Science.gov

Sample records for reveals target site

  1. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    PubMed

    Linheiro, Raquel S; Bergman, Casey M

    2012-01-01

    Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes. PMID:22347367

  2. A Chemical Biology Approach to Reveal Sirt6-targeted Histone H3 Sites in Nucleosomes.

    PubMed

    Wang, Wesley Wei; Zeng, Yu; Wu, Bo; Deiters, Alexander; Liu, Wenshe R

    2016-07-15

    As a member of a highly conserved family of NAD(+)-dependent histone deacetylases, Sirt6 is a key regulator of mammalian genome stability, metabolism, and life span. Previous studies indicated that Sirt6 is hardwired to remove histone acetylation at H3K9 and H3K56. However, how Sirt6 recognizes its nucleosome substrates has been elusive due to the difficulty of accessing homogeneous acetyl-nucleosomes and the low activity of Sirt6 toward peptide substrates. Based on the fact that Sirt6 has an enhanced activity to remove long chain fatty acylation from lysine, we developed an approach to recombinantly synthesize histone H3 with a fatty acylated lysine, N(ε)-(7-octenoyl)-lysine (OcK), installed at a number of lysine sites and used these acyl-H3 proteins to assemble acyl-nucleosomes as active Sirt6 substrates. A chemical biology approach that visualizes OcK in nucleosomes and therefore allows direct sensitization of Sirt6 activities on its acyl-nucleosome substrates was also formulated. By combining these two approaches, we showed that Sirt6 actively removes acylation from H3K9, H3K18, and H3K27; has relatively low activities toward H3K4 and K3K23; but sluggishly removes acylation at H3K14, H3K36, H3K56, and H3K79. Overexpressing Sirt6 in 293T cells led to downregulated acetylation at H3K18 and K3K27, confirming these two novel Sirt6-targeted nucleosome lysine sites in cells. Given that downregulation of H3K18 acetylation is correlated with a poor prognosis of several cancer types and H3K27 acetylation antagonizes repressive gene regulation by di- and trimethylation at H3K27, our current study implies that Sirt6 may serve as a target for cancer intervention and regulatory pathway investigation in cells. PMID:27152839

  3. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting

    PubMed Central

    Hodge, Curtis D.; Edwards, Ross A.; Markin, Craig J.; McDonald, Darin; Pulvino, Mary; Huen, Michael S. Y.; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J.; Glover, J.N. Mark

    2015-01-01

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  4. Covalent Inhibition of Ubc13 Affects Ubiquitin Signaling and Reveals Active Site Elements Important for Targeting.

    PubMed

    Hodge, Curtis D; Edwards, Ross A; Markin, Craig J; McDonald, Darin; Pulvino, Mary; Huen, Michael S Y; Zhao, Jiyong; Spyracopoulos, Leo; Hendzel, Michael J; Glover, J N Mark

    2015-07-17

    Ubc13 is an E2 ubiquitin conjugating enzyme that functions in nuclear DNA damage signaling and cytoplasmic NF-κB signaling. Here, we present the structures of complexes of Ubc13 with two inhibitors, NSC697923 and BAY 11-7082, which inhibit DNA damage and NF-κB signaling in human cells. NSC697923 and BAY 11-7082 both inhibit Ubc13 by covalent adduct formation through a Michael addition at the Ubc13 active site cysteine. The resulting adducts of both compounds exploit a binding groove unique to Ubc13. We developed a Ubc13 mutant which resists NSC697923 inhibition and, using this mutant, we show that the inhibition of cellular DNA damage and NF-κB signaling by NSC697923 is largely due to specific Ubc13 inhibition. We propose that unique structural features near the Ubc13 active site could provide a basis for the rational development and design of specific Ubc13 inhibitors. PMID:25909880

  5. High-performance targeted mass spectrometry with precision data-independent acquisition reveals site-specific glycosylation macroheterogeneity.

    PubMed

    Yeo, K Y Benjamin; Chrysanthopoulos, Panagiotis K; Nouwens, Amanda S; Marcellin, Esteban; Schulz, Benjamin L

    2016-10-01

    Protein glycosylation is a critical post-translational modification that regulates the structure, stability, and function of many proteins. Mass spectrometry is currently the preferred method for qualitative and quantitative characterization of glycosylation. However, the inherent heterogeneity of glycosylation makes its analysis difficult. Quantification of glycosylation occupancy, or macroheterogeneity, has proven to be especially challenging. Here, we used a variation of high-resolution multiple reaction monitoring (MRM(HR)) or pseudo-MRM for targeted data-independent acquisition that we term SWAT (sequential window acquisition of targeted fragment ions). We compared the analytical performance of SWATH (sequential window acquisition of all theoretical fragment ions), SWAT, and SRM (selected reaction monitoring) using a suite of synthetic peptides spiked at various concentrations into a complex yeast tryptic digest sample. SWAT provided superior analytical performance to SWATH in a targeted approach. We then used SWAT to measure site-specific N-glycosylation occupancy in cell wall glycoproteins from yeast with defects in the glycosylation biosynthetic machinery. SWAT provided robust measurement of occupancy at more N-glycosylation sites and with higher precision than SWATH, allowing identification of novel glycosylation sites dependent on the Ost3p and Ost6p regulatory subunits of oligosaccharyltransferase. PMID:27318240

  6. Novel Phosphorylation Sites in the S. cerevisiae Cdc13 Protein Reveal New Targets for Telomere Length Regulation

    PubMed Central

    Wu, Yun; DiMaggio, Peter A.; Perlman, David H.; Zakian, Virginia A.; Garcia, Benjamin A.

    2013-01-01

    The S. cerevisiae Cdc13 is a multifunctional protein with key roles in regulation of telomerase, telomere end protection, and conventional telomere replication, all of which are cell cycle-regulated processes. Given that phosphorylation is a key mechanism for regulating protein function, we identified sites of phosphorylation using nano liquid chromatography-tandem mass spectrometry (nanoLC-MS/MS). We also determined phosphorylation abundance on both wild type (WT) and a telomerase deficient form of Cdc13, encoded by the cdc13-2 allele, in both G1 phase cells, when telomerase is not active, and G2/M phase cells, when it is. We identified 21 sites of in vivo phosphorylation, of which only five had been reported previously. In contrast, phosphorylation of two in vitro targets of the ATM-like Tel1 kinase, S249 and S255, was not detected. This result helps resolve conflicting data on the importance of phosphorylation of these residues in telomerase recruitment. multiple residues showed differences in their cell cycle pattern of modification. For example, phosphorylation of S314 was significantly higher in the G2/M compared to the G1 phase and in WT versus mutant Cdc13, and a S314D mutation negatively affected telomere length. Our findings provide new targets in a key telomerase regulatory protein for modulation of telomere dynamics. PMID:23181431

  7. Quantitative Persulfide Site Identification (qPerS-SID) Reveals Protein Targets of H2S Releasing Donors in Mammalian Cells

    PubMed Central

    Longen, Sebastian; Richter, Florian; Köhler, Yvette; Wittig, Ilka; Beck, Karl-Friedrich; Pfeilschifter, Josef

    2016-01-01

    H2S is an important signalling molecule involved in diverse biological processes. It mediates the formation of cysteine persulfides (R-S-SH), which affect the activity of target proteins. Like thiols, persulfides show reactivity towards electrophiles and behave similarly to other cysteine modifications in a biotin switch assay. In this manuscript, we report on qPerS-SID a mass spectrometry-based method allowing the isolation of persulfide containing peptides in the mammalian proteome. With this method, we demonstrated that H2S donors differ in their efficacy to induce persulfides in HEK293 cells. Furthermore, data analysis revealed that persulfide formation affects all subcellular compartments and various cellular processes. Negatively charged amino acids appeared more frequently adjacent to cysteines forming persulfides. We confirmed our proteomic data using pyruvate kinase M2 as a model protein and showed that several cysteine residues are prone to persulfide formation finally leading to its inactivation. Taken together, the site-specific identification of persulfides on a proteome scale can help to identify target proteins involved in H2S signalling and enlightens the biology of H2S and its releasing agents. PMID:27411966

  8. Quantitative Persulfide Site Identification (qPerS-SID) Reveals Protein Targets of H2S Releasing Donors in Mammalian Cells.

    PubMed

    Longen, Sebastian; Richter, Florian; Köhler, Yvette; Wittig, Ilka; Beck, Karl-Friedrich; Pfeilschifter, Josef

    2016-01-01

    H2S is an important signalling molecule involved in diverse biological processes. It mediates the formation of cysteine persulfides (R-S-SH), which affect the activity of target proteins. Like thiols, persulfides show reactivity towards electrophiles and behave similarly to other cysteine modifications in a biotin switch assay. In this manuscript, we report on qPerS-SID a mass spectrometry-based method allowing the isolation of persulfide containing peptides in the mammalian proteome. With this method, we demonstrated that H2S donors differ in their efficacy to induce persulfides in HEK293 cells. Furthermore, data analysis revealed that persulfide formation affects all subcellular compartments and various cellular processes. Negatively charged amino acids appeared more frequently adjacent to cysteines forming persulfides. We confirmed our proteomic data using pyruvate kinase M2 as a model protein and showed that several cysteine residues are prone to persulfide formation finally leading to its inactivation. Taken together, the site-specific identification of persulfides on a proteome scale can help to identify target proteins involved in H2S signalling and enlightens the biology of H2S and its releasing agents. PMID:27411966

  9. Target sites of anthelmintics.

    PubMed

    Martin, R J; Robertson, A P; Bjorn, H

    1997-01-01

    This paper reviews sites of action of anthelmintic drugs including: (1) levamisole and pyrantel, which act as agonists at nicotinic acetylcholine receptors of nematodes; (2) the avermectins, which potentiate or gate the opening of glutamategated chloride channels found only in invertebrates; (3) piperazine, which acts as an agonist at GABA gated chloride channels on nematode muscle; (4) praziquantel, which increases the permeability of trematode tegument to calcium and results in contraction of the parasite muscle; (5) the benzimidazoles, like thiabendazole, which bind selectively to parasite beta-tubulin and prevents microtubule formation; (6) the proton ionophores, like closantel, which uncouple oxidative phosphorylation; (7) diamphenethide and clorsulon, which selectively inhibit glucose metabolism of Fasciola and; (8) diethylcarbamazine, which appears to interfere with arachidonic acid metabolism of filarial parasites and host. The review concludes with brief comments on the development of anthelmintics in the future. PMID:9309773

  10. Comparative analysis of the Dicer-like gene family reveals loss of miR162 target site in SmDCL1 from Salvia miltiorrhiza

    PubMed Central

    Shao, Fenjuan; Qiu, Deyou; Lu, Shanfa

    2015-01-01

    DCL1, the core component for miRNA biogenesis, is itself regulated by miR162 in Arabidopsis. MiRNA-mediated feedback regulation of AtDCL1 is important to maintain the proper level of DCL1 transcripts. However, it is unknown whether the miRNA-mediated regulation of DCL1 is conserved among plants. We analyzed the SmDCL gene family in Salvia miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies, using a comprehensive approach integrating genome-wide prediction, molecular cloning, gene expression profiling, and posttranscriptional regulation analysis. A total of five SmDCLs were identified. Comparative analysis of SmDCLs and AtDCLs showed an apparent enlargement of SmDCL introns in S. miltiorrhiza. The absence of miR162 in S. miltiorrhiza and the loss of miR162 target site in SmDCL1 were unexpectedly found. Further analysis showed that the miR162 target site was not present in DCL1 from ancient plants and was gained during plant evolution. The gained miR162 target site might be lost in a few modern plants through nucleotide mutations. Our results provide evidence for the gain and loss of miR162 and its target sites in Dicer-like genes during evolution. The data is useful for understanding the evolution of miRNA-mediated feedback regulation of DCLs in plants. PMID:25970825

  11. Comparative analysis of the Dicer-like gene family reveals loss of miR162 target site in SmDCL1 from Salvia miltiorrhiza.

    PubMed

    Shao, Fenjuan; Qiu, Deyou; Lu, Shanfa

    2015-01-01

    DCL1, the core component for miRNA biogenesis, is itself regulated by miR162 in Arabidopsis. MiRNA-mediated feedback regulation of AtDCL1 is important to maintain the proper level of DCL1 transcripts. However, it is unknown whether the miRNA-mediated regulation of DCL1 is conserved among plants. We analyzed the SmDCL gene family in Salvia miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies, using a comprehensive approach integrating genome-wide prediction, molecular cloning, gene expression profiling, and posttranscriptional regulation analysis. A total of five SmDCLs were identified. Comparative analysis of SmDCLs and AtDCLs showed an apparent enlargement of SmDCL introns in S. miltiorrhiza. The absence of miR162 in S. miltiorrhiza and the loss of miR162 target site in SmDCL1 were unexpectedly found. Further analysis showed that the miR162 target site was not present in DCL1 from ancient plants and was gained during plant evolution. The gained miR162 target site might be lost in a few modern plants through nucleotide mutations. Our results provide evidence for the gain and loss of miR162 and its target sites in Dicer-like genes during evolution. The data is useful for understanding the evolution of miRNA-mediated feedback regulation of DCLs in plants. PMID:25970825

  12. Selective Deletion of Leptin Receptors in Gonadotropes Reveals Activin and GnRH-Binding Sites as Leptin Targets in Support of Fertility

    PubMed Central

    Akhter, Noor; CarlLee, Tyler; Syed, Mohsin M.; Odle, Angela K.; Cozart, Michael A.; Haney, Anessa C.; Allensworth-James, Melody L.; Beneš, Helen

    2014-01-01

    The adipokine, leptin (LEP), is a hormonal gateway, signaling energy stores to appetite-regulatory neurons, permitting reproduction when stores are sufficient. Dual-labeling for LEP receptors (LEPRs) and gonadotropins or GH revealed a 2-fold increase in LEPR during proestrus, some of which was seen in LH gonadotropes. We therefore investigated LEPR functions in gonadotropes with Cre-LoxP technology, deleting the signaling domain of the LEPR (Lepr-exon 17) with Cre-recombinase driven by the rat LH-β promoter (Lhβ-cre). Selectivity of the deletion was validated by organ genotyping and lack of LEPR and responses to LEP by mutant gonadotropes. The mutation had no impact on growth, body weight, the timing of puberty, or pregnancy. Mutant females took 36% longer to produce their first litter and had 50% fewer pups/litter. When the broad impact of the loss of gonadotrope LEPR on all pituitary hormones was studied, mutant diestrous females had reduced serum levels of LH (40%), FSH (70%), and GH (54%) and mRNA levels of Fshβ (59%) and inhibin/activin β A and β B (25%). Mutant males had reduced serum levels of GH (74%), TSH (31%), and prolactin (69%) and mRNA levels of Gh (31%), Ghrhr (30%), Fshβ (22%), and glycoprotein α-subunit (Cga) (22%). Serum levels of LEP and ACTH and mRNA levels of Gnrhr were unchanged. However, binding to GnRH receptors was reduced in LEPR-null LH or FSH gonadotropes by 82% or 89%, respectively, in females (P < .0001) and 27% or 53%, respectively, in males (P < .03). This correlated with reductions in GnRH receptor protein immunolabeling, suggesting that LEP's actions may be posttranscriptional. Collectively, these studies highlight the importance of LEP to gonadotropes with GnRH-binding sites and activin as potential targets. LEP may modulate population growth, adjusting the number of offspring to the availability of food supplies. PMID:25057790

  13. "Target-Site" Drug Metabolism and Transport.

    PubMed

    Foti, Robert S; Tyndale, Rachel F; Garcia, Kristine L P; Sweet, Douglas H; Nagar, Swati; Sharan, Satish; Rock, Dan A

    2015-08-01

    The recent symposium on "Target-Site" Drug Metabolism and Transport that was sponsored by the American Society for Pharmacology and Experimental Therapeutics at the 2014 Experimental Biology meeting in San Diego is summarized in this report. Emerging evidence has demonstrated that drug-metabolizing enzyme and transporter activity at the site of therapeutic action can affect the efficacy, safety, and metabolic properties of a given drug, with potential outcomes including altered dosing regimens, stricter exclusion criteria, or even the failure of a new chemical entity in clinical trials. Drug metabolism within the brain, for example, can contribute to metabolic activation of therapeutic drugs such as codeine as well as the elimination of potential neurotoxins in the brain. Similarly, the activity of oxidative and conjugative drug-metabolizing enzymes in the lung can have an effect on the efficacy of compounds such as resveratrol. In addition to metabolism, the active transport of compounds into or away from the site of action can also influence the outcome of a given therapeutic regimen or disease progression. For example, organic anion transporter 3 is involved in the initiation of pancreatic β-cell dysfunction and may have a role in how uremic toxins enter pancreatic β-cells and ultimately contribute to the pathogenesis of gestational diabetes. Finally, it is likely that a combination of target-specific metabolism and cellular internalization may have a significant role in determining the pharmacokinetics and efficacy of antibody-drug conjugates, a finding which has resulted in the development of a host of new analytical methods that are now used for characterizing the metabolism and disposition of antibody-drug conjugates. Taken together, the research summarized herein can provide for an increased understanding of potential barriers to drug efficacy and allow for a more rational approach for developing safe and effective therapeutics. PMID:25986849

  14. General view of the archaeological site showing excavation and revealing ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    General view of the archaeological site showing excavation and revealing the steps leading down into the eighteenth-century burial vault - Harry Buck House, North of Main Street (14800 Governor Oden Bowie Drive), Upper Marlboro, Prince George's County, MD

  15. Expansion of CRISPR targeting sites in Bombyx mori.

    PubMed

    Zeng, Baosheng; Zhan, Shuai; Wang, Yueqiang; Huang, Yuping; Xu, Jun; Liu, Qun; Li, Zhiqian; Huang, Yongping; Tan, Anjiang

    2016-05-01

    The CRISPR/Cas9 system has been proven as a revolutionary genome engineering tool. In most cases, single guide RNA (sgRNA) targeting sites have been designed as GN19NGG or GGN18NGG, because of restriction of the initiation nucleotide for RNA Pol III promoters. Here, we demonstrate that the U6 promoter from a lepidopteran model insect, Bombyx mori, effectively expressed the sgRNA initiated with any nucleotide bases (adenine, thymine, guanine or cytosine), which further expands the CRISPR targeting space. A detailed expansion index in the genome was analysed when N20NGG was set as the CRISPR targeting site instead of GN19NGG, and revealed a significant increase of suitable targets, with the highest increase occurring on the Z sex chromosome. Transfection of different types of N20NGG sgRNAs targeting the enhanced green fluorescent protein (EGFP) combined with Cas9, significantly reduced EGFP expression in the BmN cells. An endogenous gene, BmBLOS2, was also disrupted by using various types of N20NGG sgRNAs, and the cleavage efficiency of N20NGG sgRNAs with different initial nucleotides and GC contents was evaluated in vitro. Furthermore, transgenic silkworms expressing Cas9 and sgRNAs targeting the BmBLOS2 gene were generated with many types of mutagenesis. The typical transparent skin phenotype in knock-out silkworms was stable and inheritable, suggesting that N20NGG sgRNAs function sufficiently in vivo. Our findings represent a renewal of CRISPR/Cas9 target design and will greatly facilitate insect functional genetics research. PMID:27032928

  16. Molecular Analysis of Sarcoidosis Granulomas Reveals Antimicrobial Targets.

    PubMed

    Rotsinger, Joseph E; Celada, Lindsay J; Polosukhin, Vasiliy V; Atkinson, James B; Drake, Wonder P

    2016-07-01

    Sarcoidosis is a granulomatous disease of unknown cause. Prior molecular and immunologic studies have confirmed the presence of mycobacterial virulence factors, such as catalase peroxidase and superoxide dismutase A, within sarcoidosis granulomas. Molecular analysis of granulomas can identify targets of known antibiotics classes. Currently, major antibiotics are directed against DNA synthesis, protein synthesis, and cell wall formation. We conducted molecular analysis of 40 sarcoidosis diagnostic specimens and compared them with 33 disease control specimens for the presence of mycobacterial genes that encode antibiotic targets. We assessed for genes involved in DNA synthesis (DNA gyrase A [gyrA] and DNA gyrase B), protein synthesis (RNA polymerase subunit β), cell wall synthesis (embCAB operon and enoyl reductase), and catalase peroxidase. Immunohistochemical analysis was conducted to investigate the locale of mycobacterial genes such as gyrA within 12 sarcoidosis specimens and 12 disease controls. Mycobacterial DNA was detected in 33 of 39 sarcoidosis specimens by quantitative real-time polymerase chain reaction compared with 2 of 30 disease control specimens (P < 0.001, two-tailed Fisher's test). Twenty of 39 were positive for three or more mycobacterial genes, compared with 1 of 30 control specimens (P < 0.001, two-tailed Fisher's test). Immunohistochemistry analysis localized mycobacterial gyrA nucleic acids to sites of granuloma formation in 9 of 12 sarcoidosis specimens compared with 1 of 12 disease controls (P < 0.01). Microbial genes encoding enzymes that can be targeted by currently available antimycobacterial antibiotics are present in sarcoidosis specimens and localize to sites of granulomatous inflammation. Use of antimicrobials directed against target enzymes may be an innovative treatment alternative. PMID:26807608

  17. Characteristics of Food Industry Web Sites and "Advergames" Targeting Children

    ERIC Educational Resources Information Center

    Culp, Jennifer; Bell, Robert A.; Cassady, Diana

    2010-01-01

    Objective: To assess the content of food industry Web sites targeting children by describing strategies used to prolong their visits and foster brand loyalty; and to document health-promoting messages on these Web sites. Design: A content analysis was conducted of Web sites advertised on 2 children's networks, Cartoon Network and Nickelodeon. A…

  18. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  19. In vivo phosphoproteomics analysis reveals the cardiac targets of β-adrenergic receptor signaling.

    PubMed

    Lundby, Alicia; Andersen, Martin N; Steffensen, Annette B; Horn, Heiko; Kelstrup, Christian D; Francavilla, Chiara; Jensen, Lars J; Schmitt, Nicole; Thomsen, Morten B; Olsen, Jesper V

    2013-06-01

    β-Blockers are widely used to prevent cardiac arrhythmias and to treat hypertension by inhibiting β-adrenergic receptors (βARs) and thus decreasing contractility and heart rate. βARs initiate phosphorylation-dependent signaling cascades, but only a small number of the target proteins are known. We used quantitative in vivo phosphoproteomics to identify 670 site-specific phosphorylation changes in murine hearts in response to acute treatment with specific βAR agonists. The residues adjacent to the regulated phosphorylation sites exhibited a sequence-specific preference (R-X-X-pS/T), and integrative analysis of sequence motifs and interaction networks suggested that the kinases AMPK (adenosine 5'-monophosphate-activated protein kinase), Akt, and mTOR (mammalian target of rapamycin) mediate βAR signaling, in addition to the well-established pathways mediated by PKA (cyclic adenosine monophosphate-dependent protein kinase) and CaMKII (calcium/calmodulin-dependent protein kinase type II). We found specific regulation of phosphorylation sites on six ion channels and transporters that mediate increased ion fluxes at higher heart rates, and we showed that phosphorylation of one of these, Ser(92) of the potassium channel KV7.1, increased current amplitude. Our data set represents a quantitative analysis of phosphorylated proteins regulated in vivo upon stimulation of seven-transmembrane receptors, and our findings reveal previously unknown phosphorylation sites that regulate myocardial contractility, suggesting new potential targets for the treatment of heart disease and hypertension. PMID:23737553

  20. SSFinder: high throughput CRISPR-Cas target sites prediction tool.

    PubMed

    Upadhyay, Santosh Kumar; Sharma, Shailesh

    2014-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system facilitates targeted genome editing in organisms. Despite high demand of this system, finding a reliable tool for the determination of specific target sites in large genomic data remained challenging. Here, we report SSFinder, a python script to perform high throughput detection of specific target sites in large nucleotide datasets. The SSFinder is a user-friendly tool, compatible with Windows, Mac OS, and Linux operating systems, and freely available online. PMID:25089276

  1. Radiation inactivation reveals discrete cation binding sites that modulate dihydropyridine binding sites

    SciTech Connect

    Bolger, G.T.; Skolnick, P.; Kempner, E.S. )

    1989-08-01

    In low ionic strength buffer (5 mM Tris.HCl), the binding of (3H) nitrendipine to dihydropyridine calcium antagonist binding sites of mouse forebrain membranes is increased by both Na{sup +} and Ca{sup 2+}. Radiation inactivation was used to determine the target size of ({sup 3}H)nitrendipine binding sites in 5 mM Tris.HCl buffer, in the presence and absence of these cations. After irradiation, ({sup 3}H) nitrendipine binding in buffer with or without Na+ was diminished, due to a loss of binding sites and also to an increase in Kd. After accounting for radiation effects on the dissociation constant, the target size for the nitrendipine binding site in buffer was 160-170 kDa and was 170-180 kDa in the presence of sodium. In the presence of calcium ions, ({sup 3}H)nitrendipine binding showed no radiation effects on Kd and yielded a target size of 150-170 kDa. These findings suggest, as in the case of opioid receptors, the presence of high molecular weight membrane components that modulate cation-induced alterations in radioligand binding to dihydropyridine binding sites.

  2. Target site choice of the related transposable elements Tc1 and Tc3 of Caenorhabditis elegans.

    PubMed Central

    van Luenen, H G; Plasterk, R H

    1994-01-01

    We have investigated the target choice of the related transposable elements Tc1 and Tc3 of the nematode C. elegans. The exact locations of 204 independent Tc1 insertions and 166 Tc3 insertions in an 1 kbp region of the genome were determined. There was no phenotypic selection for the insertions. All insertions were into the sequence TA. Both elements have a strong preference for certain positions in the 1 kbp region. Hot sites for integration are not clustered or regularly spaced. The orientation of the integrated transposon has no effect on the distribution pattern. We tested several explanations for the target site preference. If simple structural features of the DNA (e.g. bends) would mark hot sites, we would expect the patterns of the two related transposons Tc1 and Tc3 to be similar; however we found them to be completely different. Furthermore we found that the sequence at the donor site has no effect on the choice of the new insertion site, because the insertion pattern of a transposon that jumps from a transgenic donor site is identical to the insertion pattern of transposons jumping from endogenous genomic donor sites. The most likely explanation for the target choice is therefore that the primary sequence of the target site is recognized by the transposase. However, alignment of the Tc1 and Tc3 integration sites does not reveal a strong consensus sequence for either transposon. PMID:8127662

  3. Photoaffinity labeling in target- and binding-site identification

    PubMed Central

    Smith, Ewan; Collins, Ian

    2015-01-01

    Photoaffinity labeling (PAL) using a chemical probe to covalently bind its target in response to activation by light has become a frequently used tool in drug discovery for identifying new drug targets and molecular interactions, and for probing the location and structure of binding sites. Methods to identify the specific target proteins of hit molecules from phenotypic screens are highly valuable in early drug discovery. In this review, we summarize the principles of PAL including probe design and experimental techniques for in vitro and live cell investigations. We emphasize the need to optimize and validate probes and highlight examples of the successful application of PAL across multiple disease areas. PMID:25686004

  4. Genome-wide analysis of Musashi-2 targets reveals novel functions in governing epithelial cell migration

    PubMed Central

    Bennett, Christopher G.; Riemondy, Kent; Chapnick, Douglas A.; Bunker, Eric; Liu, Xuedong; Kuersten, Scott; Yi, Rui

    2016-01-01

    The Musashi-2 (Msi2) RNA-binding protein maintains stem cell self-renewal and promotes oncogenesis by enhancing cell proliferation in hematopoietic and gastrointestinal tissues. However, it is unclear how Msi2 recognizes and regulates mRNA targets in vivo and whether Msi2 primarily controls cell growth in all cell types. Here we identified Msi2 targets with HITS-CLIP and revealed that Msi2 primarily recognizes mRNA 3′UTRs at sites enriched in multiple copies of UAG motifs in epithelial progenitor cells. RNA-seq and ribosome profiling demonstrated that Msi2 promotes targeted mRNA decay without affecting translation efficiency. Unexpectedly, the most prominent Msi2 targets identified are key regulators that govern cell motility with a high enrichment in focal adhesion and extracellular matrix-receptor interaction, in addition to regulators of cell growth and survival. Loss of Msi2 stimulates epithelial cell migration, increases the number of focal adhesions and also compromises cell growth. These findings provide new insights into the molecular mechanisms of Msi2's recognition and repression of targets and uncover a key function of Msi2 in restricting epithelial cell migration. PMID:27034466

  5. TCGA bladder cancer study reveals potential drug targets

    Cancer.gov

    Investigators with TCGA have identified new potential therapeutic targets for a major form of bladder cancer, including important genes and pathways that are disrupted in the disease. They also discovered that, at the molecular level, some subtypes of bla

  6. An Extensive Survey of Tyrosine Phosphorylation Revealing New Sites in Human Mammary Epithelial Cells

    SciTech Connect

    Heibeck, Tyler H.; Ding, Shi-Jian; Opresko, Lee K.; Zhao, Rui; Schepmoes, Athena A.; Yang, Feng; Tolmachev, Aleksey V.; Monroe, Matthew E.; Camp, David G.; Smith, Richard D.; Wiley, H. S.; Qian, Weijun

    2009-08-01

    Protein tyrosine phosphorylation is a central regulatory mechanism in cell signaling. To extensively characterize the site-specific tyrosine phosphorylation in human cells, we present here a global survey of tyrosine phosphorylation sites in a normal-derived human mammary epithelial cell (HMEC) line by applying anti-phosphotyrosine (pTyr) peptide immunoaffinity purification (IP) coupled with high sensitivity LC-MS/MS. A total of 481 tyrosine phosphorylation sites (covered by 716 unique peptides) from 285 proteins were confidently identified in HMEC following the analysis of both the basal condition and an acute stimulated condition with epidermal growth factor (EGF). The estimated false discovery rate is 1.0% as measured by comparison against a scrambled database search. Comparison of these data to the literature showed significant agreement in site matches. Additionally 281 sites were not previously observed in HMEC culture were found. Twenty-nine of these sites have not been reported in any human cell or tissue system. The global profiling also allowed us to examine the phosphorylation stoichiometry differences based on spectral count information. Comparison of the data to a previous global proteome profiling study illustrates that most of the highly phoshorylated proteins are of relatively low-abundance. Large differences in phosphorylation stoichiometry for sites within the same protein were also observed for many of the identified proteins, suggesting potentially more important functional roles for those highly phosphorylated pTyr sites within a given protein. By mapping to major signaling networks such as EGF receptor and insulin growth factor-1 receptor signaling pathways, many known proteins involved in these pathways were revealed to be tyrosine phosphorylated, which should allow us to select interesting targeted involved in a given pathway for more directed studies. This extensive HMEC tyrosine phosphorylation dataset represents an important database

  7. Functional microRNAs and target sites are created by lineage-specific transposition

    PubMed Central

    Spengler, Ryan M.; Oakley, Clayton K.; Davidson, Beverly L.

    2014-01-01

    Transposable elements (TEs) account for nearly one-half of the sequence content in the human genome, and de novo germline transposition into regulatory or coding sequences of protein-coding genes can cause heritable disorders. TEs are prevalent in and around protein-coding genes, providing an opportunity to impart regulation. Computational studies reveal that microRNA (miRNA) genes and miRNA target sites reside within TE sequences, but there is little experimental evidence supporting a role for TEs in the birth of miRNAs, or as platform for gene regulation by miRNAs. In this work, we validate miRNAs and target sites derived from TE families prevalent in the human genome, including the ancient long interspersed nuclear element 2 (LINE2/L2), mammalian-wide interspersed repeat (MIR) retrotransposons and the primate-specific Alu family. We show that genes with 3′ untranslated region (3′ UTR) MIR elements are enriched for let-7 targets and that these sites are conserved and responsive to let-7 expression. We also demonstrate that 3′ UTR-embedded Alus are a source of miR-24 and miR-122 target sites and that a subset of active genomic Alus provide for de novo target site creation. Finally, we report that although the creation of miRNA genes by Alu elements is relatively uncommon relative to their overall genomic abundance, Alu-derived miR-1285-1 is efficiently processed from its genomic locus and regulates genes with target sites contained within homologous elements. Taken together, our data provide additional evidence for TEs as a source for miRNAs and miRNA target sites, with instances of conservation through the course of mammalian evolution. PMID:24234653

  8. Transcriptome analysis reveals transmembrane targets on transplantable midbrain dopamine progenitors

    PubMed Central

    Jönsson, Marie E.; Björklund, Anders; Parish, Clare L.; Thompson, Lachlan H.

    2015-01-01

    An important challenge for the continued development of cell therapy for Parkinson’s disease (PD) is the establishment of procedures that better standardize cell preparations for use in transplantation. Although cell sorting has been an anticipated strategy, its application has been limited by lack of knowledge regarding transmembrane proteins that can be used to target and isolate progenitors for midbrain dopamine (mDA) neurons. We used a “FACS-array” approach to identify 18 genes for transmembrane proteins with high expression in mDA progenitors and describe the utility of four of these targets (Alcam, Chl1, Gfra1, and Igsf8) for isolating mDA progenitors from rat primary ventral mesencephalon through flow cytometry. Alcam and Chl1 facilitated a significant enrichment of mDA neurons following transplantation, while targeting of Gfra1 allowed for robust separation of dopamine and serotonin neurons. Importantly, we also show that mDA progenitors isolated on the basis of transmembrane proteins are capable of extensive, functional innervation of the host striatum and correction of motor impairment in a unilateral model of PD. These results are highly relevant for current efforts to establish safe and effective stem cell-based procedures for PD, where clinical translation will almost certainly require safety and standardization measures in order to deliver well-characterized cell preparations. PMID:25775569

  9. Nuclease Target Site Selection for Maximizing On-target Activity and Minimizing Off-target Effects in Genome Editing.

    PubMed

    Lee, Ciaran M; Cradick, Thomas J; Fine, Eli J; Bao, Gang

    2016-03-01

    The rapid advancement in targeted genome editing using engineered nucleases such as ZFNs, TALENs, and CRISPR/Cas9 systems has resulted in a suite of powerful methods that allows researchers to target any genomic locus of interest. A complementary set of design tools has been developed to aid researchers with nuclease design, target site selection, and experimental validation. Here, we review the various tools available for target selection in designing engineered nucleases, and for quantifying nuclease activity and specificity, including web-based search tools and experimental methods. We also elucidate challenges in target selection, especially in predicting off-target effects, and discuss future directions in precision genome editing and its applications. PMID:26750397

  10. Nuclease Target Site Selection for Maximizing On-target Activity and Minimizing Off-target Effects in Genome Editing

    PubMed Central

    Lee, Ciaran M; Cradick, Thomas J; Fine, Eli J; Bao, Gang

    2016-01-01

    The rapid advancement in targeted genome editing using engineered nucleases such as ZFNs, TALENs, and CRISPR/Cas9 systems has resulted in a suite of powerful methods that allows researchers to target any genomic locus of interest. A complementary set of design tools has been developed to aid researchers with nuclease design, target site selection, and experimental validation. Here, we review the various tools available for target selection in designing engineered nucleases, and for quantifying nuclease activity and specificity, including web-based search tools and experimental methods. We also elucidate challenges in target selection, especially in predicting off-target effects, and discuss future directions in precision genome editing and its applications. PMID:26750397

  11. Targeted cancer exome sequencing reveals recurrent mutations in myeloproliferative neoplasms.

    PubMed

    Tenedini, E; Bernardis, I; Artusi, V; Artuso, L; Roncaglia, E; Guglielmelli, P; Pieri, L; Bogani, C; Biamonte, F; Rotunno, G; Mannarelli, C; Bianchi, E; Pancrazzi, A; Fanelli, T; Malagoli Tagliazucchi, G; Ferrari, S; Manfredini, R; Vannucchi, A M; Tagliafico, E

    2014-05-01

    With the intent of dissecting the molecular complexity of Philadelphia-negative myeloproliferative neoplasms (MPN), we designed a target enrichment panel to explore, using next-generation sequencing (NGS), the mutational status of an extensive list of 2000 cancer-associated genes and microRNAs. The genomic DNA of granulocytes and in vitro-expanded CD3+T-lymphocytes, as a germline control, was target-enriched and sequenced in a learning cohort of 20 MPN patients using Roche 454 technology. We identified 141 genuine somatic mutations, most of which were not previously described. To test the frequency of the identified variants, a larger validation cohort of 189 MPN patients was additionally screened for these mutations using Ion Torrent AmpliSeq NGS. Excluding the genes already described in MPN, for 8 genes (SCRIB, MIR662, BARD1, TCF12, FAT4, DAP3, POLG and NRAS), we demonstrated a mutation frequency between 3 and 8%. We also found that mutations at codon 12 of NRAS (NRASG12V and NRASG12D) were significantly associated, for primary myelofibrosis (PMF), with highest dynamic international prognostic scoring system (DIPSS)-plus score categories. This association was then confirmed in 66 additional PMF patients composing a final dataset of 168 PMF showing a NRAS mutation frequency of 4.7%, which was associated with a worse outcome, as defined by the DIPSS plus score. PMID:24150215

  12. Targeting Different Transthyretin Binding Sites with Unusual Natural Compounds.

    PubMed

    Ortore, Gabriella; Orlandini, Elisabetta; Braca, Alessandra; Ciccone, Lidia; Rossello, Armando; Martinelli, Adriano; Nencetti, Susanna

    2016-08-19

    Misfolding and aggregation of the transthyretin (TTR) protein leads to certain forms of amyloidosis. Some nutraceuticals, such as flavonoids and natural polyphenols, have recently been investigated as modulators of the self-assembly process of TTR, but they generally suffer from limited bioavailability. To discover innovative and more bioavailable natural compounds able to inhibit TTR amyloid formation, a docking study was performed using the crystallographic structure of TTR. This computational strategy was projected as an ad hoc inspection of the possible relationship between binding site location and modulation of the assembly process; interactions with the as-yet-unexplored epigallocatechin gallate (EGCG) sites and with the thyroxine (T4) pocket were simultaneously analyzed. All the compounds studied seem to prefer the traditional T4 binding site, but some interesting results emerged from the screening of an in-house database, used for validating the computational protocol, and of the Herbal Ingredients Targets (HIT) catalogue available on the ZINC database. PMID:27159149

  13. Directing cell therapy to anatomic target sites in vivo with magnetic resonance targeting.

    PubMed

    Muthana, Munitta; Kennerley, Aneurin J; Hughes, Russell; Fagnano, Ester; Richardson, Jay; Paul, Melanie; Murdoch, Craig; Wright, Fiona; Payne, Christopher; Lythgoe, Mark F; Farrow, Neil; Dobson, Jon; Conner, Joe; Wild, Jim M; Lewis, Claire

    2015-01-01

    Cell-based therapy exploits modified human cells to treat diseases but its targeted application in specific tissues, particularly those lying deep in the body where direct injection is not possible, has been problematic. Here we use a magnetic resonance imaging (MRI) system to direct macrophages carrying an oncolytic virus, Seprehvir, into primary and metastatic tumour sites in mice. To achieve this, we magnetically label macrophages with super-paramagnetic iron oxide nanoparticles and apply pulsed magnetic field gradients in the direction of the tumour sites. Magnetic resonance targeting guides macrophages from the bloodstream into tumours, resulting in increased tumour macrophage infiltration and reduction in tumour burden and metastasis. Our study indicates that clinical MRI scanners can not only track the location of magnetically labelled cells but also have the potential to steer them into one or more target tissues. PMID:26284300

  14. Directing cell therapy to anatomic target sites in vivo with magnetic resonance targeting

    PubMed Central

    Muthana, Munitta; Hughes, Russell; Fagnano, Ester; Richardson, Jay; Paul, Melanie; Murdoch, Craig; Wright, Fiona; Payne, Christopher; Lythgoe, Mark F.; Farrow, Neil; Dobson, Jon; Conner, Joe; Wild, Jim M; Lewis, Claire

    2015-01-01

    Cell-based therapy exploits modified human cells to treat diseases but its targeted application in specific tissues, particularly those lying deep in the body where direct injection is not possible, has been problematic. Here we use a magnetic resonance imaging (MRI) system to direct macrophages carrying an oncolytic virus, Seprehvir, into primary and metastatic tumour sites in mice. To achieve this, we magnetically label macrophages with super-paramagnetic iron oxide nanoparticles (SPIOs) and apply pulsed magnetic-field gradients in the direction of the tumour sites. Magnetic resonance targeting guides macrophages from the bloodstream into tumors, resulting in increased tumour macrophage infiltration and reduction in tumor burden and metastasis. Our study indicates that clinical MRI scanners can not only track the location of magnetically labelled cells but also have the potential to steer them into one or more target tissues. PMID:26284300

  15. Immunologic advances reveal new targets in psoriasis and psoriatic arthritis.

    PubMed

    Mortezavi, Mahta; Ritchlin, Christopher

    2015-10-01

    Psoriatic arthritis (PsA) is a chronic inflammatory joint disorder with heterogeneous clinical features that may include plaque psoriasis, joint inflammation, enthesitis, dactylitis, and abnormal bone turn over. This disease is common, affecting up to 0.5% of the population with equal male and female prevalence. Until recently, few treatment options were available for PsA and patients suffered immense physical and social burden. Traditional disease modifying agents show limited efficacy in the treatment of PsA. Anti-tumor necrosis factor (TNF) drugs are effective for all the manifestations, yet recent studies show that up to 50% of patients either do not tolerate these medications or do not maintain a clinical response. The evolution in the treatment of PsA emerged from improved understanding of the pathophysiology of the disease with Th1 and Th17 cells taking center stage. Targeting TNF along with cytokines in the IL-23/TH17 pathway (IL-23, IL-17, and IL-22) holds great promise for improved treatment outcomes in PsA. PMID:26562469

  16. Bioimage analysis of Shigella infection reveals targeting of colonic crypts

    PubMed Central

    Arena, Ellen T.; Campbell-Valois, Francois-Xavier; Tinevez, Jean-Yves; Nigro, Giulia; Sachse, Martin; Moya-Nilges, Maryse; Nothelfer, Katharina; Marteyn, Benoit; Shorte, Spencer L.; Sansonetti, Philippe J.

    2015-01-01

    Few studies within the pathogenic field have used advanced imaging and analytical tools to quantitatively measure pathogenicity in vivo. In this work, we present a novel approach for the investigation of host–pathogen processes based on medium-throughput 3D fluorescence imaging. The guinea pig model for Shigella flexneri invasion of the colonic mucosa was used to monitor the infectious process over time with GFP-expressing S. flexneri. A precise quantitative imaging protocol was devised to follow individual S. flexneri in a large tissue volume. An extensive dataset of confocal images was obtained and processed to extract specific quantitative information regarding the progression of S. flexneri infection in an unbiased and exhaustive manner. Specific parameters included the analysis of S. flexneri positions relative to the epithelial surface, S. flexneri density within the tissue, and volume of tissue destruction. In particular, at early time points, there was a clear association of S. flexneri with crypts, key morphological features of the colonic mucosa. Numerical simulations based on random bacterial entry confirmed the bias of experimentally measured S. flexneri for early crypt targeting. The application of a correlative light and electron microscopy technique adapted for thick tissue samples further confirmed the location of S. flexneri within colonocytes at the mouth of crypts. This quantitative imaging approach is a novel means to examine host–pathogen systems in a tailored and robust manner, inclusive of the infectious agent. PMID:26056271

  17. Bioimage analysis of Shigella infection reveals targeting of colonic crypts.

    PubMed

    Arena, Ellen T; Campbell-Valois, Francois-Xavier; Tinevez, Jean-Yves; Nigro, Giulia; Sachse, Martin; Moya-Nilges, Maryse; Nothelfer, Katharina; Marteyn, Benoit; Shorte, Spencer L; Sansonetti, Philippe J

    2015-06-23

    Few studies within the pathogenic field have used advanced imaging and analytical tools to quantitatively measure pathogenicity in vivo. In this work, we present a novel approach for the investigation of host-pathogen processes based on medium-throughput 3D fluorescence imaging. The guinea pig model for Shigella flexneri invasion of the colonic mucosa was used to monitor the infectious process over time with GFP-expressing S. flexneri. A precise quantitative imaging protocol was devised to follow individual S. flexneri in a large tissue volume. An extensive dataset of confocal images was obtained and processed to extract specific quantitative information regarding the progression of S. flexneri infection in an unbiased and exhaustive manner. Specific parameters included the analysis of S. flexneri positions relative to the epithelial surface, S. flexneri density within the tissue, and volume of tissue destruction. In particular, at early time points, there was a clear association of S. flexneri with crypts, key morphological features of the colonic mucosa. Numerical simulations based on random bacterial entry confirmed the bias of experimentally measured S. flexneri for early crypt targeting. The application of a correlative light and electron microscopy technique adapted for thick tissue samples further confirmed the location of S. flexneri within colonocytes at the mouth of crypts. This quantitative imaging approach is a novel means to examine host-pathogen systems in a tailored and robust manner, inclusive of the infectious agent. PMID:26056271

  18. Target-classification approach applied to active UXO sites

    NASA Astrophysics Data System (ADS)

    Shubitidze, F.; Fernández, J. P.; Shamatava, Irma; Barrowes, B. E.; O'Neill, K.

    2013-06-01

    This study is designed to illustrate the discrimination performance at two UXO active sites (Oklahoma's Fort Sill and the Massachusetts Military Reservation) of a set of advanced electromagnetic induction (EMI) inversion/discrimination models which include the orthonormalized volume magnetic source (ONVMS), joint diagonalization (JD), and differential evolution (DE) approaches and whose power and flexibility greatly exceed those of the simple dipole model. The Fort Sill site is highly contaminated by a mix of the following types of munitions: 37-mm target practice tracers, 60-mm illumination mortars, 75-mm and 4.5'' projectiles, 3.5'', 2.36'', and LAAW rockets, antitank mine fuzes with and without hex nuts, practice MK2 and M67 grenades, 2.5'' ballistic windshields, M2A1-mines with/without bases, M19-14 time fuzes, and 40-mm practice grenades with/without cartridges. The site at the MMR site contains targets of yet different sizes. In this work we apply our models to EMI data collected using the MetalMapper (MM) and 2 × 2 TEMTADS sensors. The data for each anomaly are inverted to extract estimates of the extrinsic and intrinsic parameters associated with each buried target. (The latter include the total volume magnetic source or NVMS, which relates to size, shape, and material properties; the former includes location, depth, and orientation). The estimated intrinsic parameters are then used for classification performed via library matching and the use of statistical classification algorithms; this process yielded prioritized dig-lists that were submitted to the Institute for Defense Analyses (IDA) for independent scoring. The models' classification performance is illustrated and assessed based on these independent evaluations.

  19. A structure-based approach for targeting the HIV-1 genomic RNA dimerization initiation site.

    PubMed

    Ennifar, Eric; Paillart, Jean-Christophe; Bernacchi, Serena; Walter, Philippe; Pale, Patrick; Decout, Jean-Luc; Marquet, Roland; Dumas, Philippe

    2007-10-01

    Dimerization of the genomic RNA is an important step of the HIV-1 replication cycle. The Dimerization Initiation Site (DIS) promotes dimerization of the viral genome by forming a loop-loop complex between two DIS hairpins. Crystal structures of the DIS loop-loop complex revealed an unexpected and strong similitude with the bacterial 16S ribosomal aminoacyl-tRNA site (A site), which is the target of aminoglycoside antibiotics. As a consequence of these structural and sequence similarities, the HIV-1 DIS also binds some aminoglycosides, not only in vitro, but also ex vivo, in lymphoid cells and in viral particles. Crystal structures of the DIS loop-loop in complex with several aminoglycoside antibiotics provide a detailed-view of the DIS/drug interaction and reveal some hints about possible modifications to increase the drug affinity and/or specificity. PMID:17434658

  20. Quantitative Phosphoproteomics Reveals Wee1 Kinase as a Therapeutic Target in a Model of Proneural Glioblastoma.

    PubMed

    Lescarbeau, Rebecca S; Lei, Liang; Bakken, Katrina K; Sims, Peter A; Sarkaria, Jann N; Canoll, Peter; White, Forest M

    2016-06-01

    Glioblastoma (GBM) is the most common malignant primary brain cancer. With a median survival of about a year, new approaches to treating this disease are necessary. To identify signaling molecules regulating GBM progression in a genetically engineered murine model of proneural GBM, we quantified phosphotyrosine-mediated signaling using mass spectrometry. Oncogenic signals, including phosphorylated ERK MAPK, PI3K, and PDGFR, were found to be increased in the murine tumors relative to brain. Phosphorylation of CDK1 pY15, associated with the G2 arrest checkpoint, was identified as the most differentially phosphorylated site, with a 14-fold increase in phosphorylation in the tumors. To assess the role of this checkpoint as a potential therapeutic target, syngeneic primary cell lines derived from these tumors were treated with MK-1775, an inhibitor of Wee1, the kinase responsible for CDK1 Y15 phosphorylation. MK-1775 treatment led to mitotic catastrophe, as defined by increased DNA damage and cell death by apoptosis. To assess the extensibility of targeting Wee1/CDK1 in GBM, patient-derived xenograft (PDX) cell lines were also treated with MK-1775. Although the response was more heterogeneous, on-target Wee1 inhibition led to decreased CDK1 Y15 phosphorylation and increased DNA damage and apoptosis in each line. These results were also validated in vivo, where single-agent MK-1775 demonstrated an antitumor effect on a flank PDX tumor model, increasing mouse survival by 1.74-fold. This study highlights the ability of unbiased quantitative phosphoproteomics to reveal therapeutic targets in tumor models, and the potential for Wee1 inhibition as a treatment approach in preclinical models of GBM. Mol Cancer Ther; 15(6); 1332-43. ©2016 AACR. PMID:27196784

  1. Crystal structure of an avian influenza polymerase PA[subscript N] reveals an endonuclease active site

    SciTech Connect

    Yuan, Puwei; Bartlam, Mark; Lou, Zhiyong; Chen, Shoudeng; Zhou, Jie; He, Xiaojing; Lv, Zongyang; Ge, Ruowen; Li, Xuemei; Deng, Tao; Fodor, Ervin; Rao, Zihe; Liu, Yingfang

    2009-11-10

    The heterotrimeric influenza virus polymerase, containing the PA, PB1 and PB2 proteins, catalyses viral RNA replication and transcription in the nucleus of infected cells. PB1 holds the polymerase active site and reportedly harbours endonuclease activity, whereas PB2 is responsible for cap binding. The PA amino terminus is understood to be the major functional part of the PA protein and has been implicated in several roles, including endonuclease and protease activities as well as viral RNA/complementary RNA promoter binding. Here we report the 2.2 angstrom (A) crystal structure of the N-terminal 197 residues of PA, termed PA(N), from an avian influenza H5N1 virus. The PA(N) structure has an alpha/beta architecture and reveals a bound magnesium ion coordinated by a motif similar to the (P)DX(N)(D/E)XK motif characteristic of many endonucleases. Structural comparisons and mutagenesis analysis of the motif identified in PA(N) provide further evidence that PA(N) holds an endonuclease active site. Furthermore, functional analysis with in vivo ribonucleoprotein reconstitution and direct in vitro endonuclease assays strongly suggest that PA(N) holds the endonuclease active site and has critical roles in endonuclease activity of the influenza virus polymerase, rather than PB1. The high conservation of this endonuclease active site among influenza strains indicates that PA(N) is an important target for the design of new anti-influenza therapeutics.

  2. Structures of Cryptococcus neoformans Protein Farnesyltransferase Reveal Strategies for Developing Inhibitors That Target Fungal Pathogens

    SciTech Connect

    Hast, Michael A.; Nichols, Connie B.; Armstrong, Stephanie M.; Kelly, Shannon M.; Hellinga, Homme W.; Alspaugh, J. Andrew; Beese, Lorena S.

    2012-09-17

    Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections in immunocompromised individuals, including AIDS patients and transplant recipients. Few antifungals can treat C. neoformans infections, and drug resistance is increasing. Protein farnesyltransferase (FTase) catalyzes post-translational lipidation of key signal transduction proteins and is essential in C. neoformans. We present a multidisciplinary study validating C. neoformans FTase (CnFTase) as a drug target, showing that several anticancer FTase inhibitors with disparate scaffolds can inhibit C. neoformans and suggesting structure-based strategies for further optimization of these leads. Structural studies are an essential element for species-specific inhibitor development strategies by revealing similarities and differences between pathogen and host orthologs that can be exploited. We, therefore, present eight crystal structures of CnFTase that define the enzymatic reaction cycle, basis of ligand selection, and structurally divergent regions of the active site. Crystal structures of clinically important anticancer FTase inhibitors in complex with CnFTase reveal opportunities for optimization of selectivity for the fungal enzyme by modifying functional groups that interact with structurally diverse regions. A substrate-induced conformational change in CnFTase is observed as part of the reaction cycle, a feature that is mechanistically distinct from human FTase. Our combined structural and functional studies provide a framework for developing FTase inhibitors to treat invasive fungal infections.

  3. Quantitative Proteomics Reveals That Hsp90 Inhibition Preferentially Targets Kinases and the DNA Damage Response*

    PubMed Central

    Sharma, Kirti; Vabulas, R. Martin; Macek, Boris; Pinkert, Stefan; Cox, Jürgen; Mann, Matthias; Hartl, F. Ulrich

    2012-01-01

    Despite the increasing importance of heat shock protein 90 (Hsp90) inhibitors as chemotherapeutic agents in diseases such as cancer, their global effects on the proteome remain largely unknown. Here we use high resolution, quantitative mass spectrometry to map protein expression changes associated with the application of the Hsp90 inhibitor, 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (17-DMAG). In depth data obtained from five replicate SILAC experiments enabled accurate quantification of about 6,000 proteins in HeLa cells. As expected, we observed activation of a heat shock response with induced expression of molecular chaperones, which refold misfolded proteins, and proteases, which degrade irreparably damaged polypeptides. Despite the broad range of known Hsp90 substrates, bioinformatics analysis revealed that particular protein classes were preferentially affected. These prominently included proteins involved in the DNA damage response, as well as protein kinases and especially tyrosine kinases. We followed up on this observation with a quantitative phosphoproteomic analysis of about 4,000 sites, which revealed that Hsp90 inhibition leads to much more down- than up-regulation of the phosphoproteome (34% down versus 6% up). This study defines the cellular response to Hsp90 inhibition at the proteome level and sheds light on the mechanisms by which it can be used to target cancer cells. PMID:22167270

  4. Structures of Cryptococcus neoformans Protein Farnesyltransferase Reveal Strategies for Developing Inhibitors That Target Fungal Pathogens*

    PubMed Central

    Hast, Michael A.; Nichols, Connie B.; Armstrong, Stephanie M.; Kelly, Shannon M.; Hellinga, Homme W.; Alspaugh, J. Andrew; Beese, Lorena S.

    2011-01-01

    Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections in immunocompromised individuals, including AIDS patients and transplant recipients. Few antifungals can treat C. neoformans infections, and drug resistance is increasing. Protein farnesyltransferase (FTase) catalyzes post-translational lipidation of key signal transduction proteins and is essential in C. neoformans. We present a multidisciplinary study validating C. neoformans FTase (CnFTase) as a drug target, showing that several anticancer FTase inhibitors with disparate scaffolds can inhibit C. neoformans and suggesting structure-based strategies for further optimization of these leads. Structural studies are an essential element for species-specific inhibitor development strategies by revealing similarities and differences between pathogen and host orthologs that can be exploited. We, therefore, present eight crystal structures of CnFTase that define the enzymatic reaction cycle, basis of ligand selection, and structurally divergent regions of the active site. Crystal structures of clinically important anticancer FTase inhibitors in complex with CnFTase reveal opportunities for optimization of selectivity for the fungal enzyme by modifying functional groups that interact with structurally diverse regions. A substrate-induced conformational change in CnFTase is observed as part of the reaction cycle, a feature that is mechanistically distinct from human FTase. Our combined structural and functional studies provide a framework for developing FTase inhibitors to treat invasive fungal infections. PMID:21816822

  5. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants

    PubMed Central

    Hehle, Verena K.; Paul, Matthew J.; Roberts, Victoria A.; van Dolleweerd, Craig J.; Ma, Julian K.-C.

    2016-01-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformed Nicotiana tabacum. Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy’s 13 antibody heavy and light chain mutant combinations were expressed transiently in N. tabacum and demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.—Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217

  6. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants.

    PubMed

    Hehle, Verena K; Paul, Matthew J; Roberts, Victoria A; van Dolleweerd, Craig J; Ma, Julian K-C

    2016-04-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformedNicotiana tabacum Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy's 13 antibody heavy and light chain mutant combinations were expressed transiently inN. tabacumand demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.-Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217

  7. Salivary epithelial cells: an unassuming target site for gene therapeutics

    PubMed Central

    Perez, Paola; Rowzee, Anne M.; Zheng, Changyu; Adriaansen, Janik; Baum, Bruce J.

    2010-01-01

    Salivary glands are classical exocrine glands whose external secretions result in the production of saliva. However, in addition to the secretion of exocrine proteins, salivary epithelial cells are also capable of secreting proteins internally, into the bloodstream. This brief review examines the potential for using salivary epithelial cells as a target site for in situ gene transfer, with an ultimate goal of producing therapeutic proteins for treating both systemic and upper gastrointestinal tract disorders. The review discusses the protein secretory pathways reported to be present in salivary epithelial cells, the viral gene transfer vectors shown useful for transducing these cells, model transgenic secretory proteins examined, and some clinical conditions that might benefit from such salivary gland gene transfer. PMID:20219693

  8. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  9. Targeting Large Kinase Active Site with Rigid, Bulky Octahedral Ruthenium Complexes

    SciTech Connect

    Maksimoska, Jasna; Feng, Li; Harms, Klaus; Yi, Chunling; Kissil, Joseph; Marmorstein, Ronen; Meggers, Eric

    2009-09-02

    A strategy for targeting protein kinases with large ATP-binding sites by using bulky and rigid octahedral ruthenium complexes as structural scaffolds is presented. A highly potent and selective GSK3 and Pim1 half-sandwich complex NP309 was successfully converted into a PAK1 inhibitor by making use of the large octahedral compounds {Lambda}-FL172 and {Lambda}-FL411 in which the cyclopentadienyl moiety of NP309 is replaced by a chloride and sterically demanding diimine ligands. A 1.65 {angstrom}cocrystal structure of PAK1 with {Lambda}-FL172 reveals how the large coordination sphere of the ruthenium complex matches the size of the active site and serves as a yardstick to discriminate between otherwise closely related binding sites.

  10. CapR: revealing structural specificities of RNA-binding protein target recognition using CLIP-seq data

    PubMed Central

    2014-01-01

    RNA-binding proteins (RBPs) bind to their target RNA molecules by recognizing specific RNA sequences and structural contexts. The development of CLIP-seq and related protocols has made it possible to exhaustively identify RNA fragments that bind to RBPs. However, no efficient bioinformatics method exists to reveal the structural specificities of RBP–RNA interactions using these data. We present CapR, an efficient algorithm that calculates the probability that each RNA base position is located within each secondary structural context. Using CapR, we demonstrate that several RBPs bind to their target RNA molecules under specific structural contexts. CapR is available at https://sites.google.com/site/fukunagatsu/software/capr. PMID:24447569

  11. Initial basalt target site selection evaluation for the Mars penetrator drop test

    NASA Technical Reports Server (NTRS)

    Bunch, T. E.; Quaide, W. L.; Polkowski, G.

    1976-01-01

    Potential basalt target sites for an air drop penetrator test were described and the criteria involved in site selection were discussed. A summary of the background field geology and recommendations for optimum sites are also presented.

  12. Identification of LIN28B-bound mRNAs reveals features of target recognition and regulation

    PubMed Central

    Graf, Robin; Munschauer, Mathias; Mastrobuoni, Guido; Mayr, Florian; Heinemann, Udo; Kempa, Stefan; Rajewsky, Nikolaus; Landthaler, Markus

    2013-01-01

    The conserved human LIN28 RNA-binding proteins function in development, maintenance of pluripotency and oncogenesis. We used PAR-CLIP and a newly developed variant of this method, iDo-PAR-CLIP, to identify LIN28B targets as well as sites bound by the individual RNA-binding domains of LIN28B in the human transcriptome at nucleotide resolution. The position of target binding sites reflected the known structural relative orientation of individual LIN28B-binding domains, validating iDo-PAR-CLIP. Our data suggest that LIN28B directly interacts with most expressed mRNAs and members of the let-7 microRNA family. The Lin28-binding motif detected in pre-let-7 was enriched in mRNA sequences bound by LIN28B. Upon LIN28B knockdown, cell proliferation and the cell cycle were strongly impaired. Quantitative shotgun proteomics of LIN28B depleted cells revealed significant reduction of protein synthesis from its RNA targets. Computational analyses provided evidence that the strength of protein synthesis reduction correlated with the location of LIN28B binding sites within target transcripts. PMID:23770886

  13. Structural Code for DNA Recognition Revealed in Crystal Structures of Papillomavirus E2-DNA Targets

    NASA Astrophysics Data System (ADS)

    Rozenberg, Haim; Rabinovich, Dov; Frolow, Felix; Hegde, Rashmi S.; Shakked, Zippora

    1998-12-01

    Transcriptional regulation in papillomaviruses depends on sequence-specific binding of the regulatory protein E2 to several sites in the viral genome. Crystal structures of bovine papillomavirus E2 DNA targets reveal a conformational variant of B-DNA characterized by a roll-induced writhe and helical repeat of 10.5 bp per turn. A comparison between the free and the protein-bound DNA demonstrates that the intrinsic structure of the DNA regions contacted directly by the protein and the deformability of the DNA region that is not contacted by the protein are critical for sequence-specific protein/DNA recognition and hence for gene-regulatory signals in the viral system. We show that the selection of dinucleotide or longer segments with appropriate conformational characteristics, when positioned at correct intervals along the DNA helix, can constitute a structural code for DNA recognition by regulatory proteins. This structural code facilitates the formation of a complementary protein-DNA interface that can be further specified by hydrogen bonds and nonpolar interactions between the protein amino acids and the DNA bases.

  14. Eye can read your mind: decoding gaze fixations to reveal categorical search targets.

    PubMed

    Zelinsky, Gregory J; Peng, Yifan; Samaras, Dimitris

    2013-01-01

    Is it possible to infer a person's goal by decoding their fixations on objects? Two groups of participants categorically searched for either a teddy bear or butterfly among random category distractors, each rated as high, medium, or low in similarity to the target classes. Target-similar objects were preferentially fixated in both search tasks, demonstrating information about target category in looking behavior. Different participants then viewed the searchers' scanpaths, superimposed over the target-absent displays, and attempted to decode the target category (bear/butterfly). Bear searchers were classified perfectly; butterfly searchers were classified at 77%. Bear and butterfly Support Vector Machine (SVM) classifiers were also used to decode the same preferentially fixated objects and found to yield highly comparable classification rates. We conclude that information about a person's search goal exists in fixation behavior, and that this information can be behaviorally decoded to reveal a search target-essentially reading a person's mind by analyzing their fixations. PMID:24338446

  15. Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion.

    PubMed

    Bracken, Cameron P; Li, Xiaochun; Wright, Josephine A; Lawrence, David M; Pillman, Katherine A; Salmanidis, Marika; Anderson, Matthew A; Dredge, B Kate; Gregory, Philip A; Tsykin, Anna; Neilsen, Corine; Thomson, Daniel W; Bert, Andrew G; Leerberg, Joanne M; Yap, Alpha S; Jensen, Kirk B; Khew-Goodall, Yeesim; Goodall, Gregory J

    2014-09-17

    The microRNAs of the miR-200 family maintain the central characteristics of epithelia and inhibit tumor cell motility and invasiveness. Using the Ago-HITS-CLIP technology for transcriptome-wide identification of direct microRNA targets in living cells, along with extensive validation to verify the reliability of the approach, we have identified hundreds of miR-200a and miR-200b targets, providing insights into general features of miRNA target site selection. Gene ontology analysis revealed a predominant effect of miR-200 targets in widespread coordinate control of actin cytoskeleton dynamics. Functional characterization of the miR-200 targets indicates that they constitute subnetworks that underlie the ability of cancer cells to migrate and invade, including coordinate effects on Rho-ROCK signaling, invadopodia formation, MMP activity, and focal adhesions. Thus, the miR-200 family maintains the central characteristics of the epithelial phenotype by acting on numerous targets at multiple levels, encompassing both cytoskeletal effectors that control actin filament organization and dynamics, and upstream signals that locally regulate the cytoskeleton to maintain cell morphology and prevent cell migration. PMID:25069772

  16. Genome-wide identification of miR-200 targets reveals a regulatory network controlling cell invasion

    PubMed Central

    Bracken, Cameron P; Li, Xiaochun; Wright, Josephine A; Lawrence, David M; Pillman, Katherine A; Salmanidis, Marika; Anderson, Matthew A; Dredge, B Kate; Gregory, Philip A; Tsykin, Anna; Neilsen, Corine; Thomson, Daniel W; Bert, Andrew G; Leerberg, Joanne M; Yap, Alpha S; Jensen, Kirk B; Khew-Goodall, Yeesim; Goodall, Gregory J

    2014-01-01

    The microRNAs of the miR-200 family maintain the central characteristics of epithelia and inhibit tumor cell motility and invasiveness. Using the Ago-HITS-CLIP technology for transcriptome-wide identification of direct microRNA targets in living cells, along with extensive validation to verify the reliability of the approach, we have identified hundreds of miR-200a and miR-200b targets, providing insights into general features of miRNA target site selection. Gene ontology analysis revealed a predominant effect of miR-200 targets in widespread coordinate control of actin cytoskeleton dynamics. Functional characterization of the miR-200 targets indicates that they constitute subnetworks that underlie the ability of cancer cells to migrate and invade, including coordinate effects on Rho-ROCK signaling, invadopodia formation, MMP activity, and focal adhesions. Thus, the miR-200 family maintains the central characteristics of the epithelial phenotype by acting on numerous targets at multiple levels, encompassing both cytoskeletal effectors that control actin filament organization and dynamics, and upstream signals that locally regulate the cytoskeleton to maintain cell morphology and prevent cell migration. PMID:25069772

  17. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene.

    PubMed

    Luo, Yumei; Zhu, Detu; Zhang, Zhizhuo; Chen, Yaoyong; Sun, Xiaofang

    2015-01-01

    Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB) and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction. PMID:25918715

  18. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene

    PubMed Central

    Luo, Yumei; Zhang, Zhizhuo; Chen, Yaoyong; Sun, Xiaofang

    2015-01-01

    Recently, the clustered regularly interspaced short palindromic repeats (CRISPR) system has emerged as a powerful customizable artificial nuclease to facilitate precise genetic correction for tissue regeneration and isogenic disease modeling. However, previous studies reported substantial off-target activities of CRISPR system in human cells, and the enormous putative off-target sites are labor-intensive to be validated experimentally, thus motivating bioinformatics methods for rational design of CRISPR system and prediction of its potential off-target effects. Here, we describe an integrative analytical process to identify specific CRISPR target sites in the human β-globin gene (HBB) and predict their off-target effects. Our method includes off-target analysis in both coding and noncoding regions, which was neglected by previous studies. It was found that the CRISPR target sites in the introns have fewer off-target sites in the coding regions than those in the exons. Remarkably, target sites containing certain transcriptional factor motif have enriched binding sites of relevant transcriptional factor in their off-target sets. We also found that the intron sites have fewer SNPs, which leads to less variation of CRISPR efficiency in different individuals during clinical applications. Our studies provide a standard analytical procedure to select specific CRISPR targets for genetic correction. PMID:25918715

  19. Tristetraprolin binding site atlas in the macrophage transcriptome reveals a switch for inflammation resolution.

    PubMed

    Sedlyarov, Vitaly; Fallmann, Jörg; Ebner, Florian; Huemer, Jakob; Sneezum, Lucy; Ivin, Masa; Kreiner, Kristina; Tanzer, Andrea; Vogl, Claus; Hofacker, Ivo; Kovarik, Pavel

    2016-01-01

    Precise regulation of mRNA decay is fundamental for robust yet not exaggerated inflammatory responses to pathogens. However, a global model integrating regulation and functional consequences of inflammation-associated mRNA decay remains to be established. Using time-resolved high-resolution RNA binding analysis of the mRNA-destabilizing protein tristetraprolin (TTP), an inflammation-limiting factor, we qualitatively and quantitatively characterize TTP binding positions in the transcriptome of immunostimulated macrophages. We identify pervasive destabilizing and non-destabilizing TTP binding, including a robust intronic binding, showing that TTP binding is not sufficient for mRNA destabilization. A low degree of flanking RNA structuredness distinguishes occupied from silent binding motifs. By functionally relating TTP binding sites to mRNA stability and levels, we identify a TTP-controlled switch for the transition from inflammatory into the resolution phase of the macrophage immune response. Mapping of binding positions of the mRNA-stabilizing protein HuR reveals little target and functional overlap with TTP, implying a limited co-regulation of inflammatory mRNA decay by these proteins. Our study establishes a functionally annotated and navigable transcriptome-wide atlas (http://ttp-atlas.univie.ac.at) of cis-acting elements controlling mRNA decay in inflammation. PMID:27178967

  20. Site-specific integration of adeno-associated virus involves partial duplication of the target locus

    PubMed Central

    Henckaerts, Els; Dutheil, Nathalie; Zeltner, Nadja; Kattman, Steven; Kohlbrenner, Erik; Ward, Peter; Clément, Nathalie; Rebollo, Patricia; Kennedy, Marion; Keller, Gordon M.; Linden, R. Michael

    2009-01-01

    A variety of viruses establish latency by integrating their genome into the host genome. The integration event generally occurs in a nonspecific manner, precluding the prediction of functional consequences from resulting disruptions of affected host genes. The nonpathogenic adeno-associated virus (AAV) is unique in its ability to stably integrate in a site-specific manner into the human MBS85 gene. To gain a better understanding of the integration mechanism and the consequences of MBS85 disruption, we analyzed the molecular structure of AAV integrants in various latently infected human cell lines. Our study led to the observation that AAV integration causes an extensive but partial duplication of the target gene. Intriguingly, the molecular organization of the integrant leaves the possibility that a functional copy of the disrupted target gene could potentially be preserved despite the resulting rearrangements. A latently infected, Mbs85-targeted mouse ES cell line was generated to study the functional consequences of the observed duplication-based integration mechanism. AAV-modified ES cell lines continued to self-renew, maintained their multilineage differentiation potential and contributed successfully to mouse development when injected into blastocysts. Thus, our study reveals a viral strategy for targeted genome addition with the apparent absence of functional consequences. PMID:19372372

  1. Targeting substrate-site in Jak2 kinase prevents emergence of genetic resistance.

    PubMed

    Kesarwani, Meenu; Huber, Erika; Kincaid, Zachary; Evelyn, Chris R; Biesiada, Jacek; Rance, Mark; Thapa, Mahendra B; Shah, Neil P; Meller, Jarek; Zheng, Yi; Azam, Mohammad

    2015-01-01

    Emergence of genetic resistance against kinase inhibitors poses a great challenge for durable therapeutic response. Here, we report a novel mechanism of JAK2 kinase inhibition by fedratinib (TG101348) that prevents emergence of genetic resistance. Using in vitro drug screening, we identified 211 amino-acid substitutions conferring resistance to ruxolitinib (INCB018424) and cross-resistance to the JAK2 inhibitors AZD1480, CYT-387 and lestaurtinib. In contrast, these resistant variants were fully sensitive to fedratinib. Structural modeling, coupled with mutagenesis and biochemical studies, revealed dual binding sites for fedratinib. In vitro binding assays using purified proteins showed strong affinity for the substrate-binding site (Kd = 20 nM) while affinity for the ATP site was poor (Kd = ~8 μM). Our studies demonstrate that mutations affecting the substrate-binding pocket encode a catalytically incompetent kinase, thereby preventing emergence of resistant variants. Most importantly, our data suggest that in order to develop resistance-free kinase inhibitors, the next-generation drug design should target the substrate-binding site. PMID:26419724

  2. Targeting substrate-site in Jak2 kinase prevents emergence of genetic resistance

    PubMed Central

    Kesarwani, Meenu; Huber, Erika; Kincaid, Zachary; Evelyn, Chris R.; Biesiada, Jacek; Rance, Mark; Thapa, Mahendra B.; Shah, Neil P.; Meller, Jarek; Zheng, Yi; Azam, Mohammad

    2015-01-01

    Emergence of genetic resistance against kinase inhibitors poses a great challenge for durable therapeutic response. Here, we report a novel mechanism of JAK2 kinase inhibition by fedratinib (TG101348) that prevents emergence of genetic resistance. Using in vitro drug screening, we identified 211 amino-acid substitutions conferring resistance to ruxolitinib (INCB018424) and cross-resistance to the JAK2 inhibitors AZD1480, CYT-387 and lestaurtinib. In contrast, these resistant variants were fully sensitive to fedratinib. Structural modeling, coupled with mutagenesis and biochemical studies, revealed dual binding sites for fedratinib. In vitro binding assays using purified proteins showed strong affinity for the substrate-binding site (Kd = 20 nM) while affinity for the ATP site was poor (Kd = ~8 μM). Our studies demonstrate that mutations affecting the substrate-binding pocket encode a catalytically incompetent kinase, thereby preventing emergence of resistant variants. Most importantly, our data suggest that in order to develop resistance-free kinase inhibitors, the next-generation drug design should target the substrate-binding site. PMID:26419724

  3. Top-Down Targeted Proteomics Reveals Decrease in Myosin Regulatory Light-Chain Phosphorylation That Contributes to Sarcopenic Muscle Dysfunction.

    PubMed

    Gregorich, Zachery R; Peng, Ying; Cai, Wenxuan; Jin, Yutong; Wei, Liming; Chen, Albert J; McKiernan, Susan H; Aiken, Judd M; Moss, Richard L; Diffee, Gary M; Ge, Ying

    2016-08-01

    Sarcopenia, the loss of skeletal muscle mass and function with advancing age, is a significant cause of disability and loss of independence in the elderly and thus, represents a formidable challenge for the aging population. Nevertheless, the molecular mechanism(s) underlying sarcopenia-associated muscle dysfunction remain poorly understood. In this study, we employed an integrated approach combining top-down targeted proteomics with mechanical measurements to dissect the molecular mechanism(s) in age-related muscle dysfunction. Top-down targeted proteomic analysis uncovered a progressive age-related decline in the phosphorylation of myosin regulatory light chain (RLC), a critical protein involved in the modulation of muscle contractility, in the skeletal muscle of aging rats. Top-down tandem mass spectrometry analysis identified a previously unreported bis-phosphorylated proteoform of fast skeletal RLC and localized the sites of decreasing phosphorylation to Ser14/15. Of these sites, Ser14 phosphorylation represents a previously unidentified site of phosphorylation in RLC from fast-twitch skeletal muscle. Subsequent mechanical analysis of single fast-twitch fibers isolated from the muscles of rats of different ages revealed that the observed decline in RLC phosphorylation can account for age-related decreases in the contractile properties of sarcopenic fast-twitch muscles. These results strongly support a role for decreasing RLC phosphorylation in sarcopenia-associated muscle dysfunction and suggest that therapeutic modulation of RLC phosphorylation may represent a new avenue for the treatment of sarcopenia. PMID:27362462

  4. Genome-wide characterization of cis-acting DNA targets reveals the transcriptional regulatory framework of opaque2 in maize.

    PubMed

    Li, Chaobin; Qiao, Zhenyi; Qi, Weiwei; Wang, Qian; Yuan, Yue; Yang, Xi; Tang, Yuanping; Mei, Bing; Lv, Yuanda; Zhao, Han; Xiao, Han; Song, Rentao

    2015-03-01

    Opaque2 (O2) is a transcription factor that plays important roles during maize endosperm development. Mutation of the O2 gene improves the nutritional value of maize seeds but also confers pleiotropic effects that result in reduced agronomic quality. To reveal the transcriptional regulatory framework of O2, we studied the transcriptome of o2 mutants using RNA sequencing (RNA-Seq) and determined O2 DNA binding targets using chromatin immunoprecipitation coupled to high-throughput sequencing (ChIP-Seq). The RNA-Seq analysis revealed 1605 differentially expressed genes (DEGs) and 383 differentially expressed long, noncoding RNAs. The DEGs cover a wide range of functions related to nutrient reservoir activity, nitrogen metabolism, stress resistance, etc. ChIP-Seq analysis detected 1686 O2 DNA binding sites distributed over 1143 genes. Overlay of the RNA-Seq and ChIP-Seq results revealed 35 O2-modulated target genes. We identified four O2 binding motifs; among them, TGACGTGG appears to be the most conserved and strongest. We confirmed that, except for the 16- and 18-kD zeins, O2 directly regulates expression of all other zeins. O2 directly regulates two transcription factors, genes linked to carbon and amino acid metabolism and abiotic stress resistance. We built a hierarchical regulatory model for O2 that provides an understanding of its pleiotropic biological effects. PMID:25691733

  5. Extensive site-directed mutagenesis reveals interconnected functional units in the alkaline phosphatase active site.

    PubMed

    Sunden, Fanny; Peck, Ariana; Salzman, Julia; Ressl, Susanne; Herschlag, Daniel

    2015-01-01

    Enzymes enable life by accelerating reaction rates to biological timescales. Conventional studies have focused on identifying the residues that have a direct involvement in an enzymatic reaction, but these so-called 'catalytic residues' are embedded in extensive interaction networks. Although fundamental to our understanding of enzyme function, evolution, and engineering, the properties of these networks have yet to be quantitatively and systematically explored. We dissected an interaction network of five residues in the active site of Escherichia coli alkaline phosphatase. Analysis of the complex catalytic interdependence of specific residues identified three energetically independent but structurally interconnected functional units with distinct modes of cooperativity. From an evolutionary perspective, this network is orders of magnitude more probable to arise than a fully cooperative network. From a functional perspective, new catalytic insights emerge. Further, such comprehensive energetic characterization will be necessary to benchmark the algorithms required to rationally engineer highly efficient enzymes. PMID:25902402

  6. Rapid screening of endonuclease target site preference using a modified bacterial two-plasmid selection.

    PubMed

    Wolfs, Jason M; Kleinstiver, Benjamin P; Edgell, David R

    2014-01-01

    Homing endonucleases and other site-specific endonucleases have potential applications in genome editing, yet efficient targeting requires a thorough understanding of DNA-sequence specificity. Here, we describe a modified two-plasmid genetic selection in Escherichia coli that allows rapid profiling of nucleotide substitutions within a target site of given endonucleases. The selection utilizes a toxic plasmid (pTox) that encodes a DNA gyrase toxin in addition to the endonuclease target site. Cleavage of the toxic plasmid by an endonuclease expressed from a second plasmid (pEndo) facilitates growth under selective conditions. The modified protocol utilizes competent cells harboring the endonuclease expression plasmid into which target site plasmids are transformed. Replica plating on nonselective and selective media plates identifies cleavable and non-cleavable targets. Thus, a library of randomized target sites, or many individual target sites, can be analyzed using a single transformation. Both cleavable and non-cleavable targets can be analyzed by DNA sequencing to gain information about nucleotide preference in the endonuclease's target site. PMID:24510263

  7. Dissection of the Process of Brain Metastasis Reveals Targets and Mechanisms for Molecular-based Intervention.

    PubMed

    Weidle, Ulrich H; Birzele, Fabian; Kollmorgen, Gwendlyn; Rüger, Rüdiger

    2016-01-01

    Brain metastases outnumber the incidence of brain tumors by a factor of ten. Patients with brain metastases have a dismal prognosis and current treatment modalities achieve only a modest clinical benefit. We discuss the process of brain metastasis with respect to mechanisms and involved targets to outline options for therapeutic intervention and focus on breast and lung cancer, as well as melanoma. We describe the process of penetration of the blood-brain-barrier (BBB) by disseminated tumor cells, establishment of a metastatic niche, colonization and outgrowth in the brain parenchyma. Furthermore, the role of angiogenesis in colonization of the brain parenchyma, interactions of extravasated tumor cells with microglia and astrocytes, as well as their propensity for neuromimicry, is discussed. We outline targets suitable for prevention of metastasis and summarize targets suitable for treatment of established brain metastases. Finally, we highlight the implications of findings revealing druggable mutations in brain metastases that cannot be identified in matching primary tumors. PMID:27365375

  8. Survey of activated kinase proteins reveals potential targets for cholangiocarcinoma treatment.

    PubMed

    Dokduang, Hasaya; Juntana, Sirinun; Techasen, Anchalee; Namwat, Nisana; Yongvanit, Puangrat; Khuntikeo, Narong; Riggins, Gregory J; Loilome, Watcharin

    2013-12-01

    Improving therapy for patients with cholangiocarcinoma (CCA) presents a significant challenge. This is made more difficult by a lack of a clear understanding of potential molecular targets, such as deregulated kinases. In this work, we profiled the activated kinases in CCA in order to apply them as the targets for CCA therapy. Human phospho-receptor tyrosine kinases (RTKs) and phospho-kinase array analyses revealed that multiple kinases are activated in both CCA cell lines and human CCA tissues that included cell growth, apoptosis, cell to cell interaction, movement, and angiogenesis RTKs. Predominately, the kinases activated downstream were those in the PI3K/Akt, Ras/MAPK, JAK/STAT, and Wnt/β-catenin signaling pathways. Western blot analysis confirms that Erk1/2 and Akt activation were increased in CCA tissues when compared with their normal adjacent tissue. The inhibition of kinase activation using multi-targeted kinase inhibitors, sorafenib and sunitinib led to significant cell growth inhibition and apoptosis induction via suppression of Erk1/2 and Akt activation, whereas drugs with specificity to a single kinase showed less potency. In conclusion, our study reveals the involvement of multiple kinase proteins in CCA growth that might serve as therapeutic targets for combined kinase inhibition. PMID:23812726

  9. Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces

    PubMed Central

    Engin, H. Billur; Kreisberg, Jason F.; Carter, Hannah

    2016-01-01

    Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10−4) and oncogenes (Odds Ratio 1.17, P-value < 10−3). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10−8). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer

  10. Structure-Based Analysis Reveals Cancer Missense Mutations Target Protein Interaction Interfaces.

    PubMed

    Engin, H Billur; Kreisberg, Jason F; Carter, Hannah

    2016-01-01

    Recently it has been shown that cancer mutations selectively target protein-protein interactions. We hypothesized that mutations affecting distinct protein interactions involving established cancer genes could contribute to tumor heterogeneity, and that novel mechanistic insights might be gained into tumorigenesis by investigating protein interactions under positive selection in cancer. To identify protein interactions under positive selection in cancer, we mapped over 1.2 million nonsynonymous somatic cancer mutations onto 4,896 experimentally determined protein structures and analyzed their spatial distribution. In total, 20% of mutations on the surface of known cancer genes perturbed protein-protein interactions (PPIs), and this enrichment for PPI interfaces was observed for both tumor suppressors (Odds Ratio 1.28, P-value < 10-4) and oncogenes (Odds Ratio 1.17, P-value < 10-3). To study this further, we constructed a bipartite network representing structurally resolved PPIs from all available human complexes in the Protein Data Bank (2,864 proteins, 3,072 PPIs). Analysis of frequently mutated cancer genes within this network revealed that tumor-suppressors, but not oncogenes, are significantly enriched with functional mutations in homo-oligomerization regions (Odds Ratio 3.68, P-Value < 10-8). We present two important examples, TP53 and beta-2-microglobulin, for which the patterns of somatic mutations at interfaces provide insights into specifically perturbed biological circuits. In patients with TP53 mutations, patient survival correlated with the specific interactions that were perturbed. Moreover, we investigated mutations at the interface of protein-nucleotide interactions and observed an unexpected number of missense mutations but not silent mutations occurring within DNA and RNA binding sites. Finally, we provide a resource of 3,072 PPI interfaces ranked according to their mutation rates. Analysis of this list highlights 282 novel candidate cancer genes

  11. Metabolic and Target-Site Mechanisms Combine to Confer Strong DDT Resistance in Anopheles gambiae

    PubMed Central

    Mitchell, Sara N.; Rigden, Daniel J.; Dowd, Andrew J.; Lu, Fang; Wilding, Craig S.; Weetman, David; Dadzie, Samuel; Jenkins, Adam M.; Regna, Kimberly; Boko, Pelagie; Djogbenou, Luc; Muskavitch, Marc A. T.; Ranson, Hilary; Paine, Mark J. I.; Mayans, Olga; Donnelly, Martin J.

    2014-01-01

    The development of resistance to insecticides has become a classic exemplar of evolution occurring within human time scales. In this study we demonstrate how resistance to DDT in the major African malaria vector Anopheles gambiae is a result of both target-site resistance mechanisms that have introgressed between incipient species (the M- and S-molecular forms) and allelic variants in a DDT-detoxifying enzyme. Sequencing of the detoxification enzyme, Gste2, from DDT resistant and susceptible strains of An. gambiae, revealed a non-synonymous polymorphism (I114T), proximal to the DDT binding domain, which segregated with strain phenotype. Recombinant protein expression and DDT metabolism analysis revealed that the proteins from the susceptible strain lost activity at higher DDT concentrations, characteristic of substrate inhibition. The effect of I114T on GSTE2 protein structure was explored through X-ray crystallography. The amino acid exchange in the DDT-resistant strain introduced a hydroxyl group nearby the hydrophobic DDT-binding region. The exchange does not result in structural alterations but is predicted to facilitate local dynamics and enzyme activity. Expression of both wild-type and 114T alleles the allele in Drosophila conferred an increase in DDT tolerance. The 114T mutation was significantly associated with DDT resistance in wild caught M-form populations and acts in concert with target-site mutations in the voltage gated sodium channel (Vgsc-1575Y and Vgsc-1014F) to confer extreme levels of DDT resistance in wild caught An. gambiae. PMID:24675797

  12. TarPmiR: a new approach for microRNA target site prediction

    PubMed Central

    Ding, Jun; Li, Xiaoman; Hu, Haiyan

    2016-01-01

    Motivation: The identification of microRNA (miRNA) target sites is fundamentally important for studying gene regulation. There are dozens of computational methods available for miRNA target site prediction. Despite their existence, we still cannot reliably identify miRNA target sites, partially due to our limited understanding of the characteristics of miRNA target sites. The recently published CLASH (crosslinking ligation and sequencing of hybrids) data provide an unprecedented opportunity to study the characteristics of miRNA target sites and improve miRNA target site prediction methods. Results: Applying four different machine learning approaches to the CLASH data, we identified seven new features of miRNA target sites. Combining these new features with those commonly used by existing miRNA target prediction algorithms, we developed an approach called TarPmiR for miRNA target site prediction. Testing on two human and one mouse non-CLASH datasets, we showed that TarPmiR predicted more than 74.2% of true miRNA target sites in each dataset. Compared with three existing approaches, we demonstrated that TarPmiR is superior to these existing approaches in terms of better recall and better precision. Availability and Implementation: The TarPmiR software is freely available at http://hulab.ucf.edu/research/projects/miRNA/TarPmiR/. Contacts: haihu@cs.ucf.edu or xiaoman@mail.ucf.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27207945

  13. Target-site basis for resistance to imazethapyr in redroot amaranth (Amaranthus retroflexus L.).

    PubMed

    Huang, Zhaofeng; Chen, Jinyi; Zhang, Chaoxian; Huang, Hongjuan; Wei, Shouhui; Zhou, Xinxin; Chen, Jingchao; Wang, Xu

    2016-03-01

    Experiments were conducted to confirm imazethapyr resistance in redroot amaranth (Amaranthus retroflexus L.) and study the target-site based mechanism for the resistance. Whole-plant response experiments revealed that the resistant (R) population exhibited 19.16 fold resistance to imazethapyr compared with the susceptible (S) population. In vitro ALS activity assay demonstrated that the imazethapyr I50 value of the R population was 21.33 times greater than that of the S population. However, qRT-PCR analysis revealed that there is no difference in ALS gene expression between the R and S populations. Sequence analysis revealed an Asp-376-Glu substitution in ALS in the R population. In order to verify that the imazethapyr resistance was conferred by Asp-376-Glu mutation, the ALS-R and ALS-S genes were fused to the CaMV 35S promoter and introduced into Arabidopsis respectively. The expression of ALS-R in transgenic Arabidopsis plants exhibited 13.79 fold resistance to imazethapyr compared to ALS-S transgenic Arabidopsis. PMID:26969434

  14. Using an Old Drug to Target a New Drug Site: Application of Disulfiram to Target the Zn-Site in HCV NS5A Protein.

    PubMed

    Lee, Yu-Ming; Duh, Yulander; Wang, Shih-Ting; Lai, Michael M C; Yuan, Hanna S; Lim, Carmay

    2016-03-23

    In viral proteins, labile Zn-sites, where Zn(2+) is crucial for maintaining the native protein structure but the Zn-bound cysteines are reactive, are promising drug targets. Here, we aim to (i) identify labile Zn-sites in viral proteins using guidelines established from our previous work and (ii) assess if clinically safe Zn-ejecting agents could eject Zn(2+) from the predicted target site and thus inhibit viral replication. As proof-of-concept, we identified a labile Zn-site in the hepatitis C virus (HCV) NS5A protein and showed that the antialcoholism drug, disulfiram, could inhibit HCV replication to a similar extent as the clinically used antiviral agent, ribavirin. The discovery of a novel viral target and a new role for disulfiram in inhibiting HCV replication will enhance the therapeutic armamentarium against HCV. The strategy presented can also be applied to identify labile sites in other bacterial or viral proteins that can be targeted by disulfiram or other clinically safe Zn-ejectors. PMID:26928525

  15. Assigning Quantitative Function to Post-Translational Modifications Reveals Multiple Sites of Phosphorylation That Tune Yeast Pheromone Signaling Output

    PubMed Central

    Pincus, David; Ryan, Christopher J.; Smith, Richard D.

    2013-01-01

    Cell signaling systems transmit information by post-translationally modifying signaling proteins, often via phosphorylation. While thousands of sites of phosphorylation have been identified in proteomic studies, the vast majority of sites have no known function. Assigning functional roles to the catalog of uncharacterized phosphorylation sites is a key research challenge. Here we present a general approach to address this challenge and apply it to a prototypical signaling pathway, the pheromone response pathway in Saccharomyces cerevisiae. The pheromone pathway includes a mitogen activated protein kinase (MAPK) cascade activated by a G-protein coupled receptor (GPCR). We used published mass spectrometry-based proteomics data to identify putative sites of phosphorylation on pheromone pathway components, and we used evolutionary conservation to assign priority to a list of candidate MAPK regulatory sites. We made targeted alterations in those sites, and measured the effects of the mutations on pheromone pathway output in single cells. Our work identified six new sites that quantitatively tuned system output. We developed simple computational models to find system architectures that recapitulated the quantitative phenotypes of the mutants. Our results identify a number of putative phosphorylation events that contribute to adjust the input-output relationship of this model eukaryotic signaling system. We believe this combined approach constitutes a general means not only to reveal modification sites required to turn a pathway on and off, but also those required for more subtle quantitative effects that tune pathway output. Our results suggest that relatively small quantitative influences from individual phosphorylation events endow signaling systems with plasticity that evolution may exploit to quantitatively tailor signaling outcomes. PMID:23554854

  16. Assigning Quantitative Function to Post-Translational Modifications Reveals Multiple Sites of Phosphorylation That Tune Yeast Pheromone Signaling Output

    SciTech Connect

    Pincus, David; Ryan, Christopher J.; Smith, Richard D.; Brent, Roger; Resnekov, Orna; Hakimi, Mohamed Ali

    2013-03-12

    Cell signaling systems transmit information by post-­translationally modifying signaling proteins, often via phosphorylation. While thousands of sites of phosphorylation have been identified in proteomic studies, the vast majority of sites have no known function. Assigning functional roles to the catalog of uncharacterized phosphorylation sites is a key research challenge. Here we present a general approach to address this challenge and apply it to a prototypical signaling pathway, the pheromone response pathway in Saccharomyces cerevisiae. The pheromone pathway includes a mitogen activated protein kinase (MAPK) cascade activated by a G-­protein coupled receptor (GPCR). We used mass spectrometry-based proteomics to identify sites whose phosphorylation changed when the system was active, and evolutionary conservation to assign priority to a list of candidate MAPK regulatory sites. We made targeted alterations in those sites, and measured the effects of the mutations on pheromone pathway output in single cells. Our work identified six new sites that quantitatively tuned system output. We developed simple computational models to find system architectures that recapitulated the quantitative phenotypes of the mutants. Our results identify a number of regulated phosphorylation events that contribute to adjust the input-­output relationship of this model eukaryotic signaling system. We believe this combined approach constitutes a general means not only to reveal modification sites required to turn a pathway on and off, but also those required for more subtle quantitative effects that tune pathway output. Our results further suggest that relatively small quantitative influences from individual regulatory phosphorylation events endow signaling systems with plasticity that evolution may exploit to quantitatively tailor signaling outcomes.

  17. Identification of the REST regulon reveals extensive transposable element-mediated binding site duplication

    PubMed Central

    Johnson, Rory; Gamblin, Richard J.; Ooi, Lezanne; Bruce, Alexander W.; Donaldson, Ian J.; Westhead, David R.; Wood, Ian C.; Jackson, Richard M.; Buckley, Noel J.

    2006-01-01

    The genome-wide mapping of gene-regulatory motifs remains a major goal that will facilitate the modelling of gene-regulatory networks and their evolution. The repressor element 1 is a long, conserved transcription factor-binding site which recruits the transcriptional repressor REST to numerous neuron-specific target genes. REST plays important roles in multiple biological processes and disease states. To map RE1 sites and target genes, we created a position specific scoring matrix representing the RE1 and used it to search the human and mouse genomes. We identified 1301 and 997 RE1s inhuman and mouse genomes, respectively, of which >40% are novel. By employing an ontological analysis we show that REST target genes are significantly enriched in a number of functional classes. Taking the novel REST target gene CACNA1A as an experimental model, we show that it can be regulated by multiple RE1s of different binding affinities, which are only partially conserved between human and mouse. A novel BLAST methodology indicated that many RE1s belong to closely related families. Most of these sequences are associated with transposable elements, leading us to propose that transposon-mediated duplication and insertion of RE1s has led to the acquisition of novel target genes by REST during evolution. PMID:16899447

  18. A Remote Arene-Binding Site on Prostate Specific Membrane Antigen Revealed by Antibody-Recruiting Small Molecules

    SciTech Connect

    Zhang, Andrew X.; Murelli, Ryan P.; Barinka, Cyril; Michel, Julien; Cocleaza, Alexandra; Jorgensen, William L.; Lubkowski, Jacek; Spiegel, David A.

    2010-09-27

    Prostate specific membrane antigen (PSMA) is a membrane-bound glutamate carboxypeptidase overexpressed in many forms of prostate cancer. Our laboratory has recently disclosed a class of small molecules, called ARM-Ps (antibody-recruiting molecule targeting prostate cancer) that are capable of enhancing antibody-mediated immune recognition of prostate cancer cells. Interestingly, during the course of these studies, we found ARM-Ps to exhibit extraordinarily high potencies toward PSMA, compared to previously reported inhibitors. Here, we report in-depth biochemical, crystallographic, and computational investigations which elucidate the origin of the observed affinity enhancement. These studies reveal a previously unreported arene-binding site on PSMA, which we believe participates in an aromatic stacking interaction with ARMs. Although this site is composed of only a few amino acid residues, it drastically enhances small molecule binding affinity. These results provide critical insights into the design of PSMA-targeted small molecules for prostate cancer diagnosis and treatment; more broadly, the presence of similar arene-binding sites throughout the proteome could prove widely enabling in the optimization of small molecule-protein interactions.

  19. Topological robustness analysis of protein interaction networks reveals key targets for overcoming chemotherapy resistance in glioma

    NASA Astrophysics Data System (ADS)

    Azevedo, Hátylas; Moreira-Filho, Carlos Alberto

    2015-11-01

    Biological networks display high robustness against random failures but are vulnerable to targeted attacks on central nodes. Thus, network topology analysis represents a powerful tool for investigating network susceptibility against targeted node removal. Here, we built protein interaction networks associated with chemoresistance to temozolomide, an alkylating agent used in glioma therapy, and analyzed their modular structure and robustness against intentional attack. These networks showed functional modules related to DNA repair, immunity, apoptosis, cell stress, proliferation and migration. Subsequently, network vulnerability was assessed by means of centrality-based attacks based on the removal of node fractions in descending orders of degree, betweenness, or the product of degree and betweenness. This analysis revealed that removing nodes with high degree and high betweenness was more effective in altering networks’ robustness parameters, suggesting that their corresponding proteins may be particularly relevant to target temozolomide resistance. In silico data was used for validation and confirmed that central nodes are more relevant for altering proliferation rates in temozolomide-resistant glioma cell lines and for predicting survival in glioma patients. Altogether, these results demonstrate how the analysis of network vulnerability to topological attack facilitates target prioritization for overcoming cancer chemoresistance.

  20. Topological robustness analysis of protein interaction networks reveals key targets for overcoming chemotherapy resistance in glioma

    PubMed Central

    Azevedo, Hátylas; Moreira-Filho, Carlos Alberto

    2015-01-01

    Biological networks display high robustness against random failures but are vulnerable to targeted attacks on central nodes. Thus, network topology analysis represents a powerful tool for investigating network susceptibility against targeted node removal. Here, we built protein interaction networks associated with chemoresistance to temozolomide, an alkylating agent used in glioma therapy, and analyzed their modular structure and robustness against intentional attack. These networks showed functional modules related to DNA repair, immunity, apoptosis, cell stress, proliferation and migration. Subsequently, network vulnerability was assessed by means of centrality-based attacks based on the removal of node fractions in descending orders of degree, betweenness, or the product of degree and betweenness. This analysis revealed that removing nodes with high degree and high betweenness was more effective in altering networks’ robustness parameters, suggesting that their corresponding proteins may be particularly relevant to target temozolomide resistance. In silico data was used for validation and confirmed that central nodes are more relevant for altering proliferation rates in temozolomide-resistant glioma cell lines and for predicting survival in glioma patients. Altogether, these results demonstrate how the analysis of network vulnerability to topological attack facilitates target prioritization for overcoming cancer chemoresistance. PMID:26582089

  1. Exploring What's Missing: What Do Target Absent Trials Reveal About Autism Search Superiority?

    PubMed

    Keehn, Brandon; Joseph, Robert M

    2016-05-01

    We used eye-tracking to investigate the roles of enhanced discrimination and peripheral selection in superior visual search in autism spectrum disorder (ASD). Children with ASD were faster at visual search than their typically developing peers. However, group differences in performance and eye-movements did not vary with the level of difficulty of discrimination or selection. Rather, consistent with prior ASD research, group differences were mainly the effect of faster performance on target-absent trials. Eye-tracking revealed a lack of left-visual-field search asymmetry in ASD, which may confer an additional advantage when the target is absent. Lastly, ASD symptomatology was positively associated with search superiority, the mechanisms of which may shed light on the atypical brain organization that underlies social-communicative impairment in ASD. PMID:26762114

  2. Development of a target-site based regional frequency model using historical information

    NASA Astrophysics Data System (ADS)

    Hamdi, Yasser; Bardet, Lise; Duluc, Claire-Marie; Rebour, Vincent

    2016-04-01

    Nuclear power facilities in France were designed to withstand extreme environmental conditions with a very low probability of failure. Nevertheless, some exceptional surges considered as outliers are not properly addressed by classical frequency analysis models. If available data at the site of interest (target-site) is sufficiently complete on a long period and not characterized by the presence of an outlier, at-site frequency analysis can be used to estimate quantiles with acceptable uncertainties. Otherwise, regional and historical information (HI) may be used to mitigate the lack of data and the influence of the outlier by increasing its representativeness in the sample. several models have been proposed over the last years for regional extreme surges frequency analysis in France to take into account these outliers in the frequency analysis. However, these models do not give a specific weight to the target site and cannot take into account HI. The objective of the present work is to develop a regional frequency model (RFM) centered on a target-site and using HI. The neighborhood between sites is measured by a degree of physical and statistical dependence between observations (with a prior confidence level). Unlike existing models, the obtained region around the target site (and constituting the neighboring sites) is sliding from a target-site to another. In other words, the developed model assigns a region for each target site. The idea behind the construction of a frequency model favoring target sites and the principle of moving regions around these target-sites is the original key point of the developed model. A related issue regards the estimation of missed and/or ungauged surges at target-sites from those of gauged potential neighboring sites, a multiple linear regression (MLR) is used and it can be extended to other reconstitutions models. MLR analysis can be considered conclusive only if available observations at neighboring sites are informative enough

  3. Comparative Analysis of Gene Expression Data Reveals Novel Targets of Senescence-Associated microRNAs

    PubMed Central

    Napolitano, Marco; Comegna, Marika; Succoio, Mariangela; Leggiero, Eleonora; Pastore, Lucio; Faraonio, Raffaella; Cimino, Filiberto; Passaro, Fabiana

    2014-01-01

    In the last decades, cellular senescence is viewed as a complex mechanism involved in different processes, ranging from tumor suppression to induction of age-related degenerative alterations. Senescence-inducing stimuli are myriad and, recently, we and others have demonstrated the role exerted by microRNAs in the induction and maintenance of senescence, by the identification of a subset of Senescence-Associated microRNAs (SAmiRs) up-regulated during replicative or stress-induced senescence and able to induce a premature senescent phenotype when over-expressed in human primary cells. With the intent to find novel direct targets of two specific SAmiRs, SAmiR-494 and -486-5p, and cellular pathways which they are involved in, we performed a comparative analysis of gene expression profiles available in literature to select genes down-regulated upon replicative senescence of human primary fibroblasts. Among them, we searched for SAmiR’s candidate targets by analyzing with different target prediction algorithms their 3’UTR for the presence of SAmiR-binding sites. The expression profiles of selected candidates have been validated on replicative and stress-induced senescence and the targeting of the 3’UTRs was assessed by luciferase assay. Results allowed us to identify Cell Division Cycle Associated 2 (CDCA2) and Inhibitor of DNA binding/differentiation type 4 (ID4) as novel targets of SAmiR-494 and SAmiR-486-5p, respectively. Furthermore, we demonstrated that the over-expression of CDCA2 in human primary fibroblasts was able to partially counteract etoposide-induced senescence by mitigating the activation of DNA Damage Response. PMID:24905922

  4. MBSTAR: multiple instance learning for predicting specific functional binding sites in microRNA targets

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, Sanghamitra; Ghosh, Dip; Mitra, Ramkrishna; Zhao, Zhongming

    2015-01-01

    MicroRNA (miRNA) regulates gene expression by binding to specific sites in the 3'untranslated regions of its target genes. Machine learning based miRNA target prediction algorithms first extract a set of features from potential binding sites (PBSs) in the mRNA and then train a classifier to distinguish targets from non-targets. However, they do not consider whether the PBSs are functional or not, and consequently result in high false positive rates. This substantially affects the follow up functional validation by experiments. We present a novel machine learning based approach, MBSTAR (Multiple instance learning of Binding Sites of miRNA TARgets), for accurate prediction of true or functional miRNA binding sites. Multiple instance learning framework is adopted to handle the lack of information about the actual binding sites in the target mRNAs. Biologically validated 9531 interacting and 973 non-interacting miRNA-mRNA pairs are identified from Tarbase 6.0 and confirmed with PAR-CLIP dataset. It is found that MBSTAR achieves the highest number of binding sites overlapping with PAR-CLIP with maximum F-Score of 0.337. Compared to the other methods, MBSTAR also predicts target mRNAs with highest accuracy. The tool and genome wide predictions are available at http://www.isical.ac.in/~bioinfo_miu/MBStar30.htm.

  5. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

    PubMed Central

    Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

    2015-01-01

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5′ to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

  6. Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination.

    PubMed

    Rowley, Paul A; Kachroo, Aashiq H; Ma, Chien-Hui; Maciaszek, Anna D; Guga, Piotr; Jayaram, Makkuni

    2015-07-13

    Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modification. The chemical chirality of MeP, in conjunction with mutant recombinases, reveals the stereochemical contributions of Arg-I and Arg-II. The SP preference of the native reaction is specified primarily by Arg-I. MeP reaction supported by Arg-II is nearly bias-free or RP-biased, depending on the Arg-I substituent. Positional conservation of the arginines does not translate into strict functional conservation. Charge reversal by glutamic acid substitution at Arg-I or Arg-II has opposite effects on Cre and Flp in MeP reactions. In Flp, the base immediately 5' to the scissile MeP strongly influences the choice between the catalytic tyrosine and water as the nucleophile for strand scission, thus between productive recombination and futile hydrolysis. The recombinase active site embodies the evolutionary optimization of interactions that not only favor the normal reaction but also proscribe antithetical side reactions. PMID:25999343

  7. Target sites for chemical regulation of strigolactone signaling.

    PubMed

    Nakamura, Hidemitsu; Asami, Tadao

    2014-01-01

    Demands for plant growth regulators (PGRs; chemicals that control plant growth) are increasing globally, especially in developing countries. Both positive and negative PGRs are widely used to enhance crop production and to suppress unwanted shoot growth, respectively. Strigolactones (SLs) are multifunctional molecules that function as phytohormones, inhibiting shoot branching and also functioning in the rhizospheric communication with symbiotic fungi and parasitic weeds. Therefore, it is anticipated that chemicals that regulate the functions of SLs will be widely used in agricultural applications. Although the SL biosynthetic pathway is not fully understood, it has been demonstrated that β-carotene isomerases, carotenoid cleavage dioxygenases (CCDs), and a cytochrome P450 monooxygenase are involved in strigolactone biosynthesis. A CCD inhibitor, abamine, which is also an inhibitor of abscisic acid biosynthesis, reduces the levels of SL in several plant species and reduces the germination rate of Orobanche minor seeds grown with tobacco. On the basis of the structure of abamine, several chemicals have been designed to specifically inhibit CCDs during SL synthesis. Cytochrome P450 monooxygenase is another target enzyme in the development of SL biosynthesis inhibitors, and the triazole-derived TIS series of chemicals is known to include SL biosynthesis inhibitors, although their target enzyme has not been identified. Recently, DWARF14 (D14) has been shown to be a receptor for SLs, and the D-ring moiety of SL is essential for its recognition by D14. A variety of SL agonists are currently under development and most agonists commonly contain the D-ring or a D-ring-like moiety. Several research groups have also resolved the crystal structure of D14 in the last two years. It is expected that this information on the D14 structure will be invaluable not only for developing SL agonists with novel structures but also in the design of inhibitors of SL receptors. PMID:25414720

  8. A genome-wide map of hyper-edited RNA reveals numerous new sites.

    PubMed

    Porath, Hagit T; Carmi, Shai; Levanon, Erez Y

    2014-01-01

    Adenosine-to-inosine editing is one of the most frequent post-transcriptional modifications, manifested as A-to-G mismatches when comparing RNA sequences with their source DNA. Recently, a number of RNA-seq data sets have been screened for the presence of A-to-G editing, and hundreds of thousands of editing sites identified. Here we show that existing screens missed the majority of sites by ignoring reads with excessive ('hyper') editing that do not easily align to the genome. We show that careful alignment and examination of the unmapped reads in RNA-seq studies reveal numerous new sites, usually many more than originally discovered, and in precisely those regions that are most heavily edited. Specifically, we discover 327,096 new editing sites in the heavily studied Illumina Human BodyMap data and more than double the number of detected sites in several published screens. We also identify thousands of new sites in mouse, rat, opossum and fly. Our results establish that hyper-editing events account for the majority of editing sites. PMID:25158696

  9. Selective small molecule inhibitor of the Mycobacterium tuberculosis fumarate hydratase reveals an allosteric regulatory site

    PubMed Central

    Kasbekar, Monica; Fischer, Gerhard; Mott, Bryan T.; Yasgar, Adam; Hyvönen, Marko; Boshoff, Helena I. M.; Abell, Chris; Barry, Clifton E.; Thomas, Craig J.

    2016-01-01

    Enzymes in essential metabolic pathways are attractive targets for the treatment of bacterial diseases, but in many cases, the presence of homologous human enzymes makes them impractical candidates for drug development. Fumarate hydratase, an essential enzyme in the tricarboxylic acid (TCA) cycle, has been identified as one such potential therapeutic target in tuberculosis. We report the discovery of the first small molecule inhibitor, to our knowledge, of the Mycobacterium tuberculosis fumarate hydratase. A crystal structure at 2.0-Å resolution of the compound in complex with the protein establishes the existence of a previously unidentified allosteric regulatory site. This allosteric site allows for selective inhibition with respect to the homologous human enzyme. We observe a unique binding mode in which two inhibitor molecules interact within the allosteric site, driving significant conformational changes that preclude simultaneous substrate and inhibitor binding. Our results demonstrate the selective inhibition of a highly conserved metabolic enzyme that contains identical active site residues in both the host and the pathogen. PMID:27325754

  10. Selective small molecule inhibitor of the Mycobacterium tuberculosis fumarate hydratase reveals an allosteric regulatory site.

    PubMed

    Kasbekar, Monica; Fischer, Gerhard; Mott, Bryan T; Yasgar, Adam; Hyvönen, Marko; Boshoff, Helena I M; Abell, Chris; Barry, Clifton E; Thomas, Craig J

    2016-07-01

    Enzymes in essential metabolic pathways are attractive targets for the treatment of bacterial diseases, but in many cases, the presence of homologous human enzymes makes them impractical candidates for drug development. Fumarate hydratase, an essential enzyme in the tricarboxylic acid (TCA) cycle, has been identified as one such potential therapeutic target in tuberculosis. We report the discovery of the first small molecule inhibitor, to our knowledge, of the Mycobacterium tuberculosis fumarate hydratase. A crystal structure at 2.0-Å resolution of the compound in complex with the protein establishes the existence of a previously unidentified allosteric regulatory site. This allosteric site allows for selective inhibition with respect to the homologous human enzyme. We observe a unique binding mode in which two inhibitor molecules interact within the allosteric site, driving significant conformational changes that preclude simultaneous substrate and inhibitor binding. Our results demonstrate the selective inhibition of a highly conserved metabolic enzyme that contains identical active site residues in both the host and the pathogen. PMID:27325754

  11. miRTar Hunter: A Prediction System for Identifying Human microRNA Target Sites

    PubMed Central

    Park, Kiejung; Kim, Ki-Bong

    2013-01-01

    MicroRNAs (miRNAs) are important regulators of gene expression and play crucial roles in many biological processes including apoptosis, differentiation, development, and tumorigenesis. Recent estimates suggest that more than 50% of human protein coding genes may be regulated by miRNAs and that each miRNA may bind to 300–400 target genes. Approximately 1, 000 human miRNAs have been identified so far with each having up to hundreds of unique target mRNAs. However, the targets for a majority of these miRNAs have not been identified due to the lack of large-scale experimental detection techniques. Experimental detection of miRNA target sites is a costly and time-consuming process, even though identification of miRNA targets is critical to unraveling their functions in various biological processes. To identify miRNA targets, we developed miRTar Hunter, a novel computational approach for predicting target sites regardless of the presence or absence of a seed match or evolutionary sequence conservation. Our approach is based on a dynamic programming algorithm that incorporates more sequence-specific features and reflects the properties of various types of target sites that determine diverse aspects of complementarities between miRNAs and their targets. We evaluated the performance of our algorithm on 532 known human miRNA:target pairs and 59 experimentally-verified negative miRNA:target pairs, and also compared our method with three popular programs for 481 miRNA:target pairs. miRTar Hunter outperformed three popular existing algorithms in terms of recall and precision, indicating that our unique scheme to quantify the determinants of complementary sites is effective at detecting miRNA targets. miRTar Hunter is now available at http://203.230.194.162/~kbkim. PMID:23475422

  12. A Novel MHC-I Surface Targeted for Binding by the MCMV m06 Immunoevasin Revealed by Solution NMR.

    PubMed

    Sgourakis, Nikolaos G; May, Nathan A; Boyd, Lisa F; Ying, Jinfa; Bax, Ad; Margulies, David H

    2015-11-27

    As part of its strategy to evade detection by the host immune system, murine cytomegalovirus (MCMV) encodes three proteins that modulate cell surface expression of major histocompatibility complex class I (MHC-I) molecules: the MHC-I homolog m152/gp40 as well as the m02-m16 family members m04/gp34 and m06/gp48. Previous studies of the m04 protein revealed a divergent Ig-like fold that is unique to immunoevasins of the m02-m16 family. Here, we engineer and characterize recombinant m06 and investigate its interactions with full-length and truncated forms of the MHC-I molecule H2-L(d) by several techniques. Furthermore, we employ solution NMR to map the interaction footprint of the m06 protein on MHC-I, taking advantage of a truncated H2-L(d), "mini-H2-L(d)," consisting of only the α1α2 platform domain. Mini-H2-L(d) refolded in vitro with a high affinity peptide yields a molecule that shows outstanding NMR spectral features, permitting complete backbone assignments. These NMR-based studies reveal that m06 binds tightly to a discrete site located under the peptide-binding platform that partially overlaps with the β2-microglobulin interface on the MHC-I heavy chain, consistent with in vitro binding experiments showing significantly reduced complex formation between m06 and β2-microglobulin-associated MHC-I. Moreover, we carry out NMR relaxation experiments to characterize the picosecond-nanosecond dynamics of the free mini-H2-L(d) MHC-I molecule, revealing that the site of interaction is highly ordered. This study provides insight into the mechanism of the interaction of m06 with MHC-I, suggesting a structural manipulation of the target MHC-I molecule at an early stage of the peptide-loading pathway. PMID:26463211

  13. Genomewide analysis of Drosophila GAGA factor target genes reveals context-dependent DNA binding

    PubMed Central

    van Steensel, Bas; Delrow, Jeffrey; Bussemaker, Harmen J.

    2003-01-01

    The association of sequence-specific DNA-binding factors with their cognate target sequences in vivo depends on the local molecular context, yet this context is poorly understood. To address this issue, we have performed genomewide mapping of in vivo target genes of Drosophila GAGA factor (GAF). The resulting list of ≈250 target genes indicates that GAF regulates many cellular pathways. We applied unbiased motif-based regression analysis to identify the sequence context that determines GAF binding. Our results confirm that GAF selectively associates with (GA)n repeat elements in vivo. GAF binding occurs in upstream regulatory regions, but less in downstream regions. Surprisingly, GAF binds abundantly to introns but is virtually absent from exons, even though the density of (GA)n is roughly the same. Intron binding occurs equally frequently in last introns compared with first introns, suggesting that GAF may not only regulate transcription initiation, but possibly also elongation. We provide evidence for cooperative binding of GAF to closely spaced (GA)n elements and explain the lack of GAF binding to exons by the absence of such closely spaced GA repeats. Our approach for revealing determinants of context-dependent DNA binding will be applicable to many other transcription factors. PMID:12601174

  14. Revealing potential molecular targets bridging colitis and colorectal cancer based on multidimensional integration strategy

    PubMed Central

    Hu, Yongfei; Li, Xiaobo; Wang, Xishan; Fan, Huihui; Wang, Guiyu; Wang, Dong

    2015-01-01

    Chronic inflammation may play a vital role in the pathogenesis of inflammation-associated tumors. However, the underlying mechanisms bridging ulcerative colitis (UC) and colorectal cancer (CRC) remain unclear. Here, we integrated multidimensional interaction resources, including gene expression profiling, protein-protein interactions (PPIs), transcriptional and post-transcriptional regulation data, and virus-host interactions, to tentatively explore potential molecular targets that functionally link UC and CRC at a systematic level. In this work, by deciphering the overlapping genes, crosstalking genes and pivotal regulators of both UC- and CRC-associated functional module pairs, we revealed a variety of genes (including FOS and DUSP1, etc.), transcription factors (including SMAD3 and ETS1, etc.) and miRNAs (including miR-155 and miR-196b, etc.) that may have the potential to complete the connections between UC and CRC. Interestingly, further analyses of the virus-host interaction network demonstrated that several virus proteins (including EBNA-LP of EBV and protein E7 of HPV) frequently inter-connected to UC- and CRC-associated module pairs with their validated targets significantly enriched in both modules of the host. Together, our results suggested that multidimensional integration strategy provides a novel approach to discover potential molecular targets that bridge the connections between UC and CRC, which could also be extensively applied to studies on other inflammation-related cancers. PMID:26461477

  15. ROV advanced magnetic survey for revealing archaeological targets and estimating medium magnetization

    NASA Astrophysics Data System (ADS)

    Eppelbaum, Lev

    2013-04-01

    Magnetic survey is one of most applied geophysical method for searching and localization of any objects with contrast magnetic properties (for instance, in Israel detailed magneric survey has been succesfully applied at more than 60 archaeological sites (Eppelbaum, 2010, 2011; Eppelbaum et al., 2011, 2010)). However, land magnetic survey at comparatively large archaeological sites (with observation grids 0.5 x 0.5 or 1 x 1 m) may occupy 5-10 days. At the same time the new Remote Operation Vehicle (ROV) generation - small and maneuvering vehicles - can fly at levels of few (and even one) meters over the earth's surface (flowing the relief forms or straight). Such ROV with precise magnetic field measurements (with a frequency of 20-25 observations per second) may be performed during 10-30 minutes, moreover at different levels over the earth's surface. Such geophysical investigations should have an extremely low exploitation cost. Finally, measurements of geophysical fields at different observation levels could provide new unique geophysical-archaeological information (Eppelbaum, 2005; Eppelbaum and Mishne, 2011). The developed interpretation methodology for magnetic anomalies advanced analysis (Khesin et al., 1996; Eppelbaum et al., 2001; Eppelbaum et al., 2011) may be successfully applied for ROV magnetic survey for delineation of archaeological objects and estimation averaged magnetization of geological medium. This methodology includes: (1) non-conventional procedure for elimination of secondary effect of magnetic temporary variations, (2) calculation of rugged relief influence by the use of a correlation method, (3) estimation of medium magnetization, (4) application of various informational and wavelet algorithms for revealing low anomalous effects against the strong noise background, (5) advanced procedures for magnetic anomalies quantitative analysis (they are applicable in conditions of rugged relief, inclined magnetization, and an unknown level of the total

  16. Pollen Expression of Herbicide Target Site Resistance Genes in Annual Ryegrass (Lolium rigidum).

    PubMed Central

    Richter, J.; Powles, S. B.

    1993-01-01

    Herbicide resistance can occur either through target-site insensitivity or by nontarget site-based mechanisms. Two herbicide-resistant biotypes of Lolium rigidum Gaud., one resistant to acetolactate synthase (ALS)-inhibiting herbicides (biotype WLR1) and the other resistant to acetyl CoA carboxylase (ACCase)-inhibiting herbicides (biotype WLR96) through target-site insensitivity at the whole plant and enzymic levels, were found to express this resistance in the pollen. Pollen produced by resistant biotypes grew uninhibited when challenged with herbicide, whereas that from a susceptible biotype was inhibited. A third biotype, SLR31, resistant to ACCase-inhibiting and certain ALS-inhibiting herbicides at the whole plant level through nontarget site-based mechanisms, did not exhibit this expression in the pollen. The technique described may form the basis for a rapid screen for certain nuclear-encoded, target site-based herbicide-resistance mechanisms. PMID:12231886

  17. Targeting and Processing of Site-specific DNA Interstrand Crosslinks

    PubMed Central

    Vasquez, Karen M.

    2010-01-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, and thus ICL-inducing agents such as cyclophosphamide, melphalan, cisplatin, psoralen and mitomycin C have been used clinically as anti-cancer drugs for decades. ICLs can also be formed endogenously as a consequence of cellular metabolic processes. ICL-inducing agents continue to be among the most effective chemotherapeutic treatments for many cancers; however, treatment with these agents can lead to secondary malignancies, in part due to mutagenic processing of the DNA lesions. The mechanisms of ICL repair have been characterized more thoroughly in bacteria and yeast than in mammalian cells. Thus, a better understanding the molecular mechanisms of ICL processing offers the potential to improve the efficacy of these drugs in cancer therapy. In mammalian cells it is thought that ICLs are repaired by the coordination of proteins from several pathways, including nucleotide excision repair (NER), base excision repair (BER), mismatch repair (MMR), homologous recombination (HR), translesion synthesis (TLS), and proteins involved in Fanconi anemia (FA). In this review, we focus on the potential functions of NER, MMR, and HR proteins in the repair of and response to ICLs in human cells and in mice. We will also discuss a unique approach, using psoralen covalently linked to triplex-forming oligonucleotides to direct ICLs to specific sites in the mammalian genome. PMID:20196133

  18. Structure of inorganic pyrophosphatase from Staphylococcus aureus reveals conformational flexibility of the active site.

    PubMed

    Gajadeera, Chathurada S; Zhang, Xinyi; Wei, Yinan; Tsodikov, Oleg V

    2015-02-01

    Cytoplasmic inorganic pyrophosphatase (PPiase) is an enzyme essential for survival of organisms, from bacteria to human. PPiases are divided into two structurally distinct families: family I PPiases are Mg(2+)-dependent and present in most archaea, eukaryotes and prokaryotes, whereas the relatively less understood family II PPiases are Mn(2+)-dependent and present only in some archaea, bacteria and primitive eukaryotes. Staphylococcus aureus (SA), a dangerous pathogen and a frequent cause of hospital infections, contains a family II PPiase (PpaC), which is an attractive potential target for development of novel antibacterial agents. We determined a crystal structure of SA PpaC in complex with catalytic Mn(2+) at 2.1Å resolution. The active site contains two catalytic Mn(2+) binding sites, each half-occupied, reconciling the previously observed 1:1 Mn(2+):enzyme stoichiometry with the presence of two divalent metal ion sites in the apo-enzyme. Unexpectedly, despite the absence of the substrate or products in the active site, the two domains of SA PpaC form a closed active site, a conformation observed in structures of other family II PPiases only in complex with substrate or product mimics. A region spanning residues 295-298, which contains a conserved substrate binding RKK motif, is flipped out of the active site, an unprecedented conformation for a PPiase. Because the mutant of Arg295 to an alanine is devoid of activity, this loop likely undergoes an induced-fit conformational change upon substrate binding and product dissociation. This closed conformation of SA PPiase may serve as an attractive target for rational design of inhibitors of this enzyme. PMID:25576794

  19. Chemical Proteomics Reveals Ferrochelatase as a Common Off-target of Kinase Inhibitors.

    PubMed

    Klaeger, Susan; Gohlke, Bjoern; Perrin, Jessica; Gupta, Vipul; Heinzlmeir, Stephanie; Helm, Dominic; Qiao, Huichao; Bergamini, Giovanna; Handa, Hiroshi; Savitski, Mikhail M; Bantscheff, Marcus; Médard, Guillaume; Preissner, Robert; Kuster, Bernhard

    2016-05-20

    Many protein kinases are valid drug targets in oncology because they are key components of signal transduction pathways. The number of clinical kinase inhibitors is on the rise, but these molecules often exhibit polypharmacology, potentially eliciting desired and toxic effects. Therefore, a comprehensive assessment of a compound's target space is desirable for a better understanding of its biological effects. The enzyme ferrochelatase (FECH) catalyzes the conversion of protoporphyrin IX into heme and was recently found to be an off-target of the BRAF inhibitor Vemurafenib, likely explaining the phototoxicity associated with this drug in melanoma patients. This raises the question of whether FECH binding is a more general feature of kinase inhibitors. To address this, we applied a chemical proteomics approach using kinobeads to evaluate 226 clinical kinase inhibitors for their ability to bind FECH. Surprisingly, low or submicromolar FECH binding was detected for 29 of all compounds tested and isothermal dose response measurements confirmed target engagement in cells. We also show that Vemurafenib, Linsitinib, Neratinib, and MK-2461 reduce heme levels in K562 cells, verifying that drug binding leads to a loss of FECH activity. Further biochemical and docking experiments identified the protoporphyrin pocket in FECH as one major drug binding site. Since the genetic loss of FECH activity leads to photosensitivity in humans, our data strongly suggest that FECH inhibition by kinase inhibitors is the molecular mechanism triggering photosensitivity in patients. We therefore suggest that a FECH assay should generally be part of the preclinical molecular toxicology package for the development of kinase inhibitors. PMID:26863403

  20. Diversity-Oriented Synthesis Probe Targets Plasmodium falciparum Cytochrome b Ubiquinone Reduction Site and Synergizes With Oxidation Site Inhibitors

    PubMed Central

    Lukens, Amanda K.; Heidebrecht, Richard W.; Mulrooney, Carol; Beaudoin, Jennifer A.; Comer, Eamon; Duvall, Jeremy R.; Fitzgerald, Mark E.; Masi, Daniela; Galinsky, Kevin; Scherer, Christina A.; Palmer, Michelle; Munoz, Benito; Foley, Michael; Schreiber, Stuart L.; Wiegand, Roger C.; Wirth, Dyann F.

    2015-01-01

    Background. The emergence and spread of drug resistance to current antimalarial therapies remains a pressing concern, escalating the need for compounds that demonstrate novel modes of action. Diversity-Oriented Synthesis (DOS) libraries bridge the gap between conventional small molecule and natural product libraries, allowing the interrogation of more diverse chemical space in efforts to identify probes of novel parasite pathways. Methods. We screened and optimized a probe from a DOS library using whole-cell phenotypic assays. Resistance selection and whole-genome sequencing approaches were employed to identify the cellular target of the compounds. Results. We identified a novel macrocyclic inhibitor of Plasmodium falciparum with nanomolar potency and identified the reduction site of cytochrome b as its cellular target. Combination experiments with reduction and oxidation site inhibitors showed synergistic inhibition of the parasite. Conclusions. The cytochrome b oxidation center is a validated antimalarial target. We show that the reduction site of cytochrome b is also a druggable target. Our results demonstrating a synergistic relationship between oxidation and reduction site inhibitors suggests a future strategy for new combination therapies in the treatment of malaria. PMID:25336726

  1. Benzene Probes in Molecular Dynamics Simulations Reveal Novel Binding Sites for Ligand Design.

    PubMed

    Tan, Yaw Sing; Reeks, Judith; Brown, Christopher J; Thean, Dawn; Ferrer Gago, Fernando Jose; Yuen, Tsz Ying; Goh, Eunice Tze Leng; Lee, Xue Er Cheryl; Jennings, Claire E; Joseph, Thomas L; Lakshminarayanan, Rajamani; Lane, David P; Noble, Martin E M; Verma, Chandra S

    2016-09-01

    Protein flexibility poses a major challenge in binding site identification. Several computational pocket detection methods that utilize small-molecule probes in molecular dynamics (MD) simulations have been developed to address this issue. Although they have proven hugely successful at reproducing experimental structural data, their ability to predict new binding sites that are yet to be identified and characterized has not been demonstrated. Here, we report the use of benzenes as probe molecules in ligand-mapping MD (LMMD) simulations to predict the existence of two novel binding sites on the surface of the oncoprotein MDM2. One of them was serendipitously confirmed by biophysical assays and X-ray crystallography to be important for the binding of a new family of hydrocarbon stapled peptides that were specifically designed to target the other putative site. These results highlight the predictive power of LMMD and suggest that predictions derived from LMMD simulations can serve as a reliable basis for the identification of novel ligand binding sites in structure-based drug design. PMID:27532490

  2. Targeted and genome-scale methylomics reveals gene body signatures in human cell lines

    PubMed Central

    Ball, Madeleine Price; Li, Jin Billy; Gao, Yuan; Lee, Je-Hyuk; LeProust, Emily; Park, In-Hyun; Xie, Bin; Daley, George Q.; Church, George M.

    2012-01-01

    Cytosine methylation, an epigenetic modification of DNA, is a target of growing interest for developing high throughput profiling technologies. Here we introduce two new, complementary techniques for cytosine methylation profiling utilizing next generation sequencing technology: bisulfite padlock probes (BSPPs) and methyl sensitive cut counting (MSCC). In the first method, we designed a set of ~10,000 BSPPs distributed over the ENCODE pilot project regions to take advantage of existing expression and chromatin immunoprecipitation data. We observed a pattern of low promoter methylation coupled with high gene body methylation in highly expressed genes. Using the second method, MSCC, we gathered genome-scale data for 1.4 million HpaII sites and confirmed that gene body methylation in highly expressed genes is a consistent phenomenon over the entire genome. Our observations highlight the usefulness of techniques which are not inherently or intentionally biased in favor of only profiling particular subsets like CpG islands or promoter regions. PMID:19329998

  3. In vivo activation of azipropofol prolongs anesthesia and reveals synaptic targets.

    PubMed

    Weiser, Brian P; Kelz, Max B; Eckenhoff, Roderic G

    2013-01-11

    General anesthetic photolabels have been instrumental in discovering and confirming protein binding partners and binding sites of these promiscuous ligands. We report the in vivo photoactivation of meta-azipropofol, a potent analog of propofol, in Xenopus laevis tadpoles. Covalent adduction of meta-azipropofol in vivo prolongs the primary pharmacologic effect of general anesthetics in a behavioral phenotype we termed "optoanesthesia." Coupling this behavior with a tritiated probe, we performed unbiased, time-resolved gel proteomics to identify neuronal targets of meta-azipropofol in vivo. We have identified synaptic binding partners, such as synaptosomal-associated protein 25, as well as voltage-dependent anion channels as potential facilitators of the general anesthetic state. Pairing behavioral phenotypes elicited by the activation of efficacious photolabels in vivo with time-resolved proteomics provides a novel approach to investigate molecular mechanisms of general anesthetics. PMID:23184948

  4. In Vivo Activation of Azipropofol Prolongs Anesthesia and Reveals Synaptic Targets*

    PubMed Central

    Weiser, Brian P.; Kelz, Max B.; Eckenhoff, Roderic G.

    2013-01-01

    General anesthetic photolabels have been instrumental in discovering and confirming protein binding partners and binding sites of these promiscuous ligands. We report the in vivo photoactivation of meta-azipropofol, a potent analog of propofol, in Xenopus laevis tadpoles. Covalent adduction of meta-azipropofol in vivo prolongs the primary pharmacologic effect of general anesthetics in a behavioral phenotype we termed “optoanesthesia.” Coupling this behavior with a tritiated probe, we performed unbiased, time-resolved gel proteomics to identify neuronal targets of meta-azipropofol in vivo. We have identified synaptic binding partners, such as synaptosomal-associated protein 25, as well as voltage-dependent anion channels as potential facilitators of the general anesthetic state. Pairing behavioral phenotypes elicited by the activation of efficacious photolabels in vivo with time-resolved proteomics provides a novel approach to investigate molecular mechanisms of general anesthetics. PMID:23184948

  5. Synergistic active targeting of dually integrin αvβ3/CD44-targeted nanoparticles to B16F10 tumors located at different sites of mouse bodies.

    PubMed

    Shi, Sanjun; Zhou, Min; Li, Xin; Hu, Min; Li, Chenwen; Li, Min; Sheng, Fangfang; Li, Zhuoheng; Wu, Guolin; Luo, Minghe; Cui, Huanhuan; Li, Ziwei; Fu, Ruoqiu; Xiang, Mingfeng; Xu, Jing; Zhang, Qian; Lu, Laichun

    2016-08-10

    Conventional enhanced permeation and retention (EPR) mediates the effects of many drugs, including the accumulation of nanocarriers at tumor sites, but its efficiency remains low. In this study, this limitation was overcome by developing a dual-targeting delivery system based on hyaluronan (HA, a major ligand of CD44) and tetraiodothyroacetic acid (tetrac, a specific ligand of αvβ3), which was exploited to carry docetaxel (DTX) for the synergistic active targeting to tumors. First, a tetrac-HA (TeHA) conjugate was synthesized and grafted onto the surfaces of solid lipid nanoparticles (SLNs) (TeHA-SLNs/DTX), with a high encapsulation efficiency of >91.6%. The resulting SLNs exhibited an approximately toroid morphology revealed using TEM. The cellular uptake and cytotoxicity of various formulations on CD44/αvβ3-enriched B16F10 cells were then assessed, and both results confirmed the selective uptake and high cytotoxicity of the TeHA-SLNs/DTX in a TeHA-dependent manner. In vivo imaging and vessel distribution tests revealed the efficiency of synergistic active targeting was higher than that of EPR-mediated passive targeting by the TeHA-SLNs to αvβ3-expressing tumor blood vessels and CD44-expressing tumor cells via selective targeting. Finally, in both xenograft tumor mice and in situ lung metastasis tumor mice, tumor growth was significantly inhibited by TeHA-SLNs/DTX. Therefore, TeHA-SLNs are an efficient system for the dual-targeted delivery of drugs to treat cancer in vivo. PMID:27235150

  6. Metabolite profiling of antidepressant drug action reveals novel drug targets beyond monoamine elevation

    PubMed Central

    Webhofer, C; Gormanns, P; Tolstikov, V; Zieglgänsberger, W; Sillaber, I; Holsboer, F; Turck, C W

    2011-01-01

    Currently used antidepressants elevate monoamine levels in the synaptic cleft. There is good reason to assume that this is not the only source for antidepressant therapeutic activities and that secondary downstream effects may be relevant for alleviating symptoms of depression. We attempted to elucidate affected biochemical pathways downstream of monoamine reuptake inhibition by interrogating metabolomic profiles in DBA/2Ola mice after chronic paroxetine treatment. Metabolomic changes were investigated using gas chromatography-mass spectrometry profiling and group differences were analyzed by univariate and multivariate statistics. Pathways affected by antidepressant treatment were related to energy metabolism, amino acid metabolism and hormone signaling. The identified pathways reveal further antidepressant therapeutic action and represent targets for drug development efforts. A comparison of the central nervous system with blood plasma metabolite alterations identified GABA, galactose-6-phosphate and leucine as biomarker candidates for assessment of antidepressant treatment effects in the periphery. PMID:22832350

  7. Recovery of perennial vegetation in military target sites in the eastern Mohave Desert, Arizona

    USGS Publications Warehouse

    Steiger, John W.; Webb, Robert H.

    2000-01-01

    The effect of the age of geomorphic surfaces on the recovery of desert vegetation in military target sites was studied in the Mohave and Cerbat Mountains of northwestern Arizona. The target sites were cleared of all vegetation during military exercises in 1942-1943 and have not been subsequently disturbed. The degree of recovery was measured by calculating percentage-similarity (PS) and correlation-coefficient indices on the basis of differences in cover, density, and volume of species growing in and out of each target site. PS values, ranging from 22.7 to 95.1 percent (100 percent = identical composition), indicate a wide range of recovery that is partially controlled by the edaphic properties of the geomorphic surfaces. Statistical analyses show a strong pattern that indicates a greater variability in the degree of recovery for sites on older surfaces than on younger surfaces and a weak pattern that indicates an inverse relation between the degree of recovery and geomorphic age. Comparisons of the different effects of target site construction on the edaphic characteristics of each target site provides an explanation for these patterns and suggests the soil properties critical to the recovery process. Statistically significant negative or positive response to disturbance for most species are independent of the age of the geomorphic surfaces; however, there is strong evidence for a shift in response for the common perennial species Acamptopappus sphaerocephalus, and to a lesser extent, Salazaria mexicana, Encelia farinosa, and Coldenia canescens, among different geomorphic surfaces.

  8. Comprehensive reanalysis of transcription factor knockout expression data in Saccharomyces cerevisiae reveals many new targets.

    PubMed

    Reimand, Jüri; Vaquerizas, Juan M; Todd, Annabel E; Vilo, Jaak; Luscombe, Nicholas M

    2010-08-01

    Transcription factor (TF) perturbation experiments give valuable insights into gene regulation. Genome-scale evidence from microarray measurements may be used to identify regulatory interactions between TFs and targets. Recently, Hu and colleagues published a comprehensive study covering 269 TF knockout mutants for the yeast Saccharomyces cerevisiae. However, the information that can be extracted from this valuable dataset is limited by the method employed to process the microarray data. Here, we present a reanalysis of the original data using improved statistical techniques freely available from the BioConductor project. We identify over 100,000 differentially expressed genes-nine times the total reported by Hu et al. We validate the biological significance of these genes by assessing their functions, the occurrence of upstream TF-binding sites, and the prevalence of protein-protein interactions. The reanalysed dataset outperforms the original across all measures, indicating that we have uncovered a vastly expanded list of relevant targets. In summary, this work presents a high-quality reanalysis that maximizes the information contained in the Hu et al. compendium. The dataset is available from ArrayExpress (accession: E-MTAB-109) and it will be invaluable to any scientist interested in the yeast transcriptional regulatory system. PMID:20385592

  9. Copy number and targeted mutational analysis reveals novel somatic events in metastatic prostate tumors.

    PubMed

    Robbins, Christiane M; Tembe, Waibov A; Baker, Angela; Sinari, Shripad; Moses, Tracy Y; Beckstrom-Sternberg, Stephen; Beckstrom-Sternberg, James; Barrett, Michael; Long, James; Chinnaiyan, Arul; Lowey, James; Suh, Edward; Pearson, John V; Craig, David W; Agus, David B; Pienta, Kenneth J; Carpten, John D

    2011-01-01

    Advanced prostate cancer can progress to systemic metastatic tumors, which are generally androgen insensitive and ultimately lethal. Here, we report a comprehensive genomic survey for somatic events in systemic metastatic prostate tumors using both high-resolution copy number analysis and targeted mutational survey of 3508 exons from 577 cancer-related genes using next generation sequencing. Focal homozygous deletions were detected at 8p22, 10q23.31, 13q13.1, 13q14.11, and 13q14.12. Key genes mapping within these deleted regions include PTEN, BRCA2, C13ORF15, and SIAH3. Focal high-level amplifications were detected at 5p13.2-p12, 14q21.1, 7q22.1, and Xq12. Key amplified genes mapping within these regions include SKP2, FOXA1, and AR. Furthermore, targeted mutational analysis of normal-tumor pairs has identified somatic mutations in genes known to be associated with prostate cancer including AR and TP53, but has also revealed novel somatic point mutations in genes including MTOR, BRCA2, ARHGEF12, and CHD5. Finally, in one patient where multiple independent metastatic tumors were available, we show common and divergent somatic alterations that occur at both the copy number and point mutation level, supporting a model for a common clonal progenitor with metastatic tumor-specific divergence. Our study represents a deep genomic analysis of advanced metastatic prostate tumors and has revealed candidate somatic alterations, possibly contributing to lethal prostate cancer. PMID:21147910

  10. Copy number and targeted mutational analysis reveals novel somatic events in metastatic prostate tumors

    PubMed Central

    Robbins, Christiane M.; Tembe, Waibov A.; Baker, Angela; Sinari, Shripad; Moses, Tracy Y.; Beckstrom-Sternberg, Stephen; Beckstrom-Sternberg, James; Barrett, Michael; Long, James; Chinnaiyan, Arul; Lowey, James; Suh, Edward; Pearson, John V.; Craig, David W.; Agus, David B.; Pienta, Kenneth J.; Carpten, John D.

    2011-01-01

    Advanced prostate cancer can progress to systemic metastatic tumors, which are generally androgen insensitive and ultimately lethal. Here, we report a comprehensive genomic survey for somatic events in systemic metastatic prostate tumors using both high-resolution copy number analysis and targeted mutational survey of 3508 exons from 577 cancer-related genes using next generation sequencing. Focal homozygous deletions were detected at 8p22, 10q23.31, 13q13.1, 13q14.11, and 13q14.12. Key genes mapping within these deleted regions include PTEN, BRCA2, C13ORF15, and SIAH3. Focal high-level amplifications were detected at 5p13.2-p12, 14q21.1, 7q22.1, and Xq12. Key amplified genes mapping within these regions include SKP2, FOXA1, and AR. Furthermore, targeted mutational analysis of normal-tumor pairs has identified somatic mutations in genes known to be associated with prostate cancer including AR and TP53, but has also revealed novel somatic point mutations in genes including MTOR, BRCA2, ARHGEF12, and CHD5. Finally, in one patient where multiple independent metastatic tumors were available, we show common and divergent somatic alterations that occur at both the copy number and point mutation level, supporting a model for a common clonal progenitor with metastatic tumor-specific divergence. Our study represents a deep genomic analysis of advanced metastatic prostate tumors and has revealed candidate somatic alterations, possibly contributing to lethal prostate cancer. PMID:21147910

  11. Genome-wide target specificities of CRISPR-Cas9 nucleases revealed by multiplex Digenome-seq

    PubMed Central

    Kim, Daesik; Kim, Sojung; Kim, Sunghyun; Park, Jeongbin; Kim, Jin-Soo

    2016-01-01

    We present multiplex Digenome-seq to profile genome-wide specificities of up to 11 CRISPR-Cas9 nucleases simultaneously, saving time and reducing cost. Cell-free human genomic DNA was digested using multiple sgRNAs combined with the Cas9 protein and then subjected to whole-genome sequencing. In vitro cleavage patterns, characteristic of on- and off-target sites, were computationally identified across the genome using a new DNA cleavage scoring system. We found that many false-positive, bulge-type off-target sites were cleaved by sgRNAs transcribed from an oligonucleotide duplex but not by those transcribed from a plasmid template. Multiplex Digenome-seq captured many bona fide off-target sites, missed by other genome-wide methods, at which indels were induced at frequencies <0.1%. After analyzing 964 sites cleaved in vitro by these sgRNAs and measuring indel frequencies at hundreds of off-target sites in cells, we propose a guideline for the choice of target sites for minimizing CRISPR-Cas9 off-target effects in the human genome. PMID:26786045

  12. High-throughput mutagenesis reveals functional determinants for DNA targeting by activation-induced deaminase.

    PubMed

    Gajula, Kiran S; Huwe, Peter J; Mo, Charlie Y; Crawford, Daniel J; Stivers, James T; Radhakrishnan, Ravi; Kohli, Rahul M

    2014-09-01

    Antibody maturation is a critical immune process governed by the enzyme activation-induced deaminase (AID), a member of the AID/APOBEC DNA deaminase family. AID/APOBEC deaminases preferentially target cytosine within distinct preferred sequence motifs in DNA, with specificity largely conferred by a small 9-11 residue protein loop that differs among family members. Here, we aimed to determine the key functional characteristics of this protein loop in AID and to thereby inform our understanding of the mode of DNA engagement. To this end, we developed a methodology (Sat-Sel-Seq) that couples saturation mutagenesis at each position across the targeting loop, with iterative functional selection and next-generation sequencing. This high-throughput mutational analysis revealed dominant characteristics for residues within the loop and additionally yielded enzymatic variants that enhance deaminase activity. To rationalize these functional requirements, we performed molecular dynamics simulations that suggest that AID and its hyperactive variants can engage DNA in multiple specific modes. These findings align with AID's competing requirements for specificity and flexibility to efficiently drive antibody maturation. Beyond insights into the AID-DNA interface, our Sat-Sel-Seq approach also serves to further expand the repertoire of techniques for deep positional scanning and may find general utility for high-throughput analysis of protein function. PMID:25064858

  13. High-throughput mutagenesis reveals functional determinants for DNA targeting by activation-induced deaminase

    PubMed Central

    Gajula, Kiran S.; Huwe, Peter J.; Mo, Charlie Y.; Crawford, Daniel J.; Stivers, James T.; Radhakrishnan, Ravi; Kohli, Rahul M.

    2014-01-01

    Antibody maturation is a critical immune process governed by the enzyme activation-induced deaminase (AID), a member of the AID/APOBEC DNA deaminase family. AID/APOBEC deaminases preferentially target cytosine within distinct preferred sequence motifs in DNA, with specificity largely conferred by a small 9–11 residue protein loop that differs among family members. Here, we aimed to determine the key functional characteristics of this protein loop in AID and to thereby inform our understanding of the mode of DNA engagement. To this end, we developed a methodology (Sat-Sel-Seq) that couples saturation mutagenesis at each position across the targeting loop, with iterative functional selection and next-generation sequencing. This high-throughput mutational analysis revealed dominant characteristics for residues within the loop and additionally yielded enzymatic variants that enhance deaminase activity. To rationalize these functional requirements, we performed molecular dynamics simulations that suggest that AID and its hyperactive variants can engage DNA in multiple specific modes. These findings align with AID's competing requirements for specificity and flexibility to efficiently drive antibody maturation. Beyond insights into the AID-DNA interface, our Sat-Sel-Seq approach also serves to further expand the repertoire of techniques for deep positional scanning and may find general utility for high-throughput analysis of protein function. PMID:25064858

  14. Integrative Molecular Profiling Reveals Asparagine Synthetase Is a Target in Castration-Resistant Prostate Cancer

    PubMed Central

    Sircar, Kanishka; Huang, Heng; Hu, Limei; Cogdell, David; Dhillon, Jasreman; Tzelepi, Vassiliki; Efstathiou, Eleni; Koumakpayi, Ismaël H.; Saad, Fred; Luo, Dijun; Bismar, Tarek A.; Aparicio, Ana; Troncoso, Patricia; Navone, Nora; Zhang, Wei

    2013-01-01

    The identification of new and effective therapeutic targets for the lethal, castration-resistant stage of prostate cancer (CRPC) has been challenging because of both the paucity of adequate frozen tissues and a lack of integrated molecular analysis. Therefore, in this study, we performed a genome-wide analysis of DNA copy number alterations from 34 unique surgical CRPC specimens and 5 xenografts, with matched transcriptomic profiling of 25 specimens. An integrated analysis of these data revealed that the asparagine synthetase (ASNS) gene showed a gain in copy number and was overexpressed at the transcript level. The overexpression of ASNS was validated by analyzing other public CRPC data sets. ASNS protein expression, as detected by reverse-phase protein lysate array, was tightly correlated with gene copy number. In addition, ASNS protein expression, as determined by IHC analysis, was associated with progression to a therapy-resistant disease state in TMAs that included 77 castration-resistant and 40 untreated prostate cancer patient samples. Knockdown of ASNS by small-interfering RNAs in asparagine-deprived media led to growth inhibition in both androgen-responsive (ie, LNCaP) and castration-resistant (ie, C4-2B) prostate cancer cell lines and in cells isolated from a CRPC xenograft (ie, MDA PCa 180-30). Together, our results suggest that ASNS is up-regulated in cases of CRPC and that depletion of asparagine using ASNS inhibitors will be a novel strategy for targeting CRPC cells. PMID:22245216

  15. Substrate-mediated Stabilization of a Tetrameric Drug Target Reveals Achilles Heel in Anthrax*

    PubMed Central

    Voss, Jarrod E.; Scally, Stephen W.; Taylor, Nicole L.; Atkinson, Sarah C.; Griffin, Michael D. W.; Hutton, Craig A.; Parker, Michael W.; Alderton, Malcolm R.; Gerrard, Juliet A.; Dobson, Renwick C. J.; Dogovski, Con; Perugini, Matthew A.

    2010-01-01

    Bacillus anthracis is a Gram-positive spore-forming bacterium that causes anthrax. With the increased threat of anthrax in biowarfare, there is an urgent need to characterize new antimicrobial targets from B. anthracis. One such target is dihydrodipicolinate synthase (DHDPS), which catalyzes the committed step in the pathway yielding meso-diaminopimelate and lysine. In this study, we employed CD spectroscopy to demonstrate that the thermostability of DHDPS from B. anthracis (Ba-DHDPS) is significantly enhanced in the presence of the substrate, pyruvate. Analytical ultracentrifugation studies show that the tetramer-dimer dissociation constant of the enzyme is 3-fold tighter in the presence of pyruvate compared with the apo form. To examine the significance of this substrate-mediated stabilization phenomenon, a dimeric mutant of Ba-DHDPS (L170E/G191E) was generated and shown to have markedly reduced activity compared with the wild-type tetramer. This demonstrates that the substrate, pyruvate, stabilizes the active form of the enzyme. We next determined the high resolution (2.15 Å) crystal structure of Ba-DHDPS in complex with pyruvate (3HIJ) and compared this to the apo structure (1XL9). Structural analyses show that there is a significant (91 Å2) increase in buried surface area at the tetramerization interface of the pyruvate-bound structure. This study describes a new mechanism for stabilization of the active oligomeric form of an antibiotic target from B. anthracis and reveals an “Achilles heel” that can be exploited in structure-based drug design. PMID:19948665

  16. Modulators of Stomatal Lineage Signal Transduction Alter Membrane Contact Sites and Reveal Specialization among ERECTA Kinases.

    PubMed

    Ho, Chin-Min Kimmy; Paciorek, Tomasz; Abrash, Emily; Bergmann, Dominique C

    2016-08-22

    Signal transduction from a cell's surface to its interior requires dedicated signaling elements and a cellular environment conducive to signal propagation. Plant development, defense, and homeostasis rely on plasma membrane receptor-like kinases to perceive endogenous and environmental signals, but little is known about their immediate downstream targets and signaling modifiers. Using genetics, biochemistry, and live-cell imaging, we show that the VAP-RELATED SUPPRESSOR OF TMM (VST) family is required for ERECTA-mediated signaling in growth and cell-fate determination and reveal a role for ERECTA-LIKE2 in modulating signaling by its sister kinases. We show that VSTs are peripheral plasma membrane proteins that can form complexes with integral ER-membrane proteins, thereby potentially influencing the organization of the membrane milieu to promote efficient and differential signaling from the ERECTA-family members to their downstream intracellular targets. PMID:27554856

  17. Whole Exome Sequencing Reveals Novel PHEX Splice Site Mutations in Patients with Hypophosphatemic Rickets

    PubMed Central

    Gillies, Christopher; Sampson, Matthew G.; Kher, Vijay; Sethi, Sidharth K.; Otto, Edgar A.

    2015-01-01

    Objective Hypophosphatemic rickets (HR) is a heterogeneous genetic phosphate wasting disorder. The disease is most commonly caused by mutations in the PHEX gene located on the X-chromosome or by mutations in CLCN5, DMP1, ENPP1, FGF23, and SLC34A3. The aims of this study were to perform molecular diagnostics for four patients with HR of Indian origin (two independent families) and to describe their clinical features. Methods We performed whole exome sequencing (WES) for the affected mother of two boys who also displayed the typical features of HR, including bone malformations and phosphate wasting. B-lymphoblast cell lines were established by EBV transformation and subsequent RT-PCR to investigate an uncommon splice site variant found by WES. An in silico analysis was done to obtain accurate nucleotide frequency occurrences of consensus splice positions other than the canonical sites of all human exons. Additionally, we applied direct Sanger sequencing for all exons and exon/intron boundaries of the PHEX gene for an affected girl from an independent second Indian family. Results WES revealed a novel PHEX splice acceptor mutation in intron 9 (c.1080-3C>A) in a family with 3 affected individuals with HR. The effect on splicing of this mutation was further investigated by RT-PCR using RNA obtained from a patient’s EBV-transformed lymphoblast cell line. RT-PCR revealed an aberrant splice transcript skipping exons 10-14 which was not observed in control samples, confirming the diagnosis of X-linked dominant hypophosphatemia (XLH). The in silico analysis of all human splice sites adjacent to all 327,293 exons across 81,814 transcripts among 20,345 human genes revealed that cytosine is, with 64.3%, the most frequent nucleobase at the minus 3 splice acceptor position, followed by thymidine with 28.7%, adenine with 6.3%, and guanine with 0.8%. We generated frequency tables and pictograms for the extended donor and acceptor splice consensus regions by analyzing all human

  18. Nanopharmacological Force Sensing to Reveal Allosteric Coupling in Transporter Binding Sites.

    PubMed

    Zhu, Rong; Sinwel, Doris; Hasenhuetl, Peter S; Saha, Kusumika; Kumar, Vivek; Zhang, Peng; Rankl, Christian; Holy, Marion; Sucic, Sonja; Kudlacek, Oliver; Karner, Andreas; Sandtner, Walter; Stockner, Thomas; Gruber, Hermann J; Freissmuth, Michael; Hauck Newman, Amy; Sitte, Harald H; Hinterdorfer, Peter

    2016-01-26

    Controversy regarding the number and function of ligand binding sites in neurotransmitter/sodium symporters arose from conflicting data in crystal structures and molecular pharmacology. Here, we have designed novel tools for atomic force microscopy that directly measure the interaction forces between the serotonin transporter (SERT) and the S- and R-enantiomers of citalopram on the single molecule level. This approach is based on force spectroscopy, which allows for the extraction of dynamic information under physiological conditions thus inaccessible via X-ray crystallography. Two distinct populations of characteristic binding strengths of citalopram to SERT were revealed in Na(+)-containing buffer. In contrast, in Li(+) -containing buffer, SERT showed only low force interactions. Conversely, the vestibular mutant SERT-G402H merely displayed the high force population. These observations provide physical evidence for the existence of two binding sites in SERT when accessed in a physiological context. Competition experiments revealed that these two sites are allosterically coupled and exert reciprocal modulation. PMID:26695726

  19. Targeted mutagenesis of zebrafish antithrombin III triggers disseminated intravascular coagulation and thrombosis, revealing insight into function

    PubMed Central

    Liu, Yang; Kretz, Colin A.; Maeder, Morgan L.; Richter, Catherine E.; Tsao, Philip; Vo, Andy H.; Huarng, Michael C.; Rode, Thomas; Hu, Zhilian; Mehra, Rohit; Olson, Steven T.; Joung, J. Keith

    2014-01-01

    Pathologic blood clotting is a leading cause of morbidity and mortality in the developed world, underlying deep vein thrombosis, myocardial infarction, and stroke. Genetic predisposition to thrombosis is still poorly understood, and we hypothesize that there are many additional risk alleles and modifying factors remaining to be discovered. Mammalian models have contributed to our understanding of thrombosis, but are low throughput and costly. We have turned to the zebrafish, a tool for high-throughput genetic analysis. Using zinc finger nucleases, we show that disruption of the zebrafish antithrombin III (at3) locus results in spontaneous venous thrombosis in larvae. Although homozygous mutants survive into early adulthood, they eventually succumb to massive intracardiac thrombosis. Characterization of null fish revealed disseminated intravascular coagulation in larvae secondary to unopposed thrombin activity and fibrinogen consumption, which could be rescued by both human and zebrafish at3 complementary DNAs. Mutation of the human AT3-reactive center loop abolished the ability to rescue, but the heparin-binding site was dispensable. These results demonstrate overall conservation of AT3 function in zebrafish, but reveal developmental variances in the ability to tolerate excessive clot formation. The accessibility of early zebrafish development will provide unique methods for dissection of the underlying mechanisms of thrombosis. PMID:24782510

  20. Near Surface Swimming of Salmonella Typhimurium Explains Target-Site Selection and Cooperative Invasion

    PubMed Central

    Kreibich, Saskia; Vonaesch, Pascale; Andritschke, Daniel; Rout, Samuel; Weidner, Kerstin; Sormaz, Milos; Songhet, Pascal; Horvath, Peter; Chabria, Mamta; Vogel, Viola; Spori, Doris M.; Jenny, Patrick; Hardt, Wolf-Dietrich

    2012-01-01

    Targeting of permissive entry sites is crucial for bacterial infection. The targeting mechanisms are incompletely understood. We have analyzed target-site selection by S. Typhimurium. This enteropathogenic bacterium employs adhesins (e.g. fim) and the type III secretion system 1 (TTSS-1) for host cell binding, the triggering of ruffles and invasion. Typically, S. Typhimurium invasion is focused on a subset of cells and multiple bacteria invade via the same ruffle. It has remained unclear how this is achieved. We have studied target-site selection in tissue culture by time lapse microscopy, movement pattern analysis and modeling. Flagellar motility (but not chemotaxis) was required for reaching the host cell surface in vitro. Subsequently, physical forces trapped the pathogen for ∼1.5–3 s in “near surface swimming”. This increased the local pathogen density and facilitated “scanning” of the host surface topology. We observed transient TTSS-1 and fim-independent “stopping” and irreversible TTSS-1-mediated docking, in particular at sites of prominent topology, i.e. the base of rounded-up cells and membrane ruffles. Our data indicate that target site selection and the cooperative infection of membrane ruffles are attributable to near surface swimming. This mechanism might be of general importance for understanding infection by flagellated bacteria. PMID:22911370

  1. Small activating RNA binds to the genomic target site in a seed-region-dependent manner

    PubMed Central

    Meng, Xing; Jiang, Qian; Chang, Nannan; Wang, Xiaoxia; Liu, Chujun; Xiong, Jingwei; Cao, Huiqing; Liang, Zicai

    2016-01-01

    RNA activation (RNAa) is the upregulation of gene expression by small activating RNAs (saRNAs). In order to investigate the mechanism by which saRNAs act in RNAa, we used the progesterone receptor (PR) gene as a model, established a panel of effective saRNAs and assessed the involvement of the sense and antisense strands of saRNA in RNAa. All active saRNAs had their antisense strand effectively incorporated into Ago2, whereas such consistency did not occur for the sense strand. Using a distal hotspot for saRNA targeting at 1.6-kb upstream from the PR transcription start site, we further established that gene activation mediated by saRNA depended on the complementarity of the 5′ region of the antisense strand, and that such activity was largely abolished by mutations in this region of the saRNA. We found markedly reduced RNAa effects when we created mutations in the genomic target site of saRNA PR-1611, thus providing evidence that RNAa depends on the integrity of the DNA target. We further demonstrated that this saRNA bound the target site on promoter DNA. These results demonstrated that saRNAs work via an on-site mechanism by binding to target genomic DNA in a seed-region-dependent manner, reminiscent of miRNA-like target recognition. PMID:26873922

  2. Synthetic lethal screening reveals FGFR as one of the combinatorial targets to overcome resistance to Met-targeted therapy

    PubMed Central

    Kim, Bogyou; Wang, Shangzi; Lee, Ji Min; Jeong, Yunju; Ahn, TaeJin; Son, Dae-Soon; Park, Hye Won; Yoo, Hyeon-seok; Song, Yun-Jeong; Lee, Eunjin; Oh, Young Mi; Lee, Saet Byoul; Choi, Jaehyun; Murray, Joseph C; Zhou, Yan; Song, Paul H; Kim, Kyung-Ah; Weiner, Louis M

    2014-01-01

    Met is a receptor tyrosine kinase that promotes cancer progression. In addition, Met has been implicated in resistance of tumors to various targeted therapies such as EGFR inhibitors in lung cancers, and has been prioritized as a key molecular target for cancer therapy. However, the underlying mechanism of resistance to Met targeting drugs is poorly understood. Here, we describe screening of 1310 genes to search for key regulators related to drug resistance to an anti-Met therapeutic antibody (SAIT301) by employing a siRNA-based synthetic lethal screening method. We found that knockdown of 69 genes in Met-amplified MKN45 cells sensitized the anti-tumor activity of SAIT301. Pathway analysis of these 69 genes implicated FGFR as a key regulator for anti-proliferative effects of Met targeting drugs. Inhibition of FGFR3 increased target cell apoptosis through the suppression of Bcl-xL expression, followed by reduced cancer cell growth in the presence of Met targeting drugs. Treatment of cells with the FGFR inhibitors substantially restored the efficacy of SAIT301 in SAIT301-resistant cells and enhanced the efficacy in SAIT301-sensitive cells. In addition to FGFR3, integrin β3 is another potential target for combination treatment with SAIT301. Suppression of integrin β3 decreased AKT phosphorylation in SAIT301-resistant cells and restores SAIT301 responsiveness in HCC1954 cells, which are resistant to SAIT301. Gene expression analysis using CCLE database shows cancer cells with high levels of FGFR and integrin β3 are resistant to crizotinib treatment, suggesting FGFR and integrin β3 could be used as predictive markers for Met targeted therapy and provide a potential therapeutic option to overcome acquired and innate resistance for the Met targeting drugs. PMID:24662823

  3. The X-ray Structure of a BAK Homodimer Reveals an Inhibitory Zinc Binding Site

    SciTech Connect

    Modoveanu,T.; Liu, Q.; Tocilj, A.; Watson, M.; Shore, G.; Gehring, K.

    2006-01-01

    BAK/BAX-mediated mitochondrial outer-membrane permeabilization (MOMP) drives cell death during development and tissue homeostasis from zebrafish to humans. In most cancers, this pathway is inhibited by BCL-2 family antiapoptotic members, which bind and block the action of proapoptotic BCL proteins. We report the 1.5 {angstrom} crystal structure of calpain-proteolysed BAK, cBAK, to reveal a zinc binding site that regulates its activity via homodimerization. cBAK contains an occluded BH3 peptide binding pocket that binds a BID BH3 peptide only weakly . Nonetheless, cBAK requires activation by truncated BID to induce cytochrome c release in mitochondria isolated from bak/bax double-knockout mouse embryonic fibroblasts. The BAK-mediated MOMP is inhibited by low micromolar zinc levels. This inhibition is alleviated by mutation of the zinc-coordination site in BAK. Our results link directly the antiapoptotic effects of zinc to BAK.

  4. Active-Site Monovalent Cations Revealed in a 1.55 Å Resolution Hammerhead Ribozyme Structure

    PubMed Central

    Anderson, Michael; Schultz, Eric P.; Martick, Monika; Scott, William G.

    2013-01-01

    We have obtained a 1.55 Å crystal structure of a hammerhead ribozyme derived from Schistosoma mansoni in conditions that permit detailed observations of Na+ ion binding in the ribozyme's active site. At least two such Na+ ions are observed. The first Na+ ion binds to the N7 of G10.1 and the adjacent A9 phosphate in a manner identical to that previously observed for divalent cations. A second Na+ ion binds to the Hoogsteen face of G12, the general base in the hammerhead cleavage reaction, thereby potentially dissipating the negative charge of the catalytically active enolate form of the nucleotide base. A potential but more ambiguous third site bridges the A9 and scissile phosphates in a manner consistent with previous predictions. Hammerhead ribozymes have been observed to be active in the presence of high concentrations of monovalent cations, including Na+, but the mechanism by which monovalent cations substitute for divalent cations in hammerhead catalysis remains unclear. Our results enable us to suggest that Na+ directly and specifically substitutes for divalent cations in the hammerhead active site. The detailed geometry of the pre-catalytic active site complex is also revealed with a new level of precision, thanks to the quality of the electron density maps obtained from what is currently the highest resolution ribozyme structure in the protein data bank. PMID:23711504

  5. Structure of recombinant Leishmania donovani pteridine reductase reveals a disordered active site

    PubMed Central

    Barrack, Keri L.; Tulloch, Lindsay B.; Burke, Lynsey-Ann; Fyfe, Paul K.; Hunter, William N.

    2011-01-01

    Pteridine reductase (PTR1) is a potential target for drug development against parasitic Trypanosoma and Leishmania species, protozoa that are responsible for a range of serious diseases found in tropical and subtropical parts of the world. As part of a structure-based approach to inhibitor development, specifically targeting Leishmania species, well ordered crystals of L. donovani PTR1 were sought to support the characterization of complexes formed with inhibitors. An efficient system for recombinant protein production was prepared and the enzyme was purified and crystallized in an orthorhombic form with ammonium sulfate as the precipitant. Diffraction data were measured to 2.5 Å resolution and the structure was solved by molecular replacement. However, a sulfate occupies a phosphate-binding site used by NADPH and occludes cofactor binding. The nicotinamide moiety is a critical component of the active site and without it this part of the structure is disordered. The crystal form obtained under these conditions is therefore unsuitable for the characterization of inhibitor complexes. PMID:21206018

  6. Crystal Structure of Menin Reveals Binding Site for Mixed Lineage Leukemia (MLL) Protein

    SciTech Connect

    Murai, Marcelo J.; Chruszcz, Maksymilian; Reddy, Gireesh; Grembecka, Jolanta; Cierpicki, Tomasz

    2014-10-02

    Menin is a tumor suppressor protein that is encoded by the MEN1 (multiple endocrine neoplasia 1) gene and controls cell growth in endocrine tissues. Importantly, menin also serves as a critical oncogenic cofactor of MLL (mixed lineage leukemia) fusion proteins in acute leukemias. Direct association of menin with MLL fusion proteins is required for MLL fusion protein-mediated leukemogenesis in vivo, and this interaction has been validated as a new potential therapeutic target for development of novel anti-leukemia agents. Here, we report the first crystal structure of menin homolog from Nematostella vectensis. Due to a very high sequence similarity, the Nematostella menin is a close homolog of human menin, and these two proteins likely have very similar structures. Menin is predominantly an {alpha}-helical protein with the protein core comprising three tetratricopeptide motifs that are flanked by two {alpha}-helical bundles and covered by a {beta}-sheet motif. A very interesting feature of menin structure is the presence of a large central cavity that is highly conserved between Nematostella and human menin. By employing site-directed mutagenesis, we have demonstrated that this cavity constitutes the binding site for MLL. Our data provide a structural basis for understanding the role of menin as a tumor suppressor protein and as an oncogenic co-factor of MLL fusion proteins. It also provides essential structural information for development of inhibitors targeting the menin-MLL interaction as a novel therapeutic strategy in MLL-related leukemias.

  7. Crops with target-site herbicide resistance for Orobanche and Striga control.

    PubMed

    Gressel, Jonathan

    2009-05-01

    It is necessary to control root parasitic weeds before or as they attach to the crop. This can only be easily achieved chemically with herbicides that are systemic, or with herbicides that are active in soil. Long-term control can only be attained if the crops do not metabolise the herbicide, i.e. have target-site resistance. Such target-site resistances have allowed foliar applications of herbicides inhibiting enol-pyruvylshikimate phosphate synthase (EPSPS) (glyphosate), acetolactate synthase (ALS) (e.g. chlorsulfuron, imazapyr) and dihydropteroate synthase (asulam) for Orobanche control in experimental conditions with various crops. Large-scale use of imazapyr as a seed dressing of imidazolinone-resistant maize has been commercialised for Striga control. Crops with two target-site resistances will be more resilient to the evolution of resistance in the parasite, if well managed. PMID:19280593

  8. Targeted Deep Sequencing Reveals No Definitive Evidence for Somatic Mosaicism in Atrial Fibrillation

    PubMed Central

    Roberts, Jason D.; Longoria, James; Poon, Annie; Gollob, Michael H.; Dewland, Thomas A.; Kwok, Pui-Yan; Olgin, Jeffrey E.; Deo, Rahul C.; Marcus, Gregory M.

    2015-01-01

    Background Studies of ≤15 atrial fibrillation (AF) patients have identified atrial-specific mutations within connexin genes, suggesting that somatic mutations may account for sporadic cases of the arrhythmia. We sought to identify atrial somatic mutations among patients with and without AF using targeted deep next-generation sequencing of 560 genes, including genetic culprits implicated in AF, the Mendelian cardiomyopathies and channelopathies, and all ion channels within the genome. Methods and Results Targeted gene capture and next generation sequencing were performed on DNA from lymphocytes and left atrial appendages of 34 patients (25 with AF). Twenty AF patients had undergone cardiac surgery exclusively for pulmonary vein isolation, and 17 had no structural heart disease. Sequence alignment and variant calling were performed for each atrial-lymphocyte pair using the Burrows-Wheeler Aligner, the Genome Analysis Toolkit, and MuTect packages. Next generation sequencing yielded a median 265-fold coverage depth (IQR 164–369). Comparison of the 3 million base pairs from each atrial-lymphocyte pair revealed a single potential somatic missense mutation in 3 AF patients and 2 in a single control (12 vs. 11%; p=1). All potential discordant variants had low allelic fractions (range: 2.3–7.3%) and none were detected with conventional sequencing. Conclusions Using high-depth next generation sequencing and state-of-the art somatic mutation calling approaches, no pathogenic atrial somatic mutations could be confirmed among 25 AF patients in a comprehensive cardiac arrhythmia genetic panel. These findings indicate that atrial specific mutations are rare and that somatic mosaicism is unlikely to exert a prominent role in AF pathogenesis. PMID:25406240

  9. Targeted massively parallel sequencing of angiosarcomas reveals frequent activation of the mitogen activated protein kinase pathway

    PubMed Central

    Murali, Rajmohan; Chandramohan, Raghu; Möller, Inga; Scholz, Simone L.; Berger, Michael; Huberman, Kety; Viale, Agnes; Pirun, Mono; Socci, Nicholas D.; Bouvier, Nancy; Bauer, Sebastian; Artl, Monika; Schilling, Bastian; Schimming, Tobias; Sucker, Antje; Schwindenhammer, Benjamin; Grabellus, Florian; Speicher, Michael R.; Schaller, Jörg; Hillen, Uwe; Schadendorf, Dirk; Mentzel, Thomas; Cheng, Donavan T.; Wiesner, Thomas; Griewank, Klaus G.

    2015-01-01

    Angiosarcomas are rare malignant mesenchymal tumors of endothelial differentiation. The clinical behavior is usually aggressive and the prognosis for patients with advanced disease is poor with no effective therapies. The genetic bases of these tumors have been partially revealed in recent studies reporting genetic alterations such as amplifications of MYC (primarily in radiation-associated angiosarcomas), inactivating mutations in PTPRB and R707Q hotspot mutations of PLCG1. Here, we performed a comprehensive genomic analysis of 34 angiosarcomas using a clinically-approved, hybridization-based targeted next-generation sequencing assay for 341 well-established oncogenes and tumor suppressor genes. Over half of the angiosarcomas (n = 18, 53%) harbored genetic alterations affecting the MAPK pathway, involving mutations in KRAS, HRAS, NRAS, BRAF, MAPK1 and NF1, or amplifications in MAPK1/CRKL, CRAF or BRAF. The most frequently detected genetic aberrations were mutations in TP53 in 12 tumors (35%) and losses of CDKN2A in 9 tumors (26%). MYC amplifications were generally mutually exclusive of TP53 alterations and CDKN2A loss and were identified in 8 tumors (24%), most of which (n = 7, 88%) arose post-irradiation. Previously reported mutations in PTPRB (n = 10, 29%) and one (3%) PLCG1 R707Q mutation were also identified. Our results demonstrate that angiosarcomas are a genetically heterogeneous group of tumors, harboring a wide range of genetic alterations. The high frequency of genetic events affecting the MAPK pathway suggests that targeted therapies inhibiting MAPK signaling may be promising therapeutic avenues in patients with advanced angiosarcomas. PMID:26440310

  10. Predicting target-ligand interactions using protein ligand-binding site and ligand substructures

    PubMed Central

    2015-01-01

    Background Cell proliferation, differentiation, Gene expression, metabolism, immunization and signal transduction require the participation of ligands and targets. It is a great challenge to identify rules governing molecular recognition between chemical topological substructures of ligands and the binding sites of the targets. Methods We suppose that the ligand-target interactions are determined by ligand substructures as well as the physical-chemical properties of the binding sites. Therefore, we propose a fragment interaction model (FIM) to describe the interactions between ligands and targets, with the purpose of facilitating the chemical interpretation of ligand-target binding. First we extract target-ligand complexes from sc-PDB database, based on which, we get the target binding sites and the ligands. Then we represent each binding site as a fragment vector based on a target fragment dictionary that is composed of 199 clusters (denoted as fragements in this work) obtained by clustering 4200 trimers according to their physical-chemical properties. And then, we represent each ligand as a substructure vector based on a dictionary containing 747 substructures. Finally, we build the FIM by generating the interaction matrix M (representing the fragment interaction network), and the FIM can later be used for predicting unknown ligand-target interactions as well as providing the binding details of the interactions. Results The five-fold cross validation results show that the proposed model can get higher AUC score (92%) than three prevalence algorithms CS-PD (80%), BLM-NII (85%) and RF (85%), demonstrating the remarkable predictive ability of FIM. We also show that the ligand binding sites (local information) overweight the sequence similarities (global information) in ligand-target binding, and introducing too much global information would be harmful to the predictive ability. Moreover, The derived fragment interaction network can provide the chemical insights on

  11. Hypothalamus proteomics from mouse models with obesity and anorexia reveals therapeutic targets of appetite regulation

    PubMed Central

    Manousopoulou, A; Koutmani, Y; Karaliota, S; Woelk, C H; Manolakos, E S; Karalis, K; Garbis, S D

    2016-01-01

    Objective: This study examined the proteomic profile of the hypothalamus in mice exposed to a high-fat diet (HFD) or with the anorexia of acute illness. This comparison could provide insight on the effects of these two opposite states of energy balance on appetite regulation. Methods: Four to six-week-old male C56BL/6J mice were fed a normal (control 1 group; n=7) or a HFD (HFD group; n=10) for 8 weeks. The control 2 (n=7) and lipopolysaccharide (LPS) groups (n=10) were fed a normal diet for 8 weeks before receiving an injection of saline and LPS, respectively. Hypothalamic regions were analysed using a quantitative proteomics method based on a combination of techniques including iTRAQ stable isotope labeling, orthogonal two-dimensional liquid chromatography hyphenated with nanospray ionization and high-resolution mass spectrometry. Key proteins were validated with quantitative PCR. Results: Quantitative proteomics of the hypothalamous regions profiled a total of 9249 protein groups (q<0.05). Of these, 7718 protein groups were profiled with a minimum of two unique peptides for each. Hierachical clustering of the differentiated proteome revealed distinct proteomic signatures for the hypothalamus under the HFD and LPS nutritional conditions. Literature research with in silico bioinformatics interpretation of the differentiated proteome identified key biological relevant proteins and implicated pathways. Furthermore, the study identified potential pharmacologic targets. In the LPS groups, the anorexigen pro-opiomelanocortin was downregulated. In mice with obesity, nuclear factor-κB, glycine receptor subunit alpha-4 (GlyR) and neuropeptide Y levels were elevated, whereas serotonin receptor 1B levels decreased. Conclusions: High-precision quantitative proteomics revealed that under acute systemic inflammation in the hypothalamus as a response to LPS, homeostatic mechanisms mediating loss of appetite take effect. Conversely, under chronic inflammation in the

  12. Multiple transcription factor binding sites predict AID targeting in non-immunoglobulin genes

    PubMed Central

    Duke, Jamie L.; Liu, Man; Yaari, Gur; Khalil, Ashraf M.; Tomayko, Mary M.; Shlomchik, Mark J.; Schatz, David G.; Kleinstein, Steven H.

    2013-01-01

    Aberrant targeting of the enzyme Activation Induced Cytidine Deaminase (AID) results in the accumulation of somatic mutations in approximately 25% of expressed genes in germinal center B cells. Observations in Ung−/− Msh2−/− mice suggest that many other genes efficiently repair AID-induced lesions, so that up to 45% of genes may actually be targeted by AID. It is important to understand the mechanisms that recruit AID to certain genes, as this mis-targeting represents an important risk for genome instability. We hypothesize that several mechanisms will combine to target AID to each locus. In order to resolve which mechanisms affect AID targeting, we analyze 7.3Mb of sequence data, along with the regulatory context, from 83 genes in Ung−/− Msh2−/− mice to identify common properties of AID targets. This analysis identifies the involvement of three transcription factor binding sites (E-box motifs, along with YY1 and C/EBP-beta binding sites) that may work together to recruit AID. Based on previous knowledge and these newly discovered features, a classification tree model was built to predict genome-wide AID targeting. Using this predictive model we were able to identify a set of 101 high-interest genes that are likely targets of AID. PMID:23514741

  13. Transcriptome-Wide Cleavage Site Mapping on Cellular mRNAs Reveals Features Underlying Sequence-Specific Cleavage by the Viral Ribonuclease SOX

    PubMed Central

    Gaglia, Marta Maria; Rycroft, Chris H.; Glaunsinger, Britt A.

    2015-01-01

    Many viruses express factors that reduce host gene expression through widespread degradation of cellular mRNA. An example of this class of proteins is the mRNA-targeting endoribonuclease SOX from the gamma-herpesvirus Kaposi’s sarcoma-associated herpesvirus (KSHV). Previous studies indicated that cleavage of messenger RNAs (mRNA) by SOX occurs at specific locations defined by the sequence of the target RNA, which is at odds with the down-regulation of a large portion of cellular transcripts. In this study, we address this paradox by using high-throughput sequencing of cleavage intermediates combined with a custom bioinformatics-based analysis pipeline to identify SOX cleavage sites across the mRNA transcriptome. These data, coupled with targeted mutagenesis, reveal that while cleavage sites are specific and reproducible, they are defined by a degenerate sequence motif containing a small number of conserved residues rather than a strong consensus sequence. This degenerate element is well represented in both human and KSHV mRNA, and its presence correlates with RNA destabilization by SOX. This represents a new endonuclease targeting strategy, in which use of a degenerate targeting element enables RNA cleavage at specific locations without restricting the range of targets. Furthermore, it shows that strong target selectivity can be achieved without a high degree of sequence specificity. PMID:26646420

  14. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting

    PubMed Central

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

    2016-01-01

    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  15. Engineering Factor Xa Inhibitor with Multiple Platelet-Binding Sites Facilitates its Platelet Targeting.

    PubMed

    Zhu, Yuanjun; Li, Ruyi; Lin, Yuan; Shui, Mengyang; Liu, Xiaoyan; Chen, Huan; Wang, Yinye

    2016-01-01

    Targeted delivery of antithrombotic drugs centralizes the effects in the thrombosis site and reduces the hemorrhage side effects in uninjured vessels. We have recently reported that the platelet-targeting factor Xa (FXa) inhibitors, constructed by engineering one Arg-Gly-Asp (RGD) motif into Ancylostoma caninum anticoagulant peptide 5 (AcAP5), can reduce the risk of systemic bleeding than non-targeted AcAP5 in mouse arterial injury model. Increasing the number of platelet-binding sites of FXa inhibitors may facilitate their adhesion to activated platelets, and further lower the bleeding risks. For this purpose, we introduced three RGD motifs into AcAP5 to generate a variant NR4 containing three platelet-binding sites. NR4 reserved its inherent anti-FXa activity. Protein-protein docking showed that all three RGD motifs were capable of binding to platelet receptor αIIbβ3. Molecular dynamics simulation demonstrated that NR4 has more opportunities to interact with αIIbβ3 than single-RGD-containing NR3. Flow cytometry analysis and rat arterial thrombosis model further confirmed that NR4 possesses enhanced platelet targeting activity. Moreover, NR4-treated mice showed a trend toward less tail bleeding time than NR3-treated mice in carotid artery endothelium injury model. Therefore, our data suggest that engineering multiple binding sites in one recombinant protein is a useful tool to improve its platelet-targeting efficiency. PMID:27432161

  16. PAM multiplicity marks genomic target sites as inhibitory to CRISPR-Cas9 editing

    PubMed Central

    Malina, Abba; Cameron, Christopher J. F.; Robert, Francis; Blanchette, Mathieu; Dostie, Josée; Pelletier, Jerry

    2015-01-01

    In CRISPR-Cas9 genome editing, the underlying principles for selecting guide RNA (gRNA) sequences that would ensure for efficient target site modification remain poorly understood. Here we show that target sites harbouring multiple protospacer adjacent motifs (PAMs) are refractory to Cas9-mediated repair in situ. Thus we refine which substrates should be avoided in gRNA design, implicating PAM density as a novel sequence-specific feature that inhibits in vivo Cas9-driven DNA modification. PMID:26644285

  17. The EHEC-host interactome reveals novel targets for the translocated intimin receptor.

    PubMed

    Blasche, Sonja; Arens, Stefan; Ceol, Arnaud; Siszler, Gabriella; Schmidt, M Alexander; Häuser, Roman; Schwarz, Frank; Wuchty, Stefan; Aloy, Patrick; Uetz, Peter; Stradal, Theresia; Koegl, Manfred

    2014-01-01

    Enterohemorrhagic E. coli (EHEC) manipulate their human host through at least 39 effector proteins which hijack host processes through direct protein-protein interactions (PPIs). To identify their protein targets in the host cells, we performed yeast two-hybrid screens, allowing us to find 48 high-confidence protein-protein interactions between 15 EHEC effectors and 47 human host proteins. In comparison to other bacteria and viruses we found that EHEC effectors bind more frequently to hub proteins as well as to proteins that participate in a higher number of protein complexes. The data set includes six new interactions that involve the translocated intimin receptor (TIR), namely HPCAL1, HPCAL4, NCALD, ARRB1, PDE6D, and STK16. We compared these TIR interactions in EHEC and enteropathogenic E. coli (EPEC) and found that five interactions were conserved. Notably, the conserved interactions included those of serine/threonine kinase 16 (STK16), hippocalcin-like 1 (HPCAL1) as well as neurocalcin-delta (NCALD). These proteins co-localize with the infection sites of EPEC. Furthermore, our results suggest putative functions of poorly characterized effectors (EspJ, EspY1). In particular, we observed that EspJ is connected to the microtubule system while EspY1 appears to be involved in apoptosis/cell cycle regulation. PMID:25519916

  18. Pharmacoinformatic and molecular docking studies reveal potential novel antidepressants against neurodegenerative disorders by targeting HSPB8.

    PubMed

    Sehgal, Sheikh Arslan; Mannan, Shazia; Ali, Sannia

    2016-01-01

    Charcot-Marie-Tooth (CMT) disease is an inherited peripheral neuromuscular disorder characterized by length-dependent and progressive degeneration of peripheral nerves, leading to muscular weakness. Research has shown that mutated HSPB8 may be responsible for depression, neurodegenerative disorders, and improper functioning of peripheral nerves, resulting in neuromuscular disorders like CMT. In the current work, a hybrid approach of virtual screening and molecular docking studies was followed by homology modeling and pharmacophore identification. Detailed screening analyses were carried out by 2-D similarity search against prescribed antidepressant drugs with physicochemical properties. LigandScout was employed to ascertain novel molecules and pharmacophore properties. In this study, we report three novel compounds that showed maximum binding affinity with HSPB8. Docking analysis elucidated that Met37, Ser57, Ser58, Trp60, Thr63, Thr114, Lys115, Asp116, Gly117, Val152, Val154, Leu186, Asp189, Ser190, Gln191, and Glu192 are critical residues for ligand-receptor interactions. Our analyses suggested paroxetine as a potent compound for targeting HSPB8. Selected compounds have more effective energy scores than the selected drug analogs. Additionally, site-directed mutagenesis could be significant for further analysis of the binding pocket. The novel findings based on an in silico approach may be momentous for potent drug design against depression and CMT. PMID:27226709

  19. Pharmacoinformatic and molecular docking studies reveal potential novel antidepressants against neurodegenerative disorders by targeting HSPB8

    PubMed Central

    Sehgal, Sheikh Arslan; Mannan, Shazia; Ali, Sannia

    2016-01-01

    Charcot–Marie–Tooth (CMT) disease is an inherited peripheral neuromuscular disorder characterized by length-dependent and progressive degeneration of peripheral nerves, leading to muscular weakness. Research has shown that mutated HSPB8 may be responsible for depression, neurodegenerative disorders, and improper functioning of peripheral nerves, resulting in neuromuscular disorders like CMT. In the current work, a hybrid approach of virtual screening and molecular docking studies was followed by homology modeling and pharmacophore identification. Detailed screening analyses were carried out by 2-D similarity search against prescribed antidepressant drugs with physicochemical properties. LigandScout was employed to ascertain novel molecules and pharmacophore properties. In this study, we report three novel compounds that showed maximum binding affinity with HSPB8. Docking analysis elucidated that Met37, Ser57, Ser58, Trp60, Thr63, Thr114, Lys115, Asp116, Gly117, Val152, Val154, Leu186, Asp189, Ser190, Gln191, and Glu192 are critical residues for ligand–receptor interactions. Our analyses suggested paroxetine as a potent compound for targeting HSPB8. Selected compounds have more effective energy scores than the selected drug analogs. Additionally, site-directed mutagenesis could be significant for further analysis of the binding pocket. The novel findings based on an in silico approach may be momentous for potent drug design against depression and CMT. PMID:27226709

  20. Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

    PubMed

    Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

    2016-01-01

    In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. PMID:26562361

  1. Targeted next-generation sequencing reveals multiple deleterious variants in OPLL-associated genes.

    PubMed

    Chen, Xin; Guo, Jun; Cai, Tao; Zhang, Fengshan; Pan, Shengfa; Zhang, Li; Wang, Shaobo; Zhou, Feifei; Diao, Yinze; Zhao, Yanbin; Chen, Zhen; Liu, Xiaoguang; Chen, Zhongqiang; Liu, Zhongjun; Sun, Yu; Du, Jie

    2016-01-01

    Ossification of the posterior longitudinal ligament of the spine (OPLL), which is characterized by ectopic bone formation in the spinal ligaments, can cause spinal-cord compression. To date, at least 11 susceptibility genes have been genetically linked to OPLL. In order to identify potential deleterious alleles in these OPLL-associated genes, we designed a capture array encompassing all coding regions of the target genes for next-generation sequencing (NGS) in a cohort of 55 unrelated patients with OPLL. By bioinformatics analyses, we successfully identified three novel and five extremely rare variants (MAF < 0.005). These variants were predicted to be deleterious by commonly used various algorithms, thereby resulting in missense mutations in four OPLL-associated genes (i.e., COL6A1, COL11A2, FGFR1, and BMP2). Furthermore, potential effects of the patient with p.Q89E of BMP2 were confirmed by a markedly increased BMP2 level in peripheral blood samples. Notably, seven of the variants were found to be associated with the patients with continuous subtype changes by cervical spinal radiological analyses. Taken together, our findings revealed for the first time that deleterious coding variants of the four OPLL-associated genes are potentially pathogenic in the patients with OPLL. PMID:27246988

  2. Proteomics Reveals Plastid- and Periplastid-Targeted Proteins in the Chlorarachniophyte Alga Bigelowiella natans

    PubMed Central

    Hopkins, Julia F.; Spencer, David F.; Laboissiere, Sylvie; Neilson, Jonathan A.D.; Eveleigh, Robert J.M.; Durnford, Dion G.; Gray, Michael W.; Archibald, John M.

    2012-01-01

    Chlorarachniophytes are unicellular marine algae with plastids (chloroplasts) of secondary endosymbiotic origin. Chlorarachniophyte cells retain the remnant nucleus (nucleomorph) and cytoplasm (periplastidial compartment, PPC) of the green algal endosymbiont from which their plastid was derived. To characterize the diversity of nucleus-encoded proteins targeted to the chlorarachniophyte plastid, nucleomorph, and PPC, we isolated plastid–nucleomorph complexes from the model chlorarachniophyte Bigelowiella natans and subjected them to high-pressure liquid chromatography-tandem mass spectrometry. Our proteomic analysis, the first of its kind for a nucleomorph-bearing alga, resulted in the identification of 324 proteins with 95% confidence. Approximately 50% of these proteins have predicted bipartite leader sequences at their amino termini. Nucleus-encoded proteins make up >90% of the proteins identified. With respect to biological function, plastid-localized light-harvesting proteins were well represented, as were proteins involved in chlorophyll biosynthesis. Phylogenetic analyses revealed that many, but by no means all, of the proteins identified in our proteomic screen are of apparent green algal ancestry, consistent with the inferred evolutionary origin of the plastid and nucleomorph in chlorarachniophytes. PMID:23221610

  3. Targeted next-generation sequencing reveals multiple deleterious variants in OPLL-associated genes

    PubMed Central

    Chen, Xin; Guo, Jun; Cai, Tao; Zhang, Fengshan; Pan, Shengfa; Zhang, Li; Wang, Shaobo; Zhou, Feifei; Diao, Yinze; Zhao, Yanbin; Chen, Zhen; Liu, Xiaoguang; Chen, Zhongqiang; Liu, Zhongjun; Sun, Yu; Du, Jie

    2016-01-01

    Ossification of the posterior longitudinal ligament of the spine (OPLL), which is characterized by ectopic bone formation in the spinal ligaments, can cause spinal-cord compression. To date, at least 11 susceptibility genes have been genetically linked to OPLL. In order to identify potential deleterious alleles in these OPLL-associated genes, we designed a capture array encompassing all coding regions of the target genes for next-generation sequencing (NGS) in a cohort of 55 unrelated patients with OPLL. By bioinformatics analyses, we successfully identified three novel and five extremely rare variants (MAF < 0.005). These variants were predicted to be deleterious by commonly used various algorithms, thereby resulting in missense mutations in four OPLL-associated genes (i.e., COL6A1, COL11A2, FGFR1, and BMP2). Furthermore, potential effects of the patient with p.Q89E of BMP2 were confirmed by a markedly increased BMP2 level in peripheral blood samples. Notably, seven of the variants were found to be associated with the patients with continuous subtype changes by cervical spinal radiological analyses. Taken together, our findings revealed for the first time that deleterious coding variants of the four OPLL-associated genes are potentially pathogenic in the patients with OPLL. PMID:27246988

  4. UV-B mediated metabolic rearrangements in poplar revealed by non-targeted metabolomics.

    PubMed

    Kaling, Moritz; Kanawati, Basem; Ghirardo, Andrea; Albert, Andreas; Winkler, Jana Barbro; Heller, Werner; Barta, Csengele; Loreto, Francesco; Schmitt-Kopplin, Philippe; Schnitzler, Jörg-Peter

    2015-05-01

    Plants have to cope with various abiotic stresses including UV-B radiation (280-315 nm). UV-B radiation is perceived by a photoreceptor, triggers morphological responses and primes plant defence mechanisms such as antioxidant levels, photoreapir or accumulation of UV-B screening pigments. As poplar is an important model system for trees, we elucidated the influence of UV-B on overall metabolite patterns in poplar leaves grown under high UV-B radiation. Combining non-targeted metabolomics with gas exchange analysis and confocal microscopy, we aimed understanding how UV-B radiation triggers metabolome-wide changes, affects isoprene emission, photosynthetic performance, epidermal light attenuation and finally how isoprene-free poplars adjust their metabolome under UV-B radiation. Exposure to UV-B radiation caused a comprehensive rearrangement of the leaf metabolome. Several hundreds of metabolites were up- and down-regulated over various pathways. Our analysis, revealed the up-regulation of flavonoids, anthocyanins and polyphenols and the down-regulation of phenolic precursors in the first 36 h of UV-B treatment. We also observed a down-regulation of steroids after 12 h. The accumulation of phenolic compounds leads to a reduced light transmission in UV-B-exposed plants. However, the accumulation of phenolic compounds was reduced in non-isoprene-emitting plants suggesting a metabolic- or signalling-based interaction between isoprenoid and phenolic pathways. PMID:24738572

  5. Evolutionary comparison reveals that diverging CTCF sites are signatures of ancestral topological associating domains borders.

    PubMed

    Gómez-Marín, Carlos; Tena, Juan J; Acemel, Rafael D; López-Mayorga, Macarena; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Maeso, Ignacio; Beccari, Leonardo; Aneas, Ivy; Vielmas, Erika; Bovolenta, Paola; Nobrega, Marcelo A; Carvajal, Jaime; Gómez-Skarmeta, José Luis

    2015-06-16

    Increasing evidence in the last years indicates that the vast amount of regulatory information contained in mammalian genomes is organized in precise 3D chromatin structures. However, the impact of this spatial chromatin organization on gene expression and its degree of evolutionary conservation is still poorly understood. The Six homeobox genes are essential developmental regulators organized in gene clusters conserved during evolution. Here, we reveal that the Six clusters share a deeply evolutionarily conserved 3D chromatin organization that predates the Cambrian explosion. This chromatin architecture generates two largely independent regulatory landscapes (RLs) contained in two adjacent topological associating domains (TADs). By disrupting the conserved TAD border in one of the zebrafish Six clusters, we demonstrate that this border is critical for preventing competition between promoters and enhancers located in separated RLs, thereby generating different expression patterns in genes located in close genomic proximity. Moreover, evolutionary comparison of Six-associated TAD borders reveals the presence of CCCTC-binding factor (CTCF) sites with diverging orientations in all studied deuterostomes. Genome-wide examination of mammalian HiC data reveals that this conserved CTCF configuration is a general signature of TAD borders, underscoring that common organizational principles underlie TAD compartmentalization in deuterostome evolution. PMID:26034287

  6. Evolutionary comparison reveals that diverging CTCF sites are signatures of ancestral topological associating domains borders

    PubMed Central

    Gómez-Marín, Carlos; Tena, Juan J.; Acemel, Rafael D.; López-Mayorga, Macarena; Naranjo, Silvia; de la Calle-Mustienes, Elisa; Maeso, Ignacio; Beccari, Leonardo; Aneas, Ivy; Vielmas, Erika; Bovolenta, Paola; Nobrega, Marcelo A.; Carvajal, Jaime; Gómez-Skarmeta, José Luis

    2015-01-01

    Increasing evidence in the last years indicates that the vast amount of regulatory information contained in mammalian genomes is organized in precise 3D chromatin structures. However, the impact of this spatial chromatin organization on gene expression and its degree of evolutionary conservation is still poorly understood. The Six homeobox genes are essential developmental regulators organized in gene clusters conserved during evolution. Here, we reveal that the Six clusters share a deeply evolutionarily conserved 3D chromatin organization that predates the Cambrian explosion. This chromatin architecture generates two largely independent regulatory landscapes (RLs) contained in two adjacent topological associating domains (TADs). By disrupting the conserved TAD border in one of the zebrafish Six clusters, we demonstrate that this border is critical for preventing competition between promoters and enhancers located in separated RLs, thereby generating different expression patterns in genes located in close genomic proximity. Moreover, evolutionary comparison of Six-associated TAD borders reveals the presence of CCCTC-binding factor (CTCF) sites with diverging orientations in all studied deuterostomes. Genome-wide examination of mammalian HiC data reveals that this conserved CTCF configuration is a general signature of TAD borders, underscoring that common organizational principles underlie TAD compartmentalization in deuterostome evolution. PMID:26034287

  7. Varenicline Interactions at the 5-HT3 Receptor Ligand Binding Site are Revealed by 5-HTBP

    PubMed Central

    2015-01-01

    Cys-loop receptors are the site of action of many therapeutic drugs. One of these is the smoking cessation agent varenicline, which has its major therapeutic effects at nicotinic acetylcholine (nACh) receptors but also acts at 5-HT3 receptors. Here, we report the X-ray crystal structure of the 5-HT binding protein (5-HTBP) in complex with varenicline, and test the predicted interactions by probing the potency of varenicline in a range of mutant 5-HT3 receptors expressed in HEK293 cells and Xenopus oocytes. The structure reveals a range of interactions between varenicline and 5-HTBP. We identified residues within 5 Å of varenicline and substituted the equivalent residues in the 5-HT3 receptor with Ala or a residue with similar chemical properties. Functional characterization of these mutant 5-HT3 receptors, using a fluorescent membrane potential dye in HEK cells and voltage clamp in oocytes, supports interactions between varenicline and the receptor that are similar to those in 5-HTBP. The structure also revealed C-loop closure that was less than in the 5-HT-bound 5-HTBP, and hydrogen bonding between varenicline and the complementary face of the binding pocket via a water molecule, which are characteristics consistent with partial agonist behavior of varenicline in the 5-HT3 receptor. Together, these data reveal detailed insights into the molecular interaction of varenicline in the 5-HT3 receptor. PMID:25648658

  8. Site-Directed Conjugation of Antibodies to Apoferritin Nanocarrier for Targeted Drug Delivery to Prostate Cancer Cells.

    PubMed

    Dostalova, Simona; Cerna, Tereza; Hynek, David; Koudelkova, Zuzana; Vaculovic, Tomas; Kopel, Pavel; Hrabeta, Jan; Heger, Zbynek; Vaculovicova, Marketa; Eckschlager, Tomas; Stiborova, Marie; Adam, Vojtech

    2016-06-15

    Herein, we describe a novel approach for targeting of ubiquitous protein apoferritin (APO)-encapsulating doxorubicin (DOX) to prostate cancer using antibodies against prostate-specific membrane antigen (PSMA). The conjugation of anti-PSMA antibodies and APO was carried out using HWRGWVC heptapeptide, providing their site-directed orientation. The prostate-cancer-targeted and nontargeted nanocarriers were tested using LNCaP and HUVEC cell lines. A total of 90% of LNCaP cells died after treatment with DOX (0.25 μM) or DOX in nontargeted and prostate-cancer-targeted APO, proving that the encapsulated DOX toxicity for LNCaP cells remained the same. Free DOX showed higher toxicity for nonmalignant cells, whereas the toxicity was lower after treatment with the same dosage of APO-encapsulated DOX (APODOX) and even more in prostate-cancer-targeted APODOX. Hemolytic assay revealed exceptional hemocompatibility of the entire nanocarrier. The APO encapsulation mechanism ensures applicability using a wide variety of chemotherapeutic drugs, and the presented surface modification enables targeting to various tumors. PMID:27219717

  9. CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites

    PubMed Central

    Naito, Yuki; Hino, Kimihiro; Bono, Hidemasa; Ui-Tei, Kumiko

    2015-01-01

    Summary: CRISPRdirect is a simple and functional web server for selecting rational CRISPR/Cas targets from an input sequence. The CRISPR/Cas system is a promising technique for genome engineering which allows target-specific cleavage of genomic DNA guided by Cas9 nuclease in complex with a guide RNA (gRNA), that complementarily binds to a ∼20 nt targeted sequence. The target sequence requirements are twofold. First, the 5′-NGG protospacer adjacent motif (PAM) sequence must be located adjacent to the target sequence. Second, the target sequence should be specific within the entire genome in order to avoid off-target editing. CRISPRdirect enables users to easily select rational target sequences with minimized off-target sites by performing exhaustive searches against genomic sequences. The server currently incorporates the genomic sequences of human, mouse, rat, marmoset, pig, chicken, frog, zebrafish, Ciona, fruit fly, silkworm, Caenorhabditis elegans, Arabidopsis, rice, Sorghum and budding yeast. Availability: Freely available at http://crispr.dbcls.jp/. Contact: y-naito@dbcls.rois.ac.jp Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25414360

  10. Varying target prevalence reveals two, dissociable decision criteria in visual search

    PubMed Central

    Wolfe, Jeremy M; Van Wert, Michael J

    2009-01-01

    Summary Target prevalence exerts a powerful influence on visual search behavior. In most visual search experiments, targets appear on at least 50% of trials [1–3]. However, when targets are rare (as in medical or airport screening), observers shift response criteria, leading to elevated rates of miss errors [4, 5]. Observers also speed their target-absent responses and may make more motor errors [6]. This could be a speed-accuracy tradeoff with fast, frequent absent responses producing more miss errors. Disproving this hypothesis, Experiment One shows that very high target prevalence (98%) shifts response criteria in the opposite direction, leading to elevated false alarms in a simulated baggage search task. However, the very frequent target present responses are not speeded. Rather, rare target absent responses are greatly slowed. In Experiment Two, prevalence was varied sinusoidally over 1000 trials as observers’ accuracy and reaction times (RTs) were measured. Observers’ criterion and target absent RTs tracked prevalence. Sensitivity (d′) and target-present RTs did not vary with prevalence [see also 7, 8, 9]. The results support a model in which prevalence influences two parameters: A decision criterion governing the series of perceptual decisions about each attended item and a quitting threshold that governs the timing of target-absent responses. Models in which target prevalence only influences an overall decision criterion are not supported. PMID:20079642

  11. Molecular Expression Profile Reveals Potential Biomarkers and Therapeutic Targets in Canine Endometrial Lesions

    PubMed Central

    Voorwald, Fabiana Azevedo; Marchi, Fabio Albuquerque; Villacis, Rolando Andre Rios; Alves, Carlos Eduardo Fonseca; Toniollo, Gilson Hélio; Amorim, Renee Laufer

    2015-01-01

    Cystic endometrial hyperplasia (CEH), mucometra, and pyometra are common uterine diseases in intact dogs, with pyometra being a life threatening disease. This study aimed to determine the gene expression profile of these lesions and potential biomarkers for closed-cervix pyometra, the most severe condition. Total RNA was extracted from 69 fresh endometrium samples collected from 21 healthy female dogs during diestrus, 16 CEH, 15 mucometra and 17 pyometra (eight open and nine closed-cervixes). Global gene expression was detected using the Affymetrix Canine Gene 1.0 ST Array. Unsupervised analysis revealed two clusters, one mainly composed of diestrus and CEH samples and the other by 12/15 mucometra and all pyometra samples. When comparing pyometra with other groups, 189 differentially expressed genes were detected. SLPI, PTGS2/COX2, MMP1, S100A8, S100A9 and IL8 were among the top up-regulated genes detected in pyometra, further confirmed by external expression data. Notably, a particular molecular profile in pyometra from animals previously treated with exogenous progesterone compounds was observed in comparison with pyometra from untreated dogs as well as with other groups irrespective of exogenous hormone treatment status. In addition to S100A8 and S100A9 genes, overexpression of the inflammatory cytokines IL1B, TNF and IL6 as well as LTF were detected in the pyometra from treated animals. Interestingly, closed pyometra was more frequently detected in treated dogs (64% versus 33%), with IL1B, TNF, LBP and CXCL10 among the most relevant overexpressed genes. This molecular signature associated with potential biomarkers and therapeutic targets, such as CXCL10 and COX2, should guide future clinical studies. Based on the gene expression profile we suggested that pyometra from progesterone treated dogs is a distinct molecular entity. PMID:26222498

  12. Molecular Expression Profile Reveals Potential Biomarkers and Therapeutic Targets in Canine Endometrial Lesions.

    PubMed

    Voorwald, Fabiana Azevedo; Marchi, Fabio Albuquerque; Villacis, Rolando Andre Rios; Alves, Carlos Eduardo Fonseca; Toniollo, Gilson Hélio; Amorim, Renee Laufer; Drigo, Sandra Aparecida; Rogatto, Silvia Regina

    2015-01-01

    Cystic endometrial hyperplasia (CEH), mucometra, and pyometra are common uterine diseases in intact dogs, with pyometra being a life threatening disease. This study aimed to determine the gene expression profile of these lesions and potential biomarkers for closed-cervix pyometra, the most severe condition. Total RNA was extracted from 69 fresh endometrium samples collected from 21 healthy female dogs during diestrus, 16 CEH, 15 mucometra and 17 pyometra (eight open and nine closed-cervixes). Global gene expression was detected using the Affymetrix Canine Gene 1.0 ST Array. Unsupervised analysis revealed two clusters, one mainly composed of diestrus and CEH samples and the other by 12/15 mucometra and all pyometra samples. When comparing pyometra with other groups, 189 differentially expressed genes were detected. SLPI, PTGS2/COX2, MMP1, S100A8, S100A9 and IL8 were among the top up-regulated genes detected in pyometra, further confirmed by external expression data. Notably, a particular molecular profile in pyometra from animals previously treated with exogenous progesterone compounds was observed in comparison with pyometra from untreated dogs as well as with other groups irrespective of exogenous hormone treatment status. In addition to S100A8 and S100A9 genes, overexpression of the inflammatory cytokines IL1B, TNF and IL6 as well as LTF were detected in the pyometra from treated animals. Interestingly, closed pyometra was more frequently detected in treated dogs (64% versus 33%), with IL1B, TNF, LBP and CXCL10 among the most relevant overexpressed genes. This molecular signature associated with potential biomarkers and therapeutic targets, such as CXCL10 and COX2, should guide future clinical studies. Based on the gene expression profile we suggested that pyometra from progesterone treated dogs is a distinct molecular entity. PMID:26222498

  13. Coactivation of GR and NFKB alters the repertoire of their binding sites and target genes

    PubMed Central

    Rao, Nagesha A.S.; McCalman, Melysia T.; Moulos, Panagiotis; Francoijs, Kees-Jan; Chatziioannou, Aristotelis; Kolisis, Fragiskos N.; Alexis, Michael N.; Mitsiou, Dimitra J.; Stunnenberg, Hendrik G.

    2011-01-01

    Glucocorticoid receptor (GR) exerts anti-inflammatory action in part by antagonizing proinflammatory transcription factors such as the nuclear factor kappa-b (NFKB). Here, we assess the crosstalk of activated GR and RELA (p65, major NFKB component) by global identification of their binding sites and target genes. We show that coactivation of GR and p65 alters the repertoire of regulated genes and results in their association with novel sites in a mutually dependent manner. These novel sites predominantly cluster with p65 target genes that are antagonized by activated GR and vice versa. Our data show that coactivation of GR and NFKB alters signaling pathways that are regulated by each factor separately and provide insight into the networks underlying the GR and NFKB crosstalk. PMID:21750107

  14. FLP-mediated DNA mobilization to specific target sites in Drosophila chromosomes.

    PubMed Central

    Golic, M M; Rong, Y S; Petersen, R B; Lindquist, S L; Golic, K G

    1997-01-01

    The ability to place a series of gene constructs at a specific site in the genome opens new possibilities for the experimental examination of gene expression and chromosomal position effects. We report that the FLP- FRT site-specific recombination system of the yeast 2mu plasmid can be used to integrate DNA at a chromosomal FRT target site in Drosophila. The technique we used was to first integrate an FRT- flanked gene by standard P element-mediated transformation. FLP was then used to excise the FRT- flanked donor DNA and screen for FLP-mediated re-integration at an FRT target at a different chromosome location. Such events were recovered from up to 5% of the crosses used to screen for mobilization and are easily detectable by altered linkage of a white reporter gene or by the generation of a white + gene upon integration. PMID:9278488

  15. Novel and Viable Acetylcholinesterase Target Site for Developing Effective and Environmentally Safe Insecticides

    PubMed Central

    Pang, Yuan-Ping; Brimijoin, Stephen; Ragsdale, David W; Zhu, Kun Yan; Suranyi, Robert

    2012-01-01

    Insect pests are responsible for human suffering and financial losses worldwide. New and environmentally safe insecticides are urgently needed to cope with these serious problems. Resistance to current insecticides has resulted in a resurgence of insect pests, and growing concerns about insecticide toxicity to humans discourage the use of insecticides for pest control. The small market for insecticides has hampered insecticide development; however, advances in genomics and structural genomics offer new opportunities to develop insecticides that are less dependent on the insecticide market. This review summarizes the literature data that support the hypothesis that an insect-specific cysteine residue located at the opening of the acetylcholinesterase active site is a promising target site for developing new insecticides with reduced off-target toxicity and low propensity for insect resistance. These data are used to discuss the differences between targeting the insect-specific cysteine residue and targeting the ubiquitous catalytic serine residue of acetylcholinesterase from the perspective of reducing off-target toxicity and insect resistance. Also discussed is the prospect of developing cysteine-targeting anticholinesterases as effective and environmentally safe insecticides for control of disease vectors, crop damage, and residential insect pests within the financial confines of the present insecticide market. PMID:22280344

  16. Structure-Based Identification of Novel Ligands Targeting Multiple Sites within a Chemokine-G-Protein-Coupled-Receptor Interface.

    PubMed

    Smith, Emmanuel W; Nevins, Amanda M; Qiao, Zhen; Liu, Yan; Getschman, Anthony E; Vankayala, Sai L; Kemp, M Trent; Peterson, Francis C; Li, Rongshi; Volkman, Brian F; Chen, Yu

    2016-05-12

    CXCL12 is a human chemokine that recognizes the CXCR4 receptor and is involved in immune responses and metastatic cancer. Interactions between CXCL12 and CXCR4 are an important drug target but, like other elongated protein-protein interfaces, present challenges for small molecule ligand discovery due to the relatively shallow and featureless binding surfaces. Calculations using an NMR complex structure revealed a binding hot spot on CXCL12 that normally interacts with the I4/I6 residues from CXCR4. Virtual screening was performed against the NMR model, and subsequent testing has verified the specific binding of multiple docking hits to this site. Together with our previous results targeting two other binding pockets that recognize sulfotyrosine residues (sY12 and sY21) of CXCR4, including a new analog against the sY12 binding site reported herein, we demonstrate that protein-protein interfaces can often possess multiple sites for engineering specific small molecule ligands that provide lead compounds for subsequent optimization by fragment based approaches. PMID:27058821

  17. Comparison of S. cerevisiae F-BAR domain structures reveals a conserved inositol phosphate binding site

    PubMed Central

    Moravcevic, Katarina; Alvarado, Diego; Schmitz, Karl R.; Kenniston, Jon A.; Mendrola, Jeannine M.; Ferguson, Kathryn M.; Lemmon, Mark A.

    2015-01-01

    SUMMARY F-BAR domains control membrane interactions in endocytosis, cytokinesis, and cell signaling. Although generally thought to bind curved membranes containing negatively charged phospholipids, numerous functional studies argue that differences in lipid-binding selectivities of F-BAR domains are functionally important. Here, we compare membrane-binding properties of the S. cerevisiae F-BAR domains in vitro and in vivo. Whereas some F-BAR domains (such as Bzz1p and Hof1p F-BARs) bind equally well to all phospholipids, the F-BAR domain from the RhoGAP Rgd1p preferentially binds phosphoinositides. We determined X-ray crystal structures of F-BAR domains from Hof1p and Rgd1p, the latter bound to an inositol phosphate. The structures explain phospholipid-binding selectivity differences, and reveal an F-BAR phosphoinositide binding site that is fully conserved in a mammalian RhoGAP called Gmip, and is partly retained in certain other F-BAR domains. Our findings reveal previously unappreciated determinants of F-BAR domain lipid-binding specificity, and provide a basis for its prediction from sequence. PMID:25620000

  18. Outreach for Outreach: Targeting social media audiences to promote a NASA kids’ web site

    NASA Astrophysics Data System (ADS)

    Pham, C. C.

    2009-12-01

    The Space Place is a successful NASA web site that benefits upper elementary school students and educators by providing games, activities, and resources to stimulate interest in science, technology, engineering, and mathematics, as well as to inform the audience of NASA’s contributions. As online social networking grows to be a central component of modern communication, The Space Place has explored the benefits of integrating social networks with the web site to increase awareness of materials the web site offers. This study analyzes the capabilities of social networks, and specifically the demographics of Twitter and Facebook. It then compares these results with the content, audience, and perceived demographics of The Space Place web site. Based upon the demographic results, we identified a target constituency that would benefit from the integration of social networks into The Space Place web site. As a result of this study, a Twitter feed has been established that releases a daily tweet from The Space Place. In addition, a Facebook page has been created to showcase new content and prompt interaction among fans of The Space Place. Currently, plans are under way to populate the Space Place Facebook page. Each social network has been utilized in an effort to spark excitement about the content on The Space Place, as well as to attract followers to the main NASA Space Place web site. To pursue this idea further, a plan has been developed to promote NASA Space Place’s social media tools among the target audience.

  19. Cross-species transcriptomic approach reveals genes in hamster implantation sites.

    PubMed

    Lei, Wei; Herington, Jennifer; Galindo, Cristi L; Ding, Tianbing; Brown, Naoko; Reese, Jeff; Paria, Bibhash C

    2014-12-01

    The mouse model has greatly contributed to understanding molecular mechanisms involved in the regulation of progesterone (P4) plus estrogen (E)-dependent blastocyst implantation process. However, little is known about contributory molecular mechanisms of the P4-only-dependent blastocyst implantation process that occurs in species such as hamsters, guineapigs, rabbits, pigs, rhesus monkeys, and perhaps humans. We used the hamster as a model of P4-only-dependent blastocyst implantation and carried out cross-species microarray (CSM) analyses to reveal differentially expressed genes at the blastocyst implantation site (BIS), in order to advance the understanding of molecular mechanisms of implantation. Upregulation of 112 genes and downregulation of 77 genes at the BIS were identified using a mouse microarray platform, while use of the human microarray revealed 62 up- and 38 down-regulated genes at the BIS. Excitingly, a sizable number of genes (30 up- and 11 down-regulated genes) were identified as a shared pool by both CSMs. Real-time RT-PCR and in situ hybridization validated the expression patterns of several up- and down-regulated genes identified by both CSMs at the hamster and mouse BIS to demonstrate the merit of CSM findings across species, in addition to revealing genes specific to hamsters. Functional annotation analysis found that genes involved in the spliceosome, proteasome, and ubiquination pathways are enriched at the hamster BIS, while genes associated with tight junction, SAPK/JNK signaling, and PPARα/RXRα signalings are repressed at the BIS. Overall, this study provides a pool of genes and evidence of their participation in up- and down-regulated cellular functions/pathways at the hamster BIS. PMID:25252651

  20. Activity-Based Protein Profiling of Organophosphorus and Thiocarbamate Pesticides Reveals Multiple Serine Hydrolase Targets in Mouse Brain

    PubMed Central

    NOMURA, DANIEL K.; CASIDA, JOHN E.

    2010-01-01

    Organophosphorus (OP) and thiocarbamate (TC) agrochemicals are used worldwide as insecticides, herbicides, and fungicides, but their safety assessment in terms of potential off-targets remains incomplete. In this study, we used a chemoproteomic platform, termed activity-based protein profiling, to broadly define serine hydrolase targets in mouse brain of a panel of 29 OP and TC pesticides. Among the secondary targets identified, enzymes involved in degradation of endocannabinoid signaling lipids, monoacylglycerol lipase and fatty acid amide hydrolase, were inhibited by several OP and TC pesticides. Blockade of these two enzymes led to elevations in brain endocannabinoid levels and dysregulated brain arachidonate metabolism. Other secondary targets include enzymes thought to also play important roles in the nervous system and unannotated proteins. This study reveals a multitude of secondary targets for OP and TC pesticides and underscores the utility of chemoproteomic platforms in gaining insights into biochemical pathways that are perturbed by these toxicants. PMID:21341672

  1. Transcriptome Analysis of Targeted Mouse Mutations Reveals the Topography of Local Changes in Gene Expression

    PubMed Central

    Adkisson, Michael; Nava, A. J.; Kirov, Julia V.; Cipollone, Andreanna; Willis, Brandon; Rapp, Jared; de Jong, Pieter J.; Lloyd, Kent C.

    2016-01-01

    The unintended consequences of gene targeting in mouse models have not been thoroughly studied and a more systematic analysis is needed to understand the frequency and characteristics of off-target effects. Using RNA-seq, we evaluated targeted and neighboring gene expression in tissues from 44 homozygous mutants compared with C57BL/6N control mice. Two allele types were evaluated: 15 targeted trap mutations (TRAP); and 29 deletion alleles (DEL), usually a deletion between the translational start and the 3’ UTR. Both targeting strategies insert a bacterial beta-galactosidase reporter (LacZ) and a neomycin resistance selection cassette. Evaluating transcription of genes in +/- 500 kb of flanking DNA around the targeted gene, we found up-regulated genes more frequently around DEL compared with TRAP alleles, however the frequency of alleles with local down-regulated genes flanking DEL and TRAP targets was similar. Down-regulated genes around both DEL and TRAP targets were found at a higher frequency than expected from a genome-wide survey. However, only around DEL targets were up-regulated genes found with a significantly higher frequency compared with genome-wide sampling. Transcriptome analysis confirms targeting in 97% of DEL alleles, but in only 47% of TRAP alleles probably due to non-functional splice variants, and some splicing around the gene trap. Local effects on gene expression are likely due to a number of factors including compensatory regulation, loss or disruption of intragenic regulatory elements, the exogenous promoter in the neo selection cassette, removal of insulating DNA in the DEL mutants, and local silencing due to disruption of normal chromatin organization or presence of exogenous DNA. An understanding of local position effects is important for understanding and interpreting any phenotype attributed to targeted gene mutations, or to spontaneous indels. PMID:26839965

  2. Integrated Expression Profiling and Genome-Wide Analysis of ChREBP Targets Reveals the Dual Role for ChREBP in Glucose-Regulated Gene Expression

    PubMed Central

    Lee, Yong Seok; Kim, Ha-Jung; Han, Jung-Youn; Im, Seung-Soon; Chong, Hansook Kim; Kwon, Je-Keun; Cho, Yun-Ho; Kim, Woo Kyung; Osborne, Timothy F.; Horton, Jay D.; Jun, Hee-Sook; Ahn, Yong-Ho; Ahn, Sung-Min; Cha, Ji-Young

    2011-01-01

    The carbohydrate response element binding protein (ChREBP), a basic helix-loop-helix/leucine zipper transcription factor, plays a critical role in the control of lipogenesis in the liver. To identify the direct targets of ChREBP on a genome-wide scale and provide more insight into the mechanism by which ChREBP regulates glucose-responsive gene expression, we performed chromatin immunoprecipitation-sequencing and gene expression analysis. We identified 1153 ChREBP binding sites and 783 target genes using the chromatin from HepG2, a human hepatocellular carcinoma cell line. A motif search revealed a refined consensus sequence (CABGTG-nnCnG-nGnSTG) to better represent critical elements of a functional ChREBP binding sequence. Gene ontology analysis shows that ChREBP target genes are particularly associated with lipid, fatty acid and steroid metabolism. In addition, other functional gene clusters related to transport, development and cell motility are significantly enriched. Gene set enrichment analysis reveals that ChREBP target genes are highly correlated with genes regulated by high glucose, providing a functional relevance to the genome-wide binding study. Furthermore, we have demonstrated that ChREBP may function as a transcriptional repressor as well as an activator. PMID:21811631

  3. In Search of Novel Drug Target Sites on Estrogen Receptors Using RNA Aptamers

    PubMed Central

    Xu, Daiying; Chatakonda, Vamsee-Krishna; Kourtidis, Antonis; Conklin, Douglas S.

    2014-01-01

    Estrogen receptor α (ERα) is a well-validated drug target for a majority of breast cancers. But the target sites on this receptor are far from exhaustively defined. Almost all ER antagonists in clinical use function by binding to the ligand-binding pocket to occlude agonist access. Resistance to this type of drugs may develop over time, not caused by the change of ERα itself, but by changes in ER associated proteins. This observation is fueling the development of reagents that downregulate ER activity through novel binding sites. However, it is challenging to find general ER antagonists that act independently from other known ER ligands. In this report, we describe the utility of RNA aptamers in the search for new drug target sites on ERα. We have identified three high affinity aptamers and characterized one of them in detail. This aptamer interacted with ERα in a way not affected by the presence or absence of either the steroidal ligands or the estrogen response DNA elements, and effectively inhibited ER-mediated transcriptional activation in a breast cancer cell line. Serving as a novel drug lead, it may also be used to guide the rational chemical synthesis of small molecule drugs or to perform screens of small molecule libraries for those that are able to displace the aptamer from its binding site. PMID:24588102

  4. Conserved Hydration Sites in Pin1 Reveal a Distinctive Water Recognition Motif in Proteins.

    PubMed

    Barman, Arghya; Smitherman, Crystal; Souffrant, Michael; Gadda, Giovanni; Hamelberg, Donald

    2016-01-25

    Structurally conserved water molecules are important for biomolecular stability, flexibility, and function. X-ray crystallographic studies of Pin1 have resolved a number of water molecules around the enzyme, including two highly conserved water molecules within the protein. The functional role of these localized water molecules remains unknown and unexplored. Pin1 catalyzes cis/trans isomerizations of peptidyl prolyl bonds that are preceded by a phosphorylated serine or threonine residue. Pin1 is involved in many subcellular signaling processes and is a potential therapeutic target for the treatment of several life threatening diseases. Here, we investigate the significance of these structurally conserved water molecules in the catalytic domain of Pin1 using molecular dynamics (MD) simulations, free energy calculations, analysis of X-ray crystal structures, and circular dichroism (CD) experiments. MD simulations and free energy calculations suggest the tighter binding water molecule plays a crucial role in maintaining the integrity and stability of a critical hydrogen-bonding network in the active site. The second water molecule is exchangeable with bulk solvent and is found in a distinctive helix-turn-coil motif. Structural bioinformatics analysis of nonredundant X-ray crystallographic protein structures in the Protein Data Bank (PDB) suggest this motif is present in several other proteins and can act as a water site, akin to the calcium EF hand. CD experiments suggest the isolated motif is in a distorted PII conformation and requires the protein environment to fully form the α-helix-turn-coil motif. This study provides valuable insights into the role of hydration in the structural integrity of Pin1 that can be exploited in protein engineering and drug design. PMID:26651388

  5. Systematic analysis of CRISPR-Cas9 mismatch tolerance reveals low levels of off-target activity.

    PubMed

    Anderson, Emily M; Haupt, Amanda; Schiel, John A; Chou, Eldon; Machado, Hidevaldo B; Strezoska, Žaklina; Lenger, Steve; McClelland, Shawn; Birmingham, Amanda; Vermeulen, Annaleen; Smith, Anja van Brabant

    2015-10-10

    The discovery that the bacterial clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) acquired immune system can be utilized to create double-strand breaks (DSBs) in eukaryotic genomes has resulted in the ability to create genomic changes more easily than with other genome engineering techniques. While there is significant potential for the CRISPR-Cas9 system to advance basic and applied research, several unknowns remain, including the specificity of the RNA-directed DNA cleavage by the small targeting RNA, the CRISPR RNA (crRNA). Here we describe a novel synthetic RNA approach that allows for high-throughput gene editing experiments. This was used with a functional assay for protein disruption to perform high-throughput analysis of crRNA activity and specificity. We performed a comprehensive test of target cleavage using crRNAs that contain one and two nucleotide mismatches to the DNA target in the 20mer targeting region of the crRNA, allowing for the evaluation of hundreds of potential mismatched target sites without the requirement for the off-target sequences and their adjacent PAMs to be present in the genome. Our results demonstrate that while many crRNAs are functional, less than 5% of crRNAs with two mismatches to their target are effective in gene editing; this suggests an overall high level of functionality but low level of off-targeting. PMID:26189696

  6. Target Site Specificity of the Tos17 Retrotransposon Shows a Preference for Insertion within Genes and against Insertion in Retrotransposon-Rich Regions of the Genome

    PubMed Central

    Miyao, Akio; Tanaka, Katsuyuki; Murata, Kazumasa; Sawaki, Hiromichi; Takeda, Shin; Abe, Kiyomi; Shinozuka, Yoriko; Onosato, Katsura; Hirochika, Hirohiko

    2003-01-01

    Because retrotransposons are the major component of plant genomes, analysis of the target site selection of retrotransposons is important for understanding the structure and evolution of plant genomes. Here, we examined the target site specificity of the rice retrotransposon Tos17, which can be activated by tissue culture. We have produced 47,196 Tos17-induced insertion mutants of rice. This mutant population carries ∼500,000 insertions. We analyzed >42,000 flanking sequences of newly transposed Tos17 copies from 4316 mutant lines. More than 20,000 unique loci were assigned on the rice genomic sequence. Analysis of these sequences showed that insertion events are three times more frequent in genic regions than in intergenic regions. Consistent with this result, Tos17 was shown to prefer gene-dense regions over centromeric heterochromatin regions. Analysis of insertion target sequences revealed a palindromic consensus sequence, ANGTT-TSD-AACNT, flanking the 5-bp target site duplication. Although insertion targets are distributed throughout the chromosomes, they tend to cluster, and 76% of the clusters are located in genic regions. The mechanisms of target site selection by Tos17, the utility of the mutant lines, and the knockout gene database are discussed. PMID:12897251

  7. Off-Target Effects of Psychoactive Drugs Revealed by Genome-Wide Assays in Yeast

    PubMed Central

    Ericson, Elke; Gebbia, Marinella; Heisler, Lawrence E.; Wildenhain, Jan; Tyers, Mike; Giaever, Guri; Nislow, Corey

    2008-01-01

    To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 compounds that inhibited wild-type yeast growth and were thus selected for genome-wide fitness profiling. Many of these drugs had a propensity to affect multiple cellular functions. The sensitivity profiles of half of the analyzed drugs were enriched for core cellular processes such as secretion, protein folding, RNA processing, and chromatin structure. Interestingly, fluoxetine (Prozac) interfered with establishment of cell polarity, cyproheptadine (Periactin) targeted essential genes with chromatin-remodeling roles, while paroxetine (Paxil) interfered with essential RNA metabolism genes, suggesting potential secondary drug targets. We also found that the more recently developed atypical antipsychotic clozapine (Clozaril) had no fewer off-target effects in yeast than the typical antipsychotics haloperidol (Haldol) and pimozide (Orap). Our results suggest that model organism pharmacogenetic studies provide a rational foundation for understanding the off-target effects of clinically important psychoactive agents and suggest a rational means both for devising compound derivatives with fewer side effects and for tailoring drug treatment to individual patient genotypes. PMID:18688276

  8. Analysis of Euglena gracilis Plastid-Targeted Proteins Reveals Different Classes of Transit Sequences▿

    PubMed Central

    Durnford, Dion G.; Gray, Michael W.

    2006-01-01

    The plastid of Euglena gracilis was acquired secondarily through an endosymbiotic event with a eukaryotic green alga, and as a result, it is surrounded by a third membrane. This membrane complexity raises the question of how the plastid proteins are targeted to and imported into the organelle. To further explore plastid protein targeting in Euglena, we screened a total of 9,461 expressed sequence tag (EST) clusters (derived from 19,013 individual ESTs) for full-length proteins that are plastid localized to characterize their targeting sequences and to infer potential modes of translocation. Of the 117 proteins identified as being potentially plastid localized whose N-terminal targeting sequences could be inferred, 83 were unique and could be classified into two major groups. Class I proteins have tripartite targeting sequences, comprising (in order) an N-terminal signal sequence, a plastid transit peptide domain, and a predicted stop-transfer sequence. Within this class of proteins are the lumen-targeted proteins (class IB), which have an additional hydrophobic domain similar to a signal sequence and required for further targeting across the thylakoid membrane. Class II proteins lack the putative stop-transfer sequence and possess only a signal sequence at the N terminus, followed by what, in amino acid composition, resembles a plastid transit peptide. Unexpectedly, a few unrelated plastid-targeted proteins exhibit highly similar transit sequences, implying either a recent swapping of these domains or a conserved function. This work represents the most comprehensive description to date of transit peptides in Euglena and hints at the complex routes of plastid targeting that must exist in this organism. PMID:16998072

  9. Recent discoveries of influenza A drug target sites to combat virus replication.

    PubMed

    Patel, Hershna; Kukol, Andreas

    2016-06-15

    Sequence variations in the binding sites of influenza A proteins are known to limit the effectiveness of current antiviral drugs. Clinically, this leads to increased rates of virus transmission and pathogenicity. Potential influenza A inhibitors are continually being discovered as a result of high-throughput cell based screening studies, whereas the application of computational tools to aid drug discovery has further increased the number of predicted inhibitors reported. This review brings together the aspects that relate to the identification of influenza A drug target sites and the findings from recent antiviral drug discovery strategies. PMID:27284062

  10. PARma: identification of microRNA target sites in AGO-PAR-CLIP data.

    PubMed

    Erhard, Florian; Dölken, Lars; Jaskiewicz, Lukasz; Zimmer, Ralf

    2013-01-01

    PARma is a complete data analysis software for AGO-PAR-CLIP experiments to identify target sites of microRNAs as well as the microRNA binding to these sites. It integrates specific characteristics of the experiments into a generative model. The model and a novel pattern discovery tool are iteratively applied to data to estimate seed activity probabilities, cluster confidence scores and to assign the most probable microRNA. Based on differential PAR-CLIP analysis and comparison to RIP-Chip data, we show that PARma is more accurate than existing approaches. PARma is available from http://www.bio.ifi.lmu.de/PARma. PMID:23895117

  11. PARma: identification of microRNA target sites in AGO-PAR-CLIP data

    PubMed Central

    2013-01-01

    PARma is a complete data analysis software for AGO-PAR-CLIP experiments to identify target sites of microRNAs as well as the microRNA binding to these sites. It integrates specific characteristics of the experiments into a generative model. The model and a novel pattern discovery tool are iteratively applied to data to estimate seed activity probabilities, cluster confidence scores and to assign the most probable microRNA. Based on differential PAR-CLIP analysis and comparison to RIP-Chip data, we show that PARma is more accurate than existing approaches. PARma is available from http://www.bio.ifi.lmu.de/PARma PMID:23895117

  12. DNA fingerprinting reveals elevated mutation rates in herring gulls inhabiting a genotoxically contaminated site

    SciTech Connect

    Yauk, C.L.; Quinn, J.S.

    1995-12-31

    The authors used multi-locus DNA fingerprinting to examine families of herring gulls (Larus argentatus) from a genotoxically contaminated site (Hamilton Harbour) and from a pristine location (Kent Island, Bay of Fundy) to show significant differences in mutation rates between the locations. Overall the authors identified 17 mutant bands from 15 individuals of the 35 examined from Hamilton Harbour, and 7 mutant fragments from 7 individuals, of the 43 examined from Kent Island; a mutation frequency of 0.429 per nestling for Hamilton Harbour and 0.163 for Kent Island. The total number of individuals with mutant bands was significantly higher at Hamilton Harbour than at Kent Island (X{sup 2}=6.734; df = 1; P < 0.01). Ongoing analysis of other less contaminated sites also reveals lower mutation rates than those seen in Hamilton Harbour. With multi-locus DNA fingerprinting many regions of the genome can be surveyed simultaneously. The tandemly repeated arrays of nucleotides examined with DNA fingerprinting are known to have elevated rates of mutation. Furthermore, the mutations seen with DNA fingerprinting are predominantly heritable. Other biomarkers currently used in situ are not able to monitor direct and heritable DNA mutation, or measure biological endpoints that frequently result in spontaneous abortion creating difficulty in observing significantly elevated levels in viable offspring. The authors suggest that multilocus DNA fingerprinting can be used as a biomarker to identify potentially heritable risks before the onset of other types of ecological damage. This approach provides a direct measure of mutation in situ and in vivo in a vertebrate species under ambient conditions.

  13. Revealing divergent evolution, identifying circular permutations and detecting active-sites by protein structure comparison

    PubMed Central

    Chen, Luonan; Wu, Ling-Yun; Wang, Yong; Zhang, Shihua; Zhang, Xiang-Sun

    2006-01-01

    Background Protein structure comparison is one of the most important problems in computational biology and plays a key role in protein structure prediction, fold family classification, motif finding, phylogenetic tree reconstruction and protein docking. Results We propose a novel method to compare the protein structures in an accurate and efficient manner. Such a method can be used to not only reveal divergent evolution, but also identify circular permutations and further detect active-sites. Specifically, we define the structure alignment as a multi-objective optimization problem, i.e., maximizing the number of aligned atoms and minimizing their root mean square distance. By controlling a single distance-related parameter, theoretically we can obtain a variety of optimal alignments corresponding to different optimal matching patterns, i.e., from a large matching portion to a small matching portion. The number of variables in our algorithm increases with the number of atoms of protein pairs in almost a linear manner. In addition to solid theoretical background, numerical experiments demonstrated significant improvement of our approach over the existing methods in terms of quality and efficiency. In particular, we show that divergent evolution, circular permutations and active-sites (or structural motifs) can be identified by our method. The software SAMO is available upon request from the authors, or from and . Conclusion A novel formulation is proposed to accurately align protein structures in the framework of multi-objective optimization, based on a sequence order-independent strategy. A fast and accurate algorithm based on the bipartite matching algorithm is developed by exploiting the special features. Convergence of computation is shown in experiments and is also theoretically proven. PMID:16948858

  14. Expression profiling of lymph nodes in tuberculosis patients reveal inflammatory milieu at site of infection

    PubMed Central

    Maji, Abhijit; Misra, Richa; Kumar Mondal, Anupam; Kumar, Dhirendra; Bajaj, Divya; Singhal, Anshika; Arora, Gunjan; Bhaduri, Asani; Sajid, Andaleeb; Bhatia, Sugandha; Singh, Sompal; Singh, Harshvardhan; Rao, Vivek; Dash, Debasis; Baby Shalini, E; Sarojini Michael, Joy; Chaudhary, Anil; Gokhale, Rajesh S.; Singh, Yogendra

    2015-01-01

    Extrapulmonary manifestations constitute 15 to 20% of tuberculosis cases, with lymph node tuberculosis (LNTB) as the most common form of infection. However, diagnosis and treatment advances are hindered by lack of understanding of LNTB biology. To identify host response, Mycobacterium tuberculosis infected lymph nodes from LNTB patients were studied by means of transcriptomics and quantitative proteomics analyses. The selected targets obtained by comparative analyses were validated by quantitative PCR and immunohistochemistry. This approach provided expression data for 8,728 transcripts and 102 proteins, differentially regulated in the infected human lymph node. Enhanced inflammation with upregulation of T-helper1-related genes, combined with marked dysregulation of matrix metalloproteinases, indicates tissue damage due to high immunoactivity at infected niche. This expression signature was accompanied by significant upregulation of an immunoregulatory gene, leukotriene A4 hydrolase, at both transcript and protein levels. Comparative transcriptional analyses revealed LNTB-specific perturbations. In contrast to pulmonary TB-associated increase in lipid metabolism, genes involved in fatty-acid metabolism were found to be downregulated in LNTB suggesting differential lipid metabolic signature. This study investigates the tissue molecular signature of LNTB patients for the first time and presents findings that indicate the possible mechanism of disease pathology through dysregulation of inflammatory and tissue-repair processes. PMID:26469538

  15. miRNA–target chimeras reveal miRNA 3′-end pairing as a major determinant of Argonaute target specificity

    PubMed Central

    Moore, Michael J.; Scheel, Troels K. H.; Luna, Joseph M.; Park, Christopher Y.; Fak, John J.; Nishiuchi, Eiko; Rice, Charles M.; Darnell, Robert B.

    2015-01-01

    microRNAs (miRNAs) act as sequence-specific guides for Argonaute (AGO) proteins, which mediate posttranscriptional silencing of target messenger RNAs. Despite their importance in many biological processes, rules governing AGO–miRNA targeting are only partially understood. Here we report a modified AGO HITS-CLIP strategy termed CLEAR (covalent ligation of endogenous Argonaute-bound RNAs)-CLIP, which enriches miRNAs ligated to their endogenous mRNA targets. CLEAR-CLIP mapped ∼130,000 endogenous miRNA–target interactions in mouse brain and ∼40,000 in human hepatoma cells. Motif and structural analysis define expanded pairing rules for over 200 mammalian miRNAs. Most interactions combine seed-based pairing with distinct, miRNA-specific patterns of auxiliary pairing. At some regulatory sites, this specificity confers distinct silencing functions to miRNA family members with shared seed sequences but divergent 3′-ends. This work provides a means for explicit biochemical identification of miRNA sites in vivo, leading to the discovery that miRNA 3′-end pairing is a general determinant of AGO binding specificity. PMID:26602609

  16. Physiological screening for target site insensitivity and localization of Na(+)/K(+)-ATPase in cardenolide-adapted Lepidoptera.

    PubMed

    Petschenka, Georg; Offe, Julia K; Dobler, Susanne

    2012-05-01

    Cardenolides are toxic plant compounds which specifically inhibit Na(+)/K(+)-ATPase, an animal enzyme which is essential for many physiological processes, such as the generation of action potentials. Several adapted insects feeding on cardenolide-containing plants sequester these toxins for their own defence. Some of these insects were shown to possess Na(+)/K(+)-ATPases with a reduced sensitivity towards cardenolides (target site insensitivity). In the present study we screened five species of arctiid moths feeding on cardenolide-containing plants for target site insensitivity towards cardenolides using an in vitro enzyme assay. The derived dose response curves of the respective Na(+)/K(+)-ATPases were compared to the insensitive Na(+)/K(+)-ATPase of the monarch butterfly (Danaus plexippus). Na(+)/K(+)-ATPases of all arctiid species tested were highly sensitive to ouabain, a water-soluble cardenolide which is most widely used in laboratory studies. Nevertheless, we detected substantial amounts of cardenolides in the haemolymph of two of the arctiid species. In caterpillars of the sequestering arctiid Empyreuma pugione and of D. plexippus we localized Na(+)/K(+)-ATPase by immunohistochemistry and western blot (in D. plexippus). Both techniques revealed strong expression of the enzyme in the nervous tissue and indicated weak expression or even absence in other tissues tested. We conclude that instead of target site insensitivity the investigated arctiid species use a different strategy to tolerate cardenolides. Most plausibly, the perineurium surrounding the nervous tissue functions as a barrier which prevents cardenolides from reaching Na(+)/K(+)-ATPase in the ventral nerve cord. PMID:22343317

  17. Relative position and pose measurement approach of specific operation site of space non-cooperative target

    NASA Astrophysics Data System (ADS)

    Chen, Feng; Zhou, Ying; Li, Ronghua; Huang, Jianming

    2015-12-01

    In order to achieve the rendezvous and capture of the space non-cooperative target, the relative position and pose measurement of non-cooperative target must be resolved. Since the marker is not installed into the non-cooperative target and there is no inter satellite link to transfer the information, so it is very difficult to measure the relative position and pose measurement of non-cooperative target. The solar array connecting frame of non-cooperative targets have their characters and are easy to capture, so the position and pose measurement of specific operation site of non-cooperative target based on stereo vision has been studied in this paper. The method composed of image acquiring, image filtering, edge detection, feature extraction and relative pose measurement. Finally, the relative position and attitude parameters of the solar wing connection were obtained and provided to the control system. The results of simulation and ground verification show that the algorithm is accurate and effective, and can satisfy the technical requirements of the on orbit operation. The measurement approach can be used for engineering implementation.

  18. Targeting Alternative Sites on the Androgen Receptor to Treat Castration-Resistant Prostate Cancer

    PubMed Central

    Lallous, Nada; Dalal, Kush; Cherkasov, Artem; Rennie, Paul S.

    2013-01-01

    Recurrent, metastatic prostate cancer continues to be a leading cause of cancer-death in men. The androgen receptor (AR) is a modular, ligand-inducible transcription factor that regulates the expression of genes that can drive the progression of this disease, and as a consequence, this receptor is a key therapeutic target for controlling prostate cancer. The current drugs designed to directly inhibit the AR are called anti-androgens, and all act by competing with androgens for binding to the androgen/ligand binding site. Unfortunately, with the inevitable progression of the cancer to castration resistance, many of these drugs become ineffective. However, there are numerous other regulatory sites on this protein that have not been exploited therapeutically. The regulation of AR activity involves a cascade of complex interactions with numerous chaperones, co-factors and co-regulatory proteins, leading ultimately to direct binding of AR dimers to specific DNA androgen response elements within the promoter and enhancers of androgen-regulated genes. As part of the family of nuclear receptors, the AR is organized into modular structural and functional domains with specialized roles in facilitating their inter-molecular interactions. These regions of the AR present attractive, yet largely unexploited, drug target sites for reducing or eliminating androgen signaling in prostate cancers. The design of small molecule inhibitors targeting these specific AR domains is only now being realized and is the culmination of decades of work, including crystallographic and biochemistry approaches to map the shape and accessibility of the AR surfaces and cavities. Here, we review the structure of the AR protein and describe recent advancements in inhibiting its activity with small molecules specifically designed to target areas distinct from the receptor’s androgen binding site. It is anticipated that these new classes of anti-AR drugs will provide an additional arsenal to treat

  19. Targeted Isolation of Antibodies Directed against Major Sites of SIV Env Vulnerability.

    PubMed

    Mason, Rosemarie D; Welles, Hugh C; Adams, Cameron; Chakrabarti, Bimal K; Gorman, Jason; Zhou, Tongqing; Nguyen, Richard; O'Dell, Sijy; Lusvarghi, Sabrina; Bewley, Carole A; Li, Hui; Shaw, George M; Sheng, Zizhang; Shapiro, Lawrence; Wyatt, Richard; Kwong, Peter D; Mascola, John R; Roederer, Mario

    2016-04-01

    The simian immunodeficiency virus (SIV) challenge model of lentiviral infection is often used as a model to human immunodeficiency virus type 1 (HIV-1) for studying vaccine mediated and immune correlates of protection. However, knowledge of the structure of the SIV envelope (Env) glycoprotein is limited, as is knowledge of binding specificity, function and potential efficacy of SIV antibody responses. In this study we describe the use of a competitive probe binding sort strategy as well as scaffolded probes for targeted isolation of SIV Env-specific monoclonal antibodies (mAbs). We isolated nearly 70 SIV-specific mAbs directed against major sites of SIV Env vulnerability analogous to broadly neutralizing antibody (bnAb) targets of HIV-1, namely, the CD4 binding site (CD4bs), CD4-induced (CD4i)-site, peptide epitopes in variable loops 1, 2 and 3 (V1, V2, V3) and potentially glycan targets of SIV Env. The range of SIV mAbs isolated includes those exhibiting varying degrees of neutralization breadth and potency as well as others that demonstrated binding but not neutralization. Several SIV mAbs displayed broad and potent neutralization of a diverse panel of 20 SIV viral isolates with some also neutralizing HIV-2(7312A). This extensive panel of SIV mAbs will facilitate more effective use of the SIV non-human primate (NHP) model for understanding the variables in development of a HIV vaccine or immunotherapy. PMID:27064278

  20. Targeted Isolation of Antibodies Directed against Major Sites of SIV Env Vulnerability

    PubMed Central

    Mason, Rosemarie D.; Welles, Hugh C.; Adams, Cameron; Chakrabarti, Bimal K.; Gorman, Jason; Zhou, Tongqing; Nguyen, Richard; O’Dell, Sijy; Lusvarghi, Sabrina; Bewley, Carole A.; Li, Hui; Shaw, George M.; Sheng, Zizhang; Shapiro, Lawrence; Wyatt, Richard; Kwong, Peter D.; Mascola, John R.; Roederer, Mario

    2016-01-01

    The simian immunodeficiency virus (SIV) challenge model of lentiviral infection is often used as a model to human immunodeficiency virus type 1 (HIV-1) for studying vaccine mediated and immune correlates of protection. However, knowledge of the structure of the SIV envelope (Env) glycoprotein is limited, as is knowledge of binding specificity, function and potential efficacy of SIV antibody responses. In this study we describe the use of a competitive probe binding sort strategy as well as scaffolded probes for targeted isolation of SIV Env-specific monoclonal antibodies (mAbs). We isolated nearly 70 SIV-specific mAbs directed against major sites of SIV Env vulnerability analogous to broadly neutralizing antibody (bnAb) targets of HIV-1, namely, the CD4 binding site (CD4bs), CD4-induced (CD4i)-site, peptide epitopes in variable loops 1, 2 and 3 (V1, V2, V3) and potentially glycan targets of SIV Env. The range of SIV mAbs isolated includes those exhibiting varying degrees of neutralization breadth and potency as well as others that demonstrated binding but not neutralization. Several SIV mAbs displayed broad and potent neutralization of a diverse panel of 20 SIV viral isolates with some also neutralizing HIV-27312A. This extensive panel of SIV mAbs will facilitate more effective use of the SIV non-human primate (NHP) model for understanding the variables in development of a HIV vaccine or immunotherapy. PMID:27064278

  1. Structure analysis reveals the flexibility of the ADAMTS-5 active site.

    PubMed

    Shieh, Huey-Sheng; Tomasselli, Alfredo G; Mathis, Karl J; Schnute, Mark E; Woodard, Scott S; Caspers, Nicole; Williams, Jennifer M; Kiefer, James R; Munie, Grace; Wittwer, Arthur; Malfait, Anne-Marie; Tortorella, Micky D

    2011-04-01

    A ((1S,2R)-2-hydroxy-2,3-dihydro-1H-inden-1-yl) succinamide derivative (here referred to as Compound 12) shows significant activity toward many matrix metalloproteinases (MMPs), including MMP-2, MMP-8, MMP-9, and MMP-13. Modeling studies had predicted that this compound would not bind to ADAMTS-5 (a disintegrin and metalloproteinase with thrombospondin motifs-5) due to its shallow S1' pocket. However, inhibition analysis revealed it to be a nanomolar inhibitor of both ADAMTS-4 and -5. The observed inconsistency was explained by analysis of crystallographic structures, which showed that Compound 12 in complex with the catalytic domain of ADAMTS-5 (cataTS5) exhibits an unusual conformation in the S1' pocket of the protein. This first demonstration that cataTS5 can undergo an induced conformational change in its active site pocket by a molecule like Compound 12 should enable the design of new aggrecanase inhibitors with better potency and selectivity profiles. PMID:21370305

  2. Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

    PubMed Central

    Mondal, Anupam; Bhattacherjee, Arnab

    2015-01-01

    DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

  3. Host factors in retroviral integration and the selection of integration target sites

    PubMed Central

    Craigie, Robert; Bushman, Frederic D.

    2015-01-01

    In order to replicate, a retrovirus must integrate a DNA copy of the viral RNA genome into a chromosome of the host cell. The study of retroviral integration has advanced considerably in the last few years. Here we focus on host factor interactions and the linked area of integration targeting. Genome-wide screens for cellular factors affecting HIV replication have identified a series of host cell proteins that may mediate subcellular trafficking of integration complexes, nuclear import, and integration target site selection. The cell transcriptional co-activator protein LEDGF/p75 has been identified as a tethering factor important for HIV integration, and recently, BET proteins (Brd2, 4, and 4) have been identified as tethering factors for the gammaretroviruses. A new class of HIV inhibitors has been developed targeting the HIV-1 IN-LEDGF binding site, though surprisingly these inhibitors appear to block assembly late during replication and do not act at the integration step. Going forward, genome-wide studies of HIV-host interactions offer many new starting points to investigate HIV replication and identify potential new inhibitor targets. PMID:26104434

  4. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen

    PubMed Central

    Jardine, Joseph G.; Kulp, Daniel W.; Havenar-Daughton, Colin; Sarkar, Anita; Briney, Bryan; Sok, Devin; Sesterhenn, Fabian; Ereño-Orbea, June; Kalyuzhniy, Oleksandr; Deresa, Isaiah; Hu, Xiaozhen; Spencer, Skye; Jones, Meaghan; Georgeson, Erik; Adachi, Yumiko; Kubitz, Michael; deCamp, Allan C.; Julien, Jean-Philippe; Wilson, Ian A.; Burton, Dennis R.; Crotty, Shane; Schief, William R.

    2016-01-01

    Induction of broadly neutralizing antibodies (bnAbs) is a major HIV vaccine goal. Germline-targeting immunogens aim to initiate bnAb induction by activating bnAb germline precursor B cells. Critical unmet challenges are to determine whether bnAb precursor naïve B cells bind germline-targeting immunogens and occur at sufficient frequency in humans for reliable vaccine responses. We employed deep mutational scanning and multi-target optimization to develop a germline-targeting immunogen (eOD-GT8) for diverse VRC01-class bnAbs. We then used the immunogen to isolate VRC01-class precursor naïve B cells from HIV-uninfected donors. Frequencies of true VRC01-class precursors, their structures, and their eOD-GT8 affinities support this immunogen as a candidate human vaccine prime. These methods could be applied to germline targeting for other classes of HIV bnAbs and for Abs to other pathogens. PMID:27013733

  5. Programmable Site-Specific Nucleases for Targeted Genome Engineering in Higher Eukaryotes.

    PubMed

    Govindan, Ganesan; Ramalingam, Sivaprakash

    2016-11-01

    Recent advances in the targeted genome engineering enable molecular biologists to generate sequence specific modifications with greater efficiency and higher specificity in complex eukaryotic genomes. Programmable site-specific DNA cleavage reagents and cellular DNA repair mechanisms have made this possible. These reagents have become powerful tools for delivering a site-specific genomic double-strand break (DSB) at the desired chromosomal locus, which produces sequence alterations through error-prone non-homologous end joining (NHEJ) resulting in gene inactivations/knockouts. Alternatively, the DSB can be repaired through homology-directed repair (HDR) using a donor DNA template, which leads to the introduction of desired sequence modifications at the predetermined site. Here, we summarize the role of three classes of nucleases; zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system in achieving targeted genome modifications. Further, we discuss the progress towards the applications of programmable site-specific nucleases (SSNs) in treating human diseases and other biological applications in economically important higher eukaryotic organisms such as plants and livestock. J. Cell. Physiol. 231: 2380-2392, 2016. © 2016 Wiley Periodicals, Inc. PMID:26945523

  6. Membrane blebbing as a recovery manoeuvre in site-specific sonoporation mediated by targeted microbubbles

    PubMed Central

    Leow, Ruen Shan; Wan, Jennifer M. F.; Yu, Alfred C. H.

    2015-01-01

    Site-specific perforation of the plasma membrane can be achieved through ultrasound-triggered cavitation of a single microbubble positioned adjacent to the cell. However, for this perforation approach (sonoporation), the recovery manoeuvres invoked by the cell are unknown. Here, we report new findings on how membrane blebbing can be a recovery manoeuvre that may take place in sonoporation episodes whose pores are of micrometres in diameter. Each sonoporation site was created using a protocol involving single-shot ultrasound exposure (frequency: 1 MHz; pulse length: 30 cycles; peak negative pressure: 0.45 MPa) which triggered inertial cavitation of a single targeted microbubble (diameter: 1–5 µm). Over this process, live confocal microscopy was conducted in situ to monitor membrane dynamics, model drug uptake kinetics and cytoplasmic calcium ion (Ca2+) distribution. Results show that blebbing would occur at a recovering sonoporation site after its resealing, and it may emerge elsewhere along the membrane periphery. The bleb size was correlated with the pre-exposure microbubble diameter, and 99% of blebbing cases at sonoporation sites were inflicted by microbubbles larger than 1.5 µm diameter (analysed over 124 sonoporation episodes). Blebs were not observed at irreversible sonoporation sites or when sonoporation site repair was inhibited via extracellular Ca2+ chelation. Functionally, the bleb volume was found to serve as a buffer compartment to accommodate the cytoplasmic Ca2+ excess brought about by Ca2+ influx during sonoporation. These findings suggest that membrane blebbing would help sonoporated cells restore homeostasis. PMID:25694544

  7. Inacessible Andean sites reveal land-use induced stabilisation of soil organic carbon

    NASA Astrophysics Data System (ADS)

    Heitkamp, Felix; Maqsood, Shafique; Sylvester, Steven; Kessler, Michael; Jungkunst, Hermann

    2015-04-01

    these findings were a high proportion of complexed SOC in rangeland soils (25 to 36 vs. 59% of SOC were extractable with Na-pyrophosphate in pristine and rangeland soils, respectively). Moreover, less C was associated with the light fraction (< 1.6 g cm-3), but more with the silt fraction (< 1.6 g cm-3 and size between 63 and 2µm). Differences of the δ13C signatures of vegetation and soil (Δδ13C plant-soil) were lower in all density-size fractions and even negative in the light fraction of rangeland soils, meaning that these were more depleted or less enriched with 13C relative to vegetation. This could indicate stabilisation of old C derived from former pristine vegetation (having a lower 13C signature), presence of pyrogenic carbon or specific stabilisation of depleted compounds. Overall, our the approach of using large, inaccessible sites as reference for continuously used sites revealed that grazing management had tremendous effects on the partitioning of SOC among different fractions, but not on the total stocks. Since SOC in rangeland soils was more effectively stabilised, reactions to environmental changes should be slower and SOC in pristine soils is likely to react more sensitive.

  8. Crystal Structures of a Multidrug-Resistant Human Immunodeficiency Virus Type 1 Protease Reveal an Expanded Active-Site Cavity

    SciTech Connect

    Logsdon, Bradley C.; Vickrey, John F.; Martin, Philip; Proteasa, Gheorghe; Koepke, Jay I.; Terlecky, Stanley R.; Wawrzak, Zdzislaw; Winters, Mark A.; Merigan, Thomas C.; Kovari, Ladislau C.

    2010-03-08

    The goal of this study was to use X-ray crystallography to investigate the structural basis of resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors. We overexpressed, purified, and crystallized a multidrug-resistant (MDR) HIV-1 protease enzyme derived from a patient failing on several protease inhibitor-containing regimens. This HIV-1 variant contained codon mutations at positions 10, 36, 46, 54, 63, 71, 82, 84, and 90 that confer drug resistance to protease inhibitors. The 1.8-{angstrom} crystal structure of this MDR patient isolate reveals an expanded active-site cavity. The active-site expansion includes position 82 and 84 mutations due to the alterations in the amino acid side chains from longer to shorter (e.g., V82A and I84V). The MDR isolate 769 protease 'flaps' stay open wider, and the difference in the flap tip distances in the MDR 769 variant is 12 {angstrom}. The MDR 769 protease crystal complexes with lopinavir and DMP450 reveal completely different binding modes. The network of interactions between the ligands and the MDR 769 protease is completely different from that seen with the wild-type protease-ligand complexes. The water molecule-forming hydrogen bonds bridging between the two flaps and either the substrate or the peptide-based inhibitor are lacking in the MDR 769 clinical isolate. The S1, S1', S3, and S3' pockets show expansion and conformational change. Surface plasmon resonance measurements with the MDR 769 protease indicate higher k{sub off} rates, resulting in a change of binding affinity. Surface plasmon resonance measurements provide k{sub on} and k{sub off} data (K{sub d} = k{sub off}/k{sub on}) to measure binding of the multidrug-resistant protease to various ligands. This MDR 769 protease represents a new antiviral target, presenting the possibility of designing novel inhibitors with activity against the open and expanded protease forms.

  9. Non-catalytic site HIV-1 integrase inhibitors disrupt core maturation and induce a reverse transcription block in target cells.

    PubMed

    Balakrishnan, Mini; Yant, Stephen R; Tsai, Luong; O'Sullivan, Christopher; Bam, Rujuta A; Tsai, Angela; Niedziela-Majka, Anita; Stray, Kirsten M; Sakowicz, Roman; Cihlar, Tomas

    2013-01-01

    HIV-1 integrase (IN) is the target for two classes of antiretrovirals: i) the integrase strand-transfer inhibitors (INSTIs) and ii) the non-catalytic site integrase inhibitors (NCINIs). NCINIs bind at the IN dimer interface and are thought to interfere primarily with viral DNA (vDNA) integration in the target cell by blocking IN-vDNA assembly as well as the IN-LEDGF/p75 interaction. Herein we show that treatment of virus-producing cells, but not of mature virions or target cells, drives NCINI antiviral potency. NCINIs target an essential late-stage event in HIV replication that is insensitive to LEDGF levels in the producer cells. Virus particles produced in the presence of NCINIs displayed normal Gag-Pol processing and endogenous reverse transcriptase activity, but were defective at initiating vDNA synthesis following entry into the target cell. NCINI-resistant virus carrying a T174I mutation in the IN dimer interface was less sensitive to the compound-induced late-stage effects, including the reverse transcription block. Wild-type, but not T174I virus, produced in the presence of NCINIs exhibited striking defects in core morphology and an increased level of IN oligomers that was not observed upon treatment of mature cell-free particles. Collectively, these results reveal that NCINIs act through a novel mechanism that is unrelated to the previously observed inhibition of IN activity or IN-LEDGF interaction, and instead involves the disruption of an IN function during HIV-1 core maturation and assembly. PMID:24040198

  10. Non-Catalytic Site HIV-1 Integrase Inhibitors Disrupt Core Maturation and Induce a Reverse Transcription Block in Target Cells

    PubMed Central

    Tsai, Luong; O’Sullivan, Christopher; Bam, Rujuta A.; Tsai, Angela; Niedziela-Majka, Anita; Stray, Kirsten M.; Sakowicz, Roman; Cihlar, Tomas

    2013-01-01

    HIV-1 integrase (IN) is the target for two classes of antiretrovirals: i) the integrase strand-transfer inhibitors (INSTIs) and ii) the non-catalytic site integrase inhibitors (NCINIs). NCINIs bind at the IN dimer interface and are thought to interfere primarily with viral DNA (vDNA) integration in the target cell by blocking IN-vDNA assembly as well as the IN-LEDGF/p75 interaction. Herein we show that treatment of virus-producing cells, but not of mature virions or target cells, drives NCINI antiviral potency. NCINIs target an essential late-stage event in HIV replication that is insensitive to LEDGF levels in the producer cells. Virus particles produced in the presence of NCINIs displayed normal Gag-Pol processing and endogenous reverse transcriptase activity, but were defective at initiating vDNA synthesis following entry into the target cell. NCINI-resistant virus carrying a T174I mutation in the IN dimer interface was less sensitive to the compound-induced late-stage effects, including the reverse transcription block. Wild-type, but not T174I virus, produced in the presence of NCINIs exhibited striking defects in core morphology and an increased level of IN oligomers that was not observed upon treatment of mature cell-free particles. Collectively, these results reveal that NCINIs act through a novel mechanism that is unrelated to the previously observed inhibition of IN activity or IN-LEDGF interaction, and instead involves the disruption of an IN function during HIV-1 core maturation and assembly. PMID:24040198

  11. Protecting Important Sites for Biodiversity Contributes to Meeting Global Conservation Targets

    PubMed Central

    Butchart, Stuart H. M.; Scharlemann, Jörn P. W.; Evans, Mike I.; Quader, Suhel; Aricò, Salvatore; Arinaitwe, Julius; Balman, Mark; Bennun, Leon A.; Bertzky, Bastian; Besançon, Charles; Boucher, Timothy M.; Brooks, Thomas M.; Burfield, Ian J.; Burgess, Neil D.; Chan, Simba; Clay, Rob P.; Crosby, Mike J.; Davidson, Nicholas C.; De Silva, Naamal; Devenish, Christian; Dutson, Guy C. L.; Fernández, David F. Día z; Fishpool, Lincoln D. C.; Fitzgerald, Claire; Foster, Matt; Heath, Melanie F.; Hockings, Marc; Hoffmann, Michael; Knox, David; Larsen, Frank W.; Lamoreux, John F.; Loucks, Colby; May, Ian; Millett, James; Molloy, Dominic; Morling, Paul; Parr, Mike; Ricketts, Taylor H.; Seddon, Nathalie; Skolnik, Benjamin; Stuart, Simon N.; Upgren, Amy; Woodley, Stephen

    2012-01-01

    Protected areas (PAs) are a cornerstone of conservation efforts and now cover nearly 13% of the world's land surface, with the world's governments committed to expand this to 17%. However, as biodiversity continues to decline, the effectiveness of PAs in reducing the extinction risk of species remains largely untested. We analyzed PA coverage and trends in species' extinction risk at globally significant sites for conserving birds (10,993 Important Bird Areas, IBAs) and highly threatened vertebrates and conifers (588 Alliance for Zero Extinction sites, AZEs) (referred to collectively hereafter as ‘important sites’). Species occurring in important sites with greater PA coverage experienced smaller increases in extinction risk over recent decades: the increase was half as large for bird species with>50% of the IBAs at which they occur completely covered by PAs, and a third lower for birds, mammals and amphibians restricted to protected AZEs (compared with unprotected or partially protected sites). Globally, half of the important sites for biodiversity conservation remain unprotected (49% of IBAs, 51% of AZEs). While PA coverage of important sites has increased over time, the proportion of PA area covering important sites, as opposed to less important land, has declined (by 0.45–1.14% annually since 1950 for IBAs and 0.79–1.49% annually for AZEs). Thus, while appropriately located PAs may slow the rate at which species are driven towards extinction, recent PA network expansion has under-represented important sites. We conclude that better targeted expansion of PA networks would help to improve biodiversity trends. PMID:22457717

  12. THPP target assignment reveals EchA6 as an essential fatty acid shuttle in mycobacteria.

    PubMed

    Cox, Jonathan A G; Abrahams, Katherine A; Alemparte, Carlos; Ghidelli-Disse, Sonja; Rullas, Joaquín; Angulo-Barturen, Iñigo; Singh, Albel; Gurcha, Sudagar S; Nataraj, Vijayashankar; Bethell, Stephen; Remuiñán, Modesto J; Encinas, Lourdes; Jervis, Peter J; Cammack, Nicholas C; Bhatt, Apoorva; Kruse, Ulrich; Bantscheff, Marcus; Fütterer, Klaus; Barros, David; Ballell, Lluis; Drewes, Gerard; Besra, Gurdyal S

    2016-01-01

    Phenotypic screens for bactericidal compounds against drug-resistant tuberculosis are beginning to yield novel inhibitors. However, reliable target identification remains challenging. Here, we show that tetrahydropyrazo[1,5-a]pyrimidine-3-carboxamide (THPP) selectively pulls down EchA6 in a stereospecific manner, instead of the previously assigned target Mycobacterium tuberculosis MmpL3. While homologous to mammalian enoyl-coenzyme A (CoA) hydratases, EchA6 is non-catalytic yet essential and binds long-chain acyl-CoAs. THPP inhibitors compete with CoA-binding, suppress mycolic acid synthesis, and are bactericidal in a mouse model of chronic tuberculosis infection. A point mutation, W133A, abrogated THPP-binding and increased both the in vitro minimum inhibitory concentration and the in vivo effective dose 99 in mice. Surprisingly, EchA6 interacts with selected enzymes of fatty acid synthase II (FAS-II) in bacterial two-hybrid assays, suggesting essentiality may be linked to feeding long-chain fatty acids to FAS-II. Finally, our data show that spontaneous resistance-conferring mutations can potentially obscure the actual target or alternative targets of small molecule inhibitors. PMID:27571973

  13. Metabolomics reveals that carnitine palmitoyltransferase-1 is a novel target for oxidative inactivation in human cells.

    PubMed

    Setoyama, Daiki; Fujimura, Yoshinori; Miura, Daisuke

    2013-12-01

    Oxidative dysfunction in the metabolism has long been implicated in diverse biological disorders. Although a substantial number of metabolic enzymes are targeted for inactivation by oxidative stress, identifying those targets remains difficult due to a lack of comprehensive observations of the metabolism acting through the stress response. We herein developed a metabolomics strategy using integrative liquid chromatography-mass spectrometry (LC-MS) and observing rapid metabolomic changes in response to hydrogen peroxide (H2 O2 )-induced oxidative stress in HeLa cells. Among the many metabolite changes detected, the most characteristic metabolites uniquely indicated carnitine palmitoyltransferase-1 (CPT1), the critical enzyme for mitochondrial β-oxidation of long-chain fatty acids, to be a target for oxidative inactivation. We showed that the enzymatic activity of CPT1 significantly declined by H2 O2 in several human cells. Interestingly, the inactivation was shown to be a direct effect of H2 O2 in vitro, but substantially occurred when cells were cultured with some reagents that generate reactive oxygen species (ROS). Thus, our results suggest the generality of CPT1 inhibition under various stress conditions associated with ROS generation, providing an insight into a mechanism for oxidative dysfunction in mitochondrial metabolism. Our metabolome data additionally suggest that certain methyltransferase(s) may be targets of oxidative stress as well. PMID:24118240

  14. In Search of a Cure for Proteostasis-Addicted Cancer: A AAA Target Revealed.

    PubMed

    Xia, Di; Ye, Yihong

    2015-11-01

    Tumorigenesis is often associated with an unbalanced protein homeostasis (proteostasis) network, which sensitizes cancer cells to drugs targeting protein quality control (PQC) regulators. In this issue of Cancer Cell, Anderson and colleagues investigated the anti-cancer activity of a new class of inhibitor against a multi-functional ATPase essential for proteostasis maintenance. PMID:26555170

  15. Chemogenetic Characterization of Inositol Phosphate Metabolic Pathway Reveals Druggable Enzymes for Targeting Kinetoplastid Parasites.

    PubMed

    Cestari, Igor; Haas, Paige; Moretti, Nilmar Silvio; Schenkman, Sergio; Stuart, Ken

    2016-05-19

    Kinetoplastids cause Chagas disease, human African trypanosomiasis, and leishmaniases. Current treatments for these diseases are toxic and inefficient, and our limited knowledge of drug targets and inhibitors has dramatically hindered the development of new drugs. Here we used a chemogenetic approach to identify new kinetoplastid drug targets and inhibitors. We conditionally knocked down Trypanosoma brucei inositol phosphate (IP) pathway genes and showed that almost every pathway step is essential for parasite growth and infection. Using a genetic and chemical screen, we identified inhibitors that target IP pathway enzymes and are selective against T. brucei. Two series of these inhibitors acted on T. brucei inositol polyphosphate multikinase (IPMK) preventing Ins(1,4,5)P3 and Ins(1,3,4,5)P4 phosphorylation. We show that IPMK is functionally conserved among kinetoplastids and that its inhibition is also lethal for Trypanosoma cruzi. Hence, IP enzymes are viable drug targets in kinetoplastids, and IPMK inhibitors may aid the development of new drugs. PMID:27133314

  16. HIV-1 broadly neutralizing antibody precursor B cells revealed by germline-targeting immunogen.

    PubMed

    Jardine, Joseph G; Kulp, Daniel W; Havenar-Daughton, Colin; Sarkar, Anita; Briney, Bryan; Sok, Devin; Sesterhenn, Fabian; Ereño-Orbea, June; Kalyuzhniy, Oleksandr; Deresa, Isaiah; Hu, Xiaozhen; Spencer, Skye; Jones, Meaghan; Georgeson, Erik; Adachi, Yumiko; Kubitz, Michael; deCamp, Allan C; Julien, Jean-Philippe; Wilson, Ian A; Burton, Dennis R; Crotty, Shane; Schief, William R

    2016-03-25

    Induction of broadly neutralizing antibodies (bnAbs) is a major HIV vaccine goal. Germline-targeting immunogens aim to initiate bnAb induction by activating bnAb germline precursor B cells. Critical unmet challenges are to determine whether bnAb precursor naïve B cells bind germline-targeting immunogens and occur at sufficient frequency in humans for reliable vaccine responses. Using deep mutational scanning and multitarget optimization, we developed a germline-targeting immunogen (eOD-GT8) for diverse VRC01-class bnAbs. We then used the immunogen to isolate VRC01-class precursor naïve B cells from HIV-uninfected donors. Frequencies of true VRC01-class precursors, their structures, and their eOD-GT8 affinities support this immunogen as a candidate human vaccine prime. These methods could be applied to germline targeting for other classes of HIV bnAbs and for Abs to other pathogens. PMID:27013733

  17. Global analyses of endonucleolytic cleavage in mammals reveal expanded repertoires of cleavage-inducing small RNAs and their targets

    PubMed Central

    Cass, Ashley A.; Bahn, Jae Hoon; Lee, Jae-Hyung; Greer, Christopher; Lin, Xianzhi; Kim, Yong; Hsiao, Yun-Hua Esther; Xiao, Xinshu

    2016-01-01

    In mammals, small RNAs are important players in post-transcriptional gene regulation. While their roles in mRNA destabilization and translational repression are well appreciated, their involvement in endonucleolytic cleavage of target RNAs is poorly understood. Very few microRNAs are known to guide RNA cleavage. Endogenous small interfering RNAs are expected to induce target cleavage, but their target genes remain largely unknown. We report a systematic study of small RNA-mediated endonucleolytic cleavage in mouse through integrative analysis of small RNA and degradome sequencing data without imposing any bias toward known small RNAs. Hundreds of small cleavage-inducing RNAs and their cognate target genes were identified, significantly expanding the repertoire of known small RNA-guided cleavage events. Strikingly, both small RNAs and their target sites demonstrated significant overlap with retrotransposons, providing evidence for the long-standing speculation that retrotransposable elements in mRNAs are leveraged as signals for gene targeting. Furthermore, our analysis showed that the RNA cleavage pathway is also present in human cells but affecting a different repertoire of retrotransposons. These results show that small RNA-guided cleavage is more widespread than previously appreciated. Their impact on retrotransposons in non-coding regions shed light on important aspects of mammalian gene regulation. PMID:26975654

  18. A widespread distribution of genomic CeMyoD binding sites revealed and cross validated by ChIP-Chip and ChIP-Seq techniques.

    PubMed

    Lei, Haiyan; Fukushige, Tetsunari; Niu, Wei; Sarov, Mihail; Reinke, Valerie; Krause, Michael

    2010-01-01

    Identifying transcription factor binding sites genome-wide using chromatin immunoprecipitation (ChIP)-based technology is becoming an increasingly important tool in addressing developmental questions. However, technical problems associated with factor abundance and suitable ChIP reagents are common obstacles to these studies in many biological systems. We have used two completely different, widely applicable methods to determine by ChIP the genome-wide binding sites of the master myogenic regulatory transcription factor HLH-1 (CeMyoD) in C. elegans embryos. The two approaches, ChIP-seq and ChIP-chip, yield strongly overlapping results revealing that HLH-1 preferentially binds to promoter regions of genes enriched for E-box sequences (CANNTG), known binding sites for this well-studied class of transcription factors. HLH-1 binding sites were enriched upstream of genes known to be expressed in muscle, consistent with its role as a direct transcriptional regulator. HLH-1 binding was also detected at numerous sites unassociated with muscle gene expression, as has been previously described for its mouse homolog MyoD. These binding sites may reflect several additional functions for HLH-1, including its interactions with one or more co-factors to activate (or repress) gene expression or a role in chromatin organization distinct from direct transcriptional regulation of target genes. Our results also provide a comparison of ChIP methodologies that can overcome limitations commonly encountered in these types of studies while highlighting the complications of assigning in vivo functions to identified target sites. PMID:21209968

  19. A Widespread Distribution of Genomic CeMyoD Binding Sites Revealed and Cross Validated by ChIP-Chip and ChIP-Seq Techniques

    PubMed Central

    Lei, Haiyan; Fukushige, Tetsunari; Niu, Wei; Sarov, Mihail; Reinke, Valerie; Krause, Michael

    2010-01-01

    Identifying transcription factor binding sites genome-wide using chromatin immunoprecipitation (ChIP)-based technology is becoming an increasingly important tool in addressing developmental questions. However, technical problems associated with factor abundance and suitable ChIP reagents are common obstacles to these studies in many biological systems. We have used two completely different, widely applicable methods to determine by ChIP the genome-wide binding sites of the master myogenic regulatory transcription factor HLH-1 (CeMyoD) in C. elegans embryos. The two approaches, ChIP-seq and ChIP-chip, yield strongly overlapping results revealing that HLH-1 preferentially binds to promoter regions of genes enriched for E-box sequences (CANNTG), known binding sites for this well-studied class of transcription factors. HLH-1 binding sites were enriched upstream of genes known to be expressed in muscle, consistent with its role as a direct transcriptional regulator. HLH-1 binding was also detected at numerous sites unassociated with muscle gene expression, as has been previously described for its mouse homolog MyoD. These binding sites may reflect several additional functions for HLH-1, including its interactions with one or more co-factors to activate (or repress) gene expression or a role in chromatin organization distinct from direct transcriptional regulation of target genes. Our results also provide a comparison of ChIP methodologies that can overcome limitations commonly encountered in these types of studies while highlighting the complications of assigning in vivo functions to identified target sites. PMID:21209968

  20. The genetic regulatory network centered on Pto-Wuschela and its targets involved in wood formation revealed by association studies

    PubMed Central

    Yang, Xiaohui; Wei, Zunzheng; Du, Qingzhang; Chen, Jinhui; Wang, Qingshi; Quan, Mingyang; Song, Yuepeng; Xie, Jianbo; Zhang, Deqiang

    2015-01-01

    Transcription factors (TFs) regulate gene expression and can strongly affect phenotypes. However, few studies have examined TF variants and TF interactions with their targets in plants. Here, we used genetic association in 435 unrelated individuals of Populus tomentosa to explore the variants in Pto-Wuschela and its targets to decipher the genetic regulatory network of Pto-Wuschela. Our bioinformatics and co-expression analysis identified 53 genes with the motif TCACGTGA as putative targets of Pto-Wuschela. Single-marker association analysis showed that Pto-Wuschela was associated with wood properties, which is in agreement with the observation that it has higher expression in stem vascular tissues in Populus. Also, SNPs in the 53 targets were associated with growth or wood properties under additive or dominance effects, suggesting these genes and Pto-Wuschela may act in the same genetic pathways that affect variation in these quantitative traits. Epistasis analysis indicated that 75.5% of these genes directly or indirectly interacted Pto-Wuschela, revealing the coordinated genetic regulatory network formed by Pto-Wuschela and its targets. Thus, our study provides an alternative method for dissection of the interactions between a TF and its targets, which will strength our understanding of the regulatory roles of TFs in complex traits in plants. PMID:26549216

  1. Targeted delivery of photosensitizers: efficacy and selectivity issues revealed by multifunctional ORMOSIL nanovectors in cellular systems

    NASA Astrophysics Data System (ADS)

    Selvestrel, Francesco; Moret, Francesca; Segat, Daniela; Woodhams, Josephine H.; Fracasso, Giulio; Echevarria, Iria M. Rio; Baù, Luca; Rastrelli, Federico; Compagnin, Chiara; Reddi, Elena; Fedeli, Chiara; Papini, Emanuele; Tavano, Regina; MacKenzie, Alexandra; Bovis, Melissa; Yaghini, Elnaz; MacRobert, Alexander J.; Zanini, Silvia; Boscaini, Anita; Colombatti, Marco; Mancin, Fabrizio

    2013-06-01

    PEGylated and non-PEGylated ORMOSIL nanoparticles prepared by microemulsion condensation of vinyltriethoxy-silane (VTES) were investigated in detail for their micro-structure and ability to deliver photoactive agents. With respect to pure silica nanoparticles, organic modification substantially changes the microstructure and the surface properties. This in turn leads to a modulation of both the photophysical properties of embedded photosensitizers and the interaction of the nanoparticles with biological entities such as serum proteins. The flexibility of the synthetic procedure allows the rapid preparation and screening of multifunctional nanosystems for photodynamic therapy (PDT). Selective targeting of model cancer cells was tested by using folate, an integrin specific RGD peptide and anti-EGFR antibodies. Data suggest the interference of the stealth-conferring layer (PEG) with small targeting agents, but not with bulky antibodies. Moreover, we showed that selective photokilling of tumour cells may be limited even in the case of efficient targeting because of intrinsic transport limitations of active cellular uptake mechanisms or suboptimum localization.PEGylated and non-PEGylated ORMOSIL nanoparticles prepared by microemulsion condensation of vinyltriethoxy-silane (VTES) were investigated in detail for their micro-structure and ability to deliver photoactive agents. With respect to pure silica nanoparticles, organic modification substantially changes the microstructure and the surface properties. This in turn leads to a modulation of both the photophysical properties of embedded photosensitizers and the interaction of the nanoparticles with biological entities such as serum proteins. The flexibility of the synthetic procedure allows the rapid preparation and screening of multifunctional nanosystems for photodynamic therapy (PDT). Selective targeting of model cancer cells was tested by using folate, an integrin specific RGD peptide and anti-EGFR antibodies. Data

  2. Moving target indicating radar applications in an integrated site security suite

    SciTech Connect

    Appenzeller, R.C. )

    1991-01-01

    The integration of a small, lightweight, low power consumption radar into a site security sensor suite can provide several key advantages in the ability to detect vehicles and personnel over large ground areas. This paper presents rationale for the inclusion of a man-portable Moving Target Indicator (MTI) radar in several security scenarios and outlines the technical specifics of a candidate radar. The Department of Energy (DOE) is currently investigating the effectiveness of a combination of optical sensors in concert with a scanning narrow beam radar at the Nevada Test Site in Mercury, Nevada. Demonstration results from these previous test activities are included herein. Of particular interest is the complimentary nature of this sensor suite where the large field of view achievable with radar allows the optical sensors to be used as pinpoint target classification devices. The inclusion of a radar minimizes operator fatigue caused by watching cameras scanning in azimuth and elevation. Advances in the areas of nuisance alarm rejection and improved range detection against single personnel targets were made in 1990 and this capability is included in the current production version.

  3. Rational targeting of active-site tyrosine residues using sulfonyl fluoride probes.

    PubMed

    Hett, Erik C; Xu, Hua; Geoghegan, Kieran F; Gopalsamy, Ariamala; Kyne, Robert E; Menard, Carol A; Narayanan, Arjun; Parikh, Mihir D; Liu, Shenping; Roberts, Lee; Robinson, Ralph P; Tones, Michael A; Jones, Lyn H

    2015-04-17

    This work describes the first rational targeting of tyrosine residues in a protein binding site by small-molecule covalent probes. Specific tyrosine residues in the active site of the mRNA-decapping scavenger enzyme DcpS were modified using reactive sulfonyl fluoride covalent inhibitors. Structure-based molecular design was used to create an alkyne-tagged probe bearing the sulfonyl fluoride warhead, thus enabling the efficient capture of the protein from a complex proteome. Use of the probe in competition experiments with a diaminoquinazoline DcpS inhibitor permitted the quantification of intracellular target occupancy. As a result, diaminoquinazoline upregulators of survival motor neuron protein that are used for the treatment of spinal muscular atrophy were confirmed as inhibitors of DcpS in human primary cells. This work illustrates the utility of sulfonyl fluoride probes designed to react with specific tyrosine residues of a protein and augments the chemical biology toolkit by these probes uses in target validation and molecular pharmacology. PMID:25571984

  4. Network Analysis Reveals Sex- and Antibiotic Resistance-Associated Antivirulence Targets in Clinical Uropathogens

    PubMed Central

    2015-01-01

    Increasing antibiotic resistance among uropathogenic Escherichia coli (UPEC) is driving interest in therapeutic targeting of nonconserved virulence factor (VF) genes. The ability to formulate efficacious combinations of antivirulence agents requires an improved understanding of how UPEC deploy these genes. To identify clinically relevant VF combinations, we applied contemporary network analysis and biclustering algorithms to VF profiles from a large, previously characterized inpatient clinical cohort. These mathematical approaches identified four stereotypical VF combinations with distinctive relationships to antibiotic resistance and patient sex that are independent of traditional phylogenetic grouping. Targeting resistance- or sex-associated VFs based upon these contemporary mathematical approaches may facilitate individualized anti-infective therapies and identify synergistic VF combinations in bacterial pathogens. PMID:26985454

  5. Analysis on establishing Chang'E-3 landing site as a reflectance calibration target

    NASA Astrophysics Data System (ADS)

    Liu, Bin; Fu, Xiaohui; Zeng, Xingguo; Yao, Meijuan; Zhang, Hongbo; Su, Yan; Zhao, Shu; Xue, Xiping; Li, Chunlai; Zou, Yongliao

    2015-04-01

    Recent lunar orbital observations suggested that the surface reflectance calculated based on the Apollo 16 standard area and Apollo 16 sample laboratory measurement is significantly different from its true value [1-3], one reason is the composition and maturity differences between the 62231 sampling site and the Apollo 16 standard site existed, the other reason is the physical properties of the returned lunar sample, such as porosity, have been changed during the sampling operations. So more new standard targets on the Moon, besides the widely used Apollo 16 area, are needed for imaging spectrometers on lunar missions to improve their reflectance calibration accuracies. The Chang'E-3 VIS/NIR Imaging Spectrometer (VNIS), which is just fixed at the front of the Yutu rover [4], equipped with a white spectralon panel as reflectance calibration standard, can perform in situ multispectral observations around the Chang'E-3 landing site without altering the physical and mineralogical natures of lunar soils. Therefore, it provides an opportunity to establish a new reliable standard target for in-flight reflectance calibration. The reflectance calibration target should be compositional homogeneous, the topography of which must be flat, and the reflectance should be identical with no nearby units of other different materials. As we have known, Chang'e-3 probe landed on the Mare Imbrium basin in the east part of Sinus Iridum, the landing site is relatively flat at a spatial coverage of ~660km2, and this region belongs to Eratosthenian low-Ti/high-Ti mare basalts [5-6]. According to much higher resolution topography data, elemental data and reflectance data of Chang'E-2 and Chang'E-3[7-8], we preliminary analyse the possibility on establishing Chang'E-3 landing site as a reflectance calibration target. Firstly, the overall terrain of the 4 km×4 km area around the landing site is flat, but there are still three bigger craters existed. Secondly, the composition on Chang'E-3

  6. De-Novo Identification of PPARγ/RXR Binding Sites and Direct Targets during Adipogenesis

    PubMed Central

    Vega, Vinsensius B.; Thomsen, Jane S.; Kandhadayar, Gopalan Srinivasan; Ng, Patrick Wei Pern; Chiu, Kuo Ping; Pettersson, Sven; Wei, Chia Lin; Ruan, Yijun; Liu, Edison T.

    2009-01-01

    Background The pathophysiology of obesity and type 2 diabetes mellitus is associated with abnormalities in endocrine signaling in adipose tissue and one of the key signaling affectors operative in these disorders is the nuclear hormone transcription factor peroxisome proliferator-activated receptor-γ (PPARγ). PPARγ has pleiotropic functions affecting a wide range of fundamental biological processes including the regulation of genes that modulate insulin sensitivity, adipocyte differentiation, inflammation and atherosclerosis. To date, only a limited number of direct targets for PPARγ have been identified through research using the well established pre-adipogenic cell line, 3T3-L1. In order to obtain a genome-wide view of PPARγ binding sites, we applied the pair end-tagging technology (ChIP-PET) to map PPARγ binding sites in 3T3-L1 preadipocyte cells. Methodology/Principal Findings Coupling gene expression profile analysis with ChIP-PET, we identified in a genome-wide manner over 7700 DNA binding sites of the transcription factor PPARγ and its heterodimeric partner RXR during the course of adipocyte differentiation. Our validation studies prove that the identified sites are bona fide binding sites for both PPARγ and RXR and that they are functionally capable of driving PPARγ specific transcription. Our results strongly indicate that PPARγ is the predominant heterodimerization partner for RXR during late stages of adipocyte differentiation. Additionally, we find that PPARγ/RXR association is enriched within the proximity of the 5′ region of the transcription start site and this association is significantly associated with transcriptional up-regulation of genes involved in fatty acid and lipid metabolism confirming the role of PPARγ as the master transcriptional regulator of adipogenesis. Evolutionary conservation analysis of these binding sites is greater when adjacent to up-regulated genes than down-regulated genes, suggesting the primordial function

  7. Antigen targeting reveals splenic CD169+ macrophages as promoters of germinal center B-cell responses.

    PubMed

    Veninga, Henrike; Borg, Ellen G F; Vreeman, Kyle; Taylor, Philip R; Kalay, Hakan; van Kooyk, Yvette; Kraal, Georg; Martinez-Pomares, Luisa; den Haan, Joke M M

    2015-03-01

    Ag delivery to specific APCs is an attractive approach in developing strategies for vaccination. CD169(+) macrophages in the marginal zone of the spleen represent a suitable target for delivery of Ag because of their strategic location, which is optimal for the capture of blood-borne Ag and their close proximity to B cells and T cells in the white pulp. Here we show that Ag targeting to CD169(+) macrophages in mice resulted in strong, isotype-switched, high-affinity Ab production and the preferential induction and long-term persistence of Ag-specific GC B cells and follicular Th cells. In agreement with these observations, CD169(+) macrophages retained intact Ag, induced cognate activation of B cells, and increased expression of costimulatory molecules upon activation. In addition, macrophages were required for the production of cytokines that promote B-cell responses. Our results identify CD169(+) macrophages as promoters of high-affinity humoral immune responses and emphasize the value of CD169 as target for Ag delivery to improve vaccine responses. PMID:25487358

  8. A Cell-Based Screen Reveals that the Albendazole Metabolite, Albendazole Sulfone, Targets Wolbachia

    PubMed Central

    Bray, Walter M.; White, Pamela M.; Ruybal, Jordan; Lokey, R. Scott; Debec, Alain; Sullivan, William

    2012-01-01

    Wolbachia endosymbionts carried by filarial nematodes give rise to the neglected diseases African river blindness and lymphatic filariasis afflicting millions worldwide. Here we identify new Wolbachia-disrupting compounds by conducting high-throughput cell-based chemical screens using a Wolbachia-infected, fluorescently labeled Drosophila cell line. This screen yielded several Wolbachia-disrupting compounds including three that resembled Albendazole, a widely used anthelmintic drug that targets nematode microtubules. Follow-up studies demonstrate that a common Albendazole metabolite, Albendazole sulfone, reduces intracellular Wolbachia titer both in Drosophila melanogaster and Brugia malayi, the nematode responsible for lymphatic filariasis. Significantly, Albendazole sulfone does not disrupt Drosophila microtubule organization, suggesting that this compound reduces titer through direct targeting of Wolbachia. Accordingly, both DNA staining and FtsZ immunofluorescence demonstrates that Albendazole sulfone treatment induces Wolbachia elongation, a phenotype indicative of binary fission defects. This suggests that the efficacy of Albendazole in treating filarial nematode-based diseases is attributable to dual targeting of nematode microtubules and their Wolbachia endosymbionts. PMID:23028321

  9. Antigen targeting reveals splenic CD169+ macrophages as promoters of germinal center B‐cell responses

    PubMed Central

    Veninga, Henrike; Borg, Ellen G. F.; Vreeman, Kyle; Taylor, Philip R.; Kalay, Hakan; van Kooyk, Yvette; Kraal, Georg; Martinez‐Pomares, Luisa

    2015-01-01

    Ag delivery to specific APCs is an attractive approach in developing strategies for vaccination. CD169+ macrophages in the marginal zone of the spleen represent a suitable target for delivery of Ag because of their strategic location, which is optimal for the capture of blood‐borne Ag and their close proximity to B cells and T cells in the white pulp. Here we show that Ag targeting to CD169+ macrophages in mice resulted in strong, isotype‐switched, high‐affinity Ab production and the preferential induction and long‐term persistence of Ag‐specific GC B cells and follicular Th cells. In agreement with these observations, CD169+ macrophages retained intact Ag, induced cognate activation of B cells, and increased expression of costimulatory molecules upon activation. In addition, macrophages were required for the production of cytokines that promote B‐cell responses. Our results identify CD169+ macrophages as promoters of high‐affinity humoral immune responses and emphasize the value of CD169 as target for Ag delivery to improve vaccine responses. PMID:25487358

  10. Orthogonal Click Conjugation to the Liposomal Surface Reveals the Stability of the Lipid Anchorage as Crucial for Targeting.

    PubMed

    Fritz, Thomas; Voigt, Matthias; Worm, Matthias; Negwer, Inka; Müller, Sophie S; Kettenbach, Kathrin; Ross, Tobias L; Roesch, Frank; Koynov, Kaloian; Frey, Holger; Helm, Mark

    2016-08-01

    Synthetic access to multiple surface decorations are a bottleneck in the development of liposomes for receptor mediated targeting. This opens a complex multiparameter space, exploration of which is severely limited in terms of sample numbers and turnaround times. Here, we unlock this technological barrier by a combination of a milligram-scale liposome formulation using dual centrifugation and orthogonal click chemistry on the liposomal surface. Application of these techniques to conceptually new amphiphilic compounds, which feature norbornene and alkyne groups at the apex of sterically stabilizing, hyperbranched polyglycerol moieties, revealed a particular influence of the membrane anchor of functional amphiphiles. Folic acid residues clicked to cholesterol-based amphiphiles were inefficient in folate-mediated cell targeting, while dialkyl-anchored amphiphiles remained stable in the liposomal membrane and imparted efficient targeting properties. These findings are of specific importance considering the popularity of cholesterol as a lipophilic anchor. PMID:27403892

  11. GHB receptor targets in the CNS: focus on high-affinity binding sites.

    PubMed

    Bay, Tina; Eghorn, Laura F; Klein, Anders B; Wellendorph, Petrine

    2014-01-15

    γ-Hydroxybutyric acid (GHB) is an endogenous compound in the mammalian brain with both low- and high-affinity receptor targets. GHB is used clinically in the treatment of symptoms of narcolepsy and alcoholism, but also illicitly abused as the recreational drug Fantasy. Major pharmacological effects of exogenous GHB are mediated by GABA subtype B (GABAB) receptors that bind GHB with low affinity. The existence of GHB high-affinity binding sites has been known for more than three decades, but the uncovering of their molecular identity has only recently begun. This has been prompted by the generation of molecular tools to selectively study high-affinity sites. These include both genetically modified GABAB knock-out mice and engineered selective GHB ligands. Recently, certain GABA subtype A (GABAA) receptor subtypes emerged as high-affinity GHB binding sites and potential physiological mediators of GHB effects. In this research update, a description of the various reported receptors for GHB is provided, including GABAB receptors, certain GABAA receptor subtypes and other reported GHB receptors. The main focus will thus be on the high-affinity binding targets for GHB and their potential functional roles in the mammalian brain. PMID:24269284

  12. MicroRNA-135b has a neuroprotective role via targeting of β-site APP-cleaving enzyme 1

    PubMed Central

    Zhang, Yi; Xing, Hongxia; Guo, Shuangxi; Zheng, Zhiyong; Wang, Haoliang; Xu, Dawei

    2016-01-01

    MicroRNAs (miRs) are a class of endogenous small non-coding RNAs that have been revealed to negatively mediate the expression of their target genes at the post-transcriptional level. Recently, particular miRs have demonstrated an involvement in the pathogenesis of Alzheimer's disease (AD). However, the specific role of miR-135b in AD has yet to be elucidated. The present study aimed to investigate the neuroprotective role of miR-135b, in addition to its underlying mechanism. Herein, reverse transcription-quantitative polymerase chain reaction was conducted to determine miR-135b expression levels in the peripheral blood samples of patients with AD and age-matched normal controls. The data of the present study revealed that the expression levels of miR-135b were significantly reduced in the peripheral blood of AD patients compared with normal controls (P<0.01). In vitro MTT analyses identified that the overexpression of miR-135b significantly enhanced the proliferation of hippocampal cells (P<0.01). Furthermore, in vivo analysis using a Y-maze test indicated that injection with miR-135b mimics into the third ventricle of anesthetized SAMP8 mice significantly enhanced their learning and memory capacities (P<0.01). Molecular mechanism investigations identified β-site APP-cleaving enzyme 1 (BACE1) as a direct target gene of miR-135b, and the latter was identified to negatively mediate the protein expression levels of BACE1 in hippocampal cells, in addition to hippocampal tissues, of SAMP8 mice. Based on the aforementioned findings, we propose that miR-135b has a neuroprotective role via direct targeting of BACE1 and, thus, may be used for the treatment of AD. PMID:27446280

  13. The Groucho Co-repressor Is Primarily Recruited to Local Target Sites in Active Chromatin to Attenuate Transcription

    PubMed Central

    Jennings, Barbara H.

    2014-01-01

    Gene expression is regulated by the complex interaction between transcriptional activators and repressors, which function in part by recruiting histone-modifying enzymes to control accessibility of DNA to RNA polymerase. The evolutionarily conserved family of Groucho/Transducin-Like Enhancer of split (Gro/TLE) proteins act as co-repressors for numerous transcription factors. Gro/TLE proteins act in several key pathways during development (including Notch and Wnt signaling), and are implicated in the pathogenesis of several human cancers. Gro/TLE proteins form oligomers and it has been proposed that their ability to exert long-range repression on target genes involves oligomerization over broad regions of chromatin. However, analysis of an endogenous gro mutation in Drosophila revealed that oligomerization of Gro is not always obligatory for repression in vivo. We have used chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) to profile Gro recruitment in two Drosophila cell lines. We find that Gro predominantly binds at discrete peaks (<1 kilobase). We also demonstrate that blocking Gro oligomerization does not reduce peak width as would be expected if Gro oligomerization induced spreading along the chromatin from the site of recruitment. Gro recruitment is enriched in “active” chromatin containing developmentally regulated genes. However, Gro binding is associated with local regions containing hypoacetylated histones H3 and H4, which is indicative of chromatin that is not fully open for efficient transcription. We also find that peaks of Gro binding frequently overlap the transcription start sites of expressed genes that exhibit strong RNA polymerase pausing and that depletion of Gro leads to release of polymerase pausing and increased transcription at a bona fide target gene. Our results demonstrate that Gro is recruited to local sites by transcription factors to attenuate rather than silence gene expression by promoting histone deacetylation

  14. Rad54B targeting to DNA double-strand break repair sites requires complex formation with S100A11.

    PubMed

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand; Melle, Christian

    2008-07-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21(WAF1/CIP1) was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  15. Rad54B Targeting to DNA Double-Strand Break Repair Sites Requires Complex Formation with S100A11

    PubMed Central

    Murzik, Ulrike; Hemmerich, Peter; Weidtkamp-Peters, Stefanie; Ulbricht, Tobias; Bussen, Wendy; Hentschel, Julia; von Eggeling, Ferdinand

    2008-01-01

    S100A11 is involved in a variety of intracellular activities such as growth regulation and differentiation. To gain more insight into the physiological role of endogenously expressed S100A11, we used a proteomic approach to detect and identify interacting proteins in vivo. Hereby, we were able to detect a specific interaction between S100A11 and Rad54B, which could be confirmed under in vivo conditions. Rad54B, a DNA-dependent ATPase, is described to be involved in recombinational repair of DNA damage, including DNA double-strand breaks (DSBs). Treatment with bleomycin, which induces DSBs, revealed an increase in the degree of colocalization between S100A11 and Rad54B. Furthermore, S100A11/Rad54B foci are spatially associated with sites of DNA DSB repair. Furthermore, while the expression of p21WAF1/CIP1 was increased in parallel with DNA damage, its protein level was drastically down-regulated in damaged cells after S100A11 knockdown. Down-regulation of S100A11 by RNA interference also abolished Rad54B targeting to DSBs. Additionally, S100A11 down-regulated HaCaT cells showed a restricted proliferation capacity and an increase of the apoptotic cell fraction. These observations suggest that S100A11 targets Rad54B to sites of DNA DSB repair sites and identify a novel function for S100A11 in p21-based regulation of cell cycle. PMID:18463164

  16. Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

    PubMed Central

    Pierce, M L; Ruffner, D E

    1998-01-01

    Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

  17. Chemical genetic discovery of PARP targets reveals a role for PARP-1 in transcription elongation.

    PubMed

    Gibson, Bryan A; Zhang, Yajie; Jiang, Hong; Hussey, Kristine M; Shrimp, Jonathan H; Lin, Hening; Schwede, Frank; Yu, Yonghao; Kraus, W Lee

    2016-07-01

    Poly[adenosine diphosphate (ADP)-ribose] polymerases (PARPs) are a family of enzymes that modulate diverse biological processes through covalent transfer of ADP-ribose from the oxidized form of nicotinamide adenine dinucleotide (NAD(+)) onto substrate proteins. Here we report a robust NAD(+) analog-sensitive approach for PARPs, which allows PARP-specific ADP-ribosylation of substrates that is suitable for subsequent copper-catalyzed azide-alkyne cycloaddition reactions. Using this approach, we mapped hundreds of sites of ADP-ribosylation for PARPs 1, 2, and 3 across the proteome, as well as thousands of PARP-1-mediated ADP-ribosylation sites across the genome. We found that PARP-1 ADP-ribosylates and inhibits negative elongation factor (NELF), a protein complex that regulates promoter-proximal pausing by RNA polymerase II (Pol II). Depletion or inhibition of PARP-1 or mutation of the ADP-ribosylation sites on NELF-E promotes Pol II pausing, providing a clear functional link between PARP-1, ADP-ribosylation, and NELF. This analog-sensitive approach should be broadly applicable across the PARP family and has the potential to illuminate the ADP-ribosylated proteome and the molecular mechanisms used by individual PARPs to mediate their responses to cellular signals. PMID:27256882

  18. Mechanism of intermediate filament recognition by plakin repeat domains revealed by envoplakin targeting of vimentin

    NASA Astrophysics Data System (ADS)

    Fogl, Claudia; Mohammed, Fiyaz; Al-Jassar, Caezar; Jeeves, Mark; Knowles, Timothy J.; Rodriguez-Zamora, Penelope; White, Scott A.; Odintsova, Elena; Overduin, Michael; Chidgey, Martyn

    2016-03-01

    Plakin proteins form critical connections between cell junctions and the cytoskeleton; their disruption within epithelial and cardiac muscle cells cause skin-blistering diseases and cardiomyopathies. Envoplakin has a single plakin repeat domain (PRD) which recognizes intermediate filaments through an unresolved mechanism. Herein we report the crystal structure of envoplakin's complete PRD fold, revealing binding determinants within its electropositive binding groove. Four of its five internal repeats recognize negatively charged patches within vimentin via five basic determinants that are identified by nuclear magnetic resonance spectroscopy. Mutations of the Lys1901 or Arg1914 binding determinants delocalize heterodimeric envoplakin from intracellular vimentin and keratin filaments in cultured cells. Recognition of vimentin is abolished when its residues Asp112 or Asp119 are mutated. The latter slot intermediate filament rods into basic PRD domain grooves through electrosteric complementarity in a widely applicable mechanism. Together this reveals how plakin family members form dynamic linkages with cytoskeletal frameworks.

  19. Mechanism of intermediate filament recognition by plakin repeat domains revealed by envoplakin targeting of vimentin

    PubMed Central

    Fogl, Claudia; Mohammed, Fiyaz; Al-Jassar, Caezar; Jeeves, Mark; Knowles, Timothy J.; Rodriguez-Zamora, Penelope; White, Scott A.; Odintsova, Elena; Overduin, Michael; Chidgey, Martyn

    2016-01-01

    Plakin proteins form critical connections between cell junctions and the cytoskeleton; their disruption within epithelial and cardiac muscle cells cause skin-blistering diseases and cardiomyopathies. Envoplakin has a single plakin repeat domain (PRD) which recognizes intermediate filaments through an unresolved mechanism. Herein we report the crystal structure of envoplakin's complete PRD fold, revealing binding determinants within its electropositive binding groove. Four of its five internal repeats recognize negatively charged patches within vimentin via five basic determinants that are identified by nuclear magnetic resonance spectroscopy. Mutations of the Lys1901 or Arg1914 binding determinants delocalize heterodimeric envoplakin from intracellular vimentin and keratin filaments in cultured cells. Recognition of vimentin is abolished when its residues Asp112 or Asp119 are mutated. The latter slot intermediate filament rods into basic PRD domain grooves through electrosteric complementarity in a widely applicable mechanism. Together this reveals how plakin family members form dynamic linkages with cytoskeletal frameworks. PMID:26935805

  20. Conformational toggling controls target site choice for the heteromeric transposase element Tn7.

    PubMed

    Shi, Qiaojuan; Straus, Marco R; Caron, Jeremy J; Wang, Huasheng; Chung, Yu Seon; Guarné, Alba; Peters, Joseph E

    2015-12-15

    The bacterial transposon Tn7 facilitates horizontal transfer by directing transposition into actively replicating DNA with the element-encoded protein TnsE. Structural analysis of the C-terminal domain of wild-type TnsE identified a novel protein fold including a central V-shaped loop that toggles between two distinct conformations. The structure of a robust TnsE gain-of-activity variant has this loop locked in a single conformation, suggesting that conformational flexibility regulates TnsE activity. Structure-based analysis of a series of TnsE mutants relates transposition activity to DNA binding stability. Wild-type TnsE appears to naturally form an unstable complex with a target DNA, whereas mutant combinations required for large changes in transposition frequency and targeting stabilized this interaction. Collectively, our work unveils a unique structural proofreading mechanism where toggling between two conformations regulates target commitment by limiting the stability of target DNA engagement until an appropriate insertion site is identified. PMID:26384427

  1. Novel Antibacterial Targets and Compounds Revealed by a High-Throughput Cell Wall Reporter Assay

    PubMed Central

    Nayar, Asha S.; Dougherty, Thomas J.; Ferguson, Keith E.; Granger, Brett A.; McWilliams, Lisa; Stacey, Clare; Leach, Lindsey J.; Narita, Shin-ichiro; Tokuda, Hajime; Miller, Alita A.; Brown, Dean G.

    2015-01-01

    ABSTRACT A high-throughput phenotypic screen based on a Citrobacter freundii AmpC reporter expressed in Escherichia coli was executed to discover novel inhibitors of bacterial cell wall synthesis, an attractive, well-validated target for antibiotic intervention. Here we describe the discovery and characterization of sulfonyl piperazine and pyrazole compounds, each with novel mechanisms of action. E. coli mutants resistant to these compounds display no cross-resistance to antibiotics of other classes. Resistance to the sulfonyl piperazine maps to LpxH, which catalyzes the fourth step in the synthesis of lipid A, the outer membrane anchor of lipopolysaccharide (LPS). To our knowledge, this compound is the first reported inhibitor of LpxH. Resistance to the pyrazole compound mapped to mutations in either LolC or LolE, components of the essential LolCDE transporter complex, which is required for trafficking of lipoproteins to the outer membrane. Biochemical experiments with E. coli spheroplasts showed that the pyrazole compound is capable of inhibiting the release of lipoproteins from the inner membrane. Both of these compounds have significant promise as chemical probes to further interrogate the potential of these novel cell wall components for antimicrobial therapy. IMPORTANCE The prevalence of antibacterial resistance, particularly among Gram-negative organisms, signals a need for novel antibacterial agents. A phenotypic screen using AmpC as a sensor for compounds that inhibit processes involved in Gram-negative envelope biogenesis led to the identification of two novel inhibitors with unique mechanisms of action targeting Escherichia coli outer membrane biogenesis. One compound inhibits the transport system for lipoprotein transport to the outer membrane, while the other compound inhibits synthesis of lipopolysaccharide. These results indicate that it is still possible to uncover new compounds with intrinsic antibacterial activity that inhibit novel targets

  2. Nanoparticles Effectively Target Rapamycin Delivery to Sites of Experimental Aortic Aneurysm in Rats

    PubMed Central

    Shirasu, Takuro; Koyama, Hiroyuki; Miura, Yutaka; Hoshina, Katsuyuki; Kataoka, Kazunori; Watanabe, Toshiaki

    2016-01-01

    Several drugs targeting the pathogenesis of aortic aneurysm have shown efficacy in model systems but not in clinical trials, potentially owing to the lack of targeted drug delivery. Here, we designed a novel drug delivery system using nanoparticles to target the disrupted aortic aneurysm micro-structure. We generated poly(ethylene glycol)-shelled nanoparticles incorporating rapamycin that exhibited uniform diameter and long-term stability. When injected intravenously into a rat model in which abdominal aortic aneurysm (AAA) had been induced by infusing elastase, labeled rapamycin nanoparticles specifically accumulated in the AAA. Microscopic analysis revealed that rapamycin nanoparticles were mainly distributed in the media and adventitia where the wall structures were damaged. Co-localization of rapamycin nanoparticles with macrophages was also noted. Rapamycin nanoparticles injected during the process of AAA formation evinced significant suppression of AAA formation and mural inflammation at 7 days after elastase infusion, as compared with rapamycin treatment alone. Correspondingly, the activities of matrix metalloproteinases and the expression of inflammatory cytokines were significantly suppressed by rapamycin nanoparticle treatment. Our findings suggest that the nanoparticle-based delivery system achieves specific delivery of rapamycin to the rat AAA and might contribute to establishing a drug therapy approach targeting aortic aneurysm. PMID:27336852

  3. Nanoparticles Effectively Target Rapamycin Delivery to Sites of Experimental Aortic Aneurysm in Rats.

    PubMed

    Shirasu, Takuro; Koyama, Hiroyuki; Miura, Yutaka; Hoshina, Katsuyuki; Kataoka, Kazunori; Watanabe, Toshiaki

    2016-01-01

    Several drugs targeting the pathogenesis of aortic aneurysm have shown efficacy in model systems but not in clinical trials, potentially owing to the lack of targeted drug delivery. Here, we designed a novel drug delivery system using nanoparticles to target the disrupted aortic aneurysm micro-structure. We generated poly(ethylene glycol)-shelled nanoparticles incorporating rapamycin that exhibited uniform diameter and long-term stability. When injected intravenously into a rat model in which abdominal aortic aneurysm (AAA) had been induced by infusing elastase, labeled rapamycin nanoparticles specifically accumulated in the AAA. Microscopic analysis revealed that rapamycin nanoparticles were mainly distributed in the media and adventitia where the wall structures were damaged. Co-localization of rapamycin nanoparticles with macrophages was also noted. Rapamycin nanoparticles injected during the process of AAA formation evinced significant suppression of AAA formation and mural inflammation at 7 days after elastase infusion, as compared with rapamycin treatment alone. Correspondingly, the activities of matrix metalloproteinases and the expression of inflammatory cytokines were significantly suppressed by rapamycin nanoparticle treatment. Our findings suggest that the nanoparticle-based delivery system achieves specific delivery of rapamycin to the rat AAA and might contribute to establishing a drug therapy approach targeting aortic aneurysm. PMID:27336852

  4. Magnetic Resonance Imaging Revealed Splenic Targeting of Canine Parvovirus Capsid Protein VP2

    NASA Astrophysics Data System (ADS)

    Ma, Yufei; Wang, Haiming; Yan, Dan; Wei, Yanquan; Cao, Yuhua; Yi, Peiwei; Zhang, Hailu; Deng, Zongwu; Dai, Jianwu; Liu, Xiangtao; Luo, Jianxun; Zhang, Zhijun; Sun, Shiqi; Guo, Huichen

    2016-03-01

    Canine parvovirus (CPV) is a highly contagious infectious virus, whose infectious mechanism remains unclear because of acute gastroenteritis and the lack of an efficient tool to visualize the virus in real time during virology research. In this study, we developed an iron oxide nanoparticle supported by graphene quantum dots (GQD), namely, FeGQD. In this composite material, GQD acts as a stabilizer; thus, vacancies are retained on the surface for further physical adsorption of the CPV VP2 protein. The FeGQD@VP2 nanocomposite product showed largely enhanced colloidal stability in comparison with bare FeGQD, as well as negligible toxicity both in vitro and in vivo. The composite displayed high uptake into transferrin receptor (TfR) positive cells, which are distinguishable from FeGQD or TfR negative cells. In addition, the composite developed a significant accumulation in spleen rather than in liver, where bare FeGQD or most iron oxide nanoparticles gather. As these evident targeting abilities of FeGQD@VP2 strongly suggested, the biological activity of CPV VP2 was retained in our study, and its biological functions might correspond to CPV when the rare splenic targeting ability is considered. This approach can be applied to numerous other biomedical studies that require a simple yet efficient approach to track proteins in vivo while retaining biological function and may facilitate virus-related research.

  5. Magnetic Resonance Imaging Revealed Splenic Targeting of Canine Parvovirus Capsid Protein VP2

    PubMed Central

    Ma, Yufei; Wang, Haiming; Yan, Dan; Wei, Yanquan; Cao, Yuhua; Yi, Peiwei; Zhang, Hailu; Deng, Zongwu; Dai, Jianwu; Liu, Xiangtao; Luo, Jianxun; Zhang, Zhijun; Sun, Shiqi; Guo, Huichen

    2016-01-01

    Canine parvovirus (CPV) is a highly contagious infectious virus, whose infectious mechanism remains unclear because of acute gastroenteritis and the lack of an efficient tool to visualize the virus in real time during virology research. In this study, we developed an iron oxide nanoparticle supported by graphene quantum dots (GQD), namely, FeGQD. In this composite material, GQD acts as a stabilizer; thus, vacancies are retained on the surface for further physical adsorption of the CPV VP2 protein. The FeGQD@VP2 nanocomposite product showed largely enhanced colloidal stability in comparison with bare FeGQD, as well as negligible toxicity both in vitro and in vivo. The composite displayed high uptake into transferrin receptor (TfR) positive cells, which are distinguishable from FeGQD or TfR negative cells. In addition, the composite developed a significant accumulation in spleen rather than in liver, where bare FeGQD or most iron oxide nanoparticles gather. As these evident targeting abilities of FeGQD@VP2 strongly suggested, the biological activity of CPV VP2 was retained in our study, and its biological functions might correspond to CPV when the rare splenic targeting ability is considered. This approach can be applied to numerous other biomedical studies that require a simple yet efficient approach to track proteins in vivo while retaining biological function and may facilitate virus-related research. PMID:26996514

  6. Magnetic Resonance Imaging Revealed Splenic Targeting of Canine Parvovirus Capsid Protein VP2.

    PubMed

    Ma, Yufei; Wang, Haiming; Yan, Dan; Wei, Yanquan; Cao, Yuhua; Yi, Peiwei; Zhang, Hailu; Deng, Zongwu; Dai, Jianwu; Liu, Xiangtao; Luo, Jianxun; Zhang, Zhijun; Sun, Shiqi; Guo, Huichen

    2016-01-01

    Canine parvovirus (CPV) is a highly contagious infectious virus, whose infectious mechanism remains unclear because of acute gastroenteritis and the lack of an efficient tool to visualize the virus in real time during virology research. In this study, we developed an iron oxide nanoparticle supported by graphene quantum dots (GQD), namely, FeGQD. In this composite material, GQD acts as a stabilizer; thus, vacancies are retained on the surface for further physical adsorption of the CPV VP2 protein. The FeGQD@VP2 nanocomposite product showed largely enhanced colloidal stability in comparison with bare FeGQD, as well as negligible toxicity both in vitro and in vivo. The composite displayed high uptake into transferrin receptor (TfR) positive cells, which are distinguishable from FeGQD or TfR negative cells. In addition, the composite developed a significant accumulation in spleen rather than in liver, where bare FeGQD or most iron oxide nanoparticles gather. As these evident targeting abilities of FeGQD@VP2 strongly suggested, the biological activity of CPV VP2 was retained in our study, and its biological functions might correspond to CPV when the rare splenic targeting ability is considered. This approach can be applied to numerous other biomedical studies that require a simple yet efficient approach to track proteins in vivo while retaining biological function and may facilitate virus-related research. PMID:26996514

  7. Targeting hunter distribution based on host resource selection and kill sites to manage disease risk

    PubMed Central

    Dugal, Cherie J; van Beest, Floris M; Vander Wal, Eric; Brook, Ryan K

    2013-01-01

    Endemic and emerging diseases are rarely uniform in their spatial distribution or prevalence among cohorts of wildlife. Spatial models that quantify risk-driven differences in resource selection and hunter mortality of animals at fine spatial scales can assist disease management by identifying high-risk areas and individuals. We used resource selection functions (RSFs) and selection ratios (SRs) to quantify sex- and age-specific resource selection patterns of collared (n = 67) and hunter-killed (n = 796) nonmigratory elk (Cervus canadensis manitobensis) during the hunting season between 2002 and 2012, in southwestern Manitoba, Canada. Distance to protected area was the most important covariate influencing resource selection and hunter-kill sites of elk (AICw = 1.00). Collared adult males (which are most likely to be infected with bovine tuberculosis (Mycobacterium bovis) and chronic wasting disease) rarely selected for sites outside of parks during the hunting season in contrast to adult females and juvenile males. The RSFs showed selection by adult females and juvenile males to be negatively associated with landscape-level forest cover, high road density, and water cover, whereas hunter-kill sites of these cohorts were positively associated with landscape-level forest cover and increasing distance to streams and negatively associated with high road density. Local-level forest was positively associated with collared animal locations and hunter-kill sites; however, selection was stronger for collared juvenile males and hunter-killed adult females. In instances where disease infects a metapopulation and eradication is infeasible, a principle goal of management is to limit the spread of disease among infected animals. We map high-risk areas that are regularly used by potentially infectious hosts but currently underrepresented in the distribution of kill sites. We present a novel application of widely available data to target hunter distribution based on host resource

  8. Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites

    PubMed Central

    Ji, Wei-ke; Hatch, Anna L; Merrill, Ronald A; Strack, Stefan; Higgs, Henry N

    2015-01-01

    While the dynamin GTPase Drp1 plays a critical role during mitochondrial fission, mechanisms controlling its recruitment to fission sites are unclear. A current assumption is that cytosolic Drp1 is recruited directly to fission sites immediately prior to fission. Using live-cell microscopy, we find evidence for a different model, progressive maturation of Drp1 oligomers on mitochondria through incorporation of smaller mitochondrially-bound Drp1 units. Maturation of a stable Drp1 oligomer does not forcibly lead to fission. Drp1 oligomers also translocate directionally along mitochondria. Ionomycin, a calcium ionophore, causes rapid mitochondrial accumulation of actin filaments followed by Drp1 accumulation at the fission site, and increases fission rate. Inhibiting actin polymerization, myosin IIA, or the formin INF2 reduces both un-stimulated and ionomycin-induced Drp1 accumulation and mitochondrial fission. Actin filaments bind purified Drp1 and increase GTPase activity in a manner that is synergistic with the mitochondrial protein Mff, suggesting a role for direct Drp1/actin interaction. We propose that Drp1 is in dynamic equilibrium on mitochondria in a fission-independent manner, and that fission factors such as actin filaments target productive oligomerization to fission sites. DOI: http://dx.doi.org/10.7554/eLife.11553.001 PMID:26609810

  9. Actin filaments target the oligomeric maturation of the dynamin GTPase Drp1 to mitochondrial fission sites.

    PubMed

    Ji, Wei-ke; Hatch, Anna L; Merrill, Ronald A; Strack, Stefan; Higgs, Henry N

    2015-01-01

    While the dynamin GTPase Drp1 plays a critical role during mitochondrial fission, mechanisms controlling its recruitment to fission sites are unclear. A current assumption is that cytosolic Drp1 is recruited directly to fission sites immediately prior to fission. Using live-cell microscopy, we find evidence for a different model, progressive maturation of Drp1 oligomers on mitochondria through incorporation of smaller mitochondrially-bound Drp1 units. Maturation of a stable Drp1 oligomer does not forcibly lead to fission. Drp1 oligomers also translocate directionally along mitochondria. Ionomycin, a calcium ionophore, causes rapid mitochondrial accumulation of actin filaments followed by Drp1 accumulation at the fission site, and increases fission rate. Inhibiting actin polymerization, myosin IIA, or the formin INF2 reduces both un-stimulated and ionomycin-induced Drp1 accumulation and mitochondrial fission. Actin filaments bind purified Drp1 and increase GTPase activity in a manner that is synergistic with the mitochondrial protein Mff, suggesting a role for direct Drp1/actin interaction. We propose that Drp1 is in dynamic equilibrium on mitochondria in a fission-independent manner, and that fission factors such as actin filaments target productive oligomerization to fission sites. PMID:26609810

  10. A new class of mutations reveals a novel function for the original phosphatidylinositol 3-kinase binding site

    PubMed Central

    Hong, Y. Kate; Mikami, Aki; Schaffhausen, Brian; Jun, Toni; Roberts, Thomas M.

    2003-01-01

    Previous studies have demonstrated that the specificity of Src homology 2 (SH2) and phosphotyrosine-binding domain interactions are mediated by phosphorylated tyrosines and their neighboring amino acids. Two of the first phosphotyrosine-based binding sites were found on middle T antigen of polyoma virus. Tyr-250 acts as a binding site for ShcA, whereas Tyr-315 forms a binding site for the SH2 domain of the p85 subunit of phosphatidylinositol 3-kinase. However, genetic analysis of a given phosphotyrosine's role in signaling can be complicated when it serves as a binding site for multiple proteins. The situation is particularly difficult when the phosphotyrosine serves as a secondary binding site for a protein with primary binding determinates elsewhere. Mutation of a tyrosine residue to phenylalanine blocks association of all bound proteins. Here we show that the mutation of the amino acids following the phosphorylated tyrosine to alanine can reveal phosphotyrosine function as a secondary binding site, while abrogating the phosphotyrosine motif's role as a primary binding site for SH2 domains. We tested this methodology by using middle T antigen. Our results suggest that Tyr-250 is a secondary binding site for phosphatidylinositol 3-kinase, whereas Tyr-315 is a secondary binding site for a yet-to-be-identified protein, which is critical for transformation. PMID:12881485

  11. Genome-Wide Assessment of Efficiency and Specificity in CRISPR/Cas9 Mediated Multiple Site Targeting in Arabidopsis.

    PubMed

    Peterson, Brenda A; Haak, David C; Nishimura, Marc T; Teixeira, Paulo J P L; James, Sean R; Dangl, Jeffery L; Nimchuk, Zachary L

    2016-01-01

    Simultaneous multiplex mutation of large gene families using Cas9 has the potential to revolutionize agriculture and plant sciences. The targeting of multiple genomic sites at once raises concerns about the efficiency and specificity in targeting. The model Arabidopsis thaliana is widely used in basic plant research. Previous work has suggested that the Cas9 off-target rate in Arabidopsis is undetectable. Here we use deep sequencing on pooled plants simultaneously targeting 14 distinct genomic loci to demonstrate that multiplex targeting in Arabidopsis is highly specific to on-target sites with no detectable off-target events. In addition, chromosomal translocations are extremely rare. The high specificity of Cas9 in Arabidopsis makes this a reliable method for clean mutant generation with no need to enhance specificity or adopt alternate Cas9 variants. PMID:27622539

  12. Genomic characterization of brain metastases reveals branched evolution and potential therapeutic targets

    PubMed Central

    Santagata, Sandro; Cahill, Daniel P.; Taylor-Weiner, Amaro; Jones, Robert T.; Van Allen, Eliezer M.; Lawrence, Michael S.; Horowitz, Peleg M.; Cibulskis, Kristian; Ligon, Keith L.; Tabernero, Josep; Seoane, Joan; Martinez-Saez, Elena; Curry, William T.; Dunn, Ian F.; Paek, Sun Ha; Park, Sung-Hye; McKenna, Aaron; Chevalier, Aaron; Rosenberg, Mara; Barker, Frederick G.; Gill, Corey M.; Van Hummelen, Paul; Thorner, Aaron R.; Johnson, Bruce E.; Hoang, Mai P.; Choueiri, Toni K.; Signoretti, Sabina; Sougnez, Carrie; Rabin, Michael S.; Lin, Nancy U.; Winer, Eric P.; Stemmer-Rachamimov, Anat; Meyerson, Matthew; Garraway, Levi; Gabriel, Stacey; Lander, Eric S.; Beroukhim, Rameen; Batchelor, Tracy T.; Baselga, Jose; Louis, David N.

    2016-01-01

    Brain metastases are associated with a dismal prognosis. Whether brain metastases harbor distinct genetic alterations beyond those observed in primary tumors is unknown. We performed whole-exome sequencing of 86 matched brain metastases, primary tumors and normal tissue. In all clonally related cancer samples, we observed branched evolution, where all metastatic and primary sites shared a common ancestor yet continued to evolve independently. In 53% of cases, we found potentially clinically informative alterations in the brain metastases not detected in the matched primary-tumor sample. In contrast, spatially and temporally separated brain metastasis sites were genetically homogenous. Distal extracranial and regional lymph node metastases were highly divergent from brain metastases. We detected alterations associated with sensitivity to PI3K/AKT/mTOR, CDK, and HER2/EGFR inhibitors in the brain metastases. Genomic analysis of brain metastases provides an opportunity to identify potentially clinically informative alterations not detected in clinically sampled primary tumors, regional lymph nodes, or extracranial metastases. PMID:26410082

  13. Reverse Chemical Genetics: Comprehensive Fitness Profiling Reveals the Spectrum of Drug Target Interactions.

    PubMed

    Wong, Lai H; Sinha, Sunita; Bergeron, Julien R; Mellor, Joseph C; Giaever, Guri; Flaherty, Patrick; Nislow, Corey

    2016-09-01

    The emergence and prevalence of drug resistance demands streamlined strategies to identify drug resistant variants in a fast, systematic and cost-effective way. Methods commonly used to understand and predict drug resistance rely on limited clinical studies from patients who are refractory to drugs or on laborious evolution experiments with poor coverage of the gene variants. Here, we report an integrative functional variomics methodology combining deep sequencing and a Bayesian statistical model to provide a comprehensive list of drug resistance alleles from complex variant populations. Dihydrofolate reductase, the target of methotrexate chemotherapy drug, was used as a model to identify functional mutant alleles correlated with methotrexate resistance. This systematic approach identified previously reported resistance mutations, as well as novel point mutations that were validated in vivo. Use of this systematic strategy as a routine diagnostics tool widens the scope of successful drug research and development. PMID:27588687

  14. In silico pathway analysis in cervical carcinoma reveals potential new targets for treatment

    PubMed Central

    van Dam, Peter A.; van Dam, Pieter-Jan H. H.; Rolfo, Christian; Giallombardo, Marco; van Berckelaer, Christophe; Trinh, Xuan Bich; Altintas, Sevilay; Huizing, Manon; Papadimitriou, Kostas; Tjalma, Wiebren A. A.; van Laere, Steven

    2016-01-01

    An in silico pathway analysis was performed in order to improve current knowledge on the molecular drivers of cervical cancer and detect potential targets for treatment. Three publicly available Affymetrix gene expression data-sets (GSE5787, GSE7803, GSE9750) were retrieved, vouching for a total of 9 cervical cancer cell lines (CCCLs), 39 normal cervical samples, 7 CIN3 samples and 111 cervical cancer samples (CCSs). Predication analysis of microarrays was performed in the Affymetrix sets to identify cervical cancer biomarkers. To select cancer cell-specific genes the CCSs were compared to the CCCLs. Validated genes were submitted to a gene set enrichment analysis (GSEA) and Expression2Kinases (E2K). In the CCSs a total of 1,547 probe sets were identified that were overexpressed (FDR < 0.1). Comparing to CCCLs 560 probe sets (481 unique genes) had a cancer cell-specific expression profile, and 315 of these genes (65%) were validated. GSEA identified 5 cancer hallmarks enriched in CCSs (P < 0.01 and FDR < 0.25) showing that deregulation of the cell cycle is a major component of cervical cancer biology. E2K identified a protein-protein interaction (PPI) network of 162 nodes (including 20 drugable kinases) and 1626 edges. This PPI-network consists of 5 signaling modules associated with MYC signaling (Module 1), cell cycle deregulation (Module 2), TGFβ-signaling (Module 3), MAPK signaling (Module 4) and chromatin modeling (Module 5). Potential targets for treatment which could be identified were CDK1, CDK2, ABL1, ATM, AKT1, MAPK1, MAPK3 among others. The present study identified important driver pathways in cervical carcinogenesis which should be assessed for their potential therapeutic drugability. PMID:26701206

  15. In silico pathway analysis in cervical carcinoma reveals potential new targets for treatment.

    PubMed

    van Dam, Peter A; van Dam, Pieter-Jan H H; Rolfo, Christian; Giallombardo, Marco; van Berckelaer, Christophe; Trinh, Xuan Bich; Altintas, Sevilay; Huizing, Manon; Papadimitriou, Kostas; Tjalma, Wiebren A A; van Laere, Steven

    2016-01-19

    An in silico pathway analysis was performed in order to improve current knowledge on the molecular drivers of cervical cancer and detect potential targets for treatment. Three publicly available Affymetrix gene expression data-sets (GSE5787, GSE7803, GSE9750) were retrieved, vouching for a total of 9 cervical cancer cell lines (CCCLs), 39 normal cervical samples, 7 CIN3 samples and 111 cervical cancer samples (CCSs). Predication analysis of microarrays was performed in the Affymetrix sets to identify cervical cancer biomarkers. To select cancer cell-specific genes the CCSs were compared to the CCCLs. Validated genes were submitted to a gene set enrichment analysis (GSEA) and Expression2Kinases (E2K). In the CCSs a total of 1,547 probe sets were identified that were overexpressed (FDR < 0.1). Comparing to CCCLs 560 probe sets (481 unique genes) had a cancer cell-specific expression profile, and 315 of these genes (65%) were validated. GSEA identified 5 cancer hallmarks enriched in CCSs (P < 0.01 and FDR < 0.25) showing that deregulation of the cell cycle is a major component of cervical cancer biology. E2K identified a protein-protein interaction (PPI) network of 162 nodes (including 20 drugable kinases) and 1626 edges. This PPI-network consists of 5 signaling modules associated with MYC signaling (Module 1), cell cycle deregulation (Module 2), TGFβ-signaling (Module 3), MAPK signaling (Module 4) and chromatin modeling (Module 5). Potential targets for treatment which could be identified were CDK1, CDK2, ABL1, ATM, AKT1, MAPK1, MAPK3 among others. The present study identified important driver pathways in cervical carcinogenesis which should be assessed for their potential therapeutic drugability. PMID:26701206

  16. Crystal structure of equine serum albumin in complex with cetirizine reveals a novel drug binding site.

    PubMed

    Handing, Katarzyna B; Shabalin, Ivan G; Szlachta, Karol; Majorek, Karolina A; Minor, Wladek

    2016-03-01

    Serum albumin (SA) is the main transporter of drugs in mammalian blood plasma. Here, we report the first crystal structure of equine serum albumin (ESA) in complex with antihistamine drug cetirizine at a resolution of 2.1Å. Cetirizine is bound in two sites--a novel drug binding site (CBS1) and the fatty acid binding site 6 (CBS2). Both sites differ from those that have been proposed in multiple reports based on equilibrium dialysis and fluorescence studies for mammalian albumins as cetirizine binding sites. We show that the residues forming the binding pockets in ESA are highly conserved in human serum albumin (HSA), and suggest that binding of cetirizine to HSA will be similar. In support of that hypothesis, we show that the dissociation constants for cetirizine binding to CBS2 in ESA and HSA are identical using tryptophan fluorescence quenching. Presence of lysine and arginine residues that have been previously reported to undergo nonenzymatic glycosylation in CBS1 and CBS2 suggests that cetirizine transport in patients with diabetes could be altered. A review of all available SA structures from the PDB shows that in addition to the novel drug binding site we present here (CBS1), there are two pockets on SA capable of binding drugs that do not overlap with fatty acid binding sites and have not been discussed in published reviews. PMID:26896718

  17. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  18. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  19. A Metabolic Probe-Enabled Strategy Reveals Uptake and Protein Targets of Polyunsaturated Aldehydes in the Diatom Phaeodactylum tricornutum

    PubMed Central

    Wolfram, Stefanie; Wielsch, Natalie; Hupfer, Yvonne; Mönch, Bettina; Lu-Walther, Hui-Wen; Heintzmann, Rainer; Werz, Oliver; Svatoš, Aleš; Pohnert, Georg

    2015-01-01

    Diatoms are unicellular algae of crucial importance as they belong to the main primary producers in aquatic ecosystems. Several diatom species produce polyunsaturated aldehydes (PUAs) that have been made responsible for chemically mediated interactions in the plankton. PUA-effects include chemical defense by reducing the reproductive success of grazing copepods, allelochemical activity by interfering with the growth of competing phytoplankton and cell to cell signaling. We applied a PUA-derived molecular probe, based on the biologically highly active 2,4-decadienal, with the aim to reveal protein targets of PUAs and affected metabolic pathways. By using fluorescence microscopy, we observed a substantial uptake of the PUA probe into cells of the diatom Phaeodactylum tricornutum in comparison to the uptake of a structurally closely related control probe based on a saturated aldehyde. The specific uptake motivated a chemoproteomic approach to generate a qualitative inventory of proteins covalently targeted by the α,β,γ,δ-unsaturated aldehyde structure element. Activity-based protein profiling revealed selective covalent modification of target proteins by the PUA probe. Analysis of the labeled proteins gave insights into putative affected molecular functions and biological processes such as photosynthesis including ATP generation and catalytic activity in the Calvin cycle or the pentose phosphate pathway. The mechanism of action of PUAs involves covalent reactions with proteins that may result in protein dysfunction and interference of involved pathways. PMID:26496085

  20. A Metabolic Probe-Enabled Strategy Reveals Uptake and Protein Targets of Polyunsaturated Aldehydes in the Diatom Phaeodactylum tricornutum.

    PubMed

    Wolfram, Stefanie; Wielsch, Natalie; Hupfer, Yvonne; Mönch, Bettina; Lu-Walther, Hui-Wen; Heintzmann, Rainer; Werz, Oliver; Svatoš, Aleš; Pohnert, Georg

    2015-01-01

    Diatoms are unicellular algae of crucial importance as they belong to the main primary producers in aquatic ecosystems. Several diatom species produce polyunsaturated aldehydes (PUAs) that have been made responsible for chemically mediated interactions in the plankton. PUA-effects include chemical defense by reducing the reproductive success of grazing copepods, allelochemical activity by interfering with the growth of competing phytoplankton and cell to cell signaling. We applied a PUA-derived molecular probe, based on the biologically highly active 2,4-decadienal, with the aim to reveal protein targets of PUAs and affected metabolic pathways. By using fluorescence microscopy, we observed a substantial uptake of the PUA probe into cells of the diatom Phaeodactylum tricornutum in comparison to the uptake of a structurally closely related control probe based on a saturated aldehyde. The specific uptake motivated a chemoproteomic approach to generate a qualitative inventory of proteins covalently targeted by the α,β,γ,δ-unsaturated aldehyde structure element. Activity-based protein profiling revealed selective covalent modification of target proteins by the PUA probe. Analysis of the labeled proteins gave insights into putative affected molecular functions and biological processes such as photosynthesis including ATP generation and catalytic activity in the Calvin cycle or the pentose phosphate pathway. The mechanism of action of PUAs involves covalent reactions with proteins that may result in protein dysfunction and interference of involved pathways. PMID:26496085

  1. High-throughput analysis of promoter occupancy reveals new targets for Arx, a gene mutated in mental retardation and interneuronopathies.

    PubMed

    Quillé, Marie-Lise; Carat, Solenne; Quéméner-Redon, Sylvia; Hirchaud, Edouard; Baron, Daniel; Benech, Caroline; Guihot, Jeanne; Placet, Morgane; Mignen, Olivier; Férec, Claude; Houlgatte, Rémi; Friocourt, Gaëlle

    2011-01-01

    Genetic investigations of X-linked intellectual disabilities have implicated the ARX (Aristaless-related homeobox) gene in a wide spectrum of disorders extending from phenotypes characterised by severe neuronal migration defects such as lissencephaly, to mild or moderate forms of mental retardation without apparent brain abnormalities but with associated features of dystonia and epilepsy. Analysis of Arx spatio-temporal localisation profile in mouse revealed expression in telencephalic structures, mainly restricted to populations of GABAergic neurons at all stages of development. Furthermore, studies of the effects of ARX loss of function in humans and animal models revealed varying defects, suggesting multiple roles of this gene during brain development. However, to date, little is known about how ARX functions as a transcription factor and the nature of its targets. To better understand its role, we combined chromatin immunoprecipitation and mRNA expression with microarray analysis and identified a total of 1006 gene promoters bound by Arx in transfected neuroblastoma (N2a) cells and in mouse embryonic brain. Approximately 24% of Arx-bound genes were found to show expression changes following Arx overexpression or knock-down. Several of the Arx target genes we identified are known to be important for a variety of functions in brain development and some of them suggest new functions for Arx. Overall, these results identified multiple new candidate targets for Arx and should help to better understand the pathophysiological mechanisms of intellectual disability and epilepsy associated with ARX mutations. PMID:21966449

  2. Targeted Protein Destabilization Reveals an Estrogen-mediated ER Stress Response

    PubMed Central

    Raina, Kanak; Noblin, Devin J.; Serebrenik, Yevgeniy V.; Adams, Alison; Zhao, Connie; Crews, Craig M.

    2014-01-01

    Accumulation of unfolded proteins within the endoplasmic reticulum (ER) of eukaryotic cells leads to an unfolded protein response (UPR) that either restores homeostasis or commits the cells to apoptosis. Tools traditionally used to study the UPR are pro-apoptotic and thus confound analysis of long-term cellular responses to ER stress. Here, we describe an Endoplasmic Reticulum-localized HaloTag (ERHT) protein that can be conditionally destabilized using a small molecule hydrophobic tag (HyT36). Treatment of ERHT-expressing cells with HyT36 induces an acute, resolvable ER stress that results in transient UPR activation without induction of apoptosis. Transcriptome analysis of late-stage responses to this UPR stimulus reveals a link between UPR activity and estrogen signaling. PMID:25242550

  3. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites

    PubMed Central

    Sharma, Cynthia M.; Darfeuille, Fabien; Plantinga, Titia H.; Vogel, Jörg

    2007-01-01

    The interactions of numerous regulatory small RNAs (sRNAs) with target mRNAs have been characterized, but how sRNAs can regulate multiple, structurally unrelated mRNAs is less understood. Here we show that Salmonella GcvB sRNA directly acts on seven target mRNAs that commonly encode periplasmic substrate-binding proteins of ABC uptake systems for amino acids and peptides. Alignment of GcvB homologs of distantly related bacteria revealed a conserved G/U-rich element that is strictly required for GcvB target recognition. Analysis of target gene fusion regulation in vivo, and in vitro structure probing and translation assays showed that GcvB represses its target mRNAs by binding to extended C/A-rich regions, which may also serve as translational enhancer elements. In some cases (oppA, dppA), GcvB repression can be explained by masking the ribosome-binding site (RBS) to prevent 30S subunit binding. However, GcvB can also effectively repress translation by binding to target mRNAs at upstream sites, outside the RBS. Specifically, GcvB represses gltI mRNA translation at the C/A-rich target site located at positions −57 to −45 relative to the start codon. Taken together, our study suggests highly conserved regions in sRNAs and mRNA regions distant from Shine-Dalgarno sequences as important elements for the identification of sRNA targets. PMID:17974919

  4. Identification of the target binding site of ethanolamine-binding aptamers and its exploitation for ethanolamine detection.

    PubMed

    Heilkenbrinker, Alexandra; Reinemann, Christine; Stoltenburg, Regina; Walter, Johanna-Gabriela; Jochums, André; Stahl, Frank; Zimmermann, Stefan; Strehlitz, Beate; Scheper, Thomas

    2015-01-01

    Aptamers are promising recognition elements for sensitive and specific detection of small molecules. We have previously selected ssDNA aptamers for ethanolamine, one of the smallest aptamer targets so far. The work presented here focuses on the determination of the binding region within the aptamer structure and its exploitation for the development of an aptamer-based assay for detection of ethanolamine. Sequence analysis of the aptamers resulted in the identification of a G-rich consensus sequence, which was able to fold in a typical two- or three-layered G-quartet structure. Experiments with stepwise truncated variants of the aptamers revealed that the consensus sequence is responsible and sufficient for binding to the target. On the basis of the knowledge of the aptamers binding site, we developed an aptamer-based microarray assay relying on competition between ethanolamine and an oligonucleotide complementary to the consensus sequence. Competitive binding of ethanolamine and fluorescently labeled complementary oligonucleotides resulted in fluorescence intensities dependent on ethanolamine concentration with a limit of detection of 10 pM. This method enables detection of small molecules without any labeling of analytes. The competitive assay could potentially be transferred to other aptamers and thus provides a promising system for aptamer-based detection of diverse small molecules. PMID:25435319

  5. Global Identification of SMAD2 Target Genes Reveals a Role for Multiple Co-regulatory Factors in Zebrafish Early Gastrulas*

    PubMed Central

    Liu, Zhaoting; Lin, Xiwen; Cai, Zhaoping; Zhang, Zhuqiang; Han, Chunsheng; Jia, Shunji; Meng, Anming; Wang, Qiang

    2011-01-01

    Nodal and Smad2/3 signals play pivotal roles in mesendoderm induction and axis determination during late blastulation and early gastrulation in vertebrate embryos. However, Smad2/3 direct target genes during those critical developmental stages have not been systematically identified. Here, through ChIP-chip assay, we show that the promoter/enhancer regions of 679 genes are bound by Smad2 in the zebrafish early gastrulas. Expression analyses confirm that a significant proportion of Smad2 targets are indeed subjected to Nodal/Smad2 regulation at the onset of gastrulation. The co-existence of DNA-binding sites of other transcription factors in the Smad2-bound regions allows the identification of well known Smad2-binding partners, such as FoxH1 and Lef1/β-catenin, as well as many previously unknown Smad2 partners, including Oct1 and Gata6, during embryogenesis. We demonstrate that Oct1 physically associates with and enhances the transcription and mesendodermal induction activity of Smad2, whereas Gata6 exerts an inhibitory role in Smad2 signaling and mesendodermal induction. Thus, our study systemically uncovers a large number of Smad2 targets in early gastrulas and suggests cooperative roles of Smad2 and other transcription factors in controlling target gene transcription, which will be valuable for studying regulatory cascades during germ layer formation and patterning of vertebrate embryos. PMID:21669877

  6. A comprehensive assessment of Coprates Chasma on Mars as a target site for future exploration missions

    NASA Astrophysics Data System (ADS)

    Singh, Amit; Mukherjee, Saumitra; Garg, Akshay

    2012-07-01

    Valleys on Mars are one of the least targeted regions in terms of target selection for exploration missions till date. Coprates Chasma, in the eastern part of Valles Marineris, is a region marked by normal faulting, spurs, gullies, horsts, grabens and several other features of interest. There are enough evidences of major rock rearrangements and landslides along its walls. It also has associated floor deposits that are complex in nature. Also, Interior Layered Deposits (ILDs) have been found there associated with sulphates. This work primarily focuses on Coprates Chasma to comprehensively assess its significance as an exploration target representative for valleys on Mars. Morphometric analysis of Coprates Chasma was primarily based on Mars Orbiter Laser Altimeter (MOLA) data and supplemented with additional information from existing literature regarding geology, structure and tectonics. Apart from calculation of terrain metrics several study sites have also been proposed by this study. Navigability of autonomous vehicles over the terrain and associated scientific experimentation opportunities were also evaluated. Shade component constrain was also analyzed from both ground as well as orbital studies perspectives. Coprates Chasma seems to be a perfect candidate to study tectonic activity on Mars, to understand the triggering processes and associated structures. Basal topography and geology are two decisive factors for selection of these study sites. The region is also expected to be associated with possible focusing / amplification of shock waves generated by thermal quakes, landslides and impact cratering by meteorites. It could well provide opportunities to study the complex geological history of Mars and processes leading to the formation of Valles Marineris itself.

  7. Site-targeted acoustic contrast agent detects molecular expression of tissue factor after balloon angioplasty

    NASA Astrophysics Data System (ADS)

    Hall, Christopher S.; Abendschein, Dana R.; Scherrer, David E.; Scott, Michael J.; Marsh, Jon N.; Wickline, Samuel A.; Lanza, Gregory M.

    2000-04-01

    Complex molecular signaling heralds the early stages of pathologies such as angiogenesis, inflammation, and cellular responses to mechanically damaged coronary arteries after balloon angioplasty. In previous studies, we have demonstrated acoustic enhancement of blood clot morphology with the use of a nongaseous, ligand-targeted acoustic nanoparticle emulsion delivered to areas of thrombosis both in vitro and in vivo. In this paper, we characterize the early expression of tissue factor which contributes to subsequent arterial restenosis. Tissue factor is a 42kd glycoprotein responsible for blood coagulation but also plays a well-described role in cancer metastasis, angiogenesis, and vascular restenosis. This study was designed to determine whether the targeted contrast agent could localize tissue factor expressed within the wall of balloon-injured arteries. Both carotid arteries of five pigs (20 kg) were injured using an 8 X 20 mm angioplasty balloon. The carotids were treated in situ with a perfluorocarbon nanoparticle emulsion covalently complexed to either specific anti-tissue factor polyclonal F(ab) fragments (treatment) or non-specific IgG F(ab) fragments (control). Intravascular ultrasound (30 MHz) images of the arteries were obtained before and after exposure to the emulsions. Tissue- factor targeted ultrasonic contrast agent acoustically enhanced the subintima and media at the site of balloon- induced injury compared with control contrast arteries (p less than 0.05). Immunohistochemical staining confirmed the presence of increased tissue factor at the sites of acoustic enhancement. Binding of the targeted agents was demonstrated in vitro by scanning electron microscope images of cultured smooth muscle cells that constitutively express tissue factor. This study demonstrates the concept of molecular imaging and localization of carotid arteries' tissue factor in vivo using a new, nanoparticulate emulsion. Enhancement of the visualization of the molecular

  8. Profile comparison revealed deviation from structural constraint at the positively selected sites.

    PubMed

    Oda, Hiroyuki; Ota, Motonori; Toh, Hiroyuki

    2016-09-01

    The amino acid substitutions at a site are affected by mixture of various constraints. It is also known that the amino acid substitutions are accelerated at sites under positive selection. However, the relationship between the substitutions at positively selected sites and the constraints has not been thoroughly examined. The advances in computational biology have enabled us to divide the mixture of the constraints into the structural constraint and the remainings by using the amino acid sequences and the tertiary structures, which is expressed as the deviation of the mixture of constraints from the structural constraint. Here, two types of profiles, or matrices with the size of 20 x (site length), are compared. One of the profiles represents the mixture of constraints, and is generated from a multiple amino acid sequence alignment, whereas the other is designed to represent the structural constraints. We applied the profile comparison method to proteins under positive selection to examine the relationship between the positive selection and constraints. The results suggested that the constraint at a site under positive selection tends to be deviated from the structural constraint at the site. PMID:27443483

  9. Connectivity Map-based discovery of parbendazole reveals targetable human osteogenic pathway

    PubMed Central

    Brum, Andrea M.; van de Peppel, Jeroen; van der Leije, Cindy S.; Schreuders-Koedam, Marijke; Eijken, Marco; van der Eerden, Bram C. J.; van Leeuwen, Johannes P. T. M.

    2015-01-01

    Osteoporosis is a common skeletal disorder characterized by low bone mass leading to increased bone fragility and fracture susceptibility. In this study, we have identified pathways that stimulate differentiation of bone forming osteoblasts from human mesenchymal stromal cells (hMSCs). Gene expression profiling was performed in hMSCs differentiated toward osteoblasts (at 6 h). Significantly regulated genes were analyzed in silico, and the Connectivity Map (CMap) was used to identify candidate bone stimulatory compounds. The signature of parbendazole matches the expression changes observed for osteogenic hMSCs. Parbendazole stimulates osteoblast differentiation as indicated by increased alkaline phosphatase activity, mineralization, and up-regulation of bone marker genes (alkaline phosphatase/ALPL, osteopontin/SPP1, and bone sialoprotein II/IBSP) in a subset of the hMSC population resistant to the apoptotic effects of parbendazole. These osteogenic effects are independent of glucocorticoids because parbendazole does not up-regulate glucocorticoid receptor (GR) target genes and is not inhibited by the GR antagonist mifepristone. Parbendazole causes profound cytoskeletal changes including degradation of microtubules and increased focal adhesions. Stabilization of microtubules by pretreatment with Taxol inhibits osteoblast differentiation. Parbendazole up-regulates bone morphogenetic protein 2 (BMP-2) gene expression and activity. Cotreatment with the BMP-2 antagonist DMH1 limits, but does not block, parbendazole-induced mineralization. Using the CMap we have identified a previously unidentified lineage-specific, bone anabolic compound, parbendazole, which induces osteogenic differentiation through a combination of cytoskeletal changes and increased BMP-2 activity. PMID:26420877

  10. Cytogenomic profiling of breast cancer brain metastases reveals potential for repurposing targeted therapeutics

    PubMed Central

    Bollig-Fischer, Aliccia; Michelhaugh, Sharon K.; Wijesinghe, Priyanga; Dyson, Greg; Kruger, Adele; Palanisamy, Nallasivam; Choi, Lydia; Alosh, Baraa; Ali-Fehmi, Rouba; Mittal, Sandeep

    2015-01-01

    Breast cancer brain metastases remain a significant clinical problem. Chemotherapy is ineffective and a lack of treatment options result in poor patient outcomes. Targeted therapeutics have proven to be highly effective in primary breast cancer, but lack of molecular genomic characterization of metastatic brain tumors is hindering the development of new treatment regimens. Here we contribute to fill this void by reporting on gene copy number variation (CNV) in 10 breast cancer metastatic brain tumors, assayed by array comparative genomic hybridization (aCGH). Results were compared to a list of cancer genes verified by others to influence cancer. Cancer gene aberrations were identified in all specimens and pathway-level analysis was applied to aggregate data, which identified stem cell pluripotency pathway enrichment and highlighted recurring, significant amplification of SOX2, PIK3CA, NTRK1, GNAS, CTNNB1, and FGFR1. For a subset of the metastatic brain tumor samples (n=4) we compared patient-matched primary breast cancer specimens. The results of our CGH analysis and validation by alternative methods indicate that oncogenic signals driving growth of metastatic tumors exist in the original cancer. This report contributes support for more rapid development of new treatments of metastatic brain tumors, the use of genomic-based diagnostic tools and repurposed drug treatments. PMID:25970776

  11. Candidate EDA targets revealed by expression profiling of primary keratinocytes from Tabby mutant mice

    PubMed Central

    Esibizione, Diana; Cui, Chang-Yi; Schlessinger, David

    2009-01-01

    EDA, the gene mutated in anhidrotic ectodermal dysplasia, encodes ectodysplasin, a TNF superfamily member that activates NF-kB mediated transcription. To identify EDA target genes, we have earlier used expression profiling to infer genes differentially expressed at various developmental time points in Tabby (Eda-deficient) compared to wild-type mouse skin. To increase the resolution to find genes whose expression may be restricted to epidermal cells, we have now extended studies to primary keratinocyte cultures established from E19 wild-type and Tabby skin. Using microarrays bearing 44,000 gene probes, we found 385 preliminary candidate genes whose expression was significantly affected by Eda loss. By comparing expression profiles to those from Eda-A1 transgenic skin, we restricted the list to 38 “candidate EDA targets”, 14 of which were already known to be expressed in hair follicles or epidermis. We confirmed expression changes for 3 selected genes, Tbx1, Bmp7, and Jag1, both in keratinocytes and in whole skin, by Q-PCR and Western blotting analyses. Thus, by the analysis of keratinocytes, novel candidate pathways downstream of EDA were detected. PMID:18848976

  12. Targeted resequencing reveals geographical patterns of differentiation for loci implicated in parallel evolution.

    PubMed

    Westram, Anja M; Panova, Marina; Galindo, Juan; Butlin, Roger K

    2016-07-01

    Parallel divergence and speciation provide evidence for the role of divergent selection in generating biological diversity. Recent studies indicate that parallel phenotypic divergence may not have the same genetic basis in different geographical locations - 'outlier loci' (loci potentially affected by divergent selection) are often not shared among parallel instances of phenotypic divergence. However, limited sharing may be due, in part, to technical issues if false-positive outliers occur. Here, we test this idea in the marine snail Littorina saxatilis, which has evolved two partly isolated ecotypes (adapted to crab predation vs. wave action) in multiple locations independently. We argue that if the low extent of sharing observed in earlier studies in this system is due to sampling effects, we expect outliers not to show elevated FST when sequenced in new samples from the original locations and also not to follow predictable geographical patterns of elevated FST . Following a hierarchical sampling design (within vs. between country), we applied capture sequencing, targeting outliers from earlier studies and control loci. We found that outliers again showed elevated levels of FST in their original location, suggesting they were not generated by sampling effects. Outliers were also likely to show increased FST in geographically close locations, which may be explained by higher levels of gene flow or shared ancestral genetic variation compared with more distant locations. However, in contrast to earlier findings, we also found some outlier types to show elevated FST in geographically distant locations. We discuss possible explanations for this unexpected result. PMID:27061172

  13. Targeted Gene Disruption Reveals an Adhesin Indispensable for Pathogenicity of Blastomyces dermatitidis

    PubMed Central

    Tristan Brandhorst, T.; Wüthrich, Marcel; Warner, Thomas; Klein, Bruce

    1999-01-01

    Systemic fungal infections are becoming more common and difficult to treat, yet the pathogenesis of these infectious diseases remains poorly understood. In many cases, pathogenicity can be attributed to the ability of the fungi to adhere to target tissues, but the lack of tractable genetic systems has limited progress in understanding and interfering with the offending fungal products. In Blastomyces dermatitidis, the agent of blastomycosis, a respiratory and disseminated mycosis of people and animals worldwide, expression of the putative adhesin encoded by the WI-1 gene was investigated as a possible virulence factor. DNA-mediated gene transfer was used to disrupt the WI-1 locus by allelic replacement, resulting in impaired binding and entry of yeasts into macrophages, loss of adherence to lung tissue, and abolishment of virulence in mice; each of these properties was fully restored after reconstitution of WI-1 by means of gene transfer. These findings establish the pivotal role of WI-1 in adherence and virulence of B. dermatitidis yeasts. To our knowledge, they offer the first example of a genetically proven virulence determinant among systemic dimorphic fungi, and underscore the value of reverse genetics for studies of pathogenesis in these organisms. PMID:10209038

  14. Connectivity Map-based discovery of parbendazole reveals targetable human osteogenic pathway.

    PubMed

    Brum, Andrea M; van de Peppel, Jeroen; van der Leije, Cindy S; Schreuders-Koedam, Marijke; Eijken, Marco; van der Eerden, Bram C J; van Leeuwen, Johannes P T M

    2015-10-13

    Osteoporosis is a common skeletal disorder characterized by low bone mass leading to increased bone fragility and fracture susceptibility. In this study, we have identified pathways that stimulate differentiation of bone forming osteoblasts from human mesenchymal stromal cells (hMSCs). Gene expression profiling was performed in hMSCs differentiated toward osteoblasts (at 6 h). Significantly regulated genes were analyzed in silico, and the Connectivity Map (CMap) was used to identify candidate bone stimulatory compounds. The signature of parbendazole matches the expression changes observed for osteogenic hMSCs. Parbendazole stimulates osteoblast differentiation as indicated by increased alkaline phosphatase activity, mineralization, and up-regulation of bone marker genes (alkaline phosphatase/ALPL, osteopontin/SPP1, and bone sialoprotein II/IBSP) in a subset of the hMSC population resistant to the apoptotic effects of parbendazole. These osteogenic effects are independent of glucocorticoids because parbendazole does not up-regulate glucocorticoid receptor (GR) target genes and is not inhibited by the GR antagonist mifepristone. Parbendazole causes profound cytoskeletal changes including degradation of microtubules and increased focal adhesions. Stabilization of microtubules by pretreatment with Taxol inhibits osteoblast differentiation. Parbendazole up-regulates bone morphogenetic protein 2 (BMP-2) gene expression and activity. Cotreatment with the BMP-2 antagonist DMH1 limits, but does not block, parbendazole-induced mineralization. Using the CMap we have identified a previously unidentified lineage-specific, bone anabolic compound, parbendazole, which induces osteogenic differentiation through a combination of cytoskeletal changes and increased BMP-2 activity. PMID:26420877

  15. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development[OPEN

    PubMed Central

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-01-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays) HDAC HDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed in hda101 mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalian HDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  16. Novel recognition motifs and biological functions of the RNA-binding protein HuD revealed by genome-wide identification of its targets

    PubMed Central

    Bolognani, Federico; Contente-Cuomo, Tania; Perrone-Bizzozero, Nora I.

    2010-01-01

    HuD is a neuronal ELAV-like RNA-binding protein (RBP) involved in nervous system development, regeneration, and learning and memory. This protein stabilizes mRNAs by binding to AU-rich instability elements (AREs) in their 3′ unstranslated regions (3′ UTR). To isolate its in vivo targets, messenger ribonucleoprotein (mRNP) complexes containing HuD were first immunoprecipitated from brain extracts and directly bound mRNAs identified by subsequent GST-HuD pull downs and microarray assays. Using the 3′ UTR sequences of the most enriched targets and the known sequence restrictions of the HuD ARE-binding site, we discovered three novel recognition motifs. Motifs 2 and 3 are U-rich whereas motif 1 is C-rich. In vitro binding assays indicated that HuD binds motif 3 with the highest affinity, followed by motifs 2 and 1, with less affinity. These motifs were found to be over-represented in brain mRNAs that are upregulated in HuD overexpressor mice, supporting the biological function of these sequences. Gene ontology analyses revealed that HuD targets are enriched in signaling pathways involved in neuronal differentiation and that many of these mRNAs encode other RBPs, translation factors and actin-binding proteins. These findings provide further insights into the post-transcriptional mechanisms by which HuD promotes neural development and synaptic plasticity. PMID:19846595

  17. Genome-Wide Mapping of Targets of Maize Histone Deacetylase HDA101 Reveals Its Function and Regulatory Mechanism during Seed Development.

    PubMed

    Yang, Hua; Liu, Xinye; Xin, Mingming; Du, Jinkun; Hu, Zhaorong; Peng, HuiRu; Rossi, Vincenzo; Sun, Qixin; Ni, Zhongfu; Yao, Yingyin

    2016-03-01

    Histone deacetylases (HDACs) regulate histone acetylation levels by removing the acetyl group from lysine residues. The maize (Zea mays)HDACHDA101 influences several aspects of development, including kernel size; however, the molecular mechanism by which HDA101 affects kernel development remains unknown. In this study, we find that HDA101 regulates the expression of transfer cell-specific genes, suggesting that their misregulation may be associated with the defects in differentiation of endosperm transfer cells and smaller kernels observed inhda101mutants. To investigate HDA101 function during the early stages of seed development, we performed genome-wide mapping of HDA101 binding sites. We observed that, like mammalianHDACs, HDA101 mainly targets highly and intermediately expressed genes. Although loss of HDA101 can induce histone hyperacetylation of its direct targets, this often does not involve variation in transcript levels. A small subset of inactive genes that must be negatively regulated during kernel development is also targeted by HDA101 and its loss leads to hyperacetylation and increased expression of these inactive genes. Finally, we report that HDA101 interacts with members of different chromatin remodeling complexes, such as NFC103/MSI1 and SNL1/SIN3-like protein corepressors. Taken together, our results reveal a complex genetic network regulated by HDA101 during seed development and provide insight into the different mechanisms of HDA101-mediated regulation of transcriptionally active and inactive genes. PMID:26908760

  18. System-wide Analysis of SUMOylation Dynamics in Response to Replication Stress Reveals Novel Small Ubiquitin-like Modified Target Proteins and Acceptor Lysines Relevant for Genome Stability*

    PubMed Central

    Xiao, Zhenyu; Chang, Jer-Gung; Hendriks, Ivo A.; Sigurðsson, Jón Otti; Olsen, Jesper V.; Vertegaal, Alfred C.O.

    2015-01-01

    Genotoxic agents can cause replication fork stalling in dividing cells because of DNA lesions, eventually leading to replication fork collapse when the damage is not repaired. Small Ubiquitin-like Modifiers (SUMOs) are known to counteract replication stress, nevertheless, only a small number of relevant SUMO target proteins are known. To address this, we have purified and identified SUMO-2 target proteins regulated by replication stress in human cells. The developed methodology enabled single step purification of His10-SUMO-2 conjugates under denaturing conditions with high yield and high purity. Following statistical analysis on five biological replicates, a total of 566 SUMO-2 targets were identified. After 2 h of hydroxyurea treatment, 10 proteins were up-regulated for SUMOylation and two proteins were down-regulated for SUMOylation, whereas after 24 h, 35 proteins were up-regulated for SUMOylation, and 13 proteins were down-regulated for SUMOylation. A site-specific approach was used to map over 1000 SUMO-2 acceptor lysines in target proteins. The methodology is generic and is widely applicable in the ubiquitin field. A large subset of these identified proteins function in one network that consists of interacting replication factors, transcriptional regulators, DNA damage response factors including MDC1, ATR-interacting protein ATRIP, the Bloom syndrome protein and the BLM-binding partner RMI1, the crossover junction endonuclease EME1, BRCA1, and CHAF1A. Furthermore, centromeric proteins and signal transducers were dynamically regulated by SUMOylation upon replication stress. Our results uncover a comprehensive network of SUMO target proteins dealing with replication damage and provide a framework for detailed understanding of the role of SUMOylation to counteract replication stress. Ultimately, our study reveals how a post-translational modification is able to orchestrate a large variety of different proteins to integrate different nuclear processes with the

  19. Complete genome-wide screening and subtractive genomic approach revealed new virulence factors, potential drug targets against bio-war pathogen Brucella melitensis 16M

    PubMed Central

    Pradeepkiran, Jangampalli Adi; Sainath, Sri Bhashyam; Kumar, Konidala Kranthi; Bhaskar, Matcha

    2015-01-01

    Brucella melitensis 16M is a Gram-negative coccobacillus that infects both animals and humans. It causes a disease known as brucellosis, which is characterized by acute febrile illness in humans and causes abortions in livestock. To prevent and control brucellosis, identification of putative drug targets is crucial. The present study aimed to identify drug targets in B. melitensis 16M by using a subtractive genomic approach. We used available database repositories (Database of Essential Genes, Kyoto Encyclopedia of Genes and Genomes Automatic Annotation Server, and Kyoto Encyclopedia of Genes and Genomes) to identify putative genes that are nonhomologous to humans and essential for pathogen B. melitensis 16M. The results revealed that among 3 Mb genome size of pathogen, 53 putative characterized and 13 uncharacterized hypothetical genes were identified; further, from Basic Local Alignment Search Tool protein analysis, one hypothetical protein showed a close resemblance (50%) to Silicibacter pomeroyi DUF1285 family protein (2RE3). A further homology model of the target was constructed using MODELLER 9.12 and optimized through variable target function method by molecular dynamics optimization with simulating annealing. The stereochemical quality of the restrained model was evaluated by PROCHECK, VERIFY-3D, ERRAT, and WHATIF servers. Furthermore, structure-based virtual screening was carried out against the predicted active site of the respective protein using the glycerol structural analogs from the PubChem database. We identified five best inhibitors with strong affinities, stable interactions, and also with reliable drug-like properties. Hence, these leads might be used as the most effective inhibitors of modeled protein. The outcome of the present work of virtual screening of putative gene targets might facilitate design of potential drugs for better treatment against brucellosis. PMID:25834405

  20. Targeting mechanisms at sites of complement activation for imaging and therapy.

    PubMed

    Holers, V Michael

    2016-06-01

    The complement system plays a key role in many acute injury states as well as chronic autoimmune and inflammatory diseases. Localized complement activation and alternative pathway-mediated amplification on diverse target surfaces promote local recruitment of pro-inflammatory cells and elaboration of other mediators. Despite a general understanding of the architecture of the system, though, many of the mechanisms that underlie site-specific complement activation and amplification in vivo are incompletely understood. In addition, there is no capability yet to measure the level of local tissue site-specific complement activation in patients without performing biopsies to detect products using immunohistochemical techniques. Herein is reviewed emerging evidence obtained through clinical research studies of human rheumatoid arthritis along with translational studies of its disease models which demonstrate that several parallel mechanisms are involved in site-specific amplification of activation of the complement system in vivo. Among these processes are de-regulation of the alternative pathway, effector pathway-catalyzed amplification of proximal complement activation, recognition of injury-associated ligands by components of the lectin pathway, and engagement of pathogenic natural antibodies that recognize a limited set of injury-associated neoepitopes. Studies suggest that each of these inter-related processes can play key roles in amplification of complement-dependent injury on self-tissues in vivo. These findings, in addition to development of an imaging strategy described herein designed to quantitatively measure local complement C3 fixation, have relevance to therapeutic and diagnostic strategies targeting the complement system. PMID:25979851

  1. Genome-Wide Targets Regulated by the OsMADS1 Transcription Factor Reveals Its DNA Recognition Properties.

    PubMed

    Khanday, Imtiyaz; Das, Sanjukta; Chongloi, Grace L; Bansal, Manju; Grossniklaus, Ueli; Vijayraghavan, Usha

    2016-09-01

    OsMADS1 controls rice (Oryza sativa) floral fate and organ development. Yet, its genome-wide targets and the mechanisms underlying its role as a transcription regulator controlling developmental gene expression are unknown. We identify 3112 gene-associated OsMADS1-bound sites in the floret genome. These occur in the vicinity of transcription start sites, within gene bodies, and in intergenic regions. Majority of the bound DNA contained CArG motif variants or, in several cases, only A-tracts. Sequences flanking the binding peak had a higher AT nucleotide content, implying that broader DNA structural features may define in planta binding. Sequences for binding by other transcription factor families like MYC, AP2/ERF, bZIP, etc. are enriched in OsMADS1-bound DNAs. Target genes implicated in transcription, chromatin remodeling, cellular processes, and hormone metabolism were enriched. Combining expression data from OsMADS1 knockdown florets with these DNA binding data, a snapshot of a gene regulatory network was deduced where targets, such as AP2/ERF and bHLH transcription factors and chromatin remodelers form nodes. We show that the expression status of these nodal factors can be altered by inducing the OsMADS1-GR fusion protein and present a model for a regulatory cascade where the direct targets of OsMADS1, OsbHLH108/SPT, OsERF034, and OsHSF24, in turn control genes such as OsMADS32 and OsYABBY5 This cascade, with other similar relationships, cumulatively contributes to floral organ development. Overall, OsMADS1 binds to several regulatory genes and, probably in combination with other factors, controls a gene regulatory network that ensures rice floret development. PMID:27457124

  2. Exome sequencing reveals novel mutation targets in diffuse large B-cell lymphomas derived from Chinese patients

    PubMed Central

    de Miranda, Noel F. C. C.; Georgiou, Konstantinos; Chen, Longyun; Wu, Chenglin; Gao, Zhibo; Zaravinos, Apostolos; Lisboa, Susana; Enblad, Gunilla; Teixeira, Manuel R.; Zeng, Yixin

    2014-01-01

    Next-generation sequencing studies on diffuse large B-cell lymphomas (DLBCLs) have revealed novel targets of genetic aberrations but also high intercohort heterogeneity. Previous studies have suggested that the prevalence of disease subgroups and cytogenetic profiles differ between Western and Asian patients. To characterize the coding genome of Chinese DLBCL, we performed whole-exome sequencing of DNA derived from 31 tumors and respective peripheral blood samples. The mutation prevalence of B2M, CD70, DTX1, LYN, TMSB4X, and UBE2A was investigated in an additional 105 tumor samples. We discovered 11 novel targets of recurrent mutations in DLBCL that included functionally relevant genes such as LYN and TMSB4X. Additional genes were found mutated at high frequency (≥10%) in the Chinese cohort including DTX1, which was the most prevalent mutation target in the Notch pathway. We furthermore demonstrated that mutations in DTX1 impair its function as a negative regulator of Notch. Novel and previous unappreciated targets of somatic mutations in DLBCL identified in this study support the existence of additional/alternative tumorigenic pathways in these tumors. The observed differences with previous reports might be explained by the genetic heterogeneity of DLBCL, the germline genetic makeup of Chinese individuals, and/or exposure to distinct etiological agents. PMID:25171927

  3. Deformation of dry and wet sandstone targets during hypervelocity impact experiments, as revealed from the MEMIN Program

    NASA Astrophysics Data System (ADS)

    Buhl, Elmar; Poelchau, Michael H.; Dresen, Georg; Kenkmann, Thomas

    2013-01-01

    Hypervelocity impact experiments on dry and water-saturated targets of fine-grained quartz sandstone, performed within the MEMIN project, have been investigated to determine the effects of porosity and pore space saturation on deformation mechanisms in the crater's subsurface. A dry sandstone cube and a 90% water-saturated sandstone cube (Seeberger Sandstein, 20 cm side length, about 23% porosity) were impacted at the Fraunhofer EMI acceleration facilities by 2.5 mm diameter steel spheres at 4.8 and 5.3 km s-1, respectively. Microstructural postimpact analyses of the bisected craters revealed differences in the subsurface deformation for the dry and the wet target experiments. Enhanced grain comminution and compaction in the dry experiment and a wider extent of localized deformation in the saturated experiment suggest a direct influence of pore water on deformation mechanisms. We suggest that the pore water reduces the shock impedance mismatch between grains and pore space, and thus reduces the peak stresses at grain-grain contacts. This effect inhibits profound grain comminution and effective compaction, but allows for reduced shock wave attenuation and a more effective transport of energy into the target. The reduced shock wave attenuation is supposed to be responsible for the enhanced crater growth and the development of "near surface" fractures in the wet target.

  4. Small RNA and Degradome Sequencing Reveal Complex Roles of miRNAs and Their Targets in Developing Wheat Grains

    PubMed Central

    Geng, Yuke; Hao, Chenyang; Chen, Xinhong; Zhang, Xueyong

    2015-01-01

    Plant microRNAs (miRNAs) have been shown to play critical roles in plant development. In this study, we employed small RNA combined with degradome sequencing to survey development-related miRNAs and their validated targets during wheat grain development. A total of 186 known miRNAs and 37 novel miRNAs were identified in four small RNA libraries. Moreover, a miRNA-like long hairpin locus was first identified to produce 21~22-nt phased siRNAs that act in trans to cleave target mRNAs. A comparison of the miRNAomes revealed that 55 miRNA families were differentially expressed during the grain development. Predicted and validated targets of these development-related miRNAs are involved in different cellular responses and metabolic processes including cell proliferation, auxin signaling, nutrient metabolism and gene expression. This study provides insight into the complex roles of miRNAs and their targets in regulating wheat grain development. PMID:26426440

  5. Phenyl aldehyde and propanoids exert multiple sites of action towards cell membrane and cell wall targeting ergosterol in Candida albicans

    PubMed Central

    2013-01-01

    In the present study, two phyto-compounds phenyl aldehyde (cinnamaldehyde) and propanoid (eugenol) were selected to explore their modes of action against Candida albicans. Electron microscopy, flow cytometry and spectroscopic assays were employed to determine the targets of these compounds. Treatment of C. albicans (CA04) with sub-MICs of cinnamaldehyde (50 μg/mL) and eugenol (200 μg/mL) indicated multiple sites of action including damages to cell walls, cell membranes, cytoplasmic contents and other membranous structures as observed under electron microscopy. Concentration and time dependent increase in the release of cytoplasmic contents accompanied with change in extracellular K+ concentration was recorded. Exposure of Candida cells at 4 × MIC of cinnaamldehyde and eugenol resulted in 40.21% and 50.90% dead cells, respectively as revealed by flow cytometry analysis. Treatment of Candida cells by cinnamaldehyde and eugenol at 0.5 × MIC showed 67.41% and 76.23% reduction in ergosterol biosynthesis, respectively. The binding assays reflected the ability of compounds to bind with the ergosterol. Our findings have suggested that the membrane damaging effects of phenyl aldehyde and propanoids class of compounds is attributed to their ability to inhibit ergosterol biosynthesis and simultaneously binding with ergosterol. Indirect or secondary action of these compounds on cell wall is also expected as revealed by electron microscopic studies. PMID:24010721

  6. Cell-Targeted Optogenetics and Electrical Microstimulation Reveal the Primate Koniocellular Projection to Supra-granular Visual Cortex.

    PubMed

    Klein, Carsten; Evrard, Henry C; Shapcott, Katharine A; Haverkamp, Silke; Logothetis, Nikos K; Schmid, Michael C

    2016-04-01

    Electrical microstimulation and more recently optogenetics are widely used to map large-scale brain circuits. However, the neuronal specificity achieved with both methods is not well understood. Here we compare cell-targeted optogenetics and electrical microstimulation in the macaque monkey brain to functionally map the koniocellular lateral geniculate nucleus (LGN) projection to primary visual cortex (V1). Selective activation of the LGN konio neurons with CamK-specific optogenetics caused selective electrical current inflow in the supra-granular layers of V1. Electrical microstimulation targeted at LGN konio layers revealed the same supra-granular V1 activation pattern as the one elicited by optogenetics. Taken together, these findings establish a selective koniocellular LGN influence on V1 supra-granular layers, and they indicate comparable capacities of both stimulation methods to isolate thalamo-cortical circuits in the primate brain. PMID:27021172

  7. Interaction of the intron-encoded mobility endonuclease I-PpoI with its target site.

    PubMed Central

    Ellison, E L; Vogt, V M

    1993-01-01

    Endonucleases encoded by mobile group I introns are highly specific DNases that induce a double-strand break near the site to which the intron moves. I-PpoI from the acellular slime mold Physarum polycephalum mediates the mobility of intron 3 (Pp LSU 3) in the extrachromosomal nuclear ribosomal DNA of this organism. We showed previously that cleavage by I-PpoI creates a four-base staggered cut near the point of intron insertion. We have now characterized several further properties of the endonuclease. As determined by deletion analysis, the minimal target site recognized by I-PopI was a sequence of 13 to 15 bp spanning the cleavage site. The purified protein behaved as a globular dimer in sedimentation and gel filtration. In gel mobility shift assays in the presence of EDTA, I-PpoI formed a stable and specific complex with DNA, dissociating with a half-life of 45 min. By footprinting and interference assays with methidiumpropyl-EDTA-iron(II), I-PpoI contacted a 22- to 24-bp stretch of DNA. The endonuclease protected most of the purines found in both the major and minor grooves of the DNA helix from modification by dimethyl sulfate (DMS). However, the reactivity to DMS was enhanced at some purines, suggesting that binding leads to a conformational change in the DNA. The pattern of DMS protection differed fundamentally in the two partially symmetrical halves of the recognition sequence. Images PMID:8246971

  8. Dynamin triple knockout cells reveal off target effects of commonly used dynamin inhibitors

    PubMed Central

    Park, Ryan J.; Shen, Hongying; Liu, Lijuan; Liu, Xinran; Ferguson, Shawn M.; De Camilli, Pietro

    2013-01-01

    Summary Dynamin, which is encoded by three genes in mammals, is a GTPase implicated in endocytic membrane fission. Dynamin 1 and 3 are predominantly expressed in brain, whereas dynamin 2 is ubiquitously expressed. With the goal of assessing the impact of the lack of dynamin on cell physiology, we previously generated and characterized dynamin 1 and 2 double knockout (DKO) fibroblasts. These DKO cells were unexpectedly viable in spite of a severe impairment of clathrin-mediated endocytosis. As low-level expression of the dynamin 3 gene in these cells could not be excluded, we have now engineered dynamin 1, 2 and 3 triple KO (TKO) fibroblasts. These cells did not reveal any additional defects beyond what was previously observed in DKO fibroblasts. Surprisingly, although fluid-phase endocytosis and peripheral membrane ruffling were not impaired by the lack of all three dynamins, two structurally similar, widely used dynamin inhibitors, dynasore and Dyngo-4a, robustly inhibited these two processes both in wild-type and TKO cells. Dynamin TKO cells will be useful tools for the further exploration of dynamin-dependent processes and the development of more specific dynamin inhibitors. PMID:24046449

  9. Murine Joubert syndrome reveals Hedgehog signaling defects as a potential therapeutic target for nephronophthisis

    PubMed Central

    Hynes, Ann Marie; Giles, Rachel H.; Srivastava, Shalabh; Eley, Lorraine; Whitehead, Jennifer; Danilenko, Marina; Raman, Shreya; Slaats, Gisela G.; Colville, John G.; Ajzenberg, Henry; Kroes, Hester Y.; Thelwall, Peter E.; Simmons, Nicholas L.; Miles, Colin G.; Sayer, John A.

    2014-01-01

    Nephronophthisis (NPHP) is the major cause of pediatric renal failure, yet the disease remains poorly understood, partly due to the lack of appropriate animal models. Joubert syndrome (JBTS) is an inherited ciliopathy giving rise to NPHP with cerebellar vermis aplasia and retinal degeneration. Among patients with JBTS and a cerebello-oculo-renal phenotype, mutations in CEP290 (NPHP6) are the most common genetic lesion. We present a Cep290 gene trap mouse model of JBTS that displays the kidney, eye, and brain abnormalities that define the syndrome. Mutant mice present with cystic kidney disease as neonates. Newborn kidneys contain normal amounts of lymphoid enhancer-binding factor 1 (Lef1) and transcription factor 1 (Tcf1) protein, indicating normal function of the Wnt signaling pathway; however, an increase in the protein Gli3 repressor reveals abnormal Hedgehog (Hh) signaling evident in newborn kidneys. Collecting duct cells from mutant mice have abnormal primary cilia and are unable to form spheroid structures in vitro. Treatment of mutant cells with the Hh agonist purmorphamine restored normal spheroid formation. Renal epithelial cells from a JBTS patient with CEP290 mutations showed similar impairments to spheroid formation that could also be partially rescued by exogenous stimulation of Hh signaling. These data implicate abnormal Hh signaling as the cause of NPHP and suggest that Hh agonists may be exploited therapeutically. PMID:24946806

  10. Chromatin states reveal functional associations for globally defined transcription start sites in four human cell lines

    PubMed Central

    2014-01-01

    Background Deciphering the most common modes by which chromatin regulates transcription, and how this is related to cellular status and processes is an important task for improving our understanding of human cellular biology. The FANTOM5 and ENCODE projects represent two independent large scale efforts to map regulatory and transcriptional features to the human genome. Here we investigate chromatin features around a comprehensive set of transcription start sites in four cell lines by integrating data from these two projects. Results Transcription start sites can be distinguished by chromatin states defined by specific combinations of both chromatin mark enrichment and the profile shapes of these chromatin marks. The observed patterns can be associated with cellular functions and processes, and they also show association with expression level, location relative to nearby genes, and CpG content. In particular we find a substantial number of repressed inter- and intra-genic transcription start sites enriched for active chromatin marks and Pol II, and these sites are strongly associated with immediate-early response processes and cell signaling. Associations between start sites with similar chromatin patterns are validated by significant correlations in their global expression profiles. Conclusions The results confirm the link between chromatin state and cellular function for expressed transcripts, and also indicate that active chromatin states at repressed transcripts may poise transcripts for rapid activation during immune response. PMID:24669905

  11. Identification of several potential chromatin binding sites of HOXB7 and its downstream target genes in breast cancer

    PubMed Central

    Heinonen, Henna; Lepikhova, Tatiana; Sahu, Biswajyoti; Pehkonen, Henna; Pihlajamaa, Päivi; Louhimo, Riku; Gao, Ping; Wei, Gong‐Hong; Hautaniemi, Sampsa; Jänne, Olli A.

    2015-01-01

    HOXB7 encodes a transcription factor that is overexpressed in a number of cancers and encompasses many oncogenic functions. Previous results have shown it to promote cell proliferation, angiogenesis, epithelial–mesenchymal transition, DNA repair and cell survival. Because of its role in many cancers and tumorigenic processes, HOXB7 has been suggested to be a potential drug target. However, HOXB7 binding sites on chromatin and its targets are poorly known. The aim of our study was to identify HOXB7 binding sites on breast cancer cell chromatin and to delineate direct target genes located nearby these binding sites. We found 1,504 HOXB7 chromatin binding sites in BT‐474 breast cancer cell line that overexpresses HOXB7. Seventeen selected binding sites were validated by ChIP‐qPCR in several breast cancer cell lines. Furthermore, we analyzed expression of a large number of genes located nearby HOXB7 binding sites and found several new direct targets, such as CTNND2 and SCGB1D2. Identification of HOXB7 chromatin binding sites and target genes is essential to understand better the role of HOXB7 in breast cancer and mechanisms by which it regulates tumorigenic processes. PMID:26014856

  12. Functional malignant cell heterogeneity in pancreatic neuroendocrine tumors revealed by targeting of PDGF-DD

    PubMed Central

    Cortez, Eliane; Gladh, Hanna; Braun, Sebastian; Bocci, Matteo; Cordero, Eugenia; Björkström, Niklas K.; Miyazaki, Hideki; Michael, Iacovos P.; Eriksson, Ulf; Folestad, Erika; Pietras, Kristian

    2016-01-01

    Intratumoral heterogeneity is an inherent feature of most human cancers and has profound implications for cancer therapy. As a result, there is an emergent need to explore previously unmapped mechanisms regulating distinct subpopulations of tumor cells and to understand their contribution to tumor progression and treatment response. Aberrant platelet-derived growth factor receptor beta (PDGFRβ) signaling in cancer has motivated the development of several antagonists currently in clinical use, including imatinib, sunitinib, and sorafenib. The discovery of a novel ligand for PDGFRβ, platelet-derived growth factor (PDGF)-DD, opened the possibility of a previously unidentified signaling pathway involved in tumor development. However, the precise function of PDGF-DD in tumor growth and invasion remains elusive. Here, making use of a newly generated Pdgfd knockout mouse, we reveal a functionally important malignant cell heterogeneity modulated by PDGF-DD signaling in pancreatic neuroendocrine tumors (PanNET). Our analyses demonstrate that tumor growth was delayed in the absence of signaling by PDGF-DD. Surprisingly, ablation of PDGF-DD did not affect the vasculature or stroma of PanNET; instead, we found that PDGF-DD stimulated bulk tumor cell proliferation by induction of paracrine mitogenic signaling between heterogeneous malignant cell clones, some of which expressed PDGFRβ. The presence of a subclonal population of tumor cells characterized by PDGFRβ expression was further validated in a cohort of human PanNET. In conclusion, we demonstrate a previously unrecognized heterogeneity in PanNET characterized by signaling through the PDGF-DD/PDGFRβ axis. PMID:26831065

  13. Optimized deep-targeted proteotranscriptomic profiling reveals unexplored Conus toxin diversity and novel cysteine frameworks

    PubMed Central

    Lavergne, Vincent; Harliwong, Ivon; Jones, Alun; Miller, David; Taft, Ryan J.; Alewood, Paul F.

    2015-01-01

    Cone snails are predatory marine gastropods characterized by a sophisticated venom apparatus responsible for the biosynthesis and delivery of complex mixtures of cysteine-rich toxin peptides. These conotoxins fold into small highly structured frameworks, allowing them to potently and selectively interact with heterologous ion channels and receptors. Approximately 2,000 toxins from an estimated number of >70,000 bioactive peptides have been identified in the genus Conus to date. Here, we describe a high-resolution interrogation of the transcriptomes (available at www.ddbj.nig.ac.jp) and proteomes of the diverse compartments of the Conus episcopatus venom apparatus. Using biochemical and bioinformatic tools, we found the highest number of conopeptides yet discovered in a single Conus specimen, with 3,305 novel precursor toxin sequences classified into 9 known superfamilies (A, I1, I2, M, O1, O2, S, T, Z), and identified 16 new superfamilies showing unique signal peptide signatures. We were also able to depict the largest population of venom peptides containing the pharmacologically active C-C-CC-C-C inhibitor cystine knot and CC-C-C motifs (168 and 44 toxins, respectively), as well as 208 new conotoxins displaying odd numbers of cysteine residues derived from known conotoxin motifs. Importantly, six novel cysteine-rich frameworks were revealed which may have novel pharmacology. Finally, analyses of codon usage bias and RNA-editing processes of the conotoxin transcripts demonstrate a specific conservation of the cysteine skeleton at the nucleic acid level and provide new insights about the origin of sequence hypervariablity in mature toxin regions. PMID:26150494

  14. Targeted next-generation sequencing of candidate genes reveals novel mutations in patients with dilated cardiomyopathy

    PubMed Central

    ZHAO, YUE; FENG, YUE; ZHANG, YUN-MEI; DING, XIAO-XUE; SONG, YU-ZHU; ZHANG, A-MEI; LIU, LI; ZHANG, HONG; DING, JIA-HUAN; XIA, XUE-SHAN

    2015-01-01

    Dilated cardiomyopathy (DCM) is a major cause of sudden cardiac death and heart failure, and it is characterized by genetic and clinical heterogeneity, even for some patients with a very poor clinical prognosis; in the majority of cases, DCM necessitates a heart transplant. Genetic mutations have long been considered to be associated with this disease. At present, mutations in over 50 genes related to DCM have been documented. This study was carried out to elucidate the characteristics of gene mutations in patients with DCM. The candidate genes that may cause DCM include MYBPC3, MYH6, MYH7, LMNA, TNNT2, TNNI3, MYPN, MYL3, TPM1, SCN5A, DES, ACTC1 and RBM20. Using next-generation sequencing (NGS) and subsequent mutation confirmation with traditional capillary Sanger sequencing analysis, possible causative non-synonymous mutations were identified in ~57% (12/21) of patients with DCM. As a result, 7 novel mutations (MYPN, p.E630K; TNNT2, p.G180A; MYH6, p.R1047C; TNNC1, p.D3V; DES, p.R386H; MYBPC3, p.C1124F; and MYL3, p.D126G), 3 variants of uncertain significance (RBM20, p.R1182H; MYH6, p.T1253M; and VCL, p.M209L), and 2 known mutations (MYH7, p.A26V and MYBPC3, p.R160W) were revealed to be associated with DCM. The mutations were most frequently found in the sarcomere (MYH6, MYBPC3, MYH7, TNNC1, TNNT2 and MYL3) and cytoskeletal (MYPN, DES and VCL) genes. As genetic testing is a useful tool in the clinical management of disease, testing for pathogenic mutations is beneficial to the treatment of patients with DCM and may assist in predicting disease risk for their family members before the onset of symptoms. PMID:26458567

  15. Archaeology. Sedimentary DNA from a submerged site reveals wheat in the British Isles 8000 years ago.

    PubMed

    Smith, Oliver; Momber, Garry; Bates, Richard; Garwood, Paul; Fitch, Simon; Pallen, Mark; Gaffney, Vincent; Allaby, Robin G

    2015-02-27

    The Mesolithic-to-Neolithic transition marked the time when a hunter-gatherer economy gave way to agriculture, coinciding with rising sea levels. Bouldnor Cliff, is a submarine archaeological site off the Isle of Wight in the United Kingdom that has a well-preserved Mesolithic paleosol dated to 8000 years before the present. We analyzed a core obtained from sealed sediments, combining evidence from microgeomorphology and microfossils with sedimentary ancient DNA (sedaDNA) analyses to reconstruct floral and faunal changes during the occupation of this site, before it was submerged. In agreement with palynological analyses, the sedaDNA sequences suggest a mixed habitat of oak forest and herbaceous plants. However, they also provide evidence of wheat 2000 years earlier than mainland Britain and 400 years earlier than proximate European sites. These results suggest that sophisticated social networks linked the Neolithic front in southern Europe to the Mesolithic peoples of northern Europe. PMID:25722413

  16. Active-site mobility revealed by the crystal structure of arylmalonate decarboxylase from Bordetella bronchiseptica.

    PubMed

    Kuettner, E Bartholomeus; Keim, Antje; Kircher, Markus; Rosmus, Susann; Sträter, Norbert

    2008-03-21

    Arylmalonate decarboxylase (AMDase) from Bordetella bronchiseptica catalyzes the enantioselective decarboxylation of arylmethylmalonates without the need for an organic cofactor or metal ion. The decarboxylation reaction is of interest for the synthesis of fine chemicals. As basis for an analysis of the catalytic mechanism of AMDase and for a rational enzyme design, we determined the X-ray structure of the enzyme up to 1.9 A resolution. Like the distantly related aspartate or glutamate racemases, AMDase has an aspartate transcarbamoylase fold consisting of two alpha/beta domains related by a pseudo dyad. However, the domain orientation of AMDase differs by about 30 degrees from that of the glutamate racemases, and also significant differences in active-site structures are observed. In the crystals, four independent subunits showing different conformations of active-site loops are present. This finding is likely to reflect the active-site mobility necessary for catalytic activity. PMID:18258259

  17. Proteome-wide Light/Dark Modulation of Thiol Oxidation in Cyanobacteria Revealed by Quantitative Site-specific Redox Proteomics*

    PubMed Central

    Guo, Jia; Nguyen, Amelia Y.; Dai, Ziyu; Su, Dian; Gaffrey, Matthew J.; Moore, Ronald J.; Jacobs, Jon M.; Monroe, Matthew E.; Smith, Richard D.; Koppenaal, David W.; Pakrasi, Himadri B.; Qian, Wei-Jun

    2014-01-01

    Reversible protein thiol oxidation is an essential regulatory mechanism of photosynthesis, metabolism, and gene expression in photosynthetic organisms. Herein, we present proteome-wide quantitative and site-specific profiling of in vivo thiol oxidation modulated by light/dark in the cyanobacterium Synechocystis sp. PCC 6803, an oxygenic photosynthetic prokaryote, using a resin-assisted thiol enrichment approach. Our proteomic approach integrates resin-assisted enrichment with isobaric tandem mass tag labeling to enable site-specific and quantitative measurements of reversibly oxidized thiols. The redox dynamics of ∼2,100 Cys-sites from 1,060 proteins under light, dark, and 3-(3,4-dichlorophenyl)-1,1-dimethylurea (a photosystem II inhibitor) conditions were quantified. In addition to relative quantification, the stoichiometry or percentage of oxidation (reversibly oxidized/total thiols) for ∼1,350 Cys-sites was also quantified. The overall results revealed broad changes in thiol oxidation in many key biological processes, including photosynthetic electron transport, carbon fixation, and glycolysis. Moreover, the redox sensitivity along with the stoichiometric data enabled prediction of potential functional Cys-sites for proteins of interest. The functional significance of redox-sensitive Cys-sites in NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, peroxiredoxin (AhpC/TSA family protein Sll1621), and glucose 6-phosphate dehydrogenase was further confirmed with site-specific mutagenesis and biochemical studies. Together, our findings provide significant insights into the broad redox regulation of photosynthetic organisms. PMID:25118246

  18. Proteome-wide light/dark modulation of thiol oxidation in cyanobacteria revealed by quantitative site-specific redox proteomics.

    PubMed

    Guo, Jia; Nguyen, Amelia Y; Dai, Ziyu; Su, Dian; Gaffrey, Matthew J; Moore, Ronald J; Jacobs, Jon M; Monroe, Matthew E; Smith, Richard D; Koppenaal, David W; Pakrasi, Himadri B; Qian, Wei-Jun

    2014-12-01

    Reversible protein thiol oxidation is an essential regulatory mechanism of photosynthesis, metabolism, and gene expression in photosynthetic organisms. Herein, we present proteome-wide quantitative and site-specific profiling of in vivo thiol oxidation modulated by light/dark in the cyanobacterium Synechocystis sp. PCC 6803, an oxygenic photosynthetic prokaryote, using a resin-assisted thiol enrichment approach. Our proteomic approach integrates resin-assisted enrichment with isobaric tandem mass tag labeling to enable site-specific and quantitative measurements of reversibly oxidized thiols. The redox dynamics of ∼2,100 Cys-sites from 1,060 proteins under light, dark, and 3-(3,4-dichlorophenyl)-1,1-dimethylurea (a photosystem II inhibitor) conditions were quantified. In addition to relative quantification, the stoichiometry or percentage of oxidation (reversibly oxidized/total thiols) for ∼1,350 Cys-sites was also quantified. The overall results revealed broad changes in thiol oxidation in many key biological processes, including photosynthetic electron transport, carbon fixation, and glycolysis. Moreover, the redox sensitivity along with the stoichiometric data enabled prediction of potential functional Cys-sites for proteins of interest. The functional significance of redox-sensitive Cys-sites in NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, peroxiredoxin (AhpC/TSA family protein Sll1621), and glucose 6-phosphate dehydrogenase was further confirmed with site-specific mutagenesis and biochemical studies. Together, our findings provide significant insights into the broad redox regulation of photosynthetic organisms. PMID:25118246

  19. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP

    NASA Astrophysics Data System (ADS)

    Czulak, J.; Guerreiro, A.; Metran, K.; Canfarotta, F.; Goddard, A.; Cowan, R. H.; Trochimczuk, A. W.; Piletsky, S.

    2016-05-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates.Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike

  20. A Binding Site on IL-17A for Inhibitory Macrocycles Revealed by Hydrogen/Deuterium Exchange Mass Spectrometry.

    PubMed

    Espada, Alfonso; Broughton, Howard; Jones, Spencer; Chalmers, Michael J; Dodge, Jeffrey A

    2016-03-10

    Computational assessment of the IL-17A structure identified two distinct binding pockets, the β-hairpin pocket and the α-helix pocket. The β-hairpin pocket was hypothesized to be the site of binding for peptide macrocycles. Support for this hypothesis was obtained using HDX-MS which revealed protection to exchange only within the β-hairpin pocket. This data represents the first direct structural evidence of a small molecule binding site on IL-17A that functions to disrupt the interaction with its receptor. PMID:26854023

  1. A caspase active site probe reveals high fractional inhibition needed to block DNA fragmentation.

    PubMed

    Méthot, Nathalie; Vaillancourt, John P; Huang, JingQi; Colucci, John; Han, Yongxin; Ménard, Stéphane; Zamboni, Robert; Toulmond, Sylvie; Nicholson, Donald W; Roy, Sophie

    2004-07-01

    Apoptotic markers consist of either caspase substrate cleavage products or phenotypic changes that manifest themselves as a consequence of caspase-mediated substrate cleavage. We have shown recently that pharmacological inhibitors of caspase activity prevent the appearance of two such apoptotic manifestations, alphaII-spectrin cleavage and DNA fragmentation, but that blockade of the latter required a significantly higher concentration of inhibitor. We investigated this phenomenon through the use of a novel radiolabeled caspase inhibitor, [(125)I]M808, which acts as a caspase active site probe. [(125)I]M808 bound to active caspases irreversibly and with high sensitivity in apoptotic cell extracts, in tissue extracts from several commonly used animal models of cellular injury, and in living cells. Moreover, [(125)I]M808 detected active caspases in septic mice when injected intravenously. Using this caspase probe, an active site occupancy assay was developed and used to measure the fractional inhibition required to block apoptosis-induced DNA fragmentation. In thymocytes, occupancy of up to 40% of caspase active sites had no effect on DNA fragmentation, whereas inhibition of half of the DNA cleaving activity required between 65 and 75% of active site occupancy. These results suggest that a high and persistent fractional inhibition will be required for successful caspase inhibition-based therapies. PMID:15067000

  2. The Asian Monsoon Moisture Transportation Revealed by Two Cave Sites in Myanmar

    NASA Astrophysics Data System (ADS)

    Liu, G.; Wang, X.; Chiang, H. W.; Maung Maung, P.; Jiang, X.; Aung, L. T.; Tun, S. T.

    2014-12-01

    Here we present two well-resolved, calcite δ18O records on Myanmar speleothems. The samples were collected from a coastal site in southeastern Myanmar and a plateau site in central Myanmar, respectively. Chronologically determined by high-precision U/Th dating techniques, both records span a large portion of the past 40,000 years. The two records show similar millennial-scale oscillations during the last glacial period, which are also in-phase with the speleothem records from Chinese cave sites located in the downstream of Indian Monsoon trajectories. The δ18O values between the two profiles are virtually the same, ~ -7.5‰, during late Holocene, in concert with the numbers in modern rainfall at the two sites. However, in glacial time, the δ18O value of the central Myanmar record shifts from -6.5‰ to -8‰, approximately 2‰ lower than that in the coastal dataset, which varies from -4.5‰ to -6‰. We interpret the similarly low δ18O values during Holocene in both records as a result of strong monsoonal rainfall and water recycling particularly through forest transpiration. However in glacial time, with a possibly drier and less forested land, water recycling is weaker. Therefore, rainfall δ18O and subsequently speleothem δ18O appear a stronger geographical gradient, possibly dominated by the continental rainout effect. Our interpretation can be supported by the speleothem δ13C records from the two sites. Calcite δ13C from the coastal site varies slightly from ~-7‰ in the last glacial to ~-9‰ in Holocene. Whereas it shares a similar value to the coastal record during Holocene, the δ13C profile from the plateau site shows a much higher value, up to -0.7‰, during the glacial time. This suggests that the mountainous region in central Myanmar was likely dominated by C4 plants (e.g., grass) during the glacial time, while the same region is covered by forests today. Such change on vegetation type and coverage may influence the δ18O of recycling

  3. A novel molecular mechanism involved in multiple myeloma development revealed by targeting MafB to haematopoietic progenitors

    PubMed Central

    Vicente-Dueñas, Carolina; Romero-Camarero, Isabel; González-Herrero, Inés; Alonso-Escudero, Esther; Abollo-Jiménez, Fernando; Jiang, Xiaoyu; Gutierrez, Norma C; Orfao, Alberto; Marín, Nieves; Villar, Luisa María; Criado, Ma Carmen Fernández; Pintado, Belén; Flores, Teresa; Alonso-López, Diego; De Las Rivas, Javier; Jiménez, Rafael; Criado, Francisco Javier García; Cenador, María Begoña García; Lossos, Izidore S; Cobaleda, César; Sánchez-García, Isidro

    2012-01-01

    Understanding the cellular origin of cancer can help to improve disease prevention and therapeutics. Human plasma cell neoplasias are thought to develop from either differentiated B cells or plasma cells. However, when the expression of Maf oncogenes (associated to human plasma cell neoplasias) is targeted to mouse B cells, the resulting animals fail to reproduce the human disease. Here, to explore early cellular changes that might take place in the development of plasma cell neoplasias, we engineered transgenic mice to express MafB in haematopoietic stem/progenitor cells (HS/PCs). Unexpectedly, we show that plasma cell neoplasias arise in the MafB-transgenic mice. Beyond their clinical resemblance to human disease, these neoplasias highly express genes that are known to be upregulated in human multiple myeloma. Moreover, gene expression profiling revealed that MafB-expressing HS/PCs were more similar to B cells and tumour plasma cells than to any other subset, including wild-type HS/PCs. Consistent with this, genome-scale DNA methylation profiling revealed that MafB imposes an epigenetic program in HS/PCs, and that this program is preserved in mature B cells of MafB-transgenic mice, demonstrating a novel molecular mechanism involved in tumour initiation. Our findings suggest that, mechanistically, the haematopoietic progenitor population can be the target for transformation in MafB-associated plasma cell neoplasias. PMID:22903061

  4. Fitness Cost Implications of PhiC31-Mediated Site-Specific Integrations in Target-Site Strains of the Mexican Fruit Fly, Anastrepha ludens (Diptera: Tephritidae)

    PubMed Central

    Meza, José S.; Díaz-Fleischer, Francisco; Sánchez-Velásquez, Lázaro R.; Zepeda-Cisneros, Cristina Silvia; Handler, Alfred M.; Schetelig, Marc F.

    2014-01-01

    Site-specific recombination technologies are powerful new tools for the manipulation of genomic DNA in insects that can improve transgenesis strategies such as targeting transgene insertions, allowing transgene cassette exchange and DNA mobilization for transgene stabilization. However, understanding the fitness cost implications of these manipulations for transgenic strain applications is critical. In this study independent piggyBac-mediated attP target-sites marked with DsRed were created in several genomic positions in the Mexican fruit fly, Anastrepha ludens. Two of these strains, one having an autosomal (attP_F7) and the other a Y-linked (attP_2-M6y) integration, exhibited fitness parameters (dynamic demography and sexual competitiveness) similar to wild type flies. These strains were thus selected for targeted insertion using, for the first time in mexfly, the phiC31-integrase recombination system to insert an additional EGFP-marked transgene to determine its effect on host strain fitness. Fitness tests showed that the integration event in the int_2-M6y recombinant strain had no significant effect, while the int_F7 recombinant strain exhibited significantly lower fitness relative to the original attP_F7 target-site host strain. These results indicate that while targeted transgene integrations can be achieved without an additional fitness cost, at some genomic positions insertion of additional DNA into a previously integrated transgene can have a significant negative effect. Thus, for targeted transgene insertions fitness costs must be evaluated both previous to and subsequent to new site-specific insertions in the target-site strain. PMID:25303238

  5. Structure of Insoluble Rat Sperm Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) via Heterotetramer Formation with Escherichia coli GAPDH Reveals Target for Contraceptive Design*

    PubMed Central

    Frayne, Jan; Taylor, Abby; Cameron, Gus; Hadfield, Andrea T.

    2009-01-01

    Sperm glyceraldehyde-3-phosphate dehydrogenase has been shown to be a successful target for a non-hormonal contraceptive approach, but the agents tested to date have had unacceptable side effects. Obtaining the structure of the sperm-specific isoform to allow rational inhibitor design has therefore been a goal for a number of years but has proved intractable because of the insoluble nature of both native and recombinant protein. We have obtained soluble recombinant sperm glyceraldehyde-3-phosphate dehydrogenase as a heterotetramer with the Escherichia coli glyceraldehyde-3-phosphate dehydrogenase in a ratio of 1:3 and have solved the structure of the heterotetramer which we believe represents a novel strategy for structure determination of an insoluble protein. A structure was also obtained where glyceraldehyde 3-phosphate binds in the Ps pocket in the active site of the sperm enzyme subunit in the presence of NAD. Modeling and comparison of the structures of human somatic and sperm-specific glyceraldehyde-3-phosphate dehydrogenase revealed few differences at the active site and hence rebut the long presumed structural specificity of 3-chlorolactaldehyde for the sperm isoform. The contraceptive activity of α-chlorohydrin and its apparent specificity for the sperm isoform in vivo are likely to be due to differences in metabolism to 3-chlorolactaldehyde in spermatozoa and somatic cells. However, further detailed analysis of the sperm glyceraldehyde-3-phosphate dehydrogenase structure revealed sites in the enzyme that do show significant difference compared with published somatic glyceraldehyde-3-phosphate dehydrogenase structures that could be exploited by structure-based drug design to identify leads for novel male contraceptives. PMID:19542219

  6. RNA Seq profiling reveals a novel expression pattern of TGF-β target genes in human blood eosinophils.

    PubMed

    Shen, Zhong-Jian; Hu, Jie; Esnault, Stephane; Dozmorov, Igor; Malter, James S

    2015-09-01

    Despite major advances in our understanding of TGF-β signaling in multiple cell types, little is known about the direct target genes of this pathway in human eosinophils. These cells constitute the major inflammatory component present in the sputum and lung of active asthmatics and their numbers correlate well with disease severity. During the transition from acute to chronic asthma, TGF-β levels rise several fold in the lung which drives fibroblasts to produce extracellular matrix (ECM) and participate in airway and parenchymal remodeling. In this report, we use purified blood eosinophils from healthy donors and analyze baseline and TGF-β responsive genes by RNA Seq, and demonstrate that eosinophils (PBE) express 7981 protein-coding genes of which 178 genes are up-regulated and 199 genes are down-regulated by TGF-β. While 18 target genes have been previously associated with asthma and eosinophilic disorders, the vast majority have been implicated in cell death and survival, differentiation, and cellular function. Ingenuity pathway analysis revealed that 126 canonical pathways are activated by TGF-β including iNOS, TREM1, p53, IL-8 and IL-10 signaling. As TGF-β is an important cytokine for eosinophil function and survival, and pulmonary inflammation and fibrosis, our results represent a significant step toward the identification of novel TGF-β responsive genes and provide a potential therapeutic opportunity by selectively targeting relevant genes and pathways. PMID:26112417

  7. Target genes of Dpp/BMP signaling pathway revealed by transcriptome profiling in the early D.melanogaster embryo.

    PubMed

    Dominguez, Calixto; Zuñiga, Alejandro; Hanna, Patricia; Hodar, Christian; Gonzalez, Mauricio; Cambiazo, Verónica

    2016-10-10

    In the early Drosophila melanogaster embryo, the gene regulatory network controlled by Dpp signaling is involved in the subdivision of dorsal ectoderm into the presumptive dorsal epidermis and amnioserosa. In this work, we aimed to identify new Dpp downstream targets involved in dorsal ectoderm patterning. We used oligonucleotide D. melanogaster microarrays to identify the set of genes that are differential expressed between wild type embryos and embryos that overexpress Dpp (nos-Gal4>UAS-dpp) during early stages of embryo development. By using this approach, we identified 358 genes whose relative abundance significantly increased in response to Dpp overexpression. Among them, we found the entire set of known Dpp target genes that function in dorsal ectoderm patterning (zen, doc, hnt, pnr, ush, tup, and others) in addition to several up-regulated genes of unknown functions. Spatial expression pattern of up-regulated genes in response to Dpp overexpression as well as their opposing transcriptional responses to Dpp loss- and gain-of-function indicated that they are new candidate target genes of Dpp signaling pathway. We further analyse one of the candidate genes, CG13653, which is expressed at the dorsal-most cells of the embryo during a restricted period of time. CG13653 orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa. We characterized the enhancer region of CG13653 and revealed that CG13653 is directly regulated by Dpp signaling pathway. PMID:27397649

  8. Transgenic banana plants expressing Xanthomonas wilt resistance genes revealed a stable non-target bacterial colonization structure.

    PubMed

    Nimusiima, Jean; Köberl, Martina; Tumuhairwe, John Baptist; Kubiriba, Jerome; Staver, Charles; Berg, Gabriele

    2015-01-01

    Africa is among the continents where the battle over genetically modified crops is currently being played out. The impact of GM in Africa could potentially be very positive. In Uganda, researchers have developed transgenic banana lines resistant to banana Xanthomonas wilt. The transgenic lines expressing hrap and pflp can provide a timely solution to the pandemic. However, the impact of the transgenes expression on non-target microorganisms has not yet been investigated. To study this effect, transgenic and control lines were grown under field conditions and their associated microbiome was investigated by 16S rRNA gene profiling combining amplicon sequencing and molecular fingerprinting. Three years after sucker planting, no statistically significant differences between transgenic lines and their non-modified predecessors were detected for their associated bacterial communities. The overall gammaproteobacterial rhizosphere microbiome was highly dominated by Xanthomonadales, while Pseudomonadales and Enterobacteriales were accumulated in the pseudostem. Shannon indices revealed much higher diversity in the rhizosphere than in the pseudostem endosphere. However, the expression of the transgenes did not result in changes in the diversity of Gammaproteobacteria, the closest relatives of the target pathogen. In this field experiment, the expression of the resistance genes appears to have no consequences for non-target rhizobacteria and endophytes. PMID:26657016

  9. Transgenic banana plants expressing Xanthomonas wilt resistance genes revealed a stable non-target bacterial colonization structure

    PubMed Central

    Nimusiima, Jean; Köberl, Martina; Tumuhairwe, John Baptist; Kubiriba, Jerome; Staver, Charles; Berg, Gabriele

    2015-01-01

    Africa is among the continents where the battle over genetically modified crops is currently being played out. The impact of GM in Africa could potentially be very positive. In Uganda, researchers have developed transgenic banana lines resistant to banana Xanthomonas wilt. The transgenic lines expressing hrap and pflp can provide a timely solution to the pandemic. However, the impact of the transgenes expression on non-target microorganisms has not yet been investigated. To study this effect, transgenic and control lines were grown under field conditions and their associated microbiome was investigated by 16S rRNA gene profiling combining amplicon sequencing and molecular fingerprinting. Three years after sucker planting, no statistically significant differences between transgenic lines and their non-modified predecessors were detected for their associated bacterial communities. The overall gammaproteobacterial rhizosphere microbiome was highly dominated by Xanthomonadales, while Pseudomonadales and Enterobacteriales were accumulated in the pseudostem. Shannon indices revealed much higher diversity in the rhizosphere than in the pseudostem endosphere. However, the expression of the transgenes did not result in changes in the diversity of Gammaproteobacteria, the closest relatives of the target pathogen. In this field experiment, the expression of the resistance genes appears to have no consequences for non-target rhizobacteria and endophytes. PMID:26657016

  10. Site-directed gene mutation at mixed sequence targets by psoralen-conjugated pseudo-complementary peptide nucleic acids.

    PubMed

    Kim, Ki-Hyun; Nielsen, Peter E; Glazer, Peter M

    2007-01-01

    Sequence-specific DNA-binding molecules such as triple helix-forming oligonucleotides (TFOs) provide a means for inducing site-specific mutagenesis and recombination at chromosomal sites in mammalian cells. However, the utility of TFOs is limited by the requirement for homopurine stretches in the target duplex DNA. Here, we report the use of pseudo-complementary peptide nucleic acids (pcPNAs) for intracellular gene targeting at mixed sequence sites. Due to steric hindrance, pcPNAs are unable to form pcPNA-pcPNA duplexes but can bind to complementary DNA sequences by Watson-Crick pairing via double duplex-invasion complex formation. We show that psoralen-conjugated pcPNAs can deliver site-specific photoadducts and mediate targeted gene modification within both episomal and chromosomal DNA in mammalian cells without detectable off-target effects. Most of the induced psoralen-pcPNA mutations were single-base substitutions and deletions at the predicted pcPNA-binding sites. The pcPNA-directed mutagenesis was found to be dependent on PNA concentration and UVA dose and required matched pairs of pcPNAs. Neither of the individual pcPNAs alone had any effect nor did complementary PNA pairs of the same sequence. These results identify pcPNAs as new tools for site-specific gene modification in mammalian cells without purine sequence restriction, thereby providing a general strategy for designing gene targeting molecules. PMID:17977869

  11. Human Monoclonal Islet Cell Antibodies From a Patient with Insulin- Dependent Diabetes Mellitus Reveal Glutamate Decarboxylase as the Target Antigen

    NASA Astrophysics Data System (ADS)

    Richter, Wiltrud; Endl, Josef; Eiermann, Thomas H.; Brandt, Michael; Kientsch-Engel, Rosemarie; Thivolet, Charles; Jungfer, Herbert; Scherbaum, Werner A.

    1992-09-01

    The autoimmune phenomena associated with destruction of the β cell in pancreatic islets and development of type 1 (insulin-dependent) diabetes mellitus (IDDM) include circulating islet cell antibodies. We have immortalized peripheral blood lymphocytes from prediabetic individuals and patients with newly diagnosed IDDM by Epstein-Barr virus transformation. IgG-positive cells were selected by anti-human IgG-coupled magnetic beads and expanded in cell culture. Supernatants were screened for cytoplasmic islet cell antibodies using the conventional indirect immunofluorescence test on cryostat sections of human pancreas. Six islet cell-specific B-cell lines, originating from a patient with newly diagnosed IDDM, could be stabilized on a monoclonal level. All six monoclonal islet cell antibodies (MICA 1-6) were of the IgG class. None of the MICA reacted with human thyroid, adrenal gland, anterior pituitary, liver, lung, stomach, and intestine tissues but all six reacted with pancreatic islets of different mammalian species and, in addition, with neurons of rat cerebellar cortex. MICA 1-6 were shown to recognize four distinct antigenic epitopes in islets. Islet cell antibody-positive diabetic sera but not normal human sera blocked the binding of the monoclonal antibodies to their target epitopes. Immunoprecipitation of 35S-labeled human islet cell extracts revealed that a protein of identical size to the enzyme glutamate decarboxylase (EC 4.1.1.15) was a target of all MICA. Furthermore, antigen immunotrapped by the MICA from brain homogenates showed glutamate decarboxylase enzyme activity. MICA 1-6 therefore reveal glutamate decarboxylase as the predominant target antigen of cytoplasmic islet cell autoantibodies in a patient with newly diagnosed IDDM.

  12. Formation of target-specific binding sites in enzymes: solid-phase molecular imprinting of HRP.

    PubMed

    Czulak, J; Guerreiro, A; Metran, K; Canfarotta, F; Goddard, A; Cowan, R H; Trochimczuk, A W; Piletsky, S

    2016-06-01

    Here we introduce a new concept for synthesising molecularly imprinted nanoparticles by using proteins as macro-functional monomers. For a proof-of-concept, a model enzyme (HRP) was cross-linked using glutaraldehyde in the presence of glass beads (solid-phase) bearing immobilized templates such as vancomycin and ampicillin. The cross-linking process links together proteins and protein chains, which in the presence of templates leads to the formation of permanent target-specific recognition sites without adverse effects on the enzymatic activity. Unlike complex protein engineering approaches commonly employed to generate affinity proteins, the method proposed can be used to produce protein-based ligands in a short time period using native protein molecules. These affinity materials are potentially useful tools especially for assays since they combine the catalytic properties of enzymes (for signaling) and molecular recognition properties of antibodies. We demonstrate this concept in an ELISA-format assay where HRP imprinted with vancomycin and ampicillin replaced traditional enzyme-antibody conjugates for selective detection of templates at micromolar concentrations. This approach can potentially provide a fast alternative to raising antibodies for targets that do not require high assay sensitivities; it can also find uses as a biochemical research tool, as a possible replacement for immunoperoxidase-conjugates. PMID:27174700

  13. Hyaluronan microspheres for sustained gene delivery and site-specific targeting.

    PubMed

    Yun, Yang H; Goetz, Douglas J; Yellen, Paige; Chen, Weiliam

    2004-01-01

    Hyaluronan is a naturally occurring polymer that has enjoyed wide successes in biomedical and cosmetic applications as coatings, matrices, and hydrogels. For controlled delivery applications, formulating native hyaluronan into microspheres could be advantageous but has been difficult to process unless organic solvents are used or hyaluronan has been modified by etherification. Therefore, we present a novel method of preparing hyaluronan microspheres using adipic dihydrazide mediated crosslinking chemistry. To evaluate their potential for medical applications, hyaluronan microspheres are incorporated with DNA for gene delivery or conjugated with an antigen for cell-specific targeting. The results show that our method, originally developed for preparing hyaluronan hydrogels, generates robust microspheres with a size distribution of 5-20mum. The release of the encapsulated plasmid DNA can be sustained for months and is capable of transfection in vitro and in vivo. Hyaluronan microspheres, conjugated with monoclonal antibodies to E- and P-selectin, demonstrate selective binding to cells expressing these receptors. In conclusion, we have developed a novel microsphere preparation using native hyaluronan that delivers DNA at a controlled rate and adaptable for site-specific targeting. PMID:14580918

  14. Gene duplication in the major insecticide target site, Rdl, in Drosophila melanogaster.

    PubMed

    Remnant, Emily J; Good, Robert T; Schmidt, Joshua M; Lumb, Christopher; Robin, Charles; Daborn, Phillip J; Batterham, Philip

    2013-09-01

    The Resistance to Dieldrin gene, Rdl, encodes a GABA-gated chloride channel subunit that is targeted by cyclodiene and phenylpyrazole insecticides. The gene was first characterized in Drosophila melanogaster by genetic mapping of resistance to the cyclodiene dieldrin. The 4,000-fold resistance observed was due to a single amino acid replacement, Ala(301) to Ser. The equivalent change was subsequently identified in Rdl orthologs of a large range of resistant insect species. Here, we report identification of a duplication at the Rdl locus in D. melanogaster. The 113-kb duplication contains one WT copy of Rdl and a second copy with two point mutations: an Ala(301) to Ser resistance mutation and Met(360) to Ile replacement. Individuals with this duplication exhibit intermediate dieldrin resistance compared with single copy Ser(301) homozygotes, reduced temperature sensitivity, and altered RNA editing associated with the resistant allele. Ectopic recombination between Roo transposable elements is involved in generating this genomic rearrangement. The duplication phenotypes were confirmed by construction of a transgenic, artificial duplication integrating the 55.7-kb Rdl locus with a Ser(301) change into an Ala(301) background. Gene duplications can contribute significantly to the evolution of insecticide resistance, most commonly by increasing the amount of gene product produced. Here however, duplication of the Rdl target site creates permanent heterozygosity, providing unique potential for adaptive mutations to accrue in one copy, without abolishing the endogenous role of an essential gene. PMID:23959864

  15. The BET family of proteins targets Moloney Murine Leukemia Virus integration near transcription start sites

    PubMed Central

    De Rijck, Jan; de Kogel, Christine; Demeulemeester, Jonas; Vets, Sofie; Ashkar, Sara El; Malani, Nirav; Bushman, Frederic D; Landuyt, Bart; Husson, Steven J.; Busschots, Katrien; Gijsbers, Rik; Debyser, Zeger

    2014-01-01

    Summary A hallmark of retroviral replication is integration of the viral genome in the host cell DNA. This characteristic makes retrovirus-based vectors attractive delivery vehicles for gene therapy. However, adverse events in gene therapeutic trials, caused by activation of proto-oncogenes due to Murine Leukemia Virus (MLV)-derived vector integration, hamper their application. Here we show that bromodomain and extraterminal (BET) proteins (BRD2, BRD3 and BRD4) and MLV integrase specifically interact and co-localize within the nucleus of the cell. Inhibition of the BET proteins chromatin interaction via specific bromodomain inhibitors blocks MLV virus replication at the integration step. MLV integration site distribution parallels the chromatin binding profile of BET proteins, and expression of an artificial fusion protein of the BET integrase binding domain with the chromatin interaction domain of the lentiviral targeting factor LEDGF/p75, retargets MLV integration away from TSS and into the body of actively transcribed genes, conform to the Human Immunodeficiency Virus (HIV) integration pattern. Together these data validate BET proteins as MLV integration targeting factors. PMID:24183673

  16. Analysis of Usp DNA binding domain targeting reveals critical determinants of the ecdysone receptor complex interaction with the response element.

    PubMed

    Grad, I; Niedziela-Majka, A; Kochman, M; Ozyhar, A

    2001-07-01

    The steroid hormone, 20-hydroxyecdysone (20E), directs Drosophila metamorphosis via a heterodimeric receptor formed by two members of the nuclear hormone receptors superfamily, the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. Our previous study [Niedziela-Majka, A., Kochman, M., Ozyhar, A. (2000) Eur. J. Biochem. 267, 507-519] on EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) suggested that UspDBD may act as a specific anchor that preferentially binds the 5' half-site of the pseudo-palindromic response element from the hsp27 gene promoter and thus locates the heterocomplex in the defined orientation. Here, we analyzed in detail the determinants of the UspDBD interaction with the hsp27 element. The roles of individual amino acids in the putative DNA recognition alpha helix and the roles of the base pairs of the UspDBD target sequence have been probed by site-directed mutagenesis. The results show how the hsp27 element specifies UspDBD binding and thus the polar assembly of the UspDBD/EcRDBD heterocomplex. It is suggested how possible nucleotide deviations within the 5' half-site of the element may be used for the fine-tuning of the 20E-response element specificity and consequently the physiological response. PMID:11432742

  17. Zinc-induced oligomerization of zinc α2 glycoprotein reveals multiple fatty acid-binding sites.

    PubMed

    Zahid, Henna; Miah, Layeque; Lau, Andy M; Brochard, Lea; Hati, Debolina; Bui, Tam T T; Drake, Alex F; Gor, Jayesh; Perkins, Stephen J; McDermott, Lindsay C

    2016-01-01

    Zinc α2 glycoprotein (ZAG) is an adipokine with a class I MHC protein fold and is associated with obesity and diabetes. Although its intrinsic ligand remains unknown, ZAG binds the dansylated C11 fatty acid 11-(dansylamino)undecanoic acid (DAUDA) in the groove between the α1 and α2 domains. The surface of ZAG has approximately 15 weak zinc-binding sites deemed responsible for precipitation from human plasma. In the present study the functional significance of these metal sites was investigated. Analytical ultracentrifugation (AUC) and CD showed that zinc, but not other divalent metals, causes ZAG to oligomerize in solution. Thus ZAG dimers and trimers were observed in the presence of 1 and 2 mM zinc. Molecular modelling of X-ray scattering curves and sedimentation coefficients indicated a progressive stacking of ZAG monomers, suggesting that the ZAG groove may be occluded in these. Using fluorescence-detected sedimentation velocity, these ZAG-zinc oligomers were again observed in the presence of the fluorescent boron dipyrromethene fatty acid C16-BODIPY (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid). Fluorescence spectroscopy confirmed that ZAG binds C16-BODIPY. ZAG binding to C16-BODIPY, but not to DAUDA, was reduced by increased zinc concentrations. We conclude that the lipid-binding groove in ZAG contains at least two distinct fatty acid-binding sites for DAUDA and C16-BODIPY, similar to the multiple lipid binding seen in the structurally related immune protein CD1c. In addition, because high concentrations of zinc occur in the pancreas, the perturbation of these multiple lipid-binding sites by zinc may be significant in Type 2 diabetes where dysregulation of ZAG and zinc homoeostasis occurs. PMID:26487699

  18. Targeting the Akt1 allosteric site to identify novel scaffolds through virtual screening.

    PubMed

    Yilmaz, Oya Gursoy; Olmez, Elif Ozkirimli; Ulgen, Kutlu O

    2014-02-01

    Preclinical data and tumor specimen studies report that AKT kinases are related to many human cancers. Therefore, identification and development of small molecule inhibitors targeting AKT and its signaling pathway can be therapeutic in treatment of cancer. Numerous studies report inhibitors that target the ATP-binding pocket in the kinase domains, but the similarity of this site, within the kinase family makes selectivity a major problem. The sequence identity amongst PH domains is significantly lower than that in kinase domains and developing more selective inhibitors is possible if PH domain is targeted. This in silico screening study is the first time report toward the identification of potential allosteric inhibitors expected to bind the cavity between kinase and PH domains of Akt1. Structural information of Akt1 was used to develop structure-based pharmacophore models comprising hydrophobic, acceptor, donor and ring features. The 3D structural information of previously identified allosteric Akt inhibitors obtained from literature was employed to develop a ligand-based pharmacophore model. Database was generated with drug like subset of ZINC and screening was performed based on 3D similarity to the selected pharmacophore hypotheses. Binding modes and affinities of the ligands were predicted by Glide software. Top scoring hits were further analyzed considering 2D similarity between the compounds, interactions with Akt1, fitness to pharmacophore models, ADME, druglikeness criteria and Induced-Fit docking. Using virtual screening methodologies, derivatives of 3-methyl-xanthine, quinoline-4-carboxamide and 2-[4-(cyclohexa-1,3-dien-1-yl)-1H-pyrazol-3-yl]phenol were proposed as potential leads for allosteric inhibition of Akt1. PMID:24291487

  19. Molecular profiles of Quadriceps muscle in myostatin-null mice reveal PI3K and apoptotic pathways as myostatin targets

    PubMed Central

    Chelh, Ilham; Meunier, Bruno; Picard, Brigitte; Reecy, Mark James; Chevalier, Catherine; Hocquette, Jean-François; Cassar-Malek, Isabelle

    2009-01-01

    Background Myostatin (MSTN), a member of the TGF-β superfamily, has been identified as a negative regulator of skeletal muscle mass. Inactivating mutations in the MSTN gene are responsible for the development of a hypermuscular phenotype. In this study, we performed transcriptomic and proteomic analyses to detect altered expression/abundance of genes and proteins. These differentially expressed genes and proteins may represent new molecular targets of MSTN and could be involved in the regulation of skeletal muscle mass. Results Transcriptomic analysis of the Quadriceps muscles of 5-week-old MSTN-null mice (n = 4) and their controls (n = 4) was carried out using microarray (human and murine oligonucleotide sequences) of 6,473 genes expressed in muscle. Proteomic profiles were analysed using two-dimensional gel electrophoresis coupled with mass spectrometry. Comparison of the transcriptomic profiles revealed 192 up- and 245 down- regulated genes. Genes involved in the PI3K pathway, insulin/IGF pathway, carbohydrate metabolism and apoptosis regulation were up-regulated. Genes belonging to canonical Wnt, calcium signalling pathways and cytokine-receptor cytokine interaction were down-regulated. Comparison of the protein profiles revealed 20 up- and 18 down-regulated proteins spots. Knockout of the MSTN gene was associated with up-regulation of proteins involved in glycolytic shift of the muscles and down-regulation of proteins involved in oxidative energy metabolism. In addition, an increased abundance of survival/anti-apoptotic factors were observed. Conclusion All together, these results showed a differential expression of genes and proteins related to the muscle energy metabolism and cell survival/anti-apoptotic pathway (e.g. DJ-1, PINK1, 14-3-3ε protein, TCTP/GSK-3β). They revealed the PI3K and apoptotic pathways as MSTN targets and are in favour of a role of MSTN as a modulator of cell survival in vivo. PMID:19397818

  20. Decaleside: a new class of natural insecticide targeting tarsal gustatory sites

    NASA Astrophysics Data System (ADS)

    Rajashekar, Yallappa; Rao, Lingamallu J. M.; Shivanandappa, Thimmappa

    2012-10-01

    Natural sources for novel insecticide molecules hold promise in view of their eco-friendly nature, selectivity, and mammalian safety. Recent progress in understanding the biology of insect olfaction and taste offers new strategies for developing selective pest control agents. We have isolated two natural insecticidal molecules from edible roots of Decalepis hamiltonii named Decalesides I and II, which are novel trisaccharides, highly toxic to household insect pests and stored-product insects. We have experimentally shown that insecticidal activity requires contact with tarsi on the legs but is not toxic orally. The insecticidal activity of molecules is lost by hydrolysis, and various sugars modify toxic response, showing that the insecticidal activity is via gustatory sites on the tarsi. Selective toxicity to insects by virtue of their gustatory site of action and the mammalian safety of the new insecticides is inherent in their chemical structure with 1-4 or 1-1 α linkage that is easily hydrolyzed by digestive enzymes of mammals. Decalesides represent a new chemical class of natural insecticides with a unique mode of action targeting tarsal chemosensory/gustatory system of insects.

  1. Combinatorial targeting of ribbon–helix–helix artificial transcription factors to chimeric recognition sites

    PubMed Central

    Zampini, Massimiliano; Hayes, Finbarr

    2012-01-01

    Artificial transcription factors (ATFs) are potent synthetic biology tools for modulating endogenous gene expression and precision genome editing. The ribbon–helix–helix (RHH) superfamily of transcription factors are widespread in bacteria and archaea. The principal DNA binding determinant in this family comprises a two-stranded antiparallel β-sheet (ribbons) in which a pair of eight-residue motifs insert into the major groove. Here, we demonstrate that ribbons of divergent RHH proteins are compact and portable elements that can be grafted into a common α-helical scaffold producing active ATFs. Hybrid proteins cooperatively recognize DNA sites possessing core tetramer boxes whose functional spacing is dictated by interactions between the α-helical backbones. These interactions also promote combinatorial binding of chimeras with different transplanted ribbons, but identical backbones, to synthetic sites bearing cognate boxes for each protein either in vitro or in vivo. The composite assembly of interacting hybrid proteins offers potential advantages associated with combinatorial approaches to DNA recognition compared with ATFs that involve binding of a single protein. Moreover, the new class of RHH ATFs may be utilized to re-engineer transcriptional circuits, or may be enhanced with affinity tags, fluorescent moieties or other elements for targeted genome marking and manipulation in bacteria and archaea. PMID:22492712

  2. Identification of a new JNK inhibitor targeting the JNK-JIP interaction site

    PubMed Central

    Stebbins, John L.; De, Surya K.; Machleidt, Thomas; Becattini, Barbara; Vazquez, Jesus; Kuntzen, Christian; Chen, Li-Hsing; Cellitti, Jason F.; Riel-Mehan, Megan; Emdadi, Aras; Solinas, Giovanni; Karin, Michael; Pellecchia, Maurizio

    2008-01-01

    JNK is a stress-activated protein kinase that modulates pathways implicated in a variety of disease states. JNK-interacting protein-1 (JIP1) is a scaffolding protein that enhances JNK signaling by creating a proximity effect between JNK and upstream kinases. A minimal peptide region derived from JIP1 is able to inhibit JNK activity both in vitro and in cell. We report here a series of small molecules JIP1 mimics that function as substrate competitive inhibitors of JNK. One such compound, BI-78D3, dose-dependently inhibits the phosphorylation of JNK substrates both in vitro and in cell. In animal studies, BI-78D3 not only blocks JNK dependent Con A-induced liver damage but also restores insulin sensitivity in mouse models of type 2 diabetes. Our findings open the way for the development of protein kinase inhibitors targeting substrate specific docking sites, rather than the highly conserved ATP binding sites. In view of its favorable inhibition profile, selectivity, and ability to function in the cellular milieu and in vivo, BI-78D3 represents not only a JNK inhibitor, but also a promising stepping stone toward the development of an innovative class of therapeutics. PMID:18922779

  3. Site-Selective Passivation of Defects in NiO Solar Photocathodes by Targeted Atomic Deposition.

    PubMed

    Flynn, Cory J; McCullough, Shannon M; Oh, EunBi; Li, Lesheng; Mercado, Candy C; Farnum, Byron H; Li, Wentao; Donley, Carrie L; You, Wei; Nozik, Arthur J; McBride, James R; Meyer, Thomas J; Kanai, Yosuke; Cahoon, James F

    2016-02-01

    For nanomaterials, surface chemistry can dictate fundamental material properties, including charge-carrier lifetimes, doping levels, and electrical mobilities. In devices, surface defects are usually the key limiting factor for performance, particularly in solar-energy applications. Here, we develop a strategy to uniformly and selectively passivate defect sites in semiconductor nanomaterials using a vapor-phase process termed targeted atomic deposition (TAD). Because defects often consist of atomic vacancies and dangling bonds with heightened reactivity, we observe-for the widely used p-type cathode nickel oxide-that a volatile precursor such as trimethylaluminum can undergo a kinetically limited selective reaction with these sites. The TAD process eliminates all measurable defects in NiO, leading to a nearly 3-fold improvement in the performance of dye-sensitized solar cells. Our results suggest that TAD could be implemented with a range of vapor-phase precursors and be developed into a general strategy to passivate defects in zero-, one-, and two-dimensional nanomaterials. PMID:26821265

  4. Crystal structure of the GlnZ-DraG complex reveals a different form of PII-target interaction

    PubMed Central

    Rajendran, Chitra; Gerhardt, Edileusa C. M.; Bjelic, Sasa; Gasperina, Antonietta; Scarduelli, Marcelo; Pedrosa, Fábio O.; Chubatsu, Leda S.; Merrick, Mike; Souza, Emanuel M.; Winkler, Fritz K.; Huergo, Luciano F.; Li, Xiao-Dan

    2011-01-01

    Nitrogen metabolism in bacteria and archaea is regulated by a ubiquitous class of proteins belonging to the PIIfamily. PII proteins act as sensors of cellular nitrogen, carbon, and energy levels, and they control the activities of a wide range of target proteins by protein-protein interaction. The sensing mechanism relies on conformational changes induced by the binding of small molecules to PII and also by PII posttranslational modifications. In the diazotrophic bacterium Azospirillum brasilense, high levels of extracellular ammonium inactivate the nitrogenase regulatory enzyme DraG by relocalizing it from the cytoplasm to the cell membrane. Membrane localization of DraG occurs through the formation of a ternary complex in which the PII protein GlnZ interacts simultaneously with DraG and the ammonia channel AmtB. Here we describe the crystal structure of the GlnZ-DraG complex at 2.1 Å resolution, and confirm the physiological relevance of the structural data by site-directed mutagenesis. In contrast to other known PII complexes, the majority of contacts with the target protein do not involve the T-loop region of PII. Hence this structure identifies a different mode of PII interaction with a target protein and demonstrates the potential for PII proteins to interact simultaneously with two different targets. A structural model of the AmtB-GlnZ-DraG ternary complex is presented. The results explain how the intracellular levels of ATP, ADP, and 2-oxoglutarate regulate the interaction between these three proteins and how DraG discriminates GlnZ from its close paralogue GlnB. PMID:22074780

  5. The structure of a tetrahydrofolate-sensing riboswitch reveals two ligand binding sites in a single aptamer.

    PubMed

    Trausch, Jeremiah J; Ceres, Pablo; Reyes, Francis E; Batey, Robert T

    2011-10-12

    Transport and biosynthesis of folate and its derivatives are frequently controlled by the tetrahydrofolate (THF) riboswitch in Firmicutes. We have solved the crystal structure of the THF riboswitch aptamer in complex with folinic acid, a THF analog. Uniquely, this structure reveals two molecules of folinic acid binding to a single structured domain. These two sites interact with ligand in a similar fashion, primarily through recognition of the reduced pterin moiety. 7-deazaguanine, a soluble analog of guanine, binds the riboswitch with nearly the same affinity as its natural effector. However, 7-deazaguanine effects transcriptional termination to a substantially lesser degree than folinic acid, suggesting that the cellular guanine pool does not act upon the THF riboswitch. Under physiological conditions the ligands display strong cooperative binding, with one of the two sites playing a greater role in eliciting the regulatory response, which suggests that the second site may play another functional role. PMID:21906956

  6. MitoFates: Improved Prediction of Mitochondrial Targeting Sequences and Their Cleavage Sites*

    PubMed Central

    Fukasawa, Yoshinori; Tsuji, Junko; Fu, Szu-Chin; Tomii, Kentaro; Horton, Paul; Imai, Kenichiro

    2015-01-01

    Mitochondria provide numerous essential functions for cells and their dysfunction leads to a variety of diseases. Thus, obtaining a complete mitochondrial proteome should be a crucial step toward understanding the roles of mitochondria. Many mitochondrial proteins have been identified experimentally but a complete list is not yet available. To fill this gap, methods to computationally predict mitochondrial proteins from amino acid sequence have been developed and are widely used, but unfortunately, their accuracy is far from perfect. Here we describe MitoFates, an improved prediction method for cleavable N-terminal mitochondrial targeting signals (presequences) and their cleavage sites. MitoFates introduces novel sequence features including positively charged amphiphilicity, presequence motifs, and position weight matrices modeling the presequence cleavage sites. These features are combined with classical ones such as amino acid composition and physico-chemical properties as input to a standard support vector machine classifier. On independent test data, MitoFates attains better performance than existing predictors in both detection of presequences and in predicting their cleavage sites. We used MitoFates to look for undiscovered mitochondrial proteins from 42,217 human proteins (including isoforms such as alternative splicing or translation initiation variants). MitoFates predicts 1167 genes to have at least one isoform with a presequence. Five-hundred and eighty of these genes were not annotated as mitochondrial in either UniProt or Gene Ontology. Interestingly, these include candidate regulators of parkin translocation to damaged mitochondria, and also many genes with known disease mutations, suggesting that careful investigation of MitoFates predictions may be helpful in elucidating the role of mitochondria in health and disease. MitoFates is open source with a convenient web server publicly available. PMID:25670805

  7. Homozygosity Mapping and Targeted Sanger Sequencing Reveal Genetic Defects Underlying Inherited Retinal Disease in Families from Pakistan

    PubMed Central

    Waheed, Nadia Khalida; Siddiqui, Sorath Noorani; Mustafa, Bilal; Ayub, Humaira; Ali, Liaqat; Ahmad, Shakeel; Micheal, Shazia; Hussain, Alamdar; Shah, Syed Tahir Abbas; Ali, Syeda Hafiza Benish; Ahmed, Waqas; Khan, Yar Muhammad; den Hollander, Anneke I.; Haer-Wigman, Lonneke; Collin, Rob W. J.; Khan, Muhammad Imran; Qamar, Raheel; Cremers, Frans P. M.

    2015-01-01

    Background Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD). Methods We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA), retinitis pigmentosa (RP), congenital stationary night blindness (CSNB), or cone dystrophy (CD). We employed genome-wide single nucleotide polymorphism (SNP) array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS) of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families. Results Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1. Conclusions Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future. PMID:25775262

  8. Proteomic analysis of imatinib-resistant CML-T1 cells reveals calcium homeostasis as a potential therapeutic target

    PubMed Central

    Toman, O.; Kabickova, T.; Vit, O.; Fiser, R.; Polakova, K. Machova; Zach, J.; Linhartova, J.; Vyoral, D.; Petrak, J.

    2016-01-01

    Chronic myeloid leukemia (CML) therapy has markedly improved patient prognosis after introduction of imatinib mesylate for clinical use. However, a subset of patients develops resistance to imatinib and other tyrosine kinase inhibitors (TKIs), mainly due to point mutations in the region encoding the kinase domain of the fused BCR-ABL oncogene. To identify potential therapeutic targets in imatinib-resistant CML cells, we derived imatinib-resistant CML-T1 human cell line clone (CML-T1/IR) by prolonged exposure to imatinib in growth media. Mutational analysis revealed that the Y235H mutation in BCR-ABL is probably the main cause of CML-T1/IR resistance to imatinib. To identify alternative therapeutic targets for selective elimination of imatinib-resistant cells, we compared the proteome profiles of CML-T1 and CML-T1/IR cells using 2-DE-MS. We identified eight differentially expressed proteins, with strongly upregulated Na+/H+ exchanger regulatory factor 1 (NHERF1) in the resistant cells, suggesting that this protein may influence cytosolic pH, Ca2+ concentration or signaling pathways such as Wnt in CML-T1/IR cells. We tested several compounds including drugs in clinical use that interfere with the aforementioned processes and tested their relative toxicity to CML-T1 and CML-T1/IR cells. Calcium channel blockers, calcium signaling antagonists and modulators of calcium homeostasis, namely thapsigargin, ionomycin, verapamil, carboxyamidotriazole and immunosuppressive drugs cyclosporine A and tacrolimus (FK-506) were selectively toxic to CML-T1/IR cells. The putative cellular targets of these compounds in CML-T1/IR cells are postulated in this study. We propose that Ca2+ homeostasis can be a potential therapeutic target in CML cells resistant to TKIs. We demonstrate that a proteomic approach may be used to characterize a TKI-resistant population of CML cells enabling future individualized treatment options for patients. PMID:27430982

  9. A simple in vitro Tn7-based transposition system with low target site selectivity for genome and gene analysis

    PubMed Central

    Biery, Matthew C.; Stewart, Fiona J.; Stellwagen, Anne E.; Raleigh, Elisabeth A.; Craig, Nancy L.

    2000-01-01

    A robust Tn7-based in vitro transposition system is described that displays little target site selectivity, allowing the efficient recovery of many different transposon insertions in target DNAs ranging from small plasmids to cosmids to whole genomes. Two miniTn7 derivatives are described that are useful for the analysis of genes: one a derivative for making translational and transcriptional target gene fusions and the other a derivative that can generate 15 bp (5 amino acid) insertions in target DNAs (proteins). PMID:10666445

  10. Laser Microdissection of Grapevine Leaves Reveals Site-Specific Regulation of Transcriptional Response to Plasmopara viticola.

    PubMed

    Lenzi, Luisa; Caruso, Carla; Bianchedi, Pier Luigi; Pertot, Ilaria; Perazzolli, Michele

    2016-01-01

    Grapevine is one of the most important fruit crops in the world, and it is highly susceptible to downy mildew caused by the biotrophic oomycete Plasmopara viticola. Gene expression profiling has been used extensively to investigate the regulation processes of grapevine-P. viticola interaction, but all studies to date have involved the use of whole leaves. However, only a small fraction of host cells is in contact with the pathogen, so highly localized transcriptional changes of infected cells may be masked by the large portion of non-infected cells when analyzing the whole leaf. In order to understand the transcriptional regulation of the plant reaction at the sites of pathogen infection, we optimized a laser microdissection protocol and analyzed the transcriptional changes in stomata cells and surrounding areas of grapevine leaves at early stages of P. viticola infection. The results indicate that the expression levels of seven P. viticola-responsive genes were greater in microdissected cells than in whole leaves, highlighting the site-specific transcriptional regulation of the host response. The gene modulation was restricted to the stomata cells and to the surrounding areas of infected tissues, indicating that the host response is mainly located at the infection sites and that short-distance signals are implicated. In addition, due to the high sensitivity of the laser microdissection technique, significant modulations of three genes that were completely masked in the whole tissue analysis were detected. The protocol validated in this study could greatly increase the sensitivity of further transcriptomic studies of the grapevine-P. viticola interaction. PMID:26546320

  11. DNA Replication Stress Phosphoproteome Profiles Reveal Novel Functional Phosphorylation Sites on Xrs2 in Saccharomyces cerevisiae.

    PubMed

    Huang, Dongqing; Piening, Brian D; Kennedy, Jacob J; Lin, Chenwei; Jones-Weinert, Corey W; Yan, Ping; Paulovich, Amanda G

    2016-05-01

    In response to replication stress, a phospho-signaling cascade is activated and required for coordination of DNA repair and replication of damaged templates (intra-S-phase checkpoint) . How phospho-signaling coordinates the DNA replication stress response is largely unknown. We employed state-of-the-art liquid chromatography tandem-mass spectrometry (LC-MS/MS) approaches to generate high-coverage and quantitative proteomic and phospho-proteomic profiles during replication stress in yeast, induced by continuous exposure to the DNA alkylating agent methyl methanesulfonate (MMS) . We identified 32,057 unique peptides representing the products of 4296 genes and 22,061 unique phosphopeptides representing the products of 3183 genes. A total of 542 phosphopeptides (mapping to 339 genes) demonstrated an abundance change of greater than or equal to twofold in response to MMS. The screen enabled detection of nearly all of the proteins known to be involved in the DNA damage response, as well as many novel MMS-induced phosphorylations. We assessed the functional importance of a subset of key phosphosites by engineering a panel of phosphosite mutants in which an amino acid substitution prevents phosphorylation. In total, we successfully mutated 15 MMS-responsive phosphorylation sites in seven representative genes including APN1 (base excision repair); CTF4 and TOF1 (checkpoint and sister-chromatid cohesion); MPH1 (resolution of homologous recombination intermediates); RAD50 and XRS2 (MRX complex); and RAD18 (PRR). All of these phosphorylation site mutants exhibited MMS sensitivity, indicating an important role in protecting cells from DNA damage. In particular, we identified MMS-induced phosphorylation sites on Xrs2 that are required for MMS resistance in the absence of the MRX activator, Sae2, and that affect telomere maintenance. PMID:27017623

  12. Pseudohalide anions reveal a novel extracellular site for potentiators to increase CFTR function

    PubMed Central

    Li, Man-Song; Cowley, Elizabeth A; Linsdell, Paul

    2012-01-01

    BACKGROUND AND PURPOSE There is great interest in the development of potentiator drugs to increase the activity of the cystic fibrosis transmembrane conductance regulator (CFTR) in cystic fibrosis. We tested the ability of several anions to potentiate CFTR activity by a novel mechanism. EXPERIMENTAL APPROACH Patch clamp recordings were used to investigate the ability of extracellular pseudohalide anions (Co(CN)63−, Co(NO2)63−, Fe(CN)63−, IrCl63−, Fe(CN)64−) to increase the macroscopic conductance of mutant CFTR in intact cells via interactions with cytoplasmic blocking anions. Mutagenesis of CFTR was used to identify a possible molecular mechanism of action. Transepithelial short-circuit current recordings from human airway epithelial cells were used to determine effects on net anion secretion. KEY RESULTS Extracellular pseudohalide anions were able to increase CFTR conductance in intact cells, as well as increase anion secretion in airway epithelial cells. This effect appears to reflect the interaction of these substances with a site on the extracellular face of the CFTR protein. CONCLUSIONS AND IMPLICATIONS Our results identify pseudohalide anions as increasing CFTR function by a previously undescribed molecular mechanism that involves an interaction with an extracellular site on the CFTR protein. Future drugs could utilize this mechanism to increase CFTR activity in cystic fibrosis, possibly in conjunction with known intracellularly-active potentiators. PMID:22612315

  13. Active sites of two orthologous cytochromes P450 2E1: Differences revealed by spectroscopic methods

    SciTech Connect

    Anzenbacherova, Eva; Hudecek, Jiri; Murgida, Daniel; Hildebrandt, Peter; Marchal, Stephane; Lange, Reinhard; Anzenbacher, Pavel . E-mail: anzen@tunw.upol.cz

    2005-12-09

    Cytochromes P450 2E1 of human and minipig origin were examined by absorption spectroscopy under high hydrostatic pressure and by resonance Raman spectroscopy. Human enzyme tends to denature to the P420 form more easily than the minipig form; moreover, the apparent compressibility of the heme active site (as judged from a redshift of the absorption maximum with pressure) is greater than that of the minipig counterpart. Relative compactness of the minipig enzyme is also seen in the Raman spectra, where the presence of planar heme conformation was inferred from band positions characteristic of the low-spin heme with high degree of symmetry. In this respect, the CYP2E1 seems to be another example of P450 conformational heterogeneity as shown, e.g., by Davydov et al. for CYP3A4 [Biochem. Biophys. Res. Commun. 312 (2003) 121-130]. The results indicate that the flexibility of the CYP active site is likely one of its basic structural characteristics.

  14. Revealing the function of a novel splice-site mutation of CHD7 in CHARGE syndrome.

    PubMed

    Lee, Byeonghyeon; Duz, Mehmet Bugrahan; Sagong, Borum; Koparir, Asuman; Lee, Kyu-Yup; Choi, Jae Young; Seven, Mehmet; Yuksel, Adnan; Kim, Un-Kyung; Ozen, Mustafa

    2016-02-01

    Most cases of CHARGE syndrome are sporadic and autosomal dominant. CHD7 is a major causative gene of CHARGE syndrome. In this study, we screened CHD7 in two Turkish patients demonstrating symptoms of CHARGE syndrome such as coloboma, heart defect, choanal atresia, retarded growth, genital abnomalities and ear anomalies. Two mutations of CHD7 were identified including a novel splice-site mutation (c.2443-2A>G) and a previously known frameshift mutation (c.2504_2508delATCTT). We performed exon trapping analysis to determine the effect of the c.2443-2A>G mutation at the transcriptional level, and found that it caused a complete skip of exon 7 and splicing at a cryptic splice acceptor site. Our current study is the second study demonstrating an exon 7 deficit in CHD7. Results of previous studies suggest that the c.2443-2A>G mutation affects the formation of nasal tissues and the neural retina during early development, resulting in choanal atresia and coloboma, respectively. The findings of the present study will improve our understanding of the genetic causes of CHARGE syndrome. PMID:26551301

  15. Site-Specific DNA Structural and Dynamic Features Revealed by Nucleotide-Independent Nitroxide Probes

    SciTech Connect

    Popova, Anna; Kalai, Tamas; Hideg, Kalman; Qin, Peter Z.

    2009-09-15

    In site-directed spin labeling, a covalently attached nitroxide probe containing a chemically inert unpaired electron is utilized to obtain information on the local environment of the parent macromolecule. Studies presented here examine the feasibility of probing local DNA structural and dynamic features using a class of nitroxide probes that are linked to chemically substituted phosphorothioate positions at the DNA backbone. Two members of this family, designated as R5 and R5a, were attached to eight different sites of a dodecameric DNA duplex without severely perturbing the native B-form conformation. Measured X-band electron paramagnetic resonance (EPR) spectra, which report on nitroxide rotational motions, were found to vary depending on the location of the label (e.g., duplex center vs termini) and the surrounding DNA sequence. This indicates that R5 and R5a can provide information on the DNA local environment at the level of an individual nucleotide. As these probes can be attached to arbitrary nucleotides within a nucleic acid sequence, they may provide a means to “scan” a given DNA molecule in order to interrogate its local structural and dynamic features.

  16. Asymmetric mutations in the tetrameric R67 dihydrofolate reductase reveal high tolerance to active-site substitutions

    PubMed Central

    Ebert, Maximilian C C J C; Morley, Krista L; Volpato, Jordan P; Schmitzer, Andreea R; Pelletier, Joelle N

    2015-01-01

    Type II R67 dihydrofolate reductase (DHFR) is a bacterial plasmid-encoded enzyme that is intrinsically resistant to the widely-administered antibiotic trimethoprim. R67 DHFR is genetically and structurally unrelated to E. coli chromosomal DHFR and has an unusual architecture, in that four identical protomers form a single symmetrical active site tunnel that allows only one substrate binding/catalytic event at any given time. As a result, substitution of an active-site residue has as many as four distinct consequences on catalysis, constituting an atypical model of enzyme evolution. Although we previously demonstrated that no single residue of the native active site is indispensable for function, library selection here revealed a strong bias toward maintenance of two native protomers per mutated tetramer. A variety of such “half-native” tetramers were shown to procure native-like catalytic activity, with similar KM values but kcat values 5- to 33-fold lower, illustrating a high tolerance for active-site substitutions. The selected variants showed a reduced thermal stability (Tm ∼12°C lower), which appears to result from looser association of the protomers, but generally showed a marked increase in resilience to heat denaturation, recovering activity to a significantly greater extent than the variant with no active-site substitutions. Our results suggest that the presence of two native protomers in the R67 DHFR tetramer is sufficient to provide native-like catalytic rate and thus ensure cellular proliferation. PMID:25401264

  17. Spatial Dynamics and Expanded Vertical Niche of Blue Sharks in Oceanographic Fronts Reveal Habitat Targets for Conservation

    PubMed Central

    Queiroz, Nuno; Humphries, Nicolas E.; Noble, Leslie R.; Santos, António M.; Sims, David W.

    2012-01-01

    Dramatic population declines among species of pelagic shark as a result of overfishing have been reported, with some species now at a fraction of their historical biomass. Advanced telemetry techniques enable tracking of spatial dynamics and behaviour, providing fundamental information on habitat preferences of threatened species to aid conservation. We tracked movements of the highest pelagic fisheries by-catch species, the blue shark Prionace glauca, in the North-east Atlantic using pop-off satellite-linked archival tags to determine the degree of space use linked to habitat and to examine vertical niche. Overall, blue sharks moved south-west of tagging sites (English Channel; southern Portugal), exhibiting pronounced site fidelity correlated with localized productive frontal areas, with estimated space-use patterns being significantly different from that of random walks. Tracked female sharks displayed behavioural variability in diel depth preferences, both within and between individuals. Diel depth use ranged from normal DVM (nDVM; dawn descent, dusk ascent), to reverse DVM (rDVM; dawn ascent, dusk descent), to behavioural patterns where no diel differences were apparent. Results showed that blue sharks occupy some of the most productive marine zones for extended periods and structure diel activity patterns across multiple spatio-temporal scales in response to particular habitat types. In so doing, sharks occupied an extraordinarily broad vertical depth range for their size (1.0–2.0 m fork length), from the surface into the bathypelagic realm (max. dive depth, 1160 m). The space-use patterns of blue sharks indicated they spend much of the time in areas where pelagic longlining activities are often highest, and in depth zones where these fisheries particularly target other species, which could account for the rapid declines recently reported for blue sharks in many parts of the world's oceans. Our results provide habitat targets for blue shark conservation

  18. Spatial dynamics and expanded vertical niche of blue sharks in oceanographic fronts reveal habitat targets for conservation.

    PubMed

    Queiroz, Nuno; Humphries, Nicolas E; Noble, Leslie R; Santos, António M; Sims, David W

    2012-01-01

    Dramatic population declines among species of pelagic shark as a result of overfishing have been reported, with some species now at a fraction of their historical biomass. Advanced telemetry techniques enable tracking of spatial dynamics and behaviour, providing fundamental information on habitat preferences of threatened species to aid conservation. We tracked movements of the highest pelagic fisheries by-catch species, the blue shark Prionace glauca, in the North-east Atlantic using pop-off satellite-linked archival tags to determine the degree of space use linked to habitat and to examine vertical niche. Overall, blue sharks moved south-west of tagging sites (English Channel; southern Portugal), exhibiting pronounced site fidelity correlated with localized productive frontal areas, with estimated space-use patterns being significantly different from that of random walks. Tracked female sharks displayed behavioural variability in diel depth preferences, both within and between individuals. Diel depth use ranged from normal DVM (nDVM; dawn descent, dusk ascent), to reverse DVM (rDVM; dawn ascent, dusk descent), to behavioural patterns where no diel differences were apparent. Results showed that blue sharks occupy some of the most productive marine zones for extended periods and structure diel activity patterns across multiple spatio-temporal scales in response to particular habitat types. In so doing, sharks occupied an extraordinarily broad vertical depth range for their size (1.0-2.0 m fork length), from the surface into the bathypelagic realm (max. dive depth, 1160 m). The space-use patterns of blue sharks indicated they spend much of the time in areas where pelagic longlining activities are often highest, and in depth zones where these fisheries particularly target other species, which could account for the rapid declines recently reported for blue sharks in many parts of the world's oceans. Our results provide habitat targets for blue shark conservation that

  19. Geophysical Research for Revealing and Studying of Ancient Ruins in the Archaeological Site "argamum"

    NASA Astrophysics Data System (ADS)

    Anghel, S.

    2008-12-01

    The geophysical studies were carried out within the archaeological site both in 2005 as well as in 2006.Geophysical works were conducted using Geometrics equipment (G856 proton procession magnetometer) with a 0.1nT precision, which allowed for a highly detailed local morphology of the geomagnetic field and for the mapping of the magnetic anomaly. The working technology has been chosen to enable to emphasize mainly abnormal effects produced by sources located at depths of 0-5 m. On the south side of the late Roman fortification, outside the precinct wall, an artisanal area including a furnace for manufacturing building materials dated from the late Roman period, was found as well as some Greek furnaces for manufacturing ordinary brick. The south area of the site has been studied within this research project using the magnetometrical method (Fig. 5). Geophysical studies will prove very useful for further archaeological diggings, supplying them with a more clearly defined image on the substratum situation. There is a growing involvement lately, in matters related to archaeogeophysics, of electromagnetic methods which also have an extremely high productivity. Outstanding progress achieved in increasing geophysical equipment sensitivity, more and more sophisticated techniques of processing, interpreting and two and tree dimensional shaping of results has enabled approaching using geophysical means a more larger scope of archaeological issues. Geophysical works have been carried out using Geometrics equipment with a 0.1nT precision, which allowed for highly detailed images of the local morphology of geomagnetic field and drawing of maps presenting the magnetic anomaly. The working technology has been chosen to enable to emphasize mainly abnormal effects produced by sources located at depths of 0-5 m. The first works carried out were topographical works, with the help of which the observation networks were transposed within the field, the eye of the network having 1 m

  20. The ATP-binding site of Ca(2+)-ATPase revealed by electron image analysis.

    PubMed Central

    Yonekura, K; Stokes, D L; Sasabe, H; Toyoshima, C

    1997-01-01

    The location of the ATP-binding site of a P-type ion pump, Ca(2+)-ATPase from rabbit sarcoplasmic reticulum, was examined by cryoelectron microscopy. A nonhydrolyzable analog of ATP, beta, gamma-bidentate chromium (III) complex of ATP (CrATP), was used to stabilize the enzyme in the Ca(2+)-occluded state. Tubular crystals were then induced by vanadate in the presence of EGTA, keeping CrATP bound to the enzyme. The three-dimensional structures of the crystals were determined at 14 A resolution by cryoelectron microscopy and helical image analysis. Statistical comparison of the structures with and without CrATP showed clear and significant differences at the groove proposed previously as the ATP-binding pocket. Images FIGURE 3 FIGURE 6 FIGURE 7 PMID:9138598

  1. Mixture model of pottery decorations from Lake Chad Basin archaeological sites reveals ancient segregation patterns.

    PubMed

    O'Brien, John D; Lin, Kathryn; MacEachern, Scott

    2016-03-30

    We present a new statistical approach to analysing an extremely common archaeological data type--potsherds--that infers the structure of cultural relationships across a set of excavation units (EUs). This method, applied to data from a set of complex, culturally heterogeneous sites around the Mandara mountains in the Lake Chad Basin, helps elucidate cultural succession through the Neolithic and Iron Age. We show how the approach can be integrated with radiocarbon dates to provide detailed portraits of cultural dynamics and deposition patterns within single EUs. In this context, the analysis supports ancient cultural segregation analogous to historical ethnolinguistic patterning in the region. We conclude with a discussion of the many possible model extensions using other archaeological data types. PMID:27009217

  2. Phytoliths reveal the earliest fine reedy textile in China at the Tianluoshan site

    PubMed Central

    Zhang, Jianping; Lu, Houyuan; Sun, Guoping; Flad, Rowan; Wu, Naiqin; Huan, Xiujia; He, Keyang; Wang, Yonglei

    2016-01-01

    Textiles are among the longest and most widespread technologies in human history, although poor preservation of perishable artifacts in Paleolithic and Neolithic contexts makes them difficult to unearth and has hampered study of their production and use. Here we report evidence of a plain-woven mat from the Tianluoshan site, Zhejiang, Eastern China. Phytolith and AMS dating from the mat and modern reference collections shown that the mat was made of reeds (Phragmites australis (Cav.)) and dated to 6775–6645 cal. yr. BP. This is the earliest directly dated fiber artifact so far known in China, over at least one thousand years earlier than any established dates for woven remains elsewhere. The evidence of the mat and other related remains suggest that textile products might occur earlier than 7000–8000 years ago and are significant for understanding the history of textiles, as well as production and human adaptation in Neolithic China. PMID:26766794

  3. Phytoliths reveal the earliest fine reedy textile in China at the Tianluoshan site

    NASA Astrophysics Data System (ADS)

    Zhang, Jianping; Lu, Houyuan; Sun, Guoping; Flad, Rowan; Wu, Naiqin; Huan, Xiujia; He, Keyang; Wang, Yonglei

    2016-01-01

    Textiles are among the longest and most widespread technologies in human history, although poor preservation of perishable artifacts in Paleolithic and Neolithic contexts makes them difficult to unearth and has hampered study of their production and use. Here we report evidence of a plain-woven mat from the Tianluoshan site, Zhejiang, Eastern China. Phytolith and AMS dating from the mat and modern reference collections shown that the mat was made of reeds (Phragmites australis (Cav.)) and dated to 6775-6645 cal. yr. BP. This is the earliest directly dated fiber artifact so far known in China, over at least one thousand years earlier than any established dates for woven remains elsewhere. The evidence of the mat and other related remains suggest that textile products might occur earlier than 7000-8000 years ago and are significant for understanding the history of textiles, as well as production and human adaptation in Neolithic China.

  4. Phytoliths reveal the earliest fine reedy textile in China at the Tianluoshan site.

    PubMed

    Zhang, Jianping; Lu, Houyuan; Sun, Guoping; Flad, Rowan; Wu, Naiqin; Huan, Xiujia; He, Keyang; Wang, Yonglei

    2016-01-01

    Textiles are among the longest and most widespread technologies in human history, although poor preservation of perishable artifacts in Paleolithic and Neolithic contexts makes them difficult to unearth and has hampered study of their production and use. Here we report evidence of a plain-woven mat from the Tianluoshan site, Zhejiang, Eastern China. Phytolith and AMS dating from the mat and modern reference collections shown that the mat was made of reeds (Phragmites australis (Cav.)) and dated to 6775-6645 cal. yr. BP. This is the earliest directly dated fiber artifact so far known in China, over at least one thousand years earlier than any established dates for woven remains elsewhere. The evidence of the mat and other related remains suggest that textile products might occur earlier than 7000-8000 years ago and are significant for understanding the history of textiles, as well as production and human adaptation in Neolithic China. PMID:26766794

  5. Comparative structural studies on Lys49-phospholipases A(2) from Bothrops genus reveal their myotoxic site.

    PubMed

    dos Santos, Juliana I; Soares, Andreimar Martins; Fontes, Marcos R M

    2009-08-01

    Phospholipases A(2) (PLA(2)s) are membrane-associated enzymes that hydrolyze phospholipids at the sn-2 position, releasing lysophospholipids and free fatty acids. Phospholipase A(2) homologues (Lys49-PLA(2)s) are highly myotoxic and cause extensive tissue damage despite not showing measurable catalytic activity. They are found in different snake venoms and represent one third of bothropic venom composition. The importance of these toxins during envenomation is related to the pronounced local myotoxic effect they induce since this effect is not neutralized by serum therapy. We present herein three structures of Lys49-PLA(2)s from Bothrops genus snake venom crystallized under the same conditions, two of which were grown in the presence of alpha-tocopherol (vitamin E). Comparative structural analysis of these and other Lys49-PLA(2)s showed two different patterns of oligomeric conformation that are related to the presence or absence of ligands in the hydrophobic channel. This work also confirms the biological dimer indicated by recent studies in which both C-termini are in the dimeric interface. In this configuration, we propose that the myotoxic site of these toxins is composed by the Lys 20, Lys115 and Arg118 residues. For the first time, a residue from the short-helix (Lys20) is suggested as a member of this site and the importance of Tyr119 residue to myotoxicity of bothropic Lys49-PLA(2)s is also discussed. These results support a complete hypothesis for these PLA(2)s myotoxic activity consistent with all findings on bothropic Lys49-PLA(2)s studied up to this moment, including crystallographic, bioinformatics, biochemical and biophysical data. PMID:19401234

  6. The crystal structure of human protein α1M reveals a chromophore-binding site and two putative protein–protein interfaces

    SciTech Connect

    Zhang, Yangli; Gao, Zengqiang; Guo, Zhen; Zhang, Hongpeng; Zhang, Zhenzhen; Luo, Miao; Hou, Haifeng; Huang, Ailong; Dong, Yuhui; Wang, Deqiang

    2013-09-27

    Highlights: •We determined the first structure of human α1M with heavy electron density of the chromophore. •We proposed a new structural model of the chromophore. •We first revealed that the two conserved surface regions of α1M are proposed as putative protein–protein interface sites. -- Abstract: Lipocalin α1-microglobulin (α1M) is a conserved glycoprotein present in plasma and in the interstitial fluids of all tissues. α1M is linked to a heterogeneous yellow–brown chromophore of unknown structure, and interacts with several target proteins, including α1-inhibitor-3, fibronectin, prothrombin and albumin. To date, there is little knowledge about the interaction sites between α1M and its partners. Here, we report the crystal structure of the human α1M. Due to the crystallization occurring in a low ionic strength solution, the unidentified chromophore with heavy electron density is observed at a hydrophobic inner tube of α1M. In addition, two conserved surface regions of α1M are proposed as putative protein–protein interface sites. Further study is needed to unravel the detailed information about the interaction between α1M and its partners.

  7. MiRNA-Target Interaction Reveals Cell-Specific Post-Transcriptional Regulation in Mammalian Cell Lines

    PubMed Central

    Kulkarni, Varun; Naqvi, Afsar Raza; Uttamani, Juhi Raju; Nares, Salvador

    2016-01-01

    MicroRNAs are 18–22 nucleotides long, non-coding RNAs that bind transcripts with complementary sequences leading to either mRNA degradation or translational suppression. However, the inherent differences in preferred mode of miRNA regulation among cells of different origin have not been examined. In our previous transcriptome profiling studies, we observed that post-transcriptional regulation can differ substantially depending on the cell in context. Here we examined mechanistic differences in the regulation of a let-7a targeted (wild type) or resistant (mutant) engineered renilla transcript across various mammalian cell lines of diverse origin. Dual luciferase assays show that compared to mutant (mut), the reporter gene containing wild type (wt) let-7a binding sites was efficiently suppressed upon transfection in various cell lines. Importantly, the strength of miRNA regulation varied across the cell lines. Total RNA analysis demonstrates that wt renilla mRNA was expressed to similar or higher levels compared to mut suggesting that translation repression is a predominant mode of miRNA regulation. Nonetheless, transcript degradation was observed in some cell lines. Ago-2 immunoprecipitation show that miRNA repressed renilla mRNA are associated with functional mi-RISC (miRNA-RNA induced silencing complex). Given the immense potential of miRNA as a therapeutic option, these findings highlight the necessity to thoroughly examine the mode of mRNA regulation in order to achieve the beneficial effects in targeting cells. PMID:26761000

  8. Integrated Genomic Characterization Reveals Novel, Therapeutically Relevant Drug Targets in FGFR and EGFR Pathways in Sporadic Intrahepatic Cholangiocarcinoma

    PubMed Central

    Liang, Winnie S.; Fonseca, Rafael; Bryce, Alan H.; McCullough, Ann E.; Barrett, Michael T.; Hunt, Katherine; Patel, Maitray D.; Young, Scott W.; Collins, Joseph M.; Silva, Alvin C.; Condjella, Rachel M.; Block, Matthew; McWilliams, Robert R.; Lazaridis, Konstantinos N.; Klee, Eric W.; Bible, Keith C.; Harris, Pamela; Oliver, Gavin R.; Bhavsar, Jaysheel D.; Nair, Asha A.; Middha, Sumit; Asmann, Yan; Kocher, Jean-Pierre; Schahl, Kimberly; Kipp, Benjamin R.; Barr Fritcher, Emily G.; Baker, Angela; Aldrich, Jessica; Kurdoglu, Ahmet; Izatt, Tyler; Christoforides, Alexis; Cherni, Irene; Nasser, Sara; Reiman, Rebecca; Phillips, Lori; McDonald, Jackie; Adkins, Jonathan; Mastrian, Stephen D.; Placek, Pamela; Watanabe, Aprill T.; LoBello, Janine; Han, Haiyong; Von Hoff, Daniel; Craig, David W.; Stewart, A. Keith; Carpten, John D.

    2014-01-01

    Advanced cholangiocarcinoma continues to harbor a difficult prognosis and therapeutic options have been limited. During the course of a clinical trial of whole genomic sequencing seeking druggable targets, we examined six patients with advanced cholangiocarcinoma. Integrated genome-wide and whole transcriptome sequence analyses were performed on tumors from six patients with advanced, sporadic intrahepatic cholangiocarcinoma (SIC) to identify potential therapeutically actionable events. Among the somatic events captured in our analysis, we uncovered two novel therapeutically relevant genomic contexts that when acted upon, resulted in preliminary evidence of anti-tumor activity. Genome-wide structural analysis of sequence data revealed recurrent translocation events involving the FGFR2 locus in three of six assessed patients. These observations and supporting evidence triggered the use of FGFR inhibitors in these patients. In one example, preliminary anti-tumor activity of pazopanib (in vitro FGFR2 IC50≈350 nM) was noted in a patient with an FGFR2-TACC3 fusion. After progression on pazopanib, the same patient also had stable disease on ponatinib, a pan-FGFR inhibitor (in vitro, FGFR2 IC50≈8 nM). In an independent non-FGFR2 translocation patient, exome and transcriptome analysis revealed an allele specific somatic nonsense mutation (E384X) in ERRFI1, a direct negative regulator of EGFR activation. Rapid and robust disease regression was noted in this ERRFI1 inactivated tumor when treated with erlotinib, an EGFR kinase inhibitor. FGFR2 fusions and ERRFI mutations may represent novel targets in sporadic intrahepatic cholangiocarcinoma and trials should be characterized in larger cohorts of patients with these aberrations. PMID:24550739

  9. Super-resolution microscopy reveals decondensed chromatin structure at transcription sites

    NASA Astrophysics Data System (ADS)

    Wang, Yejun; Maharana, Shovamayee; Wang, Michelle D.; Shivashankar, G. V.

    2014-03-01

    Remodeling of the local chromatin structure is essential for the regulation of gene expression. While a number of biochemical and bioimaging experiments suggest decondensed chromatin structures are associated with transcription, a direct visualization of DNA and transcriptionally active RNA polymerase II (RNA pol II) at super-resolution is still lacking. Here we investigate the structure of chromatin isolated from HeLa cells using binding activatable localization microscopy (BALM). The sample preparation method preserved the structural integrity of chromatin. Interestingly, BALM imaging of the chromatin spreads revealed the presence of decondensed chromatin as gap structures along the spreads. These gaps were enriched with phosphorylated S5 RNA pol II, and were sensitive to the cellular transcriptional state. Taken together, we could visualize the decondensed chromatin regions together with active RNA pol II for the first time using super-resolution microscopy.

  10. Super-resolution microscopy reveals decondensed chromatin structure at transcription sites.

    PubMed

    Wang, Yejun; Maharana, Shovamayee; Wang, Michelle D; Shivashankar, G V

    2014-01-01

    Remodeling of the local chromatin structure is essential for the regulation of gene expression. While a number of biochemical and bioimaging experiments suggest decondensed chromatin structures are associated with transcription, a direct visualization of DNA and transcriptionally active RNA polymerase II (RNA pol II) at super-resolution is still lacking. Here we investigate the structure of chromatin isolated from HeLa cells using binding activatable localization microscopy (BALM). The sample preparation method preserved the structural integrity of chromatin. Interestingly, BALM imaging of the chromatin spreads revealed the presence of decondensed chromatin as gap structures along the spreads. These gaps were enriched with phosphorylated S5 RNA pol II, and were sensitive to the cellular transcriptional state. Taken together, we could visualize the decondensed chromatin regions together with active RNA pol II for the first time using super-resolution microscopy. PMID:24667378

  11. Super-resolution microscopy reveals decondensed chromatin structure at transcription sites

    PubMed Central

    Wang, Yejun; Maharana, Shovamayee; Wang, Michelle D.; Shivashankar, G. V.

    2014-01-01

    Remodeling of the local chromatin structure is essential for the regulation of gene expression. While a number of biochemical and bioimaging experiments suggest decondensed chromatin structures are associated with transcription, a direct visualization of DNA and transcriptionally active RNA polymerase II (RNA pol II) at super-resolution is still lacking. Here we investigate the structure of chromatin isolated from HeLa cells using binding activatable localization microscopy (BALM). The sample preparation method preserved the structural integrity of chromatin. Interestingly, BALM imaging of the chromatin spreads revealed the presence of decondensed chromatin as gap structures along the spreads. These gaps were enriched with phosphorylated S5 RNA pol II, and were sensitive to the cellular transcriptional state. Taken together, we could visualize the decondensed chromatin regions together with active RNA pol II for the first time using super-resolution microscopy. PMID:24667378

  12. Pathway analysis of senescence-associated miRNA targets reveals common processes to different senescence induction mechanisms.

    PubMed

    Lafferty-Whyte, Kyle; Cairney, Claire J; Jamieson, Nigel B; Oien, Karin A; Keith, W Nicol

    2009-04-01

    Multiple mechanisms of senescence induction exist including telomere attrition, oxidative stress, oncogene expression and DNA damage signalling. The regulation of the cellular changes required to respond to these stimuli and create the complex senescent cell phenotype has many different mechanisms. MiRNAs present one mechanism by which genes with diverse functions on multiple pathways can be simultaneously regulated. In this study we investigated 12 miRNAs previously identified as senescence regulators. Using pathway analysis of their target genes we tested the relevance of miRNA regulation in the induction of senescence. Our analysis highlighted the potential of these senescence-associated miRNAs (SA-miRNAs) to regulate the cell cycle, cytoskeletal remodelling and proliferation signalling logically required to create a senescent cell. The reanalysis of publicly available gene expression data from studies exploring different senescence stimuli also revealed their potential to regulate core senescence processes, regardless of stimuli. We also identified stimulus specific apoptosis survival pathways theoretically regulated by the SA-miRNAs. Furthermore the observation that miR-499 and miR-34c had the potential to regulate all 4 of the senescence induction types we studied highlights their future potential as novel drug targets for senescence induction. PMID:19419692

  13. Targeted Next-generation Sequencing Reveals Novel EYS Mutations in Chinese Families with Autosomal Recessive Retinitis Pigmentosa

    PubMed Central

    Chen, Xue; Liu, Xiaoxing; Sheng, Xunlun; Gao, Xiang; Zhang, Xiumei; Li, Zili; Li, Huiping; Liu, Yani; Rong, Weining; Zhao, Kanxing; Zhao, Chen

    2015-01-01

    EYS mutations demonstrate great genotypic and phenotypic varieties, and are one of the major causes for patients with autosomal recessive retinitis pigmentosa (ARRP). Here, we aim to determine the genetic lesions with phenotypic correlations in two Chinese families with ARRP. Medical histories and ophthalmic documentations were obtained from all participants from the two pedigrees. Targeted next-generation sequencing (NGS) on 189 genes was performed to screen for RP causative mutations in the two families. Two biallelic mutations in EYS, p.[R164*];[C2139Y] and p.[W2640*];[F2954S], were identified in the two families, respectively. EYS p.R164* and p.F2954S are novel alleles associated with RP, while p.C2139Y and p.W2640* are known mutations. Crystal structure modeling on the protein eyes shut homolog encoded by the EYS gene revealed abnormal hydrogen bonds generated by p.C2139Y and p.F2954S, which would likely affect the solubility and cause significant structural changes of the two mutated proteins. In conclusion, our study expands the genotypic spectrums for EYS mutations, and may provide novel insights into the relevant pathogenesis for RP. We also demonstrate targeted NGS approach as a valuable tool for genetic diagnosis. PMID:25753737

  14. Kinome RNAi Screens Reveal Synergistic Targeting of MTOR and FGFR1 Pathways for Treatment of Lung Cancer and HNSCC.

    PubMed

    Singleton, Katherine R; Hinz, Trista K; Kleczko, Emily K; Marek, Lindsay A; Kwak, Jeff; Harp, Taylor; Kim, Jihye; Tan, Aik Choon; Heasley, Lynn E

    2015-10-15

    The FGFR1 is a therapeutic target under investigation in multiple solid tumors and clinical trials of selective tyrosine kinase inhibitors (TKI) are underway. Treatment with a single TKI represents a logical step toward personalized cancer therapy, but intrinsic and acquired resistance mechanisms limit their long-term benefit. In this study, we deployed RNAi-based functional genomic screens to identify protein kinases controlling the intrinsic sensitivity of FGFR1-dependent lung cancer and head and neck squamous cell cancer (HNSCC) cells to ponatinib, a multikinase FGFR-active inhibitor. We identified and validated a synthetic lethal interaction between MTOR and ponatinib in non-small cell lung carcinoma cells. In addition, treatment with MTOR-targeting shRNAs and pharmacologic inhibitors revealed that MTOR is an essential protein kinase in other FGFR1-expressing cancer cells. The combination of FGFR inhibitors and MTOR or AKT inhibitors resulted in synergistic growth suppression in vitro. Notably, tumor xenografts generated from FGFR1-dependent lung cancer cells exhibited only modest sensitivity to monotherapy with the FGFR-specific TKI, AZD4547, but when combined with the MTOR inhibitor, AZD2014, significantly attenuated tumor growth and prolonged survival. Our findings support the existence of a signaling network wherein FGFR1-driven ERK and activated MTOR/AKT represent distinct arms required to induce full transformation. Furthermore, they suggest that clinical efficacy of treatments for FGFR1-driven lung cancers and HNSCC may be achieved by combining MTOR inhibitors and FGFR-specific TKIs. PMID:26359452

  15. A Targetable Fluorescent Sensor Reveals that Copper-Deficient SCO1 and SCO2 Patient Cells Prioritize Mitochondrial Copper Homeostasis

    PubMed Central

    Dodani, Sheel C.; Leary, Scot C.; Cobine, Paul A.; Winge, Dennis R.; Chang, Christopher J.

    2011-01-01

    We present the design, synthesis, spectroscopy, and biological applications of Mitochondrial Coppersensor-1 (Mito-CS1), a new type of targetable fluorescent sensor for imaging exchangeable mitochondrial copper pools in living cells. Mito-CS1 is a bifunctional reporter that combines a Cu+-responsive fluorescent platform with a mitochondrial-targeting triphenylphosphonium moiety for localizing the probe to this organelle. Molecular imaging with Mito-CS1 establishes that this new chemical tool can detect changes in labile mitochondrial Cu+ in a model HEK 293T cell line as well as in human fibroblasts. Moreover, we utilized Mito-CS1 in a combined imaging and biochemical study in fibroblasts derived from patients with mutations in the two synthesis of cytochrome c oxidase 1 and 2 proteins (SCO1 and SCO2), each of which is required for assembly and metallation of functionally active cytochrome c oxidase (COX). Interestingly, we observe that although defects in these mitochondrial metallochaperones lead to a global copper deficiency at the whole cell level, total copper and exchangeable mitochondrial Cu+ pools in SCO1 and SCO2 patient fibroblasts are largely unaltered relative to wildtype controls. Our findings reveal that the cell maintains copper homeostasis in mitochondria even in situations of copper deficiency and mitochondrial metallochaperone malfunction, illustrating the importance of regulating copper stores in this energy-producing organelle. PMID:21563821

  16. NMR reveals the allosteric opening and closing of Abelson tyrosine kinase by ATP-site and myristoyl pocket inhibitors

    PubMed Central

    Skora, Lukasz; Mestan, Jürgen; Fabbro, Doriano; Jahnke, Wolfgang; Grzesiek, Stephan

    2013-01-01

    Successful treatment of chronic myelogenous leukemia is based on inhibitors binding to the ATP site of the deregulated breakpoint cluster region (Bcr)–Abelson tyrosine kinase (Abl) fusion protein. Recently, a new type of allosteric inhibitors targeting the Abl myristoyl pocket was shown in preclinical studies to overcome ATP-site inhibitor resistance arising in some patients. Using NMR and small-angle X-ray scattering, we have analyzed the solution conformations of apo Abelson tyrosine kinase (c-Abl) and c-Abl complexes with ATP-site and allosteric inhibitors. Binding of the ATP-site inhibitor imatinib leads to an unexpected open conformation of the multidomain SH3-SH2-kinase c-Abl core, whose relevance is confirmed by cellular assays on Bcr-Abl. The combination of imatinib with the allosteric inhibitor GNF-5 restores the closed, inactivated state. Our data provide detailed insights on the poorly understood combined effect of the two inhibitor types, which is able to overcome drug resistance. PMID:24191057

  17. Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

    PubMed Central

    Jones, W R; Stone, M P

    1998-01-01

    The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand. PMID:9461470

  18. Low Herbivory among Targeted Reforestation Sites in the Andean Highlands of Southern Ecuador

    PubMed Central

    Adams, Marc-Oliver; Fiedler, Konrad

    2016-01-01

    Insect herbivory constitutes an important constraint in the viability and management of targeted reforestation sites. Focusing on young experimental stands at about 2000 m elevation in southern Ecuador, we examined foliar damage over one season as a function of tree species and habitat. Native tree species (Successional hardwood: Cedrela montana and Tabebuia chrysantha; fast-growing pioneer: Heliocarpus americanus) have been planted among prevailing local landcover types (abandoned pasture, secondary shrub vegetation, and a Pinus patula plantation) in 2003/4. Plantation trees were compared to conspecifics in the spontaneous undergrowth of adjacent undisturbed rainforest matched for height and foliar volume. Specifically, we tested the hypotheses that H. americanus as a pioneer species suffers more herbivory compared to the two successional tree species, and that damage is inversely related to habitat complexity. Overall leaf damage caused by folivorous insects (excluding leafcutter ants) was low. Average leaf loss was highest among T. chrysantha (7.50% ± 0.19 SE of leaf area), followed by H. americanus (4.67% ± 0.18 SE) and C. montana (3.18% ± 0.15 SE). Contrary to expectations, leaf area loss was highest among trees in closed-canopy natural rainforest, followed by pine plantation, pasture, and secondary shrub sites. Harvesting activity of leafcutter ants (Acromyrmex sp.) was strongly biased towards T. chrysantha growing in open habitat (mean pasture: 2.5%; shrub: 10.5%) where it could result in considerable damage (> 90.0%). Insect folivory is unlikely to pose a barrier for reforestation in the tropical Andean mountain forest zone at present, but leafcutter ants may become problematic if local temperatures increase in the wake of global warming. PMID:26963395

  19. Inhibitory effects and oxidative target site of dibutyl phthalate on Karenia brevis.

    PubMed

    Li, Feng-min; Wu, Miao; Yao, Yuan; Zheng, Xiang; Zhao, Jian; Wang, Zhen-yu; Xing, Bao-shan

    2015-08-01

    The inhibitory action and possible damage mechanism of dibutyl phthalate (DBP) on the red tide algae Karenia brevis were investigated. The results showed that the algae experienced oxidative stress after exposure to 5mgL(-1) DBP. Malondialdehyde (MDA) peaked after 72h, with a value approximately 2.3 times higher than that observed for untreated cells. The superoxide dismutase (SOD) and catalase (CAT) activities significantly increased as an adaptive reaction after 48h. DBP induced the overproduction of reactive oxygen species (ROS), the OH concentration showed a peak of 33UmL(-1) at 48h, and the highest H2O2 content was approximately 250nmol/10(7) cells at 72h; these latter two values were 2.5 and 4.4 times higher than observed for the control, respectively. TEM images showed that a number of small vacuoles or apical tubers were commonly found around the cell membrane, and the membrane structure was ultimately disintegrated. Further experiments were carried out to locate the original ROS production sites following DBP exposure. The activity of CuZn-SOD (a mainly cytosolic isoform, with some also found in chloroplasts) under DBP exposure was approximately 2.5 times higher than the control, whereas the Mn-SOD (mitochondrial isoform) activity was significantly inhibited. No significant difference was observed in the activity of Fe-SOD (chloroplastic isoform). In addition, dicumarol (an inhibitor of the electron transport chain in the plasma membrane) stimulated DBP-induced ROS production, whereas rotenone (an inhibitor of the mitochondria electron transport chain complex I) decreased DBP-induced ROS production. These results suggested that mitochondria could be the main target sites for DBP attack. PMID:25770834

  20. Low Herbivory among Targeted Reforestation Sites in the Andean Highlands of Southern Ecuador.

    PubMed

    Adams, Marc-Oliver; Fiedler, Konrad

    2016-01-01

    Insect herbivory constitutes an important constraint in the viability and management of targeted reforestation sites. Focusing on young experimental stands at about 2000 m elevation in southern Ecuador, we examined foliar damage over one season as a function of tree species and habitat. Native tree species (Successional hardwood: Cedrela montana and Tabebuia chrysantha; fast-growing pioneer: Heliocarpus americanus) have been planted among prevailing local landcover types (abandoned pasture, secondary shrub vegetation, and a Pinus patula plantation) in 2003/4. Plantation trees were compared to conspecifics in the spontaneous undergrowth of adjacent undisturbed rainforest matched for height and foliar volume. Specifically, we tested the hypotheses that H. americanus as a pioneer species suffers more herbivory compared to the two successional tree species, and that damage is inversely related to habitat complexity. Overall leaf damage caused by folivorous insects (excluding leafcutter ants) was low. Average leaf loss was highest among T. chrysantha (7.50% ± 0.19 SE of leaf area), followed by H. americanus (4.67% ± 0.18 SE) and C. montana (3.18% ± 0.15 SE). Contrary to expectations, leaf area loss was highest among trees in closed-canopy natural rainforest, followed by pine plantation, pasture, and secondary shrub sites. Harvesting activity of leafcutter ants (Acromyrmex sp.) was strongly biased towards T. chrysantha growing in open habitat (mean pasture: 2.5%; shrub: 10.5%) where it could result in considerable damage (> 90.0%). Insect folivory is unlikely to pose a barrier for reforestation in the tropical Andean mountain forest zone at present, but leafcutter ants may become problematic if local temperatures increase in the wake of global warming. PMID:26963395

  1. Structures of protective antibodies reveal sites of vulnerability on Ebola virus

    PubMed Central

    Murin, Charles D.; Fusco, Marnie L.; Bornholdt, Zachary A.; Qiu, Xiangguo; Olinger, Gene G.; Zeitlin, Larry; Kobinger, Gary P.; Ward, Andrew B.; Saphire, Erica Ollmann

    2014-01-01

    Ebola virus (EBOV) and related filoviruses cause severe hemorrhagic fever, with up to 90% lethality, and no treatments are approved for human use. Multiple recent outbreaks of EBOV and the likelihood of future human exposure highlight the need for pre- and postexposure treatments. Monoclonal antibody (mAb) cocktails are particularly attractive candidates due to their proven postexposure efficacy in nonhuman primate models of EBOV infection. Two candidate cocktails, MB-003 and ZMAb, have been extensively evaluated in both in vitro and in vivo studies. Recently, these two therapeutics have been combined into a new cocktail named ZMapp, which showed increased efficacy and has been given compassionately to some human patients. Epitope information and mechanism of action are currently unknown for most of the component mAbs. Here we provide single-particle EM reconstructions of every mAb in the ZMapp cocktail, as well as additional antibodies from MB-003 and ZMAb. Our results illuminate key and recurring sites of vulnerability on the EBOV glycoprotein and provide a structural rationale for the efficacy of ZMapp. Interestingly, two of its components recognize overlapping epitopes and compete with each other for binding. Going forward, this work now provides a basis for strategic selection of next-generation antibody cocktails against Ebola and related viruses and a model for predicting the impact of ZMapp on potential escape mutations in ongoing or future Ebola outbreaks. PMID:25404321

  2. Single-cell polyadenylation site mapping reveals 3′ isoform choice variability

    PubMed Central

    Velten, Lars; Anders, Simon; Pekowska, Aleksandra; Järvelin, Aino I; Huber, Wolfgang; Pelechano, Vicent; Steinmetz, Lars M

    2015-01-01

    Cell-to-cell variability in gene expression is important for many processes in biology, including embryonic development and stem cell homeostasis. While heterogeneity of gene expression levels has been extensively studied, less attention has been paid to mRNA polyadenylation isoform choice. 3′ untranslated regions regulate mRNA fate, and their choice is tightly controlled during development, but how 3′ isoform usage varies within genetically and developmentally homogeneous cell populations has not been explored. Here, we perform genome-wide quantification of polyadenylation site usage in single mouse embryonic and neural stem cells using a novel single-cell transcriptomic method, BATSeq. By applying BATBayes, a statistical framework for analyzing single-cell isoform data, we find that while the developmental state of the cell globally determines isoform usage, single cells from the same state differ in the choice of isoforms. Notably this variation exceeds random selection with equal preference in all cells, a finding that was confirmed by RNA FISH data. Variability in 3′ isoform choice has potential implications on functional cell-to-cell heterogeneity as well as utility in resolving cell populations. PMID:26040288

  3. Structure-based mutagenesis reveals the albumin-binding site of the neonatal Fc receptor

    PubMed Central

    Andersen, Jan Terje; Dalhus, Bjørn; Cameron, Jason; Daba, Muluneh Bekele; Plumridge, Andrew; Evans, Leslie; Brennan, Stephan O.; Gunnarsen, Kristin Støen; Bjørås, Magnar; Sleep, Darrell; Sandlie, Inger

    2012-01-01

    Albumin is the most abundant protein in blood where it has a pivotal role as a transporter of fatty acids and drugs. Like IgG, albumin has long serum half-life, protected from degradation by pH-dependent recycling mediated by interaction with the neonatal Fc receptor, FcRn. Although the FcRn interaction with IgG is well characterized at the atomic level, its interaction with albumin is not. Here we present structure-based modelling of the FcRn–albumin complex, supported by binding analysis of site-specific mutants, providing mechanistic evidence for the presence of pH-sensitive ionic networks at the interaction interface. These networks involve conserved histidines in both FcRn and albumin domain III. Histidines also contribute to intramolecular interactions that stabilize the otherwise flexible loops at both the interacting surfaces. Molecular details of the FcRn–albumin complex may guide the development of novel albumin variants with altered serum half-life as carriers of drugs. PMID:22215085

  4. Targeted Capture Sequencing in Whitebark Pine Reveals Range-Wide Demographic and Adaptive Patterns Despite Challenges of a Large, Repetitive Genome.

    PubMed

    Syring, John V; Tennessen, Jacob A; Jennings, Tara N; Wegrzyn, Jill; Scelfo-Dalbey, Camille; Cronn, Richard

    2016-01-01

    Whitebark pine (Pinus albicaulis) inhabits an expansive range in western North America, and it is a keystone species of subalpine environments. Whitebark is susceptible to multiple threats - climate change, white pine blister rust, mountain pine beetle, and fire exclusion - and it is suffering significant mortality range-wide, prompting the tree to be listed as 'globally endangered' by the International Union for Conservation of Nature and 'endangered' by the Canadian government. Conservation collections (in situ and ex situ) are being initiated to preserve the genetic legacy of the species. Reliable, transferrable, and highly variable genetic markers are essential for quantifying the genetic profiles of seed collections relative to natural stands, and ensuring the completeness of conservation collections. We evaluated the use of hybridization-based target capture to enrich specific genomic regions from the 27 GB genome of whitebark pine, and to evaluate genetic variation across loci, trees, and geography. Probes were designed to capture 7,849 distinct genes, and screening was performed on 48 trees. Despite the inclusion of repetitive elements in the probe pool, the resulting dataset provided information on 4,452 genes and 32% of targeted positions (528,873 bp), and we were able to identify 12,390 segregating sites from 47 trees. Variations reveal strong geographic trends in heterozygosity and allelic richness, with trees from the southern Cascade and Sierra Range showing the greatest distinctiveness and differentiation. Our results show that even under non-optimal conditions (low enrichment efficiency; inclusion of repetitive elements in baits), targeted enrichment produces high quality, codominant genotypes from large genomes. The resulting data can be readily integrated into management and gene conservation activities for whitebark pine, and have the potential to be applied to other members of 5-needle pine group (Pinus subsect. Quinquefolia) due to their

  5. Targeted Capture Sequencing in Whitebark Pine Reveals Range-Wide Demographic and Adaptive Patterns Despite Challenges of a Large, Repetitive Genome

    PubMed Central

    Syring, John V.; Tennessen, Jacob A.; Jennings, Tara N.; Wegrzyn, Jill; Scelfo-Dalbey, Camille; Cronn, Richard

    2016-01-01

    Whitebark pine (Pinus albicaulis) inhabits an expansive range in western North America, and it is a keystone species of subalpine environments. Whitebark is susceptible to multiple threats – climate change, white pine blister rust, mountain pine beetle, and fire exclusion – and it is suffering significant mortality range-wide, prompting the tree to be listed as ‘globally endangered’ by the International Union for Conservation of Nature and ‘endangered’ by the Canadian government. Conservation collections (in situ and ex situ) are being initiated to preserve the genetic legacy of the species. Reliable, transferrable, and highly variable genetic markers are essential for quantifying the genetic profiles of seed collections relative to natural stands, and ensuring the completeness of conservation collections. We evaluated the use of hybridization-based target capture to enrich specific genomic regions from the 27 GB genome of whitebark pine, and to evaluate genetic variation across loci, trees, and geography. Probes were designed to capture 7,849 distinct genes, and screening was performed on 48 trees. Despite the inclusion of repetitive elements in the probe pool, the resulting dataset provided information on 4,452 genes and 32% of targeted positions (528,873 bp), and we were able to identify 12,390 segregating sites from 47 trees. Variations reveal strong geographic trends in heterozygosity and allelic richness, with trees from the southern Cascade and Sierra Range showing the greatest distinctiveness and differentiation. Our results show that even under non-optimal conditions (low enrichment efficiency; inclusion of repetitive elements in baits), targeted enrichment produces high quality, codominant genotypes from large genomes. The resulting data can be readily integrated into management and gene conservation activities for whitebark pine, and have the potential to be applied to other members of 5-needle pine group (Pinus subsect. Quinquefolia) due to

  6. Methyl substitution of a rexinoid agonist improves potency and reveals site of lipid toxicity.

    PubMed

    Atigadda, Venkatram R; Xia, Gang; Desphande, Anil; Boerma, LeeAnn J; Lobo-Ruppert, Susan; Grubbs, Clinton J; Smith, Craig D; Brouillette, Wayne J; Muccio, Donald D

    2014-06-26

    (2E,4E,6Z,8E)-8-(3',4'-Dihydro-1'(2'H)-naphthalen-1'-ylidene)-3,7-dimethyl-2,4,6-octatrienoic acid, 9cUAB30, is a selective rexinoid that displays substantial chemopreventive capacity with little toxicity. 4-Methyl-UAB30, an analogue of 9cUAB30, is a potent RXR agonist but caused increased lipid biosynthesis unlike 9cUAB30. To evaluate how methyl substitution influenced potency and lipid biosynthesis, we synthesized four 9cUAB30 homologues with methyl substitutions at the 5-, 6-, 7-, or 8-position of the tetralone ring. The syntheses and biological evaluations of these new analogues are reported here along with the X-ray crystal structures of each homologue bound to the ligand binding domain of hRXRα. We demonstrate that each homologue of 9cUAB30 is a more potent agonist, but only the 7-methyl-9cUAB30 caused severe hyperlipidemia in rats. On the basis of the X-ray crystal structures of these new rexinoids and bexarotene (Targretin) bound to hRXRα-LBD, we reveal that each rexinoid, which induced hyperlipidemia, had methyl groups that interacted with helix 7 residues of the LBD. PMID:24801499

  7. Methyl Substitution of a Rexinoid Agonist Improves Potency and Reveals Site of Lipid Toxicity

    PubMed Central

    2015-01-01

    (2E,4E,6Z,8E)-8-(3′,4′-Dihydro-1′(2′H)-naphthalen-1′-ylidene)-3,7-dimethyl-2,4,6-octatrienoic acid, 9cUAB30, is a selective rexinoid that displays substantial chemopreventive capacity with little toxicity. 4-Methyl-UAB30, an analogue of 9cUAB30, is a potent RXR agonist but caused increased lipid biosynthesis unlike 9cUAB30. To evaluate how methyl substitution influenced potency and lipid biosynthesis, we synthesized four 9cUAB30 homologues with methyl substitutions at the 5-, 6-, 7-, or 8-position of the tetralone ring. The syntheses and biological evaluations of these new analogues are reported here along with the X-ray crystal structures of each homologue bound to the ligand binding domain of hRXRα. We demonstrate that each homologue of 9cUAB30 is a more potent agonist, but only the 7-methyl-9cUAB30 caused severe hyperlipidemia in rats. On the basis of the X-ray crystal structures of these new rexinoids and bexarotene (Targretin) bound to hRXRα-LBD, we reveal that each rexinoid, which induced hyperlipidemia, had methyl groups that interacted with helix 7 residues of the LBD. PMID:24801499

  8. Deletion of CFTR Translation Start Site Reveals Functional Isoforms of the Protein in CF Patients

    PubMed Central

    Ramalho, Anabela S.; Lewandowska, Marzena A.; Farinha, Carlos M.; Mendes, Filipa; Gonçalves, Juan; Barreto, Celeste; Harris, Ann; Amaral, Margarida D.

    2009-01-01

    Background/Aims: Mutations in the CFTR gene cause Cystic Fibrosis (CF) the most common life-threatening autosomal recessive disease affecting Caucasians. We identified a CFTR mutation (c.120del23) abolishing the normal translation initiation codon, which occurs in two Portuguese CF patients. This study aims at functionally characterizing the effect of this novel mutation. Methods: RNA and protein techniques were applied to both native tissues from CF patients and recombinant cells expressing CFTR constructs to determine whether c.120del23 allows CFTR protein production through usage of alternative internal codons, and to characterize the putative truncated CFTR form(s). Results: Our data show that two shorter forms of CFTR protein are produced when the initiation translation codon is deleted indicating usage of internal initiation codons. The N-truncated CFTR generated by this mutation has decreased stability, very low processing efficiency, and drastically reduced function. Analysis of mutants of four methionine codons downstream to M1 (M82, M150, M152, M156) revealed that each of the codons M150/M152/M156 (exon 4) can mediate CFTR alternative translation. Conclusions: The CFTR N-terminus has an important role in avoiding CFTR turnover and in rendering effective its plasma membrane traffic. These data correlate well with the severe clinical phenotype of CF patients bearing the c.120del23 mutation. PMID:19910674

  9. Dynamic strategies for target-site search by DNA-binding proteins.

    PubMed

    de la Rosa, Mario A Díaz; Koslover, Elena F; Mulligan, Peter J; Spakowitz, Andrew J

    2010-06-16

    Gene regulatory proteins find their target sites on DNA remarkably quickly; the experimental binding rate for lac repressor is orders-of-magnitude higher than predicted by free diffusion alone. It has been proposed that nonspecific binding aids the search by allowing proteins to slide and hop along DNA. We develop a reaction-diffusion theory of protein translocation that accounts for transport both on and off the strand and incorporates the physical conformation of DNA. For linear DNA modeled as a wormlike chain, the distribution of hops available to a protein exhibits long, power-law tails that make the long-time displacement along the strand superdiffusive. Our analysis predicts effective superdiffusion coefficients for given nonspecific binding and unbinding rate parameters. Translocation rate exhibits a maximum at intermediate values of the binding rate constant, while search efficiency is optimized at larger binding rate constant values. Thus, our theory predicts a region of values of the nonspecific binding and unbinding rate parameters that balance the protein translocation rate and the efficiency of the search. Published data for several proteins falls within this predicted region of parameter values. PMID:20550907

  10. Dynamic Strategies for Target-Site Search by DNA-Binding Proteins

    PubMed Central

    Díaz de la Rosa, Mario A.; Koslover, Elena F.; Mulligan, Peter J.; Spakowitz, Andrew J.

    2010-01-01

    Abstract Gene regulatory proteins find their target sites on DNA remarkably quickly; the experimental binding rate for lac repressor is orders-of-magnitude higher than predicted by free diffusion alone. It has been proposed that nonspecific binding aids the search by allowing proteins to slide and hop along DNA. We develop a reaction-diffusion theory of protein translocation that accounts for transport both on and off the strand and incorporates the physical conformation of DNA. For linear DNA modeled as a wormlike chain, the distribution of hops available to a protein exhibits long, power-law tails that make the long-time displacement along the strand superdiffusive. Our analysis predicts effective superdiffusion coefficients for given nonspecific binding and unbinding rate parameters. Translocation rate exhibits a maximum at intermediate values of the binding rate constant, while search efficiency is optimized at larger binding rate constant values. Thus, our theory predicts a region of values of the nonspecific binding and unbinding rate parameters that balance the protein translocation rate and the efficiency of the search. Published data for several proteins falls within this predicted region of parameter values. PMID:20550907

  11. iTRAQ-based chromatin proteomic screen reveals CHD4-dependent recruitment of MBD2 to sites of DNA damage.

    PubMed

    Sun, Yazhou; Yang, Yeran; Shen, Hongyan; Huang, Min; Wang, Zhifeng; Liu, Yang; Zhang, Hui; Tang, Tie-Shan; Guo, Caixia

    2016-02-26

    Many DNA repair proteins can be recruited to DNA damage sites upon genotoxic stress. In order to search potential DNA repair proteins involved in cellular response to mitomycin C treatment, we utilized a quantitative proteome to uncover proteins that manifest differentially enrichment in the chromatin fraction after DNA damage. 397 proteins were identified, among which many factors were shown to be involved in chromatin modification and DNA repair by GO analysis. Specifically, methyl-CpG-binding domain protein 2 (MBD2) is revealed to be recruited to DNA damage sites after laser microirradiation, which was mediated through MBD domain and MBD2 C-terminus. Additionally, the recruitment of MBD2 is dependent on poly (ADP-ribose) and chromodomain helicase DNA-binding protein 4 (CHD4). Moreover, knockdown of MBD2 by CRISPR-Cas9 technique results in MMC sensitivity in mammalian cells. PMID:26827827

  12. Revealing the Functional States in the Active Site of BLUF Photoreceptors from Electrochromic Shift Calculations

    PubMed Central

    2014-01-01

    Photoexcitation with blue light of the flavin chromophore in BLUF photoreceptors induces a switch into a metastable signaling state that is characterized by a red-shifted absorption maximum. The red shift is due to a rearrangement in the hydrogen bond pattern around Gln63 located in the immediate proximity of the isoalloxazine ring system of the chromophore. There is a long-lasting controversy between two structural models, named Q63A and Q63J in the literature, on the local conformation of the residues Gln63 and Tyr21 in the dark state of the photoreceptor. As regards the mechanistic details of the light-activation mechanism, rotation of Gln63 is opposed by tautomerism in the Q63A and Q63J models, respectively. We provide a structure-based simulation of electrochromic shifts of the flavin chromophore in the wild type and in various site-directed mutants. The excellent overall agreement between experimental and computed data allows us to evaluate the two structural models. Compelling evidence is obtained that the Q63A model is incorrect, whereas the Q63J is fully consistent with the present computations. Finally, we confirm independently that a keto–enol tautomerization of the glutamine at position 63, which was proposed as molecular mechanism for the transition between the dark and the light-adapted state, explains the measured 10 to 15 nm red shift in flavin absorption between these two states of the protein. We believe that the accurateness of our results provides evidence that the BLUF photoreceptors absorption is fine-tuned through electrostatic interactions between the chromophore and the protein matrix, and finally that the simplicity of our theoretical model is advantageous as regards easy reproducibility and further extensions. PMID:25153778

  13. Metaproteomics and metabolomics analyses of chronically petroleum-polluted sites reveal the importance of general anaerobic processes uncoupled with degradation.

    PubMed

    Bargiela, Rafael; Herbst, Florian-Alexander; Martínez-Martínez, Mónica; Seifert, Jana; Rojo, David; Cappello, Simone; Genovese, María; Crisafi, Francesca; Denaro, Renata; Chernikova, Tatyana N; Barbas, Coral; von Bergen, Martin; Yakimov, Michail M; Ferrer, Manuel; Golyshin, Peter N

    2015-10-01

    Crude oil is one of the most important natural assets for humankind, yet it is a major environmental pollutant, notably in marine environments. One of the largest crude oil polluted areas in the word is the semi-enclosed Mediterranean Sea, in which the metabolic potential of indigenous microbial populations towards the large-scale chronic pollution is yet to be defined, particularly in anaerobic and micro-aerophilic sites. Here, we provide an insight into the microbial metabolism in sediments from three chronically polluted marine sites along the coastline of Italy: the Priolo oil terminal/refinery site (near Siracuse, Sicily), harbour of Messina (Sicily) and shipwreck of MT Haven (near Genoa). Using shotgun metaproteomics and community metabolomics approaches, the presence of 651 microbial proteins and 4776 metabolite mass features have been detected in these three environments, revealing a high metabolic heterogeneity between the investigated sites. The proteomes displayed the prevalence of anaerobic metabolisms that were not directly related with petroleum biodegradation, indicating that in the absence of oxygen, biodegradation is significantly suppressed. This suppression was also suggested by examining the metabolome patterns. The proteome analysis further highlighted the metabolic coupling between methylotrophs and sulphate reducers in oxygen-depleted petroleum-polluted sediments. PMID:26201687

  14. Femtosecond near-infrared laser microirradiation reveals a crucial role for PARP signaling on factor assemblies at DNA damage sites

    PubMed Central

    Saquilabon Cruz, Gladys Mae; Kong, Xiangduo; Silva, Bárbara Alcaraz; Khatibzadeh, Nima; Thai, Ryan; Berns, Michael W.; Yokomori, Kyoko

    2016-01-01

    Laser microirradiation is a powerful tool for real-time single-cell analysis of the DNA damage response (DDR). It is often found, however, that factor recruitment or modification profiles vary depending on the laser system employed. This is likely due to an incomplete understanding of how laser conditions/dosages affect the amounts and types of damage and the DDR. We compared different irradiation conditions using a femtosecond near-infrared laser and found distinct damage site recruitment thresholds for 53BP1 and TRF2 correlating with the dose-dependent increase of strand breaks and damage complexity. Low input-power microirradiation that induces relatively simple strand breaks led to robust recruitment of 53BP1 but not TRF2. In contrast, increased strand breaks with complex damage including crosslinking and base damage generated by high input-power microirradiation resulted in TRF2 recruitment to damage sites with no 53BP1 clustering. We found that poly(ADP-ribose) polymerase (PARP) activation distinguishes between the two damage states and that PARP activation is essential for rapid TRF2 recruitment while suppressing 53BP1 accumulation at damage sites. Thus, our results reveal that careful titration of laser irradiation conditions allows induction of varying amounts and complexities of DNA damage that are gauged by differential PARP activation regulating protein assembly at the damage site. PMID:26424850

  15. Metaproteomics and metabolomics analyses of chronically petroleum‐polluted sites reveal the importance of general anaerobic processes uncoupled with degradation

    PubMed Central

    Bargiela, Rafael; Herbst, Florian‐Alexander; Martínez‐Martínez, Mónica; Seifert, Jana; Rojo, David; Cappello, Simone; Genovese, María; Crisafi, Francesca; Denaro, Renata; Chernikova, Tatyana N.; Barbas, Coral; von Bergen, Martin; Yakimov, Michail M.; Golyshin, Peter N.

    2015-01-01

    Crude oil is one of the most important natural assets for humankind, yet it is a major environmental pollutant, notably in marine environments. One of the largest crude oil polluted areas in the word is the semi‐enclosed Mediterranean Sea, in which the metabolic potential of indigenous microbial populations towards the large‐scale chronic pollution is yet to be defined, particularly in anaerobic and micro‐aerophilic sites. Here, we provide an insight into the microbial metabolism in sediments from three chronically polluted marine sites along the coastline of Italy: the Priolo oil terminal/refinery site (near Siracuse, Sicily), harbour of Messina (Sicily) and shipwreck of MT Haven (near Genoa). Using shotgun metaproteomics and community metabolomics approaches, the presence of 651 microbial proteins and 4776 metabolite mass features have been detected in these three environments, revealing a high metabolic heterogeneity between the investigated sites. The proteomes displayed the prevalence of anaerobic metabolisms that were not directly related with petroleum biodegradation, indicating that in the absence of oxygen, biodegradation is significantly suppressed. This suppression was also suggested by examining the metabolome patterns. The proteome analysis further highlighted the metabolic coupling between methylotrophs and sulphate reducers in oxygen‐depleted petroleum‐polluted sediments. PMID:26201687

  16. Structure of a small-molecule inhibitor complexed with GlmU from Haemophilus influenzae reveals an allosteric binding site

    SciTech Connect

    Mochalkin, Igor; Lightle, Sandra; Narasimhan, Lakshmi; Bornemeier, Dirk; Melnick, Michael; VanderRoest, Steven; McDowell, Laura

    2008-04-02

    N-Acetylglucosamine-1-phosphate uridyltransferase (GlmU) is an essential enzyme in aminosugars metabolism and an attractive target for antibiotic drug discovery. GlmU catalyzes the formation of uridine-diphospho-N-acetylglucosamine (UDP-GlcNAc), an important precursor in the peptidoglycan and lipopolisaccharide biosynthesis in both Gram-negative and Gram-positive bacteria. Here we disclose a 1.9 {angstrom} resolution crystal structure of a synthetic small-molecule inhibitor of GlmU from Haemophilus influenzae (hiGlmU). The compound was identified through a high-throughput screening (HTS) configured to detect inhibitors that target the uridyltransferase active site of hiGlmU. The original HTS hit exhibited a modest micromolar potency (IC{sub 50} - 18 {mu}M in a racemic mixture) against hiGlmU and no activity against Staphylococcus aureus GlmU (saGlmU). The determined crystal structure indicated that the inhibitor occupies an allosteric site adjacent to the GlcNAc-1-P substrate-binding region. Analysis of the mechanistic model of the uridyltransferase reaction suggests that the binding of this allosteric inhibitor prevents structural rearrangements that are required for the enzymatic reaction, thus providing a basis for structure-guided design of a new class of mechanism-based inhibitors of GlmU.

  17. Crystal Structures of GII.10 and GII.12 Norovirus Protruding Domains in Complex with Histo-Blood Group Antigens Reveal Details for a Potential Site of Vulnerability

    SciTech Connect

    Hansman, Grant S.; Biertümpfel, Christian; Georgiev, Ivelin; McLellan, Jason S.; Chen, Lei; Zhou, Tongqing; Katayama, Kazuhiko; Kwong, Peter D.

    2011-10-10

    Noroviruses are the dominant cause of outbreaks of gastroenteritis worldwide, and interactions with human histo-blood group antigens (HBGAs) are thought to play a critical role in their entry mechanism. Structures of noroviruses from genogroups GI and GII in complex with HBGAs, however, reveal different modes of interaction. To gain insight into norovirus recognition of HBGAs, we determined crystal structures of norovirus protruding domains from two rarely detected GII genotypes, GII.10 and GII.12, alone and in complex with a panel of HBGAs, and analyzed structure-function implications related to conservation of the HBGA binding pocket. The GII.10- and GII.12-apo structures as well as the previously solved GII.4-apo structure resembled each other more closely than the GI.1-derived structure, and all three GII structures showed similar modes of HBGA recognition. The primary GII norovirus-HBGA interaction involved six hydrogen bonds between a terminal {alpha}fucose1-2 of the HBGAs and a dimeric capsid interface, which was composed of elements from two protruding subdomains. Norovirus interactions with other saccharide units of the HBGAs were variable and involved fewer hydrogen bonds. Sequence analysis revealed a site of GII norovirus sequence conservation to reside under the critical {alpha}fucose1-2 and to be one of the few patches of conserved residues on the outer virion-capsid surface. The site was smaller than that involved in full HBGA recognition, a consequence of variable recognition of peripheral saccharides. Despite this evasion tactic, the HBGA site of viral vulnerability may provide a viable target for small molecule- and antibody-mediated neutralization of GII norovirus.

  18. Proteomic analysis of imatinib-resistant CML-T1 cells reveals calcium homeostasis as a potential therapeutic target.

    PubMed

    Toman, O; Kabickova, T; Vit, O; Fiser, R; Polakova, K Machova; Zach, J; Linhartova, J; Vyoral, D; Petrak, J

    2016-09-01

    Chronic myeloid leukemia (CML) therapy has markedly improved patient prognosis after introduction of imatinib mesylate for clinical use. However, a subset of patients develops resistance to imatinib and other tyrosine kinase inhibitors (TKIs), mainly due to point mutations in the region encoding the kinase domain of the fused BCR-ABL oncogene. To identify potential therapeutic targets in imatinib‑resistant CML cells, we derived imatinib-resistant CML-T1 human cell line clone (CML-T1/IR) by prolonged exposure to imatinib in growth media. Mutational analysis revealed that the Y235H mutation in BCR-ABL is probably the main cause of CML-T1/IR resistance to imatinib. To identify alternative therapeutic targets for selective elimination of imatinib-resistant cells, we compared the proteome profiles of CML-T1 and CML-T1/IR cells using 2-DE-MS. We identified eight differentially expressed proteins, with strongly upregulated Na+/H+ exchanger regulatory factor 1 (NHERF1) in the resistant cells, suggesting that this protein may influence cytosolic pH, Ca2+ concentration or signaling pathways such as Wnt in CML-T1/IR cells. We tested several compounds including drugs in clinical use that interfere with the aforementioned processes and tested their relative toxicity to CML-T1 and CML-T1/IR cells. Calcium channel blockers, calcium signaling antagonists and modulators of calcium homeostasis, namely thapsigargin, ionomycin, verapamil, carboxyamidotriazole and immunosuppressive drugs cyclosporine A and tacrolimus (FK-506) were selectively toxic to CML-T1/IR cells. The putative cellular targets of these compounds in CML-T1/IR cells are postulated in this study. We propose that Ca2+ homeostasis can be a potential therapeutic target in CML cells resistant to TKIs. We demonstrate that a proteomic approach may be used to characterize a TKI-resistant population of CML cells enabling future individualized treatment options for patients. PMID:27430982

  19. Controllable Microfluidic Synthesis of Multiphase Drug-Carrying Lipospheres for Site-Targeted Therapy

    PubMed Central

    Hettiarachchi, Kanaka; Feingold, Steven; Zhang, Shirley; Lee, Abraham P.; Dayton, Paul A.

    2009-01-01

    We report the production of micrometer-sized gas-filled lipospheres using digital microfluidics technology for chemotherapeutic drug delivery. Advantages of on-chip synthesis include a monodisperse size distribution (polydispersity index (σ) values of <5%) with consistent stability and uniform drug loading. Photolithography techniques are applied to fabricate novel PDMS-based microfluidic devices that feature a combined dual hydrodynamic flow-focusing region and expanding nozzle geometry with a narrow orifice. Spherical vehicles are formed through flow-focusing by the self-assembly of phospholipids to a lipid layer around the gas core, followed by a shear-induced break off at the orifice. The encapsulation of an extra oil layer between the outer lipid shell and inner bubble gaseous core allows the safe transport of highly hydrophobic and toxic drugs at high concentrations. Doxorubicin (Dox) entrapment is estimated at 15 mg mL−1 of particles packed in a single ordered layer. In addition, the attachment of targeting ligands to the lipid shell allows for direct vehicle binding to cancer cells. Preliminary acoustic studies of these monodisperse gas lipospheres reveal a highly uniform echo correlation of greater than 95%. The potential exists for localized drug concentration and release with ultrasound energy. PMID:19455647

  20. NF-Y Binding Site Architecture Defines a C-Fos Targeted Promoter Class

    PubMed Central

    Haubrock, Martin; Hartmann, Fabian; Wingender, Edgar

    2016-01-01

    ChIP-seq experiments detect the chromatin occupancy of known transcription factors in a genome-wide fashion. The comparisons of several species-specific ChIP-seq libraries done for different transcription factors have revealed a complex combinatorial and context-specific co-localization behavior for the identified binding regions. In this study we have investigated human derived ChIP-seq data to identify common cis-regulatory principles for the human transcription factor c-Fos. We found that in four different cell lines, c-Fos targeted proximal and distal genomic intervals show prevalences for either AP-1 motifs or CCAAT boxes as known binding motifs for the transcription factor NF-Y, and thereby act in a mutually exclusive manner. For proximal regions of co-localized c-Fos and NF-YB binding, we gathered evidence that a characteristic configuration of repeating CCAAT motifs may be responsible for attracting c-Fos, probably provided by a nearby AP-1 bound enhancer. Our results suggest a novel regulatory function of NF-Y in gene-proximal regions. Specific CCAAT dimer repeats bound by the transcription factor NF-Y define this novel cis-regulatory module. Based on this behavior we propose a new enhancer promoter interaction model based on AP-1 motif defined enhancers which interact with CCAAT-box characterized promoter regions. PMID:27517874

  1. Protons and Psalmotoxin-1 reveal nonproton ligand stimulatory sites in chicken acid-sensing ion channel

    PubMed Central

    Smith, Rachel N; Gonzales, Eric B

    2014-01-01

    Acid-sensing ion channels (ASICs) are proton-sensitive, sodium-selective channels expressed in the nervous system that sense changes in extracellular pH. These ion channels are sensitive to an increasing number of nonproton ligands that include natural venom peptides and guanidine compounds. In the case of chicken ASIC1, the spider toxin Psalmotoxin-1 (PcTx1) activates the channel, resulting in an inward current. Furthermore, a growing class of ligands containing a guanidine group has been identified that stimulate peripheral ASICs (ASIC3), but exert subtle influence on other ASIC subtypes. The effects of the guanidine compounds on cASIC1 have not been the focus of previous study. Here, we investigated the interaction of the guanidine compound 2-guanidine-4-methylquinazoline (GMQ) on cASIC1 proton activation and PcTx1 stimulation. Exposure of expressed cASIC1 to PcTx1 resulted in biphasic currents consisting of a transient peak followed by an irreversible cASIC1 PcTx1 persistent current. This cASIC1 PcTx1 persistent current may be the result of locking the cASIC1 protein into a desensitized transition state. The guanidine compound GMQ increased the apparent affinity of protons on cASIC1 and decreased the half-maximal constant of the cASIC1 steady-state desensitization profile. Furthermore, GMQ stimulated the cASIC1 PcTx1 persistent current in a concentration-dependent manner, which resulted in a non-desensitizing inward current. Our data suggests that GMQ may have multiple sites within cASIC1 and may act as a “molecular wedge” that forces the PcTx1-desensitized ASIC into an open state. Our findings indicate that guanidine compounds, such as GMQ, may alter acid-sensing ion channel activity in combination with other stimuli, and that additional ASIC subtypes (along with ASIC3) may serve to sense and mediate signals from multiple stimuli. PMID:24262969

  2. The influence of target concentration, equilibration rate constant (ke0 ) and pharmacokinetic model on the initial propofol dose delivered in effect-site target-controlled infusion.

    PubMed

    Glen, J B; Engbers, F H M

    2016-03-01

    One advantage of effect-site target-controlled infusion is the administration of a larger initial dose of propofol to speed up the induction of anaesthesia. This dose is determined by the combination of the pharmacokinetic model parameters, the target setting and the blood-effect time-constant, ke0 . With the help of computer simulation, we determined the ke0 values required to deliver a range of initial doses with three pharmacokinetic models for propofol. With an effect site target of 4 μg.ml(-1) , in a 35-year-old, 170-cm tall, 70-kg male subject, the ke0 values delivering a dose of 1.75 mg.kg(-1) with the Marsh, Schnider and Eleveld models were 0.59 min(-1) , 0.20 min(-1) and 0.26 min(-1) , respectively. These ke0 values have the attractive feature that, when used to simulate the administration schemes used in two previous studies, predicted effect site concentrations at loss of consciousness were close to those required for maintenance of anaesthesia. PMID:26682512

  3. Stromal Transcriptional Profiles Reveal Hierarchies of Anatomical Site, Serum Response and Disease and Identify Disease Specific Pathways

    PubMed Central

    Parsonage, Greg N.; Legault, Holly M.; O’Toole, Margot; Pearson, Mark J.; Thomas, Andrew M.; Scheel-Toellner, Dagmar; Raza, Karim; Buckley, Christopher D.; Falciani, Francesco

    2015-01-01

    Synovial fibroblasts in persistent inflammatory arthritis have been suggested to have parallels with cancer growth and wound healing, both of which involve a stereotypical serum response programme. We tested the hypothesis that a serum response programme can be used to classify diseased tissues, and investigated the serum response programme in fibroblasts from multiple anatomical sites and two diseases. To test our hypothesis we utilized a bioinformatics approach to explore a publicly available microarray dataset including rheumatoid arthritis (RA), osteoarthritis (OA) and normal synovial tissue, then extended those findings in a new microarray dataset representing matched synovial, bone marrow and skin fibroblasts cultured from RA and OA patients undergoing arthroplasty. The classical fibroblast serum response programme discretely classified RA, OA and normal synovial tissues. Analysis of low and high serum treated fibroblast microarray data revealed a hierarchy of control, with anatomical site the most powerful classifier followed by response to serum and then disease. In contrast to skin and bone marrow fibroblasts, exposure of synovial fibroblasts to serum led to convergence of RA and OA expression profiles. Pathway analysis revealed three inter-linked gene networks characterising OA synovial fibroblasts: Cell remodelling through insulin-like growth factors, differentiation and angiogenesis through _3 integrin, and regulation of apoptosis through CD44. We have demonstrated that Fibroblast serum response signatures define disease at the tissue level, and that an OA specific, serum dependent repression of genes involved in cell adhesion, extracellular matrix remodelling and apoptosis is a critical discriminator between cultured OA and RA synovial fibroblasts. PMID:25807374

  4. The first crystal structure of human RNase 6 reveals a novel substrate-binding and cleavage site arrangement

    PubMed Central

    Prats-Ejarque, Guillem; Arranz-Trullén, Javier; Blanco, Jose A.; Pulido, David; Nogués, M. Victòria; Moussaoui, Mohammed; Boix, Ester

    2016-01-01

    Human RNase 6 is a cationic secreted protein that belongs to the RNase A superfamily. Its expression is induced in neutrophils and monocytes upon bacterial infection, suggesting a role in host defence. We present here the crystal structure of RNase 6 obtained at 1.72 Å (1 Å=0.1 nm) resolution, which is the first report for the protein 3D structure and thereby setting the basis for functional studies. The structure shows an overall kidney-shaped globular fold shared with the other known family members. Three sulfate anions bound to RNase 6 were found, interacting with residues at the main active site (His15, His122 and Gln14) and cationic surface-exposed residues (His36, His39, Arg66 and His67). Kinetic characterization, together with prediction of protein–nucleotide complexes by molecular dynamics, was applied to analyse the RNase 6 substrate nitrogenous base and phosphate selectivity. Our results reveal that, although RNase 6 is a moderate catalyst in comparison with the pancreatic RNase type, its structure includes lineage-specific features that facilitate its activity towards polymeric nucleotide substrates. In particular, enzyme interactions at the substrate 5′ end can provide an endonuclease-type cleavage pattern. Interestingly, the RNase 6 crystal structure revealed a novel secondary active site conformed by the His36–His39 dyad that facilitates the polynucleotide substrate catalysis. PMID:27013146

  5. The first crystal structure of human RNase 6 reveals a novel substrate-binding and cleavage site arrangement.

    PubMed

    Prats-Ejarque, Guillem; Arranz-Trullén, Javier; Blanco, Jose A; Pulido, David; Nogués, M Victòria; Moussaoui, Mohammed; Boix, Ester

    2016-06-01

    Human RNase 6 is a cationic secreted protein that belongs to the RNase A superfamily. Its expression is induced in neutrophils and monocytes upon bacterial infection, suggesting a role in host defence. We present here the crystal structure of RNase 6 obtained at 1.72 Å (1 Å=0.1 nm) resolution, which is the first report for the protein 3D structure and thereby setting the basis for functional studies. The structure shows an overall kidney-shaped globular fold shared with the other known family members. Three sulfate anions bound to RNase 6 were found, interacting with residues at the main active site (His(15), His(122) and Gln(14)) and cationic surface-exposed residues (His(36), His(39), Arg(66) and His(67)). Kinetic characterization, together with prediction of protein-nucleotide complexes by molecular dynamics, was applied to analyse the RNase 6 substrate nitrogenous base and phosphate selectivity. Our results reveal that, although RNase 6 is a moderate catalyst in comparison with the pancreatic RNase type, its structure includes lineage-specific features that facilitate its activity towards polymeric nucleotide substrates. In particular, enzyme interactions at the substrate 5' end can provide an endonuclease-type cleavage pattern. Interestingly, the RNase 6 crystal structure revealed a novel secondary active site conformed by the His(36)-His(39) dyad that facilitates the polynucleotide substrate catalysis. PMID:27013146

  6. Detection of target site resistance to pyrethroids and organophosphates in the horn fly using multiplex polymerase chain reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The horn fly, Haematobia irritans L., is an obligate blood-feeding fly and the primary insect pest parasitizing cattle in the United States. Pesticide resistance has become a huge problem for cattle producers and although several mechanisms of resistance are possible, target site resistance is the m...

  7. RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

  8. RNA-Seq reveals common and unique PXR- and CAR-target gene signatures in the mouse liver transcriptome.

    PubMed

    Cui, Julia Yue; Klaassen, Curtis D

    2016-09-01

    entire hepatic transcriptome correlated with a marked change in the expression of many DNA and histone epigenetic modifiers. In conclusion, the present study has revealed known and novel, as well as common and unique targets of PXR and CAR in mouse liver following pharmacological activation using their prototypical ligands. Results from this study will further support the role of these receptors in regulating the homeostasis of xenobiotic and intermediary metabolism in the liver, and aid in distinguishing between PXR and CAR signaling at various physiological and pathophysiological conditions. This article is part of a Special Issue entitled: Xenobiotic nuclear receptors: New Tricks for An Old Dog, edited by Dr. Wen Xie. PMID:27113289

  9. Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA.

    PubMed

    Svitashev, Sergei; Young, Joshua K; Schwartz, Christine; Gao, Huirong; Falco, S Carl; Cigan, A Mark

    2015-10-01

    Targeted mutagenesis, editing of endogenous maize (Zea mays) genes, and site-specific insertion of a trait gene using clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology are reported in maize. DNA vectors expressing maize codon-optimized Streptococcus pyogenes Cas9 endonuclease and single guide RNAs were cointroduced with or without DNA repair templates into maize immature embryos by biolistic transformation targeting five different genomic regions: upstream of the liguleless1 (LIG1) gene, male fertility genes (Ms26 and Ms45), and acetolactate synthase (ALS) genes (ALS1 and ALS2). Mutations were subsequently identified at all sites targeted, and plants containing biallelic multiplex mutations at LIG1, Ms26, and Ms45 were recovered. Biolistic delivery of guide RNAs (as RNA molecules) directly into immature embryo cells containing preintegrated Cas9 also resulted in targeted mutations. Editing the ALS2 gene using either single-stranded oligonucleotides or double-stranded DNA vectors as repair templates yielded chlorsulfuron-resistant plants. Double-strand breaks generated by RNA-guided Cas9 endonuclease also stimulated insertion of a trait gene at a site near LIG1 by homology-directed repair. Progeny showed expected Mendelian segregation of mutations, edits, and targeted gene insertions. The examples reported in this study demonstrate the utility of Cas9-guide RNA technology as a plant genome editing tool to enhance plant breeding and crop research needed to meet growing agriculture demands of the future. PMID:26269544

  10. Structure of Arabidopsis thaliana 5-methylthioribose Kinase Reveals a More Occluded Active Site Than its Bacterial Homolog

    SciTech Connect

    Ku,S.; Cornell, K.; Howell, P.

    2007-01-01

    Metabolic variations exist between the methionine salvage pathway of humans and a number of plants and microbial pathogens. 5-Methylthioribose (MTR) kinase is a key enzyme required for methionine salvage in plants and many bacteria. The absence of a mammalian homolog suggests that MTR kinase is a good target for the design of specific herbicides or antibiotics. The structure of Arabidopsis thaliana MTR kinase co-crystallized with ATP?S and MTR has been determined at 1.9 Angstroms resolution. The structure is similar to B. subtilis MTR kinase and has the same protein kinase fold observed in other evolutionarily related protein kinase-like phosphotransferases. The active site is comparable between the two enzymes with the DXE-motif coordinating the nucleotide-Mg, the D238 of the HGD catalytic loop polarizing the MTR O1 oxygen, and the RR-motif interacting with the substrate MTR. Unlike its bacterial homolog, however, the Gly-rich loop (G-loop) of A. thaliana MTR kinase has an extended conformation, which shields most of the active site from solvent, a feature that resembles eukaryotic protein kinases more than the bacterial enzyme. The G- and W-loops of A. thaliana and B. subtilis MTR kinase adopt different conformations despite high sequence similarity. The ATP?S analog was hydrolyzed during the co-crystallization procedure, resulting in ADP in the active site. This suggests that the A. thaliana enzyme, like its bacterial homolog, may have significant ATPase activity in the absence of MTR. The structure of A. thaliana MTR kinase provides a template for structure-based design of agrochemicals, particularly herbicides whose effectiveness could be regulated by nutrient levels. Features of the MTR binding site offer an opportunity for a simple organic salt of an MTR analog to specifically inhibit MTR kinase.

  11. The Combining Sites of Anti-lipid A Antibodies Reveal a Widely Utilized Motif Specific for Negatively Charged Groups.

    PubMed

    Haji-Ghassemi, Omid; Müller-Loennies, Sven; Rodriguez, Teresa; Brade, Lore; Grimmecke, Hans-Dieter; Brade, Helmut; Evans, Stephen V

    2016-05-01

    Lipopolysaccharide dispersed in the blood by Gram-negative bacteria can be a potent inducer of septic shock. One research focus has been based on antibody sequestration of lipid A (the endotoxic principle of LPS); however, none have been successfully developed into a clinical treatment. Comparison of a panel of anti-lipid A antibodies reveals highly specific antibodies produced through distinct germ line precursors. The structures of antigen-binding fragments for two homologous mAbs specific for lipid A, S55-3 and S55-5, have been determined both in complex with lipid A disaccharide backbone and unliganded. These high resolution structures reveal a conserved positively charged pocket formed within the complementarity determining region H2 loops that binds the terminal phosphates of lipid A. Significantly, this motif occurs in unrelated antibodies where it mediates binding to negatively charged moieties through a range of epitopes, including phosphorylated peptides used in diagnostics and therapeutics. S55-3 and S55-5 have combining sites distinct from anti-lipid A antibodies previously described (as a result of their separate germ line origin), which are nevertheless complementary both in shape and charge to the antigen. S55-3 and S55-5 display similar avidity toward lipid A despite possessing a number of different amino acid residues in their combining sites. Binding of lipid A occurs independent of the acyl chains, although the GlcN-O6 attachment point for the core oligosaccharide is buried in the combining site, which explains their inability to recognize LPS. Despite their lack of therapeutic potential, the observed motif may have significant immunological implications as a tool for engineering recombinant antibodies. PMID:26933033

  12. Revealing the Atomic Site-Dependent g Factor within a Single Magnetic Molecule via the Extended Kondo Effect

    NASA Astrophysics Data System (ADS)

    Du, Shixuan

    Control over charge and spin states at the single molecule level is crucial not only for a fundamental understanding of charge and spin interactions but also represents a prerequisite for development of molecular electronics and spintronics. In this talk, I will talk about the extended spin distribution in space beyond the central Mn ion, and onto the non-magnetic constituent atoms of the MnPc molecule. This extended spin distribution results in an extended Kondo effect, which can be explained by spin polarization induced by symmetry breaking of the molecular framework, as confirmed by DFT calculations. Measuring the evolution of the Kondo splitting with applied magnetic fields at different atomic sites, we find a spatial variation of the g-factor within a single molecule for the first time. The existence of atomic site-dependent g-factors can be attributed to specific molecular orbitals distributed over the entire molecule. This work not only open up a new opportunity for quantum information recording, but also provide a new route to explore the internal electronic and spin structure of complex molecules, hard to achieve otherwise. (L. W. Liu et al., Phys. Rev. Lett. 2015, 114, 126601. In collaboration with Liwei Liu, Kai Yang, Yuhang Jiang, Li Gao, Qi Liu, Boqun Song, Wende Xiao, Haitao Zhou, Hongjun Gao in CAS, Min Ouyang in MU, and A.H. Castro Neto in SNU.) Revealing the Atomic Site-Dependent g Factor within a Single Magnetic Molecule via the Extended Kondo Effect.

  13. Structures of bacterial kynurenine formamidase reveal a crowded binuclear zinc catalytic site primed to generate a potent nucleophile

    PubMed Central

    Díaz-Sáez, Laura; Srikannathasan, Velupillai; Zoltner, Martin; Hunter, William N.

    2014-01-01

    Tryptophan is an important precursor for chemical entities that ultimately support the biosynthesis of key metabolites. The second stage of tryptophan catabolism is catalysed by kynurenine formamidase, an enzyme that is different between eukaryotes and prokaryotes. In the present study, we characterize the catalytic properties and present the crystal structures of three bacterial kynurenine formamidases. The structures reveal a new amidase protein fold, a highly organized and distinctive binuclear Zn2+ catalytic centre in a confined, hydrophobic and relatively rigid active site. The structure of a complex with 2-aminoacetophenone delineates aspects of molecular recognition extending to the observation that the substrate itself may be conformationally restricted to assist binding in the confined space of the active site and for subsequent processing. The cations occupy a crowded environment, and, unlike most Zn2+-dependent enzymes, there is little scope to increase co-ordination number during catalysis. We propose that the presence of a bridging water/hydroxide ligand in conjunction with the placement of an active site histidine supports a distinctive amidation mechanism. PMID:24942958

  14. An anti-hapten camelid antibody reveals a cryptic binding site with significant energetic contributions from a nonhypervariable loop

    SciTech Connect

    Fanning, Sean W.; Horn, James R.

    2014-03-05

    Conventional anti-hapten antibodies typically bind low-molecular weight compounds (haptens) in the crevice between the variable heavy and light chains. Conversely, heavy chain-only camelid antibodies, which lack a light chain, must rely entirely on a single variable domain to recognize haptens. While several anti-hapten VHHs have been generated, little is known regarding the underlying structural and thermodynamic basis for hapten recognition. Here, an anti-methotrexate VHH (anti-MTX VHH) was generated using grafting methods whereby the three complementarity determining regions (CDRs) were inserted onto an existing VHH framework. Thermodynamic analysis of the anti-MTX VHH CDR1-3 Graft revealed a micromolar binding affinity, while the crystal structure of the complex revealed a somewhat surprising noncanonical binding site which involved MTX tunneling under the CDR1 loop. Due to the close proximity of MTX to CDR4, a nonhypervariable loop, the CDR4 loop sequence was subsequently introduced into the CDR1-3 graft, which resulted in a dramatic 1000-fold increase in the binding affinity. Crystal structure analysis of both the free and complex anti-MTX CDR1-4 graft revealed CDR4 plays a significant role in both intermolecular contacts and binding site conformation that appear to contribute toward high affinity binding. Additionally, the anti-MTX VHH possessed relatively high specificity for MTX over closely related compounds aminopterin and folate, demonstrating that VHH domains are capable of binding low-molecular weight ligands with high affinity and specificity, despite their reduced interface.

  15. Ligand-Directed Functional Selectivity at the Mu Opioid Receptor Revealed by Label-Free Integrative Pharmacology On-Target

    PubMed Central

    Morse, Megan; Tran, Elizabeth; Sun, Haiyan; Levenson, Robert; Fang, Ye

    2011-01-01

    Development of new opioid drugs that provide analgesia without producing dependence is important for pain treatment. Opioid agonist drugs exert their analgesia effects primarily by acting at the mu opioid receptor (MOR) sites. High-resolution differentiation of opioid ligands is crucial for the development of new lead drug candidates with better tolerance profiles. Here, we use a label-free integrative pharmacology on-target (iPOT) approach to characterize the functional selectivity of a library of known opioid ligands for the MOR. This approach is based on the ability to detect dynamic mass redistribution (DMR) arising from the activation of the MOR in living cells. DMR assays were performed in HEK-MOR cells with and without preconditioning with probe molecules using label-free resonant waveguide grating biosensors, wherein the probe molecules were used to modify the activity of specific signaling proteins downstream the MOR. DMR signals obtained were then translated into high resolution heat maps using similarity analysis based on a numerical matrix of DMR parameters. Our data indicate that the iPOT approach clearly differentiates functional selectivity for distinct MOR signaling pathways among different opioid ligands, thus opening new avenues to discover and quantify the functional selectivity of currently used and novel opioid receptor drugs. PMID:22003401

  16. Targeted mutagenesis of intergenic regions in the Neisseria gonorrhoeae gonococcal genetic island reveals multiple regulatory mechanisms controlling type IV secretion.

    PubMed

    Ramsey, Meghan E; Bender, Tobias; Klimowicz, Amy K; Hackett, Kathleen T; Yamamoto, Ami; Jolicoeur, Adrienne; Callaghan, Melanie M; Wassarman, Karen M; van der Does, Chris; Dillard, Joseph P

    2015-09-01

    Gonococci secrete chromosomal DNA into the extracellular environment using a type IV secretion system (T4SS). The secreted DNA acts in natural transformation and initiates biofilm development. Although the DNA and its effects are detectable, structural components of the T4SS are present at very low levels, suggestive of uncharacterized regulatory control. We sought to better characterize the expression and regulation of T4SS genes and found that the four operons containing T4SS genes are transcribed at very different levels. Increasing transcription of two of the operons through targeted promoter mutagenesis did not increase DNA secretion. The stability and steady-state levels of two T4SS structural proteins were affected by a homolog of tail-specific protease. An RNA switch was also identified that regulates translation of a third T4SS operon. The switch mechanism relies on two putative stem-loop structures contained within the 5' untranslated region of the transcript, one of which occludes the ribosome binding site and start codon. Mutational analysis of these stem loops supports a model in which induction of an alternative structure relieves repression. Taken together, these results identify multiple layers of regulation, including transcriptional, translational and post-translational mechanisms controlling T4SS gene expression and DNA secretion. PMID:26076069

  17. Targeted gene disruption reveals a role for natural secretory IgM in the maturation of the primary immune response.

    PubMed

    Ehrenstein, M R; O'Keefe, T L; Davies, S L; Neuberger, M S

    1998-08-18

    Accelerated development of the secondary immune response may be attributable in part to the rapid delivery of antigen to lymphoid follicles by circulating antibody elicited on primary immunization. Here we provide evidence indicating that the nonspecific IgM present in naive mice (natural antibody) plays a role in the acceleration of the primary response. Targeted deletion of the Ig microseconds polyadenylation site by use of Cre recombinase allowed the creation of mice that, although harboring a normal number of B cells expressing surface IgM, completely lacked serum IgM while retaining the other Ig isotypes. These mice retained a broadly normal B lymphocyte distribution (although containing a somewhat expanded peritoneal B1a subset) but exhibited substantial delays in mounting affinity-matured IgG responses to T cell-dependent antigens. The T cell-independent response, however, was augmented. The data indicate that the IgM present before antigen challenge (as well, possibly, as that elicited immediately after immunization) accelerates maturation of the primary response, presumably by complexing with the antigen and facilitating lymphocyte activation and/or antigen trapping. PMID:9707605

  18. Transportation risk assessment for the shipment of irradiated FFTF tritium target assemblies from the Hanford Site to the Savannah River Site

    SciTech Connect

    Nielsen, D. L.

    1997-11-19

    A Draft Technical Information Document (HNF-1855) is being prepared to evaluate proposed interim tritium and medical isotope production at the Fast Flux Test Facility (FFTF). This report examines the potential health and safety impacts associated with transportation of irradiated tritium targets from FFTF to the Savannah River Site for processing at the Tritium Extraction Facility. Potential risks to workers and members of the public during normal transportation and accident conditions are assessed.

  19. Comprehensive comparison of the interaction of the E2 master regulator with its cognate target DNA sites in 73 human papillomavirus types by sequence statistics

    PubMed Central

    Sánchez, Ignacio E.; Dellarole, Mariano; Gaston, Kevin; de Prat Gay, Gonzalo

    2008-01-01

    Mucosal human papillomaviruses (HPVs) are etiological agents of oral, anal and genital cancer. Properties of high- and low-risk HPV types cannot be reduced to discrete molecular traits. The E2 protein regulates viral replication and transcription through a finely tuned interaction with four sites at the upstream regulatory region of the genome. A computational study of the E2–DNA interaction in all 73 types within the alpha papillomavirus genus, including all known mucosal types, indicates that E2 proteins have similar DNA discrimination properties. Differences in E2–DNA interaction among HPV types lie mostly in the target DNA sequence, as opposed to the amino acid sequence of the conserved DNA-binding alpha helix of E2. Sequence logos of natural and in vitro selected sites show an asymmetric pattern of conservation arising from indirect readout, and reveal evolutionary pressure for a putative methylation site. Based on DNA sequences only, we could predict differences in binding energies with a standard deviation of 0.64 kcal/mol. These energies cluster into six discrete affinity hierarchies and uncovered a fifth E2-binding site in the genome of six HPV types. Finally, certain distances between sites, affinity hierarchies and their eventual changes upon methylation, are statistically associated with high-risk types. PMID:18084026

  20. Novel Genes Involved in Endosomal Traffic in Yeast Revealed by Suppression of a Targeting-defective Plasma Membrane ATPase Mutant

    PubMed Central

    Luo, Wen-jie; Chang, Amy

    1997-01-01

    A novel genetic selection was used to identify genes regulating traffic in the yeast endosomal system. We took advantage of a temperature-sensitive mutant in PMA1, encoding the plasma membrane ATPase, in which newly synthesized Pma1 is mislocalized to the vacuole via the endosome. Diversion of mutant Pma1 from vacuolar delivery and rerouting to the plasma membrane is a major mechanism of suppression of pma1ts. 16 independent suppressor of pma1 (sop) mutants were isolated. Identification of the corresponding genes reveals eight that are identical with VPS genes required for delivery of newly synthesized vacuolar proteins. A second group of SOP genes participates in vacuolar delivery of mutant Pma1 but is not essential for delivery of the vacuolar protease carboxypeptidase Y. Because the biosynthetic pathway to the vacuole intersects with the endocytic pathway, internalization of a bulk membrane endocytic marker FM 4-64 was assayed in the sop mutants. By this means, defective endosome-to-vacuole trafficking was revealed in a subset of sop mutants. Another subset of sop mutants displays perturbed trafficking between endosome and Golgi: impaired pro-α factor processing in these strains was found to be due to defective recycling of the trans-Golgi protease Kex2. One of these strains defective in Kex2 trafficking carries a mutation in SOP2, encoding a homologue of mammalian synaptojanin (implicated in synaptic vesicle endocytosis and recycling). Thus, cell surface delivery of mutant Pma1 can occur as a consequence of disturbances at several different sites in the endosomal system. PMID:9265642

  1. Identification of CD146 as a marker enriched for tumor-propagating capacity reveals targetable pathways in primary human sarcoma

    PubMed Central

    Voisin, Veronique; Sato, Shingo; Hirata, Makoto; Whetstone, Heather; Han, Ilkyu; Ailles, Laurie; Bader, Gary D.; Wunder, Jay; Alman, Benjamin A.

    2015-01-01

    Tumor-propagating cells (TPCs) are believed to drive cancer initiation, progression and recurrence. These cells are characterized by enhanced tumorigenicity and self-renewal. The ability to identify such cells in primary human sarcomas relies on the dye exclusion ability of tumor side population (SP) cells. Here, we performed a high-throughput cell surface antigen screen and found that CD146 is enriched in the SP population. In vivo serial transplantation assays showed that CD146+ cells are highly tumorigenic, capable of self-renewal and thus enriches for the TPC population. In addition, depletion of SP cells from the CD146+ population show that CD146+ cells and SP cells are a distinct and overlapping TPC populations. Gene expression profiling of CD146+ and SP cells revealed multiple pathways commonly upregulated in both of these populations. Inhibition of one of these upregulated pathways, Notch signaling, significantly reduced tumor growth and self-renewal. Our data demonstrate that CD146 is an effective cell surface marker for enriching TPCs in primary human sarcomas. Targeting differentially activated pathways in TPCs may provide new therapeutic strategies for treating sarcoma. PMID:26517673

  2. Network modelling reveals the mechanism underlying colitis-associated colon cancer and identifies novel combinatorial anti-cancer targets.

    PubMed

    Lu, Junyan; Zeng, Hanlin; Liang, Zhongjie; Chen, Limin; Zhang, Liyi; Zhang, Hao; Liu, Hong; Jiang, Hualiang; Shen, Bairong; Huang, Ming; Geng, Meiyu; Spiegel, Sarah; Luo, Cheng

    2015-01-01

    The connection between inflammation and tumourigenesis has been well established. However, the detailed molecular mechanism underlying inflammation-associated tumourigenesis remains unknown because this process involves a complex interplay between immune microenvironments and epithelial cells. To obtain a more systematic understanding of inflammation-associated tumourigenesis as well as to identify novel therapeutic approaches, we constructed a knowledge-based network describing the development of colitis-associated colon cancer (CAC) by integrating the extracellular microenvironment and intracellular signalling pathways. Dynamic simulations of the CAC network revealed a core network module, including P53, MDM2, and AKT, that may govern the malignant transformation of colon epithelial cells in a pro-tumor inflammatory microenvironment. Furthermore, in silico mutation studies and experimental validations led to a novel finding that concurrently targeting ceramide and PI3K/AKT pathway by chemical probes or marketed drugs achieves synergistic anti-cancer effects. Overall, our network model can guide further mechanistic studies on CAC and provide new insights into the design of combinatorial cancer therapies in a rational manner. PMID:26446703

  3. Network modelling reveals the mechanism underlying colitis-associated colon cancer and identifies novel combinatorial anti-cancer targets

    PubMed Central

    Lu, Junyan; Zeng, Hanlin; Liang, Zhongjie; Chen, Limin; Zhang, Liyi; Zhang, Hao; Liu, Hong; Jiang, Hualiang; Shen, Bairong; Huang, Ming; Geng, Meiyu; Spiegel, Sarah; Luo, Cheng

    2015-01-01

    The connection between inflammation and tumourigenesis has been well established. However, the detailed molecular mechanism underlying inflammation-associated tumourigenesis remains unknown because this process involves a complex interplay between immune microenvironments and epithelial cells. To obtain a more systematic understanding of inflammation-associated tumourigenesis as well as to identify novel therapeutic approaches, we constructed a knowledge-based network describing the development of colitis-associated colon cancer (CAC) by integrating the extracellular microenvironment and intracellular signalling pathways. Dynamic simulations of the CAC network revealed a core network module, including P53, MDM2, and AKT, that may govern the malignant transformation of colon epithelial cells in a pro-tumor inflammatory microenvironment. Furthermore, in silico mutation studies and experimental validations led to a novel finding that concurrently targeting ceramide and PI3K/AKT pathway by chemical probes or marketed drugs achieves synergistic anti-cancer effects. Overall, our network model can guide further mechanistic studies on CAC and provide new insights into the design of combinatorial cancer therapies in a rational manner. PMID:26446703

  4. Homozygosity mapping and targeted genomic sequencing reveal the gene responsible for cerebellar hypoplasia and quadrupedal locomotion in a consanguineous kindred

    PubMed Central

    Gulsuner, Suleyman; Tekinay, Ayse Begum; Doerschner, Katja; Boyaci, Huseyin; Bilguvar, Kaya; Unal, Hilal; Ors, Aslihan; Onat, O. Emre; Atalar, Ergin; Basak, A. Nazli; Topaloglu, Haluk; Kansu, Tulay; Tan, Meliha; Tan, Uner; Gunel, Murat; Ozcelik, Tayfun

    2011-01-01

    The biological basis for the development of the cerebro-cerebellar structures required for posture and gait in humans is poorly understood. We investigated a large consanguineous family from Turkey exhibiting an extremely rare phenotype associated with quadrupedal locomotion, mental retardation, and cerebro-cerebellar hypoplasia, linked to a 7.1-Mb region of homozygosity on chromosome 17p13.1–13.3. Diffusion weighted imaging and fiber tractography of the patients' brains revealed morphological abnormalities in the cerebellum and corpus callosum, in particular atrophy of superior, middle, and inferior peduncles of the cerebellum. Structural magnetic resonance imaging showed additional morphometric abnormalities in several cortical areas, including the corpus callosum, precentral gyrus, and Brodmann areas BA6, BA44, and BA45. Targeted sequencing of the entire homozygous region in three affected individuals and two obligate carriers uncovered a private missense mutation, WDR81 p.P856L, which cosegregated with the condition in the extended family. The mutation lies in a highly conserved region of WDR81, flanked by an N-terminal BEACH domain and C-terminal WD40 beta-propeller domains. WDR81 is predicted to be a transmembrane protein. It is highly expressed in the cerebellum and corpus callosum, in particular in the Purkinje cell layer of the cerebellum. WDR81 represents the third gene, after VLDLR and CA8, implicated in quadrupedal locomotion in humans. PMID:21885617

  5. Genomic Analysis Reveals Disruption of Striatal Neuronal Development and Therapeutic Targets in Human Huntington’s Disease Neural Stem Cells

    PubMed Central

    Ring, Karen L.; An, Mahru C.; Zhang, Ningzhe; O’Brien, Robert N.; Ramos, Eliana Marisa; Gao, Fuying; Atwood, Robert; Bailus, Barbara J.; Melov, Simon; Mooney, Sean D.; Coppola, Giovanni; Ellerby, Lisa M.

    2015-01-01

    Summary We utilized induced pluripotent stem cells (iPSCs) derived from Huntington’s disease (HD) patients as a human model of HD and determined that the disease phenotypes only manifest in the differentiated neural stem cell (NSC) stage, not in iPSCs. To understand the molecular basis for the CAG repeat expansion-dependent disease phenotypes in NSCs, we performed transcriptomic analysis of HD iPSCs and HD NSCs compared to isogenic controls. Differential gene expression and pathway analysis pointed to transforming growth factor β (TGF-β) and netrin-1 as the top dysregulated pathways. Using data-driven gene coexpression network analysis, we identified seven distinct coexpression modules and focused on two that were correlated with changes in gene expression due to the CAG expansion. Our HD NSC model revealed the dysregulation of genes involved in neuronal development and the formation of the dorsal striatum. The striatal and neuronal networks disrupted could be modulated to correct HD phenotypes and provide therapeutic targets. PMID:26651603

  6. Targeted sequencing reveals clonal genetic changes in the progression of early lung neoplasms and paired circulating DNA.

    PubMed

    Izumchenko, Evgeny; Chang, Xiaofei; Brait, Mariana; Fertig, Elana; Kagohara, Luciane T; Bedi, Atul; Marchionni, Luigi; Agrawal, Nishant; Ravi, Rajani; Jones, Sian; Hoque, Mohammad O; Westra, William H; Sidransky, David

    2015-01-01

    Lungs resected for adenocarcinomas often harbour minute discrete foci of cytologically atypical pneumocyte proliferations designated as atypical adenomatous hyperplasia (AAH). Evidence suggests that AAH represents an initial step in the progression to adenocarcinoma in situ (AIS), minimally invasive adenocarcinoma (MIA) and fully invasive adenocarcinoma. Despite efforts to identify predictive markers of malignant transformation, alterations driving this progression are poorly understood. Here we perform targeted next-generation sequencing on multifocal AAHs and different zones of histologic progression within AISs and MIAs. Multiregion sequencing demonstrated different genetic drivers within the same tumour and reveal that clonal expansion is an early event of tumorigenesis. We find that KRAS, TP53 and EGFR mutations are indicators of malignant transition. Utilizing droplet digital PCR, we find alterations associated with early neoplasms in paired circulating DNA. This study provides insight into the heterogeneity of clonal events in the progression of early lung neoplasia and demonstrates that these events can be detected even before neoplasms have invaded and acquired malignant potential. PMID:26374070

  7. Systemic analysis of inducible target of rapamycin mutants reveal a general metabolic switch controlling growth in Arabidopsis thaliana.

    PubMed

    Caldana, Camila; Li, Yan; Leisse, Andrea; Zhang, Yi; Bartholomaeus, Lisa; Fernie, Alisdair R; Willmitzer, Lothar; Giavalisco, Patrick

    2013-03-01

    The target of rapamycin (TOR) pathway is a major regulator of growth in all eukaryotes, integrating energy, nutrient and stress signals into molecular decisions. By using large-scale MS-based metabolite profiling of primary, secondary and lipid compounds in combination with array-based transcript profiling, we show that the TOR protein not only regulates growth but also influences nutrient partitioning and central energy metabolism. The study was performed on plants exhibiting conditional down-regulation of AtTOR expression, revealing strong regulation of genes involved in pathways such as the cell cycle, cell-wall modifications and senescence, together with major changes in transcripts and metabolites of the primary and secondary metabolism. In agreement with these results, our morphological and metabolic analyses disclosed major metabolic changes leading to massive accumulations of storage lipids and starch. The implications of these data in the context of the general role of TOR in eukaryotic systems are discussed in parallel with the plant-specific aspects of TOR function. Finally, we propose a role for harnessing the plant TOR pathway by utilizing it as a potent metabolic switch, offering a possible route for biotechnological optimization of plant energy content and carbon partitioning for the production of bioenergy. PMID:23173928

  8. HDAC2 blockade by nitric oxide and histone deacetylase inhibitors reveals a common target in Duchenne muscular dystrophy treatment.

    PubMed

    Colussi, Claudia; Mozzetta, Chiara; Gurtner, Aymone; Illi, Barbara; Rosati, Jessica; Straino, Stefania; Ragone, Gianluca; Pescatori, Mario; Zaccagnini, Germana; Antonini, Annalisa; Minetti, Giulia; Martelli, Fabio; Piaggio, Giulia; Gallinari, Paola; Steinkuhler, Christian; Steinkulher, Christian; Clementi, Emilio; Dell'Aversana, Carmela; Altucci, Lucia; Mai, Antonello; Capogrossi, Maurizio C; Puri, Pier Lorenzo; Gaetano, Carlo

    2008-12-01

    The overlapping histological and biochemical features underlying the beneficial effect of deacetylase inhibitors and NO donors in dystrophic muscles suggest an unanticipated molecular link among dystrophin, NO signaling, and the histone deacetylases (HDACs). Higher global deacetylase activity and selective increased expression of the class I histone deacetylase HDAC2 were detected in muscles of dystrophin-deficient MDX mice. In vitro and in vivo siRNA-mediated down-regulation of HDAC2 in dystrophic muscles was sufficient to replicate the morphological and functional benefits observed with deacetylase inhibitors and NO donors. We found that restoration of NO signaling in vivo, by adenoviral-mediated expression of a constitutively active endothelial NOS mutant in MDX muscles, and in vitro, by exposing MDX-derived satellite cells to NO donors, resulted in HDAC2 blockade by cysteine S-nitrosylation. These data reveal a special contribution of HDAC2 in the pathogenesis of Duchenne muscular dystrophy and indicate that HDAC2 inhibition by NO-dependent S-nitrosylation is important for the therapeutic response to NO donors in MDX mice. They also define a common target for independent pharmacological interventions in the treatment of Duchenne muscular dystrophy. PMID:19047631

  9. HDAC2 blockade by nitric oxide and histone deacetylase inhibitors reveals a common target in Duchenne muscular dystrophy treatment

    PubMed Central

    Colussi, Claudia; Mozzetta, Chiara; Gurtner, Aymone; Illi, Barbara; Rosati, Jessica; Straino, Stefania; Ragone, Gianluca; Pescatori, Mario; Zaccagnini, Germana; Antonini, Annalisa; Minetti, Giulia; Martelli, Fabio; Piaggio, Giulia; Gallinari, Paola; Steinkuhler, Christian; Clementi, Emilio; Dell'Aversana, Carmela; Altucci, Lucia; Mai, Antonello; Capogrossi, Maurizio C.; Puri, Pier Lorenzo; Gaetano, Carlo

    2008-01-01

    The overlapping histological and biochemical features underlying the beneficial effect of deacetylase inhibitors and NO donors in dystrophic muscles suggest an unanticipated molecular link among dystrophin, NO signaling, and the histone deacetylases (HDACs). Higher global deacetylase activity and selective increased expression of the class I histone deacetylase HDAC2 were detected in muscles of dystrophin-deficient MDX mice. In vitro and in vivo siRNA-mediated down-regulation of HDAC2 in dystrophic muscles was sufficient to replicate the morphological and functional benefits observed with deacetylase inhibitors and NO donors. We found that restoration of NO signaling in vivo, by adenoviral-mediated expression of a constitutively active endothelial NOS mutant in MDX muscles, and in vitro, by exposing MDX-derived satellite cells to NO donors, resulted in HDAC2 blockade by cysteine S-nitrosylation. These data reveal a special contribution of HDAC2 in the pathogenesis of Duchenne muscular dystrophy and indicate that HDAC2 inhibition by NO-dependent S-nitrosylation is important for the therapeutic response to NO donors in MDX mice. They also define a common target for independent pharmacological interventions in the treatment of Duchenne muscular dystrophy. PMID:19047631

  10. Targeted sequencing reveals clonal genetic changes in the progression of early lung neoplasms and paired circulating DNA

    PubMed Central

    Izumchenko, Evgeny; Chang, Xiaofei; Brait, Mariana; Fertig, Elana; Kagohara, Luciane T.; Bedi, Atul; Marchionni, Luigi; Agrawal, Nishant; Ravi, Rajani; Jones, Sian; Hoque, Mohammad O.; Westra, William H.; Sidransky, David

    2015-01-01

    Lungs resected for adenocarcinomas often harbour minute discrete foci of cytologically atypical pneumocyte proliferations designated as atypical adenomatous hyperplasia (AAH). Evidence suggests that AAH represents an initial step in the progression to adenocarcinoma in situ (AIS), minimally invasive adenocarcinoma (MIA) and fully invasive adenocarcinoma. Despite efforts to identify predictive markers of malignant transformation, alterations driving this progression are poorly understood. Here we perform targeted next-generation sequencing on multifocal AAHs and different zones of histologic progression within AISs and MIAs. Multiregion sequencing demonstrated different genetic drivers within the same tumour and reveal that clonal expansion is an early event of tumorigenesis. We find that KRAS, TP53 and EGFR mutations are indicators of malignant transition. Utilizing droplet digital PCR, we find alterations associated with early neoplasms in paired circulating DNA. This study provides insight into the heterogeneity of clonal events in the progression of early lung neoplasia and demonstrates that these events can be detected even before neoplasms have invaded and acquired malignant potential. PMID:26374070

  11. Site-specific gene targeting using transcription activator-like effector (TALE)-based nuclease in Brassica oleracea.

    PubMed

    Sun, Zijian; Li, Nianzu; Huang, Guodong; Xu, Junqiang; Pan, Yu; Wang, Zhimin; Tang, Qinglin; Song, Ming; Wang, Xiaojia

    2013-11-01

    Site-specific recognition modules with DNA nuclease have tremendous potential as molecular tools for genome targeting. The type III transcription activator-like effectors (TALEs) contain a DNA binding domain consisting of tandem repeats that can be engineered to bind user-defined specific DNA sequences. We demonstrated that customized TALE-based nucleases (TALENs), constructed using a method called "unit assembly", specifically target the endogenous FRIGIDA gene in Brassica oleracea L. var. capitata L. The results indicate that the TALENs bound to the target site and cleaved double-strand DNA in vitro and in vivo, whereas the effector binding elements have a 23 bp spacer. The T7 endonuclease I assay and sequencing data show that TALENs made double-strand breaks, which were repaired by a non-homologous end-joining pathway within the target sequence. These data show the feasibility of applying customized TALENs to target and modify the genome with deletions in those organisms that are still in lacking gene target methods to provide germplasms in breeding improvement. PMID:23870552

  12. Association genetics in Populus reveals the interactions between Pto-miR160a and its target Pto-ARF16.

    PubMed

    Tian, Jiaxing; Chen, Jinhui; Li, Bailian; Zhang, Deqiang

    2016-06-01

    MicroRNAs (miRNAs) play important roles in the regulation of gene expression in various biological processes. However, the interactions between miRNAs and their targets are largely unknown in plants. As a powerful tool for identification of variation associated with traits, association genetics provides another strategy for exploration of interactions between miRNAs and their targets. Here, we conducted expression analysis and association mapping to evaluate the interaction between Pto-miR160a and its target Pto-ARF16 in Populus tomentosa. By examining the expression patterns of Pto-MIR160a and Pto-ARF16, we identified a significant, negative correlation between their expression levels, indicating that Pto-miR160a may affect the expression of Pto-ARF16. Among the single nucleotide polymorphisms (SNPs) identified in this study, one common SNP in the pre-miRNA region of Pto-miR160a altered its predicted secondary structure while another common SNP in the predicted miRNA target site changed the binding affinity of Pto-miR160a. Linkage disequilibrium (LD) analysis revealed low LD levels of Pto-MIR160a and Pto-ARF16, indicating that they are suitable for candidate gene-based association analysis. Single SNP-based association analysis identified 19 SNPs (false discovery rate Q < 0.05) in Pto-MIR160a and Pto-ARF16 associated with three phenotypic traits. Epistasis analysis further identified 36 SNP-SNP interactions between SNPs in Pto-MIR160a and SNPs in Pto-ARF16, reflecting the possible genetic interaction of Pto-miR160a and Pto-ARF16. Taking these results together, our study identified SNPs in Pto-MIR160a and Pto-ARF16 associated with tree growth and wood properties, providing SNPs with potential applications in marker-assisted breeding and evidence for the genetic interaction of Pto-miR160a and Pto-ARF16. PMID:26732268

  13. Site-directed spectroscopy of cardiac myosin-binding protein C reveals effects of phosphorylation on protein structural dynamics.

    PubMed

    Colson, Brett A; Thompson, Andrew R; Espinoza-Fonseca, L Michel; Thomas, David D

    2016-03-22

    We have used the site-directed spectroscopies of time-resolved fluorescence resonance energy transfer (TR-FRET) and double electron-electron resonance (DEER), combined with complementary molecular dynamics (MD) simulations, to resolve the structure and dynamics of cardiac myosin-binding protein C (cMyBP-C), focusing on the N-terminal region. The results have implications for the role of this protein in myocardial contraction, with particular relevance to β-adrenergic signaling, heart failure, and hypertrophic cardiomyopathy. N-terminal cMyBP-C domains C0-C2 (C0C2) contain binding regions for potential interactions with both thick and thin filaments. Phosphorylation by PKA in the MyBP-C motif regulates these binding interactions. Our spectroscopic assays detect distances between pairs of site-directed probes on cMyBP-C. We engineered intramolecular pairs of labeling sites within cMyBP-C to measure, with high resolution, the distance and disorder in the protein's flexible regions using TR-FRET and DEER. Phosphorylation reduced the level of molecular disorder and the distribution of C0C2 intramolecular distances became more compact, with probes flanking either the motif between C1 and C2 or the Pro/Ala-rich linker (PAL) between C0 and C1. Further insight was obtained from microsecond MD simulations, which revealed a large structural change in the disordered motif region in which phosphorylation unmasks the surface of a series of residues on a stable α-helix within the motif with high potential as a protein-protein interaction site. These experimental and computational findings elucidate structural transitions in the flexible and dynamic portions of cMyBP-C, providing previously unidentified molecular insight into the modulatory role of this protein in cardiac muscle contractility. PMID:26908877

  14. Targeted Next-Generation Sequencing of a 12.5 Mb Homozygous Region Reveals ANO10 Mutations in Patients with Autosomal-Recessive Cerebellar Ataxia

    PubMed Central

    Vermeer, Sascha; Hoischen, Alexander; Meijer, Rowdy P.P.; Gilissen, Christian; Neveling, Kornelia; Wieskamp, Nienke; de Brouwer, Arjan; Koenig, Michel; Anheim, Mathieu; Assoum, Mirna; Drouot, Nathalie; Todorovic, Slobodanka; Milic-Rasic, Vedrana; Lochmüller, Hanns; Stevanin, Giovanni; Goizet, Cyril; David, Albert; Durr, Alexandra; Brice, Alexis; Kremer, Berry; van de Warrenburg, Bart P.C.; Schijvenaars, Mascha M.V.A.P.; Heister, Angelien; Kwint, Michael; Arts, Peer; van der Wijst, Jenny; Veltman, Joris; Kamsteeg, Erik-Jan; Scheffer, Hans; Knoers, Nine

    2010-01-01

    Autosomal-recessive cerebellar ataxias comprise a clinically and genetically heterogeneous group of neurodegenerative disorders. In contrast to their dominant counterparts, unraveling the molecular background of these ataxias has proven to be more complicated and the currently known mutations provide incomplete coverage for genotyping of patients. By combining SNP array-based linkage analysis and targeted resequencing of relevant sequences in the linkage interval with the use of next-generation sequencing technology, we identified a mutation in a gene and have shown its association with autosomal-recessive cerebellar ataxia. In a Dutch consanguineous family with three affected siblings a homozygous 12.5 Mb region on chromosome 3 was targeted by array-based sequence capture. Prioritization of all detected sequence variants led to four candidate genes, one of which contained a variant with a high base pair conservation score (phyloP score: 5.26). This variant was a leucine-to-arginine substitution in the DUF 590 domain of a 16K transmembrane protein, a putative calcium-activated chloride channel encoded by anoctamin 10 (ANO10). The analysis of ANO10 by Sanger sequencing revealed three additional mutations: a homozygous mutation (c.1150_1151del [p.Leu384fs]) in a Serbian family and a compound-heterozygous splice-site mutation (c.1476+1G>T) and a frameshift mutation (c.1604del [p.Leu535X]) in a French family. This illustrates the power of using initial homozygosity mapping with next-generation sequencing technology to identify genes involved in autosomal-recessive diseases. Moreover, identifying a putative calcium-dependent chloride channel involved in cerebellar ataxia adds another pathway to the list of pathophysiological mechanisms that may cause cerebellar ataxia. PMID:21092923

  15. A nicotinic acetylcholine receptor mutation conferring target-site resistance to imidacloprid in Nilaparvata lugens (brown planthopper).

    PubMed

    Liu, Zewen; Williamson, Martin S; Lansdell, Stuart J; Denholm, Ian; Han, Zhaojun; Millar, Neil S

    2005-06-14

    Neonicotinoids, such as imidacloprid, are nicotinic acetylcholine receptor (nAChR) agonists with potent insecticidal activity. Since its introduction in the early 1990s, imidacloprid has become one of the most extensively used insecticides for both crop protection and animal health applications. As with other classes of insecticides, resistance to neonicotinoids is a significant threat and has been identified in several pest species, including the brown planthopper, Nilaparvata lugens, a major rice pest in many parts of Asia. In this study, radioligand binding experiments have been conducted with whole-body membranes prepared from imidacloprid-susceptible and imidacloprid-resistant strains of N. lugens. The results reveal a much higher level of [3H]imidacloprid-specific binding to the susceptible strain than to the resistant strain (16.7 +/- 1.0 and 0.34 +/- 0.21 fmol/mg of protein, respectively). With the aim of understanding the molecular basis of imidacloprid resistance, five nAChR subunits (Nlalpha1-Nlalpha4 and Nlbeta1) have been cloned from N. lugens.A comparison of nAChR subunit genes from imidacloprid-sensitive and imidacloprid-resistant populations has identified a single point mutation at a conserved position (Y151S) in two nAChR subunits, Nlalpha1 and Nlalpha3. A strong correlation between the frequency of the Y151S point mutation and the level of resistance to imidacloprid has been demonstrated by allele-specific PCR. By expression of hybrid nAChRs containing N. lugens alpha and rat beta2 subunits, evidence was obtained that demonstrates that mutation Y151S is responsible for a substantial reduction in specific [3H]imidacloprid binding. This study provides direct evidence for the occurrence of target-site resistance to a neonicotinoid insecticide. PMID:15937112

  16. Alternative Mammalian Target of Rapamycin (mTOR) Signal Activation in Sorafenib-resistant Hepatocellular Carcinoma Cells Revealed by Array-based Pathway Profiling*

    PubMed Central

    Masuda, Mari; Chen, Wei-Yu; Miyanaga, Akihiko; Nakamura, Yuka; Kawasaki, Kumiko; Sakuma, Tomohiro; Ono, Masaya; Chen, Chi-Long; Honda, Kazufumi; Yamada, Tesshi

    2014-01-01

    Sorafenib is a multi-kinase inhibitor that has been proven effective for the treatment of unresectable hepatocellular carcinoma (HCC). However, its precise mechanisms of action and resistance have not been well established. We have developed high-density fluorescence reverse-phase protein arrays and used them to determine the status of 180 phosphorylation sites of signaling molecules in the 120 pathways registered in the NCI-Nature curated database in 23 HCC cell lines. Among the 180 signaling nodes, we found that the level of ribosomal protein S6 phosphorylated at serine residue 235/236 (p-RPS6 S235/236) was most significantly correlated with the resistance of HCC cells to sorafenib. The high expression of p-RPS6 S235/236 was confirmed immunohistochemically in biopsy samples obtained from HCC patients who responded poorly to sorafenib. Sorafenib-resistant HCC cells showed constitutive activation of the mammalian target of rapamycin (mTOR) pathway, but whole-exon sequencing of kinase genes revealed no evident alteration in the pathway. p-RPS6 S235/236 is a potential biomarker that predicts unresponsiveness of HCC to sorafenib. The use of mTOR inhibitors may be considered for the treatment of such tumors. PMID:24643969

  17. Selective Targeting of the TPX2 Site of Importin-α Using Fragment-Based Ligand Design.

    PubMed

    Holvey, Rhian S; Valkov, Eugene; Neal, David; Stewart, Murray; Abell, Chris

    2015-07-01

    Protein-protein interactions are difficult therapeutic targets, and inhibiting pathologically relevant interactions without disrupting other essential ones presents an additional challenge. Herein we report how this might be achieved for the potential anticancer target, the TPX2-importin-α interaction. Importin-α is a nuclear transport protein that regulates the spindle assembly protein TPX2. It has two binding sites--major and minor-to which partners bind. Most nuclear transport cargoes use the major site, whereas TPX2 binds principally to the minor site. Fragment-based approaches were used to identify small molecules that bind importin-α, and crystallographic studies identified a lead series that was observed to bind specifically to the minor site, representing the first ligands specific for this site. Structure-guided synthesis informed the elaboration of these fragments to explore the source of ligand selectivity between the minor and major sites. These ligands are starting points for the development of inhibitors of this protein-protein interaction. PMID:25899172

  18. Novel structure--function information on biogenic amine transporters revealed by site-directed mutagenesis and alkylation.

    PubMed

    Reith, Maarten E A

    2013-07-01

    The study reported by Wenge and Bönisch in this issue provides critical structural information regarding extracellular loop 2 (EL2) of the human norepinephrine transporter (NET). A systematic search among all 10 cysteine and 13 histidine residues in NET led to His222 in EL2 as the target for N-ethylmaleimide: its alkylation interferes with [(3)H]nisoxetine binding, indicating the part of EL2 containing His 222 reaches back into the protein interior where it prevents access by nisoxetine to its binding site. Thus, EL2 in human NET does much more than conformationally assisting substrate translocation. The present study underscores the importance of site-directed mutagenesis approaches to elucidate structural features that cannot be deduced from crystals of homolog proteins. In the case of NET, the closest crystal structure is that of the homolog LeuT, but EL2 is difficult to align with 22 less loop residues in LeuT than in NET. The present results could only be achieved by the systematic mutagenesis study of all cysteines and all histidines in NET. PMID:23532308

  19. The casposon-encoded Cas1 protein from Aciduliprofundum boonei is a DNA integrase that generates target site duplications.

    PubMed

    Hickman, Alison B; Dyda, Fred

    2015-12-15

    Many archaea and bacteria have an adaptive immune system known as CRISPR which allows them to recognize and destroy foreign nucleic acid that they have previously encountered. Two CRISPR-associated proteins, Cas1 and Cas2, are required for the acquisition step of adaptation, in which fragments of foreign DNA are incorporated into the host CRISPR locus. Cas1 genes have also been found scattered in several archaeal and bacterial genomes, unassociated with CRISPR loci or other cas proteins. Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, suggesting that these genetic regions might be mobile elements ('casposons'). To investigate this possibility, we have characterized the in vitro activities of the putative Cas1 transposase ('casposase') from Aciduliprofundum boonei. The purified Cas1 casposase can integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casposon into target DNA. Casposon integration occurs without target specificity and generates 14-15 basepair target site duplications, consistent with those found in casposon host genomes. Thus, Cas1 casposases carry out similar biochemical reactions as the CRISPR Cas1-Cas2 complex but with opposite substrate specificities: casposases integrate specific sequences into random target sites, whereas CRISPR Cas1-Cas2 integrates essentially random sequences into a specific site in the CRISPR locus. PMID:26573596

  20. The casposon-encoded Cas1 protein from Aciduliprofundum boonei is a DNA integrase that generates target site duplications

    PubMed Central

    Hickman, Alison B.; Dyda, Fred

    2015-01-01

    Many archaea and bacteria have an adaptive immune system known as CRISPR which allows them to recognize and destroy foreign nucleic acid that they have previously encountered. Two CRISPR-associated proteins, Cas1 and Cas2, are required for the acquisition step of adaptation, in which fragments of foreign DNA are incorporated into the host CRISPR locus. Cas1 genes have also been found scattered in several archaeal and bacterial genomes, unassociated with CRISPR loci or other cas proteins. Rather, they are flanked by nearly identical inverted repeats and enclosed within direct repeats, suggesting that these genetic regions might be mobile elements (‘casposons’). To investigate this possibility, we have characterized the in vitro activities of the putative Cas1 transposase (‘casposase’) from Aciduliprofundum boonei. The purified Cas1 casposase can integrate both short oligonucleotides with inverted repeat sequences and a 2.8 kb excised mini-casposon into target DNA. Casposon integration occurs without target specificity and generates 14–15 basepair target site duplications, consistent with those found in casposon host genomes. Thus, Cas1 casposases carry out similar biochemical reactions as the CRISPR Cas1-Cas2 complex but with opposite substrate specificities: casposases integrate specific sequences into random target sites, whereas CRISPR Cas1-Cas2 integrates essentially random sequences into a specific site in the CRISPR locus. PMID:26573596

  1. Synaptic targeting of AMPA receptors is regulated by a CaMKII site in the first intracellular loop of GluA1

    PubMed Central

    Lu, Wei; Isozaki, Kaname; Roche, Katherine W.; Nicoll, Roger A.

    2010-01-01

    The accumulation of AMPA receptors (AMPARs) at synapses is essential for excitatory synaptic transmission. However, the mechanisms underlying synaptic targeting of AMPARs remain elusive. We have now used a molecular replacement approach on an AMPAR-null background to investigate the targeting mechanisms necessary for regulating AMPAR trafficking in the hippocampus. Although there is an extensive literature on the role of the GluA1 C-tail in AMPAR trafficking, there is no effect of overexpressing the C-tail on basal transmission. Instead, we found that the first intracellular loop domain (Loop1) of GluA1, a previously overlooked region within AMPARs, is critical for receptor targeting to synapses, but not for delivery of receptors to the plasma membrane. We also identified a CaMKII phosphorylation site (S567) in the GluA1 Loop1, which is phosphorylated in vitro and in vivo. Furthermore, we show that S567 is a key residue that regulates Loop1-mediated AMPAR trafficking. Thus, our study reveals a unique mechanism for targeting AMPARs to synapses to mediate synaptic transmission. PMID:21135237

  2. Encapsulation of paclitaxel into lauric acid-O-carboxymethyl chitosan-transferrin micelles for hydrophobic drug delivery and site-specific targeted delivery.

    PubMed

    Nam, Joung-Pyo; Park, Seong-Cheol; Kim, Tae-Hun; Jang, Jae-Yeang; Choi, Changyong; Jang, Mi-Kyeong; Nah, Jae-Woon

    2013-11-30

    Transferrin/PEG/O-carboxymethyl chitosan/fatty acid/paclitaxel (TPOCFP) micelles were tested for suitability as a drug carrier characterized by low cytotoxicity, sustained release, high cellular uptake, and site-specific targeted delivery of hydrophobic drugs. Characterization, drug content, encapsulation efficiency, and in vitro drug release were investigated. When the feeding amount of paclitaxel (PTX) was increased, the drug content increased, but loading efficiency decreased. TPOCFP micelles had a spherical shape, with a particle size of approximately 140-649 nm. In vitro cell cytotoxicity and hemolysis assays were conducted to confirm the safety of the micelles. Anticancer activity and confocal laser scanning microscopy (CLSM) were used to confirm the targeting efficiency of target ligand-modified TPOCFP micelles. Anticancer activity and CLSM results clearly demonstrated that transferrin-modified TPOCFP micelles were quickly taken up by the cell. The endocytic pathway of TPOCFP micelles was analyzed by flow cytometry, revealing transfection via receptor-mediated endocytosis. These results suggest that PTX-encapsulated TPOCFP micelles may be used as an effective cancer-targeting drug delivery system for chemotherapy. PMID:24076228

  3. Ancient DNA analyses of early archaeological sites in New Zealand reveal extreme exploitation of moa (Aves: Dinornithiformes) at all life stages

    NASA Astrophysics Data System (ADS)

    Oskam, Charlotte L.; Allentoft, Morten E.; Walter, Richard; Scofield, R. Paul; Haile, James; Holdaway, Richard N.; Bunce, Michael; Jacomb, Chris

    2012-10-01

    The human colonisation of New Zealand in the late thirteenth century AD led to catastrophic impacts on the local biota and is among the most compelling examples of human over-exploitation of native fauna, including megafauna. Nearly half of the species in New Zealand' s pre-human avifauna are now extinct, including all nine species of large, flightless moa (Aves: Dinornithiformes). The abundance of moa in early archaeological sites demonstrates the significance of these megaherbivores in the diet of the first New Zealanders. Combining moa assemblage data, based on DNA identification of eggshell and bone, with morphological identification of bone (literature and museum catalogued specimens), we present the most comprehensive audit of moa to date from several significant 13th-15th century AD archaeological deposits across the east coast of the South Island. Mitochondrial DNA (mtDNA) was amplified from 251 of 323 (78%) eggshell fragments and 22 of 27 (88%) bone samples, and the analyses revealed the presence of four moa species: Anomalopteryx didiformis; Dinornis robustus; Emeus crassus and Euryapteryx curtus. The mtDNA, along with polymorphic microsatellite markers, enabled an estimate of the minimum number of individual eggs consumed at each site. Remarkably, in one deposit over 50 individual eggs were identified - a number that likely represents a considerable proportion of the total reproductive output of moa in the area and emphasises that human predation of all life stages of moa was intense. Molecular sexing was conducted on bones (n = 11). Contrary to previous ancient DNA studies from natural sites that consistently report an excess of female moa, we observed an excess of males (2.7:1), suggestive that males were preferential targets. This could be related to different behaviour between the two highly size-dimorphic sexes in moa. Lastly, we investigated the moa species from recovered skeletal and eggshell remains from seven Wairau Bar burials, and identified

  4. Structure of the Acinetobacter baumannii Dithiol Oxidase DsbA Bound to Elongation Factor EF-Tu Reveals a Novel Protein Interaction Site

    PubMed Central

    Premkumar, Lakshmanane; Kurth, Fabian; Duprez, Wilko; Grøftehauge, Morten K.; King, Gordon J.; Halili, Maria A.; Heras, Begoña; Martin, Jennifer L.

    2014-01-01

    The multidrug resistant bacterium Acinetobacter baumannii is a significant cause of nosocomial infection. Biofilm formation, that requires both disulfide bond forming and chaperone-usher pathways, is a major virulence trait in this bacterium. Our biochemical characterizations show that the periplasmic A. baumannii DsbA (AbDsbA) enzyme has an oxidizing redox potential and dithiol oxidase activity. We found an unexpected non-covalent interaction between AbDsbA and the highly conserved prokaryotic elongation factor, EF-Tu. EF-Tu is a cytoplasmic protein but has been localized extracellularly in many bacterial pathogens. The crystal structure of this complex revealed that the EF-Tu switch I region binds to the non-catalytic surface of AbDsbA. Although the physiological and pathological significance of a DsbA/EF-Tu association is unknown, peptides derived from the EF-Tu switch I region bound to AbDsbA with submicromolar affinity. We also identified a seven-residue DsbB-derived peptide that bound to AbDsbA with low micromolar affinity. Further characterization confirmed that the EF-Tu- and DsbB-derived peptides bind at two distinct sites. These data point to the possibility that the non-catalytic surface of DsbA is a potential substrate or regulatory protein interaction site. The two peptides identified in this work together with the newly characterized interaction site provide a novel starting point for inhibitor design targeting AbDsbA. PMID:24860094

  5. Contact Bioassays with Phenoxybenzyl and Tetrafluorobenzyl Pyrethroids against Target-Site and Metabolic Resistant Mosquitoes

    PubMed Central

    Horstmann, Sebastian; Sonneck, Rainer

    2016-01-01

    Background Mosquito strains that exhibit increased tolerance to the chemical class of compounds with a sodium channel modulator mode of action (pyrethroids and pyrethrins) are typically described as “pyrethroid resistant”. Resistance to pyrethroids is an increasingly important challenge in the control of mosquito-borne diseases, such as malaria or dengue, because one of the main interventions (the distribution of large numbers of long-lasting insecticide-treated bed nets) currently relies entirely on long-lasting pyrethroids. Increasing tolerance of target insects against this class of insecticides lowers their impact in vector control. The current study suggests that the level of metabolic resistance depends on the structure of the molecule and that structurally different compounds may still be effective because detoxifying enzymes are unable to bind to these uncommon structures. Methods Treated surface contact bioassays were performed on susceptible Aedes aegypti, East African knockdown resistance (kdr) Anopheles gambiae (strain RSP-H) and metabolically resistant Anopheles funestus (strain FUMOZ-R) with different pyrethroids, such as cypermethrin, ß-cyfluthrin, deltamethrin, permethrin and transfluthrin (alone and in combination with the synergist piperonyl butoxide). The nonfluorinated form of transfluthrin was also assessed as a single agent and in combination with piperonyl butoxide. Results Although the dosages for pyrethroids containing a phenoxybenzyl moiety have exhibited differences in terms of effectiveness among the three tested mosquito species, the structurally different transfluthrin with a polyfluorobenzyl moiety remained active in mosquitoes with upregulated P450 levels. In trials with transfluthrin mixed with piperonyl butoxide, the added synergist exhibited no efficacy-enhancing effect. Conclusion The results of this study suggest that transfluthrin has the potential to control P450-mediated metabolically resistant mosquitoes because the

  6. Toll-like receptor 4 ablation in mdx mice reveals innate immunity as a therapeutic target in Duchenne muscular dystrophy

    PubMed Central

    Giordano, Christian; Mojumdar, Kamalika; Liang, Feng; Lemaire, Christian; Li, Tong; Richardson, John; Divangahi, Maziar; Qureshi, Salman; Petrof, Basil J.

    2015-01-01

    Toll-like receptor 4 (TLR4) recognizes specific structural motifs associated with microbial pathogens and also responds to certain endogenous host molecules associated with tissue damage. In Duchenne muscular dystrophy (DMD), inflammation plays an important role in determining the ultimate fate of dystrophic muscle fibers. In this study, we used TLR4-deficient dystrophic mdx mice to assess the role of TLR4 in the pathogenesis of DMD. TLR4 expression was increased and showed enhanced activation following agonist stimulation in mdx diaphragm muscle. Genetic ablation of TLR4 led to significantly increased muscle force generation in dystrophic diaphragm muscle, which was associated with improved histopathology including decreased fibrosis, as well as reduced pro-inflammatory gene expression and macrophage infiltration. TLR4 ablation in mdx mice also altered the phenotype of muscle macrophages by inducing a shift toward a more anti-inflammatory (iNOSneg CD206pos) profile. In vitro experiments confirmed that lack of TLR4 is sufficient to influence macrophage activation status in response to classical polarizing stimuli such as IFN-gamma and IL-4. Finally, treatment of dystrophic mice with glycyrrhizin, an inhibitor of the endogenous TLR4 ligand, high mobility group box (HMGB1), also pointed to involvement of the HMGB1–TLR4 axis in promoting dystrophic diaphragm pathology. Taken together, our findings reveal TLR4 and the innate immune system as important players in the pathophysiology of DMD. Accordingly, targeting either TLR4 or its endogenous ligands may provide a new therapeutic strategy to slow disease progression. PMID:25552658

  7. Structural Analysis of the Maize Rp1 Complex Reveals Numerous Sites and Unexpected Mechanisms of Local Rearrangement

    PubMed Central

    Ramakrishna, Wusirika; Emberton, John; Ogden, Matthew; SanMiguel, Phillip; Bennetzen, Jeffrey L.

    2002-01-01

    Rp1 is a complex disease resistance locus in maize that is exceptional in both allelic variability and meiotic instability. Genomic sequence analysis of three maize BACs from the Rp1 region of the B73 inbred line revealed 4 Rp1 homologs and 18 other gene-homologous sequences, of which at least 16 are truncated. Thirteen of the truncated genes are found in three clusters, suggesting that they arose from multiple illegitimate break repairs at the same sites or from complex repairs of each of these sites with multiple unlinked DNA templates. A 43-kb region that contains an Rp1 homolog, six truncated genes, and three Opie retrotransposons was found to be duplicated in this region. This duplication is relatively recent, occurring after the insertion of the three Opie elements. The breakpoints of the duplication are outside of any genes or identified repeat sequence, suggesting a duplication mechanism that did not involve unequal recombination. A physical map and partial sequencing of the Rp1 complex indicate the presence of 15 Rp1 homologs in regions of ∼250 and 300 kb in the B73 inbred line. Comparison of fully sequenced Rp1-homologous sequences in the region demonstrates a history of unequal recombination and diversifying selection within the Leu-rich repeat 2 region, resulting in chimeric gene structures. PMID:12468738

  8. Deep sequencing of the tobacco mitochondrial transcriptome reveals expressed ORFs and numerous editing sites outside coding regions

    PubMed Central

    2014-01-01

    Background The purpose of this study was to sequence and assemble the tobacco mitochondrial transcriptome and obtain a genomic-level view of steady-state RNA abundance. Plant mitochondrial genomes have a small number of protein coding genes with large and variably sized intergenic spaces. In the tobacco mitogenome these intergenic spaces contain numerous open reading frames (ORFs) with no clear function. Results The assembled transcriptome revealed distinct monocistronic and polycistronic transcripts along with large intergenic spaces with little to no detectable RNA. Eighteen of the 117 ORFs were found to have steady-state RNA amounts above background in both deep-sequencing and qRT-PCR experiments and ten of those were found to be polysome associated. In addition, the assembled transcriptome enabled a full mitogenome screen of RNA C→U editing sites. Six hundred and thirty five potential edits were found with 557 occurring within protein-coding genes, five in tRNA genes, and 73 in non-coding regions. These sites were found in every protein-coding transcript in the tobacco mitogenome. Conclusion These results suggest that a small number of the ORFs within the tobacco mitogenome may produce functional proteins and that RNA editing occurs in coding and non-coding regions of mitochondrial transcripts. PMID:24433288

  9. The Roles of Cytochrome b559 in Assembly and Photoprotection of Photosystem II Revealed by Site-Directed Mutagenesis Studies

    PubMed Central

    Chu, Hsiu-An; Chiu, Yi-Fang

    2016-01-01

    Cytochrome b559 (Cyt b559) is one of the essential components of the Photosystem II reaction center (PSII). Despite recent accomplishments in understanding the structure and function of PSII, the exact physiological function of Cyt b559 remains unclear. Cyt b559 is not involved in the primary electron transfer pathway in PSII but may participate in secondary electron transfer pathways that protect PSII against photoinhibition. Site-directed mutagenesis studies combined with spectroscopic and functional analysis have been used to characterize Cyt b559 mutant strains and their mutant PSII complex in higher plants, green algae, and cyanobacteria. These integrated studies have provided important in vivo evidence for possible physiological roles of Cyt b559 in the assembly and stability of PSII, protecting PSII against photoinhibition, and modulating photosynthetic light harvesting. This mini-review presents an overview of recent important progress in site-directed mutagenesis studies of Cyt b559 and implications for revealing the physiological functions of Cyt b559 in PSII. PMID:26793230

  10. Structural and Functional Analysis of JMJD2D Reveals Molecular Basis for Site-Specific Demethylation among JMJD2 Demethylases

    SciTech Connect

    Krishnan, Swathi; Trievel, Raymond C.

    2013-01-08

    We found that JMJD2 lysine demethylases (KDMs) participate in diverse genomic processes. Most JMJD2 homologs display dual selectivity toward H3K9me3 and H3K36me3, with the exception of JMJD2D, which is specific for H3K9me3. Here, we report the crystal structures of the JMJD2D•2-oxoglutarate•H3K9me3 ternary complex and JMJD2D apoenzyme. Utilizing structural alignments with JMJD2A, molecular docking, and kinetic analysis with an array of histone peptide substrates, we elucidate the specific signatures that permit efficient recognition of H3K9me3 by JMJD2A and JMJD2D, and the residues in JMJD2D that occlude H3K36me3 demethylation. Surprisingly, these results reveal that JMJD2A and JMJD2D exhibit subtle yet important differences in H3K9me3 recognition, despite the overall similarity in the substrate-binding conformation. Further, we show that H3T11 phosphorylation abrogates demethylation by JMJD2 KDMs. These studies reveal the molecular basis for JMJD2 site specificity and provide a framework for structure-based design of selective inhibitors of JMJD2 KDMs implicated in disease.

  11. Analysis of CDS-located miRNA target sites suggests that they can effectively inhibit translation

    PubMed Central

    Hausser, Jean; Syed, Afzal Pasha; Bilen, Biter; Zavolan, Mihaela

    2013-01-01

    Most of what is presently known about how miRNAs regulate gene expression comes from studies that characterized the regulatory effect of miRNA binding sites located in the 3′ untranslated regions (UTR) of mRNAs. In recent years, there has been increasing evidence that miRNAs also bind in the coding region (CDS), but the implication of these interactions remains obscure because they have a smaller impact on mRNA stability compared with miRNA-target interactions that involve 3′ UTRs. Here we show that miRNA-complementary sites that are located in both CDS and 3′-UTRs are under selection pressure and share the same sequence and structure properties. Analyzing recently published data of ribosome-protected fragment profiles upon miRNA transfection from the perspective of the location of miRNA-complementary sites, we find that sites located in the CDS are most potent in inhibiting translation, while sites located in the 3′ UTR are more efficient at triggering mRNA degradation. Our study suggests that miRNAs may combine targeting of CDS and 3′ UTR to flexibly tune the time scale and magnitude of their post-transcriptional regulatory effects. PMID:23335364

  12. Ensemble-Based Virtual Screening and Experimental Validation of Inhibitors Targeting a Novel Site of Human DNMT1.

    PubMed

    Joshi, Manali; Rajpathak, Shriram N; Narwade, Santosh C; Deobagkar, Deepti

    2016-07-01

    Human DNA methyltransferase1 (hDNMT1) is responsible for preserving DNA methylation patterns that play important regulatory roles in differentiation and development. Misregulation of DNA methylation has thus been linked to many syndromes, life style diseases, and cancers. Developing specific inhibitors of hDNMT1 is an important challenge in the area since the currently targeted cofactor and substrate binding site share structural features with various proteins. In this work, we generated a structural model of the active form of hDNMT1 and identified that the 5-methylcytosine (5-mC) binding site of the hDNMT1 is structurally unique to the protein. This site has been previously demonstrated to be critical for methylation activity. We further performed multiple nanosecond time scale atomistic molecular dynamics simulations of the structural model followed by virtual screening of the Asinex database to identify inhibitors targeting the 5-mC site. Two compounds were discovered that inhibited hDNMT1 in vitro, one of which also showed inhibition in vivo corroborating the screening procedure. This study thus identifies and attempts to validate for the first time a unique site of hDNMT1 that could be harnessed for rationally designing highly selective and potent hypomethylating agents. PMID:26850820

  13. Genome-wide mapping of Sox6 binding sites in skeletal muscle reveals both direct and indirect regulation of muscle terminal differentiation by Sox6

    PubMed Central

    2011-01-01

    Background Sox6 is a multi-faceted transcription factor involved in the terminal differentiation of many different cell types in vertebrates. It has been suggested that in mice as well as in zebrafish Sox6 plays a role in the terminal differentiation of skeletal muscle by suppressing transcription of slow fiber specific genes. In order to understand how Sox6 coordinately regulates the transcription of multiple fiber type specific genes during muscle development, we have performed ChIP-seq analyses to identify Sox6 target genes in mouse fetal myotubes and generated muscle-specific Sox6 knockout (KO) mice to determine the Sox6 null muscle phenotype in adult mice. Results We have identified 1,066 Sox6 binding sites using mouse fetal myotubes. The Sox6 binding sites were found to be associated with slow fiber-specific, cardiac, and embryonic isoform genes that are expressed in the sarcomere as well as transcription factor genes known to play roles in muscle development. The concurrently performed RNA polymerase II (Pol II) ChIP-seq analysis revealed that 84% of the Sox6 peak-associated genes exhibited little to no binding of Pol II, suggesting that the majority of the Sox6 target genes are transcriptionally inactive. These results indicate that Sox6 directly regulates terminal differentiation of muscle by affecting the expression of sarcomere protein genes as well as indirectly through influencing the expression of transcription factors relevant to muscle development. Gene expression profiling of Sox6 KO skeletal and cardiac muscle revealed a significant increase in the expression of the genes associated with Sox6 binding. In the absence of the Sox6 gene, there was dramatic upregulation of slow fiber-specific, cardiac, and embryonic isoform gene expression in Sox6 KO skeletal muscle and fetal isoform gene expression in Sox6 KO cardiac muscle, thus confirming the role Sox6 plays as a transcriptional suppressor in muscle development. Conclusions Our present data indicate

  14. Targeting the cyclin-binding groove site to inhibit the catalytic activity of CDK2/cyclin A complex using p27(KIP1)-derived peptidomimetic inhibitors.

    PubMed

    Karthiga, Arumugasamy; Tripathi, Sunil Kumar; Shanmugam, Ramasamy; Suryanarayanan, Venkatesan; Singh, Sanjeev Kumar

    2015-01-01

    Functionally activated cyclin-dependent kinase 2 (CDK2)/cyclin A complex has been validated as an interesting therapeutic target to develop the efficient antineoplastic drug based on the cell cycle arrest. Cyclin A binds to CDK2 and activates the kinases as well as recruits the substrate and inhibitors using a hydrophobic cyclin-binding groove (CBG). Blocking the cyclin substrate recruitment on CBG is an alternative approach to override the specificity hurdle of the currently available ATP site targeting CDK2 inhibitors. Greater understanding of the interaction of CDK2/cyclin A complex with p27 (negative regulator) reveals that the Leu-Phe-Gly (LFG) motif region of p27 binds with the CBG site of cyclin A to arrest the malignant cell proliferation that induces apoptosis. In the present study, Replacement with Partial Ligand Alternatives through Computational Enrichment (REPLACE) drug design strategies have been applied to acquire LFG peptide-derived peptidomimetics library. The peptidomimetics function is equivalent with respect to substrate p27 protein fashion but does not act as an ATP antagonist. The combined approach of molecular docking, molecular dynamics (MD), and molecular electrostatic potential and ADME/T prediction were carried out to evaluate the peptidomimetics. Resultant interaction and electrostatic potential maps suggested that smaller substituent is desirable at the position of phenyl ring to interact with Trp217, Arg250, and Gln254 residues in the active site. The best docked poses were refined by the MD simulations which resulted in conformational changes. After equilibration, the structure of the peptidomimetic and receptor complex was stable. The results revealed that the various substrate protein-derived peptidomimetics could serve as perfect leads against CDK2 protein. PMID:25584078

  15. The same site on the integrase-binding domain of lens epithelium–derived growth factor is a therapeutic target for MLL leukemia and HIV

    PubMed Central

    Murai, Marcelo J.; Pollock, Jonathan; He, Shihan; Miao, Hongzhi; Purohit, Trupta; Yokom, Adam; Hess, Jay L.; Muntean, Andrew G.; Grembecka, Jolanta

    2014-01-01

    Lens epithelium-derived growth factor (LEDGF) is a chromatin-associated protein implicated in leukemia and HIV type 1 infection. LEDGF associates with mixed-lineage leukemia (MLL) fusion proteins and menin and is required for leukemic transformation. To better understand the molecular mechanism underlying the LEDGF integrase-binding domain (IBD) interaction with MLL fusion proteins in leukemia, we determined the solution structure of the MLL-IBD complex. We found a novel MLL motif, integrase domain binding motif 2 (IBM2), which binds to a well-defined site on IBD. Point mutations within IBM2 abolished leukemogenic transformation by MLL-AF9, validating that this newly identified motif is essential for the oncogenic activity of MLL fusion proteins. Interestingly, the IBM2 binding site on IBD overlaps with the binding site for the HIV integrase (IN), and IN was capable of efficiently sequestering IBD from the menin-MLL complex. A short IBM2 peptide binds to IBD directly and inhibits both the IBD-MLL/menin and IBD-IN interactions. Our findings show that the same site on IBD is involved in binding to MLL and HIV-IN, revealing an attractive approach to simultaneously target LEDGF in leukemia and HIV. PMID:25305204

  16. Comprehensive profiling of retroviral integration sites using target enrichment methods from historical koala samples without an assembled reference genome.

    PubMed

    Cui, Pin; Löber, Ulrike; Alquezar-Planas, David E; Ishida, Yasuko; Courtiol, Alexandre; Timms, Peter; Johnson, Rebecca N; Lenz, Dorina; Helgen, Kristofer M; Roca, Alfred L; Hartman, Stefanie; Greenwood, Alex D

    2016-01-01

    Background. Retroviral integration into the host germline results in permanent viral colonization of vertebrate genomes. The koala retrovirus (KoRV) is currently invading the germline of the koala (Phascolarctos cinereus) and provides a unique opportunity for studying retroviral endogenization. Previous analysis of KoRV integration patterns in modern koalas demonstrate that they share integration sites primarily if they are related, indicating that the process is currently driven by vertical transmission rather than infection. However, due to methodological challenges, KoRV integrations have not been comprehensively characterized. Results. To overcome these challenges, we applied and compared three target enrichment techniques coupled with next generation sequencing (NGS) and a newly customized sequence-clustering based computational pipeline to determine the integration sites for 10 museum Queensland and New South Wales (NSW) koala samples collected between the 1870s and late 1980s. A secondary aim of this study sought to identify common integration sites across modern and historical specimens by comparing our dataset to previously published studies. Several million sequences were processed, and the KoRV integration sites in each koala were characterized. Conclusions. Although the three enrichment methods each exhibited bias in integration site retrieval, a combination of two methods, Primer Extension Capture and hybridization capture is recommended for future studies on historical samples. Moreover, identification of integration sites shows that the proportion of integration sites shared between any two koalas is quite small. PMID:27069793

  17. Comprehensive profiling of retroviral integration sites using target enrichment methods from historical koala samples without an assembled reference genome

    PubMed Central

    Alquezar-Planas, David E.; Ishida, Yasuko; Courtiol, Alexandre; Timms, Peter; Johnson, Rebecca N.; Lenz, Dorina; Helgen, Kristofer M.; Roca, Alfred L.; Hartman, Stefanie

    2016-01-01

    Background. Retroviral integration into the host germline results in permanent viral colonization of vertebrate genomes. The koala retrovirus (KoRV) is currently invading the germline of the koala (Phascolarctos cinereus) and provides a unique opportunity for studying retroviral endogenization. Previous analysis of KoRV integration patterns in modern koalas demonstrate that they share integration sites primarily if they are related, indicating that the process is currently driven by vertical transmission rather than infection. However, due to methodological challenges, KoRV integrations have not been comprehensively characterized. Results. To overcome these challenges, we applied and compared three target enrichment techniques coupled with next generation sequencing (NGS) and a newly customized sequence-clustering based computational pipeline to determine the integration sites for 10 museum Queensland and New South Wales (NSW) koala samples collected between the 1870s and late 1980s. A secondary aim of this study sought to identify common integration sites across modern and historical specimens by comparing our dataset to previously published studies. Several million sequences were processed, and the KoRV integration sites in each koala were characterized. Conclusions. Although the three enrichment methods each exhibited bias in integration site retrieval, a combination of two methods, Primer Extension Capture and hybridization capture is recommended for future studies on historical samples. Moreover, identification of integration sites shows that the proportion of integration sites shared between any two koalas is quite small. PMID:27069793

  18. Random Tagging Genotyping by Sequencing (rtGBS), an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome

    PubMed Central

    Hilario, Elena; Barron, Lorna; Deng, Cecilia H.; Datson, Paul M.; Davy, Marcus W.; Storey, Roy D.

    2015-01-01

    Genotyping by sequencing (GBS) is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al. method: some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS). By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS) method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145) of BamH I sites shared with the reference genome, compared to only 14% (11,513) by stdGBS. PMID:26633193

  19. Functional Identification of Target by Expression Proteomics (FITExP) reveals protein targets and highlights mechanisms of action of small molecule drugs

    PubMed Central

    Chernobrovkin, Alexey; Marin-Vicente, Consuelo; Visa, Neus; Zubarev, Roman A.

    2015-01-01

    Phenomenological screening of small molecule libraries for anticancer activity yields potentially interesting candidate molecules, with a bottleneck in the determination of drug targets and the mechanism of anticancer action. We have found that, for the protein target of a small-molecule drug, the abundance change in late apoptosis is exceptional compared to the expectations based on the abundances of co-regulated proteins. Based on this finding, a novel method to drug target deconvolution is proposed. In a proof of principle experiment, the method yielded known targets of several common anticancer agents among a few (often, just one) likely candidates identified in an unbiased way from cellular proteome comprising more than 4,000 proteins. A validation experiment with a different set of cells and drugs confirmed the findings. As an additional benefit, mapping most specifically regulated proteins on known protein networks highlighted the mechanism of drug action. The new method, if proven to be general, can significantly shorten drug target identification, and thus facilitate the emergence of novel anticancer treatments. PMID:26052917

  20. Clusterin glycopeptide variant characterization reveals significant site-specific glycan changes in the plasma of clear cell renal cell carcinoma.

    PubMed

    Gbormittah, Francisca O; Bones, Jonathan; Hincapie, Marina; Tousi, Fateme; Hancock, William S; Iliopoulos, Othon

    2015-06-01

    Cancer-related alterations in protein glycosylation may serve as diagnostic or prognostic biomarkers or may be used for monitoring disease progression. Clusterin is a medium abundance, yet heavily glycosylated, glycoprotein that is upregulated in clear cell renal cell carcinoma (ccRCC) tumors. We recently reported that the N-glycan profile of clusterin is altered in the plasma of ccRCC patients. Here, we characterized the occupancy and the degree of heterogeneity of individual N-glycosylation sites of clusterin in the plasma of patients diagnosed with localized ccRCC, before and after curative nephrectomy (n = 40). To this end, we used tandem mass spectrometry of immunoaffinity-enriched plasma samples to analyze the individual glycosylation sites in clusterin. We determined the levels of targeted clusterin glycoforms containing either a biantennary digalactosylated disialylated (A2G2S2) glycan or a core fucosylated biantennary digalactosylated disialylated (FA2G2S2) glycan at N-glycosite N374. We showed that the presence of these two clusterin glycoforms differed significantly in the plasma of patients prior to and after curative nephrectomy for localized ccRCC. Removal of ccRCC led to a significant increase in the levels of both FA2G2S2 and A2G2S2 glycans in plasma clusterin. These changes were further confirmed by lectin blotting of plasma clusterin. It is envisioned that these identified glycan alterations may provide an additional level of therapeutic or biomarker sensitivity than levels currently achievable by monitoring expression differences alone. PMID:25855029

  1. Covalent disulfide-linked anti-CEA diabody allows site-specific conjugation and radiolabeling for tumor targeting applications

    PubMed Central

    Olafsen, Tove; Cheung, Chia-wei; Yazaki, Paul J.; Li, Lin; Sundaresan, Gobalakrishnan; Gambhir, Sanjiv S.; Sherman, Mark A.; Williams, Lawrence E.; Shively, John E.; Raubitschek, Andrew A.; Wu, Anna M.

    2014-01-01

    An engineered anti-carcinoembryonic antigen (CEA) diabody (scFv dimer, 55 kDa) was previously constructed from the murine anti-CEA T84.66 antibody. Tumor targeting, imaging and biodistribution studies in nude mice bearing LS174T xenografts with radiolabeled anti-CEA diabody demonstrated rapid tumor uptake and fast blood clearance, which are favorable properties for an imaging agent. Current radiolabeling approaches result in random modification of the protein surface, which may impair immunoreactivity especially for smaller antibody fragments. Site-specific conjugation approaches can direct modifications to reactive groups located away from the binding site. Here, cysteine residues were introduced into the anti-CEA diabody at three different locations, to provide specific thiol groups for chemical modification. One version (with a C-terminal Gly-Gly-Cys) existed exclusively as a disulfide-bonded dimer. This cysteine-modified diabody (Cys-diabody) retained high binding to CEA and demonstrated tumor targeting and biodistribution properties identical to the non-covalent diabody. Furthermore, following reduction of the disulfide bond, the Cys-diabody could be chemically modified using a thiol-specific bifunctional chelating agent, for radiometal labeling. Thus, the Cys-diabody provides a covalently linked alternative to conventional diabodies, which can be reduced and modified site-specifically. This format will provide a versatile platform for targeting a variety of agents to CEA-positive tumors. PMID:14985534

  2. A search for conserved sequences in coding regions reveals that the let-7 microRNA targets Dicer within its coding sequence

    PubMed Central

    Forman, Joshua J.; Legesse-Miller, Aster; Coller, Hilary A.

    2008-01-01

    Recognition sites for microRNAs (miRNAs) have been reported to be located in the 3′ untranslated regions of transcripts. In a computational screen for highly conserved motifs within coding regions, we found an excess of sequences conserved at the nucleotide level within coding regions in the human genome, the highest scoring of which are enriched for miRNA target sequences. To validate our results, we experimentally demonstrated that the let-7 miRNA directly targets the miRNA-processing enzyme Dicer within its coding sequence, thus establishing a mechanism for a miRNA/Dicer autoregulatory negative feedback loop. We also found computational evidence to suggest that miRNA target sites in coding regions and 3′ UTRs may differ in mechanism. This work demonstrates that miRNAs can directly target transcripts within their coding region in animals, and it suggests that a complete search for the regulatory targets of miRNAs should be expanded to include genes with recognition sites within their coding regions. As more genomes are sequenced, the methodological approach that we used for identifying motifs with high sequence conservation will be increasingly valuable for detecting functional sequence motifs within coding regions. PMID:18812516

  3. Disabling the mitotic spindle and tumor growth by targeting a cavity-induced allosteric site of survivin

    PubMed Central

    Berezov, A; Cai, Z; Freudenberg, JA; Zhang, H; Cheng, X; Thompson, T; Murali, R; Greene, MI; Wang, Q

    2012-01-01

    Survivin is a member of the inhibitor of apoptosis protein family and has an essential role in mitosis. Survivin is overexpressed in a large variety of human cancers and represents an attractive target for cancer therapy. Epidermal growth factor receptor and Her/neu-transformed human tumors in particular exhibit high levels of survivin. The survivin protein forms dimers through a conserved region that is critical for subcellular localization and biological functions of the protein. We identified small molecules that target a specific cavity adjacent to the survivin dimerization surfaces. S12, a lead compound identified in the screen, can bind to the survivin protein at the intended target site. Moreover, S12 alters spindle formation, causing mitotic arrest and cell death, and inhibits tumor growth in vitro and in vivo. Cell death occurs in premetaphase stage following mitotic arrest and is not a consequence of general toxicity. Thus, the study validates a novel therapeutic target site in the survivin protein and provides a promising strategy to develop a new class of therapeutic small molecules for the treatment of human cancers. PMID:21892210

  4. sgRNAcas9: A Software Package for Designing CRISPR sgRNA and Evaluating Potential Off-Target Cleavage Sites

    PubMed Central

    Xie, Shengsong; Shen, Bin; Zhang, Chaobao; Huang, Xingxu; Zhang, Yonglian

    2014-01-01

    Although the CRISPR/Cas9/sgRNA system efficiently cleaves intracellular DNA at desired target sites, major concerns remain on potential “off-target” cleavage that may occur throughout the whole genome. In order to improve CRISPR-Cas9 specificity for targeted genome editing and transcriptional control, we describe a bioinformatics tool “sgRNAcas9”, which is a software package developed for fast design of CRISPR sgRNA with minimized off-target effects. This package consists of programs to perform a search for CRISPR target sites (protospacers) with user-defined parameters, predict genome-wide Cas9 potential off-target cleavage sites (POT), classify the POT into three categories, batch-design oligonucleotides for constructing 20-nt (nucleotides) or truncated sgRNA expression vectors, extract desired length nucleotide sequences flanking the on- or off-target cleavage sites for designing PCR primer pairs to validate the mutations by T7E1 cleavage assay. Importantly, by identifying potential off-target sites in silico, the sgRNAcas9 allows the selection of more specific target sites and aids the identification of bona fide off-target sites, significantly facilitating the design of sgRNA for genome editing applications. sgRNAcas9 software package is publicly available at BiooTools website (www.biootools.com) under the terms of the GNU General Public License. PMID:24956386

  5. Identification of S-phase DNA damage-response targets in fission yeast reveals conservation of damage-response networks.

    PubMed

    Willis, Nicholas A; Zhou, Chunshui; Elia, Andrew E H; Murray, Johanne M; Carr, Antony M; Elledge, Stephen J; Rhind, Nicholas

    2016-06-28

    The cellular response to DNA damage during S-phase regulates a complicated network of processes, including cell-cycle progression, gene expression, DNA replication kinetics, and DNA repair. In fission yeast, this S-phase DNA damage response (DDR) is coordinated by two protein kinases: Rad3, the ortholog of mammalian ATR, and Cds1, the ortholog of mammalian Chk2. Although several critical downstream targets of Rad3 and Cds1 have been identified, most of their presumed targets are unknown, including the targets responsible for regulating replication kinetics and coordinating replication and repair. To characterize targets of the S-phase DDR, we identified proteins phosphorylated in response to methyl methanesulfonate (MMS)-induced S-phase DNA damage in wild-type, rad3∆, and cds1∆ cells by proteome-wide mass spectrometry. We found a broad range of S-phase-specific DDR targets involved in gene expression, stress response, regulation of mitosis and cytokinesis, and DNA replication and repair. These targets are highly enriched for proteins required for viability in response to MMS, indicating their biological significance. Furthermore, the regulation of these proteins is similar in fission and budding yeast, across 300 My of evolution, demonstrating a deep conservation of S-phase DDR targets and suggesting that these targets may be critical for maintaining genome stability in response to S-phase DNA damage across eukaryotes. PMID:27298342

  6. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  7. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes.

    PubMed

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5'→3', 3' →5' or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically.Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm. PMID:27515825

  8. Genome-wide meta-analysis reveals common splice site acceptor variant in CHRNA4 associated with nicotine dependence.

    PubMed

    Hancock, D B; Reginsson, G W; Gaddis, N C; Chen, X; Saccone, N L; Lutz, S M; Qaiser, B; Sherva, R; Steinberg, S; Zink, F; Stacey, S N; Glasheen, C; Chen, J; Gu, F; Frederiksen, B N; Loukola, A; Gudbjartsson, D F; Brüske, I; Landi, M T; Bickeböller, H; Madden, P; Farrer, L; Kaprio, J; Kranzler, H R; Gelernter, J; Baker, T B; Kraft, P; Amos, C I; Caporaso, N E; Hokanson, J E; Bierut, L J; Thorgeirsson, T E; Johnson, E O; Stefansson, K

    2015-01-01

    We conducted a 1000 Genomes-imputed genome-wide association study (GWAS) meta-analysis for nicotine dependence, defined by the Fagerström Test for Nicotine Dependence in 17 074 ever smokers from five European-ancestry samples. We followed up novel variants in 7469 ever smokers from five independent European-ancestry samples. We identified genome-wide significant association in the alpha-4 nicotinic receptor subunit (CHRNA4) gene on chromosome 20q13: lowest P=8.0 × 10(-9) across all the samples for rs2273500-C (frequency=0.15; odds ratio=1.12 and 95% confidence interval=1.08-1.17 for severe vs mild dependence). rs2273500-C, a splice site acceptor variant resulting in an alternate CHRNA4 transcript predicted to be targeted for nonsense-mediated decay, was associated with decreased CHRNA4 expression in physiologically normal human brains (lowest P=7.3 × 10(-4)). Importantly, rs2273500-C was associated with increased lung cancer risk (N=28 998, odds ratio=1.06 and 95% confidence interval=1.00-1.12), likely through its effect on smoking, as rs2273500-C was no longer associated with lung cancer after adjustment for smoking. Using criteria for smoking behavior that encompass more than the single 'cigarettes per day' item, we identified a common CHRNA4 variant with important regulatory properties that contributes to nicotine dependence and smoking-related consequences. PMID:26440539

  9. Circular dichroism and site-directed spin labeling reveal structural and dynamical features of high-pressure states of myoglobin

    PubMed Central

    Lerch, Michael T.; Horwitz, Joseph; McCoy, John; Hubbell, Wayne L.

    2013-01-01

    Excited states of proteins may play important roles in function, yet are difficult to study spectroscopically because of their sparse population. High hydrostatic pressure increases the equilibrium population of excited states, enabling their characterization [Akasaka K (2003) Biochemistry 42:10875–85]. High-pressure site-directed spin-labeling EPR (SDSL-EPR) was developed recently to map the site-specific structure and dynamics of excited states populated by pressure. To monitor global secondary structure content by circular dichroism (CD) at high pressure, a modified optical cell using a custom MgF2 window with a reduced aperture is introduced. Here, a combination of SDSL-EPR and CD is used to map reversible structural transitions in holomyoglobin and apomyoglobin (apoMb) as a function of applied pressure up to 2 kbar. CD shows that the high-pressure excited state of apoMb at pH 6 has helical content identical to that of native apoMb, but reversible changes reflecting the appearance of a conformational ensemble are observed by SDSL-EPR, suggesting a helical topology that fluctuates slowly on the EPR time scale. Although the high-pressure state of apoMb at pH 6 has been referred to as a molten globule, the data presented here reveal significant differences from the well-characterized pH 4.1 molten globule of apoMb. Pressure-populated states of both holomyoglobin and apoMb at pH 4.1 have significantly less helical structure, and for the latter, that may correspond to a transient folding intermediate. PMID:24248390

  10. Structural analysis and insertion study reveal the ideal sites for surface displaying foreign peptides on a betanodavirus-like particle.

    PubMed

    Xie, Junfeng; Li, Kunpeng; Gao, Yuanzhu; Huang, Runqing; Lai, Yuxiong; Shi, Yan; Yang, Shaowei; Zhu, Guohua; Zhang, Qinfen; He, Jianguo

    2016-01-01

    Betanodavirus infection causes fatal disease of viral nervous necrosis in many cultured marine and freshwater fish worldwide and the virus-like particles (VLP) are effective vaccines against betanodavirus. But vaccine and viral vector designs of betanodavirus VLP based on their structures remain lacking. Here, the three-dimensional structure of orange-spotted grouper nervous necrosis virus (OGNNV) VLP (RBS) at 3.9 Å reveals the organization of capsid proteins (CP). Based on the structural results, seven putative important sites were selected to genetically insert a 6× histidine (His)-tag for VLP formation screen, resulting in four His-tagged VLP (HV) at positions N-terminus, Ala220, Pro292 and C-terminus. The His-tags of N-terminal HV (NHV) were concealed inside virions while those of 220HV and C-terminal HV (CHV) were displayed at the outer surface. NHV, 220HV and CHV maintained the same cell entry ability as RBS in the Asian sea bass (SB) cell line, indicating that their similar surface structures can be recognized by the cellular entry receptor(s). For application of vaccine design, chromatography-purified CHV could provoke NNV-specific antibody responses as strong as those of RBS in a sea bass immunization assay. Furthermore, in carrying capacity assays, N-terminus and Ala220 can only carry short peptides and C-terminus can even accommodate large protein such as GFP to generate fluorescent VLP (CGV). For application of a viral vector, CGV could be real-time visualized to enter SB cells in invasion study. All the results confirmed that the C-terminus of CP is a suitable site to accommodate foreign peptides for vaccine design and viral vector development. PMID:26754256

  11. Circular dichroism and site-directed spin labeling reveal structural and dynamical features of high-pressure states of myoglobin.

    PubMed

    Lerch, Michael T; Horwitz, Joseph; McCoy, John; Hubbell, Wayne L

    2013-12-01

    Excited states of proteins may play important roles in function, yet are difficult to study spectroscopically because of their sparse population. High hydrostatic pressure increases the equilibrium population of excited states, enabling their characterization [Akasaka K (2003) Biochemistry 42:10875-85]. High-pressure site-directed spin-labeling EPR (SDSL-EPR) was developed recently to map the site-specific structure and dynamics of excited states populated by pressure. To monitor global secondary structure content by circular dichroism (CD) at high pressure, a modified optical cell using a custom MgF2 window with a reduced aperture is introduced. Here, a combination of SDSL-EPR and CD is used to map reversible structural transitions in holomyoglobin and apomyoglobin (apoMb) as a function of applied pressure up to 2 kbar. CD shows that the high-pressure excited state of apoMb at pH 6 has helical content identical to that of native apoMb, but reversible changes reflecting the appearance of a conformational ensemble are observed by SDSL-EPR, suggesting a helical topology that fluctuates slowly on the EPR time scale. Although the high-pressure state of apoMb at pH 6 has been referred to as a molten globule, the data presented here reveal significant differences from the well-characterized pH 4.1 molten globule of apoMb. Pressure-populated states of both holomyoglobin and apoMb at pH 4.1 have significantly less helical structure, and for the latter, that may correspond to a transient folding intermediate. PMID:24248390

  12. Integrative Multi-omic Analysis of Human Platelet eQTLs Reveals Alternative Start Site in Mitofusin 2.

    PubMed

    Simon, Lukas M; Chen, Edward S; Edelstein, Leonard C; Kong, Xianguo; Bhatlekar, Seema; Rigoutsos, Isidore; Bray, Paul F; Shaw, Chad A

    2016-05-01

    Platelets play a central role in ischemic cardiovascular events. Cardiovascular disease (CVD) is a major cause of death worldwide. Numerous genome-wide association studies (GWASs) have identified loci associated with CVD risk. However, our understanding of how these variants contribute to disease is limited. Using data from the platelet RNA and expression 1 (PRAX1) study, we analyzed cis expression quantitative trait loci (eQTLs) in platelets from 154 normal human subjects. We confirmed these results in silico by performing allele-specific expression (ASE) analysis, which demonstrated that the allelic directionality of eQTLs and ASE patterns correlate significantly. Comparison of platelet eQTLs with data from the Genotype-Tissue Expression (GTEx) project revealed that a number of platelet eQTLs are platelet specific and that platelet eQTL peaks localize to the gene body at a higher rate than eQTLs from other tissues. Upon integration with data from previously published GWASs, we found that the trait-associated variant rs1474868 coincides with the eQTL peak for mitofusin 2 (MFN2). Additional experimental and computational analyses revealed that this eQTL is linked to an unannotated alternate MFN2 start site preferentially expressed in platelets. Integration of phenotype data from the PRAX1 study showed that MFN2 expression levels were significantly associated with platelet count. This study links the variant rs1474868 to a platelet-specific regulatory role for MFN2 and demonstrates the utility of integrating multi-omic data with eQTL analysis in disease-relevant tissues for interpreting GWAS results. PMID:27132591

  13. The Crystal Structure of a Cardiovirus RNA-Dependent RNA Polymerase Reveals an Unusual Conformation of the Polymerase Active Site

    PubMed Central

    Vives-Adrian, Laia; Lujan, Celia; Oliva, Baldo; van der Linden, Lonneke; Selisko, Barbara; Coutard, Bruno; Canard, Bruno; van Kuppeveld, Frank J. M.

    2014-01-01

    ABSTRACT Encephalomyocarditis virus (EMCV) is a member of the Cardiovirus genus within the large Picornaviridae family, which includes a number of important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for viral genome replication. In this study, we report the X-ray structures of two different crystal forms of the EMCV RdRp determined at 2.8- and 2.15-Å resolution. The in vitro elongation and VPg uridylylation activities of the purified enzyme have also been demonstrated. Although the overall structure of EMCV 3Dpol is shown to be similar to that of the known RdRps of other members of the Picornaviridae family, structural comparisons show a large reorganization of the active-site cavity in one of the crystal forms. The rearrangement affects mainly motif A, where the conserved residue Asp240, involved in ribonucleoside triphosphate (rNTP) selection, and its neighbor residue, Phe239, move about 10 Å from their expected positions within the ribose binding pocket toward the entrance of the rNTP tunnel. This altered conformation of motif A is stabilized by a cation-π interaction established between the aromatic ring of Phe239 and the side chain of Lys56 within the finger domain. Other contacts, involving Phe239 and different residues of motif F, are also observed. The movement of motif A is connected with important conformational changes in the finger region flanked by residues 54 to 63, harboring Lys56, and in the polymerase N terminus. The structures determined in this work provide essential information for studies on the cardiovirus RNA replication process and may have important implications for the development of new antivirals targeting the altered conformation of motif A. IMPORTANCE The Picornaviridae family is one of the largest virus families known, including many important human and animal pathogens. The RNA-dependent RNA polymerase (RdRp) 3Dpol is a key enzyme for picornavirus genome replication and a validated

  14. Real-time single-molecule tethered particle motion analysis reveals mechanistic similarities and contrasts of Flp site-specific recombinase with Cre and λ Int

    PubMed Central

    Fan, Hsiu-Fang; Ma, Chien-Hui; Jayaram, Makkuni

    2013-01-01

    Flp, a tyrosine site-specific recombinase coded for by the selfish two micron plasmid of Saccharomyces cerevisiae, plays a central role in the maintenance of plasmid copy number. The Flp recombination system can be manipulated to bring about a variety of targeted DNA rearrangements in its native host and under non-native biological contexts. We have performed an exhaustive analysis of the Flp recombination pathway from start to finish by using single-molecule tethered particle motion (TPM). The recombination reaction is characterized by its early commitment and high efficiency, with only minor detraction from ‘non-productive’ and ‘wayward’ complexes. The recombination synapse is stabilized by strand cleavage, presumably by promoting the establishment of functional interfaces between adjacent Flp monomers. Formation of the Holliday junction intermediate poses a rate-limiting barrier to the overall reaction. Isomerization of the junction to the conformation favoring its resolution in the recombinant mode is not a slow step. Consistent with the completion of nearly every initiated reaction, the chemical steps of strand cleavage and exchange are not reversible during a recombination event. Our findings demonstrate similarities and differences between Flp and the mechanistically related recombinases λ Int and Cre. The commitment and directionality of Flp recombination revealed by TPM is consistent with the physiological role of Flp in amplifying plasmid DNA. PMID:23737451

  15. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A.; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  16. Large scale integration of drug-target information reveals poly-pharmacological drug action mechanisms in tumor cell line growth inhibition assays

    PubMed Central

    Knight, Richard A.; Gostev, Mikhail; Ilisavskii, Sergei; Willis, Anne E.; Melino, Gerry; Antonov, Alexey V.

    2014-01-01

    Understanding therapeutic mechanisms of drug anticancer cytotoxicity represents a key challenge in preclinical testing. Here we have performed a meta-analysis of publicly available tumor cell line growth inhibition assays (~ 70 assays from 6 independent experimental groups covering ~ 500 000 molecules) with the primary goal of understanding molecular therapeutic mechanisms of cancer cytotoxicity. To implement this we have collected currently available information on protein targets for molecules that were tested in the assays. We used a statistical methodology to identify protein targets overrepresented among molecules exhibiting cancer cytotoxicity with the particular focus of identifying overrepresented patterns consisting of several proteins (i.e. proteins “A” and “B” and “C”). Our analysis demonstrates that targeting individual proteins can result in a significant increase (up to 50-fold) of the observed odds for a molecule to be an efficient inhibitor of tumour cell line growth. However, further insight into potential molecular mechanisms reveals a multi-target mode of action: targeting a pattern of several proteins drastically increases the observed odds (up to 500-fold) for a molecule to be tumour cytotoxic. In contrast, molecules targeting only one protein but not targeting an additional set of proteins tend to be nontoxic. Our findings support a poly-pharmacology drug discovery paradigm, demonstrating that anticancer cytotoxicity is a product, in most cases, of multi-target mode of drug action PMID:24553133

  17. MicroRNA Expression Is Altered in an Ovalbumin-Induced Asthma Model and Targeting miR-155 with Antagomirs Reveals Cellular Specificity

    PubMed Central

    Plank, Maximilian W.; Maltby, Steven; Tay, Hock L.; Stewart, Jessica; Eyers, Fiona; Hansbro, Philip M.; Foster, Paul S.

    2015-01-01

    MicroRNAs are post-transcriptional regulators of gene expression that are differentially regulated during development and in inflammatory diseases. A role for miRNAs in allergic asthma is emerging and further investigation is required to determine whether they may serve as potential therapeutic targets. We profiled miRNA expression in murine lungs from an ovalbumin-induced allergic airways disease model, and compared expression to animals receiving dexamethasone treatment and non-allergic controls. Our analysis identified 29 miRNAs that were significantly altered during allergic inflammation. Target prediction analysis revealed novel genes with altered expression in allergic airways disease and suggests synergistic miRNA regulation of target mRNAs. To assess the impacts of one induced miRNA on pathology, we targeted miR-155-5p using a specific antagomir. Antagomir administration successfully reduced miR-155-5p expression with high specificity, but failed to alter the disease phenotype. Interestingly, further investigation revealed that antagomir delivery has variable efficacy across different immune cell types, effectively targeting myeloid cell populations, but exhibiting poor uptake in lymphocytes. Our findings demonstrate that antagomir-based targeting of miRNA function in the lung is highly specific, but highlights cell-specificity as a key limitation to be considered for antagomir-based strategies as therapeutics. PMID:26693910

  18. An Integrated Drosophila Model System Reveals Unique Properties for F14512, a Novel Polyamine-Containing Anticancer Drug That Targets Topoisomerase II

    PubMed Central

    Chelouah, Sonia; Monod-Wissler, Caroline; Bailly, Christian; Barret, Jean-Marc; Guilbaud, Nicolas; Vispé, Stéphane; Käs, Emmanuel

    2011-01-01

    F14512 is a novel anti-tumor molecule based on an epipodophyllotoxin core coupled to a cancer-cell vectoring spermine moiety. This polyamine linkage is assumed to ensure the preferential uptake of F14512 by cancer cells, strong interaction with DNA and potent inhibition of topoisomerase II (Topo II). The antitumor activity of F14512 in human tumor models is significantly higher than that of other epipodophyllotoxins in spite of a lower induction of DNA breakage. Hence, the demonstrated superiority of F14512 over other Topo II poisons might not result solely from its preferential uptake by cancer cells, but could also be due to unique effects on Topo II interactions with DNA. To further dissect the mechanism of action of F14512, we used Drosophila melanogaster mutants whose genetic background leads to an easily scored phenotype that is sensitive to changes in Topo II activity and/or localization. F14512 has antiproliferative properties in Drosophila cells and stabilizes ternary Topo II/DNA cleavable complexes at unique sites located in moderately repeated sequences, suggesting that the drug specifically targets a select and limited subset of genomic sequences. Feeding F14512 to developing mutant Drosophila larvae led to the recovery of flies expressing a striking phenotype, "Eye wide shut," where one eye is replaced by a first thoracic segment. Other recovered F14512-induced gain- and loss-of-function phenotypes similarly correspond to precise genetic dysfunctions. These complex in vivo results obtained in a whole developing organism can be reconciled with known genetic anomalies and constitute a remarkable instance of specific alterations of gene expression by ingestion of a drug. "Drosophila-based anticancer pharmacology" hence reveals unique properties for F14512, demonstrating the usefulness of an assay system that provides a low-cost, rapid and effective complement to mammalian models and permits the elucidation of fundamental mechanisms of action of candidate

  19. Code-Assisted Discovery of TAL Effector Targets in Bacterial Leaf Streak of Rice Reveals Contrast with Bacterial Blight and a Novel Susceptibility Gene

    PubMed Central

    Cernadas, Raul A.; Doyle, Erin L.; Niño-Liu, David O.; Wilkins, Katherine E.; Bancroft, Timothy; Wang, Li; Schmidt, Clarice L.; Caldo, Rico; Yang, Bing; White, Frank F.; Nettleton, Dan; Wise, Roger P.; Bogdanove, Adam J.

    2014-01-01

    Bacterial leaf streak of rice, caused by Xanthomonas oryzae pv. oryzicola (Xoc) is an increasingly important yield constraint in this staple crop. A mesophyll colonizer, Xoc differs from X. oryzae pv. oryzae (Xoo), which invades xylem to cause bacterial blight of rice. Both produce multiple distinct TAL effectors, type III-delivered proteins that transactivate effector-specific host genes. A TAL effector finds its target(s) via a partially degenerate code whereby the modular effector amino acid sequence identifies nucleotide sequences to which the protein binds. Virulence contributions of some Xoo TAL effectors have been shown, and their relevant targets, susceptibility (S) genes, identified, but the role of TAL effectors in leaf streak is uncharacterized. We used host transcript profiling to compare leaf streak to blight and to probe functions of Xoc TAL effectors. We found that Xoc and Xoo induce almost completely different host transcriptional changes. Roughly one in three genes upregulated by the pathogens is preceded by a candidate TAL effector binding element. Experimental analysis of the 44 such genes predicted to be Xoc TAL effector targets verified nearly half, and identified most others as false predictions. None of the Xoc targets is a known bacterial blight S gene. Mutational analysis revealed that Tal2g, which activates two genes, contributes to lesion expansion and bacterial exudation. Use of designer TAL effectors discriminated a sulfate transporter gene as the S gene. Across all targets, basal expression tended to be higher than genome-average, and induction moderate. Finally, machine learning applied to real vs. falsely predicted targets yielded a classifier that recalled 92% of the real targets with 88% precision, providing a tool for better target prediction in the future. Our study expands the number of known TAL effector targets, identifies a new class of S gene, and improves our ability to predict functional targeting. PMID:24586171

  20. Polymorphisms in MicroRNA Target Sites of Forkhead Box O Genes Are Associated with Hepatocellular Carcinoma

    PubMed Central

    Zeng, Xiaoyun; Yu, Hongping; Li, Anhua; Bei, Chunhua; Qiu, Xiaoqiang

    2015-01-01

    The forkhead box O (FOXO) transcription factors play important roles in various cancer development including Hepatocellular Carcinoma (HCC). In this study we conducted a hospital-based case control study including 1049 cases (HCC patients) and 1052 controls (non-tumor patients) to examine whether single nucleotide polymorphisms (SNPs) within microRNA (miRNA) target sites of FOXO genes confer HCC susceptibility. A total of three miRNA target site SNPs in the 3’ untranslated regions (UTR) of FOXO1 (rs17592236), FOXO3 (rs4946936) and FOXO4 (rs4503258) were analyzed. No statistically significant differences were found in genotype distribution for rs17592236, rs4946936, and rs4503258 between the HCC patient group and the tumor-free control group using single factor chi-square analysis (P>0.05). However, multivariate logistic regression analysis showed that the CT/TT genotype in rs17592236 was significantly associated with decreased risk of HCC development (P = 0.010, OR = 0.699, 95% CI: 0.526–0.927) as compared to the CC genotype in rs17592236. Additionally, a genetic interaction was found between rs17592236 and rs4503258 (P = 0.003, OR = 0.755, 95% CI: 0.628–0.908). Functional dual luciferase reporter assays verified that the rs17592236 SNP was a target site of human miRNA miR-137. Together, these results indicate that the rs17592236 polymorphism is associated with decreasing of HCC hereditary susceptibility likely through modulating the binding affinity of miR-137 to the 3’UTR in FOXO1 messenger RNA (mRNA). Further knowledge obtained from this study may provide important evidence for the prevention and targeted therapy of HCC. PMID:25739100

  1. HIV Develops Indirect Cross-resistance to Combinatorial RNAi Targeting Two Distinct and Spatially Distant Sites

    PubMed Central

    Shah, Priya S; Pham, Nhung P; Schaffer, David V

    2012-01-01

    Resistance to existing HIV therapies is an increasing problem, and alternative treatments are urgently needed. RNA interference (RNAi), an innate mechanism for sequence-specific gene silencing, can be harnessed therapeutically to treat viral infections, yet viral resistance can still emerge. Here, we demonstrate that HIV can develop indirect resistance to individual and combinatorial RNAi-targeting protein-coding regions up to 5,500 nucleotides (nt) downstream of the viral promoter. We identify several variants harboring mutations in the HIV promoter, and not within the RNAi targets, that produce more fully elongated transcripts. Furthermore, these variants are resistant to the RNAi, potentially by stoichiometrically overwhelming this cellular mechanism. Alarmingly, virus resistant to one short hairpin RNA (shRNA) also exhibits cross-resistance to a different shRNA, which targets a distinct and spatially distant region to which the virus has not been previously exposed. To our knowledge, this is the first example of HIV “cross-resistance” to viral inhibitors targeting different loci. Finally, combining anti-HIV RNAi with a small molecule enhancer of RNAi can inhibit the replication of an indirectly resistant mutant. These results suggest that indirect resistance to RNAi is a general mechanism that should be considered when investigating viral resistance and designing combinatorial RNAi therapies. PMID:22294151

  2. Structural and Functional Characterization of CRM1-Nup214 Interactions Reveals Multiple FG-Binding Sites Involved in Nuclear Export.

    PubMed

    Port, Sarah A; Monecke, Thomas; Dickmanns, Achim; Spillner, Christiane; Hofele, Romina; Urlaub, Henning; Ficner, Ralf; Kehlenbach, Ralph H

    2015-10-27

    CRM1 is the major nuclear export receptor. During translocation through the nuclear pore, transport complexes transiently interact with phenylalanine-glycine (FG) repeats of multiple nucleoporins. On the cytoplasmic side of the nuclear pore, CRM1 tightly interacts with the nucleoporin Nup214. Here, we present the crystal structure of a 117-amino-acid FG-repeat-containing fragment of Nup214, in complex with CRM1, Snurportin 1, and RanGTP at 2.85 Å resolution. The structure reveals eight binding sites for Nup214 FG motifs on CRM1, with intervening stretches that are loosely attached to the transport receptor. Nup214 binds to N- and C-terminal regions of CRM1, thereby clamping CRM1 in a closed conformation and stabilizing the export complex. The role of conserved hydrophobic pockets for the recognition of FG motifs was analyzed in biochemical and cell-based assays. Comparative studies with RanBP3 and Nup62 shed light on specificities of CRM1-nucleoporin binding, which serves as a paradigm for transport receptor-nucleoporin interactions. PMID:26489467

  3. Environmental proteomics reveals early microbial community responses to biostimulation at a uranium- and nitrate-contaminated site

    SciTech Connect

    Chourey, Karuna; Nissen, Silke; Vishnivetskaya, T.; Shah, Manesh B; Pffifner, Susan; Hettich, Robert {Bob} L; Loeffler, Frank E

    2013-01-01

    High performance mass spectrometry instrumentation coupled with improved protein extraction techniques enable metaproteomics to identify active members of soil and groundwater microbial communities. Metaproteomics workflows were applied to study the initial responses (i.e., 4 days post treatment) of the indigenous aquifer microbiota to biostimulation with emulsified vegetable oil (EVO) at a uranium-contaminated site. Members of the Betaproteobacteria (i.e., Dechloromonas, Ralstonia, Rhodoferax, Polaromonas, Delftia, Chromobacterium) and Firmicutes dominated the biostimulated aquifer community. Proteome characterization revealed distinct differences in protein expression between the microbial biomass collected from groundwater influenced by biostimulation and groundwater collected up-gradient of the EVO injection points. In particular, proteins involved in ammonium assimilation, EVO degradation, and polyhydroxybutyrate (PHB) granule formation were prominent following biostimulation. Interestingly, the atypical NosZ of a Dechloromonas sp. was highly expressed suggesting active nitrous oxide (N2O) respiration. c-type cytochromes were barely detected, as was citrate synthase, a biomarker for hexavalent uranium reduction activity, suggesting that metal reduction has not commenced 4 days post EVO delivery. Environmental metaproteomics identified microbial community responses to biostimulation and elucidated active pathways demonstrating the value of this technique for complementing nucleic acid-based approaches.

  4. The crystal structure of Escherichia coli heat shock protein YedU reveals three potential catalytic active sites

    PubMed Central

    Zhao, Yonghong; Liu, Deqian; Kaluarachchi, Warna D.; Bellamy, Henry D.; White, Mark A.; Fox, Robert O.

    2003-01-01

    The mRNA of Escherichia coli yedU gene is induced 31-fold upon heat shock. The 31-kD YedU protein, also calls Hsp31, is highly conserved in several human pathogens and has chaperone activity. We solved the crystal structure of YedU at 2.2 Å resolution. YedU monomer has an α/β/α sandwich domain and a small α/β domain. YedU is a dimer in solution, and its crystal structure indicates that a significant amount of surface area is buried upon dimerization. There is an extended hydrophobic patch that crosses the dimer interface on the surface of the protein. This hydrophobic patch is likely the substrate-binding site responsible for the chaperone activity. The structure also reveals a potential protease-like catalytic triad composed of Cys184, His185, and Asp213, although no enzymatic activity could be identified. YedU coordinates a metal ion using His85, His122, and Glu90. This 2-His-1-carboxylate motif is present in carboxypeptidase A (a zinc enzyme), and a number of dioxygenases and hydroxylases that utilize iron as a cofactor, suggesting another potential function for YedU. PMID:14500888

  5. The Crystal Structure of Dehi Reveals a New A-Haloacid Dehalogenase Fold And Active Site Mechanism

    SciTech Connect

    Schmidberger, J.W.; Wilce, J.A.; Weightman, A.J.; Whisstock, J.C.; Wilce, M.C.J.

    2009-05-27

    Haloacid dehalogenases catalyse the removal of halides from organic haloacids and are of interest for bioremediation and for their potential use in the synthesis of industrial chemicals. We present the crystal structure of the homodimer DehI from Pseudomonas putida strain PP3, the first structure of a group I {alpha}-haloacid dehalogenase that can process both L- and D-substrates. The structure shows that the DehI monomer consists of two domains of {approx}130 amino acids that have {approx}16% sequence identity yet adopt virtually identical and unique folds that form a pseudo-dimer. Analysis of the active site reveals the likely binding mode of both L- and D-substrates with respect to key catalytic residues. Asp189 is predicted to activate a water molecule for nucleophilic attack of the substrate chiral centre resulting in an inversion of configuration of either L- or D-substrates in contrast to D-only enzymes. These details will assist with future bioengineering of dehalogenases.

  6. Comparative Genomic Hybridization of Human Malignant Gliomas Reveals Multiple Amplification Sites and Nonrandom Chromosomal Gains and Losses

    PubMed Central

    Schròck, Evelin; Thiel, Gundula; Lozanova, Tanka; du Manoir, Stanislas; Meffert, Marie-Christine; Jauch, Anna; Speicher, Michael R.; Nürnberg, Peter; Vogel, Siegfried; Janisch, Werner; Donis-Keller, Helen; Ried, Thomas; Witkowski, Regine; Cremer, Thomas

    1994-01-01

    Nine human malignant gliomas (2 astrocytomas grade III and 7 glioblastomas) were analyzed using comparative genomic hybridization (CGH). In addition to the amplification of the EGFR gene at 7p12 in 4 of 9 cases, six new amplification sites were mapped to 1q32, 4q12, 7q21.1, 7q21.2-3, 12p, and 22q12. Nonrandom chromosomal gains and losses were identified with overrepresentation of chromosome 7 and underrepresentation of chromosome 10 as the most frequent events (1 of 2 astrocytomas, 7 of 7 glioblastomas). Gain of a part or the whole chromosome 19 and losses of chromosome bands 9pter-23 and 22q13 were detected each in five cases. Loss of chromosome band 17p13 and gain of chromosome 20 were revealed each in three cases. The validity of the CGH data was confirmed using interphase cytogenetics with YAC clones, chromosome painting in tumor metaphase spreads, and DNA fingerprinting. A comparison of CGH data with the results of chromosome banding analyses indicates that metaphase spreads accessible in primary tumor cell cultures may not represent the clones predominant in the tumor tissue ImagesFigure 1Figure 4Figure 6 PMID:8203461

  7. A Conserved Target Site in HIV-1 Gag RNA is Accessible to Inhibition by Both an HDV Ribozyme and a Short Hairpin RNA

    PubMed Central

    Scarborough, Robert J; Lévesque, Michel V; Boudrias-Dalle, Etienne; Chute, Ian C; Daniels, Sylvanne M; Ouellette, Rodney J; Perreault, Jean-Pierre; Gatignol, Anne

    2014-01-01

    Antisense-based molecules targeting HIV-1 RNA have the potential to be used as part of gene or drug therapy to treat HIV-1 infection. In this study, HIV-1 RNA was screened to identify more conserved and accessible target sites for ribozymes based on the hepatitis delta virus motif. Using a quantitative screen for effects on HIV-1 production, we identified a ribozyme targeting a highly conserved site in the Gag coding sequence with improved inhibitory potential compared to our previously described candidates targeting the overlapping Tat/Rev coding sequence. We also demonstrate that this target site is highly accessible to short hairpin directed RNA interference, suggesting that it may be available for the binding of antisense RNAs with different modes of action. We provide evidence that this target site is structurally conserved in diverse viral strains and that it is sufficiently different from the human transcriptome to limit off-target effects from antisense therapies. We also show that the modified hepatitis delta virus ribozyme is more sensitive to a mismatch in its target site compared to the short hairpin RNA. Overall, our results validate the potential of a new target site in HIV-1 RNA to be used for the development of antisense therapies. PMID:25072692