2+) regulates fluid shear-induced cytoskeletal reorganization and gene expression in osteoblasts
NASA Technical Reports Server (NTRS)
Chen, N. X.; Ryder, K. D.; Pavalko, F. M.; Turner, C. H.; Burr, D. B.; Qiu, J.; Duncan, R. L.
2000-01-01
Osteoblasts subjected to fluid shear increase the expression of the early response gene, c-fos, and the inducible isoform of cyclooxygenase, COX-2, two proteins linked to the anabolic response of bone to mechanical stimulation, in vivo. These increases in gene expression are dependent on shear-induced actin stress fiber formation. Here, we demonstrate that MC3T3-E1 osteoblast-like cells respond to shear with a rapid increase in intracellular Ca(2+) concentration ([Ca(2+)](i)) that we postulate is important to subsequent cellular responses to shear. To test this hypothesis, MC3T3-E1 cells were grown on glass slides coated with fibronectin and subjected to laminar fluid flow (12 dyn/cm(2)). Before application of shear, cells were treated with two Ca(2+) channel inhibitors or various blockers of intracellular Ca(2+) release for 0. 5-1 h. Although gadolinium, a mechanosensitive channel blocker, significantly reduced the [Ca(2+)](i) response, neither gadolinium nor nifedipine, an L-type channel Ca(2+) channel blocker, were able to block shear-induced stress fiber formation and increase in c-fos and COX-2 in MC3T3-E1 cells. However, 1, 2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid-AM, an intracellular Ca(2+) chelator, or thapsigargin, which empties intracellular Ca(2+) stores, completely inhibited stress fiber formation and c-fos/COX-2 production in sheared osteoblasts. Neomycin or U-73122 inhibition of phospholipase C, which mediates D-myo-inositol 1,4,5-trisphosphate (IP(3))-induced intracellular Ca(2+) release, also completely suppressed actin reorganization and c-fos/COX-2 production. Pretreatment of MC3T3-E1 cells with U-73343, the inactive isoform of U-73122, did not inhibit these shear-induced responses. These results suggest that IP(3)-mediated intracellular Ca(2+) release is required for modulating flow-induced responses in MC3T3-E1 cells.
A Pipeline for High-Throughput Concentration Response Modeling of Gene Expression for Toxicogenomics
House, John S.; Grimm, Fabian A.; Jima, Dereje D.; Zhou, Yi-Hui; Rusyn, Ivan; Wright, Fred A.
2017-01-01
Cell-based assays are an attractive option to measure gene expression response to exposure, but the cost of whole-transcriptome RNA sequencing has been a barrier to the use of gene expression profiling for in vitro toxicity screening. In addition, standard RNA sequencing adds variability due to variable transcript length and amplification. Targeted probe-sequencing technologies such as TempO-Seq, with transcriptomic representation that can vary from hundreds of genes to the entire transcriptome, may reduce some components of variation. Analyses of high-throughput toxicogenomics data require renewed attention to read-calling algorithms and simplified dose–response modeling for datasets with relatively few samples. Using data from induced pluripotent stem cell-derived cardiomyocytes treated with chemicals at varying concentrations, we describe here and make available a pipeline for handling expression data generated by TempO-Seq to align reads, clean and normalize raw count data, identify differentially expressed genes, and calculate transcriptomic concentration–response points of departure. The methods are extensible to other forms of concentration–response gene-expression data, and we discuss the utility of the methods for assessing variation in susceptibility and the diseased cellular state. PMID:29163636
Schulze-Lefert, P; Dangl, J L; Becker-André, M; Hahlbrock, K; Schulz, W
1989-01-01
We began characterization of the protein--DNA interactions necessary for UV light induced transcriptional activation of the gene encoding chalcone synthase (CHS), a key plant defense enzyme. Three light dependent in vivo footprints appear on a 90 bp stretch of the CHS promoter with a time course correlated with the onset of CHS transcription. We define a minimal light responsive promoter by functional analysis of truncated CHS promoter fusions with a reporter gene in transient expression experiments in parsley protoplasts. Two of the three footprinted sequence 'boxes' reside within the minimal promoter. Replacement of 10 bp within either of these 'boxes' leads to complete loss of light responsiveness. We conclude that these sequences define the necessary cis elements of the minimal CHS promoter's light responsive element. One of the functionally defined 'boxes' is homologous to an element implicated in regulation of genes involved in photosynthesis. These data represent the first example in a plant defense gene of an induced change in protein--DNA contacts necessary for transcriptional activation. Also, our data argue strongly that divergent light induced biosynthetic pathways share common regulatory units. Images PMID:2566481
Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.
An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin
2016-05-01
Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.
Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande
2013-04-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.
Mills, Margaret G; Gallagher, Evan P
2017-01-01
Chemical-induced oxidative stress and the biochemical pathways that protect against oxidative damage are of particular interest in the field of toxicology. To rapidly identify oxidative stress-responsive gene expression changes in zebrafish, we developed a targeted panel of antioxidant genes using the Affymetrix QuantiGene Plex (QGP) platform. The genes contained in our panel include eight putative Nrf2 (Nfe2l2a)-dependent antioxidant genes (hmox1a, gstp1, gclc, nqo1, prdx1, gpx1a, sod1, sod2), a stress response gene (hsp70), an inducible DNA damage repair gene (gadd45bb), and three reference genes (actb1, gapdh, hprt1). We tested this platform on larval zebrafish exposed to tert-butyl hydroperoxide (tBHP) and cadmium (Cd), two model oxidative stressors with different modes of action, and compared our results with those obtained using the more common quantitative PCR (qPCR) method. Both methods showed that exposure to tBHP and Cd induced expression of prdx1, gstp1, and hmox1a (2- to 12-fold increase via QGP), indicative of an activated Nrf2 response in larval zebrafish. Both compounds also elicited a general stress response as reflected by elevation of hsp70 and gadd45bb, with Cd being the more potent inducer. Transient changes were observed in sod2 and gpx1a expression, whereas nqo1, an Nrf2-responsive gene in mammalian cells, was minimally affected by either tBHP or Cd chemical exposures. Developmental expression analysis of the target genes by QGP revealed marked upregulation of sod2 between 0-96hpf, and to a lesser extent, of sod1 and gstp1. Once optimized, QGP analysis of these experiments was accomplished more rapidly, using far less tissue, and at lower total costs than qPCR analysis. In summary, the QGP platform as applied to higher-throughput zebrafish studies provides a reasonable cost-effective alternative to qPCR or more comprehensive transcriptomics approaches to rapidly assess the potential for chemicals to elicit oxidative stress as a mechanism of
Zhang, Yongqiang; Pei, Xinwu; Zhang, Chao; Lu, Zifeng; Wang, Zhixing; Jia, Shirong; Li, Weimin
2012-01-01
Background The hypersensitive response (HR) system of Chenopodium spp. confers broad-spectrum virus resistance. However, little knowledge exists at the genomic level for Chenopodium, thus impeding the advanced molecular research of this attractive feature. Hence, we took advantage of RNA-seq to survey the foliar transcriptome of C. amaranticolor, a Chenopodium species widely used as laboratory indicator for pathogenic viruses, in order to facilitate the characterization of the HR-type of virus resistance. Methodology and Principal Findings Using Illumina HiSeq™ 2000 platform, we obtained 39,868,984 reads with 3,588,208,560 bp, which were assembled into 112,452 unigenes (3,847 clusters and 108,605 singletons). BlastX search against the NCBI NR database identified 61,698 sequences with a cut-off E-value above 10−5. Assembled sequences were annotated with gene descriptions, GO, COG and KEGG terms, respectively. A total number of 738 resistance gene analogs (RGAs) and homology sequences of 6 key signaling proteins within the R proteins-directed signaling pathway were identified. Based on this transcriptome data, we investigated the gene expression profiles over the stage of HR induced by Tobacco mosaic virus and Cucumber mosaic virus by using digital gene expression analysis. Numerous candidate genes specifically or commonly regulated by these two distinct viruses at early and late stages of the HR were identified, and the dynamic changes of the differently expressed genes enriched in the pathway of plant-pathogen interaction were particularly emphasized. Conclusions To our knowledge, this study is the first description of the genetic makeup of C. amaranticolor, providing deep insight into the comprehensive gene expression information at transcriptional level in this species. The 738 RGAs as well as the differentially regulated genes, particularly the common genes regulated by both TMV and CMV, are suitable candidates which merit further functional characterization
Loose, David S.; Gottipati, Koteswara R.; Natarajan, Kartiga; Mitchell, Courtney T.
2016-01-01
The intensification and concentration of animal production operations expose workers to high levels of organic dusts in the work environment. Exposure to organic dusts is a risk factor for the development of acute and chronic respiratory symptoms and diseases. Lung epithelium plays important roles in the control of immune and inflammatory responses to environmental agents to maintain lung health. To better understand the effects of organic dust on lung inflammatory responses, we characterized the gene expression profiles of A549 alveolar and Beas2B bronchial epithelial and THP-1 monocytic cells influenced by exposure to poultry dust extract by DNA microarray analysis using Illumina Human HT-12 v4 Expression BeadChip. We found that A549 alveolar and Beas2B bronchial epithelial and THP-1 cells responded with unique changes in the gene expression profiles with regulation of genes encoding inflammatory cytokines, chemokines, and other inflammatory proteins being common to all the three cells. Significantly induced genes included IL-8, IL-6, IL-1β, ICAM-1, CCL2, CCL5, TLR4, and PTGS2. Validation by real-time qRT-PCR, ELISA, Western immunoblotting, and immunohistochemical staining of lung sections from mice exposed to dust extract validated DNA microarray results. Pathway analysis indicated that dust extract induced changes in gene expression influenced functions related to cellular growth and proliferation, cell death and survival, and cellular development. These data show that a broad range of inflammatory mediators produced in response to poultry dust exposure can modulate lung immune and inflammatory responses. This is the first report on organic dust induced changes in expression profiles in lung epithelial and THP-1 monocytic cells. PMID:26884459
A gene expression profile indicative of early stage HER2 targeted therapy response.
O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert
2013-07-01
Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.
Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather
2014-01-01
The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770
Bernal, Laura; Alvarado-Vázquez, Abigail; Ferreira, David Wilson; Paige, Candler A; Ulecia-Morón, Cristina; Hill, Bailey; Caesar, Marina; Romero-Sandoval, E Alfonso
2017-02-01
Macrophages orchestrate the initiation and resolution of inflammation by producing pro- and anti-inflammatory products. An imbalance in these mediators may originate from a deficient or excessive immune response. Therefore, macrophages are valid therapeutic targets to restore homeostasis under inflammatory conditions. We hypothesize that a specific mannosylated nanoparticle effectively induces gene expression in human macrophages under inflammatory conditions without undesirable immunogenic responses. THP-1 macrophages were challenged with lipopolysaccharide (LPS, 5μg/mL). Polyethylenimine (PEI) nanoparticles grafted with a mannose receptor ligand (Man-PEI) were used as a gene delivery method. Nanoparticle toxicity, Man-PEI cellular uptake rate and gene induction efficiency (GFP, CD14 or CD68) were studied. Potential immunogenic responses were evaluated by measuring the production of tumor necrosis factor-alpha (TNF-α), Interleukin (IL)-6 and IL-10. Man-PEI did not produce cytotoxicity, and it was effectively up-taken by THP-1 macrophages (69%). This approach produced a significant expression of GFP (mRNA and protein), CD14 and CD68 (mRNA), and transiently and mildly reduced IL-6 and IL-10 levels in LPS-challenged macrophages. Our results indicate that Man-PEI is suitable for inducing an efficient gene overexpression in human macrophages under inflammatory conditions with limited immunogenic responses. Our promising results set the foundation to test this technology to induce functional anti-inflammatory genes. Copyright © 2016 Elsevier GmbH. All rights reserved.
Aubry-Hivet, D; Nziengui, H; Rapp, K; Oliveira, O; Paponov, I A; Li, Y; Hauslage, J; Vagt, N; Braun, M; Ditengou, F A; Dovzhenko, A; Palme, K
2014-01-01
Plant roots are among most intensively studied biological systems in gravity research. Altered gravity induces asymmetric cell growth leading to root bending. Differential distribution of the phytohormone auxin underlies root responses to gravity, being coordinated by auxin efflux transporters from the PIN family. The objective of this study was to compare early transcriptomic changes in roots of Arabidopsis thaliana wild type, and pin2 and pin3 mutants under parabolic flight conditions and to correlate these changes to auxin distribution. Parabolic flights allow comparison of transient 1-g, hypergravity and microgravity effects in living organisms in parallel. We found common and mutation-related genes differentially expressed in response to transient microgravity phases. Gene ontology analysis of common genes revealed lipid metabolism, response to stress factors and light categories as primarily involved in response to transient microgravity phases, suggesting that fundamental reorganisation of metabolic pathways functions upstream of a further signal mediating hormonal network. Gene expression changes in roots lacking the columella-located PIN3 were stronger than in those deprived of the epidermis and cortex cell-specific PIN2. Moreover, repetitive exposure to microgravity/hypergravity and gravity/hypergravity flight phases induced an up-regulation of auxin responsive genes in wild type and pin2 roots, but not in pin3 roots, suggesting a critical function of PIN3 in mediating auxin fluxes in response to transient microgravity phases. Our study provides important insights towards understanding signal transduction processes in transient microgravity conditions by combining for the first time the parabolic flight platform with the transcriptome analysis of different genetic mutants in the model plant, Arabidopsis. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lombaert, Nooemi; Lison, Dominique; Van Hummelen, Paul
Hard metals consist of tungsten carbide (WC) and metallic cobalt (Co) particles and are important industrial materials produced for their extreme hardness and high wear resistance properties. While occupational exposure to metallic Co alone is apparently not associated with an increased risk of cancer, the WC-Co particle mixture was shown to be carcinogenic in exposed workers. The in vitro mutagenic/apoptogenic potential of WC-Co in human peripheral blood mononucleated cells was previously demonstrated by us. This study aimed at obtaining a broader view of the pathways responsible for WC-Co induced carcinogenicity, and in particular genotoxicity and apoptosis. We analyzed the profilemore » of gene expression induced in vitro by WC-Co versus control (24 h treatment) in human PBMC and monocytes using microarrays. The most significantly up-regulated pathways for WC-Co treated PBMC were apoptosis and stress/defense response; the most down-regulated was immune response. For WC-Co treated monocytes the most significantly up- and down-regulated pathways were nucleosome/chromatin assembly and immune response respectively. Quantitative RT-PCR data for a selection of the most strongly modulated genes (HMOX1, HSPA1A, HSPA1L, BNIP3, BNIP3L, ADORA2B, MT3, PLA2G7, TNFAIP6), and some additionally chosen apoptosis related genes (BCL2, BAX, FAS, FASL, TNF{alpha}), confirmed the microarray data after WC-Co exposure and demonstrated limited differences between the Co-containing compounds. Overall, this study provides the first analysis of gene expression induced by the WC-Co mixture showing a large profile of gene modulation and giving a preliminary indication for a hypoxia mimicking environment induced by WC-Co exposure.« less
Xu, Lin; Li, Sheng; Ran, Xueqin; Liu, Chang; Lin, Rutao; Wang, Jiafu
2016-09-01
Azadirachtin has been used as an antifeedant and growth disruption agent for many insect species. Previous investigations have reported the apoptotic effects of azadirachtin on some insect cells, but the molecular mechanisms are still not clear. This study investigated the underlying molecular mechanisms for the apoptotic effects induced by azadirachtin on Drosophila melanogaster S2 cells in vitro. The results of the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide assay demonstrated that azadirachtin exhibited significant cytotoxicity to S2 cells in a time- and dose-dependent manner. The changes in cellular morphology and the DNA fragmentation demonstrated that azadirachtin induced remarkable apoptosis of S2 cells. Expression levels of 276 genes were found to be significantly changed in S2 cells after exposure to azadirachtin, as detected by Drosophila genome array. Among these genes, calmodulin (CaM) was the most highly upregulated gene. Azadirachtin was further demonstrated to trigger intracellular Ca(2+) release in S2 cells. The genes related to the apoptosis pathway, determined from chip data, were validated by the real-time quantitative polymerase chain reaction method. The results showed that azadirachtin-mediated intracellular Ca(2+) release was the primary event that triggered apoptosis in Drosophila S2 cells through both pathways of the Ca(2+) -CaM and EcR/Usp signalling cascade. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.
Miura, Kenji; Yamano, Takashi; Yoshioka, Satoshi; Kohinata, Tsutomu; Inoue, Yoshihiro; Taniguchi, Fumiya; Asamizu, Erika; Nakamura, Yasukazu; Tabata, Satoshi; Yamato, Katsuyuki T.; Ohyama, Kanji; Fukuzawa, Hideya
2004-01-01
Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM. PMID:15235119
Goodale, Britton C.; Tilton, Susan C.; Wilson, Glenn; Corvi, Margaret M.; Janszen, Derek B.; Anderson, Kim A.; Waters, Katrina M.; Tanguay, Robert L.
2014-01-01
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous in the environment as components of fossil fuels and by-products of combustion. These multi-ring chemicals differentially activate the Aryl Hydrocarbon Receptor (AHR) in a structurally dependent manner, and induce toxicity via both AHR-dependent and-independent mechanisms. PAH exposure is known to induce developmental malformations in zebrafish embryos, and recent studies have shown cardiac toxicity induced by compounds with low AHR affinity. Unraveling the potentially diverse molecular mechanisms of PAH toxicity is essential for understanding the hazard posed by complex PAH mixtures present in the environment. We analyzed transcriptional responses to PAH exposure in zebrafish embryos exposed to benz(a)anthracene (BAA), dibenzothiophene (DBT) and pyrene (PYR) at concentrations that induced developmental malformations by 120 hours post-fertilization (hpf). Whole genome microarray analysis of mRNA expression at 24 and 48 hpf identified genes that were differentially regulated over time and in response to the three PAH structures. PAH body burdens were analyzed at both time points using GC-MS, and demonstrated differences in PAH uptake into the embryos. This was important for discerning dose-related differences from those that represented unique molecular mechanisms. While BAA misregulated the least number of transcripts, it caused strong induction of cyp1a and other genes known to be downstream of the AHR, which were not induced by the other two PAHs. Analysis of functional roles of misregulated genes and their predicted regulatory transcription factors also distinguished the BAA response from regulatory networks disrupted by DBT and PYR exposure. These results indicate that systems approaches can be used to classify the toxicity of PAHs based on the networks perturbed following exposure, and may provide a path for unraveling the toxicity of complex PAH mixtures. PMID:23656968
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Tailoring the Immune Response via Customization of Pathogen Gene Expression
Runco, Lisa M.; Stauft, Charles B.
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769
Environmentally induced responses co-opted for reproductive altruism
Nedelcu, Aurora M.
2009-01-01
Reproductive altruism is an extreme form of altruism best typified by sterile castes in social insects and somatic cells in multicellular organisms. Although reproductive altruism is central to the evolution of multicellularity and eusociality, the mechanistic basis for the evolution of this behaviour is yet to be deciphered. Here, we report that the gene responsible for the permanent suppression of reproduction in the somatic cells of the multicellular green alga, Volvox carteri, evolved from a gene that in its unicellular relative, Chlamydomonas reinhardtii, is part of the general acclimation response to various environmental stress factors, which includes the temporary suppression of reproduction. Furthermore, we propose a model for the evolution of soma, in which by simulating the acclimation signal (i.e. a change in cellular redox status) in a developmental rather than environmental context, responses beneficial to a unicellular individual can be co-opted into an altruistic behaviour at the group level. The co-option of environmentally induced responses for reproductive altruism can contribute to the stability of this behaviour, as the loss of such responses would be costly for the individual. This hypothesis also predicts that temporally varying environments, which will select for more efficient acclimation responses, are likely to be more conducive to the evolution of reproductive altruism. PMID:19578098
Environmentally induced responses co-opted for reproductive altruism.
Nedelcu, Aurora M
2009-12-23
Reproductive altruism is an extreme form of altruism best typified by sterile castes in social insects and somatic cells in multicellular organisms. Although reproductive altruism is central to the evolution of multicellularity and eusociality, the mechanistic basis for the evolution of this behaviour is yet to be deciphered. Here, we report that the gene responsible for the permanent suppression of reproduction in the somatic cells of the multicellular green alga, Volvox carteri, evolved from a gene that in its unicellular relative, Chlamydomonas reinhardtii, is part of the general acclimation response to various environmental stress factors, which includes the temporary suppression of reproduction. Furthermore, we propose a model for the evolution of soma, in which by simulating the acclimation signal (i.e. a change in cellular redox status) in a developmental rather than environmental context, responses beneficial to a unicellular individual can be co-opted into an altruistic behaviour at the group level. The co-option of environmentally induced responses for reproductive altruism can contribute to the stability of this behaviour, as the loss of such responses would be costly for the individual. This hypothesis also predicts that temporally varying environments, which will select for more efficient acclimation responses, are likely to be more conducive to the evolution of reproductive altruism.
Ethylene-induced differential gene expression during abscission of citrus leaves
Merelo, Paz; Cercós, Manuel; Tadeo, Francisco R.; Talón, Manuel
2008-01-01
The main objective of this work was to identify and classify genes involved in the process of leaf abscission in Clementina de Nules (Citrus clementina Hort. Ex Tan.). A 7 K unigene citrus cDNA microarray containing 12 K spots was used to characterize the transcriptome of the ethylene-induced abscission process in laminar abscission zone-enriched tissues and the petiole of debladed leaf explants. In these conditions, ethylene induced 100% leaf explant abscission in 72 h while, in air-treated samples, the abscission period started later and took 240 h. Gene expression monitored during the first 36 h of ethylene treatment showed that out of the 12 672 cDNA microarray probes, ethylene differentially induced 725 probes distributed as follows: 216 (29.8%) probes in the laminar abscission zone and 509 (70.2%) in the petiole. Functional MIPS classification and manual annotation of differentially expressed genes highlighted key processes regulating the activation and progress of the cell separation that brings about abscission. These included cell-wall modification, lipid transport, protein biosynthesis and degradation, and differential activation of signal transduction and transcription control pathways. Expression data associated with the petiole indicated the occurrence of a double defensive strategy mediated by the activation of a biochemical programme including scavenging ROS, defence and PR genes, and a physical response mostly based on lignin biosynthesis and deposition. This work identifies new genes probably involved in the onset and development of the leaf abscission process and suggests a different but co-ordinated and complementary role for the laminar abscission zone and the petiole during the process of abscission. PMID:18515267
Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity
2010-01-01
Background Activation of Toll-like receptors (TLRs) is widely accepted as an essential event for defence against infection. Many TLRs utilize a common signalling pathway that relies on activation of the kinase IRAK4 and the transcription factor NFκB for the rapid expression of immunity genes. Methods 21 K DNA microarray technology was used to evaluate LPS-induced (TLR4) gene responses in blood monocytes from a child with an IRAK4-deficiency. In vitro responsiveness to LPS was confirmed by real-time PCR and ELISA and compared to the clinical predisposition of the child and IRAK4-deficient mice to Gram negative infection. Results We demonstrated that the vast majority of LPS-responsive genes in IRAK4-deficient monocytes were greatly suppressed, an observation that is consistent with the described role for IRAK4 as an essential component of TLR4 signalling. The severely impaired response to LPS, however, is inconsistent with a remarkably low incidence of Gram negative infections observed in this child and other children with IRAK4-deficiency. This unpredicted clinical phenotype was validated by demonstrating that IRAK4-deficient mice had a similar resistance to infection with Gram negative S. typhimurium as wildtype mice. A number of immunity genes, such as chemokines, were expressed at normal levels in human IRAK4-deficient monocytes, indicating that particular IRAK4-independent elements within the repertoire of TLR4-induced responses are expressed. Conclusions Sufficient defence to Gram negative immunity does not require IRAK4 or a robust, 'classic' inflammatory and immune response. PMID:20105294
Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Vialou, Vincent; Heller, Elizabeth A; Yieh, Lynn; LaBonté, Benoit; Peña, Catherine J; Shen, Li; Wittenberg, Gayle M; Nestler, Eric J
2017-02-15
Examining transcriptional regulation by antidepressants in key neural circuits implicated in depression and understanding the relation to transcriptional mechanisms of susceptibility and natural resilience may help in the search for new therapeutic agents. Given the heterogeneity of treatment response in human populations, examining both treatment response and nonresponse is critical. We compared the effects of a conventional monoamine-based tricyclic antidepressant, imipramine, and a rapidly acting, non-monoamine-based antidepressant, ketamine, in mice subjected to chronic social defeat stress, a validated depression model, and used RNA sequencing to analyze transcriptional profiles associated with susceptibility, resilience, and antidepressant response and nonresponse in the prefrontal cortex (PFC), nucleus accumbens, hippocampus, and amygdala. We identified similar numbers of responders and nonresponders after ketamine or imipramine treatment. Ketamine induced more expression changes in the hippocampus; imipramine induced more expression changes in the nucleus accumbens and amygdala. Transcriptional profiles in treatment responders were most similar in the PFC. Nonresponse reflected both the lack of response-associated gene expression changes and unique gene regulation. In responders, both drugs reversed susceptibility-associated transcriptional changes and induced resilience-associated transcription in the PFC. We generated a uniquely large resource of gene expression data in four interconnected limbic brain regions implicated in depression and its treatment with imipramine or ketamine. Our analyses highlight the PFC as a key site of common transcriptional regulation by antidepressant drugs and in both reversing susceptibility- and inducing resilience-associated molecular adaptations. In addition, we found region-specific effects of each drug, suggesting both common and unique effects of imipramine versus ketamine. Copyright © 2016 Society of Biological
Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eric Y. Chuang
2006-08-31
It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less
Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C
2015-01-01
To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.
Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao
2016-01-01
Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICEAc) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICEAc-located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity. PMID:27849579
Ling, Jun; Wang, Hui; Wu, Ping; Li, Tao; Tang, Yu; Naseer, Nawar; Zheng, Huiming; Masson-Boivin, Catherine; Zhong, Zengtao; Zhu, Jun
2016-11-29
Horizontal gene transfer (HGT) of genomic islands is a driving force of bacterial evolution. Many pathogens and symbionts use this mechanism to spread mobile genetic elements that carry genes important for interaction with their eukaryotic hosts. However, the role of the host in this process remains unclear. Here, we show that plant compounds inducing the nodulation process in the rhizobium-legume mutualistic symbiosis also enhance the transfer of symbiosis islands. We demonstrate that the symbiosis island of the Sesbania rostrata symbiont, Azorhizobium caulinodans, is an 87.6-kb integrative and conjugative element (ICE Ac ) that is able to excise, form a circular DNA, and conjugatively transfer to a specific site of gly-tRNA gene of other rhizobial genera, expanding their host range. The HGT frequency was significantly increased in the rhizosphere. An ICE Ac -located LysR-family transcriptional regulatory protein AhaR triggered the HGT process in response to plant flavonoids that induce the expression of nodulation genes through another LysR-type protein, NodD. Our study suggests that rhizobia may sense rhizosphere environments and transfer their symbiosis gene contents to other genera of rhizobia, thereby broadening rhizobial host-range specificity.
Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.
Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C
2016-05-01
Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.
Zhang, Weixiong; Ruan, Jianhua; Ho, Tuan-Hua David; You, Youngsook; Yu, Taotao; Quatrano, Ralph S
2005-07-15
A fundamental problem of computational genomics is identifying the genes that respond to certain endogenous cues and environmental stimuli. This problem can be referred to as targeted gene finding. Since gene regulation is mainly determined by the binding of transcription factors and cis-regulatory DNA sequences, most existing gene annotation methods, which exploit the conservation of open reading frames, are not effective in finding target genes. A viable approach to targeted gene finding is to exploit the cis-regulatory elements that are known to be responsible for the transcription of target genes. Given such cis-elements, putative target genes whose promoters contain the elements can be identified. As a case study, we apply the above approach to predict the genes in model plant Arabidopsis thaliana which are inducible by a phytohormone, abscisic acid (ABA), and abiotic stress, such as drought, cold and salinity. We first construct and analyze two ABA specific cis-elements, ABA-responsive element (ABRE) and its coupling element (CE), in A.thaliana, based on their conservation in rice and other cereal plants. We then use the ABRE-CE module to identify putative ABA-responsive genes in A.thaliana. Based on RT-PCR verification and the results from literature, this method has an accuracy rate of 67.5% for the top 40 predictions. The cis-element based targeted gene finding approach is expected to be widely applicable since a large number of cis-elements in many species are available.
Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.
2009-01-01
Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510
Ciencewicki, Jonathan M.; Verhein, Kirsten C.; Gerrish, Kevin; McCaw, Zachary R.; Li, Jianying; Bushel, Pierre R.
2016-01-01
Ozone is a common, potent oxidant pollutant in industrialized nations. Ozone exposure causes airway hyperreactivity, lung hyperpermeability, inflammation, and cell damage in humans and laboratory animals, and exposure to ozone has been associated with exacerbation of asthma, altered lung function, and mortality. The mechanisms of ozone-induced lung injury and differential susceptibility are not fully understood. Ozone-induced lung inflammation is mediated, in part, by the innate immune system. We hypothesized that mannose-binding lectin (MBL), an innate immunity serum protein, contributes to the proinflammatory events caused by ozone-mediated activation of the innate immune system. Wild-type (Mbl+/+) and MBL-deficient (Mbl−/−) mice were exposed to ozone (0.3 ppm) for up to 72 h, and bronchoalveolar lavage fluid was examined for inflammatory markers. Mean numbers of eosinophils and neutrophils and levels of the neutrophil attractants C-X-C motif chemokines 2 [Cxcl2 (major intrinsic protein 2)] and 5 [Cxcl5 (limb expression, LIX)] in the bronchoalveolar lavage fluid were significantly lower in Mbl−/− than Mbl+/+ mice exposed to ozone. Using genome-wide mRNA microarray analyses, we identified significant differences in transcript response profiles and networks at baseline [e.g., nuclear factor erythroid-related factor 2 (NRF2)-mediated oxidative stress response] and after exposure (e.g., humoral immune response) between Mbl+/+ and Mbl−/− mice. The microarray data were further analyzed to discover several informative differential response patterns and subsequent gene sets, including the antimicrobial response and the inflammatory response. We also used the lists of gene transcripts to search the LINCS L1000CDS2 data sets to identify agents that are predicted to perturb ozone-induced changes in gene transcripts and inflammation. These novel findings demonstrate that targeted deletion of Mbl caused differential levels of inflammation-related gene sets at
Liu, Ning; Ding, Yong; Fromm, Michael; Avramova, Zoya
2014-05-01
Plants that have experienced several exposures to dehydration stress show increased resistance to future exposures by producing faster and/or stronger reactions, while many dehydration stress responding genes in Arabidopsis thaliana super-induce their transcription as a 'memory' from the previous encounter. A previously unknown, rather unusual, memory response pattern is displayed by a subset of the dehydration stress response genes. Despite robustly responding to a first stress, these genes return to their initial, pre-stressed, transcript levels during the watered recovery; surprisingly, they do not respond further to subsequent stresses of similar magnitude and duration. This transcriptional behavior defines the 'revised-response' memory genes. Here, we investigate the molecular mechanisms regulating this transcription memory behavior. Potential roles of abscisic acid (ABA), of transcription factors (TFs) from the ABA signaling pathways (ABF2/3/4 and MYC2), and of histone modifications (H3K4me3 and H3K27me3) as factors in the revised-response transcription memory patterns are elucidated. We identify the TF MYC2 as the critical component for the memory behavior of a specific subset of MYC2-dependent genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Peixoto, António; Evaristo, César; Munitic, Ivana; Monteiro, Marta; Charbit, Alain; Rocha, Benedita; Veiga-Fernandes, Henrique
2007-01-01
To study in vivo CD8 T cell differentiation, we quantified the coexpression of multiple genes in single cells throughout immune responses. After in vitro activation, CD8 T cells rapidly express effector molecules and cease their expression when the antigen is removed. Gene behavior after in vivo activation, in contrast, was quite heterogeneous. Different mRNAs were induced at very different time points of the response, were transcribed during different time periods, and could decline or persist independently of the antigen load. Consequently, distinct gene coexpression patterns/different cell types were generated at the various phases of the immune responses. During primary stimulation, inflammatory molecules were induced and down-regulated shortly after activation, generating early cells that only mediated inflammation. Cytotoxic T cells were generated at the peak of the primary response, when individual cells simultaneously expressed multiple killer molecules, whereas memory cells lost killer capacity because they no longer coexpressed killer genes. Surprisingly, during secondary responses gene transcription became permanent. Secondary cells recovered after antigen elimination were more efficient killers than cytotoxic T cells present at the peak of the primary response. Thus, primary responses produced two transient effector types. However, after boosting, CD8 T cells differentiate into long-lived killer cells that persist in vivo in the absence of antigen. PMID:17485515
RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.
Maldonado-Mendoza, Ignacio E; Harrison, Maria J
Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.
Jang, Ah-Ra; Choi, Joo-Hee; Shin, Sung Jae; Park, Jong-Hwan
2018-04-01
Mycobacterium tuberculosis is a highly virulent bacterium that causes tuberculosis. It infects about one third of the world's population. Type I interferons (IFNs) play a detrimental role in host defense against M. tuberculosis infection. Proteins secreted by M. tuberculosis through ESX-1 secretion system contribute to type I IFNs production. However, the precise mechanism by which 6-kDa early secretory antigen target (ESAT6), one of ESX-1-mediated secretory proteins, induces type I IFNs production in host cells is currently unclear. Therefore, the objective of the present study was to determine the underlying molecular mechanism regulating ESAT6-mediated gene expression of IFN-β in macrophages. Recombinant ESAT6 produced from E. coli expression system induced IFN-β gene expression in various types of macrophages such as mouse bone marrow-derived macrophages (BMDMs), peritoneal macrophages, and MH-S cells (murine alveolar macrophage cell line). Deficiency of TLR4 and TRIF absolutely abrogated ESAT6-induced IFN-β gene expression. TLR2 and MyD88 were partially involved in IFN-β gene expression in response to low dose of ESAT6. Another recombinant ESAT6 produced from baculovirus system also upregulated IFN-β gene expression via TLR4-dependent pathway. Polymyxin B (PMB) treatment impaired LPS-induced IFN-β expression. However, IFN-β expression induced by ESAT6 was not influenced by PMB. This suggests that ESAT6-mediated IFN-β expression is not due to LPS contamination. Treatment with ESAT6 resulted in activation of TBK1 and IRF3 in macrophages. Such activation was abolished in TLR4- and TRIF-deficient cells. Moreover, inhibition of IRF3 and TBK1 suppressed IFN-β gene expression in response to ESAT6. Our results suggest that ESAT6 might contribute to virulence of M. tuberculosis by regulating type I IFNs production through TLR4-TRIF signaling pathway. Copyright © 2017 Elsevier Ltd. All rights reserved.
van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther
2011-01-01
Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).
A gene expression profile indicative of early stage HER2 targeted therapy response
2013-01-01
Background Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Results Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. Conclusions In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor. Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents. PMID:23816254
Response of marine bacterioplankton pH homeostasis gene expression to elevated CO2
NASA Astrophysics Data System (ADS)
Bunse, Carina; Lundin, Daniel; Karlsson, Christofer M. G.; Akram, Neelam; Vila-Costa, Maria; Palovaara, Joakim; Svensson, Lovisa; Holmfeldt, Karin; González, José M.; Calvo, Eva; Pelejero, Carles; Marrasé, Cèlia; Dopson, Mark; Gasol, Josep M.; Pinhassi, Jarone
2016-05-01
Human-induced ocean acidification impacts marine life. Marine bacteria are major drivers of biogeochemical nutrient cycles and energy fluxes; hence, understanding their performance under projected climate change scenarios is crucial for assessing ecosystem functioning. Whereas genetic and physiological responses of phytoplankton to ocean acidification are being disentangled, corresponding functional responses of bacterioplankton to pH reduction from elevated CO2 are essentially unknown. Here we show, from metatranscriptome analyses of a phytoplankton bloom mesocosm experiment, that marine bacteria responded to lowered pH by enhancing the expression of genes encoding proton pumps, such as respiration complexes, proteorhodopsin and membrane transporters. Moreover, taxonomic transcript analysis showed that distinct bacterial groups expressed different pH homeostasis genes in response to elevated CO2. These responses were substantial for numerous pH homeostasis genes under low-chlorophyll conditions (chlorophyll a <2.5 μg l-1) however, the changes in gene expression under high-chlorophyll conditions (chlorophyll a >20 μg l-1) were low. Given that proton expulsion through pH homeostasis mechanisms is energetically costly, these findings suggest that bacterioplankton adaptation to ocean acidification could have long-term effects on the economy of ocean ecosystems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nordgren, Kendra K.S., E-mail: knordgre@d.umn.edu; Wallace, Kendall B., E-mail: kwallace@d.umn.edu
Doxorubicin (DOX) is a widely prescribed treatment for a broad scope of cancers, but clinical utility is limited by the cumulative, dose-dependent cardiomyopathy that occurs with repeated administration. DOX-induced cardiotoxicity is associated with the production of reactive oxygen species (ROS) and oxidation of lipids, DNA and proteins. A major cellular defense mechanism against such oxidative stress is activation of the Keap1/Nrf2-antioxidant response element (ARE) signaling pathway, which transcriptionally regulates expression of antioxidant genes such as Nqo1 and Gstp1. In the present study, we address the hypothesis that an initial event associated with DOX-induced oxidative stress is activation of the Keap1/Nrf2-dependentmore » expression of antioxidant genes and that this is regulated through drug-induced changes in redox status of the Keap1 protein. Incubation of H9c2 rat cardiac myoblasts with DOX resulted in a time- and dose-dependent decrease in non-protein sulfhydryl groups. Associated with this was a near 2-fold increase in Nrf2 protein content and enhanced transcription of several of the Nrf2-regulated down-stream genes, including Gstp1, Ugt1a1, and Nqo1; the expression of Nfe2l2 (Nrf2) itself was unaltered. Furthermore, both the redox status and the total amount of Keap1 protein were significantly decreased by DOX, with the loss of Keap1 being due to both inhibited gene expression and increased autophagic, but not proteasomal, degradation. These findings identify the Keap1/Nrf2 pathway as a potentially important initial response to acute DOX-induced oxidative injury, with the primary regulatory events being the oxidation and autophagic degradation of the redox sensor Keap1 protein. - Highlights: • DOX caused a ∼2-fold increase in Nrf2 protein content. • DOX enhanced transcription of several Nrf2-regulated down-stream genes. • Redox status and total amount of Keap1 protein were significantly decreased by DOX. • Loss of Keap1 protein was
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, C.A.; Phillips, D.A.
Flavonoid signals from alfalfa (Medicago sativa L.) induce transcription of nodulation (nod) genes in Rhizobium meliloti. Alfalfa roots release three major nod-gene inducers: 4{prime},7-dihydroxyflavanone, 4{prime},7-dihydroxyflavone, and 4,4{prime}-dihydroxy-2{prime}-methoxychalcone. The objective of the present study was to define temporal relationships between synthesis and exudation for those flavonoids. Requirements for concurrent flavonoid biosynthesis were assessed by treating roots of intact alfalfa seedlings with (U-{sup 14}C)-L-phenylalanine in the presence or absence of the phenylalanine ammonia-lyase inhibitor L-2-aminoxy-3-phenylpropionic acid (AOPP). In the absence of AOPP, each of the three flavonoids in exudates contained {sup 14}C. In the presence of AOPP, {sup 14}C labeling and releasemore » of all the exuded nod-gene inducers were reduced significantly. AOPP inhibited labeling and release of the strongest nod-gene inducer, methoxychalcone, by more than 90%. The release process responsible for exudation of nod-gene inducers appears to be specific rather than a general phenomenon such as a sloughing off of cells during root growth.« less
Börgeling, Yvonne; Schmolke, Mirco; Viemann, Dorothee; Nordhoff, Carolin; Roth, Johannes; Ludwig, Stephan
2014-01-03
Highly pathogenic avian influenza viruses (HPAIV) induce severe inflammation in poultry and men. One characteristic of HPAIV infections is the induction of a cytokine burst that strongly contributes to viral pathogenicity. This cell-intrinsic hypercytokinemia seems to involve hyperinduction of p38 mitogen-activated protein kinase. Here we investigate the role of p38 MAPK signaling in the antiviral response against HPAIV in mice as well as in human endothelial cells, the latter being a primary source of cytokines during systemic infections. Global gene expression profiling of HPAIV-infected endothelial cells in the presence of the p38-specific inhibitor SB 202190 revealed that inhibition of p38 MAPK leads to reduced expression of IFNβ and other cytokines after H5N1 and H7N7 infection. More than 90% of all virus-induced genes were either partially or fully dependent on p38 signaling. Moreover, promoter analysis confirmed a direct impact of p38 on the IFNβ promoter activity. Furthermore, upon treatment with IFN or conditioned media from HPAIV-infected cells, p38 controls interferon-stimulated gene expression by coregulating STAT1 by phosphorylation at serine 727. In vivo inhibition of p38 MAPK greatly diminishes virus-induced cytokine expression concomitant with reduced viral titers, thereby protecting mice from lethal infection. These observations show that p38 MAPK acts on two levels of the antiviral IFN response. Initially the kinase regulates IFN induction and, at a later stage, p38 controls IFN signaling and thereby expression of IFN-stimulated genes. Thus, inhibition of MAP kinase p38 may be an antiviral strategy that protects mice from lethal influenza by suppressing excessive cytokine expression.
Ancient genes establish stress-induced mutation as a hallmark of cancer.
Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul
2017-01-01
Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to
Ancient genes establish stress-induced mutation as a hallmark of cancer
Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul
2017-01-01
Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to
Xiong, Hongchun; Guo, Huijun; Xie, Yongdun; Zhao, Linshu; Gu, Jiayu; Zhao, Shirong; Li, Junhui; Liu, Luxiang
2017-06-02
Salinity stress has become an increasing threat to food security worldwide and elucidation of the mechanism for salinity tolerance is of great significance. Induced mutation, especially spaceflight mutagenesis, is one important method for crop breeding. In this study, we show that a spaceflight-induced wheat mutant, named salinity tolerance 1 (st1), is a salinity-tolerant line. We report the characteristics of transcriptomic sequence variation induced by spaceflight, and show that mutations in genes associated with sodium ion transport may directly contribute to salinity tolerance in st1. Furthermore, GO and KEGG enrichment analysis of differentially expressed genes (DEGs) between salinity-treated st1 and wild type suggested that the homeostasis of oxidation-reduction process is important for salt tolerance in st1. Through KEGG pathway analysis, "Butanoate metabolism" was identified as a new pathway for salinity responses. Additionally, key genes for salinity tolerance, such as genes encoding arginine decarboxylase, polyamine oxidase, hormones-related, were not only salt-induced in st1 but also showed higher expression in salt-treated st1 compared with salt-treated WT, indicating that these genes may play important roles in salinity tolerance in st1. This study presents valuable genetic resources for studies on transcriptome variation caused by induced mutation and the identification of salt tolerance genes in crops.
Acetylation of hMOF Modulates H4K16ac to Regulate DNA Repair Genes in Response to Oxidative Stress.
Zhong, Jianing; Ji, Liying; Chen, Huiqian; Li, Xianfeng; Zhang, Jian'an; Wang, Xingxing; Wu, Weilin; Xu, Ying; Huang, Fei; Cai, Wanshi; Sun, Zhong Sheng
2017-01-01
Oxidative stress is considered to be a key risk state for a variety of human diseases. In response to oxidative stress, the regulation of transcriptional expression of DNA repair genes would be important to DNA repair and genomic stability. However, the overall pattern of transcriptional expression of DNA repair genes and the underlying molecular response mechanism to oxidative stress remain unclear. Here, by employing colorectal cancer cell lines following exposure to hydrogen peroxide, we generated expression profiles of DNA repair genes via RNA-seq and identified gene subsets that are induced or repressed following oxidative stress exposure. RRBS-seq analyses further indicated that transcriptional regulation of most of the DNA repair genes that were induced or repressed is independent of their DNA methylation status. Our analyses also indicate that hydrogen peroxide induces deacetylase SIRT1 which decreases chromatin affinity and the activity of histone acetyltransferase hMOF toward H4K16ac and results in decreased transcriptional expression of DNA repair genes. Taken together, our findings provide a potential mechanism by which oxidative stress suppresses DNA repair genes which is independent of the DNA methylation status of their promoters.
Chlorhexidine Induces VanA-Type Vancomycin Resistance Genes in Enterococci
Bhardwaj, Pooja; Ziegler, Elizabeth
2016-01-01
Chlorhexidine is a bisbiguanide antiseptic used for infection control. Vancomycin-resistant E. faecium (VREfm) is among the leading causes of hospital-acquired infections. VREfm may be exposed to chlorhexidine at supra- and subinhibitory concentrations as a result of chlorhexidine bathing and chlorhexidine-impregnated central venous catheter use. We used RNA sequencing to investigate how VREfm responds to chlorhexidine gluconate exposure. Among the 35 genes upregulated ≥10-fold after 15 min of exposure to the MIC of chlorhexidine gluconate were those encoding VanA-type vancomycin resistance (vanHAX) and those associated with reduced daptomycin susceptibility (liaXYZ). We confirmed that vanA upregulation was not strain or species specific by querying other VanA-type VRE. VanB-type genes were not induced. The vanH promoter was found to be responsive to subinhibitory chlorhexidine gluconate in VREfm, as was production of the VanX protein. Using vanH reporter experiments with Bacillus subtilis and deletion analysis in VREfm, we found that this phenomenon is VanR dependent. Deletion of vanR did not result in increased chlorhexidine susceptibility, demonstrating that vanHAX induction is not protective against chlorhexidine. As expected, VanA-type VRE is more susceptible to ceftriaxone in the presence of sub-MIC chlorhexidine. Unexpectedly, VREfm is also more susceptible to vancomycin in the presence of subinhibitory chlorhexidine, suggesting that chlorhexidine-induced gene expression changes lead to additional alterations in cell wall synthesis. We conclude that chlorhexidine induces expression of VanA-type vancomycin resistance genes and genes associated with daptomycin nonsusceptibility. Overall, our results indicate that the impacts of subinhibitory chlorhexidine exposure on hospital-associated pathogens should be further investigated in laboratory studies. PMID:26810654
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kovalova, Natalia, E-mail: kovalova@msu.edu
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a persistent environmental pollutant that activates the aryl hydrocarbon receptor (AhR) resulting in altered gene expression. In vivo, in vitro, and ex vivo studies have demonstrated that B cells are directly impaired by TCDD, and are a sensitive target as evidenced by suppression of antibody responses. The window of sensitivity to TCDD-induced suppression of IgM secretion among mouse, rat and human B cells is similar. Specifically, TCDD must be present within the initial 12 h post B cell stimulation, indicating that TCDD disrupts early signaling network(s) necessary for B lymphocyte activation and differentiation. Therefore, we hypothesized thatmore » TCDD treatment across three different species (mouse, rat and human) triggers a conserved, B cell-specific mechanism that is involved in TCDD-induced immunosuppression. RNA sequencing (RNA-Seq) was used to identify B cell-specific orthologous genes that are differentially expressed in response to TCDD in primary mouse, rat and human B cells. Time course studies identified TCDD-elicited differential expression of 515 human, 2371 mouse and 712 rat orthologous genes over the 24-h period. 28 orthologs were differentially expressed in response to TCDD in all three species. Overrepresented pathways enriched in all three species included cytokine-cytokine receptor interaction, ECM-receptor interaction, focal adhesion, regulation of actin cytoskeleton and pathways in cancer. Differentially expressed genes functionally associated with cell-cell signaling in humans, immune response in mice, and oxidation reduction in rats. Overall, these results suggest that despite the conservation of the AhR and its signaling mechanism, TCDD elicits species-specific gene expression changes. - Highlights: • Kovalova TAAP Highlights Nov. 2016 • RNA-Seq identified TCDD-induced gene expression in PWM-activated primary B cells. • TCDD elicited differential expression of 515 human, 2371 mouse
Kovi, Mallikarjuna Rao; Zhang, Yushan; Yu, Sibin; Yang, Gaiyu; Yan, Wenhao; Xing, Yongzhong
2011-09-01
Appropriate plant height is crucial for lodging resistance to improve the rice crop yield. The application of semi-dwarf 1 led to the green revolution in the 1960s, by predominantly increasing the rice yield. However, the frequent use of single sd1 gene sources may cause genetic vulnerability to pests and diseases. Identifying useful novel semi-dwarf genes is important for the genetic manipulation of plant architecture in practical rice breeding. In this study, introgression lines derived from two parents contrasting in plant height, Zhenshan 97 and Pokkali were employed to locate a gene with a large effect on plant height by the bulk segregant analysis method. A major gene, ph1, was mapped to a region closely linked to sd1 on chromosome 1; the additive effects of ph1 were more than 50 cm on the plant height and 2 days on the heading date in a BC(4)F(2) population and its progeny. ph1 was then fine mapped to BAC AP003227. Gene annotation indicated that LOC_OS01g65990 encoding a chitin-inducible gibberellin-responsive protein (CIGR), which belongs to the GRAS family, might be the right candidate gene of ph1. Co-segregation analysis of the candidate gene-derived marker finally confirmed its identity as the candidate gene. A higher expression level of the CIGR was detected in all the tested tissues in tall plants compared to those of short plants, especially in the young leaf sheath containing elongating tissues, which indicated its importance role in regulating plant height. ph1 showed a tremendous genetic effect on plant height, which is distinct from sd1 and could be a new resource for breeding semi-dwarf varieties.
Boswell, Mikki G; Wells, Melissa C; Kirk, Lyndsey M; Ju, Zhenlin; Zhang, Ziping; Booth, Rachell E; Walter, Ronald B
2009-03-01
Gene expression profiling using DNA microarray technology is a useful tool for assessing gene transcript level responses after an organism is exposed to environmental stress. Herein, we detail results from studies using an 8 k medaka (Oryzias latipes) microarray to assess modulated gene expression patterns upon hypoxia exposure of the live-bearing aquaria fish, Xiphophorus maculatus. To assess the reproducibility and reliability of using the medaka array in cross-genus hybridization, a two-factor ANOVA analysis of gene expression was employed. The data show the tissue source of the RNA used for array hybridization contributed more to the observed response of modulated gene targets than did the species source of the RNA. In addition, hierarchical clustering via heat map analyses of groupings of tissues and species (Xiphophorus and medaka) suggests that hypoxia induced similar responses in the same tissues from these two diverse aquatic model organisms. Our Xiphophorus results indicate 206 brain, 37 liver, and 925 gill gene targets exhibit hypoxia induced expression changes. Analysis of the Xiphophorus data to determine those features exhibiting a significant (p<0.05)+/-3 fold change produced only two gene targets within brain tissue and 80 features within gill tissue. Of these 82 characterized features, 39 were identified via homology searching (cut-off E-value of 1 x 10(-5)) and placed into one or more biological process gene ontology groups. Among these 39 genes, metabolic energy changes and manipulation was the most affected biological pathway (13 genes).
Gene regulatory network of unfolded protein response genes in endoplasmic reticulum stress.
Takayanagi, Sayuri; Fukuda, Riga; Takeuchi, Yuuki; Tsukada, Sakiko; Yoshida, Kenichi
2013-01-01
In the endoplasmic reticulum (ER), secretory and membrane proteins are properly folded and modified, and the failure of these processes leads to ER stress. At the same time, unfolded protein response (UPR) genes are activated to maintain homeostasis. Despite the thorough characterization of the individual gene regulation of UPR genes to date, further investigation of the mutual regulation among UPR genes is required to understand the complex mechanism underlying the ER stress response. In this study, we aimed to reveal a gene regulatory network formed by UPR genes, including immunoglobulin heavy chain-binding protein (BiP), X-box binding protein 1 (XBP1), C/EBP [CCAAT/enhancer-binding protein]-homologous protein (CHOP), PKR-like endoplasmic reticulum kinase (PERK), inositol-requiring 1 (IRE1), activating transcription factor 6 (ATF6), and ATF4. For this purpose, we focused on promoter-luciferase reporters for BiP, XBP1, and CHOP genes, which bear an ER stress response element (ERSE), and p5 × ATF6-GL3, which bears an unfolded protein response element (UPRE). We demonstrated that the luciferase activities of the BiP and CHOP promoters were upregulated by all the UPR genes, whereas those of the XBP1 promoter and p5 × ATF6-GL3 were upregulated by all the UPR genes except for BiP, CHOP, and ATF4 in HeLa cells. Therefore, an ERSE- and UPRE-centered gene regulatory network of UPR genes could be responsible for the robustness of the ER stress response. Finally, we revealed that BiP protein was degraded when cells were treated with DNA-damaging reagents, such as etoposide and doxorubicin; this finding suggests that the expression level of BiP is tightly regulated at the post-translational level, rather than at the transcriptional level, in the presence of DNA damage.
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Narimatsu, Masahiro; Maeda, Hisoka; Itoh, Shousaku; Atsumi, Toru; Ohtani, Takuya; Nishida, Keigo; Itoh, Motoyuki; Kamimura, Daisuke; Park, Sung-Joo; Mizuno, Katsunori; Miyazaki, Jun-ichi; Hibi, Masahiko; Ishihara, Katsuhiko; Nakajima, Koichi; Hirano, Toshio
2001-01-01
Signal transducer and activator of transcription 3 (STAT3) mediates signals of various growth factors and cytokines, including interleukin-6 (IL-6). In certain IL-6-responsive cell lines, the stat3 gene is autoregulated by STAT3 through a composite IL-6 response element in its promoter that contains a STAT3-binding element (SBE) and a cyclic AMP-responsive element. To reveal the nature and roles of the stat3 autoregulation in vivo, we generated mice that harbor a mutation in the SBE (stat3mSBE). The intact SBE was crucial for IL-6-induced stat3 gene activation in the spleen, especially in the red pulp region, the kidney, and both mature and immature T lymphocytes. The SBE was not required, however, for IL-6-induced stat3 gene activation in hepatocytes. T lymphocytes from the stat3mSBE/mSBE mice were more susceptible to apoptosis despite the presence of IL-6 than those from wild-type mice. Consistent with this, IL-6-dependent activation of the Pim-1 and junB genes, direct target genes for STAT3, was attenuated in T lymphocytes of the stat3mSBE/mSBE mice. Thus, the tissue-specific autoregulation of the stat3 gene operates in vivo and plays a role in IL-6-induced antiapoptotic signaling in T cells. PMID:11533249
Wagner, R Doug; Johnson, Shemedia J
2012-06-20
Vaginal epithelial cells have receptors, signal transduction mechanisms, and cytokine secretion capabilities to recruit host defenses against Candida albicans infections. This research evaluates how probiotic lactobacilli affect the defensive epithelial response. This study used quantitative reverse transcription-polymerase chain reaction assay (qRT-PCR), flow cytometry, and a multiplex immunoassay to observe changes in the regulation of gene expression related to cytokine responses in the VK2 (E6/E7) vaginal epithelial cell line treated with 17β-estradiol, exposed to probiotic Lactobacillus rhamnosus GR-1® and Lactobacillus reuteri RC-14® and challenged with C. albicans. Data were statistically evaluated by repeated measures analysis of variance and paired t-tests where appropriate. C. albicans induced mRNA expression of genes related to inflammatory cytokine responses associated with nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinase (MAPK) signal transduction pathways. 17β-estradiol suppressed expression of interleukin-1α (IL-1α), IL-6, IL-8, and tumor necrosis factor alpha (TNFα) mRNA. Probiotic lactobacilli suppressed C. albicans-induced nuclear factor-kappa B inhibitor kinase kinase alpha (Iκκα), Toll-like receptor-2 (TLR2), TLR6, IL-8, and TNFα, also suggesting inhibition of NF-κB signaling. The lactobacilli induced expression of IL-1α, and IL-1β mRNA, which was not inhibited by curcumin, suggesting that they induce an alternate inflammatory signal transduction pathway to NF-κB, such as the mitogen activated protein kinase and activator protein-1 (MAPK/AP-1) signal transduction pathway. Curcumin inhibited IL-13 secretion, suggesting that expression of this cytokine is mainly regulated by NF-κB signaling in VK2 cells. The results suggest that C. albicans infection induces pro-inflammatory responses in vaginal epithelial cells, and estrogen and lactobacilli suppress expression of NF-κB-related inflammatory genes. Probiotic
NASA Technical Reports Server (NTRS)
Moreno-Villanueva, Maria; Krieger, Stephanie; Feiveson, Alan; Kovach, Annie Marie; Buerkle, Alexander; Wu, Honglu
2017-01-01
Under Earth gravity conditions cellular damage can be counteracted by activation of the physiological defense mechanisms or through medical interventions. The mode of action of both, physiological response and medical interventions can be affected by microgravity leading to failure in repairing the damage. There are many studies reporting the effects of microgravity and/or radiation on cellular functions. However, little is known about the synergistic effects on cellular response to radiation when other endogenous cellular stress-response pathways are previously activated. Here, we investigated whether previous stimulation of the adrenergic receptor, which modulates immune response, affects radiation-induced apoptosis in immune cells under simulated microgravity conditions. Peripheral blood mononuclear cells (PBMCs) were stimulated with isoproterenol (a sympathomimetic drug) and exposed to 0.8 or 2Gy gamma-radiation in simulated microgravity versus Earth gravity. Expression of genes involved in adrenergic receptor pathways, DNA repair and apoptosis as well as the number of apoptotic cells and DNA strand breaks were determined. Our results showed that, under simulated microgravity conditions, previous treatment with isoproterenol prevented radiation-induced i) gene down regulation, ii) DNA strand breaks formation and iii) apoptosis induction. Interestedly, we found a radiation-induced increase of adrenergic receptor gene expression, which was also abolished in simulated microgravity. Understanding the mechanisms of isoproterenol-mediated radioprotection in simulated microgravity can help to develop countermeasures for space-associated health risks as well as radio-sensitizers for cancer therapy.
Le Dily, François; Baù, Davide; Pohl, Andy; Vicent, Guillermo P.; Serra, François; Soronellas, Daniel; Castellano, Giancarlo; Wright, Roni H.G.; Ballare, Cecilia; Filion, Guillaume; Marti-Renom, Marc A.
2014-01-01
The human genome is segmented into topologically associating domains (TADs), but the role of this conserved organization during transient changes in gene expression is not known. Here we describe the distribution of progestin-induced chromatin modifications and changes in transcriptional activity over TADs in T47D breast cancer cells. Using ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing), Hi-C (chromosome capture followed by high-throughput sequencing), and three-dimensional (3D) modeling techniques, we found that the borders of the ∼2000 TADs in these cells are largely maintained after hormone treatment and that up to 20% of the TADs could be considered as discrete regulatory units where the majority of the genes are either transcriptionally activated or repressed in a coordinated fashion. The epigenetic signatures of the TADs are homogeneously modified by hormones in correlation with the transcriptional changes. Hormone-induced changes in gene activity and chromatin remodeling are accompanied by differential structural changes for activated and repressed TADs, as reflected by specific and opposite changes in the strength of intra-TAD interactions within responsive TADs. Indeed, 3D modeling of the Hi-C data suggested that the structure of TADs was modified upon treatment. The differential responses of TADs to progestins and estrogens suggest that TADs could function as “regulons” to enable spatially proximal genes to be coordinately transcribed in response to hormones. PMID:25274727
Diet-Induced Obesity Reprograms the Inflammatory Response of the Murine Lung to Inhaled Endotoxin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tilton, Susan C.; Waters, Katrina M.; Karin, Norman J.
The co-occurrence of environmental factors is common in complex human diseases and, as such, understanding the molecular responses involved is essential to determine risk and susceptibility to disease. We have investigated the key biological pathways that define susceptibility for pulmonary infection during obesity in diet-induced obese (DIO) and regular weight (RW) C57BL/6 mice exposed to inhaled lipopolysaccharide (LPS). LPS induced a strong inflammatory response in all mice as indicated by elevated cell counts of macrophages and neutrophils and levels of proinflammatory cytokines (MDC, MIP-1γ, IL-12, RANTES) in the bronchoalveolar lavage fluid. Additionally, DIO mice exhibited 50% greater macrophage cell counts,more » but decreased levels of the cytokines, IL-6, TARC, TNF-α, and VEGF relative to RW mice. Microarray analysis of lung tissue showed over half of the LPS-induced expression in DIO mice consisted of genes unique for obese mice, suggesting that obesity reprograms how the lung responds to subsequent insult. In particular, we found that obese animals exposed to LPS have gene signatures showing increased inflammatory and oxidative stress response and decreased antioxidant capacity compared with RW. Because signaling pathways for these responses can be common to various sources of environmentally induced lung damage, we further identified biomarkers that are indicative of specific toxicant exposure by comparing gene signatures after LPS exposure to those from a parallel study with cigarette smoke. These data show obesity may increase sensitivity to further insult and that co-occurrence of environmental stressors result in complex biosignatures that are not predicted from analysis of individual exposures.« less
Hu, Bo Hua; Cai, Qunfeng; Hu, Zihua; Patel, Minal; Bard, Jonathan; Jamison, Jennifer; Coling, Donald
2012-01-01
Matrix metalloproteinases (MMPs) and their related gene products regulate essential cellular functions. An imbalance in MMPs has been implicated in various neurological disorders, including traumatic injuries. Here, we report a role for MMPs and their related gene products in the modulation of cochlear responses to acoustic trauma in rats. The normal cochlea was shown to be enriched in MMP enzymatic activity, and this activity was reduced in a time-dependent fashion after traumatic noise injury. The analysis of gene expression by RNA-seq and qRT-PCR revealed the differential expression of MMPs and their related genes between functionally specialized regions of the sensory epithelium. The expression of these genes was dynamically regulated between the acute and chronic phases of noise-induced hearing loss. Moreover, noise-induced expression changes in two endogenous MMP inhibitors, Timp1 and Timp2, in sensory cells were dependent upon the stage of nuclear condensation, suggesting a specific role for MMP activity in sensory cell apoptosis. A short-term application of doxycycline, a broad-spectrum inhibitor of MMPs, prior to noise exposure reduced noise-induced hearing loss and sensory cell death. By contrast, a 7-day treatment compromised hearing sensitivity and potentiated noise-induced hearing loss. This detrimental effect of the long-term inhibition of MMPs on noise-induced hearing loss was further confirmed using targeted Mmp7 knockout mice. Together, these observations suggest that MMPs and their related genes participate in the regulation of cochlear responses to acoustic overstimulation and that the modulation of MMP activity can serve as a novel therapeutic target for the reduction of noise-induced cochlear damage. PMID:23100416
Li, Wande
2013-01-01
Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664
Gene expression profiles responses to aphid feeding in chrysanthemum (Chrysanthemum morifolium).
Xia, Xiaolong; Shao, Yafeng; Jiang, Jiafu; Ren, Liping; Chen, Fadi; Fang, Weimin; Guan, Zhiyong; Chen, Sumei
2014-12-02
Chrysanthemum is an important ornamental plant all over the world. It is easily attacked by aphid, Macrosiphoniella sanbourni. The molecular mechanisms of plant defense responses to aphid are only partially understood. Here, we investigate the gene expression changes in response to aphid feeding in chrysanthemum leaf by RNA-Seq technology. Three libraries were generated from pooled leaf tissues of Chrysanthemum morifolium 'nannongxunzhang' that were collected at different time points with (Y) or without (CK) aphid infestations and mock puncture treatment (Z), and sequenced using an Illumina HiSeqTM 2000 platform. A total of 7,363,292, 7,215,860 and 7,319,841 clean reads were obtained in library CK, Y and Z, respectively. The proportion of clean reads was >97.29% in each library. Approximately 76.35% of the clean reads were mapped to a reference gene database including all known chrysanthemum unigene sequences. 1,157, 527 and 340 differentially expressed genes (DEGs) were identified in the comparison of CK-VS-Y, CK-VS-Z and Z-VS-Y, respectively. These DEGs were involved in phytohormone signaling, cell wall biosynthesis, photosynthesis, reactive oxygen species (ROS) pathway and transcription factor regulatory networks, and so on. Changes in gene expression induced by aphid feeding are shown to be multifaceted. There are various forms of crosstalk between different pathways those genes belonging to, which would allow plants to fine-tune its defense responses.
Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H
2006-10-01
We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.
Study of the Genes and Mechanism Involved in the Radioadaptive Response
NASA Technical Reports Server (NTRS)
Dasgupta, Pushan R.
2009-01-01
The radioadaptive response is a phenomenon where exposure to a prior low dose of radiation reduces the level of damage induced by a subsequent high radiation dose. The molecular mechanism behind this is still not well understood. Learning more about the radioadaptive response is critical for long duration spaceflight since astronauts are exposed to low levels of cosmic radiation. The micronucleus assay was used to measure the level of damage caused by radiation. Although cells which were not washed with phosphate buffered saline (PBS) after a low priming dose of 5cGy did not show adaptation to the challenge dose, washing the cells with PBS and giving the cells fresh media after the low dose did allow radioadaptation to occur. This is consistent with the results of a previous publication by another research group. In the present study, genes involved in DNA damage signaling and the oxidative stress response were studied using RT PCR techniques in order to look at changes in expression level after the low dose with or without washing. Our preliminary results indicate that upregulation of oxidative stress response genes ANGPTL7, NCF2, TTN, and SRXN1 may be involved in the radioadaptive response. The low dose of radiation alone was found to activate the oxidative stress response genes GPR156 and MTL5, whereas, washing the cells alone caused relatively robust upregulation of the oxidative stress response genes DUSP1 and PTGS2. Washing after the priming dose showed some changes in the expression level of several DNA damage signaling genes. In addition, we studied whether washing the cells after the priming dose has an effect on the level of nitric oxide in both the media and cells, since nitric oxide levels are known to increase in the media of the cells after a high dose of radiation only if the cells were already exposed to a low priming dose. Based on this preliminary study, we propose that washing the cells after priming exposure actually eliminates some factor
Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C
2010-01-01
Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947
[Immune response induced by HIV DNA vaccine combined with recombinant adeno-associated virus].
Liu, Yan-zheng; Zhou, Ling; Wang, Qi; Ye, Shu-qing; Li, Hong-xia; Zeng, Yi
2004-09-01
HIV-1 DNA vaccine and recombinant adeno-associated virus (rAAV) expressing gagV3 gene of HIV-1 subtype B were constructed and BALB/c mice were immunized by vaccination regimen consisting of consecutive priming with DNA vaccine and boosting with rAAV vaccine; the CTL and antibody response were detected and compared with those induced by DNA vaccine or rAAV vaccine separately. HIV-1 subtype B gagV3 gene was inserted into the polyclonal site of plasmid pCI-neo, DNA vaccine pCI-gagV3 was thereby constructed; pCI-gagV3 was transfected into p815 cells, G-418-resistant cells were obtained through screening transfected cells with G418, the expression of HIV-1 antigen in G-418-resistant cells was detected by EIA; BALB/c mice were immunized with pCI-gagV3 and the immune response was tested; BALB/c mouse immunized with pCI-gagV3 and combined with rAAV expressing the same gagV3 genes were tested for antibody level in sera by EIA method and cytotoxicity response by LDH method. pCI-gagV3 could express HIV-1 gene in p815 cells; pCI-gagV3 could induce HIV-1 specific humoral and cell-mediated immune response in BALB/c mice. The HIV-1 specific antibody level was 1/20; when the ratio of effector cells: target cells was 50:1, the average specific cytotoxicity was 41.7%; there was no evident increase in the antibody level induced by pCI-gagV3 combined with rAAV, but there was increase in CTL response, the average specific cytotoxicity was 61.3% when effector cells: target cells ratio was 50:1. HIV-1 specific cytotoxicity in BALB/c mice can be increased by immunization of BALB/c mice with DNA vaccine combined with rAAV vaccine.
Hai, Bo; Zhao, Qingguo; Qin, Lizheng; Rangaraj, Dharanipathy; Gutti, Veera R; Liu, Fei
2016-05-01
Irreversible hypofunction of salivary glands is common in head and neck cancer survivors treated with radiotherapy and can only be temporarily relieved with current treatments. We found in an inducible sonic hedgehog (Shh) transgenic mouse model that transient activation of the Hedgehog pathway after irradiation rescued salivary gland function in males by preserving salivary stem/progenitor cells and parasympathetic innervation. To translate these findings into feasible clinical application, we evaluated the effects of Shh gene transfer to salivary glands of wild-type mice on irradiation-induced hyposalivation. Shh or control GFP gene was delivered by noninvasive retrograde ductal instillation of corresponding adenoviral vectors. In both male and female mice, Shh gene delivery efficiently activated Hedgehog/Gli signaling, and significantly improved stimulated saliva secretion and preserved saliva-producing acinar cells after irradiation. In addition to preserving parasympathetic innervation through induction of neurotrophic factors, Shh gene delivery also alleviated the irradiation damage of the microvasculature, likely via inducing angiogenic factors, but did not expand the progeny of cells responsive to Hedgehog/Gli signaling. These data indicate that transient activation of the Hedgehog pathway by gene delivery is promising to rescue salivary function after irradiation in both sexes, and the Hedgehog/Gli pathway may function mainly in cell nonautonomous manners to achieve the rescue effect.
Gressier, Florence; Porcelli, Stefano; Calati, Raffaella; Serretti, Alessandro
2016-02-01
Clozapine (CLZ) is the prototype atypical antipsychotic and it has many advantages over other antipsychotic drugs. Several data suggest that both CLZ response and induced weight gain are strongly determined by genetic variability. However, results remain mainly inconclusive. We aim to review the literature data about pharmacogenetics studies on CLZ efficacy, focusing on pharmacodynamic genes. Further, we performed meta-analyses on response when at least three studies for each polymorphism were available. Sensitivity analyses were conducted on Caucasian population when feasible. Electronic literature search was performed to identify pertinent studies published until May 2014 using PubMed, ISI Web of Knowledge and PsycINFO databases. For meta-analyses, data were entered and analyzed through RevMan version 5.2 using a random-effect model. Our literature search yielded 9266 articles on CLZ; among these, we identified 59 pertinent pharmacogenetic studies. Genotype data were retrieved for 14 polymorphisms in 9 genes. Among these, we had available data from at least three independent samples for 8 SNPs in 6 genes to perform meta-analyses: DRD2 rs1799732, DRD3 rs6280, HTR2A rs6313, rs6311, rs6314, HTR2C rs6318, HTR3A rs1062613, TNFa rs1800629. Although literature review provided conflicting results, in meta-analyses three genetic variants within serotonin genes resulted associated to CLZ response: rs6313 and rs6314 within HTR2A gene and rs1062613 within HT3A gene. On the other hand, no clear finding emerged for CLZ-induced weight gain. Our results suggest a possible serotonergic modulation of CLZ clinical response. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.
The Yeast Environmental Stress Response Regulates Mutagenesis Induced by Proteotoxic Stress
Shor, Erika; Fox, Catherine A.; Broach, James R.
2013-01-01
Conditions of chronic stress are associated with genetic instability in many organisms, but the roles of stress responses in mutagenesis have so far been elucidated only in bacteria. Here, we present data demonstrating that the environmental stress response (ESR) in yeast functions in mutagenesis induced by proteotoxic stress. We show that the drug canavanine causes proteotoxic stress, activates the ESR, and induces mutagenesis at several loci in an ESR-dependent manner. Canavanine-induced mutagenesis also involves translesion DNA polymerases Rev1 and Polζ and non-homologous end joining factor Ku. Furthermore, under conditions of chronic sub-lethal canavanine stress, deletions of Rev1, Polζ, and Ku-encoding genes exhibit genetic interactions with ESR mutants indicative of ESR regulating these mutagenic DNA repair processes. Analyses of mutagenesis induced by several different stresses showed that the ESR specifically modulates mutagenesis induced by proteotoxic stress. Together, these results document the first known example of an involvement of a eukaryotic stress response pathway in mutagenesis and have important implications for mechanisms of evolution, carcinogenesis, and emergence of drug-resistant pathogens and chemotherapy-resistant tumors. PMID:23935537
Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather
2012-07-01
• Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.
Schippers, I J; Kloppenburg, M; Snippe, L; Ab, G
1994-11-01
The chicken very low density apolipoprotein II (apoVLDLII) gene is estrogen-inducible and specifically expressed in liver. We examined the possible involvement of the retinoid X receptor (RXR) and its ligand 9-cis-retinoic acid (9-cis-RA) in the activation of the apoVLDLII promoter. We first concentrated on a potential RXR recognition site, which deviates at only one position from a perfect direct A/GGGTCA repeat spaced by one nucleotide (DR-1) and was earlier identified as a common HNF-4/COUP-TF recognition site. However, band shift analysis revealed that this imperfect DR-1 motif does not interact with RXR alpha-homodimers. In accordance with this observation we found that this regulatory element does not mediate transactivation through RXR alpha in the presence of 9-cis-RA. However, our experiments revealed another, unexpected, effect of 9-cis-RA. Instead of stimulating, 9-cis-RA attenuated estrogen-induced expression of transfected estrogen-responsive VLDL-CAT reporter plasmids. This repression appeared to take place through the main estrogen response element (ERE) of the gene. Importantly, 9-cis-RA also strongly repressed the estrogen-induced expression of the endogenous apoVLDLII gene in cultured chicken hepatoma cells.
Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio
2011-11-25
We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.
Mazzoni, C; Santori, F; Saliola, M; Falcone, C
2000-01-01
KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.
Keller, H; Pamboukdjian, N; Ponchet, M; Poupet, A; Delon, R; Verrier, J L; Roby, D; Ricci, P
1999-01-01
The rapid and effective activation of disease resistance responses is essential for plant defense against pathogen attack. These responses are initiated when pathogen-derived molecules (elicitors) are recognized by the host. We have developed a strategy for creating novel disease resistance traits whereby transgenic plants respond to infection by a virulent pathogen with the production of an elicitor. To this end, we generated transgenic tobacco plants harboring a fusion between the pathogen-inducible tobacco hsr 203J gene promoter and a Phytophthora cryptogea gene encoding the highly active elicitor cryptogein. Under noninduced conditions, the transgene was silent, and no cryptogein could be detected in the transgenic plants. In contrast, infection by the virulent fungus P. parasitica var nicotianae stimulated cryptogein production that coincided with the fast induction of several defense genes at and around the infection sites. Induced elicitor production resulted in a localized necrosis that resembled a P. cryptogea-induced hypersensitive response and that restricted further growth of the pathogen. The transgenic plants displayed enhanced resistance to fungal pathogens that were unrelated to Phytophthora species, such as Thielaviopsis basicola, Erysiphe cichoracearum, and Botrytis cinerea. Thus, broad-spectrum disease resistance of a plant can be generated without the constitutive synthesis of a transgene product. PMID:9927640
Hao, Hai-Ting; Zhao, Xia; Shang, Qian-Han; Wang, Yun; Guo, Zhi-Hong; Zhang, Yu-Bao; Xie, Zhong-Kui; Wang, Ruo-Yu
2016-01-01
Some plant growth-promoting rhizobacteria (PGPR) regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE) profiling of different growth stages (seedling and mature) and tissues (leaves and roots). Compared with the control, 1,507 and 820 differentially expressed genes (DEGs) were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation) with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response to biotic
Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression
1998-05-01
Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method...termed subtractive display. The subtractive display screen identified 42 monoterpene -induced genes comprising 9 known genes and 33 unidentified genes...as well as 58 monoterpene -repressed genes comprising 1 known gene and 57 unidentified genes. Several of the identified differentially expressed
Transcriptome Analysis of Early Responsive Genes in Rice during Magnaporthe oryzae Infection.
Wang, Yiming; Kwon, Soon Jae; Wu, Jingni; Choi, Jaeyoung; Lee, Yong-Hwan; Agrawal, Ganesh Kumar; Tamogami, Shigeru; Rakwal, Randeep; Park, Sang-Ryeol; Kim, Beom-Gi; Jung, Ki-Hong; Kang, Kyu Young; Kim, Sang Gon; Kim, Sun Tae
2014-12-01
Rice blast disease caused by Magnaporthe oryzae is one of the most serious diseases of cultivated rice (Oryza sativa L.) in most rice-growing regions of the world. In order to investigate early response genes in rice, we utilized the transcriptome analysis approach using a 300 K tilling microarray to rice leaves infected with compatible and incompatible M. oryzae strains. Prior to the microarray experiment, total RNA was validated by measuring the differential expression of rice defense-related marker genes (chitinase 2, barwin, PBZ1, and PR-10) by RT-PCR, and phytoalexins (sakuranetin and momilactone A) with HPLC. Microarray analysis revealed that 231 genes were up-regulated (>2 fold change, p < 0.05) in the incompatible interaction compared to the compatible one. Highly expressed genes were functionally characterized into metabolic processes and oxidation-reduction categories. The oxidative stress response was induced in both early and later infection stages. Biotic stress overview from MapMan analysis revealed that the phytohormone ethylene as well as signaling molecules jasmonic acid and salicylic acid is important for defense gene regulation. WRKY and Myb transcription factors were also involved in signal transduction processes. Additionally, receptor-like kinases were more likely associated with the defense response, and their expression patterns were validated by RT-PCR. Our results suggest that candidate genes, including receptor-like protein kinases, may play a key role in disease resistance against M. oryzae attack.
Xing, Zhiguo; Ni, Yaping; Zhao, Junjie; Ma, Xudong
2017-05-01
Glioblastoma multiforme is a type of central nervous system tumor with extremely poor prognosis. Previously, hydrogen peroxide (H 2 O 2 ), which promotes the oxidative stress response, has been reported to induce the apoptosis of glioma cells. Recently, secreted frizzled-related protein 1 (SFRP1) has been shown to be associated with various types of malignant tumors and with H 2 O 2 -induced oxidative stress in cardiomyocytes by negatively regulating the Wnt signaling pathway. This study aimed to explore SFRP1 expression and its roles in H 2 O 2 -induced apoptosis in human glioma cells. We found that the SFRP1 level was decreased in several human glioma cell lines, including U87, U251, and SW1783 cells. In U251 cells, SFRP1 could function as a cancer suppressor gene, and the growth of U251 cells could be inhibited not only by H 2 O 2 but also by the overexpression of SFRP1. Furthermore, we demonstrated that H 2 O 2 -induced SFRP1 gene demethylation partially contributed to H 2 O 2 -induced U251 cell apoptosis, which was verified by studies using an SFRP inhibitor (WAY-316606). Our research identified that H 2 O 2 -induced SFRP1 gene demethylation contributes to H 2 O 2 -induced apoptosis in human U251 glioma cells.
Nomikou, N; Feichtinger, G A; Saha, S; Nuernberger, S; Heimel, P; Redl, H; McHale, A P
2018-01-01
Gene-activated matrix (GAM)-based therapeutics for tissue regeneration are limited by efficacy, the lack of spatiotemporal control and availability of target cells, all of which impact negatively on their translation to the clinic. Here, an advanced ultrasound-responsive GAM is described containing target cells that facilitates matrix-assisted sonoporation (MAS) to induce osteogenic differentiation. Ultrasound-responsive GAMs consisting of fibrin/collagen hybrid-matrices containing microbubbles, bone morphogenetic protein BMP2/7 coexpression plasmids together with C2C12 cells were treated with ultrasound either in vitro or following parenteral intramuscular implantation in vivo. Using direct measurement for alkaline phosphatase activity, von Kossa staining and immunohistochemical analysis for osteocalcin expression, MAS-stimulated osteogenic differentiation was confirmed in the GAMs in vitro 7 days after treatment with ultrasound. At day 30 post-treatment with ultrasound, ectopic osteogenic differentiation was confirmed in vivo using X-ray microcomputed tomography and histological analysis. Osteogenic differentiation was indicated by the presence of ectopic bone structures in all animals treated with MAS. In addition, bone volumes in this group were statistically greater than those in the control groups. This novel approach of incorporating a MAS capability into GAMs could be exploited to facilitate ex vivo gene transfer with subsequent surgical implantation or alternatively provide a minimally invasive means of stimulating in situ transgene delivery for osteoinductive gene-based therapies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.
Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L
2009-10-01
To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the
Min, Ting; Fang, Fang; Ge, Hang; Shi, Yan-na; Luo, Zheng-rong; Yao, Yun-cong; Grierson, Donald; Yin, Xue-ren; Chen, Kun-song
2014-01-01
A hypoxic environment is generally undesirable for most plants and stimulates anaerobic metabolism. It is a beneficial treatment, however, for the removal of astringency from persimmon to improve the fruit quality after harvest. High soluble tannins (SCTs) content is one of most important causes of astringency. High CO2 (95%) treatment effectively reduced SCTs in both “Mopan” and “Gongcheng-shuishi” persimmon fruit by causing increases in acetaldehyde. Using RNA-seq and realtime PCR, twelve ethylene response factor genes (DkERF11-22) were isolated and characterized, to determine those responsive to high CO2 treatment. Only two genes, DkERF19 and DkERF22, showed trans-activation effects on the promoters of deastringency-related genes pyruvate decarboxylase genes (DkPDC2 and DkPDC3) and the transcript levels of these genes was enhanced by hypoxia. Moreover, DkERF19 and the previously isolated DkERF9 had additive effects on activating the DkPDC2 promoter. Taken together, these results provide further evidence that transcriptome changes in the level of DkERF mRNAs regulate deastringency-related genes and their role in the mechanism of persimmon fruit deastringency is discussed. PMID:24805136
Trichostatin A Selectively Suppresses the Cold-Induced Transcription of the ZmDREB1 Gene in Maize
Hu, Yong; Zhang, Lu; Zhao, Lin; Li, Jun; He, Shibin; Zhou, Kun; Yang, Fei; Huang, Min; Jiang, Li; Li, Lijia
2011-01-01
Post-translational modifications of histone proteins play a crucial role in responding to environmental stresses. Histone deacetylases (HDACs) catalyze the removal of an acetyl group from histones and are generally believed to be a transcriptional repressor. In this paper, we report that cold treatment highly induces the up-regulation of HDACs, leading to global deacetylation of histones H3 and H4. Treatment of maize with the HDAC inhibitor trichostatin A (TSA) under cold stress conditions strongly inhibits induction of the maize cold-responsive genes ZmDREB1 and ZmCOR413. However, up-regulation of the ZmICE1 gene in response to cold stress is less affected. The expression of drought and salt induced genes, ZmDBF1 and rab17, is almost unaffected by TSA treatment. Thus, these observations show that HDACs may selectively activate transcription. The time course of TSA effects on the expression of ZmDREB1 and ZmCOR413 genes indicates that HDACs appear to directly activate the ZmDREB1 gene, which in turn modulates ZmCOR413 expression. After cold treatment, histone hyperacetylation and DNA demethylation occurs in the ICE1 binding region, accompanied by an increase in accessibility to micrococcal nuclease (MNase). The two regions adjacent to the ICE1 binding site remain hypoacetylated and methylated. However, during cold acclimation, TSA treatment increases the acetylation status and accessibility of MNase and decreases DNA methylation at these two regions. However, TSA treatment does not affect histone hyperacetylation and DNA methylation levels at the ICE1 binding regions of the ZmDREB1 gene. Altogether, our findings indicate that HDACs positively regulate the expression of the cold-induced ZmDREB1 gene through histone modification and chromatin conformational changes and that this activation is both gene and site selective. PMID:21811564
Guarnieri, Douglas J.; Brayton, Catherine E.; Richards, Sarah M.; Maldonado-Aviles, Jaime; Trinko, Joseph R.; Nelson, Jessica; Taylor, Jane R.; Gourley, Shannon L.; DiLeone, Ralph J.
2011-01-01
Background Food restriction is known to enhance learning and motivation. The neural mechanisms underlying these responses likely involve alterations in gene expression in brain regions mediating the motivation to feed. Methods Analysis of gene expression profiles in male C57BL6/J mice using whole-genome microarrays was completed in the medial prefrontal cortex, nucleus accumbens, ventral tegmental area, and the hypothalamus following a five day food restriction. Quantitative PCR was used to validate these findings and determine the time-course of expression changes. Plasma levels of the stress hormone corticosterone (CORT) were measured by ELISA. Expression changes were measured in adrenalectomized animals that underwent food restriction, as well as in animals receiving daily injections of CORT. Progressive ratio responding for food, a measure of motivated behavior, was assessed after CORT treatment in restricted and fed animals. Results Brief food restriction results in an upregulation of peripheral stress responsive genes in the mammalian brain. Time-course analysis demonstrated rapid and persistent expression changes in all four brain regions under study. Administration of CORT to non-restricted animals was sufficient to induce a subset of the genes, and alterations in gene expression after food restriction were dependent on intact adrenal glands. CORT can increase the motivation to work for food only in the restricted state. Conclusions These data demonstrate a central role for CORT in mediating both molecular and behavioral responses to food restriction. The stress hormone-induced alterations in gene expression described here may be relevant for both adaptive and pathological responses to stress. PMID:21855858
Sellamuthu, Rajendran; Umbright, Christina; Li, Shengqiao; Kashon, Michael; Joseph, Pius
2015-01-01
A proper understanding of the mechanisms underlying crystalline silica-induced pulmonary toxicity has implications in the management and potential prevention of the adverse health effects associated with silica exposure including silicosis, cancer and several auto-immune diseases. Human lung type II epithelial cells and rat lungs exposed to crystalline silica were employed as experimental models to determine global gene expression changes in order to understand the molecular mechanisms underlying silica-induced pulmonary toxicity. The differential gene expression profile induced by silica correlated with its toxicity in the A549 cells. The biological processes perturbed by silica exposure in the A549 cells and rat lungs, as identified by the bioinformatics analysis of the differentially expressed genes, demonstrated significant similarity. Functional categorization of the differentially expressed genes identified cancer, cellular movement, cellular growth and proliferation, cell death, inflammatory response, cell cycle, cellular development, and genetic disorder as top ranking biological functions perturbed by silica exposure in A549 cells and rat lungs. Results of our study, in addition to confirming several previously identified molecular targets and mechanisms involved in silica toxicity, identified novel molecular targets and mechanisms potentially involved in silica-induced pulmonary toxicity. Further investigations, including those focused on the novel molecular targets and mechanisms identified in the current study may result in better management and, possibly, reduction and/or prevention of the potential adverse health effects associated with crystalline silica exposure. PMID:22087542
Dieterich, Christine; Puey, Angela; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C.; Ng, Hanna H.
2009-01-01
Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and sacrificed on day 8. Clinical chemistry and histopathology demonstrated kidney injury at 400 mg/kg only. Hierarchical clustering analysis revealed that kidney gene expression profiles of all mice treated at 400 mg/kg clustered with those of mice administered 200 mg/kg iv. Transcriptional profiling might thus be more sensitive than current clinical markers for detecting kidney damage, though the profiles can differ with the route of administration. Analysis of transcripts whose expression was changed by at least twofold compared with vehicle saline after high iv and ip doses of vancomycin suggested the possibility of oxidative stress and mitochondrial damage in vancomycin-induced toxicity. In addition, our data showed changes in expression of several transcripts from the complement and inflammatory pathways. Such expression changes were confirmed by relative real-time reverse transcription–polymerase chain reaction. Finally, our results further substantiate the use of gene markers of kidney toxicity such as KIM-1/Havcr1, as indicators of renal injury. PMID:18930951
Dieterich, Christine; Puey, Angela; Lin, Sylvia; Lyn, Sylvia; Swezey, Robert; Furimsky, Anna; Fairchild, David; Mirsalis, Jon C; Ng, Hanna H
2009-01-01
Vancomycin, one of few effective treatments against methicillin-resistant Staphylococcus aureus, is nephrotoxic. The goals of this study were to (1) gain insights into molecular mechanisms of nephrotoxicity at the genomic level, (2) evaluate gene markers of vancomycin-induced kidney injury, and (3) compare gene expression responses after iv and ip administration. Groups of six female BALB/c mice were treated with seven daily iv or ip doses of vancomycin (50, 200, and 400 mg/kg) or saline, and sacrificed on day 8. Clinical chemistry and histopathology demonstrated kidney injury at 400 mg/kg only. Hierarchical clustering analysis revealed that kidney gene expression profiles of all mice treated at 400 mg/kg clustered with those of mice administered 200 mg/kg iv. Transcriptional profiling might thus be more sensitive than current clinical markers for detecting kidney damage, though the profiles can differ with the route of administration. Analysis of transcripts whose expression was changed by at least twofold compared with vehicle saline after high iv and ip doses of vancomycin suggested the possibility of oxidative stress and mitochondrial damage in vancomycin-induced toxicity. In addition, our data showed changes in expression of several transcripts from the complement and inflammatory pathways. Such expression changes were confirmed by relative real-time reverse transcription-polymerase chain reaction. Finally, our results further substantiate the use of gene markers of kidney toxicity such as KIM-1/Havcr1, as indicators of renal injury.
Riahi, Reza; Wang, Shue; Long, Min; Li, Na; Chiou, Pei-Yu; Zhang, Donna D; Wong, Pak Kin
2014-04-22
The photothermal effect of plasmonic nanostructures has numerous applications, such as cancer therapy, photonic gene circuit, large cargo delivery, and nanostructure-enhanced laser tweezers. The photothermal operation can also induce unwanted physical and biochemical effects, which potentially alter the cell behaviors. However, there is a lack of techniques for characterizing the dynamic cell responses near the site of photothermal operation with high spatiotemporal resolution. In this work, we show that the incorporation of locked nucleic acid probes with gold nanorods allows photothermal manipulation and real-time monitoring of gene expression near the area of irradiation in living cells and animal tissues. The multimodal gold nanorod serves as an endocytic delivery reagent to transport the probes into the cells, a fluorescence quencher and a binding competitor to detect intracellular mRNA, and a plasmonic photothermal transducer to induce cell ablation. We demonstrate the ability of the gold nanorod-locked nucleic acid complex for detecting the spatiotemporal gene expression in viable cells and tissues and inducing photothermal ablation of single cells. Using the gold nanorod-locked nucleic acid complex, we systematically characterize the dynamic cellular heat shock responses near the site of photothermal operation. The gold nanorod-locked nucleic acid complex enables mapping of intracellular gene expressions and analyzes the photothermal effects of nanostructures toward various biomedical applications.
Martin, Guiomar; Soy, Judit; Monte, Elena
2016-01-01
Members of the PIF quartet (PIFq; PIF1, PIF3, PIF4, and PIF5) collectively contribute to induce growth in Arabidopsis seedlings under short day (SD) conditions, specifically promoting elongation at dawn. Their action involves the direct regulation of growth-related and hormone-associated genes. However, a comprehensive definition of the PIFq-regulated transcriptome under SD is still lacking. We have recently shown that SD and free-running (LL) conditions correspond to "growth" and "no growth" conditions, respectively, correlating with greater abundance of PIF protein in SD. Here, we present a genomic analysis whereby we first define SD-regulated genes at dawn compared to LL in the wild type, followed by identification of those SD-regulated genes whose expression depends on the presence of PIFq. By using this sequential strategy, we have identified 349 PIF/SD-regulated genes, approximately 55% induced and 42% repressed by both SD and PIFq. Comparison with available databases indicates that PIF/SD-induced and PIF/SD-repressed sets are differently phased at dawn and mid-morning, respectively. In addition, we found that whereas rhythmicity of the PIF/SD-induced gene set is lost in LL, most PIF/SD-repressed genes keep their rhythmicity in LL, suggesting differential regulation of both gene sets by the circadian clock. Moreover, we also uncovered distinct overrepresented functions in the induced and repressed gene sets, in accord with previous studies in other examined PIF-regulated processes. Interestingly, promoter analyses showed that, whereas PIF/SD-induced genes are enriched in direct PIF targets, PIF/SD-repressed genes are mostly indirectly regulated by the PIFs and might be more enriched in ABA-regulated genes.
Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan
2015-09-17
Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.
Nuñez-Badinez, Paulina; Sepúlveda, Hugo; Diaz, Emilio; Greffrath, Wolfgang; Treede, Rolf-Detlef; Stehberg, Jimmy; Montecino, Martin; van Zundert, Brigitte
2018-05-01
The purinergic receptor P2X3 (P2X3-R) plays important roles in molecular pathways of pain, and reduction of its activity or expression effectively reduces chronic inflammatory and neuropathic pain sensation. Inflammation, nerve injury, and cancer-induced pain can increase P2X3-R mRNA and/or protein levels in dorsal root ganglia (DRG). However, P2X3-R expression is unaltered or even reduced in other pain studies. The reasons for these discrepancies are unknown and might depend on the applied traumatic intervention or on intrinsic factors such as age, gender, genetic background, and/or epigenetics. In this study, we sought to get insights into the molecular mechanisms responsible for inflammatory hyperalgesia by determining P2X3-R expression in DRG neurons of juvenile male rats that received a Complete Freund's Adjuvant (CFA) bilateral paw injection. We demonstrate that all CFA-treated rats showed inflammatory hyperalgesia, however, only a fraction (14-20%) displayed increased P2X3-R mRNA levels, reproducible across both sides. Immunostaining assays did not reveal significant increases in the percentage of P2X3-positive neurons, indicating that increased P2X3-R at DRG somas is not critical for inducing inflammatory hyperalgesia in CFA-treated rats. Chromatin immunoprecipitation (ChIP) assays showed a correlated (R 2 = 0.671) enrichment of the transcription factor Runx1 and the epigenetic active mark histone H3 acetylation (H3Ac) at the P2X3-R gene promoter in a fraction of the CFA-treated rats. These results suggest that animal-specific increases in P2X3-R mRNA levels are likely associated with the genetic/epigenetic context of the P2X3-R locus that controls P2X3-R gene transcription by recruiting Runx1 and epigenetic co-regulators that mediate histone acetylation. © 2017 Wiley Periodicals, Inc.
Combinatorial Control of Light Induced Chromatin Remodeling and Gene Activation in Neurospora
Sancar, Cigdem; Ha, Nati; Yilmaz, Rüstem; Tesorero, Rafael; Fisher, Tamas; Brunner, Michael; Sancar, Gencer
2015-01-01
Light is an important environmental cue that affects physiology and development of Neurospora crassa. The light-sensing transcription factor (TF) WCC, which consists of the GATA-family TFs WC1 and WC2, is required for light-dependent transcription. SUB1, another GATA-family TF, is not a photoreceptor but has also been implicated in light-inducible gene expression. To assess regulation and organization of the network of light-inducible genes, we analyzed the roles of WCC and SUB1 in light-induced transcription and nucleosome remodeling. We show that SUB1 co-regulates a fraction of light-inducible genes together with the WCC. WCC induces nucleosome eviction at its binding sites. Chromatin remodeling is facilitated by SUB1 but SUB1 cannot activate light-inducible genes in the absence of WCC. We identified FF7, a TF with a putative O-acetyl transferase domain, as an interaction partner of SUB1 and show their cooperation in regulation of a fraction of light-inducible and a much larger number of non light-inducible genes. Our data suggest that WCC acts as a general switch for light-induced chromatin remodeling and gene expression. SUB1 and FF7 synergistically determine the extent of light-induction of target genes in common with WCC but have in addition a role in transcription regulation beyond light-induced gene expression. PMID:25822411
Lode, Holger N.; Xiang, Rong; Duncan, Steven R.; Theofilopoulos, Argyrios N.; Gillies, Stephen D.; Reisfeld, Ralph A.
1999-01-01
Induction, maintenance, and amplification of tumor-protective immunity after cytokine gene therapy is essential for the clinical success of immunotherapeutic approaches. We investigated whether this could be achieved by single-chain IL-12 (scIL-12) gene therapy followed by tumor-targeted IL-2 using a fusion protein containing a tumor-specific recombinant anti-ganglioside GD2 antibody and IL-2 (ch14.18-IL-2) in a poorly immunogenic murine neuroblastoma model. Herein, we demonstrate the absence of liver and bone marrow metastases after a lethal challenge with NXS2 wild-type cells only in mice (five of six animals) vaccinated with scIL-12-producing NXS2 cells and given a booster injection of low-dose ch14.18-IL-2 fusion protein. This tumor-protective immunity was effective 3 months after initial vaccination, in contrast to control animals treated with a nonspecific fusion protein or an equivalent mixture of antibody and IL-2. Only vaccinated mice receiving the tumor-specific ch14.18-IL-2 fusion protein revealed a reactivation of CD8+ T cells and subsequent MHC class I-restricted tumor target cell lysis in vitro. The sequential increase in the usage of TCR chains Vβ11 and -13 in mouse CD8+ T cells after vaccination and amplification with ch14.18-IL-2 suggests that the initial polyclonal CD8+ T cell response is effectively boosted by targeted IL-2. In conclusion, we demonstrate that a successful boost of a partially protective memory T cell immune response that is induced by scIL-12 gene therapy could be generated by tumor-specific targeting of IL-2 with a ch14.18-IL-2 fusion protein. This approach could increase success rates of clinical cancer vaccine trials. PMID:10411920
Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum
2013-01-01
Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses
HLS7, a hemopoietic lineage switch gene homologous to the leukemia-inducing gene MLF1.
Williams, J H; Daly, L N; Ingley, E; Beaumont, J G; Tilbrook, P A; Lalonde, J P; Stillitano, J P; Klinken, S P
1999-01-01
Hemopoietic lineage switching occurs when leukemic cells, apparently committed to one lineage, change and display the phenotype of another pathway. cDNA representational difference analysis was used to identify myeloid-specific genes that may be associated with an erythroid to myeloid lineage switch involving the murine J2E erythroleukemic cell line. One of the genes isolated (HLS7) is homologous to the novel human oncogene myeloid leukemia factor 1 (MLF1) involved in the t(3;5)(q25.1;q34) translocation associated with acute myeloid leukemia. Enforced expression of HLS7 in J2E cells induced a monoblastoid phenotype, thereby recapitulating the spontaneous erythroid to myeloid lineage switch. HLS7 also inhibited erythropoietin- or chemically-induced differentiation of erythroleukemic cell lines and suppressed development of erythropoietin-responsive colonies in semi-solid culture. However, intracellular signaling activated by erythropoietin was not impeded by ectopic expression of HLS7. In contrast, HLS7 promoted maturation of M1 monoblastoid cells and increased myeloid colony formation in vitro. These data show that HLS7 can influence erythroid/myeloid lineage switching and the development of normal hemopoietic cells. PMID:10523300
HLS7, a hemopoietic lineage switch gene homologous to the leukemia-inducing gene MLF1.
Williams, J H; Daly, L N; Ingley, E; Beaumont, J G; Tilbrook, P A; Lalonde, J P; Stillitano, J P; Klinken, S P
1999-10-15
Hemopoietic lineage switching occurs when leukemic cells, apparently committed to one lineage, change and display the phenotype of another pathway. cDNA representational difference analysis was used to identify myeloid-specific genes that may be associated with an erythroid to myeloid lineage switch involving the murine J2E erythroleukemic cell line. One of the genes isolated (HLS7) is homologous to the novel human oncogene myeloid leukemia factor 1 (MLF1) involved in the t(3;5)(q25.1;q34) translocation associated with acute myeloid leukemia. Enforced expression of HLS7 in J2E cells induced a monoblastoid phenotype, thereby recapitulating the spontaneous erythroid to myeloid lineage switch. HLS7 also inhibited erythropoietin- or chemically-induced differentiation of erythroleukemic cell lines and suppressed development of erythropoietin-responsive colonies in semi-solid culture. However, intracellular signaling activated by erythropoietin was not impeded by ectopic expression of HLS7. In contrast, HLS7 promoted maturation of M1 monoblastoid cells and increased myeloid colony formation in vitro. These data show that HLS7 can influence erythroid/myeloid lineage switching and the development of normal hemopoietic cells.
20-Hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body.
Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng
2013-08-01
Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcR (DN) ) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body.
20-hydroxyecdysone upregulates Atg genes to induce autophagy in the Bombyx fat body
Tian, Ling; Ma, Li; Guo, Enen; Deng, Xiaojuan; Ma, Sanyuan; Xia, Qingyou; Cao, Yang; Li, Sheng
2013-01-01
Autophagy is finely regulated at multiple levels and plays crucial roles in development and disease. In the fat body of the silkworm, Bombyx mori, autophagy occurs and Atg gene expression peaks during the nonfeeding molting and pupation stages when the steroid hormone (20-hydroxyecdysone; 20E) is high. Injection of 20E into the feeding larvae upregulated Atg genes and reduced TORC1 activity resulting in autophagy induction in the fat body. Conversely, RNAi knockdown of the 20E receptor partner (USP) or targeted overexpression of a dominant negative mutant of the 20E receptor (EcRDN) in the larval fat body reduced autophagy and downregulated the Atg genes, confirming the importance of 20E-induction of Atg gene expression during pupation. Moreover, in vitro treatments of the larval fat body with 20E upregulated the Atg genes. Five Atg genes were potentially 20E primary-responsive, and a 20E response element was identified in the Atg1 (ortholog of human ULK1) promoter region. Furthermore, RNAi knockdown of 4 key genes (namely Br-C, E74, HR3 and βftz-F1) in the 20E-triggered transcriptional cascade reduced autophagy and downregulated Atg genes to different levels. Taken together, we conclude that in addition to blocking TORC1 activity for autophagosome initiation, 20E upregulates Atg genes to induce autophagy in the Bombyx fat body. PMID:23674061
Yu, Xiang; Takebayashi, Arika; Demura, Taku; Ohtani, Misato
2017-09-01
Knowledge on the responses of woody plants to abiotic stress can inform strategies to breed improved tree varieties and to manage tree species for environmental conservation and the production of lignocellulosic biomass. In this study, we examined the expression patterns of poplar (Populus trichocarpa) genes encoding members of the sucrose nonfermenting1-related protein kinase 2 (SnRK2) family, which are core components of the abiotic stress response. The P. trichocarpa genome contains twelve SnRK2 genes (PtSnRK2.1- PtSnRK2.12) that can be divided into three subclasses (I-III) based on the structures of their encoded kinase domains. We found that PtSnRK2s are differentially expressed in various organs. In MS medium-grown plants, all of the PtSnRK2 genes were significantly upregulated in response to abscisic acid (ABA) treatment, whereas osmotic and salt stress treatments induced only some (four and seven, respectively) of the PtSnRK2 genes. By contrast, soil-grown plants showed increased expression of most PtSnRK2 genes under drought and salt treatments, but not under ABA treatment. In soil-grown plants, drought stress induced SnRK2 subclass II genes in all tested organs (leaves, stems, and roots), whereas subclass III genes tended to be upregulated in leaves only. These results suggest that the PtSnRK2 genes are involved in abiotic stress responses, are at least partially activated by ABA, and show organ-specific responses.
Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A
2008-05-01
Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor
Galhardo, Rodrigo S.; Do, Robert; Yamada, Masami; Friedberg, Errol C.; Hastings, P. J.; Nohmi, Takehiko; Rosenberg, Susan M.
2009-01-01
Stress-induced mutagenesis is a collection of mechanisms observed in bacterial, yeast, and human cells in which adverse conditions provoke mutagenesis, often under the control of stress responses. Control of mutagenesis by stress responses may accelerate evolution specifically when cells are maladapted to their environments, i.e., are stressed. It is therefore important to understand how stress responses increase mutagenesis. In the Escherichia coli Lac assay, stress-induced point mutagenesis requires induction of at least two stress responses: the RpoS-controlled general/starvation stress response and the SOS DNA-damage response, both of which upregulate DinB error-prone DNA polymerase, among other genes required for Lac mutagenesis. We show that upregulation of DinB is the only aspect of the SOS response needed for stress-induced mutagenesis. We constructed two dinB(oc) (operator-constitutive) mutants. Both produce SOS-induced levels of DinB constitutively. We find that both dinB(oc) alleles fully suppress the phenotype of constitutively SOS-“off” lexA(Ind−) mutant cells, restoring normal levels of stress-induced mutagenesis. Thus, dinB is the only SOS gene required at induced levels for stress-induced point mutagenesis. Furthermore, although spontaneous SOS induction has been observed to occur in only a small fraction of cells, upregulation of dinB by the dinB(oc) alleles in all cells does not promote a further increase in mutagenesis, implying that SOS induction of DinB, although necessary, is insufficient to differentiate cells into a hypermutable condition. PMID:19270270
An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis
Guo, Hongyan; Zhang, Wei; Tian, Hainan; Zheng, Kaijie; Dai, Xuemei; Liu, Shanda; Hu, Qingnan; Wang, Xianling; Liu, Bao; Wang, Shucai
2015-01-01
Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance, and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa) CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION) gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid), a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice. Taken together, our results showed that OsCLE48 is an auxin responsive peptide hormone gene, and it regulates shoot apical
Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción
2015-10-24
NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.
An elm EST database for identifying leaf beetle egg-induced defense genes
2012-01-01
Background Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Results Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and
An elm EST database for identifying leaf beetle egg-induced defense genes.
Büchel, Kerstin; McDowell, Eric; Nelson, Will; Descour, Anne; Gershenzon, Jonathan; Hilker, Monika; Soderlund, Carol; Gang, David R; Fenning, Trevor; Meiners, Torsten
2012-06-15
Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and primary metabolism
Xu, Ruirui; Liu, Caiyun; Li, Ning; Zhang, Shizhong
2016-12-01
Argonaute (AGO) proteins, which are found in yeast, animals, and plants, are the core molecules of the RNA-induced silencing complex. These proteins play important roles in plant growth, development, and responses to biotic stresses. The complete analysis and classification of the AGO gene family have been recently reported in different plants. Nevertheless, systematic analysis and expression profiling of these genes have not been performed in apple (Malus domestica). Approximately 15 AGO genes were identified in the apple genome. The phylogenetic tree, chromosome location, conserved protein motifs, gene structure, and expression of the AGO gene family in apple were analyzed for gene prediction. All AGO genes were phylogenetically clustered into four groups (i.e., AGO1, AGO4, MEL1/AGO5, and ZIPPY/AGO7) with the AGO genes of Arabidopsis. These groups of the AGO gene family were statistically analyzed and compared among 31 plant species. The predicted apple AGO genes are distributed across nine chromosomes at different densities and include three segment duplications. Expression studies indicated that 15 AGO genes exhibit different expression patterns in at least one of the tissues tested. Additionally, analysis of gene expression levels indicated that the genes are mostly involved in responses to NaCl, PEG, heat, and low-temperature stresses. Hence, several candidate AGO genes are involved in different aspects of physiological and developmental processes and may play an important role in abiotic stress responses in apple. To the best of our knowledge, this study is the first to report a comprehensive analysis of the apple AGO gene family. Our results provide useful information to understand the classification and putative functions of these proteins, especially for gene members that may play important roles in abiotic stress responses in M. hupehensis.
Wang, Liling; Li, Haibo; Wei, Hailong; Wu, Xueqian; Ke, Leqin
2014-01-01
Cadmium (Cd) is one of the most serious environmental pollutants. Filamentous fungi are very promising organisms for controlling and reducing the amount of heavy metals released by human and industrial activities. However, the molecular mechanisms involved in Cd accumulation and tolerance of filamentous fungi are not fully understood. Agaricus blazei Murrill, an edible mushroom with medicinal properties, demonstrates high tolerance for heavy metals, especially Cd. To investigate the molecular mechanisms underlying the response of A. blazei after Cd exposure, we constructed a forward subtractive library that represents cadmium-induced genes in A. blazei under 4 ppm Cd stress for 14 days using suppression subtractive hybridization combined with mirror orientation selection. Differential screening allowed us to identify 39 upregulated genes, 26 of which are involved in metabolism, protein fate, cellular transport, transport facilitation and transport routes, cell rescue, defense and virulence, transcription, and the action of proteins with a binding function, and 13 are encoding hypothetical proteins with unknown functions. Induction of six A. blazei genes after Cd exposure was further confirmed by RT-qPCR. The cDNAs isolated in this study contribute to our understanding of genes involved in the biochemical pathways that participate in the response of filamentous fungi to Cd exposure. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
2010-01-01
Background The amygdala-kindled rat is a model for human temporal lobe epilepsy and activity-dependent synaptic plasticity. Hippocampal RNA isolated from amygdala-kindled rats at different kindling stages was analyzed to identify kindling-induced genes. Furthermore, effects of the anti-epileptic drug levetiracetam on kindling-induced gene expression were examined. Results Cyclooxygenase-2 (Cox-2), Protocadherin-8 (Pcdh8) and TGF-beta-inducible early response gene-1 (TIEG1) were identified and verified as differentially expressed transcripts in the hippocampus of kindled rats by in situ hybridization and quantitative RT-PCR. In addition, we identified a panel of 16 additional transcripts which included Arc, Egr3/Pilot, Homer1a, Ania-3, MMP9, Narp, c-fos, NGF, BDNF, NT-3, Synaptopodin, Pim1 kinase, TNF-α, RGS2, Egr2/krox-20 and β-A activin that were differentially expressed in the hippocampus of amygdala-kindled rats. The list consists of many synaptic plasticity-related immediate early genes (IEGs) as well as some late response genes encoding transcription factors, neurotrophic factors and proteins that are known to regulate synaptic remodelling. In the hippocampus, induction of IEG expression was dependent on the afterdischarge (AD) duration. Levetiracetam, 40 mg/kg, suppressed the development of kindling measured as severity of seizures and AD duration. In addition, single animal profiling also showed that levetiracetam attenuated the observed kindling-induced IEG expression; an effect that paralleled the anti-epileptic effect of the drug on AD duration. Conclusions The present study provides mRNA expression data that suggest that levetiracetam attenuates expression of genes known to regulate synaptic remodelling. In the kindled rat, levetiracetam does so by shortening the AD duration thereby reducing the seizure-induced changes in mRNA expression in the hippocampus. PMID:20105316
Hasan, Mahbub; Seo, Ji-Eun; Rahaman, Khandoker Asiqur; Min, Hophil; Kim, Ki Hun; Park, Ju-Hyung; Sung, Changmin; Son, Junghyun; Kang, Min-Jung; Jung, Byung Hwa; Park, Won Sang; Kwon, Oh-Seung
2017-02-20
Experimental autoimmune encephalomyelitis (EAE) is an inflammatory autoimmune disease of the central nervous system resulting from degeneration of the myelin sheath. This study is aimed to identify differentially expressed genes (DEGs) in the brain of EAE-induced normal diet (ND) mice and high-fat diet (HFD)-induced obese mice, and to identify novel genes responsible for elucidating the mechanism of the disease. Purified mRNA samples from the brain tissue were analyzed for gene microarray and validated by real-time RT-PCR. DEGs were identified if significant changes greater than 1.5-fold or less than 0.66-fold were observed (p<0.05). Pathway construction and functional categorization were performed using the Kyoto encyclopedia of genes and genomes pathways and gene ontology (GO) analysis. HFD-EAE mice showed more severe disease symptoms than ND-EAE mice. From GO study, fold changes of HFD-EAE to ND-EAE genes indicated that the genes were significantly associated to the pathways related with the immune response, antigen presentation, and complement activation. The genes related with metal ion-binding proteins were upregulated in HFD-EAE and ND-EAE mice. Upregulation of Cul9, Mast2, and C4b expression is significantly higher in HFD-EAE mice than ND-EAE mice. Cul9, Mast2, C4b, Psmb8, Ly86, and Ms4a6d were significantly upregulated in both ND- and HFD-EAE mice. Fcgr4, S3-12, Gca, and Zdhhc4 were upregulated only in ND-EAE, and Xlr4b was upregulated only in HFD-EAE mice. And significant upregulated genes of metal ion-binding proteins (Cul9 and Mast2) were observed in HFD-EAE mice. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
Blood meal induced regulation of the chemosensory gene repertoire in the southern house mosquito.
Taparia, Tanvi; Ignell, Rickard; Hill, Sharon Rose
2017-05-19
The southern house mosquito, Culex quinquefasciatus, is one of the most prevalent vectors of lymphatic filariasis and flavivirus-induced encephalitis. Its vectorial capacity is directly affected by its reproductive feeding behaviors, such as host seeking, blood feeding, resting, and egg laying. In mosquitoes, these gonotrophic behaviors are odor-mediated and regulated following blood feeding. Immediately after a blood meal, female mosquitoes show reduced olfactory responsiveness and flight activity, as they enter a resting state. Insights into antennal chemosensory gene regulation at this time period can provide a foundation to identify targets involved in the state switch between host seeking and resting. This study used quantitative gene expression analyses to explore blood meal induced regulation of chemosensory gene families in the antennae of 6 days post-emergence C. quinquefasciatus females. Improved annotations for multiple chemosensory gene families, and a quantitative differential gene expression analysis between host seeking and 24 h post- blood fed females of the same age, allowed for the detection of transcripts that potentially play a role in the switch from host seeking to resting, in C. quinquefasciatus. The expression profiles of chemosensory genes varied significantly between the two treatments. Annotations for chemosensory gene repertoires in C. quinquefasciatus have been manually curated and corrected for 3' exon choice and transcript length, through sequence and transcriptome analyses. The gene expression analyses identified various molecular components of the peripheral olfactory system in C. quinquefasciatus, including odorant receptors, ionotropic receptors, odorant binding proteins and chemosensory proteins, that are regulated in response to blood feeding, and could be critical for the behavioral switch from host seeking to resting. Functional characterization of these proteins in the future can identify targets essential for the females
Comparative Gene Expression Profiles Induced by PPARγ and PPARα/γ Agonists in Human Hepatocytes
Rogue, Alexandra; Lambert, Carine; Jossé, Rozenn; Antherieu, Sebastien; Spire, Catherine; Claude, Nancy; Guillouzo, André
2011-01-01
Background Several glitazones (PPARγ agonists) and glitazars (dual PPARα/γ agonists) have been developed to treat hyperglycemia and, simultaneously, hyperglycemia and dyslipidemia, respectively. However, most have caused idiosyncratic hepatic or extrahepatic toxicities through mechanisms that remain largely unknown. Since the liver plays a key role in lipid metabolism, we analyzed changes in gene expression profiles induced by these two types of PPAR agonists in human hepatocytes. Methodology/Principal Findings Primary human hepatocytes and the well-differentiated human hepatoma HepaRG cells were exposed to different concentrations of two PPARγ (troglitazone and rosiglitazone) and two PPARα/γ (muraglitazar and tesaglitazar) agonists for 24 h and their transcriptomes were analyzed using human pangenomic Agilent microarrays. Principal Component Analysis, hierarchical clustering and Ingenuity Pathway Analysis® revealed large inter-individual variability in the response of the human hepatocyte populations to the different compounds. Many genes involved in lipid, carbohydrate, xenobiotic and cholesterol metabolism, as well as inflammation and immunity, were regulated by both PPARγ and PPARα/γ agonists in at least a number of human hepatocyte populations and/or HepaRG cells. Only a few genes were selectively deregulated by glitazars when compared to glitazones, indicating that PPARγ and PPARα/γ agonists share most of their target genes. Moreover, some target genes thought to be regulated only in mouse or to be expressed in Kupffer cells were also found to be responsive in human hepatocytes and HepaRG cells. Conclusions/Significance This first comprehensive analysis of gene regulation by PPARγ and PPARα/γ agonists favor the conclusion that glitazones and glitazars share most of their target genes and induce large differential changes in gene profiles in human hepatocytes depending on hepatocyte donor, the compound class and/or individual compound, thereby
Triazole induced concentration-related gene signatures in rat whole embryo culture.
Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H
2012-09-01
Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.
Bedre, Renesh; Rajasekaran, Kanniah; Mangu, Venkata Ramanarao; Sanchez Timm, Luis Eduardo; Bhatnagar, Deepak; Baisakh, Niranjan
2015-01-01
Aflatoxins are toxic and potent carcinogenic metabolites produced from the fungi Aspergillus flavus and A. parasiticus. Aflatoxins can contaminate cottonseed under conducive preharvest and postharvest conditions. United States federal regulations restrict the use of aflatoxin contaminated cottonseed at >20 ppb for animal feed. Several strategies have been proposed for controlling aflatoxin contamination, and much success has been achieved by the application of an atoxigenic strain of A. flavus in cotton, peanut and maize fields. Development of cultivars resistant to aflatoxin through overexpression of resistance associated genes and/or knocking down aflatoxin biosynthesis of A. flavus will be an effective strategy for controlling aflatoxin contamination in cotton. In this study, genome-wide transcriptome profiling was performed to identify differentially expressed genes in response to infection with both toxigenic and atoxigenic strains of A. flavus on cotton (Gossypium hirsutum L.) pericarp and seed. The genes involved in antifungal response, oxidative burst, transcription factors, defense signaling pathways and stress response were highly differentially expressed in pericarp and seed tissues in response to A. flavus infection. The cell-wall modifying genes and genes involved in the production of antimicrobial substances were more active in pericarp as compared to seed. The genes involved in auxin and cytokinin signaling were also induced. Most of the genes involved in defense response in cotton were highly induced in pericarp than in seed. The global gene expression analysis in response to fungal invasion in cotton will serve as a source for identifying biomarkers for breeding, potential candidate genes for transgenic manipulation, and will help in understanding complex plant-fungal interaction for future downstream research.
Dunnick, Wesley A; Shi, Jian; Holden, Victoria; Fontaine, Clinton; Collins, John T
2011-01-01
Germline transcription precedes class switch recombination (CSR). The promoter regions and I exons of these germline transcripts include binding sites for activation- and cytokine-induced transcription factors, and the promoter regions/I exons are essential for CSR. Therefore, it is a strong hypothesis that the promoter/I exons regions are responsible for much of cytokine-regulated, gene-specific CSR. We tested this hypothesis by swapping the germline promoter and I exons for the murine γ1 and γ2a H chain genes in a transgene of the entire H chain C-region locus. We found that the promoter/I exon for γ1 germline transcripts can direct robust IL-4-induced recombination to the γ2a gene. In contrast, the promoter/I exon for the γ2a germline transcripts works poorly in the context of the γ1 H chain gene, resulting in expression of γ1 H chains that is <1% the wild-type level. Nevertheless, the small amount of recombination to the chimeric γ1 gene is induced by IFN-γ. These results suggest that cytokine regulation of CSR, but not the magnitude of CSR, is regulated by the promoter/I exons.
2014-01-01
Background Throughout Asia, including Japan, rice plants are cultivated in a wide range of areas from lowlands to highlands and are frequently exposed to fog, including acid fog. Some physiological studies have shown that acid fog can be a stress factor for plants. We analyzed the gene expression profiles of rice plants treated with artificially prepared simulated acid fog (SiAF) or simulated neutral fog (SiNF) for 1 or 7 days. Results Microarray analysis results suggested that both the SiAF and the SiNF treatments induced the expression of genes involved in the defense and stress responses in rice plants. Induction of such genes was detected in plants treated with SiAF for 1 day, and the number of induced genes increased in plants treated with SiAF for 7 days. The genes for defense and stress responses were also induced by SiNF for 7 days, although they were not induced by SiNF for 1 day. The gene expression profiles of the SiAF-treated and the SiNF-treated plants were compared to those of plants treated with other stress factors. The comparison revealed that both SiAF and SiNF treatments have similar effects to biotic stresses and ozone stress. The genes encoding NADPH oxidase and germin, which function in apoplasts, were also induced by SiAF, SiNF and biotic stresses. Conclusions These findings suggest that both the SiAF and the SiNF treatments may result in oxidative stress through the apoplastic production of reactive oxygen species. PMID:24987489
Jakubowicz, Małgorzata; Gałgańska, Hanna; Nowak, Witold; Sadowski, Jan
2010-01-01
In higher plants, copper ions, hydrogen peroxide, and cycloheximide have been recognized as very effective inducers of the transcriptional activity of genes encoding the enzymes of the ethylene biosynthesis pathway. In this report, the transcriptional patterns of genes encoding the 1-aminocyclopropane-1-carboxylate synthases (ACSs), 1-aminocyclopropane-1-carboxylate oxidases (ACOs), ETR1, ETR2, and ERS1 ethylene receptors, phospholipase D (PLD)-α1, -α2, -γ1, and -δ, and respiratory burst oxidase homologue (Rboh)-NADPH oxidase-D and -F in response to these inducers in Brassica oleracea etiolated seedlings are shown. ACS1, ACO1, ETR2, PLD-γ1, and RbohD represent genes whose expression was considerably affected by all of the inducers used. The investigations were performed on the seedlings with (i) ethylene insensitivity and (ii) a reduced level of the PLD-derived phosphatidic acid (PA). The general conclusion is that the expression of ACS1, -3, -4, -5, -7, and -11, ACO1, ETR1, ERS1, and ETR2, PLD-γ 1, and RbohD and F genes is undoubtedly under the reciprocal cross-talk of the ethylene and PAPLD signalling routes; both signals affect it in concerted or opposite ways depending on the gene or the type of stimuli. The results of these studies on broccoli seedlings are in agreement with the hypothesis that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (constitutive triple response 1) activity. PMID:20581125
Santiago, Felix W; Covaleda, Lina M; Sanchez-Aparicio, Maria T; Silvas, Jesus A; Diaz-Vizarreta, Ana C; Patel, Jenish R; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo; Aguilar, Patricia V
2014-04-01
Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions.
Santiago, Felix W.; Covaleda, Lina M.; Sanchez-Aparicio, Maria T.; Silvas, Jesus A.; Diaz-Vizarreta, Ana C.; Patel, Jenish R.; Popov, Vsevolod; Yu, Xue-jie; García-Sastre, Adolfo
2014-01-01
ABSTRACT Recognition of viral pathogens by the retinoic acid-inducible gene I (RIG-I)-like receptor (RLR) family results in the activation of type I interferon (IFN) responses. To avoid this response, most viruses have evolved strategies that target different essential steps in the activation of host innate immunity. In this study, we report that the nonstructural protein NSs of the newly described severe fever with thrombocytopenia syndrome virus (SFTSV) is a potent inhibitor of IFN responses. The SFTSV NSs protein was found to inhibit the activation of the beta interferon (IFN-β) promoter induced by viral infection and by a RIG-I ligand. Astonishingly, we found that SFTSV NSs interacts with and relocalizes RIG-I, the E3 ubiquitin ligase TRIM25, and TANK-binding kinase 1 (TBK1) into SFTSV NSs-induced cytoplasmic structures. Interestingly, formation of these SFTSV NSs-induced structures occurred in the absence of the Atg7 gene, a gene essential for autophagy. Furthermore, confocal microscopy studies revealed that these SFTSV NSs-induced structures colocalize with Rab5 but not with Golgi apparatus or endoplasmic reticulum markers. Altogether, the data suggest that sequestration of RIG-I signaling molecules into endosome-like structures may be the mechanism used by SFTSV to inhibit IFN responses and point toward a novel mechanism for the suppression of IFN responses. IMPORTANCE The mechanism by which the newly described SFTSV inhibits host antiviral responses has not yet been fully characterized. In this study, we describe the redistribution of RIG-I signaling components into virus-induced cytoplasmic structures in cells infected with SFTSV. This redistribution correlates with the inhibition of host antiviral responses. Further characterization of the interplay between the viral protein and components of the IFN responses could potentially provide targets for the rational development of therapeutic interventions. PMID:24478431
Karouna-Renier, N. K.; Rao, K.R.
2009-01-01
In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.
Molecular Structure-Based Large-Scale Prediction of Chemical-Induced Gene Expression Changes.
Liu, Ruifeng; AbdulHameed, Mohamed Diwan M; Wallqvist, Anders
2017-09-25
The quantitative structure-activity relationship (QSAR) approach has been used to model a wide range of chemical-induced biological responses. However, it had not been utilized to model chemical-induced genomewide gene expression changes until very recently, owing to the complexity of training and evaluating a very large number of models. To address this issue, we examined the performance of a variable nearest neighbor (v-NN) method that uses information on near neighbors conforming to the principle that similar structures have similar activities. Using a data set of gene expression signatures of 13 150 compounds derived from cell-based measurements in the NIH Library of Integrated Network-based Cellular Signatures program, we were able to make predictions for 62% of the compounds in a 10-fold cross validation test, with a correlation coefficient of 0.61 between the predicted and experimentally derived signatures-a reproducibility rivaling that of high-throughput gene expression measurements. To evaluate the utility of the predicted gene expression signatures, we compared the predicted and experimentally derived signatures in their ability to identify drugs known to cause specific liver, kidney, and heart injuries. Overall, the predicted and experimentally derived signatures had similar receiver operating characteristics, whose areas under the curve ranged from 0.71 to 0.77 and 0.70 to 0.73, respectively, across the three organ injury models. However, detailed analyses of enrichment curves indicate that signatures predicted from multiple near neighbors outperformed those derived from experiments, suggesting that averaging information from near neighbors may help improve the signal from gene expression measurements. Our results demonstrate that the v-NN method can serve as a practical approach for modeling large-scale, genomewide, chemical-induced, gene expression changes.
Guarnieri, Douglas J; Brayton, Catherine E; Richards, Sarah M; Maldonado-Aviles, Jaime; Trinko, Joseph R; Nelson, Jessica; Taylor, Jane R; Gourley, Shannon L; DiLeone, Ralph J
2012-02-15
Food restriction is known to enhance learning and motivation. The neural mechanisms underlying these responses likely involve alterations in gene expression in brain regions mediating the motivation to feed. Analysis of gene expression profiles in male C57BL/6J mice using whole-genome microarrays was completed in the medial prefrontal cortex, nucleus accumbens, ventral tegmental area, and the hypothalamus following a 5-day food restriction. Quantitative polymerase chain reaction was used to validate these findings and determine the time course of expression changes. Plasma levels of the stress hormone corticosterone (CORT) were measured by enzyme-linked immunosorbent assay. Expression changes were measured in adrenalectomized animals that underwent food restriction, as well as in animals receiving daily injections of CORT. Progressive ratio responding for food, a measure of motivated behavior, was assessed after CORT treatment in restricted and fed animals. Brief food restriction results in an upregulation of peripheral stress responsive genes in the mammalian brain. Time-course analysis demonstrated rapid and persistent expression changes in all four brain regions under study. Administration of CORT to nonrestricted animals was sufficient to induce a subset of the genes, and alterations in gene expression after food restriction were dependent on intact adrenal glands. CORT can increase the motivation to work for food only in the restricted state. These data demonstrate a central role for CORT in mediating both molecular and behavioral responses to food restriction. The stress hormone-induced alterations in gene expression described here may be relevant for both adaptive and pathological responses to stress. Copyright © 2012 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.
ERK Oscillation-Dependent Gene Expression Patterns and Deregulation by Stress-Response
DOE Office of Scientific and Technical Information (OSTI.GOV)
Waters, Katrina M.; Cummings, Brian S.; Shankaran, Harish
2014-09-15
Studies were undertaken to determine whether ERK oscillations regulate a unique subset of genes in human keratinocytes and subsequently, whether the p38 stress response inhibits ERK oscillations. A DNA microarray identified many genes that were unique to ERK oscillations, and network reconstruction predicted an important role for the mediator complex subunit 1 (MED1) node in mediating ERK oscillation-dependent gene expression. Increased ERK-dependent phosphorylation of MED1 was observed in oscillating cells compared to non-oscillating counterparts as validation. Treatment of keratinocytes with a p38 inhibitor (SB203580) increased ERK oscillation amplitudes and MED1 and phospho-MED1 protein levels. Bromate is a probable human carcinogenmore » that activates p38. Bromate inhibited ERK oscillations in human keratinocytes and JB6 cells and induced an increase in phospho-p38 and decrease in phospho-MED1 protein levels. Treatment of normal rat kidney cells and primary salivary gland epithelial cells with bromate decreased phospho-MED1 levels in a reversible fashion upon treatment with p38 inhibitors (SB202190; SB203580). Our results indicate that oscillatory behavior in the ERK pathway alters homeostatic gene regulation patterns and that the cellular response to perturbation may manifest differently in oscillating vs non-oscillating cells.« less
Singh, Mahendra Pratap; Kim, Ki Young; Kwak, Geun-Hee; Baek, Suk-Hwan; Kim, Hwa-Young
2017-10-01
Methionine sulfoxide reductase A (MsrA) is a major antioxidant enzyme that specifically catalyzes the reduction of methionine S-sulfoxide. In this study, we used MsrA gene-knockout (MsrA -/- ) mice and bone marrow-derived macrophages (BMDMs) to investigate the role of MsrA in the regulation of inflammatory responses induced by lipopolysaccharide (LPS). MsrA -/- mice were more susceptible to LPS-induced lethal shock than wild-type (MsrA +/+ ) mice. Serum levels of the proinflammatory cytokines IL-6 and TNF-α induced by LPS were higher in MsrA -/- than in MsrA +/+ mice. MsrA deficiency in the BMDMs also increased the LPS-induced cytotoxicity as well as TNF-α level. Basal and LPS-induced reactive oxygen species (ROS) levels were higher in MsrA -/- than in MsrA +/+ BMDMs. Phosphorylation levels of p38, JNK, and ERK were higher in MsrA -/- than in MsrA +/+ BMDMs in response to LPS, suggesting that MsrA deficiency increases MAPK activation. Furthermore, MsrA deficiency increased the expression and nuclear translocation of NF-κB and the expression of inducible nitric oxide synthase, a target gene of NF-κB, in response to LPS. Taken together, our results suggest that MsrA protects against LPS-induced septic shock, and negatively regulates proinflammatory responses via inhibition of the ROS-MAPK-NF-κB signaling pathways. Copyright © 2017 Elsevier Inc. All rights reserved.
Biomarker discovery and gene expression responses in Lycopersicon esculentum root exposed to lead.
Hou, Jing; Bai, Lili; Xie, Yujia; Liu, Xinhui; Cui, Baoshan
2015-12-15
Gene expression analysis has shown particular promise for the identification of molecular biomarkers that can be used for further evaluation of potential toxicity of chemicals present in agricultural soil. In the study, we focused on the development of molecular markers to detect Pb toxicity in agricultural soil. Using the results obtained from microarray analysis, twelve Pb-responsive genes were selected and tested in different Pb concentrations to examine their concentration-response characteristics using real-time quantitative polymerase chain reaction (RT-qPCR). All the Pb treatments set in our study could generally induce the differential expression of the 12 genes, while the lowest observable adverse effect concentration (LOAEC) of Pb for seed germination, root elongation, biomass and structural modification derived from 1,297, 177, 177, and 1,297 mg Pb/kg soil, respectively, suggesting that the transcriptional approach was more sensitive than the traditional end points of death, growth, and morphology for the evaluation of Pb toxicity. The relative expression of glycoalkaloid metabolism 1 (P=-0.790), ethylene-responsive transcription factor ERF017 (P=-0.686) and CASP-like protein 4C2 (P=-0.652) demonstrates a dose-dependent response with Pb content in roots, implying that the three genes can be used as sensitive bioindicators of Pb stress in Lycopersicon esculentum. Copyright © 2015 Elsevier B.V. All rights reserved.
Roles of factorial noise in inducing bimodal gene expression
NASA Astrophysics Data System (ADS)
Liu, Peijiang; Yuan, Zhanjiang; Huang, Lifang; Zhou, Tianshou
2015-06-01
Some gene regulatory systems can exhibit bimodal distributions of mRNA or protein although the deterministic counterparts are monostable. This noise-induced bimodality is an interesting phenomenon and has important biological implications, but it is unclear how different sources of expression noise (each source creates so-called factorial noise that is defined as a component of the total noise) contribute separately to this stochastic bimodality. Here we consider a minimal model of gene regulation, which is monostable in the deterministic case. Although simple, this system contains factorial noise of two main kinds: promoter noise due to switching between gene states and transcriptional (or translational) noise due to synthesis and degradation of mRNA (or protein). To better trace the roles of factorial noise in inducing bimodality, we also analyze two limit models, continuous and adiabatic approximations, apart from the exact model. We show that in the case of slow gene switching, the continuous model where only promoter noise is considered can exhibit bimodality; in the case of fast switching, the adiabatic model where only transcriptional or translational noise is considered can also exhibit bimodality but the exact model cannot; and in other cases, both promoter noise and transcriptional or translational noise can cooperatively induce bimodality. Since slow gene switching and large protein copy numbers are characteristics of eukaryotic cells, whereas fast gene switching and small protein copy numbers are characteristics of prokaryotic cells, we infer that eukaryotic stochastic bimodality is induced mainly by promoter noise, whereas prokaryotic stochastic bimodality is induced primarily by transcriptional or translational noise.
Röschmann, K I L; van Kuijen, A-M; Luiten, S; Jonker, M J; Breit, T M; Fokkens, W J; Petersen, A; van Drunen, C M
2012-10-01
Seasonal allergic rhinitis (AR) is a global health problem and its prevalence has increased considerably in the last decades. As the allergic response with its clinical manifestations is triggered by only a few proteins within natural extracts, there is an increasing tendency for single-component-resolved diagnosis and immunotherapy. As natural exposure is not to single proteins, but to complex mixtures of molecules, we were interested in comparing the activation of respiratory epithelial cells induced by the purified major allergen Phl p 1 with the induction caused by a complete extract of Timothy grass pollen (GPE). NCI-H292 cells were exposed to GPE or Ph1 p 1 for 24 h, isolated RNA and cell culture supernatants were used for microarray analysis, multiplex enzyme-linked immunosorbant assay (ELISA) and subsequent analysis. We found 262 genes that showed a GPE-induced change of at least 3-fold, whereas Ph1 p 1-stimulation resulted in 71 genes with a fold induction of more than 3-fold. Besides genes that were regulated by both stimuli, we also detected genes displaying an opposite response after stimulation, suggesting that GPE might be more than purified major allergens with regard to induced immune responses. Additional components within GPE and the resulting modulation of general processes affecting gene transcription and signalling pathways might be crucial to maintain/overcome the diseased phenotype and to induce the influx of cells contributing to late-phase allergic responses. When the initial process of sensitization is the matter of interest or late-phase allergic responses, one might miss important immune modulatory molecules and their interaction with allergens by applying single components only. © 2012 Blackwell Publishing Ltd.
Genome-wide analysis of drought induced gene expression changes in flax (Linum usitatissimum).
Dash, Prasanta K; Cao, Yongguo; Jailani, Abdul K; Gupta, Payal; Venglat, Prakash; Xiang, Daoquan; Rai, Rhitu; Sharma, Rinku; Thirunavukkarasu, Nepolean; Abdin, Malik Z; Yadava, Devendra K; Singh, Nagendra K; Singh, Jas; Selvaraj, Gopalan; Deyholos, Mike; Kumar, Polumetla Ananda; Datla, Raju
2014-01-01
A robust phenotypic plasticity to ward off adverse environmental conditions determines performance and productivity in crop plants. Flax (linseed), is an important cash crop produced for natural textile fiber (linen) or oilseed with many health promoting products. This crop is prone to drought stress and yield losses in many parts of the world. Despite recent advances in drought research in a number of important crops, related progress in flax is very limited. Since, response of this plant to drought stress has not been addressed at the molecular level; we conducted microarray analysis to capture transcriptome associated with induced drought in flax. This study identified 183 differentially expressed genes (DEGs) associated with diverse cellular, biophysical and metabolic programs in flax. The analysis also revealed especially the altered regulation of cellular and metabolic pathways governing photosynthesis. Additionally, comparative transcriptome analysis identified a plethora of genes that displayed differential regulation both spatially and temporally. These results revealed co-regulated expression of 26 genes in both shoot and root tissues with implications for drought stress response. Furthermore, the data also showed that more genes are upregulated in roots compared to shoots, suggesting that roots may play important and additional roles in response to drought in flax. With prolonged drought treatment, the number of DEGs increased in both tissue types. Differential expression of selected genes was confirmed by qRT-PCR, thus supporting the suggested functional association of these intrinsic genes in maintaining growth and homeostasis in response to imminent drought stress in flax. Together the present study has developed foundational and new transcriptome data sets for drought stress in flax.
HRGFish: A database of hypoxia responsive genes in fishes
NASA Astrophysics Data System (ADS)
Rashid, Iliyas; Nagpure, Naresh Sahebrao; Srivastava, Prachi; Kumar, Ravindra; Pathak, Ajey Kumar; Singh, Mahender; Kushwaha, Basdeo
2017-02-01
Several studies have highlighted the changes in the gene expression due to the hypoxia response in fishes, but the systematic organization of the information and the analytical platform for such genes are lacking. In the present study, an attempt was made to develop a database of hypoxia responsive genes in fishes (HRGFish), integrated with analytical tools, using LAMPP technology. Genes reported in hypoxia response for fishes were compiled through literature survey and the database presently covers 818 gene sequences and 35 gene types from 38 fishes. The upstream fragments (3,000 bp), covered in this database, enables to compute CG dinucleotides frequencies, motif finding of the hypoxia response element, identification of CpG island and mapping with the reference promoter of zebrafish. The database also includes functional annotation of genes and provides tools for analyzing sequences and designing primers for selected gene fragments. This may be the first database on the hypoxia response genes in fishes that provides a workbench to the scientific community involved in studying the evolution and ecological adaptation of the fish species in relation to hypoxia.
Graham, Madge Y
2005-12-01
Lactofen belongs to the diphenylether class of herbicides, which targets protoporphyrinogen oxidase, which in turn causes singlet oxygen generation. In tolerant plants like soybean (Glycine max), the chemical nonetheless causes necrotic patches called "bronzing" in contact areas. Here it is shown that such bronzing is accompanied by cell death, which was quantified from digital microscopic images using Assess Software. Cellular autofluorescence accompanied cell death, and a homolog of the cell death marker gene, Hsr203j, was induced by lactofen in treated soybean tissues. Thus, this form of chemically induced cell death shares some hallmarks of certain types of programmed cell death. In addition to the cell death phenotype, lactofen caused enhanced expressions of chalcone synthase and chalcone reductase genes, mainly in the exposed and immediately adjacent (proximal) cells. Furthermore, isoflavone synthase genes, which are wound inducible in soybean, were up-regulated by lactofen in both proximal and distal cell zones in minimally wounded cotyledons and further enhanced in wounded tissues. Moreover, if the wall glucan elicitor from Phytophthora sojae was present during lactofen treatment, the induction of isoflavone synthase was even more rapid. These results are consistent with the fact that lactofen triggers massive isoflavone accumulations and activates the capacity for glyceollin elicitation competency. In addition, lactofen induces late expression of a selective set of pathogenesis-related (PR) protein genes, including PR-1a, PR-5, and PR-10, mainly in treated proximal tissues. These various results are discussed in the context of singlet oxygen-induced responses and lactofen's potential as a disease resistance-inducing agent.
Sheikh, Nadeem; Dudas, Jozsef; Ramadori, Giuliano
2007-07-01
In the present study, turpentine oil was injected in the hind limb muscle of the rat to stimulate an acute-phase response (APR). The changes in the gene expression of cytokines and proteins known to be involved in the iron regulatory pathway were then studied in the liver and in extra-hepatic tissue. In addition to the strong upregulation of interleukin-6 (IL-6) and IL-1 beta observed in the inflamed muscle, an upregulation of the genes for IL1-beta and tumor necrosis factor-alpha, but not IL-6, were detectable in the liver. Hepatic Hepc gene expression increased to a maximum at 6 h after the onset of APR. An upregulation of transferrin, transferrin receptor 1 (TfR1), TfR2, ferritin-H, iron responsive element binding protein-1 (IRP1), IRP2 and divalent metal transporter gene expression was also found. Hemojuvelin (Hjv)-, ferroportin 1-, Dcytb-, hemochromatosis-gene- and hephaestin gene expression was downregulated. Hepcidin (Hepc) gene expression was not only detectable in extra-hepatic tissues such as heart, small intestine, colon, spleen and kidney but it was also upregulated under acute-phase conditions, with the Hjv gene being regulated antagonistically. Fpn-1 gene expression was downregulated significantly in heart, colon and spleen. Most of the genes of the known proteins involved in iron metabolism are expressed not only in the liver but also in extra-hepatic tissues. Under acute-phase conditions, acute-phase cytokines (eg IL-6) may modulate the gene expression of such proteins not only in the liver but also in other organs.
Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo
2014-12-01
HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of
Kim, Bung-Nyun; Kim, Jae-Won; Cummins, Tarrant D R; Bellgrove, Mark A; Hawi, Ziarih; Hong, Soon-Beom; Yang, Young-Hui; Kim, Hyo-Jin; Shin, Min-Sup; Cho, Soo-Churl; Kim, Ji-Hoon; Son, Jung-Woo; Shin, Yun-Mi; Chung, Un-Sun; Han, Doug-Hyun
2013-06-01
Noradrenergic dysfunction may be associated with cognitive impairments in attention-deficit/hyperactivity disorder (ADHD), including increased response time variability, which has been proposed as a leading endophenotype for ADHD. The aim of this study was to examine the relationship between polymorphisms in the α-2A-adrenergic receptor (ADRA2A) and norepinephrine transporter (SLC6A2) genes and attentional performance in ADHD children before and after pharmacological treatment.One hundred one medication-naive ADHD children were included. All subjects were administered methylphenidate (MPH)-OROS for 12 weeks. The subjects underwent a computerized comprehensive attention test to measure the response time variability at baseline before MPH treatment and after 12 weeks. Additive regression analyses controlling for ADHD symptom severity, age, sex, IQ, and final dose of MPH examined the association between response time variability on the comprehensive attention test measures and allelic variations in single-nucleotide polymorphisms of the ADRA2A and SLC6A2 before and after MPH treatment.Increasing possession of an A allele at the G1287A polymorphism of SLC6A2 was significantly related to heightened response time variability at baseline in the sustained (P = 2.0 × 10) and auditory selective attention (P = 1.0 × 10) tasks. Response time variability at baseline increased additively with possession of the T allele at the DraI polymorphism of the ADRA2A gene in the auditory selective attention task (P = 2.0 × 10). After medication, increasing possession of a G allele at the MspI polymorphism of the ADRA2A gene was associated with increased MPH-related change in response time variability in the flanker task (P = 1.0 × 10).Our study suggested an association between norepinephrine gene variants and response time variability measured at baseline and after MPH treatment in children with ADHD. Our results add to a growing body of evidence, suggesting that response time
Convergent evolution of heat-inducibility during subfunctionalization of the Hsp70 gene family
2013-01-01
Background Heat-shock proteins of the 70 kDa family (Hsp70s) are essential chaperones required for key cellular functions. In eukaryotes, four subfamilies can be distinguished according to their function and localisation in different cellular compartments: cytosol, endoplasmic reticulum, mitochondria and chloroplasts. Generally, multiple cytosol-type Hsp70s can be found in metazoans that show either constitutive expression and/or stress-inducibility, arguing for the evolution of different tasks and functions. Information about the hsp70 copy number and diversity in microbial eukaryotes is, however, scarce, and detailed knowledge about the differential gene expression in most protists is lacking. Therefore, we have characterised the Hsp70 gene family of Paramecium caudatum to gain insight into the evolution and differential heat stress response of the distinct family members in protists and to investigate the diversification of eukaryotic hsp70s focusing on the evolution of heat-inducibility. Results Eleven putative hsp70 genes could be detected in P. caudatum comprising homologs of three major Hsp70-subfamilies. Phylogenetic analyses revealed five evolutionarily distinct Hsp70-groups, each with a closer relationship to orthologous sequences of Paramecium tetraurelia than to another P. caudatum Hsp70-group. These highly diverse, paralogous groups resulted from duplications preceding Paramecium speciation, underwent divergent evolution and were subject to purifying selection. Heat-shock treatments were performed to test for differential expression patterns among the five Hsp70-groups as well as for a functional conservation within Paramecium. These treatments induced exceptionally high mRNA up-regulations in one cytosolic group with a low basal expression, indicative for the major heat inducible hsp70s. All other groups showed comparatively high basal expression levels and moderate heat-inducibility, signifying constitutively expressed genes. Comparative EST analyses
Stress, and pathogen response gene expression in modeled microgravity
NASA Technical Reports Server (NTRS)
Sundaresan, Alamelu; Pellis, Neal R.
2006-01-01
Purpose: Immune suppression in microgravity has been well documented. With the advent of human exploration and long-term space travel, the immune system of the astronaut must be optimally maintained. It is important to investigate the expression patterns of cytokine genes, because they are directly related to immune response. Heat shock proteins (HSPs), also called stress proteins, are a group of proteins that are present in the cells of every life form. These proteins are induced when a cell responds to stressors such as heat, cold and oxygen deprivation. Microgravity is another stressor that may regulate HSPs. Heat shock proteins trigger immune response through activities that occur both inside the cell (intracellular) and outside the cell (extracellular). Knowledge about these two gene groups could lead to establishment of a blueprint of the immune response and adaptation-related genes in the microgravity environment. Methods: Human peripheral blood cells were cultured in 1g (T flask) and modeled microgravity (MMG, rotating-wall vessel) for 24 and 72 hours. Cell samples were collected and subjected to gene array analysis using the Affymetrix HG_U95 array. Data was collected and subjected to a two-way analysis of variance. The genes related to immune and stress responses were analyzed. Results and Conclusions: HSP70 was up-regulated by more than two fold in microgravity culture, while HSP90 was significantly down-regulated. HSP70 is not typically expressed in all kinds of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. Increased serum HSP70 levels correlate with a better outcome for heat-stroke or severe trauma patients. At the same time, elevated serum levels of HSP70 have been detected in patients with peripheral or renal vascular disease. HSP90 has been identified in the cytosol, nucleus and
Gene Profiling Characteristics of Radioadaptive Response in AG01522 Normal Human Fibroblasts
Hou, Jue; Wang, Fan; Kong, Peizhong; Yu, Peter K. N.; Wang, Hongzhi; Han, Wei
2015-01-01
Radioadaptive response (RAR) in mammalian cells refers to the phenomenon where a low-dose ionizing irradiation alters the gene expression profiles, and protects the cells from the detrimental effects of a subsequent high dose exposure. Despite the completion of numerous experimental studies on RAR, the underlying mechanism has remained unclear. In this study, we aimed to have a comprehensive investigation on the RAR induced in the AG01522 human fibroblasts first exposed to 5 cGy (priming dose) and then followed by 2 Gy (challenge dose) of X-ray through comparisons to those cells that had only received a single 2 Gy dose. We studied how the priming dose affected the expression of gene transcripts, and to identify transcripts or pathways that were associated with the reduced chromosomal damages (in terms of the number of micronuclei) after application of the challenging dose. Through the mRNA and microRNA microarray analyses, the transcriptome alteration in AG01522 cells was examined, and the significantly altered genes were identified for different irradiation procedures using bioinformatics approaches. We observed that a low-dose X-ray exposure produced an alert, triggering and altering cellular responses to defend against subsequent high dose-induced damages, and accelerating the cell repair process. Moreover, the p53 signaling pathway was found to play critial roles in regulating DNA damage responses at the early stage after application of the challenging dose, particularly in the RAR group. Furthermore, microRNA analyses also revealed that cell communication and intercellular signaling transduction played important roles after low-dose irradiation. We conclude that RAR benefits from the alarm mechanisms triggered by a low-dose priming radation dose. PMID:25886619
PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid.
Halim, Vincentius A; Altmann, Simone; Ellinger, Dorothea; Eschen-Lippold, Lennart; Miersch, Otto; Scheel, Dierk; Rosahl, Sabine
2009-01-01
To elucidate the molecular mechanisms underlying pathogen-associated molecular pattern (PAMP)-induced defense responses in potato (Solanum tuberosum), the role of the signaling compounds salicylic acid (SA) and jasmonic acid (JA) was analyzed. Pep-13, a PAMP from Phytophthora, induces the accumulation of SA, JA and hydrogen peroxide, as well as the activation of defense genes and hypersensitive-like cell death. We have previously shown that SA is required for Pep-13-induced defense responses. To assess the importance of JA, RNA interference constructs targeted at the JA biosynthetic genes, allene oxide cyclase and 12-oxophytodienoic acid reductase, were expressed in transgenic potato plants. In addition, expression of the F-box protein COI1 was reduced by RNA interference. Plants expressing the RNA interference constructs failed to accumulate the respective transcripts in response to wounding or Pep-13 treatment, neither did they contain significant amounts of JA after elicitation. In response to infiltration of Pep-13, the transgenic plants exhibited a highly reduced accumulation of reactive oxygen species as well as reduced hypersensitive cell death. The ability of the JA-deficient plants to accumulate SA suggests that SA accumulation is independent or upstream of JA accumulation. These data show that PAMP responses in potato require both SA and JA and that, in contrast to Arabidopsis, these compounds act in the same signal transduction pathway. Despite their inability to fully respond to PAMP treatment, the transgenic RNA interference plants are not altered in their basal defense against Phytophthora infestans.
Wang, Hui; Miao, Wujun; Wang, Fei; Cheng, Yiyun
2018-06-11
The assembly of low molecular weight polymers into highly efficient and nontoxic nanostructures has broad applicability in gene delivery. In this study, we reported the assembly of coumarin-anchored low generation dendrimers in aqueous solution via hydrophobic interactions. The synthesized material showed significantly improved DNA binding and gene delivery, and minimal toxicity on the transfected cells. Moreover, the coumarin moieties in the assembled nanostructures endow the materials with light-responsive drug delivery behaviors. The coumarin substitutes in the assembled nanostructures were cross-linked with each other upon irradiation at 365 nm, and the cross-linked assemblies were degraded upon further irradiation at 254 nm. As a result, the drug-loaded nanoparticle showed a light-responsive drug release behavior and light-enhanced anticancer activity. The assembled nanoparticle also exhibited a complementary anticancer activity through the codelivery of 5-fluorouracil and a therapeutic gene encoding tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). This study provided a facile strategy to develop light-responsive polymers for the codelivery of therapeutic genes and anticancer drugs.
Yin, Jian; Wang, Ai-Ping; Li, Wan-Fang; Shi, Rui; Jin, Hong-Tao; Wei, Jin-Feng
2018-01-01
The present work aims to explore the time-response (from 24 h to 96 h) characteristic and identify early potential sensitive biomarkers of copper (Cu) (as copper chloride dihydrate), cadmium (Cd) (as cadmium acetate), lead (Pb) (as lead nitrate) and chromium (Cr) (as potassium dichromate) exposure in adult zebrafish, focusing on reactive oxygen species (ROS), SOD activity, lipid peroxidation and gene expression related to oxidative stress and inflammatory response. Furthermore, the survival rate decreased apparently by a concentration-dependent manner after Cu, Cr, Cd and Pb exposure, and we selected non-lethal concentrations 0.05 mg/L for Cu, 15 mg/L for Cr, 3 mg/L for Cd and 93.75μg/L for Pb to test the effect on the following biological indicators. Under non-lethal concentration, the four heavy metals have no apparent histological change in adult zebrafish gills. Similar trends in ROS production, MDA level and SOD activity were up-regulated by the four heavy metals, while MDA level responded more sensitive to Pb by time-dependent manner than the other three heavy metals. In addition, mRNA levels related to antioxidant system (SOD1, SOD2 and Nrf2) were up-regulated by non-lethal concentration Cu, Cr, Cd and Pb exposure. MDA level and SOD1 gene have a more delayed response to heavy metals. Genes related to immunotoxicity were increased significantly after heavy metals exposure at non-lethal concentrations. TNF-α and IL-1β gene have similar sensibility to the four heavy metals, while IL-8 gene was more responsive to Cr, Cd and Pb exposure at 48 h groups and IFN-γ gene showed more sensitivity to Cu at 48 h groups than the other heavy metals. In conclusion, the present works have suggested that the IFN-γ gene may applied as early sensitive biomarker to identify Cu-induced toxicity, while MDA content and IL-8 gene may use as early sensitive biomarkers for evaluating the risk of Pb exposure. Moreover, IL-8 and IFN-γ gene were more responsive to heavy
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Takahashi, Junko; Waki, Shiori; Matsumoto, Rena; Odake, Junji; Miyaji, Takayuki; Tottori, Junichi; Iwanaga, Takehiro; Iwahashi, Hitoshi
2012-01-01
Background Hyperlipidemia animal models have been established, but complete gene expression profiles of the transition from normal lipid levels have not been obtained. Miniature pigs are useful model animals for gene expression studies on dietary-induced hyperlipidemia because they have a similar anatomy and digestive physiology to humans, and blood samples can be obtained from them repeatedly. Methodology Two typical dietary treatments were used for dietary-induced hyperlipidemia models, by using specific pathogen-free (SPF) Clawn miniature pigs. One was a high-fat and high-cholesterol diet (HFCD) and the other was a high-fat, high-cholesterol, and high-sucrose diet (HFCSD). Microarray analyses were conducted from whole blood samples during the dietary period and from white blood cells at the end of the dietary period to evaluate the transition of expression profiles of the two dietary models. Principal Findings Variations in whole blood gene expression intensity within the HFCD or the HFCSD group were in the same range as the controls provide with normal diet at all periods. This indicates uniformity of dietary-induced hyperlipidemia for our dietary protocols. Gene ontology- (GO) based functional analyses revealed that characteristics of the common changes between HFCD and HFCSD were involved in inflammatory responses and reproduction. The correlation coefficient between whole blood and white blood cell expression profiles at 27 weeks with the HFCSD diet was significantly lower than that of the control and HFCD diet groups. This may be due to the effects of RNA originating from the tissues and/or organs. Conclusions No statistically significant differences in fasting plasma lipids and glucose levels between the HFCD and HFCSD groups were observed. However, blood RNA analyses revealed different characteristics corresponding to the dietary protocols. In this study, whole blood RNA analyses proved to be a useful tool to evaluate transitions in dietary-induced
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adebambo, Oluwadamilare A.; Ray, Paul D.; Shea, Damian
Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one bymore » Cd. Six gene biomarkers were measured in order to evaluate the effects from the metal mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu{sup 2+} transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. - Highlights: • Toxicogenomic responses of environmental metal mixtures assessed • Induction of ATP7B, HO-1, MT1A, MT1F and MT1G by metal mixtures observed in placental cells • Higher gene induction in response to metal mixtures versus single metal treatments.« less
Salmonella induces prominent gene expression in the rat colon
Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg MJ
2007-01-01
Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression
Salmonella induces prominent gene expression in the rat colon.
Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg M J
2007-09-12
Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFN gamma and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression.
Lou, Yonggen; Baldwin, Ian T.
2004-01-01
Although nitrogen (N) availability is known to alter constitutive resistance against herbivores, its influence on herbivore-induced responses, including signaling pathways, transcriptional signatures, and the subsequently elicited chemical defenses is poorly understood. We used the native tobacco, Nicotiana attenuata, which germinates in the postfire environment and copes with large changes in soil N during postfire succession, to compare a suite of Manduca sexta- and elicitor-induced responses in plants grown under high- and low-N (LN) supply rates. LN supply decreased relative growth rates and biomass by 35% at 40 d compared to high-N plants; furthermore, it also attenuated (by 39 and 60%) the elicitor-induced jasmonate and salicylate bursts, two N-intensive direct defenses (nicotine and trypsin proteinase inhibitors, albeit by different mechanisms), and carbon-containing nonvolatile defenses (rutin, chlorogenic acid, and diterpene glycosides), but did not affect the induced release of volatiles (cis-α-bergamotene and germacrene A), which function as indirect defenses. M. sexta and methyl jasmonate-induced transcriptional responses measured with a microarray enriched in herbivore-induced genes were also substantially reduced in plants grown under LN supply rates. In M. sexta-attacked LN plants, only 36 (45%) up-regulated and 46 (58%) down-regulated genes showed the same regulation as those in attacked high-N plants. However, transcriptional responses frequently directly countered the observed metabolic changes. Changes in a leaf's sensitivity to elicitation, an attacked leaf's waning ability to export oxylipin wound signals, and/or resource limitations in LN plants can account for the observed results, underscoring the conclusion that defense activation is a resource-intensive response. PMID:15133153
Ling, JunJun; Yang, Shengyou; Huang, Yi; Wei, Dongfeng; Cheng, Weidong
2018-06-01
Alzheimer disease (AD) is a progressive neurodegenerative disease, the etiology of which remains largely unknown. Accumulating evidence indicates that elevated manganese (Mn) in brain exerts toxic effects on neurons and contributes to AD development. Thus, we aimed to explore the gene and pathway variations through analysis of high through-put data in this process.To screen the differentially expressed genes (DEGs) that may play critical roles in Mn-induced AD, public microarray data regarding Mn-treated neurocytes versus controls (GSE70845), and AD versus controls (GSE48350), were downloaded and the DEGs were screened out, respectively. The intersection of the DEGs of each datasets was obtained by using Venn analysis. Then, gene ontology (GO) function analysis and KEGG pathway analysis were carried out. For screening hub genes, protein-protein interaction network was constructed. At last, DEGs were analyzed in Connectivity Map (CMAP) for identification of small molecules that overcome Mn-induced neurotoxicity or AD development.The intersection of the DEGs obtained 140 upregulated and 267 downregulated genes. The top 5 items of biological processes of GO analysis were taxis, chemotaxis, cell-cell signaling, regulation of cellular physiological process, and response to wounding. The top 5 items of KEGG pathway analysis were cytokine-cytokine receptor interaction, apoptosis, oxidative phosphorylation, Toll-like receptor signaling pathway, and insulin signaling pathway. Afterwards, several hub genes such as INSR, VEGFA, PRKACB, DLG4, and BCL2 that might play key roles in Mn-induced AD were further screened out. Interestingly, tyrphostin AG-825, an inhibitor of tyrosine phosphorylation, was predicted to be a potential agent for overcoming Mn-induced neurotoxicity or AD development.The present study provided a novel insight into the molecular mechanisms of Mn-induced neurotoxicity or AD development and screened out several small molecular candidates that might be
Banerjee, Antara; Bhattacharya, Parna; Dagur, Pradeep K; Karmakar, Subir; Ismail, Nevien; Joshi, Amritanshu B; Akue, Adovi D; KuKuruga, Mark; McCoy, John Philip; Dey, Ranadhir; Nakhasi, Hira L
2018-01-01
No vaccine exists against visceral leishmaniasis. To develop effective vaccines, we have previously reported protective role of live attenuated centrin gene-deleted Leishmania donovani ( LdCen -/- ) parasites through induction of Th1 type immune response in mice, hamsters, and dogs. In this study, we specifically explored the role of Th17 cells in LdCen -/- -induced host protection in mice. Our results showed that compared with wild-type L. donovani infection, LdCen -/- parasites induce significantly higher expression of Th17 differentiation cytokines in splenic dendritic cells. There was also induction of IL-17 and its promoting cytokines in total splenocytes and in both CD4 and CD8 T cells following immunization with LdCen -/- Upon challenge with wild-type parasites, IL-17 and its differentiating cytokines were significantly higher in LdCen -/- -immunized mice compared with nonimmunized mice that resulted in parasite control. Alongside IL-17 induction, we observed induction of IFN-γ-producing Th1 cells as reported earlier. However, Th17 cells are generated before Th1 cells. Neutralization of either IL-17 or IFN-γ abrogated LdCen -/- -induced host protection further confirming the essential role of Th17 along with Th1 cytokines in host protection. Treatment with recombinant IL-23, which is required for stabilization and maintenance of IL-17, heightened Th17, and Tc17 responses in immunized mice splenocytes. In contrast, Th17 response was absent in immunized IL-23R -/- mice that failed to induce protection upon virulent Leishmania challenge suggesting that IL-23 plays an essential role in IL-17-mediated protection by LdCen -/- parasites. This study unveiled the role of IL-23-dependent IL-17 induction in LdCen -/- parasite-induced immunity and subsequent protection against visceral leishmaniasis.
Enders, Laramy S.; Bickel, Ryan D.; Brisson, Jennifer A.; Heng-Moss, Tiffany M.; Siegfried, Blair D.; Zera, Anthony J.; Miller, Nicholas J.
2014-01-01
Environmental stress affects basic organismal functioning and can cause physiological, developmental, and reproductive impairment. However, in many nonmodel organisms, the core molecular stress response remains poorly characterized and the extent to which stress-induced transcriptional changes differ across qualitatively different stress types is largely unexplored. The current study examines the molecular stress response of the soybean aphid (Aphis glycines) using RNA sequencing and compares transcriptional responses to multiple stressors (heat, starvation, and plant defenses) at a standardized stress level (27% adult mortality). Stress-induced transcriptional changes showed remarkable variation, with starvation, heat, and plant defensive stress altering the expression of 3985, 510, and 12 genes, respectively. Molecular responses showed little overlap across all three stressors. However, a common transcriptional stress response was identified under heat and starvation, involved with up-regulation of glycogen biosynthesis and molecular chaperones and down-regulation of bacterial endosymbiont cellular and insect cuticular components. Stressor-specific responses indicated heat affected expression of heat shock proteins and cuticular components, whereas starvation altered a diverse set of genes involved in primary metabolism, oxidative reductive processes, nucleosome and histone assembly, and the regulation of DNA repair and replication. Exposure to host plant defenses elicited the weakest response, of which half of the genes were of unknown function. This study highlights the need for standardizing stress levels when comparing across stress types and provides a basis for understanding the role of general vs. stressor specific molecular responses in aphids. PMID:25538100
Sphingomonas wittichii Strain RW1 Genome-Wide Gene Expression Shifts in Response to Dioxins and Clay
Tsoi, Tamara V.; Iwai, Shoko; Liu, Cun; Fish, Jordan A.; Gu, Cheng; Johnson, Timothy A.; Zylstra, Gerben; Teppen, Brian J.; Li, Hui; Hashsham, Syed A.; Boyd, Stephen A.; Cole, James R.; Tiedje, James M.
2016-01-01
Sphingomonas wittichii strain RW1 (RW1) is one of the few strains that can grow on dibenzo-p-dioxin (DD). We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF), and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC) as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes’ microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis. PMID:27309357
Patterson, Rachel A.; Juarez, Michelle T.; Hermann, Anita; Sasik, Roman; Hardiman, Gary; McGinnis, William
2013-01-01
After injury to the animal epidermis, a variety of genes are transcriptionally activated in nearby cells to regenerate the missing cells and facilitate barrier repair. The range and types of diffusible wound signals that are produced by damaged epidermis and function to activate repair genes during epidermal regeneration remains a subject of very active study in many animals. In Drosophila embryos, we have discovered that serine protease function is locally activated around wound sites, and is also required for localized activation of epidermal repair genes. The serine protease trypsin is sufficient to induce a striking global epidermal wound response without inflicting cell death or compromising the integrity of the epithelial barrier. We developed a trypsin wounding treatment as an amplification tool to more fully understand the changes in the Drosophila transcriptome that occur after epidermal injury. By comparing our array results with similar results on mammalian skin wounding we can see which evolutionarily conserved pathways are activated after epidermal wounding in very diverse animals. Our innovative serine protease-mediated wounding protocol allowed us to identify 8 additional genes that are activated in epidermal cells in the immediate vicinity of puncture wounds, and the functions of many of these genes suggest novel genetic pathways that may control epidermal wound repair. Additionally, our data augments the evidence that clean puncture wounding can mount a powerful innate immune transcriptional response, with different innate immune genes being activated in an interesting variety of ways. These include puncture-induced activation only in epidermal cells in the immediate vicinity of wounds, or in all epidermal cells, or specifically in the fat body, or in multiple tissues. PMID:23637905
Tamiru, Amanuel; Bruce, Toby J A; Richter, Annett; Woodcock, Christine M; Midega, Charles A O; Degenhardt, Jörg; Kelemu, Segenet; Pickett, John A; Khan, Zeyaur R
2017-04-01
Maize ( Zea mays ) emits volatile terpenes in response to insect feeding and egg deposition to defend itself against harmful pests. However, maize cultivars differ strongly in their ability to produce the defense signal. To further understand the agroecological role and underlying genetic mechanisms for variation in terpene emission among maize cultivars, we studied the production of an important signaling component ( E )-caryophyllene in a South American maize landrace Braz1006 possessing stemborer Chilo partellus egg inducible defense trait, in comparison with the European maize line Delprim and North American inbred line B73. The ( E) - caryophyllene production level and transcript abundance of TPS23, terpene synthase responsible for ( E) - caryophyllene formation, were compared between Braz1006, Delprim, and B73 after mimicked herbivory. Braz1006-TPS23 was heterologously expressed in E. coli , and amino acid sequences were determined. Furthermore, electrophysiological and behavioral responses of a key parasitic wasp Cotesia sesamiae to C . partellus egg-induced Braz1006 volatiles were determined using coupled gas chromatography electroantennography and olfactometer bioassay studies. After elicitor treatment, Braz1006 released eightfold higher ( E) -caryophyllene than Delprim, whereas no ( E) -caryophyllene was detected in B73. The superior (E)- caryophyllene production by Braz1006 was positively correlated with high transcript levels of TPS23 in the landrace compared to Delprim. TPS23 alleles from Braz1006 showed dissimilarities at different sequence positions with Delprim and B73 and encodes an active enzyme. Cotesia sesamiae was attracted to egg-induced volatiles from Braz1006 and synthetic (E)- caryophyllene. The variation in ( E) -caryophyllene emission between Braz1006 and Delprim is positively correlated with induced levels of TPS23 transcripts. The enhanced TPS23 activity and corresponding ( E) -caryophyllene production by the maize landrace could be
Mechanical Stress Induces Biotic and Abiotic Stress Responses via a Novel cis-Element
Walley, Justin W; Coughlan, Sean; Hudson, Matthew E; Covington, Michael F; Kaspi, Roy; Banu, Gopalan; Harmer, Stacey L; Dehesh, Katayoon
2007-01-01
Plants are continuously exposed to a myriad of abiotic and biotic stresses. However, the molecular mechanisms by which these stress signals are perceived and transduced are poorly understood. To begin to identify primary stress signal transduction components, we have focused on genes that respond rapidly (within 5 min) to stress signals. Because it has been hypothesized that detection of physical stress is a mechanism common to mounting a response against a broad range of environmental stresses, we have utilized mechanical wounding as the stress stimulus and performed whole genome microarray analysis of Arabidopsis thaliana leaf tissue. This led to the identification of a number of rapid wound responsive (RWR) genes. Comparison of RWR genes with published abiotic and biotic stress microarray datasets demonstrates a large overlap across a wide range of environmental stresses. Interestingly, RWR genes also exhibit a striking level and pattern of circadian regulation, with induced and repressed genes displaying antiphasic rhythms. Using bioinformatic analysis, we identified a novel motif overrepresented in the promoters of RWR genes, herein designated as the Rapid Stress Response Element (RSRE). We demonstrate in transgenic plants that multimerized RSREs are sufficient to confer a rapid response to both biotic and abiotic stresses in vivo, thereby establishing the functional involvement of this motif in primary transcriptional stress responses. Collectively, our data provide evidence for a novel cis-element that is distributed across the promoters of an array of diverse stress-responsive genes, poised to respond immediately and coordinately to stress signals. This structure suggests that plants may have a transcriptional network resembling the general stress signaling pathway in yeast and that the RSRE element may provide the key to this coordinate regulation. PMID:17953483
Reese, Tiffany A.; Bi, Kevin; Kambal, Amal; Filali-Mouhim, Ali; Beura, Lalit K.; Bürger, Matheus C.; Pulendran, Bali; Sekaly, Rafick; Jameson, Stephen C.; Masopust, David; Haining, W. Nicholas; Virgin, Herbert W.
2016-01-01
Summary Immune responses differ between laboratory mice and humans. Chronic infection with viruses and parasites are common in humans, but are absent in laboratory mice, and thus represent potential contributors to inter-species differences in immunity. To test this, we sequentially infected laboratory mice with herpesviruses, influenza, and an intestinal helminth, and compared their blood immune signatures to mock-infected mice before and after vaccination against Yellow Fever Virus (YFV-17D). Sequential infection altered pre- and post-vaccination gene expression, cytokines, and antibodies in blood. Sequential pathogen exposure induced gene signatures that recapitulated those seen in blood from pet store-raised versus laboratory mice, and adult versus cord blood in humans. Therefore basal and vaccine-induced murine immune responses are altered by infection with agents common outside of barrier facilities. This raises the possibility that we can improve mouse models of vaccination and immunity by selective microbial exposure of laboratory animals to mimic that of humans. PMID:27107939
Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space
NASA Technical Reports Server (NTRS)
Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu
2015-01-01
Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to
Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space
NASA Technical Reports Server (NTRS)
Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu
2015-01-01
Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.
Capilla, Amalia; Karachentsev, Dmitry; Patterson, Rachel A.; Hermann, Anita; Juarez, Michelle T.; McGinnis, William
2017-01-01
The epidermis serves as a protective barrier in animals. After epidermal injury, barrier repair requires activation of many wound response genes in epidermal cells surrounding wound sites. Two such genes in Drosophila encode the enzymes dopa decarboxylase (Ddc) and tyrosine hydroxylase (ple). In this paper we explore the involvement of the Toll/NF-κB pathway in the localized activation of wound repair genes around epidermal breaks. Robust activation of wound-induced transcription from ple and Ddc requires Toll pathway components ranging from the extracellular ligand Spätzle to the Dif transcription factor. Epistasis experiments indicate a requirement for Spätzle ligand downstream of hydrogen peroxide and protease function, both of which are known activators of wound-induced transcription. The localized activation of Toll a few cell diameters from wound edges is reminiscent of local activation of Toll in early embryonic ventral hypoderm, consistent with the hypothesis that the dorsal–ventral patterning function of Toll arose from the evolutionary cooption of a morphogen-responsive function in wound repair. Furthermore, the combinatorial activity of Toll and other signaling pathways in activating epidermal barrier repair genes can help explain why developmental activation of the Toll, ERK, or JNK pathways alone fail to activate wound repair loci. PMID:28289197
Weinkopff, Tiffany; de Oliveira, Camila I; de Carvalho, Augusto M; Hauyon-La Torre, Yazmin; Muniz, Aline C; Miranda, Jose Carlos; Barral, Aldina; Tacchini-Cottier, Fabienne
2014-01-01
During a blood meal, Lutzomyia intermedia sand flies transmit Leishmania braziliensis, a parasite causing tegumentary leishmaniasis. In experimental leishmaniasis, pre-exposure to saliva of most blood-feeding sand flies results in parasite establishment in absence of any skin damages in mice challenged with dermotropic Leishmania species together with saliva. In contrast, pre-immunization with Lu. intermedia salivary gland sonicate (SGS) results in enhanced skin inflammatory exacerbation upon co-inoculation of Lu. intermedia SGS and L. braziliensis. These data highlight potential unique features of both L. braziliensis and Lu. intermedia. In this study, we investigated the genes modulated by Lu. intermedia SGS immunization to understand their potential impact on the subsequent cutaneous immune response following inoculation of both SGS and L. braziliensis. The cellular recruitment and global gene expression profile was analyzed in mice repeatedly inoculated or not with Lu. intermedia. Microarray gene analysis revealed the upregulation of a distinct set of IFN-inducible genes, an immune signature not seen to the same extent in control animals. Of note this INF-inducible gene set was not induced in SGS pre-immunized mice subsequently co-inoculated with SGS and L. braziliensis. These data suggest the parasite prevented the upregulation of this Lu. intermedia saliva-related immune signature. The presence of these IFN-inducible genes was further analyzed in peripheral blood mononuclear cells (PBMCs) sampled from uninfected human individuals living in a L. braziliensis-endemic region of Brazil thus regularly exposed to Lu. intermedia bites. PBMCs were cultured in presence or absence of Lu. intermedia SGS. Using qRT-PCR we established that the IFN-inducible genes induced in the skin of SGS pre-immunized mice, were also upregulated by SGS in PBMCs from human individuals regularly exposed to Lu. intermedia bites, but not in PBMCs of control subjects. These data demonstrate
Weinkopff, Tiffany; de Oliveira, Camila I.; de Carvalho, Augusto M.; Hauyon-La Torre, Yazmin; Muniz, Aline C.; Miranda, Jose Carlos; Barral, Aldina; Tacchini-Cottier, Fabienne
2014-01-01
During a blood meal, Lutzomyia intermedia sand flies transmit Leishmania braziliensis, a parasite causing tegumentary leishmaniasis. In experimental leishmaniasis, pre-exposure to saliva of most blood-feeding sand flies results in parasite establishment in absence of any skin damages in mice challenged with dermotropic Leishmania species together with saliva. In contrast, pre-immunization with Lu. intermedia salivary gland sonicate (SGS) results in enhanced skin inflammatory exacerbation upon co-inoculation of Lu. intermedia SGS and L. braziliensis. These data highlight potential unique features of both L. braziliensis and Lu. intermedia. In this study, we investigated the genes modulated by Lu. intermedia SGS immunization to understand their potential impact on the subsequent cutaneous immune response following inoculation of both SGS and L. braziliensis. The cellular recruitment and global gene expression profile was analyzed in mice repeatedly inoculated or not with Lu. intermedia. Microarray gene analysis revealed the upregulation of a distinct set of IFN-inducible genes, an immune signature not seen to the same extent in control animals. Of note this INF-inducible gene set was not induced in SGS pre-immunized mice subsequently co-inoculated with SGS and L. braziliensis. These data suggest the parasite prevented the upregulation of this Lu. intermedia saliva-related immune signature. The presence of these IFN-inducible genes was further analyzed in peripheral blood mononuclear cells (PBMCs) sampled from uninfected human individuals living in a L. braziliensis-endemic region of Brazil thus regularly exposed to Lu. intermedia bites. PBMCs were cultured in presence or absence of Lu. intermedia SGS. Using qRT-PCR we established that the IFN-inducible genes induced in the skin of SGS pre-immunized mice, were also upregulated by SGS in PBMCs from human individuals regularly exposed to Lu. intermedia bites, but not in PBMCs of control subjects. These data demonstrate
Avramova, Zoya
2015-07-01
Drought, salinity, extreme temperature variations, pathogen and herbivory attacks are recurring environmental stresses experienced by plants throughout their life. To survive repeated stresses, plants provide responses that may be different from their response during the first encounter with the stress. A different response to a similar stress represents the concept of 'stress memory'. A coordinated reaction at the organismal, cellular and gene/genome levels is thought to increase survival chances by improving the plant's tolerance/avoidance abilities. Ultimately, stress memory may provide a mechanism for acclimation and adaptation. At the molecular level, the concept of stress memory indicates that the mechanisms responsible for memory-type transcription during repeated stresses are not based on repetitive activation of the same response pathways activated by the first stress. Some recent advances in the search for transcription 'memory factors' are discussed with an emphasis on super-induced dehydration stress memory response genes in Arabidopsis. © 2015 The Author The Plant Journal © 2015 John Wiley & Sons Ltd.
Dadras, Soheil S.; Cai, Xiaoyan; Abasolo, Ibane; Wang, Zhou
2001-01-01
The growth and development of some of the male sex accessory organs such as the prostate requires the conversion of testosterone to dihydrotestosterone (DHT) by 5α-reductase. To provide insights into the role of testosterone versus DHT in the prostate, we studied the impact of finasteride, a potent and specific inhibitor of 5α-reductase, on the expression of prostatic androgen-response genes in testis-intact rats and in 7-day castrated rats. Finasteride inhibition of the conversion of testosterone to DHT was confirmed by measuring serum and intraprostatic androgens. As expected, finasteride treatment caused a reduction in the wet weight of the prostate in the testis-intact rats and inhibited the testosterone-stimulated prostatic regrowth in the 7-day castrated rats. Although finasteride treatment had little or no effect on the expression of the surveyed androgen-response genes in testis-intact rats, its administration enhanced the expression of many androgen-response genes during the testosterone-stimulated regrowth of the regressed prostate in castrated rats. These observations suggest that testosterone is more potent than DHT in stimulating the expression of many androgen-response genes in the regressed prostate. The expression of androgen-response genes is mainly prostate specific and thus is likely to be associated with androgen-dependent prostatic differentiation. Therefore, testosterone is more potent than DHT in inducing differentiation and weaker in stimulating proliferation during prostate regrowth. The fact that testosterone is a strong inducer of prostatic differentiation has potential clinical implications. PMID:11444528
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun Yang; Kojima, Chikara; Chignell, Colin
2011-09-15
Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm{supmore » 2}) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: > Arsenic transformation adapted to UV-induced apoptosis. > Arsenic transformation diminished oxidant response. > Arsenic transformation enhanced UV-induced DNA damage.« less
Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki
2004-01-01
The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894
Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.
2009-01-01
OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of
NASA Astrophysics Data System (ADS)
Fortunati, A.; Tassone, P.; Migliaccio, F.
2008-06-01
Researches were conducted on the effect of neutron radiation on the expression of genes auxin activated or connected with the process of senescence in Arabidopsis plants. The research was done by applying the real-time polymerase chain reaction (PCR) technique. The results indicated that the auxin response factors (ARFs) genes are clearly downregulated, whereas the indolacetic acid-induced (Aux/IAAs) genes in some cases were upregulated. By contrast in the mutants for auxin transport aux1 and eir1 the ARFs genes were upregulated. In addition, both in the wildtype and mutants, some already known genes activated by stress and senescence were significantly upregulated. On the basis of these researches we conclude that the process of senescence induced by irradiation is, at least in part, controlled by the physiology of the hormone auxin.
Ray, Lara A
2011-01-01
Neurobiological theories of addiction have highlighted disruption in stress pathways as a central feature of addictive disorders, and pharmacological treatments targeting stress mechanisms hold great promise. This study examines genetic determinants of stress-induced and cue-induced craving in heavy drinkers by testing single-nucleotide polymorphisms (SNPs) of the corticotrophin-releasing hormone binding protein (CRH-BP) gene and the mu-opioid receptor (OPRM1) gene. This study combines guided imagery stress exposure and in vivo alcohol cue exposure in a sample of 64 (23 women) non-treatment-seeking heavy drinkers. Analyses, uncorrected for multiple comparisons, revealed that a tag SNP of the CRH-BP gene (rs10055255) moderated stress-induced craving in this sample. The same SNP predicted greater affective responses to the stress manipulation, including greater levels of subjective tension and negative mood. The Asp40 allele of the OPRM1 was associated with greater cue-induced alcohol craving following the neutral imagery condition. These initial results extend recent preclinical and clinical findings implicating the CRH-BP in stress-related alcoholism and confirm the role of the Asp40 allele of the OPRM1 gene in reward-driven alcohol phenotypes. Human laboratory models of stress and cue-induced craving may be useful in pharmacotherapy development targeting dysregulation of stress systems. Larger studies are needed to validate these preliminary findings, which should also be extended to clinical samples. Copyright © 2010 by the Research Society on Alcoholism.
Wang, Fang; Ning, Duo; Chen, Yang; Dang, Cong; Han, Nai-Shun; Liu, Yu'e; Ye, Gong-Yin
2015-01-01
Bt proteins are the most widely used insecticidal proteins in transgenic crops for improving insect resistance. We previously observed longer nymphal developmental duration and lower fecundity in brown planthopper (BPH) fed on Bt rice line KMD2, although Bt insecticidal protein Cry1Ab could rarely concentrate in this non-target rice pest. In the present study, we performed microarray analysis in an effort to detect Bt-independent variation, which might render Bt rice more defensive and/or less nutritious to BPH. We detected 3834 and 3273 differentially expressed probe-sets in response to BPH infestation in non-Bt parent Xiushui 11 and Bt rice KMD2, respectively, only 439 of which showed significant differences in expression between rice lines. Our analysis revealed a shift from growth to defense responses in response to BPH infestation, which was also detected in many other studies of plants suffering biotic and abiotic stresses. Chlorophyll biosynthesis and basic metabolism pathways were inhibited in response to infestation. IAA and GA levels decreased as a result of the repression of biosynthesis-related genes or the induction of inactivation-related genes. In accordance with these observations, a number of IAA-, GA-, BR-signaling genes were downregulated in response to BPH. Thus, the growth of rice plants under BPH attack was reduced and defense related hormone signaling like JA, SA and ET were activated. In addition, growth-related hormone signaling pathways, such as GA, BR, and auxin signaling pathways, as well as ABA, were also found to be involved in BPH-induced defense. On the other side, 51 probe-sets (represented 50 genes) that most likely contribute to the impact of Bt rice on BPH were identified, including three early nodulin genes, four lipid metabolic genes, 14 stress response genes, three TF genes and genes with other functions. Two transcription factor genes, bHLH and MYB, together with lipid transfer protein genes LTPL65 and early nodulin gene ENOD
Lorimore, S A; Wright, E G
2003-01-01
To review studies of radiation responses in the haemopoietic system in the context of radiation-induced genomic instability, bystander effects and inflammatory-type processes. There is considerable evidence that cells that themselves are not exposed to ionizing radiation but are the progeny of cells irradiated many cell divisions previously may express a high frequency of gene mutations, chromosomal aberrations and cell death. These effects are collectively known as radiation-induced genomic instability. A second untargeted effect results in non-irradiated cells exhibiting responses typically associated with direct radiation exposure but occurs as a consequence of contact with irradiated cells or by receiving soluble signals from irradiated cells. These effects are collectively known as radiation-induced bystander effects. Reported effects include increases or decreases in damage-inducible and stress-related proteins; increases or decreases in reactive oxygen species, cell death or cell proliferation, and induction of mutations and chromosome aberrations. This array of responses is reminiscent of effects mediated by cytokines and other similar regulatory factors that may involve, but do not necessarily require, gap junction-mediated transfer, have multiple inducers and a variety of context-dependent consequences in different cell systems. That chromosomal instability in haemopoietic cells can be induced by an indirect bystander-type mechanism both in vitro and in vivo provides a potential link between these two untargeted effects and there are radiation responses in vivo consistent with the microenvironment contributing secondary cell damage as a consequence of an inflammatory-type response to radiation-induced injury. Intercellular signalling, production of cytokines and free radicals are features of inflammatory responses that have the potential for both bystander-mediated and persisting damage as well as for conferring a predisposition to malignancy. The
Heuchel, R; Radtke, F; Georgiev, O; Stark, G; Aguet, M; Schaffner, W
1994-06-15
We have described and cloned previously a factor (MTF-1) that binds specifically to heavy metal-responsive DNA sequence elements in the enhancer/promoter region of metallothionein genes. MTF-1 is a protein of 72.5 kDa that contains six zinc fingers and multiple domains for transcriptional activation. Here we report the disruption of both alleles of the MTF-1 gene in mouse embryonic stem cells by homologous recombination. The resulting null mutant cell line fails to produce detectable amounts of MTF-1. Moreover, due to the loss of MTF-1, the endogenous metallothionein I and II genes are silent, indicating that MTF-1 is required for both their basal and zinc-induced transcription. In addition to zinc, other heavy metals, including cadmium, copper, nickel and lead, also fail to activate metal-responsive promoters in null mutant cells. However, cotransfection of an MTF-1 expression vector and metal-responsive reporter genes yields strong basal transcription that can be further boosted by zinc treatment of cells. These results demonstrate that MTF-1 is essential for metallothionein gene regulation. Finally, we present evidence that MTF-1 itself is a zinc sensor, which exhibits increased DNA binding activity upon zinc treatment.
Diet-induced obesity reprograms the inflammatory response of the murine lung to inhaled endotoxin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tilton, Susan C., E-mail: susan.tilton@pnnl.gov; Waters, Katrina M.; Karin, Norman J.
The co-occurrence of environmental factors is common in complex human diseases and, as such, understanding the molecular responses involved is essential to determine risk and susceptibility to disease. We have investigated the key biological pathways that define susceptibility for pulmonary infection during obesity in diet-induced obese (DIO) and regular weight (RW) C57BL/6 mice exposed to inhaled lipopolysaccharide (LPS). LPS induced a strong inflammatory response in all mice as indicated by elevated cell counts of macrophages and neutrophils and levels of proinflammatory cytokines (MDC, MIP-1γ, IL-12, RANTES) in the bronchoalveolar lavage fluid. Additionally, DIO mice exhibited 50% greater macrophage cell counts,more » but decreased levels of the cytokines, IL-6, TARC, TNF-α, and VEGF relative to RW mice. Microarray analysis of lung tissue showed over half of the LPS-induced expression in DIO mice consisted of genes unique for obese mice, suggesting that obesity reprograms how the lung responds to subsequent insult. In particular, we found that obese animals exposed to LPS have gene signatures showing increased inflammatory and oxidative stress response and decreased antioxidant capacity compared with RW. Because signaling pathways for these responses can be common to various sources of environmentally induced lung damage, we further identified biomarkers that are indicative of specific toxicant exposure by comparing gene signatures after LPS exposure to those from a parallel study with cigarette smoke. These data show obesity may increase sensitivity to further insult and that co-occurrence of environmental stressors result in complex biosignatures that are not predicted from analysis of individual exposures. - Highlights: ► Obesity modulates inflammatory markers in BAL fluid after LPS exposure. ► Obese animals have a unique transcriptional signature in lung after LPS exposure. ► Obesity elevates inflammatory stress and reduces antioxidant capacity in
Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael
2008-04-16
The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains.
Ståhlberg, Anders; Elbing, Karin; Andrade-Garda, José Manuel; Sjögreen, Björn; Forootan, Amin; Kubista, Mikael
2008-01-01
Background The large sensitivity, high reproducibility and essentially unlimited dynamic range of real-time PCR to measure gene expression in complex samples provides the opportunity for powerful multivariate and multiway studies of biological phenomena. In multiway studies samples are characterized by their expression profiles to monitor changes over time, effect of treatment, drug dosage etc. Here we perform a multiway study of the temporal response of four yeast Saccharomyces cerevisiae strains with different glucose uptake rates upon altered metabolic conditions. Results We measured the expression of 18 genes as function of time after addition of glucose to four strains of yeast grown in ethanol. The data are analyzed by matrix-augmented PCA, which is a generalization of PCA for 3-way data, and the results are confirmed by hierarchical clustering and clustering by Kohonen self-organizing map. Our approach identifies gene groups that respond similarly to the change of nutrient, and genes that behave differently in mutant strains. Of particular interest is our finding that ADH4 and ADH6 show a behavior typical of glucose-induced genes, while ADH3 and ADH5 are repressed after glucose addition. Conclusion Multiway real-time PCR gene expression profiling is a powerful technique which can be utilized to characterize functions of new genes by, for example, comparing their temporal response after perturbation in different genetic variants of the studied subject. The technique also identifies genes that show perturbed expression in specific strains. PMID:18412983
USDA-ARS?s Scientific Manuscript database
Marek’s disease (MD) is a lymphoproliferative disease of chickens induced by a highly cell-associated oncogenic alpha-herpesvirus, Marek’s disease virus (MDV). MDV replicates in chicken lymphocytes and establishes a latency infection within CD4+ T cells. Host-virus interaction, immune responses to...
Hong, Chi Eun; Ha, Young-Im; Choi, Hyoju; Moon, Ju Yeon; Lee, Jiyoung; Shin, Ah-Young; Park, Chang Jin; Yoon, Gyeong Mee; Kwon, Suk-Yoon; Jo, Ick-Hyun; Park, Jeong Mee
2017-03-01
Alpha-dioxygenases (α-DOX) catalyzing the primary oxygenation of fatty acids to oxylipins were recently found in plants. Here, the biological roles of the pepper α-DOX (Ca-DOX) gene, which is strongly induced during non-host pathogen infection in chili pepper, were examined. Virus-induced gene silencing demonstrated that down-regulation of Ca-DOX enhanced susceptibility to bacterial pathogens and suppressed the hypersensitive response via the suppression of pathogenesis-related genes such as PR4, proteinase inhibitor II and lipid transfer protein (PR14). Ca-DOX-silenced pepper plants also exhibited more retarded growth with lower epidermal cell numbers and reduced cell wall thickness than control plants. To better understand regulation of Ca-DOX, transgenic Arabidopsis plants harboring the β-glucuronidase (GUS) reporter gene driven from a putative Ca-DOX promoter were generated. GUS expression was significantly induced upon avirulent pathogen infection in transgenic Arabidopsis leaves, whereas GUS induction was relatively weak upon virulent pathogen treatment. After treatment with plant hormones, early and strong GUS expression was seen after treatment of salicylic acid, whereas ethylene and methyl jasmonate treatments produced relatively weak and late GUS signals. These results will enable us to further understand the role of α-DOX, which is important in lipid metabolism, defense responses, and growth development in plants.
Seizure-mediated neuronal activation induces DREAM gene expression in the mouse brain.
Matsu-ura, Toru; Konishi, Yoshiyuki; Aoki, Tsutomu; Naranjo, Jose R; Mikoshiba, Katsuhiko; Tamura, Taka-aki
2002-12-30
Various transcriptional activators are induced in neurons concomitantly with long-lasting neural activity, whereas only a few transcription factors are known to act as neural activity-inducible transcription repressors. In this study, mRNA of DREAM (DRE-antagonizing modulator), a Ca(2+)-modulated transcriptional repressor, was demonstrated to accumulate in the mouse brain after pentylenetetrazol (PTZ)-induced seizures. Accumulation in the mouse hippocampus reached maximal level in the late phase (at 7-8 h) after PTZ injection. Kainic acid induced the same response. Interestingly, the late induction of DREAM expression required new protein synthesis and was blocked by MK801 suggesting that Ca(2+)-influx via NMDA receptors is necessary for the PTZ-mediated DREAM expression. In situ hybridization revealed that PTZ-induced DREAM mRNA accumulation was observed particularly in the dentate gyrus, cerebral cortex, and piriform cortex. The results of the present study demonstrate that DREAM is a neural activity-stimulated late gene and suggest its involvement in adaptation to long-lasting neuronal activity.
Hwang, Sun-Goo; Kim, Dong Sub; Hwang, Jung Eun; Han, A-Reum; Jang, Cheol Seong
2014-05-15
In order to better understand the biological systems that are affected in response to cosmic ray (CR), we conducted weighted gene co-expression network analysis using the module detection method. By using the Pearson's correlation coefficient (PCC) value, we evaluated complex gene-gene functional interactions between 680 CR-responsive probes from integrated microarray data sets, which included large-scale transcriptional profiling of 1000 microarray samples. These probes were divided into 6 distinct modules that contained 20 enriched gene ontology (GO) functions, such as oxidoreductase activity, hydrolase activity, and response to stimulus and stress. In particular, modules 1 and 2 commonly showed enriched annotation categories such as oxidoreductase activity, including enriched cis-regulatory elements known as ROS-specific regulators. These results suggest that the ROS-mediated irradiation response pathway is affected by CR in modules 1 and 2. We found 243 ionizing radiation (IR)-responsive probes that exhibited similarities in expression patterns in various irradiation microarray data sets. The expression patterns of 6 randomly selected IR-responsive genes were evaluated by quantitative reverse transcription polymerase chain reaction following treatment with CR, gamma rays (GR), and ion beam (IB); similar patterns were observed among these genes under these 3 treatments. Moreover, we constructed subnetworks of IR-responsive genes and evaluated the expression levels of their neighboring genes following GR treatment; similar patterns were observed among them. These results of network-based analyses might provide a clue to understanding the complex biological system related to the CR response in plants. Copyright © 2014 Elsevier B.V. All rights reserved.
Inducible Defenses Stay Up Late: Temporal Patterns of Immune Gene Expression in Tenebrio molitor
Johnston, Paul R; Makarova, Olga; Rolff, Jens
2014-01-01
The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. PMID:24318927
Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.
Johnston, Paul R; Makarova, Olga; Rolff, Jens
2013-12-06
The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.
Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.
Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui
2014-01-01
Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878
Gibbons, Taylor C; Metzger, David C H; Healy, Timothy M; Schulte, Patricia M
2017-05-01
Phenotypic plasticity is thought to facilitate the colonization of novel environments and shape the direction of evolution in colonizing populations. However, the relative prevalence of various predicted patterns of changes in phenotypic plasticity following colonization remains unclear. Here, we use a whole-transcriptome approach to characterize patterns of gene expression plasticity in the gills of a freshwater-adapted and a saltwater-adapted ecotype of threespine stickleback (Gasterosteus aculeatus) exposed to a range of salinities. The response of the gill transcriptome to environmental salinity had a large shared component common to both ecotypes (2159 genes) with significant enrichment of genes involved in transmembrane ion transport and the restructuring of the gill epithelium. This transcriptional response to freshwater acclimation is induced at salinities below two parts per thousand. There was also differentiation in gene expression patterns between ecotypes (2515 genes), particularly in processes important for changes in the gill structure and permeability. Only 508 genes that differed between ecotypes also responded to salinity and no specific processes were enriched among this gene set, and an even smaller number (87 genes) showed evidence of changes in the extent of the response to salinity acclimation between ecotypes. No pattern of relative expression dominated among these genes, suggesting that neither gains nor losses of plasticity dominated the changes in expression patterns between the ecotypes. These data demonstrate that multiple patterns of changes in gene expression plasticity can occur following colonization of novel habitats. © 2017 John Wiley & Sons Ltd.
Haddad, George; Belosevic, Miodrag
2009-02-01
We examined the induction of macrophage pro-inflammatory responses by transferrin-derived synthetic peptide originally identified following digestion of transferrin from different species (murine, bovine, human N-lobe and goldfish) using elastase. The mass spectrometry analysis of elastase-digested murine transferrin identified a 31 amino acid peptide located in the N2 sub-domain of the transferrin N-lobe, that we named TMAP. TMAP was synthetically produced and shown to induce a number of pro-inflammatory genes by quantitative PCR. TMAP induced chemotaxis, a potent nitric oxide response, and TNF-alpha secretion in different macrophage populations; P338D1 macrophage-like cells, mouse peritoneal macrophages, mouse bone marrow-derived macrophages (BMDM) and goldfish macrophages. The treatment of BMDM cultures with TMAP stimulated the production of nine cytokines and chemokines (IL-6, MCP-5, MIP-1 alpha, MIP-1 gamma, MIP-2, GCSF, KC, VEGF, and RANTES) that was measured using cytokine antibody array and confirmed by Western blot. Our results indicate that transferrin-derived peptide, TMAP, is an immunomodulating molecule capable of inducing pro-inflammatory responses in lower and higher vertebrates.
Molecular cloning of a defense-response-related cytochrome P450 gene from tobacco.
Takemoto, D; Hayashi, M; Doke, N; Nishimura, M; Kawakita, K
1999-12-01
Plant defenses against pathogen attack involve a series of inducible responses that contribute to resistance. Tobacco leaves injected with HWC (hyphal wall components prepared from Phytophthora infestans) elicitor showed typical defense responses, including the induction of localized necrosis and the accumulation of pathogenesis-related proteins. In order to elucidate the molecular mechanisms by which plant defense systems are activated, we screened tobacco plants for genes differentially expressed in response to HWC. We performed differential screening by RT-PCR with random primers and obtained PCR products specific to HWC-treated leaf RNA. Northern hybridization using the PCR products as probes confirmed that one transcript was actually induced by HWC treatment. As the deduced amino acid sequence of this clone showed the highest degree of similarity to elicitor-induced soybean cytochrome P450 CYP82A4, it was designated CYP82E1. The expression of CYP82E1 was strongly induced in tobacco by the soybean pathogen Pseudomonas syringae pv. glycinea (nonpathogenic on tobacco), but it was activated only slightly and in a delayed fashion by the tobacco pathogen P. syringae pv. tabaci (pathogenic on tobacco), implying that the product of CYP82E1 may be involved in disease resistance in tobacco.
Identification of water-deficit responsive genes in maritime pine (Pinus pinaster Ait.) roots.
Dubos, Christian; Plomion, Christophe
2003-01-01
Root adaptation to soil environmental factors is very important to maritime pine, the main conifer species used for reforestation in France. The range of climates in the sites where this species is established varies from flooded in winter to drought-prone in summer. No studies have yet focused on the morphological, physiological or molecular variability of the root system to adapt its growth to such an environment. We developed a strategy to isolate drought-responsive genes in the root tissue in order to identify the molecular mechanisms that trees have evolved to cope with drought (the main problem affecting wood productivity), and to exploit this information to improve drought stress tolerance. In order to provide easy access to the root system, seedlings were raised in hydroponic solution. Polyethylene glycol was used as an osmoticum to induce water deficit. Using the cDNA-AFLP technique, we screened more than 2500 transcript derived fragments, of which 33 (1.2%) showed clear variation in presence/absence between non stressed and stressed medium. The relative abundance of these transcripts was then analysed by reverse northern. Only two out of these 33 genes showed significant opposite behaviour between both techniques. The identification and characterization of water-deficit responsive genes in roots provide the emergence of physiological understanding of the patterns of gene expression and regulation involved in the drought stress response of maritime pine.
Changes in gene expression linked to methamphetamine-induced dopaminergic neurotoxicity.
Xie, Tao; Tong, Liqiong; Barrett, Tanya; Yuan, Jie; Hatzidimitriou, George; McCann, Una D; Becker, Kevin G; Donovan, David M; Ricaurte, George A
2002-01-01
The purpose of these studies was to examine the role of gene expression in methamphetamine (METH)-induced dopamine (DA) neurotoxicity. First, the effects of the mRNA synthesis inhibitor, actinomycin-D, and the protein synthesis inhibitor, cycloheximide, were examined. Both agents afforded complete protection against METH-induced DA neurotoxicity and did so independently of effects on core temperature, DA transporter function, or METH brain levels, suggesting that gene transcription and mRNA translation play a role in METH neurotoxicity. Next, microarray technology, in combination with an experimental approach designed to facilitate recognition of relevant gene expression patterns, was used to identify gene products linked to METH-induced DA neurotoxicity. This led to the identification of several genes in the ventral midbrain associated with the neurotoxic process, including genes for energy metabolism [cytochrome c oxidase subunit 1 (COX1), reduced nicotinamide adenine dinucleotide ubiquinone oxidoreductase chain 2, and phosphoglycerate mutase B], ion regulation (members of sodium/hydrogen exchanger and sodium/bile acid cotransporter family), signal transduction (adenylyl cyclase III), and cell differentiation and degeneration (N-myc downstream-regulated gene 3 and tau protein). Of these differentially expressed genes, we elected to further examine the increase in COX1 expression, because of data implicating energy utilization in METH neurotoxicity and the known role of COX1 in energy metabolism. On the basis of time course studies, Northern blot analyses, in situ hybridization results, and temperature studies, we now report that increased COX1 expression in the ventral midbrain is linked to METH-induced DA neuronal injury. The precise role of COX1 and other genes in METH neurotoxicity remains to be elucidated.
Chen, Er-Hu; Hou, Qiu-Li; Wei, Dan-Dan; Jiang, Hong-Bo; Wang, Jin-Jun
2017-08-17
Diet composition (yeast:carbohydrate ratio) is an important determinant of growth, development, and reproduction. Recent studies have shown that decreased yeast intake elicits numerous transcriptomic changes and enhances somatic maintenance and lifespan, which in turn reduces reproduction in various insects. However, our understanding of the responses leading to a decrease in yeast ratio to 0% is limited. In the present study, we investigated the effects of a sugar-only diet (SD) on the gene expression patterns of the oriental fruit fly, Bactrocera dorsalis (Hendel), one of the most economically important pests in the family Tephritidae. RNA sequencing analyses showed that flies reared on an SD induced significant changes in the expression levels of genes associated with specific metabolic as well as cell growth and death pathways. Moreover, the observed upregulated genes in energy production and downregulated genes associated with reproduction suggested that SD affects somatic maintenance and reproduction in B. dorsalis. As expected, we observed that SD altered B. dorsalis phenotypes by significantly increasing stress (starvation and desiccation) resistance, decreasing reproduction, but did not extend lifespan compared to those that received a normal diet (ND) regime. In addition, administration of an SD resulted in a reduction in antioxidant enzyme activities and an increase in MDA concentrations, thereby suggesting that antioxidants cannot keep up with the increase in oxidative damage induced by SD regime. The application of an SD diet induces changes in phenotypes, antioxidant responses, and gene expressions in B. dorsalis. Previous studies have associated extended lifespan with reduced fecundity. The current study did not observe a prolongation of lifespan in B. dorsalis, which instead incurred oxidative damage. The findings of the present study improve our understanding of the molecular, biochemical, and phenotypic response of B. dorsalis to an SD diet.
Barcode Sequencing Screen Identifies SUB1 as a Regulator of Yeast Pheromone Inducible Genes
Sliva, Anna; Kuang, Zheng; Meluh, Pamela B.; Boeke, Jef D.
2016-01-01
The yeast pheromone response pathway serves as a valuable model of eukaryotic mitogen-activated protein kinase (MAPK) pathways, and transcription of their downstream targets. Here, we describe application of a screening method combining two technologies: fluorescence-activated cell sorting (FACS), and barcode analysis by sequencing (Bar-Seq). Using this screening method, and pFUS1-GFP as a reporter for MAPK pathway activation, we readily identified mutants in known mating pathway components. In this study, we also include a comprehensive analysis of the FUS1 induction properties of known mating pathway mutants by flow cytometry, featuring single cell analysis of each mutant population. We also characterized a new source of false positives resulting from the design of this screen. Additionally, we identified a deletion mutant, sub1Δ, with increased basal expression of pFUS1-GFP. Here, in the first ChIP-Seq of Sub1, our data shows that Sub1 binds to the promoters of about half the genes in the genome (tripling the 991 loci previously reported), including the promoters of several pheromone-inducible genes, some of which show an increase upon pheromone induction. Here, we also present the first RNA-Seq of a sub1Δ mutant; the majority of genes have no change in RNA, but, of the small subset that do, most show decreased expression, consistent with biochemical studies implicating Sub1 as a positive transcriptional regulator. The RNA-Seq data also show that certain pheromone-inducible genes are induced less in the sub1Δ mutant relative to the wild type, supporting a role for Sub1 in regulation of mating pathway genes. The sub1Δ mutant has increased basal levels of a small subset of other genes besides FUS1, including IMD2 and FIG1, a gene encoding an integral membrane protein necessary for efficient mating. PMID:26837954
Identifying Candidate Reprogramming Genes in Mouse Induced Pluripotent Stem Cells.
Gao, Fang; Li, Jingyu; Zhang, Heng; Yang, Xu; An, Tiezhu
2017-08-01
Factor-based induced reprogramming approaches have tremendous potential for human regenerative medicine, but the efficiencies of these approaches are still low. In this study, we analyzed the global transcriptional profiles of mouse induced pluripotent stem cells (miPSCs) and mouse embryonic stem cells (mESCs) from seven different labs and present here the first successful clustering according to cell type, not by lab of origin. We identified 2131 different expression genes (DEs) as candidate pluripotency-associated genes by comparing mESCs/miPSCs with somatic cells and 720 DEs between miPSCs and mESCs. Interestingly, there was a significant overlap between the two DE sets. Therefore, we defined the overlap DEs as "consensus DEs" including 313 miPSC-specific genes expressed at a higher level in miPSCs versus mESCs and 184 mESC-specific genes in total and reasoned that these may contribute to the differences in pluripotency between mESCs and miPSCs. A classification of "consensus DEs" according to their different expression levels between somatic cells and mESCs/miPSCs shows that 86% of the miPSC-specific genes are more highly expressed in somatic cells, while 73% of mESC-specific genes are highly expressed in mESCs/miPSCs, indicating that the miPSCs have not efficiently silenced the expression pattern of the somatic cells from which they are derived and failed to completely induce the genes with high expression levels in mESCs. We further revealed a strong correlation between oocyte-enriched factors and insufficiently induced mESC-specific genes and identified 11 hub genes via network analysis. In light of these findings, we postulated that these key hub genes might not only drive somatic cell nuclear transfer (SCNT) reprogramming but also augment the efficiency and quality of miPSC reprogramming.
Foxtail Mosaic Virus-Induced Gene Silencing in Monocot Plants.
Liu, Na; Xie, Ke; Jia, Qi; Zhao, Jinping; Chen, Tianyuan; Li, Huangai; Wei, Xiang; Diao, Xianmin; Hong, Yiguo; Liu, Yule
2016-07-01
Virus-induced gene silencing (VIGS) is a powerful technique to study gene function in plants. However, very few VIGS vectors are available for monocot plants. Here we report that Foxtail mosaic virus (FoMV) can be engineered as an effective VIGS system to induce efficient silencing of endogenous genes in monocot plants including barley (Hordeum vulgare L.), wheat (Triticum aestivum) and foxtail millet (Setaria italica). This is evidenced by FoMV-based silencing of phytoene desaturase (PDS) and magnesium chelatase in barley, of PDS and Cloroplastos alterados1 in foxtail millet and wheat, and of an additional gene IspH in foxtail millet. Silencing of these genes resulted in photobleached or chlorosis phenotypes in barley, wheat, and foxtail millet. Furthermore, our FoMV-based gene silencing is the first VIGS system reported for foxtail millet, an important C4 model plant. It may provide an efficient toolbox for high-throughput functional genomics in economically important monocot crops. © 2016 American Society of Plant Biologists. All Rights Reserved.
Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.
2008-01-01
Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss, were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as “expression signatures”. Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that diffierent doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose. PMID:16725192
Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R
2006-07-01
Determining how gene expression profiles change with toxicant dose will improve the utility of arrays in identifying biomarkers and modes of toxic action. Isogenic rainbow trout, Oncorhyncus mykiss,were exposed to 10, 50 or 100 ng/L ethynylestradiol (a xeno-estrogen) for 7 days. Following exposure hepatic RNA was extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNAs. Transcript expression in treated vs control fish was analyzed via Genespring (Silicon Genetics) to identify genes with altered expression, as well as to determine gene clustering patterns that can be used as "expression signatures". Array results were confirmed via qRT PCR. Our analysis indicates that gene expression profiles varied somewhat with dose. Established biomarkers of exposure to estrogenic chemicals, such as vitellogenin, vitelline envelope proteins, and the estrogen receptor alpha, were induced at every dose. Other genes were dose specific, suggesting that different doses induce distinct physiological responses. These findings demonstrate that cDNA microarrays could be used to identify both toxicant class and relative dose.
Xi, Yang; Troy, Niamh M.; Anderson, Denise; Pena, Olga M.; Lynch, Jason P.; Phipps, Simon; Bosco, Anthony; Upham, John W.
2017-01-01
Though human rhinoviruses (HRVs) are usually innocuous viruses, they can trigger serious consequences in certain individuals, especially in the setting of impaired interferon (IFN) synthesis. Plasmacytoid dendritic cells (pDCs) are key IFN producing cells, though we know little about the role of pDC in HRV-induced immune responses. Herein, we used gene expression microarrays to examine HRV-activated peripheral blood mononuclear cells (PBMCs) from healthy people, in combination with pDC depletion, to assess whether observed gene expression patterns were pDC dependent. As expected, pDC depletion led to a major reduction in IFN-α release. This was associated with profound differences in gene expression between intact PBMC and pDC-depleted PBMC, and major changes in upstream regulators: 70–80% of the HRV activated genes appeared to be pDC dependent. Real-time PCR confirmed key changes in gene expression, in which the following selected genes were shown to be highly pDC dependent: the transcription factor IRF7, both IL-27 chains (IL-27p28 and EBI3), the alpha chain of the IL-15 receptor (IL-15RA) and the IFN-related gene IFI27. HRV-induced IL-6, IFN-γ, and IL-27 protein synthesis were also highly pDC dependent. Supplementing pDC-depleted cultures with recombinant IL-15, IFN-γ, IL-27, or IL-6 was able to restore the IFN-α response, thereby compensating for the absence of pDC. Though pDC comprise only a minority population of migratory leukocytes, our findings highlight the profound extent to which these cells contribute to the immune response to HRV. PMID:29118754
Insect and wound induced GUS gene expression from a Beta vulgaris proteinase inhibitor gene promoter
USDA-ARS?s Scientific Manuscript database
Inducible gene promoters that are specifically activated by pathogen invasion or insect pest attack are needed for effective expression of resistance genes to control plant diseases. In the present study, a promoter from a serine proteinase inhibitor gene (BvSTI) shown to be up-regulated in resist...
Lee, Heung-Soon; Kwon, Soon-Ho; Ham, Ji-Eun; Lee, Joo Young; Kim, Dong-Hoon; Shin, Kyung-Ho; Choi, Sang-Hyun
2012-07-01
Previously, the authors reported that zaprinast, an inhibitor of cGMP-selective phosphodiesterases, induced the secretions of TNF-α and IL-1β by microglia and enhanced the induction of iNOS by lipopolysaccharide (LPS). In this study, the signaling mechanism responsible for microglial activation by zaprinast was investigated and the effects of zaprinast and LPS on microglial activation were compared. Zaprinast was found to activate ERK1/2, p38 MAPK, JNK, NFκB, and PI3K/Akt, and subsequently, induce the mRNA expressions of IL-1α, IL-1β, TNF-α, CCL2, CCL4, CXCL1, CXCL2, and CD14. Associations between signaling pathways and gene expressions were examined by treating microglia with signal inhibitors. PDTC inhibited the induction of all the above genes by zaprinast, and SB203580 inhibited all genes except CXCL1. SP600125, PD98059, and LY294002 inhibited the induction of at least CCL2. Microglial activation by zaprinast was then compared with full-blown activation by LPS. The zaprinast-induced phosphorylations of MAPKs and IκB were less prompt than LPS-induced phosphorylations. IκB degradation by LPS was significant at 10min and did not return to normal, whereas zaprinast induced a later, transient degradation. LPS induced the mRNA expressions of IL-1β, TNF-α, IL-6, CCL2, iNOS, and COX-2, and although zaprinast significantly induced the expressions of all except IL-6 and iNOS, these inductions were far less than those induced by LPS. Collectively, zaprinast was found to upregulate microglial activity mainly via NFκB and p38 MAPK signaling and the subsequent expressions of inflammatory genes. Although, zaprinast was found to have obvious effects on microglia, these were weaker than the effects of LPS. Copyright © 2012 Elsevier B.V. All rights reserved.
Robinson, Joshua F; Theunissen, Peter T; van Dartel, Dorien A M; Pennings, Jeroen L; Faustman, Elaine M; Piersma, Aldert H
2011-09-01
Toxicogenomic evaluations may improve toxicity prediction of in vitro-based developmental models, such as whole embryo culture (WEC) and embryonic stem cells (ESC), by providing a robust mechanistic marker which can be linked with responses associated with developmental toxicity in vivo. While promising in theory, toxicogenomic comparisons between in vivo and in vitro models are complex due to inherent differences in model characteristics and experimental design. Determining factors which influence these global comparisons are critical in the identification of reliable mechanistic-based markers of developmental toxicity. In this study, we compared available toxicogenomic data assessing the impact of the known teratogen, methylmercury (MeHg) across a diverse set of in vitro and in vivo models to investigate the impact of experimental variables (i.e. model, dose, time) on our comparative assessments. We evaluated common and unique aspects at both the functional (Gene Ontology) and gene level of MeHg-induced response. At the functional level, we observed stronger similarity in MeHg-response between mouse embryos exposed in utero (2 studies), ESC, and WEC as compared to liver, brain and mouse embryonic fibroblast MeHg studies. These findings were strongly correlated to the presence of a MeHg-induced developmentally related gene signature. In addition, we identified specific MeHg-induced gene expression alterations associated with developmental signaling and heart development across WEC, ESC and in vivo systems. However, the significance of overlap between studies was highly dependent on traditional experimental variables (i.e. dose, time). In summary, we identify promising examples of unique gene expression responses which show in vitro-in vivo similarities supporting the relevance of in vitro developmental models for predicting in vivo developmental toxicity. Copyright © 2011 Elsevier Inc. All rights reserved.
"Bad genes" & criminal responsibility.
González-Tapia, María Isabel; Obsuth, Ingrid
2015-01-01
The genetics of the accused is trying to break into the courts. To date several candidate genes have been put forward and their links to antisocial behavior have been examined and documented with some consistency. In this paper, we focus on the so called "warrior gene", or the low-activity allele of the MAOA gene, which has been most consistently related to human behavior and specifically to violence and antisocial behavior. In preparing this paper we had two objectives. First, to summarize and analyze the current scientific evidence, in order to gain an in depth understanding of the state of the issue and determine whether a dominant line of generally accepted scientific knowledge in this field can be asserted. Second, to derive conclusions and put forward recommendations related to the use of genetic information, specifically the presence of the low-activity genotype of the MAOA gene, in modulation of criminal responsibility in European and US courts. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ovsyannikova, Inna G.; Haralambieva, Iana H.; Dhiman, Neelam; O’Byrne, Megan M.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.
2009-01-01
Background Genetic polymorphisms play an important role in rubella vaccine-induced immunity. Methods We genotyped 714 healthy children after two age-appropriate doses of rubella-containing vaccine for 142 potential SNPs. Results Specific polymorphisms in the vitamin A receptor, RIG-I, TRIM5 and TRIM22 genes were significantly associated with rubella vaccine humoral immunity. The minor allele of the rs4416353 in the vitamin A receptor gene was associated with an allele dose-related decrease (P=.019) in rubella antibody response. The minor allele of rs6793694, in the vitamin A receptor gene, was associated with an allele dose-related antibody decrease (P=.039). The minor variant of nonsynonymous SNP rs10813831 (Arg7Cys) in the RIG-I gene was associated with an allele dose-related decrease in rubella antibody level from 37.4 IU/mL to 28.0 IU/mL (P=.035), while increased representation of the minor allele of the 5’UTR SNP (rs3824949, P=.015), in the antiretroviral TRIM5 gene, was associated with an allele dose-related increase in rubella antibody. It is of particular interest that the nonsynonymous SNP rs3740996 (His43Tyr) in the TRIM5 gene was associated with variations in rubella antibody response (P=.016) after having been previously found to have a significant functional role. Conclusions These findings further expand our immunogenetic understanding of mechanisms of rubella vaccine-induced immunity. PMID:20001730
Ibarra Sierra, E; Díaz Chávez, J; Cortés-Malagón, EM; Uribe-Figueroa, L; Hidalgo-Miranda, A; Lambert, PF; Gariglio, P
2013-01-01
HPV16 E7 oncoprotein expression in K14E7 transgenic mice induces cervical cancer after 6 months of treatment with the co-carcinogen 17β-estradiol. In untreated mice, E7 also induces skin tumors late in life albeit at low penetrance. These findings indicate that E7 alters cellular functions in cervix and skin so as to predispose these organs to tumorigenesis. Using microarrays, we determined the global genes expression profile in cervical and skin tissue of young adult K14E7 transgenic mice without estrogen treatment. In these tissues, the E7 oncoprotein altered the transcriptional pattern of genes involved in several biological processes including signal transduction, transport, metabolic process, cell adhesion, apoptosis, cell differentiation, immune response and inflammatory response. Among the E7-dysregulated genes were ones not previously known to be involved in cervical neoplasia including DMBT1, GLI1 and 17βHSD2 in cervix, as well as MMP2, 12, 14, 19 and 27 in skin. PMID:22980503
Ibarra Sierra, E; Díaz Chávez, J; Cortés-Malagón, E M; Uribe-Figueroa, L; Hidalgo-Miranda, A; Lambert, P F; Gariglio, P
2012-11-25
HPV16 E7 oncoprotein expression in K14E7 transgenic mice induces cervical cancer after 6 months of treatment with the co-carcinogen 17β-estradiol. In untreated mice, E7 also induces skin tumors late in life albeit at low penetrance. These findings indicate that E7 alters cellular functions in cervix and skin so as to predispose these organs to tumorigenesis. Using microarrays, we determined the global genes expression profile in cervical and skin tissue of young adult K14E7 transgenic mice without estrogen treatment. In these tissues, the E7 oncoprotein altered the transcriptional pattern of genes involved in several biological processes including signal transduction, transport, metabolic process, cell adhesion, apoptosis, cell differentiation, immune response and inflammatory response. Among the E7-dysregulated genes were ones not previously known to be involved in cervical neoplasia including DMBT1, GLI1 and 17βHSD2 in cervix, as well as MMP2, 12, 14, 19 and 27 in skin. Copyright © 2012 Elsevier Inc. All rights reserved.
Perot, Brieuc P; Boussier, Jeremy; Yatim, Nader; Rossman, Jeremy S; Ingersoll, Molly A; Albert, Matthew L
2018-05-10
Influenza A virus (IAV) infection perturbs metabolic pathways such as autophagy, a stress-induced catabolic pathway that crosstalks with cellular inflammatory responses. However, the impact of autophagy perturbation on IAV gene expression or host cell responses remains disputed. Discrepant results may be a reflection of in vivo studies using cell-specific autophagy-related (Atg) gene-deficient mouse strains, which do not delineate modification of developmental programmes from more proximal effects on inflammatory response. In vitro experiments can be confounded by gene expression divergence in wild-type cultivated cell lines, as compared to those experiencing long-term absence of autophagy. With the goal to investigate cellular processes within cells that are competent or incompetent for autophagy, we generated a novel experimental cell line in which autophagy can be restored by ATG5 protein stabilization in an otherwise Atg5-deficient background. We confirmed that IAV induced autophagosome formation and p62 accumulation in infected cells and demonstrated that perturbation of autophagy did not impact viral infection or replication in ATG5-stablized cells. Notably, the induction of interferon-stimulated genes (ISGs) by IAV was diminished when cells were autophagy competent. We further demonstrated that, in the absence of ATG5, IAV-induced interferon-β (IFN-β) expression was increased as compared to levels in autophagy-competent lines, a mechanism that was independent of IAV non-structural protein 1. In sum, we report that induction of autophagy by IAV infection reduces ISG expression in infected cells by limiting IFN-β expression, which may benefit viral replication and spread.
Nieva, Claudia; Busk, Peter K; Domínguez-Puigjaner, Eva; Lumbreras, Victoria; Testillano, Pilar S; Risueño, Maria-Carmen; Pagès, Montserrat
2005-08-01
The plant hormone abscisic acid regulates gene expression in response to growth stimuli and abiotic stress. Previous studies have implicated members of the bZIP family of transcription factors as mediators of abscisic acid dependent gene expression through the ABRE cis-element. Here, we identify two new maize bZIP transcription factors, EmBP-2 and ZmBZ-1 related to EmBP-1 and OsBZ-8 families. They are differentially expressed during embryo development; EmBP-2 is constitutive, whereas ZmBZ-1 is abscisic acid-inducible and accumulates during late embryogenesis. Both factors are nuclear proteins that bind to ABREs and activate transcription of the abscisic acid-inducible gene rab28 from maize. EmBP-2 and ZmBZ-1 are phosphorylated by protein kinase CK2 and phosphorylation alters their DNA binding properties. Our data suggest that EmBP-2 and ZmBZ-1 are involved in the expression of abscisic acid inducible genes such as rab28 and their activity is modulated by ABA and by phosphorylation.
Erdi, Balázs; Nagy, Péter; Zvara, Agnes; Varga, Agnes; Pircs, Karolina; Ménesi, Dalma; Puskás, László G; Juhász, Gábor
2012-07-01
Autophagy delivers cytoplasmic material for lysosomal degradation in eukaryotic cells. Starvation induces high levels of autophagy to promote survival in the lack of nutrients. We compared genome-wide transcriptional profiles of fed and starved control, autophagy-deficient Atg7 and Atg1 null mutant Drosophila larvae to search for novel regulators of autophagy. Genes involved in catabolic processes including autophagy were transcriptionally upregulated in all cases. We also detected repression of genes involved in DNA replication in autophagy mutants compared with control animals. The expression of Rack1 (receptor of activated protein kinase C 1) increased 4.1- to 5.5-fold during nutrient deprivation in all three genotypes. The scaffold protein Rack1 plays a role in a wide range of processes including translation, cell adhesion and migration, cell survival and cancer. Loss of Rack1 led to attenuated autophagic response to starvation, and glycogen stores were decreased 11.8-fold in Rack1 mutant cells. Endogenous Rack1 partially colocalized with GFP-Atg8a and early autophagic structures on the ultrastructural level, suggesting its involvement in autophagosome formation. Endogenous Rack1 also showed a high degree of colocalization with glycogen particles in the larval fat body, and with Shaggy, the Drosophila homolog of glycogen synthase kinase 3B (GSK-3B). Our results, for the first time, demonstrated the fundamental role of Rack1 in autophagy and glycogen synthesis.
Starrett, D. A.; Laties, G. G.
1993-01-01
Whereas intact postharvest avocado (Persea americana Mill.) fruit may take 1 or more weeks to ripen, ripening is hastened by pulsing fruit for 24 h with ethylene or propylene and is initiated promptly by cutting slices, or discs, of mesocarp tissue. Because the preclimacteric lag period constitutes the extended and variable component of the ripening syndrome, we postulated that selective gene expression during the lag period leads to the triggering of the climacteric. Accordingly, we sought to identify genes that are expressed gradually in the course of the lag period in intact fruit, are turned on sooner in response to a pulse, and are induced promptly in response to wounding (i.e. slicing). To this end, a mixed cDNA library was constructed from mRNA from untreated fruit, pulsed fruit, and aged slices, and the library was screened for genes induced by wounding or by pulsing and/or wounding. The time course of induction of genes encoding selected clones was established by probing northern blots of mRNA from tissues variously treated over a period of time. Four previously identified ripening-associated genes encoding cellulase, polygalacturonase (PG), cytochrome P-450 oxidase (P-450), and ethylene-forming enzyme (EFE, or 1-aminocyclopropane-1-carboxylic acid synthase), respectively, were studied in the same way. Whereas cellulase, PG, and EFE were ruled out as having a role in the initiation of the climacteric, the time course of P-450 induction, as well as the response of same to pulsing and wounding met the criteria[mdash]together with several clones from the mixed library[mdash]for a gene potentially involved in preclimacteric events leading to the onset of the climacteric. Further, it was established that the continuous presence of ethylene is required for persisting induction, and it is suggested that in selected cases wounding may exert a synergistic effect on ethylene action. PMID:12231929
Rabara, Roel C; Tripathi, Prateek; Lin, Jun; Rushton, Paul J
2013-02-15
Drought is one of the important environmental factors affecting crop production worldwide and therefore understanding the molecular response of plant to stress is an important step in crop improvement. WRKY transcription factors are one of the 10 largest transcription factor families across the green lineage. In this study, highly upregulated dehydration-induced WRKY and enzyme-coding genes from tobacco and soybean were selected from microarray data for promoter analyses. Putative stress-related cis-regulatory elements such as TGACG motif, ABRE-like elements; W and G-like sequences were identified by an in silico analyses of promoter region of the selected genes. GFP quantification of transgenic BY-2 cell culture showed these promoters direct higher expression in-response to 100 μM JA treatment compared to 100 μM ABA, 10% PEG and 85 mM NaCl treatments. Thus promoter activity upon JA treatment and enrichment of MeJA-responsive elements in the promoter of the selected genes provides insights for these genes to be jasmonic acid responsive with potential of mediating cross-talk during dehydration responses. Copyright © 2013 Elsevier Inc. All rights reserved.
Network-based association of hypoxia-responsive genes with cardiovascular diseases
NASA Astrophysics Data System (ADS)
Wang, Rui-Sheng; Oldham, William M.; Loscalzo, Joseph
2014-10-01
Molecular oxygen is indispensable for cellular viability and function. Hypoxia is a stress condition in which oxygen demand exceeds supply. Low cellular oxygen content induces a number of molecular changes to activate regulatory pathways responsible for increasing the oxygen supply and optimizing cellular metabolism under limited oxygen conditions. Hypoxia plays critical roles in the pathobiology of many diseases, such as cancer, heart failure, myocardial ischemia, stroke, and chronic lung diseases. Although the complicated associations between hypoxia and cardiovascular (and cerebrovascular) diseases (CVD) have been recognized for some time, there are few studies that investigate their biological link from a systems biology perspective. In this study, we integrate hypoxia genes, CVD genes, and the human protein interactome in order to explore the relationship between hypoxia and cardiovascular diseases at a systems level. We show that hypoxia genes are much closer to CVD genes in the human protein interactome than that expected by chance. We also find that hypoxia genes play significant bridging roles in connecting different cardiovascular diseases. We construct a hypoxia-CVD bipartite network and find several interesting hypoxia-CVD modules with significant gene ontology similarity. Finally, we show that hypoxia genes tend to have more CVD interactors in the human interactome than in random networks of matching topology. Based on these observations, we can predict novel genes that may be associated with CVD. This network-based association study gives us a broad view of the relationships between hypoxia and cardiovascular diseases and provides new insights into the role of hypoxia in cardiovascular biology.
Roy, Sushmita
2017-01-01
Arbuscular mycorrhizal (AM) associations enhance the phosphorous and nitrogen nutrition of host plants, but little is known about their role in potassium (K+) nutrition. Medicago truncatula plants were cocultured with the AM fungus Rhizophagus irregularis under high and low K+ regimes for 6 weeks. We determined how K+ deprivation affects plant development and mineral acquisition and how these negative effects are tempered by the AM colonization. The transcriptional response of AM roots under K+ deficiency was analyzed by whole-genome RNA sequencing. K+ deprivation decreased root biomass and external K+ uptake and modulated oxidative stress gene expression in M. truncatula roots. AM colonization induced specific transcriptional responses to K+ deprivation that seem to temper these negative effects. A gene network analysis revealed putative key regulators of these responses. This study confirmed that AM associations provide some tolerance to K+ deprivation to host plants, revealed that AM symbiosis modulates the expression of specific root genes to cope with this nutrient stress, and identified putative regulators participating in these tolerance mechanisms. PMID:28159827
Protocadherin-1 binds to SMAD3 and suppresses TGF-β1-induced gene transcription
Faura Tellez, Grissel; Vandepoele, Karl; Brouwer, Uilke; Koning, Henk; Elderman, Robin M.; Hackett, Tillie-Louise; Willemse, Brigitte W. M.; Holloway, John; Van Roy, Frans; Koppelman, Gerard H.
2015-01-01
Genetic studies have identified Protocadherin-1 (PCDH1) and Mothers against decapentaplegic homolog-3 (SMAD3) as susceptibility genes for asthma. PCDH1 is expressed in bronchial epithelial cells and has been found to interact with SMAD3 in yeast two-hybrid (Y2H) overexpression assays. Here, we test whether PCDH1 and SMAD3 interact at endogenous protein levels in bronchial epithelial cells and evaluate the consequences thereof for transforming growth factor-β1 (TGF-β1)-induced gene transcription. We performed Y2H screens and coimmunoprecipitation (co-IP) experiments of PCDH1 and SMAD3 in HEK293T and 16HBE14o− (16HBE) cell lines. Activity of a SMAD3-driven luciferase reporter gene in response to TGF-β1 was measured in BEAS-2B cells transfected with PCDH1 and in 16HBE cells transfected with PCDH1-small-interfering RNA (siRNA). TGF-β1-induced gene expression was quantified in BEAS-2B clones overexpressing PCDH1 and in human primary bronchial epithelial cells (PBECs) transfected with PCDH1-siRNA. We confirm PCDH1 and SMAD3 interactions by Y2H and by co-IP in HEK293T cells overexpressing both proteins, and at endogenous protein levels in 16HBE cells. TGF-β-induced activation of a SMAD3-driven reporter was reduced by exogenous PCDH1 in BEAS2B cells, whereas it was increased by siRNA-mediated knockdown of endogenous PCDH1 in 16HBE cells. Overexpression of PCDH1 suppressed expression of TGF-β target genes in BEAS-2B cells, whereas knockdown of PCDH1 in human PBECs increased TGF-β-induced gene expression. In conclusion, we demonstrate that PCDH1 binds to SMAD3 and regulates its activation by TGF-β signaling in bronchial epithelial cells. We propose that PCDH1 and SMAD3 act in a single pathway in asthma susceptibility that affects sensitivity of the airway epithelium to TGF-β. PMID:26209277
Kelly, MM; King, EM; Rider, CF; Gwozd, C; Holden, NS; Eddleston, J; Zuraw, B; Leigh, R; O'Byrne, PM; Newton, R
2012-01-01
BACKGROUND AND PURPOSE Inhaled corticosteroids (ICS) are the cornerstone of asthma pharmacotherapy and, acting via the glucocorticoid receptor (GR), reduce inflammatory gene expression. While this is often attributed to a direct inhibitory effect of the GR on inflammatory gene transcription, corticosteroids also induce the expression of anti-inflammatory genes in vitro. As there are no data to support this effect in asthmatic subjects taking ICS, we have assessed whether ICS induce anti-inflammatory gene expression in subjects with atopic asthma. EXPERIMENTAL APPROACH Bronchial biopsies from allergen-challenged atopic asthmatic subjects taking inhaled budesonide or placebo were subjected to gene expression analysis using real-time reverse transcriptase-PCR for the corticosteroid-inducible genes (official gene symbols with aliases in parentheses): TSC22D3 [glucocorticoid-induced leucine zipper (GILZ)], dual-specificity phosphatase-1 (MAPK phosphatase-1), both anti-inflammatory effectors, and FKBP5 [FK506-binding protein 51 (FKBP51)], a regulator of GR function. Cultured pulmonary epithelial and smooth muscle cells were also treated with corticosteroids before gene expression analysis. KEY RESULTS Compared with placebo, GILZ and FKBP51 mRNA expression was significantly elevated in budesonide-treated subjects. Budesonide also increased GILZ expression in human epithelial and smooth muscle cells in culture. Immunostaining of bronchial biopsies revealed GILZ expression in the airways epithelium and smooth muscle of asthmatic subjects. CONCLUSIONS AND IMPLICATIONS Expression of the corticosteroid-induced genes, GILZ and FKBP51, is up-regulated in the airways of allergen-challenged asthmatic subjects taking inhaled budesonide. Consequently, the biological effects of corticosteroid-induced genes should be considered when assessing the actions of ICS. Treatment modalities that increase or decrease GR-dependent transcription may correspondingly affect corticosteroid efficacy
Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook
2011-01-01
Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes. PMID:21119621
Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook
2011-03-01
Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes.
Gonzalez, Lauren E; Keller, Kristen; Chan, Karen X; Gessel, Megan M; Thines, Bryan C
2017-07-17
The ubiquitin 26S proteasome system (UPS) selectively degrades cellular proteins, which results in physiological changes to eukaryotic cells. F-box proteins are substrate adaptors within the UPS and are responsible for the diversity of potential protein targets. Plant genomes are enriched in F-box genes, but the vast majority of these have unknown roles. This work investigated the Arabidopsis F-box gene F-BOX STRESS INDUCED 1 (FBS1) for its effects on gene expression in order elucidate its previously unknown biological function. Using publically available Affymetrix ATH1 microarray data, we show that FBS1 is significantly co-expressed in abiotic stresses with other well-characterized stress response genes, including important stress-related transcriptional regulators. This gene suite is most highly expressed in roots under cold and salt stresses. Transcriptome analysis of fbs1-1 knock-out plants grown at a chilling temperature shows that hundreds of genes require FBS1 for appropriate expression, and that these genes are enriched in those having roles in both abiotic and biotic stress responses. Based on both this genome-wide expression data set and quantitative real-time PCR (qPCR) analysis, it is apparent that FBS1 is required for elevated expression of many jasmonic acid (JA) genes that have established roles in combatting environmental stresses, and that it also controls a subset of JA biosynthesis genes. FBS1 also significantly impacts abscisic acid (ABA) regulated genes, but this interaction is more complex, as FBS1 has both positive and negative effects on ABA-inducible and ABA-repressible gene modules. One noteworthy effect of FBS1 on ABA-related stress processes, however, is the restraint it imposes on the expression of multiple class I LIPID TRANSFER PROTEIN (LTP) gene family members that have demonstrated protective effects in water deficit-related stresses. FBS1 impacts plant stress responses by regulating hundreds of genes that respond to the plant
Sergio, Luiz Philippe S; Lucinda, Leda M F; Reboredo, Maycon M; de Paoli, Flavia; Fonseca, Lídia M C; Pinheiro, Bruno V; Mencalha, Andre L; Fonseca, Adenilson S
2018-03-01
Purpose/Aim of the study: Patients suffering from chronic obstructive pulmonary disease (COPD) in association with acute respiratory distress syndrome (ARDS) present oxidative stress in lung cells, with production of free radicals and DNA lesions in pulmonary and adjacent cells. Once the DNA molecule is damaged, a set of enzymatic mechanisms are trigged to preserve genetic code integrity and cellular homeostasis. These enzymatic mechanisms include the base and the nucleotide excision repair pathways, as well as telomere regulation. Thus, the aim of this work was to evaluate the mRNA levels from APEX1, ERCC2, TP53, and TRF2 genes in lung tissue from Wistar rats affected by acute lung injury in response to sepsis and emphysema. Adult male Wistar rats were randomized into 4 groups (n = 6, for each group): control, emphysema, sepsis, and emphysema with sepsis. Pulmonary emphysema was induced by intratracheal instillation of elastase (12 IU/animal) and sepsis induced by intraperitoneal Escherichia coli lipopolysaccharide (LPS) injection (10 mg/kg). Lungs were removed, and samples were withdrawn for histological analysis and total RNA extraction, cDNA synthesis, and mRNA level evaluation by real time quantitative polymerase chain reaction. Data show acute lung injury by LPS and emphysema by elastase and that APEX1, ERCC2, TP53, and TRF2 mRNA levels are increased significantly (p < 0.01) in emphysema with sepsis group. Our results suggest that alteration in mRNA levels from DNA repair and genomic stability could be part of cell response to acute lung injury in response to emphysema and sepsis.
Zhang, Huajian; Wu, Qun; Cao, Shun; Zhao, Tongyao; Chen, Ling; Zhuang, Peitong; Zhou, Xiuhong; Gao, Zhimou
2014-11-01
In this study, we report the cloning of the SsCut gene encoding cutinase from Sclerotinia sclerotiorum. We isolated a 609-bp cDNA encoding a polypeptide of 202 amino acids with a molecular weight of 20.4 kDa. Heterologous expression of SsCut in Escherichia coli (His-SsCut) caused the formation of lesions in tobacco that closely resembled hypersensitive response lesions. Mutational analysis identified the C-terminal-half peptide and the same amino acids indispensable for both enzyme and elicitor activity. His-SsCut was caused cell death in Arabidopsis, soybean (Glycine max), oilseed rape (Brassica napus), rice (Oryza sativa), maize (Zea mays), and wheat (Triticum aestivum), indicating that both dicot and monocot species are responsive to the elicitor. Furthermore, the elicitation of tobacco was effective in the induction of the activities of hydrogen peroxide, phenylalanine ammonia-lyase, peroxides, and polyphenol oxidase. His-SsCut-treated plants exhibited enhanced resistance as indicated by a significant reduction in the number and size of S. sclerotiorum, Phytophthora sojae, and P. nicotianae lesions on leaves relative to controls. Real-time PCR results indicated that the expression of defense-related genes and genes involved in signal transduction were induced by His-SsCut. Our results demonstrate that SsCut is an elicitor that triggers defense responses in plants and will help to clarify its relationship to downstream signaling pathways that induce defense responses.
Choudhry, Shweta; Que, Loretta G.; Yang, Zhonghui; Liu, Limin; Eng, Celeste; Kim, Sung O.; Kumar, Gunjan; Thyne, Shannon; Chapela, Rocio; Rodriguez-Santana, Jose R.; Rodriguez-Cintron, William; Avila, Pedro C.; Stamler, Jonathan S.; Burchard, Esteban G.
2010-01-01
Background Short-acting inhaled β2-agonists such as albuterol are used for bronchodilation and are the mainstay of asthma treatment worldwide. There is significant variation in bronchodilator responsiveness to albuterol not only between individuals but also across racial/ethnic groups. The β2-adrenergic receptor (β2AR) is the target for β2-agonist drugs. The enzyme S-nitrosoglutathione reductase (GSNOR), which regulates levels of the endogenous bronchodilator S-nitrosoglutathione, has been shown to modulate the response to β2-agonists. Objective We hypothesized that there are pharmacogenetic interactions between GSNOR and β2AR gene variants which are associated with variable response to albuterol. Methods We performed family-based analyses to test for association between GSNOR gene variants and asthma and related phenotypes in 609 Puerto Rican and Mexican families with asthma. In addition, we tested these subjects for pharmacogenetic interaction between GSNOR and β2AR gene variants and responsiveness to albuterol using linear regression. Cell transfection experiments were performed to test the potential effect of the GSNOR gene variants. Results Among Puerto Ricans, several GSNOR SNPs and a haplotype in the 3′UTR were significantly associated with increased risk for asthma and lower bronchodilator responsiveness (p = 0.04 to 0.007). The GSNOR risk haplotype affects expression of GSNOR mRNA and protein, suggesting a gain of function. Furthermore, gene-gene interaction analysis provided evidence of pharmacogenetic interaction between GSNOR and β2AR gene variants and the response to albuterol in Puerto Rican (p = 0.03), Mexican (p = 0.15) and combined Puerto Rican and Mexican asthmatics (p = 0.003). Specifically, GSNOR+17059*β2AR+46 genotype combinations (TG+GG*AG and TG+GG*GG) were associated with lower bronchodilator response. Conclusion Genotyping of GSNOR and β2AR genes may be a useful in identifying Latino subjects, who might benefit from adjuvant
Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu
2018-01-01
We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.
Light-Inducible Gene Regulation with Engineered Zinc Finger Proteins
Polstein, Lauren R.; Gersbach, Charles A.
2014-01-01
The coupling of light-inducible protein-protein interactions with gene regulation systems has enabled the control of gene expression with light. In particular, heterodimer protein pairs from plants can be used to engineer a gene regulation system in mammalian cells that is reversible, repeatable, tunable, controllable in a spatiotemporal manner, and targetable to any DNA sequence. This system, Light-Inducible Transcription using Engineered Zinc finger proteins (LITEZ), is based on the blue light-induced interaction of GIGANTEA and the LOV domain of FKF1 that drives the localization of a transcriptional activator to the DNA-binding site of a highly customizable engineered zinc finger protein. This chapter provides methods for modifying LITEZ to target new DNA sequences, engineering a programmable LED array to illuminate cell cultures, and using the modified LITEZ system to achieve spatiotemporal control of transgene expression in mammalian cells. PMID:24718797
Wen, Zewen; Liu, Zhiyong; Hou, Yuyong; Liu, Chenfeng; Gao, Feng; Zheng, Yubin; Chen, Fangjian
2015-10-01
Haematococcus pluvialis is one of the most promising natural sources of astaxanthin. However, inducing the accumulation process has become one of the primary obstacles in astaxanthin production. In this study, the effect of ethanol on astaxanthin accumulation was investigated. The results demonstrated that astaxanthin accumulation occurred with ethanol addition even under low-light conditions. The astaxanthin productivity could reach 11.26 mg L(-1) d(-1) at 3% (v/v) ethanol, which was 2.03 times of that of the control. The transcriptional expression patterns of eight carotenogenic genes were evaluated using real-time PCR. The results showed that ethanol greatly enhanced transcription of the isopentenyl diphosphate (IPP) isomerase genes (ipi-1 and ipi-2), which were responsible for isomerization reaction of IPP and dimethylallyl diphosphate (DMAPP). This finding suggests that ethanol induced astaxanthin biosynthesis was up-regulated mainly by ipi-1 and ipi-2 at transcriptional level, promoting isoprenoid synthesis and substrate supply to carotenoid formation. Thus ethanol has the potential to be used as an effective reagent to induce astaxanthin accumulation in H. pluvialis. Copyright © 2015 Elsevier Inc. All rights reserved.
Plant methyl salicylate induces defense responses in the rhizobacterium Bacillus subtilis.
Kobayashi, Kazuo
2015-04-01
Bacillus subtilis is a rhizobacterium that promotes plant growth and health. Cultivation of B. subtilis with an uprooted weed on solid medium produced pleat-like architectures on colonies near the plant. To test whether plants emit signals that affect B. subtilis colony morphology, we examined the effect of plant-related compounds on colony morphology. Bacillus subtilis formed mucoid colonies specifically in response to methyl salicylate, which is a plant-defense signal released in response to pathogen infection. Methyl salicylate induced mucoid colony formation by stimulating poly-γ-glutamic acid biosynthesis, which formed enclosing capsules that protected the cells from exposure to antimicrobial compounds. Poly-γ-glutamic acid synthesis depended on the DegS-DegU two-component regulatory system, which activated DegSU-dependent gene transcription in response to methyl salicylate. Bacillus subtilis did not induce plant methyl salicylate production, indicating that the most probable source of methyl salicylate in the rhizosphere is pathogen-infected plants. Methyl salicylate induced B. subtilis biosynthesis of the antibiotics bacilysin and fengycin, the latter of which exhibited inhibitory activity against the plant pathogenic fungus Fusarium oxysporum. We propose that B. subtilis may sense plants under pathogen attack via methyl salicylate, and express defense responses that protect both B. subtilis and host plants in the rhizosphere. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Sequential induction of Fur-regulated genes in response to iron limitation in Bacillus subtilis.
Pi, Hualiang; Helmann, John D
2017-11-28
Bacterial cells modulate transcription in response to changes in iron availability. The ferric uptake regulator (Fur) senses intracellular iron availability and plays a central role in maintaining iron homeostasis in Bacillus subtilis Here we utilized FrvA, a high-affinity Fe 2+ efflux transporter from Listeria monocytogenes , as an inducible genetic tool to deplete intracellular iron. We then characterized the responses of the Fur, FsrA, and PerR regulons as cells transition from iron sufficiency to deficiency. Our results indicate that the Fur regulon is derepressed in three distinct waves. First, uptake systems for elemental iron ( efeUOB ), ferric citrate ( fecCDEF ), and petrobactin ( fpbNOPQ ) are induced to prevent iron deficiency. Second, B. subtilis synthesizes its own siderophore bacillibactin ( dhbACEBF ) and turns on bacillibactin ( feuABC ) and hydroxamate siderophore ( fhuBCGD ) uptake systems to scavenge iron from the environment and flavodoxins ( ykuNOP ) to replace ferredoxins. Third, as iron levels decline further, an "iron-sparing" response ( fsrA , fbpAB , and fbpC ) is induced to block the translation of abundant iron-utilizing proteins and thereby permit the most essential iron-dependent enzymes access to the limited iron pools. ChIP experiments demonstrate that in vivo occupancy of Fur correlates with derepression of each operon, and the graded response observed here results, at least in part, from higher-affinity binding of Fur to the "late"-induced genes.
Protein aggregation as a cellular response to oxidative stress induced by heme and iron
Vasconcellos, Luiz R. C.; Dutra, Fabianno F.; Siqueira, Mariana S.; Paula-Neto, Heitor A.; Dahan, Jennifer; Kiarely, Ellen; Carneiro, Leticia A. M.; Bozza, Marcelo T.; Travassos, Leonardo H.
2016-01-01
Hemolytic diseases include a variety of conditions with diverse etiologies in which red blood cells are destroyed and large amounts of hemeproteins are released. Heme has been described as a potent proinflammatory molecule that is able to induce multiple innate immune responses, such as those triggered by TLR4 and the NLRP3 inflammasome, as well as necroptosis in macrophages. The mechanisms by which eukaryotic cells respond to the toxic effects induced by heme to maintain homeostasis are not fully understood, however. Here we describe a previously uncharacterized cellular response induced by heme: the formation of p62/SQTM1 aggregates containing ubiquitinated proteins in structures known as aggresome-like induced structures (ALIS). This action is part of a response driven by the transcription factor NRF2 to the excessive generation of reactive oxygen species induced by heme that results in the expression of genes involved in antioxidant responses, including p62/SQTM1. Furthermore, we show that heme degradation by HO-1 is required for ALIS formation, and that the free iron released on heme degradation is necessary and sufficient to induce ALIS. Moreover, ferritin, a key protein in iron metabolism, prevents excessive ALIS formation. Finally, in vivo, hemolysis promotes an increase in ALIS formation in target tissues. Our data unravel a poorly understood aspect of the cellular responses induced by heme that can be explored to better understand the effects of free heme and free iron during hemolytic diseases such as sickle cell disease, dengue fever, malaria, and sepsis. PMID:27821769
Ethylene induces combinatorial effects of histone H3 acetylation in gene expression in Arabidopsis.
Wang, Likai; Zhang, Fan; Rode, Siddharth; Chin, Kevin K; Ko, Eun Esther; Kim, Jonghwan; Iyer, Vishwanath R; Qiao, Hong
2017-07-17
Histone acetylation and deacetylation are essential for gene regulation and have been implicated in the regulation of plant hormone responses. Many studies have indicated the role of histone acetylation in ethylene signaling; however, few studies have investigated how ethylene signaling regulates the genomic landscape of chromatin states. Recently, we found that ethylene can specifically elevate histone H3K14 acetylation and the non-canonical histone H3K23 acetylation in etiolated seedlings and the gene activation is positively associated with the elevation of H3K14Ac and H3K23Ac in response to ethylene. To assess the role of H3K9, H3K14, and H3K23 histone modifications in the ethylene response, we examined how ethylene regulates histone acetylation and the transcriptome at global level and in ethylene regulated genes both in wild type (Col-0) and ein2-5 seedlings. Our results revealed that H3K9Ac, H3K14Ac, and H3K23Ac are preferentially enriched around the transcription start sites and are positively correlated with gene expression levels in Col-0 and ein2-5 seedlings both with and without ethylene treatment. In the absence of ethylene, no combinatorial effect of H3K9Ac, H3K14Ac, and H3K23Ac on gene expression was detected. In the presence of ethylene, however, combined enrichment of the three histone acetylation marks was associated with high gene expression levels, and this ethylene-induced change was EIN2 dependent. In addition, we found that ethylene-regulated genes are expressed at medium or high levels, and a group of ethylene regulated genes are marked by either one of H3K9Ac, H3K14Ac or H3K23Ac. In this group of genes, the levels of H3K9Ac were altered by ethylene, but in the absence of ethylene the levels of H3K9Ac and peak breadths are distinguished in up- and down- regulated genes. In the presence of ethylene, the changes in the peak breadths and levels of H3K14Ac and H3K23Ac are required for the alteration of gene expressions. Our study reveals that
Genome-wide identification of WRKY family genes and their response to cold stress in Vitis vinifera
2014-01-01
Background WRKY transcription factors are one of the largest families of transcriptional regulators in plants. WRKY genes are not only found to play significant roles in biotic and abiotic stress response, but also regulate growth and development. Grapevine (Vitis vinifera) production is largely limited by stressful climate conditions such as cold stress and the role of WRKY genes in the survival of grapevine under these conditions remains unknown. Results We identified a total of 59 VvWRKYs from the V. vinifera genome, belonging to four subgroups according to conserved WRKY domains and zinc-finger structure. The majority of VvWRKYs were expressed in more than one tissue among the 7 tissues examined which included young leaves, mature leaves, tendril, stem apex, root, young fruits and ripe fruits. Publicly available microarray data suggested that a subset of VvWRKYs was activated in response to diverse stresses. Quantitative real-time PCR (qRT-PCR) results demonstrated that the expression levels of 36 VvWRKYs are changed following cold exposure. Comparative analysis was performed on data from publicly available microarray experiments, previous global transcriptome analysis studies, and qRT-PCR. We identified 15 VvWRKYs in at least two of these databases which may relate to cold stress. Among them, the transcription of three genes can be induced by exogenous ABA application, suggesting that they can be involved in an ABA-dependent signaling pathway in response to cold stress. Conclusions We identified 59 VvWRKYs from the V. vinifera genome and 15 of them showed cold stress-induced expression patterns. These genes represented candidate genes for future functional analysis of VvWRKYs involved in the low temperature-related signal pathways in grape. PMID:24755338
Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting.
Aguirre, Andrew J; Meyers, Robin M; Weir, Barbara A; Vazquez, Francisca; Zhang, Cheng-Zhong; Ben-David, Uri; Cook, April; Ha, Gavin; Harrington, William F; Doshi, Mihir B; Kost-Alimova, Maria; Gill, Stanley; Xu, Han; Ali, Levi D; Jiang, Guozhi; Pantel, Sasha; Lee, Yenarae; Goodale, Amy; Cherniack, Andrew D; Oh, Coyin; Kryukov, Gregory; Cowley, Glenn S; Garraway, Levi A; Stegmaier, Kimberly; Roberts, Charles W; Golub, Todd R; Meyerson, Matthew; Root, David E; Tsherniak, Aviad; Hahn, William C
2016-08-01
The CRISPR/Cas9 system enables genome editing and somatic cell genetic screens in mammalian cells. We performed genome-scale loss-of-function screens in 33 cancer cell lines to identify genes essential for proliferation/survival and found a strong correlation between increased gene copy number and decreased cell viability after genome editing. Within regions of copy-number gain, CRISPR/Cas9 targeting of both expressed and unexpressed genes, as well as intergenic loci, led to significantly decreased cell proliferation through induction of a G2 cell-cycle arrest. By examining single-guide RNAs that map to multiple genomic sites, we found that this cell response to CRISPR/Cas9 editing correlated strongly with the number of target loci. These observations indicate that genome targeting by CRISPR/Cas9 elicits a gene-independent antiproliferative cell response. This effect has important practical implications for the interpretation of CRISPR/Cas9 screening data and confounds the use of this technology for the identification of essential genes in amplified regions. We found that the number of CRISPR/Cas9-induced DNA breaks dictates a gene-independent antiproliferative response in cells. These observations have practical implications for using CRISPR/Cas9 to interrogate cancer gene function and illustrate that cancer cells are highly sensitive to site-specific DNA damage, which may provide a path to novel therapeutic strategies. Cancer Discov; 6(8); 914-29. ©2016 AACR.See related commentary by Sheel and Xue, p. 824See related article by Munoz et al., p. 900This article is highlighted in the In This Issue feature, p. 803. 2016 American Association for Cancer Research.
Aguado, Ana; Capote, Nieves; Romero, Fernando; Dodd, Ian C; Colmenero-Flores, José M
2014-10-01
To investigate effects of soil moisture heterogeneity on plant physiology and gene expression in roots and leaves, three treatments were implemented in sunflower plants growing with roots split between two compartments: a control (C) treatment supplying 100% of plant evapotranspiration, and two treatments receiving 50% of plant evapotranspiration, either evenly distributed to both compartments (deficit irrigation - DI) or unevenly distributed to ensure distinct wet and dry compartments (partial rootzone drying - PRD). Plants receiving the same amount of water responded differently under the two irrigation systems. After 3 days, evapotranspiration was similar in C and DI, but 20% less in PRD, concomitant with decreased leaf water potential (Ψleaf) and increased leaf xylem ABA concentration. Six water-stress responsive genes were highly induced in roots growing in the drying soil compartment of PRD plants, and their expression was best correlated with local soil water content. On the other hand, foliar gene expression differed significantly from that of the root and correlated better with xylem ABA concentration and Ψleaf. While the PRD irrigation strategy triggered stronger physiological and molecular responses, suggesting a more intense and systemic stress reaction due to local dehydration of the dry compartment of PRD plants, the DI strategy resulted in similar water savings without strongly inducing these responses. Correlating physiological and molecular responses in PRD/DI plants may provide insights into the severity and location of water deficits and may enable a better understanding of long-distance signalling mechanisms. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
ARG1 Is a Novel Bronchodilator Response Gene
Litonjua, Augusto A.; Lasky-Su, Jessica; Schneiter, Kady; Tantisira, Kelan G.; Lazarus, Ross; Klanderman, Barbara; Lima, John J.; Irvin, Charles G.; Peters, Stephen P.; Hanrahan, John P.; Liggett, Stephen B.; Hawkins, Gregory A.; Meyers, Deborah A.; Bleecker, Eugene R.; Lange, Christoph; Weiss, Scott T.
2008-01-01
Rationale: Inhaled β-agonists are one of the most widely used classes of drugs for the treatment of asthma. However, a substantial proportion of patients with asthma do not have a favorable response to these drugs, and identifying genetic determinants of drug response may aid in tailoring treatment for individual patients. Objectives: To screen variants in candidate genes in the steroid and β-adrenergic pathways for association with response to inhaled β-agonists. Methods: We genotyped 844 single nucleotide polymorphisms (SNPs) in 111 candidate genes in 209 children and their parents participating in the Childhood Asthma Management Program. We screened the association of these SNPs with acute response to inhaled β-agonists (bronchodilator response [BDR]) using a novel algorithm implemented in a family-based association test that ranked SNPs in order of statistical power. Genes that had SNPs with median power in the highest quartile were then taken for replication analyses in three other asthma cohorts. Measurements and Main Results: We identified 17 genes from the screening algorithm and genotyped 99 SNPs from these genes in a second population of patients with asthma. We then genotyped 63 SNPs from four genes with significant associations with BDR, for replication in a third and fourth population of patients with asthma. Evidence for association from the four asthma cohorts was combined, and SNPs from ARG1 were significantly associated with BDR. SNP rs2781659 survived Bonferroni correction for multiple testing (combined P value = 0.00048, adjusted P value = 0.047). Conclusions: These findings identify ARG1 as a novel gene for acute BDR in both children and adults with asthma. PMID:18617639
Dubois, Marieke; Van den Broeck, Lisa; Claeys, Hannes; Van Vlierberghe, Kaatje; Matsui, Minami; Inzé, Dirk
2015-01-01
Leaf growth is a tightly regulated and complex process, which responds in a dynamic manner to changing environmental conditions, but the mechanisms that reduce growth under adverse conditions are rather poorly understood. We previously identified a growth inhibitory pathway regulating leaf growth upon exposure to a low concentration of mannitol and characterized the ETHYLENE RESPONSE FACTOR (ERF)/APETALA2 transcription factor ERF6 as a central activator of both leaf growth inhibition and induction of stress tolerance genes. Here, we describe the role of the transcriptional repressor ERF11 in relation to the ERF6-mediated stress response in Arabidopsis (Arabidopsis thaliana). Using inducible overexpression lines, we show that ERF6 induces the expression of ERF11. ERF11 in turn molecularly counteracts the action of ERF6 and represses at least some of the ERF6-induced genes by directly competing for the target gene promoters. As a phenotypical consequence of the ERF6-ERF11 antagonism, the extreme dwarfism caused by ERF6 overexpression is suppressed by overexpression of ERF11. Together, our data demonstrate that dynamic mechanisms exist to fine-tune the stress response and that ERF11 counteracts ERF6 to maintain a balance between plant growth and stress defense. PMID:25995327
Comparison of gene expression changes induced by biguanides in db/db mice liver.
Heishi, Masayuki; Hayashi, Koji; Ichihara, Junji; Ishikawa, Hironori; Kawamura, Takao; Kanaoka, Masaharu; Taiji, Mutsuo; Kimura, Toru
2008-08-01
Large-scale clinical studies have shown that the biguanide drug metformin, widely used for type 2 diabetes, to be very safe. By contrast, another biguanide, phenformin, has been withdrawn from major markets because of a high incidence of serious adverse effects. The difference in mode of action between the two biguanides remains unclear. To gain insight into the different modes of action of the two drugs, we performed global gene expression profiling using the livers of obese diabetic db/db mice after a single administration of phenformin or metformin at levels sufficient to cause a significant reduction in blood glucose level. Metformin induced modest expression changes, including G6pc in the liver as previously reported. By contrast, phenformin caused changes in expression level of many additional genes. We used a knowledge-based bioinformatic analysis to study the effects of phenformin. Differentially expressed genes identified in this study constitute a large gene network, which may be related to cell death, inflammation or wound response. Our results suggest that the two biguanides show a similar hypoglycemic effect in db/db mice, but phenformin induces a greater stress on the liver even a short time after a single administration. These findings provide a novel insight into the cause of the relatively high occurrence of serious adverse effect after phenformin treatment.
Ren, Jun; Zhu, Bang-Hao; Relling, David P; Esberg, Lucy B; Ceylan-Isik, Asli F
2008-11-01
Levels of the obese gene product leptin are often elevated in obesity and may contribute to obesity-induced cardiovascular complications. However, the role of leptin in obesity-associated cardiac abnormalities has not been clearly defined. This study was designed to determine the influence of high-fat diet-induced obesity on cardiac contractile response of leptin. Mechanical and intracellular Ca(2+) properties were evaluated using an IonOptix system in cardiomyocytes from adult rats fed low- and high-fat diets for 12 weeks. Cardiomyocyte contractile and intracellular Ca(2+) properties were examined including peak shortening, duration and maximal velocity of shortening/relengthening (TPS/TR(90), +/-dl/dt), Fura-2-fluorescence intensity change (DeltaFFI), and intracellular Ca(2+) decay rate (tau). Expression of the leptin receptor (Ob-R) was evaluated by western blot analysis. High-fat diet increased systolic blood pressure and plasma leptin levels. PS and +/-dl/dt were depressed whereas TPS and TR(90) were prolonged after high-fat diet feeding. Leptin elicited a concentration-dependent (0-1,000 nmol/l) inhibition of PS, +/-dl/dt, and DeltaFFI in low-fat but not high-fat diet-fed rat cardiomyocytes without affecting TPS and TR(90). The Janus kinase 2 (JAK2) inhibitor AG490, the mitogen-activated protein kinase (MAPK) inhibitor SB203580, and the nitric oxide synthase (NOS) inhibitor L-NAME abrogated leptin-induced cardiomyocyte contractile response in low-fat diet group without affecting the high-fat diet group. High-fat diet significantly downregulated cardiac expression of Ob-R. Elevation of extracellular Ca(2+) concentration nullified obesity-induced cardiomyocyte mechanical dysfunction and leptin-induced depression in PS. These data indicate presence of cardiac leptin resistance in diet-induced obesity possibly associated with impaired leptin receptor signaling.
Habibian, Justine S; Jefic, Mitra; Bagchi, Rushita A; Lane, Robert H; McKnight, Robert A; McKinsey, Timothy A; Morrison, Ron F; Ferguson, Bradley S
2017-10-10
Adipose tissue inflammation is a central pathological element that regulates obesity-mediated insulin resistance and type II diabetes. Evidence demonstrates that extracellular signal-regulated kinase (ERK 1/2) activation (i.e. phosphorylation) links tumor necrosis factor α (TNFα) to pro-inflammatory gene expression in the nucleus. Dual specificity phosphatases (DUSPs) inactivate ERK 1/2 through dephosphorylation and can thus inhibit inflammatory gene expression. We report that DUSP5, an ERK1/2 phosphatase, was induced in epididymal white adipose tissue (WAT) in response to diet-induced obesity. Moreover, DUSP5 mRNA expression increased during obesity development concomitant to increases in TNFα expression. Consistent with in vivo findings, DUSP5 mRNA expression increased in adipocytes in response to TNFα, parallel with ERK1/2 dephosphorylation. Genetic loss of DUSP5 exacerbated TNFα-mediated ERK 1/2 signaling in 3T3-L1 adipocytes and in adipose tissue of mice. Furthermore, inhibition of ERK 1/2 and c-Jun N terminal kinase (JNK) signaling attenuated TNFα-induced DUSP5 expression. These data suggest that DUSP5 functions in the feedback inhibition of ERK1/2 signaling in response to TNFα, which resulted in increased inflammatory gene expression. Thus, DUSP5 potentially acts as an endogenous regulator of adipose tissue inflammation; although its role in obesity-mediated inflammation and insulin signaling remains unclear.
Epigenetic dysregulation of key developmental genes in radiation-induced rat mammary carcinomas.
Daino, Kazuhiro; Nishimura, Mayumi; Imaoka, Tatsuhiko; Takabatake, Masaru; Morioka, Takamitsu; Nishimura, Yukiko; Shimada, Yoshiya; Kakinuma, Shizuko
2018-02-13
With the increase in the number of long-term cancer survivors worldwide, there is a growing concern about the risk of secondary cancers induced by radiotherapy. Epigenetic modifications of genes associated with carcinogenesis are attractive targets for the prevention of cancer owing to their reversible nature. To identify genes with possible changes in functionally relevant DNA methylation patterns in mammary carcinomas induced by radiation exposure, we performed microarray-based global DNA methylation and expression profiling in γ-ray-induced rat mammary carcinomas and normal mammary glands. The gene expression profiling identified dysregulation of developmentally related genes, including the downstream targets of polycomb repressive complex 2 (PRC2) and overexpression of enhancer of zeste homolog 2, a component of PRC2, in the carcinomas. By integrating expression and DNA methylation profiles, we identified ten hypermethylated and three hypomethylated genes that possibly act as tumor-suppressor genes and oncogenes dysregulated by aberrant DNA methylation; half of these genes encode developmental transcription factors. Bisulfite sequencing and quantitative PCR confirmed the dysregulation of the polycomb-regulated developmentally related transcription-factor genes Dmrt2, Hoxa7, Foxb1, Sox17, Lhx8, Gata3 and Runx1. Silencing of Hoxa7 was further verified by immunohistochemistry. These results suggest that, in radiation-induced mammary gland carcinomas, PRC2-mediated aberrant DNA methylation leads to dysregulation of developmentally related transcription-factor genes. Our findings provide clues to molecular mechanisms linking epigenetic regulation and radiation-induced breast carcinogenesis and underscore the potential of such epigenetic mechanisms as targets for cancer prevention. © 2018 UICC.
Babu, Mohan; Griffiths, Jonathan S; Huang, Tyng-Shyan; Wang, Aiming
2008-01-01
Background Virus infection induces the activation and suppression of global gene expression in the host. Profiling gene expression changes in the host may provide insights into the molecular mechanisms that underlie host physiological and phenotypic responses to virus infection. In this study, the Arabidopsis Affymetrix ATH1 array was used to assess global gene expression changes in Arabidopsis thaliana plants infected with Plum pox virus (PPV). To identify early genes in response to PPV infection, an Arabidopsis synchronized single-cell transformation system was developed. Arabidopsis protoplasts were transfected with a PPV infectious clone and global gene expression changes in the transfected protoplasts were profiled. Results Microarray analysis of PPV-infected Arabidopsis leaf tissues identified 2013 and 1457 genes that were significantly (Q ≤ 0.05) up- (≥ 2.5 fold) and downregulated (≤ -2.5 fold), respectively. Genes associated with soluble sugar, starch and amino acid, intracellular membrane/membrane-bound organelles, chloroplast, and protein fate were upregulated, while genes related to development/storage proteins, protein synthesis and translation, and cell wall-associated components were downregulated. These gene expression changes were associated with PPV infection and symptom development. Further transcriptional profiling of protoplasts transfected with a PPV infectious clone revealed the upregulation of defence and cellular signalling genes as early as 6 hours post transfection. A cross sequence comparison analysis of genes differentially regulated by PPV-infected Arabidopsis leaves against uniEST sequences derived from PPV-infected leaves of Prunus persica, a natural host of PPV, identified orthologs related to defence, metabolism and protein synthesis. The cross comparison of genes differentially regulated by PPV infection and by the infections of other positive sense RNA viruses revealed a common set of 416 genes. These identified genes
Cytomegalovirus: pathophysiological mechanisms of the cytomegalovirus-induced cellular responses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nokta, M.A.
1986-01-01
Cytomegalovirus (CMV) infection of fibroblasts of human origin is associated with a cascade of morphologic cellular responses which in other systems have been associated with regulation of intracellular free (IF) (Ca/sup + +/). In the present study, the relationship of specific ion fluxes (Ca/sup + +/, Na/sup +/) to the development of cytomegalovirus (CMV)-induced morphologic cellular responses was investigated. An influx of Ca/sup + +/ was observed by the first hour after CMV infection (PI), and total calcium sequestered by infected cells was enhanced by 5 hr Pl. A gradual rise in intracellular free (IF) (Ca/sup + +/) was observedmore » that continued through 48 hour postinfection (hr Pl). The IF (Ca/sup + +/) response to CMV infection was shown to be multiplicity dependent, require viable virus, and occur under conditions consistent with the expression of immediate early CMV genes. Development and progression of cytomegaly was found to be independent of CMV DNA synthesis and appeared to be dependent on the IF (Ca/sup + +/) response. Ca/sup + +/ influx blockers (e.g. verapamil) and cyclic nucleotide modulators (e.g. papaverine) inhibited both Ca/sup + +/ responses and cytomegaly. Quabain-sensitive /sup 86/Rb uptake and sequestering of Ca/sup + +/ increased in parallel with development of cytomegaly. There may be a relationship between Ca/sup + +/ influx, IF (Ca/sup + +/), activation of the Na/sup +//H/sup +/ exchanger, induction of Na/sup +/, Cl/sup -/, HCO/sub 3/ cotransport, Na/sup +/ entry, Na/sup +//K/sup +/ ATPase activity and development of CMV-induced morphologic cellular responses including cytomegaly.« less
Meddeb, Mariam; Carpentier, Wassila; Cagnard, Nicolas; Nadaud, Sophie; Grillon, Antoine; Barthel, Cathy; De Martino, Sylvie Josiane; Jaulhac, Benoît; Boulanger, Nathalie
2016-01-01
In Lyme borreliosis, the skin is the key site for bacterial inoculation by the infected tick and for cutaneous manifestations. We previously showed that different strains of Borrelia burgdorferi sensu stricto isolated from tick and from different clinical stages of the Lyme borreliosis (erythema migrans, and acrodermatitis chronica atrophicans) elicited a very similar transcriptional response in normal human dermal fibroblasts. In this study, using whole transcriptome microarray chips, we aimed to compare the transcriptional response of normal human dermal fibroblasts stimulated by 3 Borrelia burgdorferi sensu lato strains belonging to 3 main pathogenic species (B. afzelii, B. garinii and B. burgdorferi sensu stricto) in order to determine whether “species-related” inflammatory pathways could be identified. The three Borrelia strains tested exhibited similar transcriptional profiles, and no species-specific fingerprint of transcriptional changes in fibroblasts was observed. Conversely, a common core of chemokines/cytokines (CCL2, CXCL1, CXCL2, CXCL6, CXCL10, IL-6, IL-8) and interferon-related genes was stimulated by all the 3 strains. Dermal fibroblasts appear to play a key role in the cutaneous infection with Borrelia, inducing a homogeneous inflammatory response, whichever Borrelia species was involved. PMID:27706261
Kim, Ji Eun; Park, So Hae; Kwak, Moon Hwa; Go, Jun; Koh, Eun Kyoung; Song, Sung Hwa; Sung, Ji Eun; Lee, Hee Seob; Hong, Jin Tae; Hwang, Dae Youn
2015-01-01
To characterize the changes in global gene expression in the distal colon of constipated SD rats in response to the laxative effects of aqueous extracts of Liriope platyphylla (AEtLP), including isoflavone, saponin, oligosaccharide, succinic acid and hydroxyproline, the total RNA extracted from the distal colon of AEtLP-treated constipation rats was hybridized to oligonucleotide microarrays. The AEtLP treated rats showed an increase in the number of stools, mucosa thickness, flat luminal surface thickness, mucin secretion, and crypt number. Overall, compared to the controls, 581 genes were up-regulated and 216 genes were down-regulated by the constipation induced by loperamide in the constipated rats. After the AEtLP treatment, 67 genes were up-regulated and 421 genes were down-regulated. Among the transcripts up-regulated by constipation, 89 were significantly down-regulated and 22 were recovered to the normal levels by the AEtLP treatment. The major genes in the down-regulated categories included Slc9a5, klk10, Fgf15, and Alpi, whereas the major genes in the recovered categories were Cyp2b2, Ace, G6pc, and Setbp1. On the other hand, after the AEtLP treatment, ten of these genes down-regulated by constipation were up-regulated significantly and five were recovered to the normal levels. The major genes in the up-regulated categories included Serpina3n, Lcn2 and Slc5a8, whereas the major genes in the recovered categories were Tmem45a, Rerg and Rgc32. These results indicate that several gene functional groups and individual genes as constipation biomarkers respond to an AEtLP treatment in constipated model rats. PMID:26151867
Le Dréan, Y; Lazennec, G; Kern, L; Saligaut, D; Pakdel, F; Valotaire, Y
1995-08-01
We previously reported that the expression of the rainbow trout estrogen receptor (rtER) gene is markedly increased by estradiol (E2). In this paper, we have used transient transfection assays with reporter plasmids expressing chloramphenicol acetyl transferase (CAT), linked to 5' flanking regions of the rtER gene promoter, to identify cis-elements responsible for E2 inducibility. Deletion analysis localized an estrogen-responsive element (ERE), at position +242, with one mutation on the first base compared with the consensus sequence. This element confers estrogen responsiveness to CAT reporter linked to both the herpes simplex virus thymidine kinase promoter and the homologous rtER promoter. Moreover, using a 0.2 kb fragment of the rtER promoter encompassing the ERE and the rtER DNA binding domain obtained from a bacterial expression system, DNase I footprinting experiments demonstrated a specific protection covering 20 bp (+240/+260) containing the ERE sequence. Based on these studies, we believe that this ERE sequence, identified in the rtER gene promoter, may be a major cis-acting element involved in the regulation of the gene by estrogen.
Ahmed, Nasar Uddin; Jung, Hee-Jeong; Park, Jong-In; Cho, Yong-Gu; Hur, Yoonkang; Nou, Ill-Sup
2015-01-10
Cold and freezing stress is a major environmental constraint to the production of Brassica crops. Enhancement of tolerance by exploiting cold and freezing tolerance related genes offers the most efficient approach to address this problem. Cold-induced transcriptional profiling is a promising approach to the identification of potential genes related to cold and freezing stress tolerance. In this study, 99 highly expressed genes were identified from a whole genome microarray dataset of Brassica rapa. Blast search analysis of the Brassica oleracea database revealed the corresponding homologous genes. To validate their expression, pre-selected cold tolerant and susceptible cabbage lines were analyzed. Out of 99 BoCRGs, 43 were differentially expressed in response to varying degrees of cold and freezing stress in the contrasting cabbage lines. Among the differentially expressed genes, 18 were highly up-regulated in the tolerant lines, which is consistent with their microarray expression. Additionally, 12 BoCRGs were expressed differentially after cold stress treatment in two contrasting cabbage lines, and BoCRG54, 56, 59, 62, 70, 72 and 99 were predicted to be involved in cold regulatory pathways. Taken together, the cold-responsive genes identified in this study provide additional direction for elucidating the regulatory network of low temperature stress tolerance and developing cold and freezing stress resistant Brassica crops. Copyright © 2014 Elsevier B.V. All rights reserved.
Gaddelapati, Sharath Chandra; Kalsi, Megha; Roy, Amit; Palli, Subba Reddy
2018-08-01
The Colorado potato beetle (CPB), Leptinotarsa decemlineata developed resistance to imidacloprid after exposure to this insecticide for multiple generations. Our previous studies showed that xenobiotic transcription factor, cap 'n' collar isoform C (CncC) regulates the expression of multiple cytochrome P450 genes, which play essential roles in resistance to plant allelochemicals and insecticides. In this study, we sought to obtain a comprehensive picture of the genes regulated by CncC in imidacloprid-resistant CPB. We performed sequencing of RNA isolated from imidacloprid-resistant CPB treated with dsRNA targeting CncC or gene coding for green fluorescent protein (control). Comparative transcriptome analysis showed that CncC regulated the expression of 1798 genes, out of which 1499 genes were downregulated in CncC knockdown beetles. Interestingly, expression of 79% of imidacloprid induced P450 genes requires CncC. We performed quantitative real-time PCR to verify the reduction in the expression of 20 genes including those coding for detoxification enzymes (P450s, glutathione S-transferases, and esterases) and ABC transporters. The genes coding for ABC transporters are induced in insecticide resistant CPB and require CncC for their expression. Knockdown of genes coding for ABC transporters simultaneously or individually caused an increase in imidacloprid-induced mortality in resistant beetles confirming their contribution to insecticide resistance. These studies identified CncC as a transcription factor involved in regulation of genes responsible for imidacloprid resistance. Small molecule inhibitors of CncC or suppression of CncC by RNAi could provide effective synergists for pest control or management of insecticide resistance. Copyright © 2018 Elsevier Ltd. All rights reserved.
Hu, S.S.; Mei, L.; Chen, J.Y.; Huang, Z.W.; Wu, H.
2014-01-01
Tinnitus could be associated with neuronal hyperactivity in the auditory center. As a neuronal activity marker, immediate-early gene (IEG) expression is considered part of a general neuronal response to natural stimuli. Some IEGs, especially the activity-dependent cytoskeletal protein (Arc) and the early growth response gene-1 (Egr-1), appear to be highly correlated with sensory-evoked neuronal activity. We hypothesize, therefore, an increase of Arc and Egr-1 will be observed in a tinnitus model. In our study, we used the gap prepulse inhibition of acoustic startle (GPIAS) paradigm to confirm that salicylate induces tinnitus-like behavior in rats. However, expression of the Arc gene and Egr-1 gene were decreased in the inferior colliculus (IC) and auditory cortex (AC), in contradiction of our hypothesis. Expression of N-methyl D-aspartate receptor subunit 2B (NR2B) was increased and all of these changes returned to normal 14 days after treatment with salicylate ceased. These data revealed long-time administration of salicylate induced tinnitus markedly but reversibly and caused neural plasticity changes in the IC and the AC. Decreased expression of Arc and Egr-1 might be involved with instability of synaptic plasticity in tinnitus. PMID:24704997
2012-01-01
Background Plant growth is greatly affected by low temperatures, and the expression of a number of genes is induced by cold stress. Although many genes in the cold signaling pathway have been identified in Arabidopsis, little is known about the transcription factors involved in the cold stress response in apple. Results Here, we show that the apple bHLH (basic helix-loop-helix) gene MdCIbHLH1 (Cold-Induced bHLH1), which encodes an ICE-like protein, was noticeably induced in response to cold stress. The MdCIbHLH1 protein specifically bound to the MYC recognition sequences in the AtCBF3 promoter, and MdCIbHLH1 overexpression enhanced cold tolerance in transgenic Arabidopsis. In addition, the MdCIbHLH1 protein bound to the promoters of MdCBF2 and favorably contributed to cold tolerance in transgenic apple plants by upregulating the expression of MdCBF2 through the CBF (C-repeat-binding factor) pathway. Our findings indicate that MdCIbHLH1 functions in stress tolerance in different species. For example, ectopic MdCIbHLH1 expression conferred enhanced chilling tolerance in transgenic tobacco. Finally, we observed that cold induces the degradation of the MdCIbHLH1 protein in apple and that this degradation was potentially mediated by ubiquitination and sumoylation. Conclusions Based on these findings, MdCIbHLH1 encodes a transcription factor that is important for the cold tolerance response in apple. PMID:22336381
Trauma-induced systemic inflammatory response versus exercise-induced immunomodulatory effects.
Fehrenbach, Elvira; Schneider, Marion E
2006-01-01
Accidental trauma and heavy endurance exercise, both induce a kind of systemic inflammatory response, also called systemic inflammatory response syndrome (SIRS). Exercise-related SIRS is conditioned by hyperthermia and concomitant heat shock responses, whereas trauma-induced SIRS manifests concomitantly with tissue necrosis and immune activation, secondarily followed by fever. Inflammatory cytokines are common denominators in both trauma and exercise, although there are marked quantitative differences. Different anti-inflammatory cytokines may be involved in the control of inflammation in trauma- and exercise-induced stress. Exercise leads to a balanced equilibrium between inflammatory and anti-inflammatory responses. Intermittent states of rest, as well as anti-oxidant capacity, are lacking or minor in trauma but are high in exercising individuals. Regular training may enhance immune competence, whereas trauma-induced SIRS often paves the way for infectious complications, such as sepsis.
Ezrin Inhibition Up-regulates Stress Response Gene Expression*
Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T.; Minas, Tsion Z.; Conn, Erin J.; Hong, Sung-Hyeok; Pauly, Gary T.; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A.; Toretsky, Jeffrey A.; Üren, Aykut
2016-01-01
Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes. PMID:27137931
Host genetic variation influences gene expression response to rhinovirus infection.
Çalışkan, Minal; Baker, Samuel W; Gilad, Yoav; Ober, Carole
2015-04-01
Rhinovirus (RV) is the most prevalent human respiratory virus and is responsible for at least half of all common colds. RV infections may result in a broad spectrum of effects that range from asymptomatic infections to severe lower respiratory illnesses. The basis for inter-individual variation in the response to RV infection is not well understood. In this study, we explored whether host genetic variation is associated with variation in gene expression response to RV infections between individuals. To do so, we obtained genome-wide genotype and gene expression data in uninfected and RV-infected peripheral blood mononuclear cells (PBMCs) from 98 individuals. We mapped local and distant genetic variation that is associated with inter-individual differences in gene expression levels (eQTLs) in both uninfected and RV-infected cells. We focused specifically on response eQTLs (reQTLs), namely, genetic associations with inter-individual variation in gene expression response to RV infection. We identified local reQTLs for 38 genes, including genes with known functions in viral response (UBA7, OAS1, IRF5) and genes that have been associated with immune and RV-related diseases (e.g., ITGA2, MSR1, GSTM3). The putative regulatory regions of genes with reQTLs were enriched for binding sites of virus-activated STAT2, highlighting the role of condition-specific transcription factors in genotype-by-environment interactions. Overall, we suggest that the 38 loci associated with inter-individual variation in gene expression response to RV-infection represent promising candidates for affecting immune and RV-related respiratory diseases.
Pombo, Marina A; Zheng, Yi; Fernandez-Pozo, Noe; Dunham, Diane M; Fei, Zhangjun; Martin, Gregory B
2014-01-01
Plants have two related immune systems to defend themselves against pathogen attack. Initially,pattern-triggered immunity is activated upon recognition of microbe-associated molecular patterns by pattern recognition receptors. Pathogenic bacteria deliver effector proteins into the plant cell that interfere with this immune response and promote disease. However, some plants express resistance proteins that detect the presence of specific effectors leading to a robust defense response referred to as effector-triggered immunity. The interaction of tomato with Pseudomonas syringae pv. tomato is an established model system for understanding the molecular basis of these plant immune responses. We apply high-throughput RNA sequencing to this pathosystem to identify genes whose expression changes specifically during pattern-triggered or effector-triggered immunity. We then develop reporter genes for each of these responses that will enable characterization of the host response to the large collection of P. s. pv. tomato strains that express different combinations of effectors. Virus-induced gene silencing of 30 of the effector-triggered immunity-specific genes identifies Epk1 which encodes a predicted protein kinase from a family previously unknown to be involved in immunity. Knocked-down expression of Epk1 compromises effector-triggered immunity triggered by three bacterial effectors but not by effectors from non-bacterial pathogens. Epistasis experiments indicate that Epk1 acts upstream of effector-triggered immunity-associated MAP kinase signaling. Using RNA-seq technology we identify genes involved in specific immune responses. A functional genomics screen led to the discovery of Epk1, a novel predicted protein kinase required for plant defense activation upon recognition of three different bacterial effectors.
Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.
Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee
2016-02-01
Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.
A novel screen for genes associated with pheromone-induced sterility
Camiletti, Alison L.; Percival-Smith, Anthony; Croft, Justin R.; Thompson, Graham J.
2016-01-01
For honey bee and other social insect colonies the ‘queen substance’ regulates colony reproduction rendering workers functionally sterile. The evolution of worker reproductive altruism is explained by inclusive fitness theory, but little is known of the genes involved or how they regulate the phenotypic expression of altruism. We previously showed that application of honeybee queen pheromone to virgin fruit flies suppresses fecundity. Here we exploit this finding to identify genes associated with the perception of an ovary-inhibiting social pheromone. Mutational and RNAi approaches in Drosophila reveal that the olfactory co-factor Orco together with receptors Or49b, Or56a and Or98a are potentially involved in the perception of queen pheromone and the suppression of fecundity. One of these, Or98a, is known to mediate female fly mating behaviour, and its predicted ligand is structurally similar to a methyl component of the queen pheromone. Our novel approach to finding genes associated with pheromone-induced sterility implies conserved reproductive regulation between social and pre-social orders, and further helps to identify candidate orthologues from the pheromone-responsive pathway that may regulate honeybee worker sterility. PMID:27786267
The Surgically Induced Stress Response
Finnerty, Celeste C.; Mabvuure, Nigel Tapiwa; Ali, Arham; Kozar, Rosemary A.; Herndon, David N.
2013-01-01
The stress response to surgery, critical illness, trauma, and burns encompasses derangements of metabolic and physiological processes which induce perturbations in the inflammatory, acute phase, hormonal, and genomic responses. Hypermetabolism and hypercatabolism result, leading to muscle wasting, impaired immune function and wound healing, organ failure, and death. The surgery-induced stress response is largely similar to that triggered by traumatic injuries; the duration of the stress response, however, varies according to the severity of injury (surgical or traumatic). This spectrum of injuries and insults ranges from small lacerations to severe insults such as large poly-traumatic and burn injuries. Although the stress response to acute trauma evolved to improve chances of survival following injury, in modern surgical practice the stress response can be detrimental. PMID:24009246
Sharma, Anuj; Bhattacharya, Bhaskar; Puri, Raj K; Maheshwari, Radha K
2008-01-01
Background Neurovirulent Venezuelan equine encephalitis virus (VEEV) causes lethal encephalitis in equines and is transmitted to humans by mosquitoes. VEEV is highly infectious when transmitted by aerosol and has been developed as a bio-warfare agent, making it an important pathogen to study from a military and civilian standpoint. Molecular mechanisms of VEE pathogenesis are poorly understood. To study these, the gene expression profile of VEEV infected mouse brains was investigated. Changes in gene expression were correlated with histological changes in the brain. In addition, a molecular framework of changes in gene expression associated with progression of the disease was studied. Results Our results demonstrate that genes related to important immune pathways such as antigen presentation, inflammation, apoptosis and response to virus (Cxcl10, CxCl11, Ccl5, Ifr7, Ifi27 Oas1b, Fcerg1,Mif, Clusterin and MHC class II) were upregulated as a result of virus infection. The number of over-expressed genes (>1.5-fold level) increased as the disease progressed (from 197, 296, 400, to 1086 at 24, 48, 72 and 96 hours post infection, respectively). Conclusion Identification of differentially expressed genes in brain will help in the understanding of VEEV-induced pathogenesis and selection of biomarkers for diagnosis and targeted therapy of VEEV-induced neurodegeneration. PMID:18558011
Hong, S W; Jon, J H; Kwak, J M; Nam, H G
1997-01-01
A cDNA clone for a receptor-like protein kinase gene (RPK1) was isolated from Arabidopsis thaliana. The clone is 1952 bp long with 1623 bp of an open reading frame encoding a peptide of 540 amino acids. The deduced peptide (RPK1) contains four distinctive domains characteristic of receptor kinases: (a) a putative amino-terminal signal sequence domain; (b) a domain with five extracellular leucine-rich repeat sequences; (c) a membrane-spanning domain; and (d) a cytoplasmic protein kinase domain that contains all of the 11 subdomains conserved among protein kinases. The RPK1 gene is expressed in flowers, stems, leaves, and roots. Expression of the RPK1 gene is induced within 1 h after treatment with abscisic acid (ABA). The gene is also rapidly induced by several environmental stresses such as dehydration, high salt, and low temperature, suggesting that the gene is involved in a general stress response. The dehydration-induced expression is not impaired in aba-1, abi1-1, abi2-1, and abi3-1 mutants, suggesting that the dehydration-induced expression of the RPK1 gene is ABA-independent. A possible role of this gene in the signal transduction pathway of ABA and the environmental stresses is discussed. PMID:9112773
Mohammed, Javid P.; Fusakio, Michael E.; Rainbow, Daniel B.; Moule, Carolyn; Fraser, Heather I.; Clark, Jan; Todd, John A.; Peterson, Laurence B.; Savage, Paul B.; Wills-Karp, Marsha; Ridgway, William M.; Wicker, Linda S.; Mattner, Jochen
2011-01-01
Environmental and genetic factors define the susceptibility of an individual to autoimmune disease. Although common genetic pathways affect general immunological tolerance mechanisms in autoimmunity, the effects of such genes could vary under distinct immune challenges within different tissues. Here we demonstrate this by observing that autoimmune type 1 diabetes (T1D) protective haplotypes at the susceptibility region 10 (Idd10) introgressed from chromosome 3 of B6 and A/J mice onto the NOD background increase the severity of autoimmune primary biliary cirrhosis (PBC) induced by infection with Novosphingobium aromaticivorans (N. aro), an ubiquitous alphaproteobacterium, when compared to mice having the NOD and NOD.CAST Idd10 T1D susceptible haplotypes. Substantially increased liver pathology in mice having the B6 and A/J Idd10 haplotypes correlates with reduced expression of CD101 on dendritic cells (DCs), macrophages and granulocytes following infection, delayed clearance of N. aro and the promotion of overzealous, IFN-γ- and IL-17-dominated T cell responses essential for the adoptive transfer of liver lesions. CD101-knockout mice generated on the B6 background also exhibit substantially more severe N.aro-induced liver disease correlating with increased IFN-γ and IL-17 responses compared to wild type mice. These data strongly support the hypothesis that allelic variation of the Cd101 gene, located in the Idd10 region, alters the severity of liver autoimmunity induced by N. aro. PMID:21613619
De-La-Peña, Clelia; Rangel-Cano, Alicia; Alvarez-Venegas, Raúl
2012-05-01
Genes in eukaryotic organisms function within the context of chromatin, and the mechanisms that modulate the structure of chromatin are defined as epigenetic. In Arabidopsis, pathogen infection induces the expression of at least one histone deacetylase, suggesting that histone acetylation/deacetylation has an important role in the pathogenic response in plants. How/whether histone methylation affects gene response to pathogen infection is unknown. To gain a better understanding of the epigenetic mechanisms regulating the interaction between Pseudomonas syringae and Arabidopsis thaliana, we analysed three different Arabidopsis ash1-related (absent, small or homeotic discs 1) mutants. We found that the loss of function of ASHH2 and ASHR1 resulted in faster hypersensitive responses (HRs) to both mutant (hrpA) and pathogenic (DC3000) strains of P. syringae, whereas control (Col-0) and ashr3 mutants appeared to be more resistant to the infection after 2 days. Furthermore, we showed that, in the ashr3 background, the PR1 gene (PATHOGENESIS-RELATED GENE 1) displayed the highest expression levels on infection with DC3000, correlating with increased resistance against this pathogen. Our results show that, in both the ashr1 and ashh2 backgrounds, the histone H3 lysine 4 dimethylation (H3K4me2) levels decreased at the promoter region of PR1 on infection with the DC3000 strain, suggesting that an epigenetically regulated PR1 expression is involved in the plant defence. Our results suggest that histone methylation in response to pathogen infection may be a critical component in the signalling and defence processes occurring between plants and microbes. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.
Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen
2017-06-01
The underlying mechanisms of glucocorticoid (GC)‑induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC‑induced ANFH. E‑MEXP‑2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid‑induced ANFH rats compared with 5 placebo‑treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC‑induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25‑Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α‑2‑macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC‑induced ANFH via interacting with VDR. A2M may also be involved in the development of GC‑induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC‑induced ANFH may provide novel targets for diagnostics and therapeutic treatment.
Huang, Gangyong; Wei, Yibing; Zhao, Guanglei; Xia, Jun; Wang, Siqun; Wu, Jianguo; Chen, Feiyan; Chen, Jie; Shi, Jingshen
2017-01-01
The underlying mechanisms of glucocorticoid (GC)-induced avascular necrosis of the femoral head (ANFH) have yet to be fully understood, in particular the mechanisms associated with the change of gene expression pattern. The present study aimed to identify key genes with a differential expression pattern in GC-induced ANFH. E-MEXP-2751 microarray data were downloaded from the ArrayExpress database. Differentially expressed genes (DEGs) were identified in 5 femoral head samples of steroid-induced ANFH rats compared with 5 placebo-treated rat samples. Gene Ontology (GO) and pathway enrichment analyses were performed upon these DEGs. A total 93 DEGs (46 upregulated and 47 downregulated genes) were identified in GC-induced ANFH samples. These DEGs were enriched in different GO terms and pathways, including chondrocyte differentiation and detection of chemical stimuli. The enrichment map revealed that skeletal system development was interconnected with several other GO terms by gene overlap. The literature mined network analysis revealed that 5 upregulated genes were associated with femoral necrosis, including parathyroid hormone receptor 1 (PTHR1), vitamin D (1,25-Dihydroxyvitamin D3) receptor (VDR), collagen, type II, α1, proprotein convertase subtilisin/kexin type 6 and zinc finger protein 354C (ZFP354C). In addition, ZFP354C and VDR were identified to transcription factors. Furthermore, PTHR1 was revealed to interact with VDR, and α-2-macroglobulin (A2M) interacted with fibronectin 1 (FN1) in the PPI network. PTHR1 may be involved in GC-induced ANFH via interacting with VDR. A2M may also be involved in the development of GC-induced ANFH through interacting with FN1. An improved understanding of the molecular mechanisms underlying GC-induced ANFH may provide novel targets for diagnostics and therapeutic treatment. PMID:28393228
Li, Zhi-Hua; Zhong, Li-Qiao; Mu, Wei-Na; Wu, Yan-Hua
2016-02-01
In this study, the effects of tributyltin (TBT) on biochemical parameters (antioxidant responses and Na(+) -K(+) -ATPase) in different tissues were investigated by using juvenile common carp (Cyprinus Carpio) as well as growth and ion regulation-related genes expression and stress-related proteins profiling in fish liver. Oxidative stress indices and Na(+) -K(+) -ATPase showed tissues-specific responses in fish exposed to different TBT concentrations. All tested genes related to GH/IGF-I axis and ion-regulation were significantly induced in the TBT group with lower concentrations (except for the igfbp3 in 10 μg/L) and were inhibited in 20 μg/L. In addition, the profiling of two proteins Hsp 70 and MT were increasing in a dose-dependent manner under TBT stress. In short, TBT-induced biochemical and molecular responses in different tissues were reflected in the measured parameters in the test. On the basis of TBT residue levels in the natural environment, more long-term experiments at lower concentrations will be necessary in the future. © 2015 Wiley Periodicals, Inc.
Konlechner, Cornelia; Türktaş, Mine; Langer, Ingrid; Vaculík, Marek; Wenzel, Walter W.; Puschenreiter, Markus; Hauser, Marie-Theres
2013-01-01
Salix caprea is well suited for phytoextraction strategies. In a previous survey we showed that genetically distinct S. caprea plants isolated from metal-polluted and unpolluted sites differed in their zinc (Zn) and cadmium (Cd) tolerance and accumulation abilities. To determine the molecular basis of this difference we examined putative homologues of genes involved in heavy metal responses and identified over 200 new candidates with a suppression subtractive hybridization (SSH) screen. Quantitative expression analyses of 20 genes in leaves revealed that some metallothioneins and cell wall modifying genes were induced irrespective of the genotype's origin and metal uptake capacity while a cysteine biosynthesis gene was expressed constitutively higher in the metallicolous genotype. The third and largest group of genes was only induced in the metallicolous genotype. These data demonstrate that naturally adapted woody non-model species can help to discover potential novel molecular mechanisms for metal accumulation and tolerance. PMID:23562959
Bae, Hanhong; Kim, Soo-Hyung; Kim, Moon S; Sicher, Richard C; Lary, David; Strem, Mary D; Natarajan, Savithiry; Bailey, Bryan A
2008-02-01
Drought can negatively impact pod production despite the fact that cacao production usually occurs in tropical areas having high rainfall. Polyamines (PAs) have been associated with the response of plants to drought in addition to their roles in responses to many other stresses. The constitutive and drought inducible expression patterns of genes encoding enzymes involved in PA biosynthesis were determined: an ornithine decarboxylase (TcODC), an arginine decarboxylase (TcADC), an S-adenosylmethionine decarboxylase (TcSAMDC), a spermidine synthase (TcSPDS), and a spermine synthase (TcSPMS). Expression analysis using quantitative real-time reverse transcription-PCR (QPCR) results showed that the PA biosynthesis genes were expressed in all plant tissues examined. Constitutive expression of PA biosynthesis genes was generally highest in mature leaves and open flowers. Expression of TcODC, TcADC, and TcSAMDC was induced with the onset of drought and correlated with changes in stomatal conductance, photosynthesis, photosystem II efficiency, leaf water potential and altered emission of blue-green fluorescence from cacao leaves. Induction of TcSAMDC in leaves was most closely correlated with changes in water potential. The earliest measured responses to drought were enhanced expression of TcADC and TcSAMDC in roots along with decreases in stomatal conductance, photosynthesis, and photosystem II efficiency. Elevated levels of putrescine, spermidine, and spermine were detected in cacao leaves 13days after the onset of drought. Expression of all five PA associated transcripts was enhanced (1.5-3-fold) in response to treatment with abscisic acid. TcODC and TcADC, were also responsive to mechanical wounding, infection by Phytophthora megakarya (a causal agent of black pod disease in cacao), the necrosis- and ethylene-inducing protein (Nep1) of Fusarium oxysporum, and flower abscission. TcSAMDC expression was responsive to all stresses except flower abscission. TcODC, although
Furuya, Toshiki; Hirose, Satomi; Osanai, Hisashi; Semba, Hisashi; Kino, Kuniki
2011-01-01
Mycobacterium goodii strain 12523 is an actinomycete that is able to oxidize phenol regioselectively at the para position to produce hydroquinone. In this study, we investigated the genes responsible for this unique regioselective oxidation. On the basis of the fact that the oxidation activity of M. goodii strain 12523 toward phenol is induced in the presence of acetone, we first identified acetone-induced proteins in this microorganism by two-dimensional electrophoretic analysis. The N-terminal amino acid sequence of one of these acetone-induced proteins shares 100% identity with that of the protein encoded by the open reading frame Msmeg_1971 in Mycobacterium smegmatis strain mc2155, whose genome sequence has been determined. Since Msmeg_1971, Msmeg_1972, Msmeg_1973, and Msmeg_1974 constitute a putative binuclear iron monooxygenase gene cluster, we cloned this gene cluster of M. smegmatis strain mc2155 and its homologous gene cluster found in M. goodii strain 12523. Sequence analysis of these binuclear iron monooxygenase gene clusters revealed the presence of four genes designated mimABCD, which encode an oxygenase large subunit, a reductase, an oxygenase small subunit, and a coupling protein, respectively. When the mimA gene (Msmeg_1971) of M. smegmatis strain mc2155, which was also found to be able to oxidize phenol to hydroquinone, was deleted, this mutant lost the oxidation ability. This ability was restored by introduction of the mimA gene of M. smegmatis strain mc2155 or of M. goodii strain 12523 into this mutant. Interestingly, we found that these gene clusters also play essential roles in propane and acetone metabolism in these mycobacteria. PMID:21183637
Plasticity-Related Gene Expression During Eszopiclone-Induced Sleep.
Gerashchenko, Dmitry; Pasumarthi, Ravi K; Kilduff, Thomas S
2017-07-01
Experimental evidence suggests that restorative processes depend on synaptic plasticity changes in the brain during sleep. We used the expression of plasticity-related genes to assess synaptic plasticity changes during drug-induced sleep. We first characterized sleep induced by eszopiclone in mice during baseline conditions and during the recovery from sleep deprivation. We then compared the expression of 18 genes and two miRNAs critically involved in synaptic plasticity in these mice. Gene expression was assessed in the cerebral cortex and hippocampus by the TaqMan reverse transcription polymerase chain reaction and correlated with sleep parameters. Eszopiclone reduced the latency to nonrapid eye movement (NREM) sleep and increased NREM sleep amounts. Eszopiclone had no effect on slow wave activity (SWA) during baseline conditions but reduced the SWA increase during recovery sleep (RS) after sleep deprivation. Gene expression analyses revealed three distinct patterns: (1) four genes had higher expression either in the cortex or hippocampus in the group of mice with increased amounts of wakefulness; (2) a large proportion of plasticity-related genes (7 out of 18 genes) had higher expression during RS in the cortex but not in the hippocampus; and (3) six genes and the two miRNAs showed no significant changes across conditions. Even at a relatively high dose (20 mg/kg), eszopiclone did not reduce the expression of plasticity-related genes during RS period in the cortex. These results indicate that gene expression associated with synaptic plasticity occurs in the cortex in the presence of a hypnotic medication. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.
Wang, Cuicui; Fu, Daqi
2018-03-21
Eggplant ( Solanum melongena L.) fruits accumulate flavonoids in their cuticle and epidermal cells during ripening. Although many mutants available in model plant species, such as Arabidopsis thaliana and Medicago truncatula, are enabling the intricacies of flavonoid-related physiology to be deduced, the mechanisms whereby flavonoids influence eggplant fruit physiology are unknown. Virus-induced gene silencing (VIGS) is a reliable tool for the study of flavonoid function in fruit, and in this study, we successfully applied this technique to downregulate S. melongena chalcone synthase gene ( SmCHS) expression during eggplant fruit ripening. In addition to the expected change in fruit color attributable to a lack of anthocyanins, several other modifications, including differences in epidermal cell size and shape, were observed in the different sectors. We also found that silencing of CHS gene expression was associated with a negative gravitropic response in eggplant fruits. These observations indicate that epidermal cell expansion during ripening is dependent upon CHS expression and that there may be a relationship between CHS expression and gravitropism during eggplant fruit ripening.
Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.
1999-01-01
The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891
Mariscal, Ana M; Kakizawa, Shigeyuki; Hsu, Jonathan Y; Tanaka, Kazuki; González-González, Luis; Broto, Alicia; Querol, Enrique; Lluch-Senar, Maria; Piñero-Lambea, Carlos; Sun, Lijie; Weyman, Philip D; Wise, Kim S; Merryman, Chuck; Tse, Gavin; Moore, Adam J; Hutchison, Clyde A; Smith, Hamilton O; Tomita, Masaru; Venter, J Craig; Glass, John I; Piñol, Jaume; Suzuki, Yo
2018-05-22
Functional genomics studies in minimal mycoplasma cells enable unobstructed access to some of the most fundamental processes in biology. Conventional transposon bombardment and gene knockout approaches often fail to reveal functions of genes that are essential for viability, where lethality precludes phenotypic characterization. Conditional inactivation of genes is effective for characterizing functions central to cell growth and division, but tools are limited for this purpose in mycoplasmas. Here we demonstrate systems for inducible repression of gene expression based on clustered regularly interspaced short palindromic repeats-mediated interference (CRISPRi) in Mycoplasma pneumoniae and synthetic Mycoplasma mycoides, two organisms with reduced genomes actively used in systems biology studies. In the synthetic cell, we also demonstrate inducible gene expression for the first time. Time-course data suggest rapid kinetics and reversible engagement of CRISPRi. Targeting of six selected endogenous genes with this system results in lowered transcript levels or reduced growth rates that agree with lack or shortage of data in previous transposon bombardment studies, and now produces actual cells to analyze. The ksgA gene encodes a methylase that modifies 16S rRNA, rendering it vulnerable to inhibition by the antibiotic kasugamycin. Targeting the ksgA gene with CRISPRi removes the lethal effect of kasugamycin and enables cell growth, thereby establishing specific and effective gene modulation with our system. The facile methods for conditional gene activation and inactivation in mycoplasmas open the door to systematic dissection of genetic programs at the core of cellular life.
Elanchezhian, R; Sakthivel, M; Geraldine, P; Thomas, P A
2010-03-30
Differential expression of apoptotic genes has been demonstrated in selenite-induced cataract. Acetyl-l-carnitine (ALCAR) has been shown to prevent selenite cataractogenesis by maintaining lenticular antioxidant enzyme and redox system components at near normal levels and also by inhibiting lenticular calpain activity. The aim of the present experiment was to investigate the possibility that ALCAR also prevents selenite-induced cataractogenesis by regulating the expression of antioxidant (catalase) and apoptotic [caspase-3, early growth response protein-1 (EGR-1) and cytochrome c oxidase subunit I (COX-I)] genes. The experiment was conducted on 9-day-old Wistar rat pups, which were divided into normal, cataract-untreated and cataract-treated groups. Putative changes in gene expression in whole lenses removed from the rats were determined by measuring mRNA transcript levels of the four genes by RT-PCR analysis, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The expression of lenticular caspase-3 and EGR-1 genes appeared to be upregulated, as inferred by detecting increased mRNA transcript levels, while that of COX-I and catalase genes appeared to be downregulated (lowered mRNA transcript levels) in the lenses of cataract-untreated rats. However, in rats treated with ALCAR, the lenticular mRNA transcript levels were maintained at near normal (control) levels. These results suggest that ALCAR may prevent selenite-induced cataractogenesis by preventing abnormal expression of lenticular genes governing apoptosis.
Felix-Portillo, Monserrath; Martinez-Quintana, José A; Peregrino-Uriarte, Alma B; Yepiz-Plascencia, Gloria
2014-10-01
Aquatic animals encounter variation in oxygen tension that leads to the accumulation of reactive oxygen species (ROS) that can harm the organisms. Under these circumstances some organisms have evolved to tolerate hypoxia. In mammals, metallothioneins (MTs) protect against hypoxia-generated ROS. Here we report the MT gene from the shrimp Litopenaeus vannamei (LvMT). LvMT is differentially expressed in hemocytes, intestine, gills, pleopods, heart, hepatopancreas and muscle, with the highest levels in hepatopancreas and heart. LvMT mRNA increases during hypoxia in hepatopancreas and gills after 3 h at 1.5 mg L(-1) dissolved oxygen (DO). This gene structure resembles the homologs from invertebrates and vertebrates possessing three exons, two introns and response elements for metal response transcription factor 1 (MTF-1), hypoxia-inducible factor 1 (HIF-1) and p53 in the promoter region. During hypoxia, HIF-1/MTF-1 might participate inducing MT to contribute towards the tolerance to ROS toxicity. MT importance in aquatic organisms may include also ROS-detoxifying processes. Copyright © 2014 Elsevier Ltd. All rights reserved.
Li, Kang; Tian, Ling; Guo, Zhongjian; Guo, Sanyou; Zhang, Jianzhen; Gu, Shi-Hong; Palli, Subba R.; Cao, Yang; Li, Sheng
2016-01-01
The temporal control mechanisms that precisely control animal development remain largely elusive. The timing of major developmental transitions in insects, including molting and metamorphosis, is coordinated by the steroid hormone 20-hydroxyecdysone (20E). 20E involves feedback loops to maintain pulses of ecdysteroid biosynthesis leading to its upsurge, whereas the underpinning molecular mechanisms are not well understood. Using the silkworm Bombyx mori as a model, we demonstrated that E75, the 20E primary response gene, mediates a regulatory loop between ecdysteroid biosynthesis and 20E signaling. E75 isoforms A and C directly bind to retinoic acid receptor-related response elements in Halloween gene promoter regions to induce gene expression thus promoting ecdysteroid biosynthesis and developmental transition, whereas isoform B antagonizes the transcriptional activity of isoform A/C through physical interaction. As the expression of E75 isoforms is differentially induced by 20E, the E75-mediated regulatory loop represents a fine autoregulation of steroidogenesis, which contributes to the precise control of developmental timing. PMID:27365399
The AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response
Asano, Tomoya; Yasuda, Michiko; Nakashita, Hideo; Kimura, Makoto; Yamaguchi1, Kazuo
2008-01-01
Phytopathogenic Fusarium species produce the trichothecene family of phytotoxins, which function as a virulence factor during infection of plants. Trichothecenes are classifiable into four major groups by their chemical structures. Recently, the AtNFXL1 gene was reported as a type A trichothecene T-2 toxin-inducible gene. The AtNFXL1 gene encodes a putative transcription factor with similarity to the human transcription repressor NF-X1. The atnfxl1 mutant exhibited hypersensitivity phenotype to T-2 toxin but not to type B deoxynivalenol (DON) in comparison with wild type when Arabidopsis thaliana grew on agar medium containing trichothecenes. The absence or presence of a carbonyl group at the C8 position distinguishes type A and type B. Growth defect by another type A trichothecene diacetoxyscirpenol (DAS), was weakly enhanced in the atnfxl1 mutant. Diacetoxyscirpenol is distinguishable from T-2 toxin only by the absence of an isovaleryl group at the C8 position. Correspondingly, the AtNFXL1 promoter activity was apparently induced in T-2 toxin-treated and DAS-treated plants. In contrast, DON failed to induce the AtNFXL1 promoter activity. Consequently, the AtNFXL1 gene functions as a signaling component of the type A trichothecene-dependent response in Arabidopsis. In addition, the C8 position of trichothecenes might be closely related to the function of AtNFXL1 gene. PMID:19704430
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Imtiaz, Muhammad; Mushtaq, Muhammad Adnan; Nawaz, Muhammad Amjad; Ashraf, Muhammad; Rizwan, Muhammad Shahid; Mehmood, Sajid; Aziz, Omar; Rizwan, Muhammad; Virk, Muhammad Safiullah; Shakeel, Qaiser; Ijaz, Raina; Androutsopoulos, Vasilis P; Tsatsakis, Aristides M; Coleman, Michael D
2018-06-13
The present study aimed to elucidate the photosynthetic performance, antioxidant enzyme activities, anthocyanin contents, anthocyanin biosynthetic gene expression, and vanadium uptake in mustard genotypes (purple and green) that differ in photosynthetic capacity under vanadium stress. The results indicated that vanadium significantly reduced photosynthetic activity in both genotypes. The activities of the antioxidant enzymes were increased significantly in response to vanadium in both genotypes, although the purple exhibited higher. The anthocyanin contents were also reduced under vanadium stress. The anthocyanin biosynthetic genes were highly expressed in the purple genotype, notably the genes TT8, F3H, and MYBL2 under vanadium stress. The results indicate that induction of TT8, F3H, and MYBL2 genes was associated with upregulation of the biosynthetic genes required for higher anthocyanin biosynthesis in purple compared with the green mustard. The roots accumulated higher vanadium than shoots in both mustard genotypes. The results indicate that the purple mustard had higher vanadium tolerance. Copyright © 2018 Elsevier B.V. All rights reserved.
Ghosh Dasgupta, Modhumita; Dharanishanthi, Veeramuthu
2017-09-05
Ecophysiological studies in Eucalyptus have shown that water is the principal factor limiting stem growth. Effect of water deficit conditions on physiological and biochemical parameters has been extensively reported in Eucalyptus. The present study was conducted to identify major polyethylene glycol induced water stress responsive transcripts in Eucalyptus grandis using gene co-expression network. A customized array representing 3359 water stress responsive genes was designed to document their expression in leaves of E. grandis cuttings subjected to -0.225MPa of PEG treatment. The differentially expressed transcripts were documented and significantly co-expressed transcripts were used for construction of network. The co-expression network was constructed with 915 nodes and 3454 edges with degree ranging from 2 to 45. Ninety four GO categories and 117 functional pathways were identified in the network. MCODE analysis generated 27 modules and module 6 with 479 nodes and 1005 edges was identified as the biologically relevant network. The major water responsive transcripts represented in the module included dehydrin, osmotin, LEA protein, expansin, arabinogalactans, heat shock proteins, major facilitator proteins, ARM repeat proteins, raffinose synthase, tonoplast intrinsic protein and transcription factors like DREB2A, ARF9, AGL24, UNE12, WLIM1 and MYB66, MYB70, MYB 55, MYB 16 and MYB 103. The coordinated analysis of gene expression patterns and coexpression networks developed in this study identified an array of transcripts that may regulate PEG induced water stress responses in E. grandis. Copyright © 2017 Elsevier B.V. All rights reserved.
Radiation-induced genomic instability: radiation quality and dose response
NASA Technical Reports Server (NTRS)
Smith, Leslie E.; Nagar, Shruti; Kim, Grace J.; Morgan, William F.
2003-01-01
Genomic instability is a term used to describe a phenomenon that results in the accumulation of multiple changes required to convert a stable genome of a normal cell to an unstable genome characteristic of a tumor. There has been considerable recent debate concerning the importance of genomic instability in human cancer and its temporal occurrence in the carcinogenic process. Radiation is capable of inducing genomic instability in mammalian cells and instability is thought to be the driving force responsible for radiation carcinogenesis. Genomic instability is characterized by a large collection of diverse endpoints that include large-scale chromosomal rearrangements and aberrations, amplification of genetic material, aneuploidy, micronucleus formation, microsatellite instability, and gene mutation. The capacity of radiation to induce genomic instability depends to a large extent on radiation quality or linear energy transfer (LET) and dose. There appears to be a low dose threshold effect with low LET, beyond which no additional genomic instability is induced. Low doses of both high and low LET radiation are capable of inducing this phenomenon. This report reviews data concerning dose rate effects of high and low LET radiation and their capacity to induce genomic instability assayed by chromosomal aberrations, delayed lethal mutations, micronuclei and apoptosis.
Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A
2004-12-01
The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid
Virus-induced gene silencing (VIGS) in barley seedling leaves
USDA-ARS?s Scientific Manuscript database
Virus-induced gene silencing (VIGS) is one of the most potent reverse genetics technologies for gene functional characterization. This method exploits a dsRNA-mediated antiviral defense mechanism in plants. Using this method allows researchers to generate rapid phenotypic data in a relatively rapid ...
He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui
2017-07-03
Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.
Marcolino-Gomes, Juliana; Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Nakayama, Thiago Jonas; Ribeiro Reis, Rafaela; Bouças Farias, Jose Renato; Harmon, Frank G; Correa Molinari, Hugo Bruno; Correa Molinari, Mayla Daiane; Nepomuceno, Alexandre
2015-01-01
The soybean transcriptome displays strong variation along the day in optimal growth conditions and also in response to adverse circumstances, like drought stress. However, no study conducted to date has presented suitable reference genes, with stable expression along the day, for relative gene expression quantification in combined studies on drought stress and diurnal oscillations. Recently, water deficit responses have been associated with circadian clock oscillations at the transcription level, revealing the existence of hitherto unknown processes and increasing the demand for studies on plant responses to drought stress and its oscillation during the day. We performed data mining from a transcriptome-wide background using microarrays and RNA-seq databases to select an unpublished set of candidate reference genes, specifically chosen for the normalization of gene expression in studies on soybean under both drought stress and diurnal oscillations. Experimental validation and stability analysis in soybean plants submitted to drought stress and sampled during a 24 h timecourse showed that four of these newer reference genes (FYVE, NUDIX, Golgin-84 and CYST) indeed exhibited greater expression stability than the conventionally used housekeeping genes (ELF1-β and β-actin) under these conditions. We also demonstrated the effect of using reference candidate genes with different stability values to normalize the relative expression data from a drought-inducible soybean gene (DREB5) evaluated in different periods of the day.
Zhou, Bang-Jun; Jia, Pei-Song; Gao, Feng; Guo, Hui-Shan
2012-07-01
Verticillium dahliae Kleb. is a hemibiotrophic, phytopathogenic fungus that causes wilt disease in a wide range of crops, including cotton. Successful host colonization by hemibiotrophic pathogens requires the induction of plant cell death to provide the saprophytic nutrition for the transition from the biotrophic to the necrotrophic stage. In this study, we identified a necrosis-inducing Phytophthora protein (NPP1) domain-containing protein family containing nine genes in a virulent, defoliating isolate of V. dahliae (V592), named the VdNLP genes. Functional analysis demonstrated that only two of these VdNLP genes, VdNLP1 and VdNLP2, encoded proteins that were capable of inducing necrotic lesions and triggering defense responses in Nicotiana benthamiana, Arabidopsis, and cotton plants. Both VdNLP1 and VdNLP2 induced the wilting of cotton seedling cotyledons. However, gene-deletion mutants targeted by VdNLP1, VdNLP2, or both did not affect the pathogenicity of V. dahliae V592 in cotton infection. Similar expression and induction patterns were found for seven of the nine VdNLP transcripts. Through a comparison of the conserved amino acid residues of VdNLP with different necrosis-inducing activities, combined with mutagenesis-based analyses, we identified several novel conserved amino acid residues, in addition to the known conserved heptapeptide GHRHDWE motif and the cysteine residues of the NPP domain-containing protein, that are indispensable for the necrosis-inducing activity of the VdNLP2 protein.
Systemic Analysis of Heat Shock Response Induced by Heat Shock and a Proteasome Inhibitor MG132
Kim, Hee-Jung; Joo, Hye Joon; Kim, Yung Hee; Ahn, Soyeon; Chang, Jun; Hwang, Kyu-Baek; Lee, Dong-Hee; Lee, Kong-Joo
2011-01-01
The molecular basis of heat shock response (HSR), a cellular defense mechanism against various stresses, is not well understood. In this, the first comprehensive analysis of gene expression changes in response to heat shock and MG132 (a proteasome inhibitor), both of which are known to induce heat shock proteins (Hsps), we compared the responses of normal mouse fibrosarcoma cell line, RIF- 1, and its thermotolerant variant cell line, TR-RIF-1 (TR), to the two stresses. The cellular responses we examined included Hsp expressions, cell viability, total protein synthesis patterns, and accumulation of poly-ubiquitinated proteins. We also compared the mRNA expression profiles and kinetics, in the two cell lines exposed to the two stresses, using microarray analysis. In contrast to RIF-1 cells, TR cells resist heat shock caused changes in cell viability and whole-cell protein synthesis. The patterns of total cellular protein synthesis and accumulation of poly-ubiquitinated proteins in the two cell lines were distinct, depending on the stress and the cell line. Microarray analysis revealed that the gene expression pattern of TR cells was faster and more transient than that of RIF-1 cells, in response to heat shock, while both RIF-1 and TR cells showed similar kinetics of mRNA expression in response to MG132. We also found that 2,208 genes were up-regulated more than 2 fold and could sort them into three groups: 1) genes regulated by both heat shock and MG132, (e.g. chaperones); 2) those regulated only by heat shock (e.g. DNA binding proteins including histones); and 3) those regulated only by MG132 (e.g. innate immunity and defense related molecules). This study shows that heat shock and MG132 share some aspects of HSR signaling pathway, at the same time, inducing distinct stress response signaling pathways, triggered by distinct abnormal proteins. PMID:21738571
Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)
Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.
2002-01-01
Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.
Ezrin Inhibition Up-regulates Stress Response Gene Expression.
Çelik, Haydar; Bulut, Gülay; Han, Jenny; Graham, Garrett T; Minas, Tsion Z; Conn, Erin J; Hong, Sung-Hyeok; Pauly, Gary T; Hayran, Mutlu; Li, Xin; Özdemirli, Metin; Ayhan, Ayşe; Rudek, Michelle A; Toretsky, Jeffrey A; Üren, Aykut
2016-06-17
Ezrin is a member of the ERM (ezrin/radixin/moesin) family of proteins that links cortical cytoskeleton to the plasma membrane. High expression of ezrin correlates with poor prognosis and metastasis in osteosarcoma. In this study, to uncover specific cellular responses evoked by ezrin inhibition that can be used as a specific pharmacodynamic marker(s), we profiled global gene expression in osteosarcoma cells after treatment with small molecule ezrin inhibitors, NSC305787 and NSC668394. We identified and validated several up-regulated integrated stress response genes including PTGS2, ATF3, DDIT3, DDIT4, TRIB3, and ATF4 as novel ezrin-regulated transcripts. Analysis of transcriptional response in skin and peripheral blood mononuclear cells from NSC305787-treated mice compared with a control group revealed that, among those genes, the stress gene DDIT4/REDD1 may be used as a surrogate pharmacodynamic marker of ezrin inhibitor compound activity. In addition, we validated the anti-metastatic effects of NSC305787 in reducing the incidence of lung metastasis in a genetically engineered mouse model of osteosarcoma and evaluated the pharmacokinetics of NSC305787 and NSC668394 in mice. In conclusion, our findings suggest that cytoplasmic ezrin, previously considered a dormant and inactive protein, has important functions in regulating gene expression that may result in down-regulation of stress response genes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
2010-01-01
Background Epidemiological evidence supports the association between exposure to ambient particulate matter (PM) and cardiovascular diseases. Chronic exposure to ultrafine particles (UFP; Dp <100 nm) is reported to promote atherosclerosis in ApoE knockout mice. Atherogenesis-prone factors induce endothelial dysfunction that contributes to the initiation and progression of atherosclerosis. We previously demonstrated that UFP induced oxidative stress via c-Jun N-terminal Kinases (JNK) activation in endothelial cells. In this study, we investigated pro-inflammatory responses of human aortic endothelial cells (HAEC) exposed to UFP emitted from a diesel truck under an idling mode (UFP1) and an urban dynamometer driving schedule (UFP2), respectively. We hypothesize that UFP1 and UFP2 with distinct chemical compositions induce differential pro-inflammatory responses in endothelial cells. Results UFP2 contained a higher level of redox active organic compounds and metals on a per PM mass basis than UFP1. While both UFP1 and UFP2 induced superoxide production and up-regulated stress response genes such as heme oxygenease-1 (HO-1), OKL38, and tissue factor (TF), only UFP2 induced the expression of pro-inflammatory genes such as IL-8 (2.8 ± 0.3-fold), MCP-1 (3.9 ± 0.4-fold), and VCAM (6.5 ± 1.1-fold) (n = 3, P < 0.05). UFP2-exposed HAEC also bound to a higher number of monocytes than UFP1-exposed HAEC (Control = 70 ± 7.5, UFP1 = 106.7 ± 12.5, UFP2 = 137.0 ± 8.0, n = 3, P < 0.05). Adenovirus NF-κB Luciferase reporter assays revealed that UFP2, but not UFP1, significantly induced NF-κB activities. NF-κB inhibitor, CAY10512, significantly abrogated UFP2-induced pro-inflammatory gene expression and monocyte binding. Conclusion While UFP1 induced higher level of oxidative stress and stress response gene expression, only UFP2, with higher levels of redox active organic compounds and metals, induced pro-inflammatory responses via NF-κB signaling. Thus, UFP with distinct
Waelput, W; Verhee, A; Broekaert, D; Eyckerman, S; Vandekerckhove, J; Beattie, J H; Tavernier, J
2000-05-15
Using PC12 cells as an in vitro model system, we have identified a series of transcripts induced through activation of the leptin receptor. On the basis of kinetic studies, two distinct gene sets could be discerned: signal transducer and activator of transciption-3 (STAT-3), suppressor of cytokine signalling-3 (SOCS-3), MT-II (metallothionein-II), the serine/threonine kinase fibroblast-growth-factor-inducible kinase (Fnk) and modulator recognition factor (MRF-1), which are immediate early response genes, and pancreatitis-associated protein I (PAP I), squalene epoxidase, uridine diphosphate glucuronosyltransferase and annexin VIII, which are late induced target genes. At late time points a strong co-stimulation with beta-nerve growth factor or with the adenylate cyclase activator forskolin was observed. To assess the validity of the PC12-cell model system, we examined the effect of leptin administration on the gene transcription of STAT-3, MT-II, Fnk and PAP I in vivo. Leptin treatment of leptin-deficient ob/ob mice increased the STAT-3, SOCS-3, MT-II and Fnk mRNA, and MT-I protein levels in liver, whereas, in jejunum, expression of PAP I mRNA was down-regulated. Furthermore, administration of leptin to starved wild-type mice enhanced the expression of MT-II and Fnk mRNA in liver, but decreased MT-II and PAP I mRNA expression in jejunum. These findings may help to explain the obese phenotype observed in some colonies of MT-I- and MT-II-null mice and/or the observation that leptin protects against tumour-necrosis-factor toxicity in vivo.
Hanning, Jennifer E; Saini, Harpreet K; Murray, Matthew J; Caffarel, Maria M; van Dongen, Stijn; Ward, Dawn; Barker, Emily M; Scarpini, Cinzia G; Groves, Ian J; Stanley, Margaret A; Enright, Anton J; Pett, Mark R; Coleman, Nicholas
2013-11-01
In cervical carcinomas, high-risk human papillomavirus (HR-HPV) may be integrated into host chromosomes or remain extra-chromosomal (episomal). We used the W12 cervical keratinocyte model to investigate the effects of HPV16 early gene depletion on in vitro cervical carcinogenesis pathways, particularly effects shared by cells with episomal versus integrated HPV16 DNA. Importantly, we were able to study the specific cellular consequences of viral gene depletion by using short interfering RNAs known not to cause phenotypic or transcriptional off-target effects in keratinocytes. We found that while cervical neoplastic progression in vitro was characterized by dynamic changes in HPV16 transcript levels, viral early gene expression was required for cell survival at all stages of carcinogenesis, regardless of viral physical state, levels of early gene expression or histology in organotypic tissue culture. Moreover, HPV16 early gene depletion induced changes in host gene expression that were common to both episome-containing and integrant-containing cells. In particular, we observed up-regulation of autophagy genes, associated with enrichment of senescence and innate immune-response pathways, including the senescence-associated secretory phenotype (SASP). In keeping with these observations, HPV16 early gene depletion induced autophagy in both episome-containing and integrant-containing W12 cells, as evidenced by the appearance of autophagosomes, punctate expression of the autophagy marker LC3, conversion of LC3B-I to LC3B-II, and reduced levels of the autophagy substrate p62. Consistent with the reported association between autophagy and senescence pathways, HPV16 early gene depletion induced expression of the senescence marker beta-galactosidase and increased secretion of the SASP-related protein IGFBP3. Together, these data indicate that depleting HR-HPV early genes would be of potential therapeutic benefit in all cervical carcinogenesis pathways, regardless of viral
Response of Saccharomyces cerevisiae to D-limonene-induced oxidative stress.
Liu, Jidong; Zhu, Yibo; Du, Guocheng; Zhou, Jingwen; Chen, Jian
2013-07-01
In the present study, we investigated the mode of cell response induced by D-limonene in Saccharomyces cerevisiae. D-limonene treatment was found to be accompanied by intracellular accumulation of reactive oxygen species (ROS). Since ROS impair cell membranes, an engineered strain with enhanced membrane biosynthesis exhibited a higher tolerance to D-limonene. Subsequent addition of an ROS scavenger significantly reduced the ROS level and alleviated cell growth inhibition. Thus, D-limonene-induced ROS accumulation plays an important role in cell death in S. cerevisiae. In D-limonene-treated S. cerevisiae strains, higher levels of antioxidants, antioxidant enzymes, and nicotinamide adenine dinucleotide phosphate (NADPH) were synthesized. Quantitative real-time PCR results also verified that D-limonene treatment triggered upregulation of genes involved in the antioxidant system and the regeneration of NADPH at the transcription level in S. cerevisiae. These data indicate that D-limonene treatment results in intracellular ROS accumulation, an important factor in cell death, and several antioxidant mechanisms in S. cerevisiae were enhanced in response to D-limonene treatment.
Park, Sujin; Yang, Kyung-Min; Park, Yuna; Hong, Eunji; Hong, Chang Pyo; Park, Jinah; Pang, Kyoungwha; Lee, Jihee; Park, Bora; Lee, Siyoung; An, Haein; Kwak, Mi-Kyung; Kim, Junil; Kang, Jin Muk; Kim, Pyunggang; Xiao, Yang; Nie, Guangjun; Ooshima, Akira; Kim, Seong-Jin
2018-03-01
Smad3 linker phosphorylation plays essential roles in tumor progression and metastasis. We have previously reported that the mutation of Smad3 linker phosphorylation sites (Smad3-Erk/Pro-directed kinase site mutant constructs [EPSM]) markedly reduced the tumor progression while increasing the lung metastasis in breast cancer. We performed high-throughput RNA-Sequencing of the human prostate cancer cell lines infected with adenoviral Smad3-EPSM to identify the genes regulated by Smad3-EPSM. In this study, we identified genes which are differentially regulated in the presence of Smad3-EPSM. We first confirmed that Smad3-EPSM strongly enhanced a capability of cell motility and invasiveness as well as the expression of epithelial-mesenchymal transition marker genes, CDH2 , SNAI1 , and ZEB1 in response to TGF-β1 in human pancreatic and prostate cancer cell lines. We identified GADD45B , CTGF , and JUNB genes in the expression profiles associated with cell motility and invasiveness induced by the Smad3-EPSM. These results suggested that inhibition of Smad3 linker phosphorylation may enhance cell motility and invasiveness by inducing expression of GADD45B , CTGF , and JUNB genes in various cancers.
Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong
2017-09-26
Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.
Zhang, Xiaoxuan; Wang, Guangji; Gurley, Emily C.; Zhou, Huiping
2014-01-01
Background Apigenin is a non-toxic natural flavonoid that is abundantly present in common fruits and vegetables. It has been reported that apigenin has various beneficial health effects such as anti-inflammation and chemoprevention. Multiple studies have shown that inflammation is an important risk factor for atherosclerosis, diabetes, sepsis, various liver diseases, and other metabolic diseases. Although it has been long realized that apigenin has anti-inflammatory activities, the underlying functional mechanisms are still not fully understood. Methodology and Principal Findings In the present study, we examined the effect of apigenin on LPS-induced inflammatory response and further elucidated the potential underlying mechanisms in human THP-1-induced macrophages and mouse J774A.1 macrophages. By using the PrimePCR array, we were able to identify the major target genes regulated by apigenin in LPS-mediated immune response. The results indicated that apigenin significantly inhibited LPS-induced production of pro-inflammatory cytokines, such as IL-6, IL-1β, and TNF-α through modulating multiple intracellular signaling pathways in macrophages. Apigenin inhibited LPS-induced IL-1β production by inhibiting caspase-1 activation through the disruption of the NLRP3 inflammasome assembly. Apigenin also prevented LPS-induced IL-6 and IL-1β production by reducing the mRNA stability via inhibiting ERK1/2 activation. In addition, apigenin significantly inhibited TNF-α and IL-1β-induced activation of NF-κB. Conclusion and Significance Apigenin Inhibits LPS-induced Inflammatory Response through multiple mechanisms in macrophages. These results provided important scientific evidences for the potential application of apigenin as a therapeutic agent for inflammatory diseases. PMID:25192391
Adebambo, Oluwadamilare A.; Ray, Paul D.; Shea, Damian; Fry, Rebecca C.
2016-01-01
Exposure to elevated levels of the toxic metals inorganic arsenic (iAs) and cadmium (Cd) represents a major global health problem. These metals often occur as mixtures in the environment, creating the potential for interactive or synergistic biological effects different from those observed in single exposure conditions. In the present study, environmental mixtures collected from two waste sites in China and comparable mixtures prepared in the laboratory were tested for toxicogenomic response in placental JEG-3 cells. These cells serve as a model for evaluating cellular responses to exposures during pregnancy. One of the mixtures was predominated by iAs and one by Cd. Six gene biomarkers were measured in order to evaluate the effects from the metals mixtures using dose and time-course experiments including: heme oxygenase 1 (HO-1) and metallothionein isoforms (MT1A, MT1F and MT1G) previously shown to be preferentially induced by exposure to either iAs or Cd, and metal transporter genes aquaporin-9 (AQP9) and ATPase, Cu2+ transporting, beta polypeptide (ATP7B). There was a significant increase in the mRNA expression levels of ATP7B, HO-1, MT1A, MT1F, and MT1G in mixture-treated cells compared to the iAs or Cd only-treated cells. Notably, the genomic responses were observed at concentrations significantly lower than levels found at the environmental collection sites. These data demonstrate that metal mixtures increase the expression of gene biomarkers in placental JEG-3 cells in a synergistic manner. Taken together, the data suggest that toxic metals that co-occur may induce detrimental health effects that are currently underestimated when analyzed as single metals. PMID:26472158
Liu, Lin; Yang, DongFeng; Liang, TongYao; Zhang, HaiHua; He, ZhiGui; Liang, ZongSuo
2016-09-01
Phosphate starvation increased the production of phenolic acids by inducing the key enzyme genes in a positive feedback pathway in Saliva miltiorrhiza hairy roots. SPX may be involved in this process. Salvia miltiorrhiza is a wildly popular traditional Chinese medicine used for the treatment of coronary heart diseases and inflammation. Phosphate is an essential plant macronutrient that is often deficient, thereby limiting crop yield. In this study, we investigated the effects of phosphate concentration on the biomass and accumulation of phenolic acid in S. miltiorrhiza. Results show that 0.124 mM phosphate was favorable for plant growth. Moreover, 0.0124 mM phosphate was beneficial for the accumulation of phenolic acids, wherein the contents of danshensu, caffeic acid, rosmarinic acid, and salvianolic acid B were, respectively, 2.33-, 1.02-, 1.68-, and 2.17-fold higher than that of the control. By contrast, 12.4 mM phosphate inhibited the accumulation of phenolic acids. The key enzyme genes in the phenolic acid biosynthesis pathway were investigated to elucidate the mechanism of phosphate starvation-induced increase of phenolic acids. The results suggest that phosphate starvation induced the gene expression from the downstream pathway to the upstream pathway, i.e., a feedback phenomenon. In addition, phosphate starvation response gene SPX (SYG1, Pho81, and XPR1) was promoted by phosphate deficiency (0.0124 mM). We inferred that SPX responded to phosphate starvation, which then affected the expression of later responsive key enzyme genes in phenolic acid biosynthesis, resulting in the accumulation of phenolic acids. Our findings provide a resource-saving and environmental protection strategy to increase the yield of active substance in herbal preparations. The relationship between SPX and key enzyme genes and the role they play in phenolic acid biosynthesis during phosphate deficiency need further studies.
Woo, Seon Min; Min, Kyoung-Jin; Kim, Shin; Park, Jong-Wook; Kim, Dong Eun; Chun, Kyung-Soo; Kim, Young Ho; Lee, Tae-Jin; Kim, Sang Hyun; Choi, Yung Hyun; Chang, Jong-Soo; Kwon, Taeg Kyu
2014-03-25
Silibinin, an effective anti-cancer and chemopreventive agent, has been shown to exert multiple effects on cancer cells, including inhibition of both cell proliferation and migration. However, the molecular mechanisms responsible for these effects are not fully understood. We observed that silibinin significantly induced the expression of the non-steroidal anti-inflammatory drug-activated gene-1 (NAG-1) in both p53 wild-type and p53-null cancer cell lines, suggesting that silibinin-induced NAG-1 up-regulation is p53-independent manner. Silibinin up-regulates early growth response-1 (EGR-1) expression. The ectopic expression of EGR-1 significantly increased NAG-1 promoter activity and NAG-1 protein expression in a dose-dependent manner. Furthermore, down-regulation of EGR-1 expression using siRNA markedly reduced silibinin-mediated NAG-1 expression, suggesting that the expression of EGR-1 is critical for silibinin-induced NAG-1 expression. We also observed that reactive oxygen species (ROS) are generated by silibinin; however, ROS did not affect silibinin-induced NAG-1 expression and apoptosis. In addition, we demonstrated that the mitogen-activated protein kinase (MAP kinase) signal transduction pathway is involved in silibinin-induced NAG-1 expression. Inhibitors of p38 MAP kinase (SB203580) attenuated silibinin-induced NAG-1 expression. Furthermore, we found that siRNA-mediated knockdown of NAG-1 attenuated silibinin-induced apoptosis. Collectively, the results of this study demonstrate for the first time that up-regulation of NAG-1 contributes to silibinin-induced apoptosis in cancer cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Molecular mechanism of emotional stress-induced and catecholamine-induced heart attack.
Ueyama, Takashi; Senba, Emiko; Kasamatsu, Ken; Hano, Takuzo; Yamamoto, Katsuhiro; Nishio, Ichiro; Tsuruo, Yoshihiro; Yoshida, Ken-ichi
2003-01-01
Emotional or physical stress triggers 'tako-tsubo' cardiomyopathy or 'transient left ventricular apical ballooning', but the pathogenesis is unclear. In response to the immobilization stress of rats, a useful model of emotional stress, rapid activation of p44/p42 mitogen-activated protein kinase was observed in the heart, followed by a transient upregulation of immediate early genes in the smooth muscle cells of coronary arteries, the endothelial cells and the myocardium. Heat shock protein 70 was induced in the aortic and coronary arterial smooth muscle cells and in the myocardium. Natriuretic peptide genes were also upregulated in the myocardium. Sequential gene expression can be considered as an adaptive response to emotional stress. Blocking of both alpha-adrenoceptors and beta-adrenoceptors eliminated the upregulation of immediate early genes induced by stress, while alpha-agonists and beta-agonists upregulated immediate early genes in the perfused heart. Activation of alpha-adrenoceptors and beta-adrenoceptors is the primary trigger of emotional stress-induced molecular changes in the heart.
Dynamic regulation of VEGF-inducible genes by an ERK/ERG/p300 transcriptional network.
Fish, Jason E; Cantu Gutierrez, Manuel; Dang, Lan T; Khyzha, Nadiya; Chen, Zhiqi; Veitch, Shawn; Cheng, Henry S; Khor, Melvin; Antounians, Lina; Njock, Makon-Sébastien; Boudreau, Emilie; Herman, Alexander M; Rhyner, Alexander M; Ruiz, Oscar E; Eisenhoffer, George T; Medina-Rivera, Alejandra; Wilson, Michael D; Wythe, Joshua D
2017-07-01
The transcriptional pathways activated downstream of vascular endothelial growth factor (VEGF) signaling during angiogenesis remain incompletely characterized. By assessing the signals responsible for induction of the Notch ligand delta-like 4 (DLL4) in endothelial cells, we find that activation of the MAPK/ERK pathway mirrors the rapid and dynamic induction of DLL4 transcription and that this pathway is required for DLL4 expression. Furthermore, VEGF/ERK signaling induces phosphorylation and activation of the ETS transcription factor ERG, a prerequisite for DLL4 induction. Transcription of DLL4 coincides with dynamic ERG-dependent recruitment of the transcriptional co-activator p300. Genome-wide gene expression profiling identified a network of VEGF-responsive and ERG-dependent genes, and ERG chromatin immunoprecipitation (ChIP)-seq revealed the presence of conserved ERG-bound putative enhancer elements near these target genes. Functional experiments performed in vitro and in vivo confirm that this network of genes requires ERK, ERG and p300 activity. Finally, genome-editing and transgenic approaches demonstrate that a highly conserved ERG-bound enhancer located upstream of HLX (which encodes a transcription factor implicated in sprouting angiogenesis) is required for its VEGF-mediated induction. Collectively, these findings elucidate a novel transcriptional pathway contributing to VEGF-dependent angiogenesis. © 2017. Published by The Company of Biologists Ltd.
Lack of pathogenic mutations in SOS1 gene in phenytoin-induced gingival overgrowth patients.
Margiotti, Katia; Pascolini, Giulia; Consoli, Federica; Guida, Valentina; Di Bonaventura, Carlo; Giallonardo, Anna Teresa; Pizzuti, Antonio; De Luca, Alessandro
2017-08-01
Gingival overgrowth is a side effect associated with some distinct classes of drugs, such as anticonvulsants, immunosuppressants, and calcium channel blockers. One of the main drugs associated with gingival overgrowth is the antiepileptic phenytoin, which affects gingival tissues by altering extracellular matrix metabolism. It has been shown that mutation of human SOS1 gene is responsible for a rare hereditary gingival fibromatosis type 1, a benign gingival overgrowth. The aim of the present study is to evaluate the possible contribution of SOS1 mutation to gingival overgrowth-related phenotype. We selected and screened for mutations a group of 24 epileptic patients who experienced significant gingival overgrowth following phenytoin therapy. Mutation scanning was carried out by denaturing high-performance liquid chromatography analysis of the entire coding region of the SOS1 gene. Novel identified variants were analyzed in-silico by using Alamut Visual mutation interpretation software, and comparison with normal control group was done. Mutation scanning of the entire coding sequence of SOS1 gene identified seven intronic variants and one new exonic substitution (c.138G>A). The seven common intronic variants were not considered to be of pathogenic importance. The exonic substitution c.138G>A was found to be absent in 100 ethnically matched normal control chromosomes, but was not expected to have functional significance based on prediction bioinformatics tools. This study represents the first mutation analysis of the SOS1 gene in phenytoin-induced gingival overgrowth epileptic patients. Present results suggest that obvious pathogenic mutations in the SOS1 gene do not represent a common mechanism underlying phenytoin-induced gingival overgrowth in epileptic patients; other mechanisms are likely to be involved in the pathogenesis of this drug-induced phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.
Protective effects of L-selenomethionine on space radiation induced changes in gene expression.
Stewart, J; Ko, Y-H; Kennedy, A R
2007-06-01
Ionizing radiation can produce adverse biological effects in astronauts during space travel. Of particular concern are the types of radiation from highly energetic, heavy, charged particles known as HZE particles. The aims of our studies are to characterize HZE particle radiation induced biological effects and evaluate the effects of L-selenomethionine (SeM) on these adverse biological effects. In this study, microarray technology was used to measure HZE radiation induced changes in gene expression, as well as to evaluate modulation of these changes by SeM. Human thyroid epithelial cells (HTori-3) were irradiated (1 GeV/n iron ions) in the presence or in the absence of 5 microM SeM. At 6 h post-irradiation, all cells were harvested for RNA isolation. Gene Chip U133Av2 from Affymetrix was used for the analysis of gene expression, and ANOVA and EASE were used for a determination of the genes and biological processes whose differential expression is statistically significant. Results of this microarray study indicate that exposure to small doses of radiation from HZE particles, 10 and 20 cGy from iron ions, induces statistically significant differential expression of 196 and 610 genes, respectively. In the presence of SeM, differential expression of 77 out of 196 genes (exposure to 10 cGy) and 336 out of 610 genes (exposure to 20 cGy) is abolished. In the presence or in the absence of SeM, radiation from HZE particles induces differential expression of genes whose products have roles in the induction of G1/S arrest during the mitotic cell cycle, as well as heat shock proteins. Some of the genes, whose expressions were affected by radiation from HZE particles and were unchanged in irradiated cells treated with SeM, have been shown to have altered expression levels in cancer cells. The conclusions of this report are that radiation from HZE particles can induce differential expression of many genes, some of which are known to play roles in the same processes that have
Yu, Zhanjiang; Yang, Xiaoda; Wang, Kui
2006-06-01
The aim of this work is to define the relationship between heat shock protein (HSP) and reactive oxygen species (ROS) in the cells exposed to different concentrations of metal ions, and to evaluate a new method for tracing the dynamic levels of cellular reactive oxygen species using a HSE-SEAP reporter gene. The expression of heat shock protein was measured using a secreted alkaline phosphatase (SEAP) reporter gene transformed into HeLa cell strain, the levels of superoxide anion (O(2)(-)) and hydrogen peroxide (H(2)O(2)) were determined by NBT reduction assay and DCFH staining flow cytometry (FCM), respectively. The experimental results demonstrated that the expression of heat shock protein induced by metal ions was linearly related to the cellular superoxide anion level before cytotoxic effects were observed, but not related to the cellular hydrogen peroxide level. The experimental results suggested that metal ions might induce heat shock protein by elevating cellular superoxide anion level, and thus the expression of heat shock protein indicated by the HSE-SEAP reporter gene can be an effective model for monitoring the dynamic level of superoxide anion and early metal-induced oxidative stress/cytotoxicity.
Gene expression responses of HeLa cells to chemical species generated by an atmospheric plasma flow
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokoyama, Mayo, E-mail: yokoyama@plasma.ifs.tohoku.ac.jp; Johkura, Kohei, E-mail: kohei@shinshu-u.ac.jp; Sato, Takehiko, E-mail: sato@ifs.tohoku.ac.jp
2014-08-08
Highlights: • Response of HeLa cells to a plasma-irradiated medium was revealed by DNA microarray. • Gene expression pattern was basically different from that in a H{sub 2}O{sub 2}-added medium. • Prominently up-/down-regulated genes were partly shared by the two media. • Gene ontology analysis showed both similar and different responses in the two media. • Candidate genes involved in response to ROS were detected in each medium. - Abstract: Plasma irradiation generates many factors able to affect the cellular condition, and this feature has been studied for its application in the field of medicine. We previously reported that hydrogenmore » peroxide (H{sub 2}O{sub 2}) was the major cause of HeLa cell death among the chemical species generated by high level irradiation of a culture medium by atmospheric plasma. To assess the effect of plasma-induced factors on the response of live cells, HeLa cells were exposed to a medium irradiated by a non-lethal plasma flow level, and their gene expression was broadly analyzed by DNA microarray in comparison with that in a corresponding concentration of 51 μM H{sub 2}O{sub 2}. As a result, though the cell viability was sufficiently maintained at more than 90% in both cases, the plasma-medium had a greater impact on it than the H{sub 2}O{sub 2}-medium. Hierarchical clustering analysis revealed fundamentally different cellular responses between these two media. A larger population of genes was upregulated in the plasma-medium, whereas genes were downregulated in the H{sub 2}O{sub 2}-medium. However, a part of the genes that showed prominent differential expression was shared by them, including an immediate early gene ID2. In gene ontology analysis of upregulated genes, the plasma-medium showed more diverse ontologies than the H{sub 2}O{sub 2}-medium, whereas ontologies such as “response to stimulus” were common, and several genes corresponded to “response to reactive oxygen species.” Genes of AP-1 proteins, e
Glennon, Nicole B.; Jabado, Omar; Lo, Michael K.
2015-01-01
ABSTRACT Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. IMPORTANCE Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral
Glennon, Nicole B; Jabado, Omar; Lo, Michael K; Shaw, Megan L
2015-08-01
Bats are important reservoirs for several viruses, many of which cause lethal infections in humans but have reduced pathogenicity in bats. As the innate immune response is critical for controlling viruses, the nature of this response in bats and how it may differ from that in other mammals are of great interest. Using next-generation transcriptome sequencing (mRNA-seq), we profiled the transcriptional response of Pteropus vampyrus bat kidney (PVK) cells to Newcastle disease virus (NDV), an avian paramyxovirus known to elicit a strong innate immune response in mammalian cells. The Pteropus genus is a known reservoir of Nipah virus (NiV) and Hendra virus (HeV). Analysis of the 200 to 300 regulated genes showed that genes for interferon (IFN) and antiviral pathways are highly upregulated in NDV-infected PVK cells, including genes for beta IFN, RIG-I, MDA5, ISG15, and IRF1. NDV-infected cells also upregulated several genes not previously characterized to be antiviral, such as RND1, SERTAD1, CHAC1, and MORC3. In fact, we show that MORC3 is induced by both IFN and NDV infection in PVK cells but is not induced by either stimulus in human A549 cells. In contrast to NDV infection, HeV and NiV infection of PVK cells failed to induce these innate immune response genes. Likewise, an attenuated response was observed in PVK cells infected with recombinant NDVs expressing the NiV IFN antagonist proteins V and W. This study provides the first global profile of a robust virus-induced innate immune response in bats and indicates that henipavirus IFN antagonist mechanisms are likely active in bat cells. Bats are the reservoir host for many highly pathogenic human viruses, including henipaviruses, lyssaviruses, severe acute respiratory syndrome coronavirus, and filoviruses, and many other viruses have also been isolated from bats. Viral infections are reportedly asymptomatic or heavily attenuated in bat populations. Despite their ecological importance to viral maintenance, research
Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya
2015-12-01
Unfolded protein response (UPR) is an intracellular signaling pathway for adaptation to endoplasmic reticulum (ER) stress. In yeast UPR, Ire1 cleaves the unconventional intron of HAC1 mRNA, and the functional Hac1 protein translated from the spliced HAC1 mRNA induces the expression of ER chaperone genes and ER-associated degradation genes for the refolding or degradation of unfolded proteins. In this study, we constructed an ireA (IRE1 ortholog) conditionally expressing strain of Aspergillus oryzae, a filamentous fungus producing a large amount of amylolytic enzymes, and examined the contribution of UPR to ER stress adaptation under physiological conditions. Repression of ireA completely blocked A. oryzae growth under conditions inducing the production of hydrolytic enzymes, such as amylases and proteases. This growth defect was restored by the introduction of unconventional intronless hacA (hacA-i). Furthermore, UPR was observed to be induced by amylolytic gene expression, and the disruption of the transcriptional activator for amylolytic genes resulted in partial growth restoration of the ireA-repressing strain. In addition, a homokaryotic ireA disruption mutant was successfully generated using the strain harboring hacA-i as a parental host. These results indicated that UPR is required for A. oryzae growth to alleviate ER stress induced by excessive production of hydrolytic enzymes. Copyright © 2015 Elsevier Inc. All rights reserved.
Rodriguez-Saona, Cesar R.; Polashock, James; Malo, Edi A.
2013-01-01
Jasmonates, i.e., jasmonic acid (JA) and methyl jasmonate (MeJA), are signaling hormones that regulate a large number of defense responses in plants which in turn affect the plants’ interactions with herbivores and their natural enemies. Here, we investigated the effect of jasmonates on the emission of volatiles in the American cranberry, Vaccinium macrocarpon, at different levels of biological organization from gene expression to organismal interactions. At the molecular level, four genes (BCS, LLS, NER1, and TPS21) responded significantly to gypsy moth larval feeding, MeJA, and mechanical wounding, but to different degrees. The most dramatic changes in expression of BCS and TPS21 (genes in the sesquiterpenoid pathway) were when treated with MeJA. Gypsy moth-damaged and MeJA-treated plants also had significantly elevated expression of LLS and NER1 (genes in the monoterpene and homoterpene biosynthesis pathways, respectively). At the biochemical level, MeJA induced a complex blend of monoterpene and sesquiterpene compounds that differed from gypsy moth and mechanical damage, and followed a diurnal pattern of emission. At the organismal level, numbers of Sparganothis sulfureana moths were lower while numbers of parasitic wasps were higher on sticky traps near MeJA-treated cranberry plants than those near untreated plants. Out of 11 leaf volatiles tested, (Z)-3-hexenyl acetate, linalool, and linalool oxide elicited strong antennal (EAG) responses from S. sulfureana, whereas sesquiterpenes elicited weak EAG responses. In addition, mortality of S. sulfureana larvae increased by about 43% in JA treated cranberry plants as compared with untreated plants, indicating a relationship among adult preference, antennal sensitivity to plant odors, and offspring performance. This study highlights the role of the jasmonate-dependent defensive pathway in the emissions of herbivore-induced volatiles in cranberries and its importance in multi-trophic level interactions. PMID
Rodriguez-Saona, Cesar R; Polashock, James; Malo, Edi A
2013-01-01
Jasmonates, i.e., jasmonic acid (JA) and methyl jasmonate (MeJA), are signaling hormones that regulate a large number of defense responses in plants which in turn affect the plants' interactions with herbivores and their natural enemies. Here, we investigated the effect of jasmonates on the emission of volatiles in the American cranberry, Vaccinium macrocarpon, at different levels of biological organization from gene expression to organismal interactions. At the molecular level, four genes (BCS, LLS, NER1, and TPS21) responded significantly to gypsy moth larval feeding, MeJA, and mechanical wounding, but to different degrees. The most dramatic changes in expression of BCS and TPS21 (genes in the sesquiterpenoid pathway) were when treated with MeJA. Gypsy moth-damaged and MeJA-treated plants also had significantly elevated expression of LLS and NER1 (genes in the monoterpene and homoterpene biosynthesis pathways, respectively). At the biochemical level, MeJA induced a complex blend of monoterpene and sesquiterpene compounds that differed from gypsy moth and mechanical damage, and followed a diurnal pattern of emission. At the organismal level, numbers of Sparganothis sulfureana moths were lower while numbers of parasitic wasps were higher on sticky traps near MeJA-treated cranberry plants than those near untreated plants. Out of 11 leaf volatiles tested, (Z)-3-hexenyl acetate, linalool, and linalool oxide elicited strong antennal (EAG) responses from S. sulfureana, whereas sesquiterpenes elicited weak EAG responses. In addition, mortality of S. sulfureana larvae increased by about 43% in JA treated cranberry plants as compared with untreated plants, indicating a relationship among adult preference, antennal sensitivity to plant odors, and offspring performance. This study highlights the role of the jasmonate-dependent defensive pathway in the emissions of herbivore-induced volatiles in cranberries and its importance in multi-trophic level interactions.
Mann, Brandon A.; Huang, Julia He; Li, Ping; Chang, Hua-Chen; Slee, Roger B.; O'Sullivan, Audrey; Mathur, Anita; Yeh, Norman; Klemsz, Michael J.; Brutkiewicz, Randy R.; Blum, Janice S.
2008-01-01
Blocking the function of Stat (signal transducer and activator of transcription) proteins, which are critical for antiviral responses, has evolved as a common mechanism for pathogen immune evasion. The poxvirus-encoded phosphatase H1 is critical for viral replication, and may play an additional role in the evasion of host defense by dephosphorylating Stat1 and blocking interferon (IFN)-stimulated innate immune responses. Vaccinia virus (VACV) H1 can inhibit the phosphorylation of the transcription factor Stat1 after IFN-γ stimulation of epithelial cells, greatly attenuating IFN-induced biological functions. In this study, we demonstrate that VACV infection is capable of inhibiting the phosphorylation of Stat1 and Stat2 after stimulation of fibroblasts or bone marrow-derived macrophages with either type I or type II IFNs, but did not inhibit the activation of Stat3 or Stat5 in either cell type. By using recombinant proteins for in vitro assays, we observe that variola virus H1 is more active than VACV H1, although it has similar selectivity for Stat targets. Differential effects of VACV infection were observed on the induction of IFN-stimulated genes, with complete inhibition of some genes by VACV infection, while others were less affected. Despite the IFN-γ-induced expression of some genes in VACV-infected cells, IFN-γ was unable to rescue the VACV-mediated inhibition of MHC class II antigen presentation. Moreover, VACV infection can affect the IFN-induced expression of Stat1-dependent and Stat1-independent genes, suggesting that the virus may target additional IFN-activated pathways. Thus, VACV targets multiple signaling pathways in the evasion of antiviral immune responses. PMID:18593332
The Pea Photoperiod Response Gene STERILE NODES Is an Ortholog of LUX ARRHYTHMO1[W][OPEN
Liew, Lim Chee; Hecht, Valérie; Sussmilch, Frances C.; Weller, James L.
2014-01-01
The STERILE NODES (SN) locus in pea (Pisum sativum) was one of the first photoperiod response genes to be described and provided early evidence for the genetic control of long-distance signaling in flowering-time regulation. Lines homozygous for recessive sn mutations are early flowering and photoperiod insensitive, with an increased ability to promote flowering across a graft union in short-day conditions. Here, we show that SN controls developmental regulation of genes in the FT family and rhythmic regulation of genes related to circadian clock function. Using a positional and functional candidate approach, we identify SN as the pea ortholog of LUX ARRHYTHMO, a GARP transcription factor from Arabidopsis (Arabidopsis thaliana) with an important role in circadian clock function. In addition to induced mutants, sequence analysis demonstrates the presence of at least three other independent, naturally occurring loss-of-function mutations among known sn cultivars. Examination of genetic and regulatory interactions between SN and two other circadian clock genes, HIGH RESPONSE TO PHOTOPERIOD (HR) and DIE NEUTRALIS (DNE), suggests a complex relationship in which HR regulates expression of SN and the role of DNE and HR in control of flowering is dependent on SN. These results extend previous work to show that pea orthologs of all three Arabidopsis evening complex genes regulate clock function and photoperiod-responsive flowering and suggest that the function of these genes may be widely conserved. PMID:24706549
RNA splicing regulates the temporal order of TNF-induced gene expression.
Hao, Shengli; Baltimore, David
2013-07-16
When cells are induced to express inflammatory genes by treatment with TNF, the mRNAs for the induced genes appear in three distinct waves, defining gene groups I, II, and III, or early, intermediate, and late genes. To examine the basis for these different kinetic classes, we have developed a PCR-based procedure to distinguish pre-mRNAs from mRNAs. It shows that the three groups initiate transcription virtually simultaneously but that delays in splicing characterize groups II and III. We also examined the elongation times, concluding that pre-mRNA synthesis is coordinate but splicing differences directly regulate the timing of mRNA production.
In Vivo Imaging of Local Gene Expression Induced by Magnetic Hyperthermia
Sandre, Olivier; Genevois, Coralie; Garaio, Eneko; Adumeau, Laurent; Mornet, Stéphane; Couillaud, Franck
2017-01-01
The present work aims to demonstrate that colloidal dispersions of magnetic iron oxide nanoparticles stabilized with dextran macromolecules placed in an alternating magnetic field can not only produce heat, but also that these particles could be used in vivo for local and noninvasive deposition of a thermal dose sufficient to trigger thermo-induced gene expression. Iron oxide nanoparticles were first characterized in vitro on a bio-inspired setup, and then they were assayed in vivo using a transgenic mouse strain expressing the luciferase reporter gene under transcriptional control of a thermosensitive promoter. Iron oxide nanoparticles dispersions were applied topically on the mouse skin or injected subcutaneously with Matrigel™ to generate so-called pseudotumors. Temperature was monitored continuously with a feedback loop to control the power of the magnetic field generator and to avoid overheating. Thermo-induced luciferase expression was followed by bioluminescence imaging 6 h after heating. We showed that dextran-coated magnetic iron oxide nanoparticle dispersions were able to induce in vivo mild hyperthermia compatible with thermo-induced gene expression in surrounding tissues and without impairing cell viability. These data open new therapeutic perspectives for using mild magnetic hyperthermia as noninvasive modulation of tumor microenvironment by local thermo-induced gene expression or drug release. PMID:28208731
Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping
2006-01-01
To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karve, Abhijit A; Weston, David; Jawdy, Sara
2012-01-01
Shade avoidance signaling in higher plants involves perception of the incident red/far-red (R/FR) light by phytochromes and the modulation of downstream transcriptional networks to regulate developmental plasticity in relation to heterogeneous light environments. In this study, we characterized the expression and functional features of Populus phytochrome (PHY) gene family as well as the transcriptional responses of Populus to the changes in R/FR light. Expression data indicated that PHYA is the predominant PHY in the dark grown Populus seedling whereas PHYBs are most abundant in mature tissue types. Out of three Populus PHYs, PHYA is light labile and localized to cytosolmore » in dark whereas both PHYB1 and PHYB2 are light stable and are localized to nucleus in mesophyll protoplasts. When expressed in Arabidopsis, PHYB1 rescued Arabidopsis phyB mutant phenotype whereas PHYB2 did not, suggesting functional diversification between these two gene family members. However, phenotypes of transgenic Populus lines with altered expression of PHYB1, PHYB2 or both and the expression of candidate shade response genes in these transgenic lines suggest that PHYB1 and PHYB2 may have distinct yet overlapping functions. The RNAseq results and analysis of Populus exposed to enriched-FR light indicate that genes associated in cell wall modification and brassinosteroid signaling were induced under far red light. Overall our data indicate that Populus transcriptional responses are at least partially conserved with Arabidopsis.« less
Jung, In Jung; Hwang, Jung Eun; Han, Sung Min; Kim, Dong Sub; Ahn, Joon-Woo; Choi, Hong-Il; Kwon, Soon-Jae; Kang, Si-Yong; Kim, Jin-Baek
2017-07-01
Exposure to ionizing radiation induces plant defenses by regulating the expression of response genes. The systemic acquired resistance deficient 1 (SARD1) is a key gene in plant defense response. In this study, the function of Oryza sativa SARD1 (OsSARD1) was investigated after exposure of seeds/plants to ionizing radiation, jasmonic acid (JA) or salicylic acid (SA). Rice seeds exposed to two types of ionizing radiations (gamma ray [GR] and ion beam [IB]) were analyzed by quantitative reverse transcription PCR (qRT-PCR) to identify the genes that are altered in response to ionizing radiation. Then, OsSARD1-overexpressing homozygous Arabidopsis plants were generated to assess the effects of OsSARD1 in the response to irradiation. The phenotypes of these transgenic plants, as well as control plants, were monitored after GR irradiation at doses of 200 and 300 Gray (Gy). The OsSARD1 transcript was strongly downregulated after exposure to GR and IB irradiation. Previous phylogenetic analysis showed that the Arabidopsis SARD1 (AtSARD1) protein is closely related to Arabidopsis calmodulin-binding protein 60g (AtCBP60g), which is known to be required for activation of SA biosynthesis. In this study, phylogenetic analysis showed that OsSARD1 was grouped with AtSARD1. The OsSARD1 gene was induced after exposure to SA and JA. The biological phenotype of OsSARD1-overexpressing Arabidopsis plants was examined. OsSARD1-overexpressing plants displayed resistance to GR; in comparison with wild-type plants, the height and weight of OsSARD1-overexpressing plants were significantly greater after GR irradiation. In addition, OsSARD1 protein was abundantly accumulated in the nucleus. The results indicate that OsSARD1 plays an important role in the regulation of the defense responses to GR and IB irradiation and exhibits phytohormone induced expression.
Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart
2012-10-01
The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less
KERIS: kaleidoscope of gene responses to inflammation between species
Li, Peng; Tompkins, Ronald G; Xiao, Wenzhong
2017-01-01
A cornerstone of modern biomedical research is the use of animal models to study disease mechanisms and to develop new therapeutic approaches. In order to help the research community to better explore the similarities and differences of genomic response between human inflammatory diseases and murine models, we developed KERIS: kaleidoscope of gene responses to inflammation between species (available at http://www.igenomed.org/keris/). As of June 2016, KERIS includes comparisons of the genomic response of six human inflammatory diseases (burns, trauma, infection, sepsis, endotoxin and acute respiratory distress syndrome) and matched mouse models, using 2257 curated samples from the Inflammation and the Host Response to Injury Glue Grant studies and other representative studies in Gene Expression Omnibus. A researcher can browse, query, visualize and compare the response patterns of genes, pathways and functional modules across different diseases and corresponding murine models. The database is expected to help biologists choosing models when studying the mechanisms of particular genes and pathways in a disease and prioritizing the translation of findings from disease models into clinical studies. PMID:27789704
Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M
1993-01-01
The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.
Essop, M Faadiel; Razeghi, Peter; McLeod, Chris; Young, Martin E; Taegtmeyer, Heinrich; Sack, Michael N
2004-02-06
Mitochondrial uncoupling proteins 2 and 3 (UCP2 and UCP3) are postulated to contribute to antioxidant defense, nutrient partitioning, and energy efficiency in the heart. To distinguish isotype function in response to metabolic stress we measured cardiac mitochondrial function and cardiac UCP gene expression following chronic hypobaric hypoxia. Isolated mitochondrial O(2) consumption and ATP synthesis rate were reduced but respiratory coupling was unchanged compared to normoxic groups. Concurrently, left ventricular UCP3 mRNA levels were significantly decreased with hypoxia (p<0.05) while UCP2 levels remained unchanged versus controls. Diminished UCP3 expression was associated with coordinate regulation of counter-regulatory metabolic genes. From these data, we propose a role for UCP3 in the regulation of fatty acid oxidation in the heart as opposed to uncoupling of mitochondria. Moreover, the divergent hypoxia-induced regulation of UCP2 and UCP3 supports distinct mitochondrial regulatory functions of these inner mitochondrial membrane proteins in the heart in response to metabolic stress.
Nakashima, N; Tamura, T
2013-06-01
Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.
IKK{epsilon} modulates RSV-induced NF-{kappa}B-dependent gene transcription
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bao Xiaoyong; Indukuri, Hemalatha; Liu Tianshuang
2010-12-20
Respiratory syncytial virus (RSV), a negative-strand RNA virus, is the most common cause of epidemic respiratory disease in infants and young children. RSV infection of airway epithelial cells induces the expression of immune/inflammatory genes through the activation of a subset of transcription factors, including Nuclear Factor-{kappa}B (NF-{kappa}B). In this study we have investigated the role of the non canonical I{kappa}B kinase (IKK){epsilon} in modulating RSV-induced NF-{kappa}B activation. Our results show that inhibition of IKK{epsilon} activation results in significant impairment of viral-induced NF-{kappa}B-dependent gene expression, through a reduction in NF-{kappa}B transcriptional activity, without changes in nuclear translocation or DNA-binding activity. Absencemore » of IKK{epsilon} results in a significant decrease of RSV-induced NF-{kappa}B phosphorylation on serine 536, a post-translational modification important for RSV-induced NF-{kappa}B-dependent gene expression, known to regulate NF-{kappa}B transcriptional activity without affecting nuclear translocation. This study identifies a novel mechanism by which IKK{epsilon} regulates viral-induced cellular signaling.« less
Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F
2010-08-01
The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.
Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V
2017-12-28
expression of pathogenesis-related protein-encoding genes and genes involved in ROS production or related to cell wall biogenesis. Furthermore, we identified genes that were upregulated specifically in flax genotypes resistant to Fusarium wilt. We suggest that the identified genes in resistant cultivars and BC 2 F 5 populations showing induced expression in response to F. oxysporum infection are the most promising resistance gene candidates.
Transgenerational, Dynamic Methylation of Stomata Genes in Response to Low Relative Humidity
Tricker, Penny J.; Rodríguez López, Carlos M.; Gibbings, George; Hadley, Paul; Wilkinson, Mike J.
2013-01-01
Transgenerational inheritance of abiotic stress-induced epigenetic modifications in plants has potential adaptive significance and might condition the offspring to improve the response to the same stress, but this is at least partly dependent on the potency, penetrance and persistence of the transmitted epigenetic marks. We examined transgenerational inheritance of low Relative Humidity-induced DNA methylation for two gene loci in the stomatal developmental pathway in Arabidopsis thaliana and the abundance of associated short-interfering RNAs (siRNAs). Heritability of low humidity-induced methylation was more predictable and penetrative at one locus (SPEECHLESS, entropy ≤ 0.02; χ2 < 0.001) than the other (FAMA, entropy ≤ 0.17; χ2 ns). Methylation at SPEECHLESS correlated positively with the continued presence of local siRNAs (r2 = 0.87; p = 0.013) which, however, could be disrupted globally in the progeny under repeated stress. Transgenerational methylation and a parental low humidity-induced stomatal phenotype were heritable, but this was reversed in the progeny under repeated treatment in a previously unsuspected manner. PMID:23531533
Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.
2012-01-01
Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133
Drug-loaded nanoparticles induce gene expression in human pluripotent stem cell derivatives
NASA Astrophysics Data System (ADS)
Gajbhiye, Virendra; Escalante, Leah; Chen, Guojun; Laperle, Alex; Zheng, Qifeng; Steyer, Benjamin; Gong, Shaoqin; Saha, Krishanu
2013-12-01
Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained higher fibroblast proliferation levels and MMP activity. The results demonstrate that the PEG-H40-DXC nanoparticle system provides an effective tool to controlling gene expression in human stem cell derivatives.Tissue engineering and advanced manufacturing of human stem cells requires a suite of tools to control gene expression spatiotemporally in culture. Inducible gene expression systems offer cell-extrinsic control, typically through addition of small molecules, but small molecule inducers typically contain few functional groups for further chemical modification. Doxycycline (DXC), a potent small molecule inducer of tetracycline (Tet) transgene systems, was conjugated to a hyperbranched dendritic polymer (Boltorn H40) and subsequently reacted with polyethylene glycol (PEG). The resulting PEG-H40-DXC nanoparticle exhibited pH-sensitive drug release behavior and successfully controlled gene expression in stem-cell-derived fibroblasts with a Tet-On system. While free DXC inhibited fibroblast proliferation and matrix metalloproteinase (MMP) activity, PEG-H40-DXC nanoparticles maintained
Hypergravity-induced changes in gene expression in Arabidopsis hypocotyls
NASA Astrophysics Data System (ADS)
Yoshioka, R.; Soga, K.; Wakabayashi, K.; Takeba, G.; Hoson, T.
2003-05-01
Under hypergravity conditions, the cell wall of stem organs becomes mechanically rigid and elongation growth is suppressed, which can be recognized as the mechanism for plants to resist gravitational force. The changes in gene expression by hypergravity treatment were analyzed in Arabidopsis hypocotyls by the differential display method, for identifying genes involved in hypergravity-induced growth suppression. Sixty-two cDNA clones were expressed differentially between the control and 300 g conditions: the expression levels of 39 clones increased, whereas those of 23 clones decreased under hypergravity conditions. Sequence analysis and database searching revealed that 12 clones, 9 up-regulated and 3 down-regulated, have homology to known proteins. The expression of these genes was further analyzed using RT-PCR. Finally, six genes were confirmed to be up-regulated by hypergravity. One of such genes encoded 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGR), which catalyzes a reaction producing mevalonic acid, a key precursor ofterpenoids such as membrane sterols and several types of hormones. The expression of HMGR gene increased within several hours after hypergravity treatment. Also, compactin, an inhibitor of HMGR, prevented hypergravity-induced growth suppression, suggesting that HMGR is involved in suppression of Arabidopsis hypocotyl growth by hypergravity. In addition, hypergravity increased the expression levels of genes encoding CCR1 and ERD15, which were shown to take part in the signaling pathway of environmental stimuli such as temperature and water, and those of the α-tubulin gene. These genes may be involved in a series of cellular events leading to growth suppression of stem organs under hypergravity conditions.
2012-01-01
Background Thalidomide is an anti-inflammatory and anti-angiogenic drug currently used for the treatment of several diseases, including erythema nodosum leprosum, which occurs in patients with lepromatous leprosy. In this research, we use DNA microarray analysis to identify the impact of thalidomide on gene expression responses in human cells after lipopolysaccharide (LPS) stimulation. We employed a two-stage framework. Initially, we identified 1584 altered genes in response to LPS. Modulation of this set of genes was then analyzed in the LPS stimulated cells treated with thalidomide. Results We identified 64 genes with altered expression induced by thalidomide using the rank product method. In addition, the lists of up-regulated and down-regulated genes were investigated by means of bioinformatics functional analysis, which allowed for the identification of biological processes affected by thalidomide. Confirmatory analysis was done in five of the identified genes using real time PCR. Conclusions The results showed some genes that can further our understanding of the biological mechanisms in the action of thalidomide. Of the five genes evaluated with real time PCR, three were down regulated and two were up regulated confirming the initial results of the microarray analysis. PMID:22695124
NASA Astrophysics Data System (ADS)
Lu, Tao; Wu, Honglu; Karouia, Fathi; Stodieck, Louis; Zhang, Ye; Wong, Michael
2016-07-01
Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 mg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by focus pattern and focus number counting of phosphorylated histone protein H2AX (γg-H2AX). The cells on the ISS showed modestly increased average focus counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profiles of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in γg-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not
Empuku, Shinichiro; Nakajima, Kentaro; Akagi, Tomonori; Kaneko, Kunihiko; Hijiya, Naoki; Etoh, Tsuyoshi; Shiraishi, Norio; Moriyama, Masatsugu; Inomata, Masafumi
2016-05-01
Preoperative chemoradiotherapy (CRT) for locally advanced rectal cancer not only improves the postoperative local control rate, but also induces downstaging. However, it has not been established how to individually select patients who receive effective preoperative CRT. The aim of this study was to identify a predictor of response to preoperative CRT for locally advanced rectal cancer. This study is additional to our multicenter phase II study evaluating the safety and efficacy of preoperative CRT using oral fluorouracil (UMIN ID: 03396). From April, 2009 to August, 2011, 26 biopsy specimens obtained prior to CRT were analyzed by cyclopedic microarray analysis. Response to CRT was evaluated according to a histological grading system using surgically resected specimens. To decide on the number of genes for dividing into responder and non-responder groups, we statistically analyzed the data using a dimension reduction method, a principle component analysis. Of the 26 cases, 11 were responders and 15 non-responders. No significant difference was found in clinical background data between the two groups. We determined that the optimal number of genes for the prediction of response was 80 of 40,000 and the functions of these genes were analyzed. When comparing non-responders with responders, genes expressed at a high level functioned in alternative splicing, whereas those expressed at a low level functioned in the septin complex. Thus, an 80-gene expression set that predicts response to preoperative CRT for locally advanced rectal cancer was identified using a novel statistical method.
Li, Cong; Yue, Jing; Wu, Xiaowei; Xu, Cong; Yu, Jingjuan
2014-10-01
The DREB (dehydration-responsive element binding)-type transcription factors regulate the expression of stress-inducible genes by binding the DRE/CRT cis-elements in promoter regions. The upstream transcription factors that regulate the transcription of DREB transcription factors have not been clearly defined, although the function of DREB transcription factors in abiotic stress is known. In this study, an abscisic acid (ABA)-responsive DREB-binding protein gene (SiARDP) was cloned from foxtail millet (Setaria italica). The transcript level of SiARDP increased not only after drought, high salt, and low temperature stresses, but also after an ABA treatment in foxtail millet seedlings. Two ABA-responsive elements (ABRE1: ACGTGTC; ABRE2: ACGTGGC) exist in the promoter of SiARDP. Further analyses showed that two ABA-responsive element binding (AREB)-type transcription factors, SiAREB1 and SiAREB2, could physically bind to the ABRE core element in vitro and in vivo. The constitutive expression of SiARDP in Arabidopsis thaliana enhanced drought and salt tolerance during seed germination and seedling development, and overexpression of SiARDP in foxtail millet improved drought tolerance. The expression levels of target genes of SiARDP were upregulated in transgenic Arabidopsis and foxtail millet. These results reveal that SiARDP, one of the target genes of SiAREB, is involved in ABA-dependent signal pathways and plays a critical role in the abiotic stress response in plants. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Kulski, Jerzy K; Kenworthy, William; Bellgard, Matthew; Taplin, Ross; Okamoto, Koichi; Oka, Akira; Mabuchi, Tomotaka; Ozawa, Akira; Tamiya, Gen; Inoko, Hidetoshi
2005-12-01
Gene expression profiling was performed on biopsies of affected and unaffected psoriatic skin and normal skin from seven Japanese patients to obtain insights into the pathways that control this disease. HUG95A Affymetrix DNA chips that contained oligonucleotide arrays of approximately 12,000 well-characterized human genes were used in the study. The statistical analysis of the Affymetrix data, based on the ranking of the Student t-test statistic, revealed a complex regulation of molecular stress and immune gene responses. The majority of the 266 induced genes in affected and unaffected psoriatic skin were involved with interferon mediation, immunity, cell adhesion, cytoskeleton restructuring, protein trafficking and degradation, RNA regulation and degradation, signalling transduction, apoptosis and atypical epidermal cellular proliferation and differentiation. The disturbances in the normal protein degradation equilibrium of skin were reflected by the significant increase in the gene expression of various protease inhibitors and proteinases, including the induced components of the ATP/ubiquitin-dependent non-lysosomal proteolytic pathway that is involved with peptide processing and presentation to T cells. Some of the up-regulated genes, such as TGM1, IVL, FABP5, CSTA and SPRR, are well-known psoriatic markers involved in atypical epidermal cellular organization and differentiation. In the comparison between the affected and unaffected psoriatic skin, the transcription factor JUNB was found at the top of the statistical rankings for the up-regulated genes in affected skin, suggesting that it has an important but as yet undefined role in psoriasis. Our gene expression data and analysis suggest that psoriasis is a chronic interferon- and T-cell-mediated immune disease of the skin where the imbalance in epidermal cellular structure, growth and differentiation arises from the molecular antiviral stress signals initiating inappropriate immune responses.
Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.
2017-01-01
ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347
Wagner, R Doug; Johnson, Shemedia J; Danielsen, Zhixia Yan; Lim, Jin-Hee; Mudalige, Thilak; Linder, Sean
2017-01-01
Mucous-penetrating nanoparticles consisting of poly lactic acid-co-glycolic acid (PLGA)-polyethylene glycol (PEG) could improve targeting of microbicidal drugs for sexually transmitted diseases by intravaginal inoculation. Nanoparticles can induce inflammatory responses, which may exacerbate the inflammation that occurs in the vaginal tracts of women with yeast infections. This study evaluated the effects of these drug-delivery nanoparticles on VK2(E6/E7) vaginal epithelial cell proinflammatory responses to Candida albicans yeast infections. Vaginal epithelial cell monolayers were infected with C. albicans and exposed to 100 μg/ml 49.5 nm PLGA-PEG nanospheres or 20 μg/ml 1.1 x 500 nm PEG-functionalized graphene oxide (GO-PEG) sheets. The cells were assessed for changes in mRNA and protein expression of inflammation-related genes by RT-qPCR and physiological markers of cell stress using high content analysis and flow cytometry. C. albicans exposure suppressed apoptotic gene expression, but induced oxidative stress in the cells. The nanomaterials induced cytotoxicity and programmed cell death responses alone and with C. albicans. PLGA-PEG nanoparticles induced mRNA expression of apoptosis-related genes and induced poly (ADP-ribose) polymerase (PARP) cleavage, increased BAX/BCL2 ratios, and chromatin condensation indicative of apoptosis. They also induced autophagy, endoplasmic reticulum stress, and DNA damage. They caused the cells to excrete inflammatory recruitment molecules chemokine (C-X-C motif) ligand 1 (CXCL1), interleukin-1α (IL1A), interleukin-1β (IL1B), calprotectin (S100A8), and tumor necrosis factor α (TNF). GO-PEG nanoparticles induced expression of necrosis-related genes and cytotoxicity. They reduced autophagy and endoplasmic reticulum stress, and apoptotic gene expression responses. The results show that stealth nanoparticle drug-delivery vehicles may cause intracellular damage to vaginal epithelial cells by several mechanisms and that their use
Johnson, Shemedia J.; Danielsen, Zhixia Yan; Lim, Jin-Hee; Mudalige, Thilak; Linder, Sean
2017-01-01
Mucous-penetrating nanoparticles consisting of poly lactic acid-co-glycolic acid (PLGA)-polyethylene glycol (PEG) could improve targeting of microbicidal drugs for sexually transmitted diseases by intravaginal inoculation. Nanoparticles can induce inflammatory responses, which may exacerbate the inflammation that occurs in the vaginal tracts of women with yeast infections. This study evaluated the effects of these drug-delivery nanoparticles on VK2(E6/E7) vaginal epithelial cell proinflammatory responses to Candida albicans yeast infections. Vaginal epithelial cell monolayers were infected with C. albicans and exposed to 100 μg/ml 49.5 nm PLGA-PEG nanospheres or 20 μg/ml 1.1 x 500 nm PEG-functionalized graphene oxide (GO-PEG) sheets. The cells were assessed for changes in mRNA and protein expression of inflammation-related genes by RT-qPCR and physiological markers of cell stress using high content analysis and flow cytometry. C. albicans exposure suppressed apoptotic gene expression, but induced oxidative stress in the cells. The nanomaterials induced cytotoxicity and programmed cell death responses alone and with C. albicans. PLGA-PEG nanoparticles induced mRNA expression of apoptosis-related genes and induced poly (ADP-ribose) polymerase (PARP) cleavage, increased BAX/BCL2 ratios, and chromatin condensation indicative of apoptosis. They also induced autophagy, endoplasmic reticulum stress, and DNA damage. They caused the cells to excrete inflammatory recruitment molecules chemokine (C-X-C motif) ligand 1 (CXCL1), interleukin-1α (IL1A), interleukin-1β (IL1B), calprotectin (S100A8), and tumor necrosis factor α (TNF). GO-PEG nanoparticles induced expression of necrosis-related genes and cytotoxicity. They reduced autophagy and endoplasmic reticulum stress, and apoptotic gene expression responses. The results show that stealth nanoparticle drug-delivery vehicles may cause intracellular damage to vaginal epithelial cells by several mechanisms and that their use
Huang, Kaihui; Zhong, Yan; Li, Yingjun; Zheng, Dan; Cheng, Zong-Ming
2016-10-01
The ABA/water stress/ripening-induced (ASR) gene family exists universally in higher plants, and many ASR genes are up-regulated during periods of environmental stress and fruit ripening. Although a considerable amount of research has been performed investigating ASR gene response to abiotic stresses, relatively little is known about their roles in response to biotic stresses. In this report, we identified five ASR genes in apple (Malus × domestica) and explored their phylogenetic relationship, duplication events, and selective pressure. Five apple ASR genes (Md-ASR) were divided into two clades based on phylogenetic analysis. Species-specific duplication was detected in M. domestica ASR genes. Leaves of 'Golden delicious' and 'Starking' were infected with Alternaria alternata f. sp. mali, which causes apple blotch disease, and examined for the expression of the ASR genes in lesion areas during the first 72 h after inoculation. Md-ASR genes showed different expression patterns at different sampling times in 'Golden delicious' and 'Starking'. The activities of stress-related enzymes, peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), phenylalanine ammonia lyase (PAL), and polyphenoloxidase (PPO), and the content of malondialdehyde (MDA) were also measured in different stages of disease development in two cultivars. The ASR gene expression patterns and theses physiological indexes for disease resistance suggested that Md-ASR genes are involved in biotic stress responses in apple.
Martínez-Paz, Pedro; Morales, Mónica; Sánchez-Argüello, Paloma; Morcillo, Gloria; Martínez-Guitarte, José Luis
2017-01-01
The freshwater snail Physa acuta is a sensitive organism to xenobiotics that is appropriate for toxicity testing. Cadmium (Cd) is a heavy metal with known toxic effects on several organisms, which include endocrine disruption and activation of the cellular stress responses. There is scarce genomic information on P. acuta; hence, in this work, we identify several genes related to the hormonal system, the stress response and the detoxification system to evaluate the effects of Cd. The transcriptional activity of the endocrine-related genes oestrogen receptor (ER), oestrogen-related receptor (ERR), and retinoid X receptor (RXR), the heat shock proteins genes hsp70 and hsp90 and a metallothionein (MT) gene was analysed in P. acuta exposed to Cd. In addition, the hsp70 and hsp90 genes were also evaluated after heat shock treatment. Real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis showed that Cd presence induced a significant increase in the mRNA levels of ER, ERR and RXR, suggesting a putative mode of action that could explain the endocrine disruptor activity of this heavy metal at the molecular level on Gastropoda. Moreover, the hsp70 gene was upregulated after 24-h Cd treatment, but the hsp90 gene expression was not affected. In contrast, the hsp70 and hsp90 genes were strongly upregulated during heat shock response. Finally, the MT gene expression showed a non-significant variability after Cd exposure. In conclusion, this study provides, for the first time, information about the effects of Cd on the endocrine system of Gastropoda at the molecular level and offers new putative biomarker genes that could be useful in ecotoxicological studies, risk assessment and bioremediation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Resistance Inducers Modulate Pseudomonas syringae pv. Tomato Strain DC3000 Response in Tomato Plants
Scalschi, Loredana; Camañes, Gemma; Llorens, Eugenio; Fernández-Crespo, Emma; López, María M.; García-Agustín, Pilar; Vicedo, Begonya
2014-01-01
The efficacy of hexanoic acid (Hx) as an inducer of resistance in tomato plants against Pseudomonas syringae pv. tomato DC3000 was previously demonstrated, and the plant response was characterized. Because little is known about the reaction of the pathogen to this effect, the goal of the present work was to determine whether the changes in the plant defence system affect the pathogen behaviour. This work provides the first demonstration of the response of the pathogen to the changes observed in plants after Hx application in terms of not only the population size but also the transcriptional levels of genes involved in quorum sensing establishment and pathogenesis. Therefore, it is possible that Hx treatment attenuates the virulence and survival of bacteria by preventing or diminishing the appearance of symptoms and controlling the growth of the bacteria in the mesophyll. It is interesting to note that the gene transcriptional changes in the bacteria from the treated plants occur at the same time as the changes in the plants. Hx is able to alter bacteria pathogenesis and survival only when it is applied as a resistance inducer because the changes that it promotes in plants affect the bacteria. PMID:25244125
Applebaum, Mark A; Jha, Aashish R; Kao, Clara; Hernandez, Kyle M; DeWane, Gillian; Salwen, Helen R; Chlenski, Alexandre; Dobratic, Marija; Mariani, Christopher J; Godley, Lucy A; Prabhakar, Nanduri; White, Kevin; Stranger, Barbara E; Cohn, Susan L
2016-11-22
Neuroblastoma is notable for its broad spectrum of clinical behavior ranging from spontaneous regression to rapidly progressive disease. Hypoxia is well known to confer a more aggressive phenotype in neuroblastoma. We analyzed transcriptome data from diagnostic neuroblastoma tumors and hypoxic neuroblastoma cell lines to identify genes whose expression levels correlate with poor patient outcome and are involved in the hypoxia response. By integrating a diverse set of transcriptome datasets, including those from neuroblastoma patients and neuroblastoma derived cell lines, we identified nine genes (SLCO4A1, ENO1, HK2, PGK1, MTFP1, HILPDA, VKORC1, TPI1, and HIST1H1C) that are up-regulated in hypoxia and whose expression levels are correlated with poor patient outcome in three independent neuroblastoma cohorts. Analysis of 5-hydroxymethylcytosine and ENCODE data indicate that at least five of these nine genes have an increase in 5-hydroxymethylcytosine and a more open chromatin structure in hypoxia versus normoxia and are putative targets of hypoxia inducible factor (HIF) as they contain HIF binding sites in their regulatory regions. Four of these genes are key components of the glycolytic pathway and another three are directly involved in cellular metabolism. We experimentally validated our computational findings demonstrating that seven of the nine genes are significantly up-regulated in response to hypoxia in the four neuroblastoma cell lines tested. This compact and robustly validated group of genes, is associated with the hypoxia response in aggressive neuroblastoma and may represent a novel target for biomarker and therapeutic development.
Miersch, Claudia; Döring, Frank
2013-07-02
The metabolic and health-promoting effects of dietary restriction (DR) have been extensively studied in several species. The response to DR with respect to sex is essentially unknown. To address this question, we used the model organism Caenorhabditis elegans to analyze body composition and gene expression in males and hermaphrodites in response to DR. Unexpectedly, DR increased the fat-to-fat-free mass ratio and enlarged lipid droplets in both sexes to a similar extent. These effects were linked to a downregulation of the lipase-like 5 (lipl-5) gene in both sexes at two developmental stages. By contrast, the reductions in body size, protein content, and total RNA content in response to DR were more pronounced in hermaphrodites than in males. Functional enrichment analysis of gene expression data showed a DR-induced downregulation of several embryogenesis-associated genes concomitant with an ongoing expression of sperm-associated genes in hermaphrodites. In conclusion, DR increases fat stores in both sexes of C. elegans in the form of large and possibly lipolysis-resistant lipid droplets and markedly alters the reproductive program in hermaphrodites but not in males.
Lenka, Sangram K; Lohia, Bikash; Kumar, Abhay; Chinnusamy, Viswanathan; Bansal, Kailash C
2009-02-01
Abscisic acid (ABA), the popular plant stress hormone, plays a key role in regulation of sub-set of stress responsive genes. These genes respond to ABA through specific transcription factors which bind to cis-regulatory elements present in their promoters. We discovered the ABA Responsive Element (ABRE) core (ACGT) containing CGMCACGTGB motif as over-represented motif among the promoters of ABA responsive co-expressed genes in rice. Targeted gene prediction strategy using this motif led to the identification of 402 protein coding genes potentially regulated by ABA-dependent molecular genetic network. RT-PCR analysis of arbitrarily chosen 45 genes from the predicted 402 genes confirmed 80% accuracy of our prediction. Plant Gene Ontology (GO) analysis of ABA responsive genes showed enrichment of signal transduction and stress related genes among diverse functional categories.
Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li
2013-01-01
Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8+, but not CD4+ T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy. PMID:23671644
Wang, Li-Xin; Mei, Zhen-Yang; Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li
2013-01-01
Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8(+), but not CD4(+) T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy.
USDA-ARS?s Scientific Manuscript database
Virus-induced gene silencing (VIGS) is a powerful and rapid approach for determining the functions of plant genes. The basis of VIGS is that a viral genome is engineered so that it can carry fragments of plant genes, typically in the 200-300 base pair size range. The recombinant viruses are used to ...
Sphingosine-1-phosphate induces pro-remodelling response in airway smooth muscle cells
Fuerst, E; Foster, H R; Ward, J P T; Corrigan, C J; Cousins, D J; Woszczek, G
2014-01-01
Background Increased proliferation of airway smooth muscle (ASM) cells leading to hyperplasia and increased ASM mass is one of the most characteristic features of airway remodelling in asthma. A bioactive lipid, sphingosine-1-phosphate (S1P), has been suggested to affect airway remodelling by stimulation of human ASM cell proliferation. Objective To investigate the effect of S1P on signalling and regulation of gene expression in ASM cells from healthy and asthmatic individuals. Methods Airway smooth muscle cells grown from bronchial biopsies of healthy and asthmatic individuals were exposed to S1P. Gene expression was analysed using microarray, real-time PCR and Western blotting. Receptor signalling and function were determined by mRNA knockdown and intracellular calcium mobilization experiments. Results S1P potently regulated the expression of more than 80 genes in human ASM cells, including several genes known to be involved in the regulation of cell proliferation and airway remodelling (HBEGF, TGFB3, TXNIP, PLAUR, SERPINE1, RGS4). S1P acting through S1P2 and S1P3 receptors activated intracellular calcium mobilization and extracellular signal-regulated and Rho-associated kinases to regulate gene expression. S1P-induced responses were not inhibited by corticosteroids and did not differ significantly between ASM cells from healthy and asthmatic individuals. Conclusion S1P induces a steroid-resistant, pro-remodelling pathway in ASM cells. Targeting S1P or its receptors could be a novel treatment strategy for inhibiting airway remodelling in asthma. PMID:25041788
Li, Ping; Shi, Ming-Lei; Shen, Wen-Long; Zhang, Zhang; Xie, De-Jian; Zhang, Xiang-Yuan; He, Chao; Zhang, Yan; Zhao, Zhi-Hu
2017-08-01
Interferon-induced transmembrane protein (IFITM) 1, 2 and 3 genes encode a family of interferon (IFN)-induced transmembrane proteins that block entry of a broad spectrum of pathogens. However, the transcriptional regulation of these genes, especially whether there exist any enhancers and their roles during the IFN induction process remain elusive. Here, through public data mining, episomal luciferase reporter assay and in vivo CRISPR-Cas9 genome editing, we identified an IFN-responsive enhancer located 35kb upstream of IFITM3 gene promoter upregulating the IFN-induced expression of IFITM1, 2 and 3 genes. Chromatin immunoprecipitation (ChIP), electrophoretic mobility shift assay (EMSA) and luciferase reporter assay demonstrated that signal transducers and activators of transcription (STAT) 1 bound to the enhancer with the treatment of IFN and was indispensable for the enhancer activity. Furthermore, using chromosome conformation capture technique, we revealed that the IFITM1, 2 and 3 genes physically clustered together and constitutively looped to the distal enhancer through long-range interactions in both HEK293 and A549 cells, providing structural basis for coordinated regulation of IFITM1, 2 and 3 by the enhancer. Finally, we showed that in vivo truncation of the enhancer impaired IFN-induced resistance to influenza A virus (IAV) infection. These findings expand our understanding of the mechanisms underlying the transcriptional regulation of IFITM1, 2 and 3 expression and its ability to mediate IFN signaling. Copyright © 2017 Elsevier B.V. All rights reserved.
Tang, F; Xu, L; Yan, R; Song, X; Li, X
2012-12-01
Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).
Plant natriuretic peptides induce proteins diagnostic for an adaptive response to stress.
Turek, Ilona; Marondedze, Claudius; Wheeler, Janet I; Gehring, Chris; Irving, Helen R
2014-01-01
In plants, structural and physiological evidence has suggested the presence of biologically active natriuretic peptides (PNPs). PNPs are secreted into the apoplast, are systemically mobile and elicit a range of responses signaling via cGMP. The PNP-dependent responses include tissue specific modifications of cation transport and changes in stomatal conductance and the photosynthetic rate. PNP also has a critical role in host defense responses. Surprisingly, PNP-homologs are produced by several plant pathogens during host colonization suppressing host defense responses. Here we show that a synthetic peptide representing the biologically active fragment of the Arabidopsis thaliana PNP (AtPNP-A) induces the production of reactive oxygen species in suspension-cultured A. thaliana (Col-0) cells. To identify proteins whose expression changes in an AtPNP-A dependent manner, we undertook a quantitative proteomic approach, employing tandem mass tag (TMT) labeling, to reveal temporal responses of suspension-cultured cells to 1 nM and 10 pM PNP at two different time-points post-treatment. Both concentrations yield a distinct differential proteome signature. Since only the higher (1 nM) concentration induces a ROS response, we conclude that the proteome response at the lower concentration reflects a ROS independent response. Furthermore, treatment with 1 nM PNP results in an over-representation of the gene ontology (GO) terms "oxidation-reduction process," "translation" and "response to salt stress" and this is consistent with a role of AtPNP-A in the adaptation to environmental stress conditions.
Moon, Ju Yeon; Lee, Jeong Hee; Oh, Chang-Sik; Kang, Hong-Gu; Park, Jeong Mee
2016-12-01
HRT is a plant coiled-coil, nucleotide-binding and leucine-rich repeat (CC-NB-LRR) disease resistance protein that triggers the hypersensitive response (HR) on recognition of Turnip crinkle virus (TCV) coat protein (CP). The molecular mechanism and significance of HR-mediated cell death for TCV resistance have not been fully elucidated. To identify the genes involved in HRT/TCV CP-mediated HR in Nicotiana benthamiana, we performed virus-induced gene silencing (VIGS) of 459 expressed sequence tags (ESTs) of pathogen-responsive Capsicum annuum genes. VIGS of CaBLP5, which encodes an endoplasmic reticulum (ER)-associated immunoglobulin-binding protein (BiP), silenced NbBiP4 and NbBiP5 and significantly reduced HRT-mediated HR. The induction of ER stress-responsive genes and the accumulation of ER-targeted BiPs in response to HRT-mediated HR suggest that ER is involved in HR in N. benthamiana. BiP4/5 silencing significantly down-regulated HRT at the mRNA and protein levels, and affected SGT1 and HSP90 expression. Co-expression of TCV CP in BiP4/5-silenced plants completely abolished HRT induction. Transient expression of TCV CP alone induced selected ER stress-responsive gene transcripts only in Tobacco rattle virus (TRV)-infected plants, and most of these genes were induced by HRT/TCV CP, except for bZIP60, which was induced specifically in response to HRT/TCV CP. TCV CP-mediated induction of ER stress-responsive genes still occurred in BiP4/5-silenced plants, but HRT/TCV CP-mediated induction of these genes was defective. Tunicamycin, a chemical that inhibits protein N-glycosylation, inhibited HRT-mediated HR, suggesting that ER has a role in HR regulation. These results indicate that BiP and ER, which modulate pattern recognition receptors in innate immunity, also regulate R protein-mediated resistance. © 2016 BSPP and John Wiley & Sons Ltd.