Science.gov

Sample records for ribosomal gtpase centre

  1. Cooperative assembly of proteins in the ribosomal GTPase centre demonstrated by their interactions with mutant 23S rRNAs.

    PubMed Central

    Rosendahl, G; Douthwaite, S

    1995-01-01

    The ribosomal protein L11 binds to the region of 23S rRNA associated with the GTPase-dependent steps of protein synthesis. Nucleotides 1054-1107 within this region of the Escherichia coli 23S rRNA gene were mutagenized with bisulphite. Twenty point mutations (G-->A and C-->T transitions) and numerous multiple mutations were generated. Expression of mutant 23S rRNAs in vivo shows that all the mutations detectably alter the phenotype, with effects ranging from a slight growth rate reduction to lack of viability. Temperature sensitivity is conferred by 1071G-->A and 1092C-->U substitutions. These effects are relieved by point mutations at other sites, indicating functional interconnections within the higher order structure of this 23S rRNA region. Several mutations prevent direct binding of r-protein L11 to 23S rRNA in vitro. These mutations are mainly in a short irregular stem (1087-1102) and within a hairpin loop (1068-1072), where the protein probably makes nucleotide contacts. Some of these mutations also interfere with binding of the r-protein complex L10.(L12)4 to an adjacent site on the rRNA. When added together to rRNA, proteins L10.(L12)4 and L11 bind cooperatively to overcome the effects of mutations at 1091 and 1099. The proteins also stimulate each others binding to rRNA mutated at 1087 or 1092, although in these cases binding remains clearly substoichiometric. Surprisingly, none of the mutations prevents incorporation of L11 into ribosomes in vivo, indicating that other, as yet unidentified, factors are involved in the cooperative assembly process. Images PMID:7630717

  2. The K+-dependent GTPase Nug1 is implicated in the association of the helicase Dbp10 to the immature peptidyl transferase centre during ribosome maturation

    PubMed Central

    Manikas, Rizos-Georgios; Thomson, Emma; Thoms, Matthias; Hurt, Ed

    2016-01-01

    Ribosome synthesis employs a number of energy-consuming enzymes in both eukaryotes and prokaryotes. One such enzyme is the conserved circularly permuted GTPase Nug1 (nucleostemin in human). Nug1 is essential for 60S subunit assembly and nuclear export, but its role and time of action during maturation remained unclear. Based on in vitro enzymatic assays using the Chaetomium thermophilum (Ct) orthologue, we show that Nug1 exhibits a low intrinsic GTPase activity that is stimulated by potassium ions, rendering Nug1 a cation-dependent GTPase. In vivo we observe 60S biogenesis defects upon depletion of yeast Nug1 or expression of a Nug1 nucleotide-binding mutant. Most prominently, the RNA helicase Dbp10 was lost from early pre-60S particles, which suggested a physical interaction that could be reconstituted in vitro using CtNug1 and CtDbp10. In vivo rRNA–protein crosslinking revealed that Nug1 and Dbp10 bind at proximal and partially overlapping sites on the 60S pre-ribosome, most prominently to H89 that will constitute part of the peptidyl transferase center (PTC). The binding sites of Dbp10 are the same as those identified for the prokaryotic helicase DbpA bound to the 50S subunit. We suggest that Dbp10 and DbpA are performing a conserved role during PTC formation in all organisms. PMID:26823502

  3. The K⁺-dependent GTPase Nug1 is implicated in the association of the helicase Dbp10 to the immature peptidyl transferase centre during ribosome maturation.

    PubMed

    Manikas, Rizos-Georgios; Thomson, Emma; Thoms, Matthias; Hurt, Ed

    2016-02-29

    Ribosome synthesis employs a number of energy-consuming enzymes in both eukaryotes and prokaryotes. One such enzyme is the conserved circularly permuted GTPase Nug1 (nucleostemin in human). Nug1 is essential for 60S subunit assembly and nuclear export, but its role and time of action during maturation remained unclear. Based on in vitro enzymatic assays using the Chaetomium thermophilum (Ct) orthologue, we show that Nug1 exhibits a low intrinsic GTPase activity that is stimulated by potassium ions, rendering Nug1 a cation-dependent GTPase. In vivo we observe 60S biogenesis defects upon depletion of yeast Nug1 or expression of a Nug1 nucleotide-binding mutant. Most prominently, the RNA helicase Dbp10 was lost from early pre-60S particles, which suggested a physical interaction that could be reconstituted in vitro using CtNug1 and CtDbp10. In vivo rRNA-protein crosslinking revealed that Nug1 and Dbp10 bind at proximal and partially overlapping sites on the 60S pre-ribosome, most prominently to H89 that will constitute part of the peptidyl transferase center (PTC). The binding sites of Dbp10 are the same as those identified for the prokaryotic helicase DbpA bound to the 50S subunit. We suggest that Dbp10 and DbpA are performing a conserved role during PTC formation in all organisms. PMID:26823502

  4. GTPases mechanisms and functions of translation factors on the ribosome.

    PubMed

    Rodnina, M V; Stark, H; Savelsbergh, A; Wieden, H J; Mohr, D; Matassova, N B; Peske, F; Daviter, T; Gualerzi, C O; Wintermeyer, W

    2000-01-01

    The elongation factors (EF) Tu and G and initiation factor 2 (IF2) from bacteria are multidomain GTPases with essential functions in the elongation and initiation phases of translation. They bind to the same site on the ribosome where their low intrinsic GTPase activities are strongly stimulated. The factors differ fundamentally from each other, and from the majority of GTPases, in the mechanisms of GTPase control, the timing of Pi release, and the functional role of GTP hydrolysis. EF-Tu x GTP forms a ternary complex with aminoacyl-tRNA, which binds to the ribosome. Only when a matching codon is recognized, the GTPase of EF-Tu is stimulated, rapid GTP hydrolysis and Pi release take place, EF-Tu rearranges to the GDP form, and aminoacyl-tRNA is released into the peptidyltransferase center. In contrast, EF-G hydrolyzes GTP immediately upon binding to the ribosome, stimulated by ribosomal protein L7/12. Subsequent translocation is driven by the slow dissociation of Pi, suggesting a mechano-chemical function of EF-G. Accordingly, different conformations of EF-G on the ribosome are revealed by cryo-electron microscopy. GTP hydrolysis by IF2 is triggered upon formation of the 70S initiation complex, and the dissociation of Pi and/or IF2 follows a rearrangement of the ribosome into the elongation-competent state. PMID:10937868

  5. The conserved GTPase HflX is a ribosome splitting factor that binds to the E-site of the bacterial ribosome

    PubMed Central

    Coatham, Mackenzie L.; Brandon, Harland E.; Fischer, Jeffrey J.; Schümmer, Tobias; Wieden, Hans-Joachim

    2016-01-01

    Using a combination of biochemical, structural probing and rapid kinetics techniques we reveal for the first time that the universally conserved translational GTPase (trGTPase) HflX binds to the E-site of the 70S ribosome and that its GTPase activity is modulated by peptidyl transferase centre (PTC) and peptide exit tunnel (PET) binding antibiotics, suggesting a previously undescribed mode of action for these antibiotics. Our rapid kinetics studies reveal that HflX functions as a ribosome splitting factor that disassembles the 70S ribosomes into its subunits in a nucleotide dependent manner. Furthermore, our probing and hydrolysis studies show that the ribosome is able to activate trGTPases bound to its E-site. This is, to our knowledge, the first case in which the hydrolytic activity of a translational GTPase is not activated by the GTPase activating centre (GAC) in the ribosomal A-site. Furthermore, we provide evidence that the bound state of the PTC is able to regulate the GTPase activity of E-site bound HflX. PMID:26733579

  6. EF-G-dependent GTPase on the ribosome. conformational change and fusidic acid inhibition.

    PubMed

    Seo, Hyuk-Soo; Abedin, Sameem; Kamp, Detlev; Wilson, Daniel N; Nierhaus, Knud H; Cooperman, Barry S

    2006-02-28

    Protein synthesis studies increasingly focus on delineating the nature of conformational changes occurring as the ribosome exerts its catalytic functions. Here, we use FRET to examine such changes during single-turnover EF-G-dependent GTPase on vacant ribosomes and to elucidate the mechanism by which fusidic acid (FA) inhibits multiple-turnover EF-G.GTPase. Our measurements focus on the distance between the G' region of EF-G and the N-terminal region of L11 (L11-NTD), located within the GTPase activation center of the ribosome. We demonstrate that single-turnover ribosome-dependent EF-G GTPase proceeds according to a kinetic scheme in which rapid G' to L11-NTD movement requires prior GTP hydrolysis and, via branching pathways, either precedes P(i) release (major pathway) or occurs simultaneously with it (minor pathway). Such movement retards P(i) release, with the result that P(i) release is essentially rate-determining in single-turnover GTPase. This is the most significant difference between the EF-G.GTPase activities of vacant and translocating ribosomes [Savelsbergh, A., Katunin, V. I., Mohr, D., Peske, F., Rodnina, M. V., and Wintermeyer, W. (2003) Mol. Cell 11, 1517-1523], which are otherwise quite similar. Both the G' to L11-NTD movement and P(i) release are strongly inhibited by thiostrepton but not by FA. Contrary to the standard view that FA permits only a single round of GTP hydrolysis [Bodley, J. W., Zieve, F. J., and Lin, L. (1970) J. Biol. Chem. 245, 5662-5667], we find that FA functions rather as a slow inhibitor of EF-G.GTPase, permitting a number of GTPase turnovers prior to complete inhibition while inducing a closer approach of EF-G to the GAC than is seen during normal turnover. PMID:16489743

  7. Conformationally restricted elongation factor G retains GTPase activity but is inactive in translocation on the ribosome.

    PubMed

    Peske, F; Matassova, N B; Savelsbergh, A; Rodnina, M V; Wintermeyer, W

    2000-08-01

    Elongation factor G (EF-G) from Escherichia coli is a large, five-domain GTPase that promotes tRNA translocation on the ribosome. Full activity requires GTP hydrolysis, suggesting that a conformational change of the factor is important for function. To restrict the intramolecular mobility, two cysteine residues were engineered into domains 1 and 5 of EF-G that spontaneously formed a disulfide cross-link. Cross-linked EF-G retained GTPase activity on the ribosome, whereas it was inactive in translocation as well as in turnover. Both activities were restored when the cross-link was reversed by reduction. These results strongly argue against a GTPase switch-type model of EF-G function and demonstrate that conformational mobility is an absolute requirement for EF-G function on the ribosome. PMID:10983996

  8. Ribosome-induced tuning of GTP hydrolysis by a translational GTPase.

    PubMed

    Maracci, Cristina; Peske, Frank; Dannies, Ev; Pohl, Corinna; Rodnina, Marina V

    2014-10-01

    GTP hydrolysis by elongation factor Tu (EF-Tu), a translational GTPase that delivers aminoacyl-tRNAs to the ribosome, plays a crucial role in decoding and translational fidelity. The basic reaction mechanism and the way the ribosome contributes to catalysis are a matter of debate. Here we use mutational analysis in combination with measurements of rate/pH profiles, kinetic solvent isotope effects, and ion dependence of GTP hydrolysis by EF-Tu off and on the ribosome to dissect the reaction mechanism. Our data suggest that--contrary to current models--the reaction in free EF-Tu follows a pathway that does not involve the critical residue H84 in the switch II region. Binding to the ribosome without a cognate codon in the A site has little effect on the GTPase mechanism. In contrast, upon cognate codon recognition, the ribosome induces a rearrangement of EF-Tu that renders GTP hydrolysis sensitive to mutations of Asp21 and His84 and insensitive to K(+) ions. We suggest that Asp21 and His84 provide a network of interactions that stabilize the positions of the γ-phosphate and the nucleophilic water, respectively, and thus play an indirect catalytic role in the GTPase mechanism on the ribosome. PMID:25246550

  9. Ribosome-induced tuning of GTP hydrolysis by a translational GTPase

    PubMed Central

    Maracci, Cristina; Peske, Frank; Dannies, Ev; Pohl, Corinna; Rodnina, Marina V.

    2014-01-01

    GTP hydrolysis by elongation factor Tu (EF-Tu), a translational GTPase that delivers aminoacyl-tRNAs to the ribosome, plays a crucial role in decoding and translational fidelity. The basic reaction mechanism and the way the ribosome contributes to catalysis are a matter of debate. Here we use mutational analysis in combination with measurements of rate/pH profiles, kinetic solvent isotope effects, and ion dependence of GTP hydrolysis by EF-Tu off and on the ribosome to dissect the reaction mechanism. Our data suggest that—contrary to current models—the reaction in free EF-Tu follows a pathway that does not involve the critical residue H84 in the switch II region. Binding to the ribosome without a cognate codon in the A site has little effect on the GTPase mechanism. In contrast, upon cognate codon recognition, the ribosome induces a rearrangement of EF-Tu that renders GTP hydrolysis sensitive to mutations of Asp21 and His84 and insensitive to K+ ions. We suggest that Asp21 and His84 provide a network of interactions that stabilize the positions of the γ-phosphate and the nucleophilic water, respectively, and thus play an indirect catalytic role in the GTPase mechanism on the ribosome. PMID:25246550

  10. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    SciTech Connect

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.

    2007-11-01

    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  11. A Novel Domain in Translational GTPase BipA Mediates Interaction with the 70S Ribosome and Influences GTP Hydrolysis

    SciTech Connect

    deLivron, M.; Makanji, H; Lane, M; Robinson, V

    2009-01-01

    BipA is a universally conserved prokaryotic GTPase that exhibits differential ribosome association in response to stress-related events. It is a member of the translation factor family of GTPases along with EF-G and LepA. BipA has five domains. The N-terminal region of the protein, consisting of GTPase and {beta}-barrel domains, is common to all translational GTPases. BipA domains III and V have structural counterparts in EF-G and LepA. However, the C-terminal domain (CTD) of the protein is unique to the BipA family. To investigate how the individual domains of BipA contribute to the biological properties of the protein, deletion constructs were designed and their GTP hydrolysis and ribosome binding properties assessed. Data presented show that removal of the CTD abolishes the ability of BipA to bind to the ribosome and that ribosome complex formation requires the surface provided by domains III and V and the CTD. Additional mutational analysis was used to outline the BipA-70S interaction surface extending across these domains. Steady state kinetic analyses revealed that successive truncation of domains from the C-terminus resulted in a significant increase in the intrinsic GTP hydrolysis rate and a loss of ribosome-stimulated GTPase activity. These results indicate that, similar to other translational GTPases, the ribosome binding and GTPase activities of BipA are tightly coupled. Such intermolecular regulation likely plays a role in the differential ribosome binding by the protein.

  12. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases

    PubMed Central

    McCaughan, Urszula M.; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G.

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  13. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases.

    PubMed

    McCaughan, Urszula M; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  14. Structural insights into the function of a unique tandem GTPase EngA in bacterial ribosome assembly

    PubMed Central

    Zhang, Xiaoxiao; Yan, Kaige; Zhang, Yixiao; Li, Ningning; Ma, Chengying; Li, Zhifei; Zhang, Yanqing; Feng, Boya; Liu, Jing; Sun, Yadong; Xu, Yanji; Lei, Jianlin; Gao, Ning

    2014-01-01

    Many ribosome-interacting GTPases, with proposed functions in ribosome biogenesis, are also implicated in the cellular regulatory coupling between ribosome assembly process and various growth control pathways. EngA is an essential GTPase in bacteria, and intriguingly, it contains two consecutive GTPase domains (GD), being one-of-a-kind among all known GTPases. EngA is required for the 50S subunit maturation. However, its molecular role remains elusive. Here, we present the structure of EngA bound to the 50S subunit. Our data show that EngA binds to the peptidyl transferase center (PTC) and induces dramatic conformational changes on the 50S subunit, which virtually returns the 50S subunit to a state similar to that of the late-stage 50S assembly intermediates. Very interestingly, our data show that the two GDs exhibit a pseudo-two-fold symmetry in the 50S-bound conformation. Our results indicate that EngA recognizes certain forms of the 50S assembly intermediates, and likely facilitates the conformational maturation of the PTC of the 23S rRNA in a direct manner. Furthermore, in a broad context, our data also suggest that EngA might be a sensor of the cellular GTP/GDP ratio, endowed with multiple conformational states, in response to fluctuations in cellular nucleotide pool, to facilitate and regulate ribosome assembly. PMID:25389271

  15. Characterization of the autophosphorylation property of HflX, a ribosome-binding GTPase from Escherichia coli.

    PubMed

    Ghosh, Aditi; Dutta, Dipak; Bandyopadhyay, Kaustav; Parrack, Pradeep

    2016-07-01

    Escherichia coli HflX belongs to the widely distributed but poorly characterized HflX family of translation factor-related GTPases that is conserved from bacteria to humans. A 426-residue polypeptide that binds 50S ribosomes and has both GTPase and ATPase activities, HflX also exhibits autophosphorylation activity. We show that HflX(C), a C-terminal fragment of HflX, has an enhanced autophosphorylation activity compared to the full-length protein. Using a chemical stability assay and thin layer chromatography, we have determined that phosphorylation occurs at a serine residue. Each of the nine serine residues of HflX(C) was mutated to alanine. It was found that all but S211A retained autophosphorylation activity, suggesting that S211, located in the P-loop, was the likely site for autophosphorylation. While the S211A mutant lacked the autophosphorylation site, it possessed strong GTP binding and GTPase activities. PMID:27398305

  16. The nucleolar GTPase nucleostemin-like 1 plays a role in plant growth and senescence by modulating ribosome biogenesis

    PubMed Central

    Jeon, Young; Park, Yong-Joon; Cho, Hui Kyung; Jung, Hyun Ju; Ahn, Tae-Kyu; Kang, Hunseung; Pai, Hyun-Sook

    2015-01-01

    Nucleostemin is a nucleolar GTP-binding protein that is involved in stem cell proliferation, embryonic development, and ribosome biogenesis in mammals. Plant nucleostemin-like 1 (NSN1) plays a role in embryogenesis, and apical and floral meristem development. In this study, a nucleolar function of NSN1 in the regulation of ribosome biogenesis was identified. Green fluorescent protein (GFP)-fused NSN1 localized to the nucleolus, which was primarily determined by its N-terminal domain. Recombinant NSN1 and its N-terminal domain (NSN1-N) bound to RNA in vitro. Recombinant NSN1 expressed GTPase activity in vitro. NSN1 silencing in Arabidopsis thaliana and Nicotiana benthamiana led to growth retardation and premature senescence. NSN1 interacted with Pescadillo and EBNA1 binding protein 2 (EBP2), which are nucleolar proteins involved in ribosome biogenesis, and with several ribosomal proteins. NSN1, NSN1-N, and EBP2 co-fractionated primarily with the 60S ribosomal large subunit in vivo. Depletion of NSN1 delayed 25S rRNA maturation and biogenesis of the 60S ribosome subunit, and repressed global translation. NSN1-deficient plants exhibited premature leaf senescence, excessive accumulation of reactive oxygen species, and senescence-related gene expression. Taken together, these results suggest that NSN1 plays a crucial role in plant growth and senescence by modulating ribosome biogenesis. PMID:26163696

  17. Antibiotic interactions at the GTPase-associated centre within Escherichia coli 23S rRNA.

    PubMed Central

    Egebjerg, J; Douthwaite, S; Garrett, R A

    1989-01-01

    A comprehensive range of chemical reagents and ribonucleases was employed to investigate the interaction of the antibiotics thiostrepton and micrococcin with the ribosomal protein L11-23S RNA complex and with the 50S subunit. Both antibiotics block processes associated with the ribosomal A-site but differ in their effects on GTP hydrolysis, which is inhibited by thiostrepton and stimulated by micrococcin. The interaction sites of both drugs were shown to occur within the nucleotide sequences A1067-A1098 within the protein L11 binding site on 23S RNA. This region of the ribosome structure is involved in elongation factor-G-dependent GTP hydrolysis and in the stringent response. No effects of drug binding were detected elsewhere in the 23S RNA. In general, the two drugs afforded 23S RNA similar protection from the chemical and nuclease probes in accord with their similar modes of action. One important exception, however, occurred at nucleotide A1067 within a terminal loop where thiostrepton protected the N-1 position while micrococcin rendered it more reactive. This difference correlates with the opposite effects of the two antibiotics on GTPase activity. Images PMID:2470587

  18. The Vibrio harveyi GTPase CgtAV Is Essential and Is Associated with the 50S Ribosomal Subunit

    PubMed Central

    Sikora, A. E.; Zielke, R.; Datta, K.; Maddock, J. R.

    2006-01-01

    It was previously reported that unlike the other obg/cgtA GTPases, the Vibrio harveyi cgtAV is not essential. Here we show that cgtAV was not disrupted in these studies and is, in fact, essential for viability. Depletion of CgtAV did not result in cell elongation. CgtAV is associated with the large ribosomal particle. In light of our results, we predict that the V. harveyi CgtAV protein plays a similar essential role to that seen for Obg/CgtA proteins in other bacteria. PMID:16428430

  19. Nuclear/nucleolar GTPase 2 proteins as a subfamily of YlqF/YawG GTPases function in pre-60S ribosomal subunit maturation of mono- and dicotyledonous plants.

    PubMed

    Im, Chak Han; Hwang, Sung Min; Son, Young Sim; Heo, Jae Bok; Bang, Woo Young; Suwastika, I Nengah; Shiina, Takashi; Bahk, Jeong Dong

    2011-03-11

    The YlqF/YawG families are important GTPases involved in ribosome biogenesis, cell proliferation, or cell growth, however, no plant homologs have yet to be characterized. Here we isolated rice (Oryza sativa) and Arabidopsis nuclear/nucleolar GTPase 2 (OsNug2 and AtNug2, respectively) that belong to the YawG subfamily and characterized them for pre-60S ribosomal subunit maturation. They showed typical intrinsic YlqF/YawG family GTPase activities in bacteria and yeasts with k(cat) values 0.12 ± 0.007 min(-1) (n = 6) and 0.087 ± 0.002 min(-1) (n = 4), respectively, and addition of 60S ribosomal subunits stimulated their activities in vitro. In addition, OsNug2 rescued the lethality of the yeast nug2 null mutant through recovery of 25S pre-rRNA processing. By yeast two-hybrid screening five clones, including a putative one of 60S ribosomal proteins, OsL10a, were isolated. Subcellular localization and pulldown assays resulted in that the N-terminal region of OsNug2 is sufficient for nucleolar/nuclear targeting and association with OsL10a. OsNug2 is physically associated with pre-60S ribosomal complexes highly enriched in the 25S, 5.8S, and 5S rRNA, and its interaction was stimulated by exogenous GTP. Furthermore, the AtNug2 knockdown mutant constructed by the RNAi method showed defective growth on the medium containing cycloheximide. Expression pattern analysis revealed that the distribution of AtNug2 mainly in the meristematic region underlies its potential role in active plant growth. Finally, it is concluded that Nug2/Nog2p GTPase from mono- and didicotyledonous plants is linked to the pre-60S ribosome complex and actively processed 27S into 25S during the ribosomal large subunit maturation process, i.e. prior to export to the cytoplasm. PMID:21205822

  20. Nuclear/Nucleolar GTPase 2 Proteins as a Subfamily of YlqF/YawG GTPases Function in Pre-60S Ribosomal Subunit Maturation of Mono- and Dicotyledonous Plants*

    PubMed Central

    Im, Chak Han; Hwang, Sung Min; Son, Young Sim; Heo, Jae Bok; Bang, Woo Young; Suwastika, I. Nengah; Shiina, Takashi; Bahk, Jeong Dong

    2011-01-01

    The YlqF/YawG families are important GTPases involved in ribosome biogenesis, cell proliferation, or cell growth, however, no plant homologs have yet to be characterized. Here we isolated rice (Oryza sativa) and Arabidopsis nuclear/nucleolar GTPase 2 (OsNug2 and AtNug2, respectively) that belong to the YawG subfamily and characterized them for pre-60S ribosomal subunit maturation. They showed typical intrinsic YlqF/YawG family GTPase activities in bacteria and yeasts with kcat values 0.12 ± 0.007 min−1 (n = 6) and 0.087 ± 0.002 min−1 (n = 4), respectively, and addition of 60S ribosomal subunits stimulated their activities in vitro. In addition, OsNug2 rescued the lethality of the yeast nug2 null mutant through recovery of 25S pre-rRNA processing. By yeast two-hybrid screening five clones, including a putative one of 60S ribosomal proteins, OsL10a, were isolated. Subcellular localization and pulldown assays resulted in that the N-terminal region of OsNug2 is sufficient for nucleolar/nuclear targeting and association with OsL10a. OsNug2 is physically associated with pre-60S ribosomal complexes highly enriched in the 25S, 5.8S, and 5S rRNA, and its interaction was stimulated by exogenous GTP. Furthermore, the AtNug2 knockdown mutant constructed by the RNAi method showed defective growth on the medium containing cycloheximide. Expression pattern analysis revealed that the distribution of AtNug2 mainly in the meristematic region underlies its potential role in active plant growth. Finally, it is concluded that Nug2/Nog2p GTPase from mono- and didicotyledonous plants is linked to the pre-60S ribosome complex and actively processed 27S into 25S during the ribosomal large subunit maturation process, i.e. prior to export to the cytoplasm. PMID:21205822

  1. TaTypA, a Ribosome-Binding GTPase Protein, Positively Regulates Wheat Resistance to the Stripe Rust Fungus

    PubMed Central

    Liu, Peng; Myo, Thwin; Ma, Wei; Lan, Dingyun; Qi, Tuo; Guo, Jia; Song, Ping; Guo, Jun; Kang, Zhensheng

    2016-01-01

    Tyrosine phosphorylation protein A (TypA/BipA) belongs to the ribosome-binding GTPase superfamily. In many bacterial species, TypA acts as a global stress and virulence regulator and also mediates resistance to the antimicrobial peptide bactericidal permeability-increasing protein. However, the function of TypA in plants under biotic stresses is not known. In this study, we isolated and functionally characterized a stress-responsive TypA gene (TaTypA) from wheat, with three copies located on chromosomes 6A, 6B, and 6D, respectively. Transient expression assays indicated chloroplast localization of TaTypA. The transcript levels of TaTypA were up-regulated in response to treatment with methyl viologen, which induces reactive oxygen species (ROS) in chloroplasts through photoreaction, cold stress, and infection by an avirulent strain of the stripe rust pathogen. Knock down of the expression of TaTypA through virus-induced gene silencing decreased the resistance of wheat to stripe rust accompanied by weakened ROS accumulation and hypersensitive response, an increase in TaCAT and TaSOD expression, and an increase in pathogen hyphal growth and branching. Our findings suggest that TaTypA contributes to resistance in an ROS-dependent manner. PMID:27446108

  2. A high-throughput screen of the GTPase activity of Escherichia coli EngA to find an inhibitor of bacterial ribosome biogenesis

    PubMed Central

    Bharat, Amrita; Blanchard, Jan E.; Brown, Eric D.

    2014-01-01

    The synthesis of ribosomes is an essential process, which is aided by a variety of transacting factors in bacteria. Among these is a group of GTPases essential for bacterial viability and emerging as promising targets for new antibacterial agents. Herein, we describe a robust high-throughput screening process for inhibitors of one such GTPase, the Escherichia coli EngA protein. The primary screen employed an assay of phosphate production in 384-well density. Reaction conditions were chosen to maximize sensitivity for the discovery of competitive inhibitors while maintaining a strong signal amplitude and low noise. In a pilot screen of 31,800 chemical compounds, 44 active compounds were identified. Further, we describe the elimination of non-specific inhibitors that were detergent-sensitive or reactive as well as those that interfered with the high-throughput phosphate assay. Four inhibitors survived these common counter-screens for non-specificity but these chemicals were also inhibitors of the unrelated enzyme dihydrofolate reductase, suggesting that they too were promiscuously active. The high-throughput screen of the EngA protein described here provides a meticulous pilot study in the search for specific inhibitors of GTPases involved in ribosome biogenesis. PMID:23606650

  3. Review: Translational GTPases.

    PubMed

    Maracci, Cristina; Rodnina, Marina V

    2016-08-01

    Translational GTPases (trGTPases) play key roles in facilitating protein synthesis on the ribosome. Despite the high degree of evolutionary conservation in the sequences of their GTP-binding domains, the rates of GTP hydrolysis and nucleotide exchange vary broadly between different trGTPases. EF-Tu, one of the best-characterized model G proteins, evolved an exceptionally rapid and tightly regulated GTPase activity, which ensures rapid and accurate incorporation of amino acids into the nascent chain. Other trGTPases instead use the energy of GTP hydrolysis to promote movement or to ensure the forward commitment of translation reactions. Recent data suggest the GTPase mechanism of EF-Tu and provide an insight in the catalysis of GTP hydrolysis by its unusual activator, the ribosome. Here we summarize these advances in understanding the functional cycle and the regulation of trGTPases, stimulated by the elucidation of their structures on the ribosome and the progress in dissecting the reaction mechanism of GTPases. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 463-475, 2016. PMID:26971860

  4. rRNA Suppressor of a Eukaryotic Translation Initiation Factor 5B/Initiation Factor 2 Mutant Reveals a Binding Site for Translational GTPases on the Small Ribosomal Subunit▿

    PubMed Central

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G.; Maher, Kathryn N.; Lorsch, Jon R.; Dever, Thomas E.

    2009-01-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit. PMID:19029250

  5. Studies on crystal structures, active-centre geometry and depurinating mechanism of two ribosome-inactivating proteins.

    PubMed Central

    Huang, Q; Liu, S; Tang, Y; Jin, S; Wang, Y

    1995-01-01

    Two ribosome-inactivating proteins, trichosanthin and alpha-momorcharin, have been studied in the forms of complexes with ATP or formycin, by an X-ray-crystallographic method at 1.6-2.0 A (0.16-0.20 nm) resolution. The native alpha-momorcharin had been studied at 2.2 A resolution. Structures of trichosanthin were determined by a multiple isomorphous replacement method. Structures of alpha-momorcharin were determined by a molecular replacement method using refined trichosanthin as the searching model. Small ligands in all these complexes have been recognized and built on the difference in electron density. All these structures have been refined to achieve good results, both in terms of crystallography and of ideal geometry. These two proteins show considerable similarity in their three-dimensional folding and to that of related proteins. On the basis of these structures, detailed geometries of the active centres of these two proteins are described and are compared with those of related proteins. In all complexes the interactions between ligand atoms and protein atoms, including hydrophobic forces, aromatic stacking interactions and hydrogen bonds, are found to be specific towards the adenine base. The relationship between the sequence conservation of ribosome-inactivating proteins and their active-centre geometry was analysed. A depurinating mechanism of ribosome-inactivating proteins is proposed on the basis of these results. The N-7 atom of the substrate base group is proposed to be protonated by an acidic residue in the active centre. Images Figure 1 PMID:7619070

  6. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  7. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  8. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  9. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-06-01

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly. PMID:27251291

  10. Phylogenetic distribution of translational GTPases in bacteria

    PubMed Central

    Margus, Tõnu; Remm, Maido; Tenson, Tanel

    2007-01-01

    Background Translational GTPases are a family of proteins in which GTPase activity is stimulated by the large ribosomal subunit. Conserved sequence features allow members of this family to be identified. Results To achieve accurate protein identification and grouping we have developed a method combining searches with Hidden Markov Model profiles and tree based grouping. We found all the genes for translational GTPases in 191 fully sequenced bacterial genomes. The protein sequences were grouped into nine subfamilies. Analysis of the results shows that three translational GTPases, the translation factors EF-Tu, EF-G and IF2, are present in all organisms examined. In addition, several copies of the genes encoding EF-Tu and EF-G are present in some genomes. In the case of multiple genes for EF-Tu, the gene copies are nearly identical; in the case of multiple EF-G genes, the gene copies have been considerably diverged. The fourth translational GTPase, LepA, the function of which is currently unknown, is also nearly universally conserved in bacteria, being absent from only one organism out of the 191 analyzed. The translation regulator, TypA, is also present in most of the organisms examined, being absent only from bacteria with small genomes. Surprisingly, some of the well studied translational GTPases are present only in a very small number of bacteria. The translation termination factor RF3 is absent from many groups of bacteria with both small and large genomes. The specialized translation factor for selenocysteine incorporation – SelB – was found in only 39 organisms. Similarly, the tetracycline resistance proteins (Tet) are present only in a small number of species. Proteins of the CysN/NodQ subfamily have acquired functions in sulfur metabolism and production of signaling molecules. The genes coding for CysN/NodQ proteins were found in 74 genomes. This protein subfamily is not confined to Proteobacteria, as suggested previously but present also in many other

  11. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  12. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  13. Crystal structure of YjeQ from Thermotoga maritima contains a circularly permuted GTPase domain

    PubMed Central

    Shin, Dong Hae; Lou, Yun; Jancarik, Jaru; Yokota, Hisao; Kim, Rosalind; Kim, Sung-Hou

    2004-01-01

    We have determined the crystal structure of the GDP complex of the YjeQ protein from Thermotoga maritima (TmYjeQ), a member of the YjeQ GTPase subfamaily. TmYjeQ, a homologue of Escherichia coli YjeQ, which is known to bind to the ribosome, is composed of three domains: an N-terminal oligonucleotide/oligosaccharide-binding fold domain, a central GTPase domain, and a C-terminal zinc-finger domain. The crystal structure of TmYjeQ reveals two interesting domains: a circularly permutated GTPase domain and an unusual zinc-finger domain. The binding mode of GDP in the GTPase domain of TmYjeQ is similar to those of GDP or GTP analogs in ras proteins, a prototype GTPase. The N-terminal oligonucleotide/oligosaccharide-binding fold domain, together with the GTPase domain, forms the extended RNA-binding site. The C-terminal domain has an unusual zinc-finger motif composed of Cys-250, Cys-255, Cys-263, and His-257, with a remote structural similarity to a portion of a DNA-repair protein, rad51 fragment. The overall structural features of TmYjeQ make it a good candidate for an RNA-binding protein, which is consistent with the biochemical data of the YjeQ subfamily in binding to the ribosome. PMID:15331784

  14. Structural stabilization of GTP-binding domains in circularly permuted GTPases: Implications for RNA binding

    PubMed Central

    Anand, Baskaran; Verma, Sunil Kumar; Prakash, Balaji

    2006-01-01

    GTP hydrolysis by GTPases requires crucial residues embedded in a conserved G-domain as sequence motifs G1–G5. However, in some of the recently identified GTPases, the motif order is circularly permuted. All possible circular permutations were identified after artificially permuting the classical GTPases and subjecting them to profile Hidden Markov Model searches. This revealed G4–G5–G1–G2–G3 as the only possible circular permutation that can exist in nature. It was also possible to recognize a structural rationale for the absence of other permutations, which either destabilize the invariant GTPase fold or disrupt regions that provide critical residues for GTP binding and hydrolysis, such as Switch-I and Switch-II. The circular permutation relocates Switch-II to the C-terminus and leaves it unfastened, thus affecting GTP binding and hydrolysis. Stabilizing this region would require the presence of an additional domain following Switch-II. Circularly permuted GTPases (cpGTPases) conform to such a requirement and always possess an ‘anchoring’ C-terminal domain. There are four sub-families of cpGTPases, of which three possess an additional domain N-terminal to the G-domain. The biochemical function of these domains, based on available experimental reports and domain recognition analysis carried out here, are suggestive of RNA binding. The features that dictate RNA binding are unique to each subfamily. It is possible that RNA-binding modulates GTP binding or vice versa. In addition, phylogenetic analysis indicates a closer evolutionary relationship between cpGTPases and a set of universally conserved bacterial GTPases that bind the ribosome. It appears that cpGTPases are RNA-binding proteins possessing a means to relate GTP binding to RNA binding. PMID:16648363

  15. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  16. Functional characterization of EngA(MS), a P-loop GTPase of Mycobacterium smegmatis.

    PubMed

    Agarwal, Nisheeth; Pareek, Madhu; Thakur, Preeti; Pathak, Vibha

    2012-01-01

    Bacterial P-loop GTPases belong to a family of proteins that selectively hydrolyze a small molecule guanosine tri-phosphate (GTP) to guanosine di-phosphate (GDP) and inorganic phosphate, and regulate several essential cellular activities such as cell division, chromosomal segregation and ribosomal assembly. A comparative genome sequence analysis of different mycobacterial species indicates the presence of multiple P-loop GTPases that exhibit highly conserved motifs. However, an exact function of most of these GTPases in mycobacteria remains elusive. In the present study we characterized the function of a P-loop GTPase in mycobacteria by employing an EngA homologue from Mycobacterium smegmatis, encoded by an open reading frame, designated as MSMEG_3738. Amino acid sequence alignment and phylogenetic analysis suggest that MSMEG_3738 (termed as EngA(MS)) is highly conserved in mycobacteria. Homology modeling of EngA(MS) reveals a cloverleaf structure comprising of α/β fold typical to EngA family of GTPases. Recombinant EngA(MS) purified from E. coli exhibits a GTP hydrolysis activity which is inhibited by the presence of GDP. Interestingly, the EngA(MS) protein is co-eluted with 16S and 23S ribosomal RNA during purification and exhibits association with 30S, 50S and 70S ribosomal subunits. Further studies demonstrate that GTP is essential for interaction of EngA(MS) with 50S subunit of ribosome and specifically C-terminal domains of EngA(MS) are required to facilitate this interaction. Moreover, EngA(MS) devoid of N-terminal region interacts well with 50S even in the absence of GTP, indicating a regulatory role of the N-terminal domain in EngA(MS)-50S interaction. PMID:22506030

  17. Structure-based design and screening of inhibitors for an essential bacterial GTPase, Der.

    PubMed

    Hwang, Jihwan; Tseitin, Vladimir; Ramnarayan, Kal; Shenderovich, Mark D; Inouye, Masayori

    2012-05-01

    Der is an essential and widely conserved GTPase that assists assembly of a large ribosomal subunit in bacteria. Der associates specifically with the 50S subunit in a GTP-dependent manner and the cells depleted of Der accumulate the structurally unstable 50S subunit, which dissociates into an aberrant subunit at a lower Mg(2+) concentration. As Der is an essential and ubiquitous protein in bacteria, it may prove to be an ideal cellular target against which new antibiotics can be developed. In the present study, we describe our attempts to identify novel antibiotics specifically targeting Der GTPase. We performed the structure-based design of Der inhibitors using the X-ray crystal structure of Thermotoga maritima Der (TmDer). Virtual screening of commercially available chemical library retrieved 257 small molecules that potentially inhibit Der GTPase activity. These 257 chemicals were tested for their in vitro effects on TmDer GTPase and in vivo antibacterial activities. We identified three structurally diverse compounds, SBI-34462, -34566 and -34612, that are both biologically active against bacterial cells and putative enzymatic inhibitors of Der GTPase homologs. We also presented the possible interactions of each compound with the Der GTP-binding site to understand the mechanism of inhibition. Therefore, our lead compounds inhibiting Der GTPase provide scaffolds for the development of novel antibiotics against antibiotic-resistant pathogenic bacteria. PMID:22377538

  18. Structure of the GTP Form of Elongation Factor 4 (EF4) Bound to the Ribosome.

    PubMed

    Kumar, Veerendra; Ero, Rya; Ahmed, Tofayel; Goh, Kwok Jian; Zhan, Yin; Bhushan, Shashi; Gao, Yong-Gui

    2016-06-17

    Elongation factor 4 (EF4) is a member of the family of ribosome-dependent translational GTPase factors, along with elongation factor G and BPI-inducible protein A. Although EF4 is highly conserved in bacterial, mitochondrial, and chloroplast genomes, its exact biological function remains controversial. Here we present the cryo-EM reconstitution of the GTP form of EF4 bound to the ribosome with P and E site tRNAs at 3.8-Å resolution. Interestingly, our structure reveals an unrotated ribosome rather than a clockwise-rotated ribosome, as observed in the presence of EF4-GDP and P site tRNA. In addition, we also observed a counterclockwise-rotated form of the above complex at 5.7-Å resolution. Taken together, our results shed light on the interactions formed between EF4, the ribosome, and the P site tRNA and illuminate the GTPase activation mechanism at previously unresolved detail. PMID:27137929

  19. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  20. Dynamin, a membrane remodelling GTPase

    PubMed Central

    Ferguson, Shawn M.; De Camilli, Pietro

    2012-01-01

    Dynamin, the founding member of a family of dynamin-like GTPases (DLPs) implicated in membrane remodelling, has a critical role in endocytic membrane fission events. The use of complementary approaches, including live cell imaging, cell free-studies, X-ray crystallography and genetic studies in mice has greatly advanced our understanding of the mechanisms by which dynamin acts, its essential roles in cell physiology and the specific function of different dynamin isoforms. In addition, several connections between dynamin and human disease have also emerged that highlight specific contributions of this GTPase to the physiology of different tissues. PMID:22233676

  1. A monovalent cation acts as structural and catalytic cofactor in translational GTPases

    PubMed Central

    Kuhle, Bernhard; Ficner, Ralf

    2014-01-01

    Translational GTPases are universally conserved GTP hydrolyzing enzymes, critical for fidelity and speed of ribosomal protein biosynthesis. Despite their central roles, the mechanisms of GTP-dependent conformational switching and GTP hydrolysis that govern the function of trGTPases remain poorly understood. Here, we provide biochemical and high-resolution structural evidence that eIF5B and aEF1A/EF-Tu bound to GTP or GTPγS coordinate a monovalent cation (M+) in their active site. Our data reveal that M+ ions form constitutive components of the catalytic machinery in trGTPases acting as structural cofactor to stabilize the GTP-bound “on” state. Additionally, the M+ ion provides a positive charge into the active site analogous to the arginine-finger in the Ras-RasGAP system indicating a similar role as catalytic element that stabilizes the transition state of the hydrolysis reaction. In sequence and structure, the coordination shell for the M+ ion is, with exception of eIF2γ, highly conserved among trGTPases from bacteria to human. We therefore propose a universal mechanism of M+-dependent conformational switching and GTP hydrolysis among trGTPases with important consequences for the interpretation of available biochemical and structural data. PMID:25225612

  2. Rho GTPases and their effector proteins.

    PubMed Central

    Bishop, A L; Hall, A

    2000-01-01

    Rho GTPases are molecular switches that regulate many essential cellular processes, including actin dynamics, gene transcription, cell-cycle progression and cell adhesion. About 30 potential effector proteins have been identified that interact with members of the Rho family, but it is still unclear which of these are responsible for the diverse biological effects of Rho GTPases. This review will discuss how Rho GTPases physically interact with, and regulate the activity of, multiple effector proteins and how specific effector proteins contribute to cellular responses. To date most progress has been made in the cytoskeleton field, and several biochemical links have now been established between GTPases and the assembly of filamentous actin. The main focus of this review will be Rho, Rac and Cdc42, the three best characterized mammalian Rho GTPases, though the genetic analysis of Rho GTPases in lower eukaryotes is making increasingly important contributions to this field. PMID:10816416

  3. Regulating Rho GTPases and their regulators.

    PubMed

    Hodge, Richard G; Ridley, Anne J

    2016-08-01

    Rho GTPases regulate cytoskeletal and cell adhesion dynamics and thereby coordinate a wide range of cellular processes, including cell migration, cell polarity and cell cycle progression. Most Rho GTPases cycle between a GTP-bound active conformation and a GDP-bound inactive conformation to regulate their ability to activate effector proteins and to elicit cellular responses. However, it has become apparent that Rho GTPases are regulated by post-translational modifications and the formation of specific protein complexes, in addition to GTP-GDP cycling. The canonical regulators of Rho GTPases - guanine nucleotide exchange factors, GTPase-activating proteins and guanine nucleotide dissociation inhibitors - are regulated similarly, creating a complex network of interactions to determine the precise spatiotemporal activation of Rho GTPases. PMID:27301673

  4. Colicin E3 cleavage of 16S rRNA impairs decoding and accelerates tRNA translocation on Escherichia coli ribosomes

    PubMed Central

    Lancaster, Lorna E; Savelsbergh, Andreas; Kleanthous, Colin; Wintermeyer, Wolfgang; Rodnina, Marina V

    2008-01-01

    The cytotoxin colicin E3 targets the 30S subunit of bacterial ribosomes and specifically cleaves 16S rRNA at the decoding centre, thereby inhibiting translation. Although the cleavage site is well known, it is not clear which step of translation is inhibited. We studied the effects of colicin E3 cleavage on ribosome functions by analysing individual steps of protein synthesis. We find that the cleavage affects predominantly the elongation step. The inhibitory effect of colicin E3 cleavage originates from the accumulation of sequential impaired decoding events, each of which results in low occupancy of the A site and, consequently, decreasing yield of elongating peptide. The accumulation leads to an almost complete halt of translation after reading of a few codons. The cleavage of 16S rRNA does not impair monitoring of codon–anticodon complexes or GTPase activation during elongation-factor Tu-dependent binding of aminoacyl-tRNA, but decreases the stability of the codon–recognition complex and slows down aminoacyl-tRNA accommodation in the A site. The tRNA–mRNA translocation is faster on colicin E3-cleaved than on intact ribosomes and is less sensitive to inhibition by the antibiotic viomycin. PMID:18485067

  5. Deregulation of Rho GTPases in cancer

    PubMed Central

    Porter, Andrew P.; Papaioannou, Alexandra; Malliri, Angeliki

    2016-01-01

    ABSTRACT In vitro and in vivo studies and evidence from human tumors have long implicated Rho GTPase signaling in the formation and dissemination of a range of cancers. Recently next generation sequencing has identified direct mutations of Rho GTPases in human cancers. Moreover, the effects of ablating genes encoding Rho GTPases and their regulators in mouse models, or through pharmacological inhibition, strongly suggests that targeting Rho GTPase signaling could constitute an effective treatment. In this review we will explore the various ways in which Rho signaling can be deregulated in human cancers. PMID:27104658

  6. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  7. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  8. Guanylate-Binding Protein 1, an Interferon-Induced GTPase, Exerts an Antiviral Activity against Classical Swine Fever Virus Depending on Its GTPase Activity

    PubMed Central

    Li, Lian-Feng; Yu, Jiahui; Li, Yongfeng; Wang, Jinghan; Li, Su; Zhang, Lingkai; Xia, Shui-Li; Yang, Qian; Wang, Xiao; Yu, Shaoxiong; Luo, Yuzi; Sun, Yuan; Zhu, Yan; Munir, Muhammad

    2016-01-01

    ABSTRACT Many viruses trigger the type I interferon (IFN) pathway upon infection, resulting in the transcription of hundreds of interferon-stimulated genes (ISGs), which define the antiviral state of the host. Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), a highly contagious viral disease endangering the pig industry in many countries. However, anti-CSFV ISGs are poorly documented. Here we screened 20 ISGs that are commonly induced by type I IFNs against CSFV in lentivirus-delivered cell lines, resulting in the identification of guanylate-binding protein 1 (GBP1) as a potent anti-CSFV ISG. We observed that overexpression of GBP1, an IFN-induced GTPase, remarkably suppressed CSFV replication, whereas knockdown of endogenous GBP1 expression by small interfering RNAs significantly promoted CSFV growth. Furthermore, we demonstrated that GBP1 acted mainly on the early phase of CSFV replication and inhibited the translation efficiency of the internal ribosome entry site of CSFV. In addition, we found that GBP1 was upregulated at the transcriptional level in CSFV-infected PK-15 cells and in various organs of CSFV-infected pigs. Coimmunoprecipitation and glutathione S-transferase (GST) pulldown assays revealed that GBP1 interacted with the NS5A protein of CSFV, and this interaction was mapped in the N-terminal globular GTPase domain of GBP1. Interestingly, the K51 of GBP1, which is crucial for its GTPase activity, was essential for the inhibition of CSFV replication. We showed further that the NS5A-GBP1 interaction inhibited GTPase activity, which was critical for its antiviral effect. Taking our findings together, GBP1 is an anti-CSFV ISG whose action depends on its GTPase activity. IMPORTANCE Classical swine fever virus (CSFV) is the causative agent of classical swine fever (CSF), an economically important viral disease affecting the pig industry in many countries. To date, only a few host restriction factors against CSFV

  9. LRRK2 autophosphorylation enhances its GTPase activity.

    PubMed

    Liu, Zhiyong; Mobley, James A; DeLucas, Lawrence J; Kahn, Richard A; West, Andrew B

    2016-01-01

    The leucine-rich repeat kinase (LRRK)-2 protein contains nonoverlapping GTPase and kinase domains, and mutation in either domain can cause Parkinson disease. GTPase proteins are critical upstream modulators of many effector protein kinases. In LRRK2, this paradigm may be reversed, as the kinase domain phosphorylates its own GTPase domain. In this study, we found that the ameba LRRK2 ortholog ROCO4 phosphorylates the GTPase domain [termed Ras-of-complex (ROC) domain in this family] of human LRRK2 on the same residues as the human LRRK2 kinase. Phosphorylation of ROC enhances its rate of GTP hydrolysis [from kcat (catalytic constant) 0.007 to 0.016 min(-1)], without affecting GTP or GDP dissociation kinetics [koff = 0.093 and 0.148 min(-1) for GTP and GDP, respectively). Phosphorylation also promotes the formation of ROC dimers, although GTPase activity appears to be equivalent between purified dimers and monomers. Modeling experiments show that phosphorylation induces conformational changes at the critical p-loop structure. Finally, ROC appears to be one of many GTPases phosphorylated in p-loop residues, as revealed by alignment of LRRK2 autophosphorylation sites with GTPases annotated in the phosphoproteome database. These results provide an example of a novel mechanism for kinase-mediated control of GTPase activity. PMID:26396237

  10. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  11. Initiation factor 2 crystal structure reveals a different domain organization from eukaryotic initiation factor 5B and mechanism among translational GTPases.

    PubMed

    Eiler, Daniel; Lin, Jinzhong; Simonetti, Angelita; Klaholz, Bruno P; Steitz, Thomas A

    2013-09-24

    The initiation of protein synthesis uses initiation factor 2 (IF2) in prokaryotes and a related protein named eukaryotic initiation factor 5B (eIF5B) in eukaryotes. IF2 is a GTPase that positions the initiator tRNA on the 30S ribosomal initiation complex and stimulates its assembly to the 50S ribosomal subunit to make the 70S ribosome. The 3.1-Å resolution X-ray crystal structures of the full-length Thermus thermophilus apo IF2 and its complex with GDP presented here exhibit two different conformations (all of its domains except C2 domain are visible). Unlike all other translational GTPases, IF2 does not have an effecter domain that stably contacts the switch II region of the GTPase domain. The domain organization of IF2 is inconsistent with the "articulated lever" mechanism of communication between the GTPase and initiator tRNA binding domains that has been proposed for eIF5B. Previous cryo-electron microscopy reconstructions, NMR experiments, and this structure show that IF2 transitions from being flexible in solution to an extended conformation when interacting with ribosomal complexes. PMID:24029018

  12. Role of a ribosomal RNA phosphate oxygen during the EF-G–triggered GTP hydrolysis

    PubMed Central

    Koch, Miriam; Flür, Sara; Kreutz, Christoph; Ennifar, Eric; Micura, Ronald; Polacek, Norbert

    2015-01-01

    Elongation factor-catalyzed GTP hydrolysis is a key reaction during the ribosomal elongation cycle. Recent crystal structures of G proteins, such as elongation factor G (EF-G) bound to the ribosome, as well as many biochemical studies, provide evidence that the direct interaction of translational GTPases (trGTPases) with the sarcin-ricin loop (SRL) of ribosomal RNA (rRNA) is pivotal for hydrolysis. However, the precise mechanism remains elusive and is intensively debated. Based on the close proximity of the phosphate oxygen of A2662 of the SRL to the supposedly catalytic histidine of EF-G (His87), we probed this interaction by an atomic mutagenesis approach. We individually replaced either of the two nonbridging phosphate oxygens at A2662 with a methyl group by the introduction of a methylphosphonate instead of the natural phosphate in fully functional, reconstituted bacterial ribosomes. Our major finding was that only one of the two resulting diastereomers, the SP methylphosphonate, was compatible with efficient GTPase activation on EF-G. The same trend was observed for a second trGTPase, namely EF4 (LepA). In addition, we provide evidence that the negative charge of the A2662 phosphate group must be retained for uncompromised activity in GTP hydrolysis. In summary, our data strongly corroborate that the nonbridging proSP phosphate oxygen at the A2662 of the SRL is critically involved in the activation of GTP hydrolysis. A mechanistic scenario is supported in which positioning of the catalytically active, protonated His87 through electrostatic interactions with the A2662 phosphate group and H-bond networks are key features of ribosome-triggered activation of trGTPases. PMID:25941362

  13. Formins as effector proteins of Rho GTPases

    PubMed Central

    Kühn, Sonja; Geyer, Matthias

    2014-01-01

    Formin proteins were recognized as effectors of Rho GTPases some 15 years ago. They contribute to different cellular actin cytoskeleton structures by their ability to polymerize straight actin filaments at the barbed end. While not all formins necessarily interact with Rho GTPases, a subgroup of mammalian formins, termed Diaphanous-related formins or DRFs, were shown to be activated by small GTPases of the Rho superfamily. DRFs are autoinhibited in the resting state by an N- to C-terminal interaction that renders the central actin polymerization domain inactive. Upon the interaction with a GTP-bound Rho, Rac, or Cdc42 GTPase, the C-terminal autoregulation domain is displaced from its N-terminal recognition site and the formin becomes active to polymerize actin filaments. In this review we discuss the current knowledge on the structure, activation, and function of formin-GTPase interactions for the mammalian formin families Dia, Daam, FMNL, and FHOD. We describe both direct and indirect interactions of formins with GTPases, which lead to formin activation and cytoskeletal rearrangements. The multifaceted function of formins as effector proteins of Rho GTPases thus reflects the diversity of the actin cytoskeleton in cells. PMID:24914801

  14. Potassium Acts as a GTPase-Activating Element on Each Nucleotide-Binding Domain of the Essential Bacillus subtilis EngA

    PubMed Central

    Foucher, Anne-Emmanuelle; Reiser, Jean-Baptiste; Ebel, Christine; Housset, Dominique; Jault, Jean-Michel

    2012-01-01

    EngA proteins form a unique family of bacterial GTPases with two GTP-binding domains in tandem, namely GD1 and GD2, followed by a KH (K-homology) domain. They have been shown to interact with the bacterial ribosome and to be involved in its biogenesis. Most prokaryotic EngA possess a high GTPase activity in contrast to eukaryotic GTPases that act mainly as molecular switches. Here, we have purified and characterized the GTPase activity of the Bacillus subtilis EngA and two shortened EngA variants that only contain GD1 or GD2-KH. Interestingly, the GTPase activity of GD1 alone is similar to that of the whole EngA, whereas GD2-KH has a 150-fold lower GTPase activity. At physiological concentration, potassium strongly stimulates the GTPase activity of each protein construct. Interestingly, it affects neither the affinities for nucleotides nor the monomeric status of EngA or the GD1 domain. Thus, potassium likely acts as a chemical GTPase-activating element as proposed for another bacterial GTPase like MnmE. However, unlike MnmE, potassium does not promote dimerization of EngA. In addition, we solved two crystal structures of full-length EngA. One of them contained for the first time a GTP-like analogue bound to GD2 while GD1 was free. Surprisingly, its overall fold was similar to a previously solved structure with GDP bound to both sites. Our data indicate that a significant structural change must occur upon K+ binding to GD2, and a comparison with T. maritima EngA and MnmE structures allowed us to propose a model explaining the chemical basis for the different GTPase activities of GD1 and GD2. PMID:23056455

  15. Locking GTPases covalently in their functional states

    NASA Astrophysics Data System (ADS)

    Wiegandt, David; Vieweg, Sophie; Hofmann, Frank; Koch, Daniel; Li, Fu; Wu, Yao-Wen; Itzen, Aymelt; Müller, Matthias P.; Goody, Roger S.

    2015-07-01

    GTPases act as key regulators of many cellular processes by switching between active (GTP-bound) and inactive (GDP-bound) states. In many cases, understanding their mode of action has been aided by artificially stabilizing one of these states either by designing mutant proteins or by complexation with non-hydrolysable GTP analogues. Because of inherent disadvantages in these approaches, we have developed acryl-bearing GTP and GDP derivatives that can be covalently linked with strategically placed cysteines within the GTPase of interest. Binding studies with GTPase-interacting proteins and X-ray crystallography analysis demonstrate that the molecular properties of the covalent GTPase-acryl-nucleotide adducts are a faithful reflection of those of the corresponding native states and are advantageously permanently locked in a defined nucleotide (that is active or inactive) state. In a first application, in vivo experiments using covalently locked Rab5 variants provide new insights into the mechanism of correct intracellular localization of Rab proteins.

  16. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  17. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  18. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  19. Structures of ribosome-bound initiation factor 2 reveal the mechanism of subunit association

    PubMed Central

    Sprink, Thiemo; Ramrath, David J. F.; Yamamoto, Hiroshi; Yamamoto, Kaori; Loerke, Justus; Ismer, Jochen; Hildebrand, Peter W.; Scheerer, Patrick; Bürger, Jörg; Mielke, Thorsten; Spahn, Christian M. T.

    2016-01-01

    Throughout the four phases of protein biosynthesis—initiation, elongation, termination, and recycling—the ribosome is controlled and regulated by at least one specified translational guanosine triphosphatase (trGTPase). Although the structural basis for trGTPase interaction with the ribosome has been solved for the last three steps of translation, the high-resolution structure for the key initiation trGTPase, initiation factor 2 (IF2), complexed with the ribosome, remains elusive. We determine the structure of IF2 complexed with a nonhydrolyzable guanosine triphosphate analog and initiator fMet-tRNAiMet in the context of the Escherichia coli ribosome to 3.7-Å resolution using cryo-electron microscopy. The structural analysis reveals previously unseen intrinsic conformational modes of the 70S initiation complex, establishing the mutual interplay of IF2 and initator transfer RNA (tRNA) with the ribsosome and providing the structural foundation for a mechanistic understanding of the final steps of translation initiation. PMID:26973877

  20. Structures of ribosome-bound initiation factor 2 reveal the mechanism of subunit association.

    PubMed

    Sprink, Thiemo; Ramrath, David J F; Yamamoto, Hiroshi; Yamamoto, Kaori; Loerke, Justus; Ismer, Jochen; Hildebrand, Peter W; Scheerer, Patrick; Bürger, Jörg; Mielke, Thorsten; Spahn, Christian M T

    2016-03-01

    Throughout the four phases of protein biosynthesis-initiation, elongation, termination, and recycling-the ribosome is controlled and regulated by at least one specified translational guanosine triphosphatase (trGTPase). Although the structural basis for trGTPase interaction with the ribosome has been solved for the last three steps of translation, the high-resolution structure for the key initiation trGTPase, initiation factor 2 (IF2), complexed with the ribosome, remains elusive. We determine the structure of IF2 complexed with a nonhydrolyzable guanosine triphosphate analog and initiator fMet-tRNAi (Met) in the context of the Escherichia coli ribosome to 3.7-Å resolution using cryo-electron microscopy. The structural analysis reveals previously unseen intrinsic conformational modes of the 70S initiation complex, establishing the mutual interplay of IF2 and initator transfer RNA (tRNA) with the ribsosome and providing the structural foundation for a mechanistic understanding of the final steps of translation initiation. PMID:26973877

  1. Ribosomal Dynamics: Intrinsic Instability of a Molecular Machine

    NASA Astrophysics Data System (ADS)

    Gao, Haixiao; Le Barron, Jamie; Frank, Joachim

    Ribosomes are molecular machines that translate genetic message into nascent peptides, through a complex dynamics interplay with mRNAs, tRNAs, and various protein factors. A prominent example of ribosomal dynamics is the rotation of small ribosomal subunit with respect to a large subunit, characterized as the "ratchet motion," which is triggered by the binding of several translation factors. Here, we analyze two kinds of ribosomal ratchet motions, induced by the binding of EF-G and RF3, respectively, as previously observed by cryo-electron microscopy. Using the flexible fitting technique (real-space refinement) and an RNA secondary structure display tool (coloRNA), we obtained quasi-atomic models of the ribosome in these ratchet-motion-related functional states and mapped the observed differences onto the highly conserved RNA secondary structure. Comparisons between two sets of ratchet motions revealed that, while the overall patterns of the RNA displacement are very similar, several local regions stand out in their differential behavior, including the highly conserved GAC (GTPase-associated-center) region. We postulate that these regions are important in modulating general ratchet motion and bestowing it with the dynamic characteristics required for the specific function.

  2. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  3. Rho GTPase signalling in cell migration

    PubMed Central

    Ridley, Anne J

    2015-01-01

    Cells migrate in multiple different ways depending on their environment, which includes the extracellular matrix composition, interactions with other cells, and chemical stimuli. For all types of cell migration, Rho GTPases play a central role, although the relative contribution of each Rho GTPase depends on the environment and cell type. Here, I review recent advances in our understanding of how Rho GTPases contribute to different types of migration, comparing lamellipodium-driven versus bleb-driven migration modes. I also describe how cells migrate across the endothelium. In addition to Rho, Rac and Cdc42, which are well known to regulate migration, I discuss the roles of other less-well characterized members of the Rho family. PMID:26363959

  4. Are There Rab GTPases in Archaea?

    PubMed Central

    Surkont, Jaroslaw; Pereira-Leal, Jose B.

    2016-01-01

    A complex endomembrane system is one of the hallmarks of Eukaryotes. Vesicle trafficking between compartments is controlled by a diverse protein repertoire, including Rab GTPases. These small GTP-binding proteins contribute identity and specificity to the system, and by working as molecular switches, trigger multiple events in vesicle budding, transport, and fusion. A diverse collection of Rab GTPases already existed in the ancestral Eukaryote, yet, it is unclear how such elaborate repertoire emerged. A novel archaeal phylum, the Lokiarchaeota, revealed that several eukaryotic-like protein systems, including small GTPases, are present in Archaea. Here, we test the hypothesis that the Rab family of small GTPases predates the origin of Eukaryotes. Our bioinformatic pipeline detected multiple putative Rab-like proteins in several archaeal species. Our analyses revealed the presence and strict conservation of sequence features that distinguish eukaryotic Rabs from other small GTPases (Rab family motifs), mapping to the same regions in the structure as in eukaryotic Rabs. These mediate Rab-specific interactions with regulators of the REP/GDI (Rab Escort Protein/GDP dissociation Inhibitor) family. Sensitive structure-based methods further revealed the existence of REP/GDI-like genes in Archaea, involved in isoprenyl metabolism. Our analysis supports a scenario where Rabs differentiated into an independent family in Archaea, interacting with proteins involved in membrane biogenesis. These results further support the archaeal nature of the eukaryotic ancestor and provide a new insight into the intermediate stages and the evolutionary path toward the complex membrane-associated signaling circuits that characterize the Ras superfamily of small GTPases, and specifically Rab proteins. PMID:27034425

  5. Are There Rab GTPases in Archaea?

    PubMed

    Surkont, Jaroslaw; Pereira-Leal, Jose B

    2016-07-01

    A complex endomembrane system is one of the hallmarks of Eukaryotes. Vesicle trafficking between compartments is controlled by a diverse protein repertoire, including Rab GTPases. These small GTP-binding proteins contribute identity and specificity to the system, and by working as molecular switches, trigger multiple events in vesicle budding, transport, and fusion. A diverse collection of Rab GTPases already existed in the ancestral Eukaryote, yet, it is unclear how such elaborate repertoire emerged. A novel archaeal phylum, the Lokiarchaeota, revealed that several eukaryotic-like protein systems, including small GTPases, are present in Archaea. Here, we test the hypothesis that the Rab family of small GTPases predates the origin of Eukaryotes. Our bioinformatic pipeline detected multiple putative Rab-like proteins in several archaeal species. Our analyses revealed the presence and strict conservation of sequence features that distinguish eukaryotic Rabs from other small GTPases (Rab family motifs), mapping to the same regions in the structure as in eukaryotic Rabs. These mediate Rab-specific interactions with regulators of the REP/GDI (Rab Escort Protein/GDP dissociation Inhibitor) family. Sensitive structure-based methods further revealed the existence of REP/GDI-like genes in Archaea, involved in isoprenyl metabolism. Our analysis supports a scenario where Rabs differentiated into an independent family in Archaea, interacting with proteins involved in membrane biogenesis. These results further support the archaeal nature of the eukaryotic ancestor and provide a new insight into the intermediate stages and the evolutionary path toward the complex membrane-associated signaling circuits that characterize the Ras superfamily of small GTPases, and specifically Rab proteins. PMID:27034425

  6. Crystal structure of release factor RF3 trapped in the GTP state on a rotated conformation of the ribosome

    SciTech Connect

    Zhou, Jie; Lancaster, Laura; Trakhanov, Sergei; Noller, Harry F.

    2012-03-26

    The class II release factor RF3 is a GTPase related to elongation factor EF-G, which catalyzes release of class I release factors RF1 and RF2 from the ribosome after termination of protein synthesis. The 3.3 {angstrom} crystal structure of the RF3 {center_dot} GDPNP {center_dot} ribosome complex provides a high-resolution description of interactions and structural rearrangements that occur when binding of this translational GTPase induces large-scale rotational movements in the ribosome. RF3 induces a 7{sup o} rotation of the body and 14{sup o} rotation of the head of the 30S ribosomal subunit, and itself undergoes inter- and intradomain conformational rearrangements. We suggest that ordering of critical elements of switch loop I and the P loop, which help to form the GTPase catalytic site, are caused by interactions between the G domain of RF3 and the sarcin-ricin loop of 23S rRNA. The rotational movements in the ribosome induced by RF3, and its distinctly different binding orientation to the sarcin-ricin loop of 23S rRNA, raise interesting implications for the mechanism of action of EF-G in translocation.

  7. Small RAB GTPases Regulate Multiple Steps of Mitosis.

    PubMed

    Miserey-Lenkei, Stéphanie; Colombo, María I

    2016-01-01

    GTPases of the RAB family are key regulators of multiple steps of membrane trafficking. Several members of the RAB GTPase family have been implicated in mitotic progression. In this review, we will first focus on the function of endosome-associated RAB GTPases reported in early steps of mitosis, spindle pole maturation, and during cytokinesis. Second, we will discuss the role of Golgi-associated RAB GTPases at the metaphase/anaphase transition and during cytokinesis. PMID:26925400

  8. Small RAB GTPases Regulate Multiple Steps of Mitosis

    PubMed Central

    Miserey-Lenkei, Stéphanie; Colombo, María I.

    2016-01-01

    GTPases of the RAB family are key regulators of multiple steps of membrane trafficking. Several members of the RAB GTPase family have been implicated in mitotic progression. In this review, we will first focus on the function of endosome-associated RAB GTPases reported in early steps of mitosis, spindle pole maturation, and during cytokinesis. Second, we will discuss the role of Golgi-associated RAB GTPases at the metaphase/anaphase transition and during cytokinesis. PMID:26925400

  9. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  10. Role and timing of GTP binding and hydrolysis during EF-G-dependent tRNA translocation on the ribosome

    PubMed Central

    Wilden, Berthold; Savelsbergh, Andreas; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2006-01-01

    The translocation of tRNA and mRNA through the ribosome is promoted by elongation factor G (EF-G), a GTPase that hydrolyzes GTP during the reaction. Recently, it was reported that, in contrast to previous observations, the affinity of EF-G was much weaker for GTP than for GDP and that ribosome-catalyzed GDP–GTP exchange would be required for translocation [Zavialov AV, Hauryliuk VV, Ehrenberg M (2005) J Biol 4:9]. We have reinvestigated GTP/GDP binding and show that EF-G binds GTP and GDP with affinities in the 20 to 40 μM range (37°C), in accordance with earlier reports. Furthermore, GDP exchange, which is extremely rapid on unbound EF-G, is retarded, rather than accelerated, on the ribosome, which, therefore, is not a nucleotide-exchange factor for EF-G. The EF-G·GDPNP complex, which is very labile, is stabilized 30,000-fold by binding to the ribosome. These findings, together with earlier kinetic results, reveal that EF-G enters the pretranslocation ribosome in the GTP-bound form and indicate that, upon ribosome-complex formation, the nucleotide-binding pocket of EF-G is closed, presumably in conjunction with GTPase activation. GTP hydrolysis is required for rapid tRNA–mRNA movement, and Pi release induces further rearrangements of both EF-G and the ribosome that are required for EF-G turnover. PMID:16940356

  11. Approaches of targeting Rho GTPases in cancer drug discovery

    PubMed Central

    Lin, Yuan; Zheng, Yi

    2016-01-01

    Introduction Rho GTPases are master regulators of actomyosin structure and dynamics and play pivotal roles in a variety of cellular processes including cell morphology, gene transcription, cell cycle progression and cell adhesion. Because aberrant Rho GTPase signaling activities are widely associated with human cancer, key components of Rho GTPase signaling pathways have attracted increasing interest as potential therapeutic targets. Similar to Ras, Rho GTPases themselves were, until recently, deemed “undruggable” because of structure-function considerations. Several approaches to interfere with Rho GTPase signaling have been explored and show promise as new ways for tackling cancer cells. Areas covered This review focuses on the recent progress in targeting the signaling activities of three prototypical Rho GTPases, i.e. RhoA, Rac1, and Cdc42. The authors describe the involvement of these Rho GTPases, their key regulators and effectors in cancer. Furthermore, the authors discuss the current approaches for rationally targeting aberrant Rho GTPases along their signaling cascades, upstream and downstream of Rho GTPases and posttranslational modifications at a molecular level. Expert opinion To date, while no clinically effective drugs targeting Rho GTPase signaling for cancer treatment are available, tool compounds and lead drugs that pharmacologically inhibit Rho GTPase pathways have shown promise. Small molecule inhibitors targeting Rho GTPase signaling may add new treatment options for future precision cancer therapy, particularly in combination with other anti-cancer agents. PMID:26087073

  12. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  13. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  14. Invited review: Small GTPases and their GAPs.

    PubMed

    Mishra, Ashwini K; Lambright, David G

    2016-08-01

    Widespread utilization of small GTPases as major regulatory hubs in many different biological systems derives from a conserved conformational switch mechanism that facilitates cycling between GTP-bound active and GDP-bound inactive states under control of guanine nucleotide exchange factors (GEFs) and GTPase activating proteins (GAPs), which accelerate slow intrinsic rates of activation by nucleotide exchange and deactivation by GTP hydrolysis, respectively. Here we review developments leading to current understanding of intrinsic and GAP catalyzed GTP hydrolytic reactions in small GTPases from structural, molecular and chemical mechanistic perspectives. Despite the apparent simplicity of the GTPase cycle, the structural bases underlying the hallmark hydrolytic reaction and catalytic acceleration by GAPs are considerably more diverse than originally anticipated. Even the most fundamental aspects of the reaction mechanism have been challenging to decipher. Through a combination of experimental and in silico approaches, the outlines of a consensus view have begun to emerge for the best studied paradigms. Nevertheless, recent observations indicate that there is still much to be learned. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 431-448, 2016. PMID:26972107

  15. Exceptionally large entropy contributions enable the high rates of GTP hydrolysis on the ribosome

    PubMed Central

    Åqvist, Johan; Kamerlin, Shina C.L.

    2015-01-01

    Protein synthesis on the ribosome involves hydrolysis of GTP in several key steps of the mRNA translation cycle. These steps are catalyzed by the translational GTPases of which elongation factor Tu (EF-Tu) is the fastest GTPase known. Here, we use extensive computer simulations to explore the origin of its remarkably high catalytic rate on the ribosome and show that it is made possible by a very large positive activation entropy. This entropy term (TΔS‡) amounts to more than 7 kcal/mol at 25 °C. It is further found to be characteristic of the reaction mechanism utilized by the translational, but not other, GTPases and it enables these enzymes to attain hydrolysis rates exceeding 500 s−1. This entropy driven mechanism likely reflects the very high selection pressure on the speed of protein synthesis, which drives the rate of each individual GTPase towards maximal turnover rate of the whole translation cycle. PMID:26497916

  16. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  17. Alignment/misalignment hypothesis for tRNA selection by the ribosome.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    Transfer RNAs (tRNAs) are the adaptor molecules that allow the ribosome to decode genetic information during protein synthesis. During decoding, the ribosome must chose the tRNA whose anticodon corresponds to the codon inscribed in the messenger RNA to incorporate the correct amino acid into the growing polypeptide chain. Fidelity is improved dramatically by a GTP hydrolysis event. Information about the correctness of the anticodon must be sent from the decoding center to the elongation factor, EF-Tu, where the GTP hydrolysis takes place. A second discrimination event entails the accommodation of the aminoacyl-tRNA into its fully bound A/A state inside the ribosome. Here, we present a hypothesis for a specific mechanism of signal transduction through the tRNA, which operates during GTPase activation and accommodation. We propose that the rigidity of the tRNA plays an important role in the transmission of the decoding signal. While the tRNA must flex during binding and accommodation, its anisotropic stiffness enables precise positioning of the acceptor arm in the A/T state, the A/A state and the accommodation corridor. Correct alignment will result in optimal GTPase activation and accommodation rates. Incorrect tRNAs, however, whose anticodons are misaligned, will also have acceptor arms that are misaligned, resulting in sub-optimal GTPase activation and accommodation rates. In the case of GTPase activation, it is possible that the misalignment of the acceptor arm affects the rate directly, by altering the conformational change of the switch region of EF-Tu, or indirectly, by changing the alignment of EF-Tu with respect to the sarcin-ricin loop (SRL) of the large ribosomal subunit. PMID:16890341

  18. An Allosteric Pathway Revealed in the Ribosome Binding Stress Factor BipA

    SciTech Connect

    Makanji, H.; deLivron, M; Robinson, V

    2009-01-01

    BipA is a highly conserved prokaryotic GTPase that functions as a master regulator of stress and virulence processes in bacteria. It is a member of the translational factor family of GTPases along with EF-G, IF-2 and LepA. Structural and biochemical data suggest that ribosome binding specificity for each member of this family lies in an effector domain. As with other bacterial GTPases, the ribosome binding and GTPase activities of this protein are tightly coupled. However, the mechanism by which this occurs is still unknown. A series of experiments have been designed to probe structural features of the protein to see if we can pinpoint specific areas of BipA, perhaps even individual residues, which are important to its association with the ribosome. Included in the list are the C-terminal effector domain of the protein, which is distinct to the BipA family of proteins, and amino acid residues in the switch I and II regions of the G domain. Using sucrose density gradients, we have shown that the C-terminal domain is required in order for BipA to bind to the ribosome. Moreover, deletion of this domain increases the GTP hydrolysis rates of the protein, likely through relief of inhibitory contacts. Additional evidence has revealed an allosteric connection between the conformationally flexible switch II region and the C-terminal domain of BipA. Site directed mutagenesis, sucrose gradients and malachite green assays are being used to elucidate the details of this coupling.

  19. A Pan-GTPase Inhibitor as a Molecular Probe

    PubMed Central

    Hong, Lin; Guo, Yuna; BasuRay, Soumik; Agola, Jacob O.; Romero, Elsa; Simpson, Denise S.; Schroeder, Chad E.; Simons, Peter; Waller, Anna; Garcia, Matthew; Carter, Mark; Ursu, Oleg; Gouveia, Kristine; Golden, Jennifer E.; Aubé, Jeffrey; Wandinger-Ness, Angela; Sklar, Larry A.

    2015-01-01

    Overactive GTPases have often been linked to human diseases. The available inhibitors are limited and have not progressed far in clinical trials. We report here a first-in-class small molecule pan-GTPase inhibitor discovered from a high throughput screening campaign. The compound CID1067700 inhibits multiple GTPases in biochemical, cellular protein and protein interaction, as well as cellular functional assays. In the biochemical and protein interaction assays, representative GTPases from Rho, Ras, and Rab, the three most generic subfamilies of the GTPases, were probed, while in the functional assays, physiological processes regulated by each of the three subfamilies of the GTPases were examined. The chemical functionalities essential for the activity of the compound were identified through structural derivatization. The compound is validated as a useful molecular probe upon which GTPase-targeting inhibitors with drug potentials might be developed. PMID:26247207

  20. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  1. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  2. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  3. YsxC, an essential protein in Staphylococcus aureus crucial for ribosome assembly/stability

    PubMed Central

    2009-01-01

    Background Bacterial growth and division requires a core set of essential proteins, several of which are still of unknown function. They are also attractive targets for the development of new antibiotics. YsxC is a member of a family of GTPases highly conserved across eubacteria with a possible ribosome associated function. Results Here, we demonstrate by the creation of a conditional lethal mutant that ysxC is apparently essential for growth in S. aureus. To begin to elucidate YsxC function, a translational fusion of YsxC to the CBP-ProteinA tag in the staphylococcal chromosome was made, enabling Tandem Affinity Purification (TAP) of YsxC-interacting partners. These included the ribosomal proteins S2, S10 and L17, as well as the β' subunit of the RNA polymerase. YsxC was then shown to copurify with ribosomes as an accessory protein specifically localizing to the 50 S subunit. YsxC depletion led to a decrease in the presence of mature ribosomes, indicating a role in ribosome assembly and/or stability in S. aureus. Conclusions In this study we demonstrate that YsxC of S. aureus localizes to the ribosomes, is crucial for ribosomal stability and is apparently essential for the life of S. aureus. PMID:20021644

  4. Small GTPases as regulators of cell division

    PubMed Central

    Militello, Rodrigo; Colombo, María I.

    2013-01-01

    The superfamily of small GTPases serves as a signal transducer to regulate a diverse array of cellular functions. The members of this superfamily are structurally and functionally classified into at least 5 groups (Ras, Rho/Rac, Rab, Arf, and Ran) and they are involved in the control of cell proliferation and differentiation, regulation of the actin cytoskeleton, membrane trafficking, and nuclear transport. It is widely reported that members of the Rab family participate in the control of intracellular membrane trafficking through the interaction with specific effector molecules. However, many Rabs and other small GTPases have also been shown to function in cell division. In this review, we discuss current knowledge about Rab proteins regulating different stages of the cell cycle, such as the congregation and segregation of chromosomes (during metaphase) and the final stage of cell division known as cytokinesis, in which a cell is cleaved originating 2 daughter cells. PMID:24265858

  5. Rag GTPase in amino acid signaling.

    PubMed

    Kim, Joungmok; Kim, Eunjung

    2016-04-01

    Rag small GTPases were identified as the sixth subfamily of Ras-related GTPases. Compelling evidence suggests that Rag heterodimer (RagA/B and RagC/D) plays an important role in amino acid signaling toward mechanistic target of rapamycin complex 1 (mTORC1), which is a central player in the control of cell growth in response to a variety of environmental cues, including growth factors, cellular energy/oxygen status, and amino acids. Upon amino acid stimulation, active Rag heterodimer (RagA/B(GTP)-RagC/D(GDP)) recruits mTORC1 to the lysosomal membrane where Rheb resides. In this review, we provide a current understanding on the amino acid-regulated cell growth control via Rag-mTORC1 with recently identified key players, including Ragulator, v-ATPase, and GATOR complexes. Moreover, the functions of Rag in physiological systems and in autophagy are discussed. PMID:26781224

  6. A tale of two GTPases in cotranslational protein targeting

    PubMed Central

    Saraogi, Ishu; Akopian, David; Shan, Shu-Ou

    2011-01-01

    Guanosine triphosphatases (GTPases) comprise a superfamily of proteins that provide molecular switches to regulate numerous cellular processes. The “GTPase switch” paradigm, in which a GTPase acts as a bimodal switch that is turned “on” and “off” by external regulatory factors, has been used to interpret the regulatory mechanism of many GTPases. Recent work on a pair of GTPases in the signal recognition particle (SRP) pathway has revealed a distinct mode of GTPase regulation. Instead of the classical GTPase switch, the two GTPases in the SRP and SRP receptor undergo a series of conformational changes during their dimerization and reciprocal activation. Each conformational rearrangement provides a point at which these GTPases can communicate with and respond to their upstream and downstream biological cues, thus ensuring the spatial and temporal precision of all the molecular events in the SRP pathway. We suggest that the SRP and SRP receptor represent an emerging class of “multistate” regulatory GTPases uniquely suited to provide exquisite control over complex cellular pathways that require multiple molecular events to occur in a highly coordinated fashion. PMID:21898651

  7. Locking GTPases covalently in their functional states

    PubMed Central

    Wiegandt, David; Vieweg, Sophie; Hofmann, Frank; Koch, Daniel; Li, Fu; Wu, Yao-Wen; Itzen, Aymelt; Müller, Matthias P.; Goody, Roger S.

    2015-01-01

    GTPases act as key regulators of many cellular processes by switching between active (GTP-bound) and inactive (GDP-bound) states. In many cases, understanding their mode of action has been aided by artificially stabilizing one of these states either by designing mutant proteins or by complexation with non-hydrolysable GTP analogues. Because of inherent disadvantages in these approaches, we have developed acryl-bearing GTP and GDP derivatives that can be covalently linked with strategically placed cysteines within the GTPase of interest. Binding studies with GTPase-interacting proteins and X-ray crystallography analysis demonstrate that the molecular properties of the covalent GTPase–acryl–nucleotide adducts are a faithful reflection of those of the corresponding native states and are advantageously permanently locked in a defined nucleotide (that is active or inactive) state. In a first application, in vivo experiments using covalently locked Rab5 variants provide new insights into the mechanism of correct intracellular localization of Rab proteins. PMID:26178622

  8. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  9. Rho GTPases at the crossroad of signaling networks in mammals

    PubMed Central

    Wojnacki, José; Quassollo, Gonzalo; Marzolo, María-Paz; Cáceres, Alfredo

    2014-01-01

    Microtubule (MT) organization and dynamics downstream of external cues is crucial for maintaining cellular architecture and the generation of cell asymmetries. In interphase cells RhoA, Rac, and Cdc42, conspicuous members of the family of small Rho GTPases, have major roles in modulating MT stability, and hence polarized cell behaviors. However, MTs are not mere targets of Rho GTPases, but also serve as signaling platforms coupling MT dynamics to Rho GTPase activation in a variety of cellular conditions. In this article, we review some of the key studies describing the reciprocal relationship between small Rho-GTPases and MTs during migration and polarization. PMID:24691223

  10. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  11. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  12. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  13. Mechanism of fusidic acid inhibition of RRF- and EF-G-dependent splitting of the bacterial post-termination ribosome

    PubMed Central

    Borg, Anneli; Pavlov, Michael; Ehrenberg, Måns

    2016-01-01

    The antibiotic drug fusidic acid (FA) is commonly used in the clinic against gram-positive bacterial infections. FA targets ribosome-bound elongation factor G (EF-G), a translational GTPase that accelerates both messenger RNA (mRNA) translocation and ribosome recycling. How FA inhibits translocation was recently clarified, but FA inhibition of ribosome recycling by EF-G and ribosome recycling factor (RRF) has remained obscure. Here we use fast kinetics techniques to estimate mean times of ribosome splitting and the stoichiometry of GTP hydrolysis by EF-G at varying concentrations of FA, EF-G and RRF. These mean times together with previous data on uninhibited ribosome recycling were used to clarify the mechanism of FA inhibition of ribosome splitting. The biochemical data on FA inhibition of translocation and recycling were used to model the growth inhibitory effect of FA on bacterial populations. We conclude that FA inhibition of translocation provides the dominant cause of bacterial growth reduction, but that FA inhibition of ribosome recycling may contribute significantly to FA-induced expression of short regulatory open reading frames, like those involved in FA resistance. PMID:27001509

  14. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement

    PubMed Central

    Budkevich, Tatyana V.; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J.F.; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W.; Tung, Chang-Shung; Nierhaus, Knud H.; Sanbonmatsu, Karissa Y.; Spahn, Christian M.T.

    2014-01-01

    SUMMARY The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present sub-nanometer resolution cryo-electron microscopy maps of the mammalian 80S ribosome in the post-translocational state and in complex with the eukaryotic eEF1A•Val-tRNA•GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the post-translocational state from the classical pre-translocational state ribosome. We term this motion “subunit rolling”. Correspondingly, a mammalian decoding complex visualized in sub-states before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  15. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  16. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  17. Regulation of phagocytosis by Rho GTPases

    PubMed Central

    Mao, Yingyu; Finnemann, Silvia C

    2015-01-01

    Phagocytosis is defined as a cellular uptake pathway for particles of greater than 0.5 μm in diameter. Particle clearance by phagocytosis is of critical importance for tissue health and homeostasis. The ultimate goal of anti-pathogen phagocytosis is to destroy engulfed bacteria or fungi and to stimulate cell-cell signaling that mount an efficient immune defense. In contrast, clearance phagocytosis of apoptotic cells and cell debris is anti-inflammatory. High capacity clearance phagocytosis pathways are available to professional phagocytes of the immune system and the retina. Additionally, a low capacity, so-called bystander phagocytic pathway is available to most other cell types. Different phagocytic pathways are stimulated by particle ligation of distinct surface receptors but all forms of phagocytosis require F-actin recruitment beneath tethered particles and F-actin re-arrangement promoting engulfment, which are controlled by Rho family GTPases. The specificity of Rho GTPase activity during the different forms of phagocytosis by mammalian cells is the subject of this review. PMID:25941749

  18. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  19. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  20. Dual use of GTP hydrolysis by elongation factor G on the ribosome

    PubMed Central

    Cunha, Carlos E.; Belardinelli, Riccardo; Peske, Frank; Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2013-01-01

    Elongation factor G (EF-G) is a GTPase that catalyzes tRNA and mRNA translocation during the elongation cycle of protein synthesis. The GTP-bound state of the factor on the ribosome has been studied mainly with non-hydrolyzable analogs of GTP, which led to controversial conclusions about the role of GTP hydrolysis in translocation. Here we describe a mutant of EF-G in which the catalytic His91 is replaced with Ala. The mutant EF-G does not hydrolyze GTP, but binds GTP with unchanged affinity, allowing us to study the function of the authentic GTP-bound form of EF-G in translocation. Utilizing fluorescent reporter groups attached to the tRNAs, mRNA, and the ribosome we compile the velocity map of translocation seen from different perspectives. The data suggest that GTP hydrolysis accelerates translocation up to 30-fold and facilitates conformational rearrangements of both 30S subunit (presumably the backward rotation of the 30S head) and EF-G that lead to the dissociation of the factor. Thus, EF-G combines the energy regime characteristic for motor proteins, accelerating movement by a conformational change induced by GTP hydrolysis, with that of a switch GTPase, which upon Pi release switches the conformations of EF-G and the ribosome to low affinity, allowing the dissociation of the factor. PMID:26824016

  1. Dual use of GTP hydrolysis by elongation factor G on the ribosome.

    PubMed

    Cunha, Carlos E; Belardinelli, Riccardo; Peske, Frank; Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V

    2013-01-01

    Elongation factor G (EF-G) is a GTPase that catalyzes tRNA and mRNA translocation during the elongation cycle of protein synthesis. The GTP-bound state of the factor on the ribosome has been studied mainly with non-hydrolyzable analogs of GTP, which led to controversial conclusions about the role of GTP hydrolysis in translocation. Here we describe a mutant of EF-G in which the catalytic His91 is replaced with Ala. The mutant EF-G does not hydrolyze GTP, but binds GTP with unchanged affinity, allowing us to study the function of the authentic GTP-bound form of EF-G in translocation. Utilizing fluorescent reporter groups attached to the tRNAs, mRNA, and the ribosome we compile the velocity map of translocation seen from different perspectives. The data suggest that GTP hydrolysis accelerates translocation up to 30-fold and facilitates conformational rearrangements of both 30S subunit (presumably the backward rotation of the 30S head) and EF-G that lead to the dissociation of the factor. Thus, EF-G combines the energy regime characteristic for motor proteins, accelerating movement by a conformational change induced by GTP hydrolysis, with that of a switch GTPase, which upon Pi release switches the conformations of EF-G and the ribosome to low affinity, allowing the dissociation of the factor. PMID:26824016

  2. Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

    SciTech Connect

    deLivron, M.; Robinson, V

    2008-01-01

    BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

  3. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  4. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  5. Small GTPase regulation of GPCR anterograde trafficking

    PubMed Central

    Wang, Guansong; Wu, Guangyu

    2011-01-01

    The physiological functions of heterotrimeric G protein-coupled receptors (GPCRs) are dictated by their intracellular trafficking and precise targeting to the functional destinations. Over the past decades, most studies on the trafficking of GPCRs have focused on the events involved in endocytosis and recycling. In contrast, the molecular mechanisms underlying anterograde transport of newly synthesized GPCRs from the endoplasmic reticulum (ER) to the cell surface have just begun to be revealed. In this review, we will discuss current advances in understanding the role of Ras-like GTPases, specifically the Rab and Sar1/ARF subfamilies, in regulating cell-surface transport of GPCRs en route from the ER and the Golgi. PMID:22015208

  6. Solubilization and partial characterization of a microsomal high affinity GTPase

    SciTech Connect

    Nicchitta, C.; Williamson, J.R.

    1987-05-01

    Isolated rat liver microsomes release sequestered Ca/sup 2 +/ following addition of GTP. In contrast to permeabilized cells, GTP dependent microsomal Ca/sup 2 +/ release requires low concentrations of polyethylene glycol (PEG). They have identified a microsomal, PEG-sensitive high affinity GTPase which shares a number of characteristics with the GTP-dependent Ca/sup 2 +/ release system. To aid in further characterization of this activity they have initiated studies on the solubilization and purification of the microsomal GTPases. When microsomes are solubilized under the following conditions (150 mM NaCl, 5 mg protein/ml, 1% Triton X-114) PEG sensitive GTPase activity selectively partitions into the detergent rich phase of the Triton X-114 extract. As observed in intact microsomal membranes the Triton X-114 soluble GTPase is maximally stimulated by 3% PEG. Half maximal stimulation is observed at 1% PEG. PEG increases the Vmax of this activity; no effects on Km were observed. The Km for GTP of the detergent soluble GTPase is 5 ..mu..M. This GTPase is sensitive to inhibition by sulfhydryl reagents. PEG-sensitive GTPase activity was completely inhibited in the presence of 25 ..mu..M p-hydroxymercuribenzoate (PHMB); half maximal inhibition was observed at 5 ..mu..M. Labeling of the Triton X-114 extract with the photosensitive compound (/sup 32/P) 8-azido GTP indicated the presence of two prominent GTP binding proteins of approximate molecular weights 17 and 54 kD.

  7. Interferon-Inducible GTPases in Host Resistance, Inflammation and Disease.

    PubMed

    Pilla-Moffett, Danielle; Barber, Matthew F; Taylor, Gregory A; Coers, Jörn

    2016-08-28

    Cell-autonomous immunity is essential for host organisms to defend themselves against invasive microbes. In vertebrates, both the adaptive and the innate branches of the immune system operate cell-autonomous defenses as key effector mechanisms that are induced by pro-inflammatory interferons (IFNs). IFNs can activate cell-intrinsic host defenses in virtually any cell type ranging from professional phagocytes to mucosal epithelial cells. Much of this IFN-induced host resistance program is dependent on four families of IFN-inducible GTPases: the myxovirus resistance proteins, the immunity-related GTPases, the guanylate-binding proteins (GBPs), and the very large IFN-inducible GTPases. These GTPase families provide host resistance to a variety of viral, bacterial, and protozoan pathogens through the sequestration of microbial proteins, manipulation of vesicle trafficking, regulation of antimicrobial autophagy (xenophagy), execution of intracellular membranolytic pathways, and the activation of inflammasomes. This review discusses our current knowledge of the molecular function of IFN-inducible GTPases in providing host resistance, as well as their role in the pathogenesis of autoinflammatory Crohn's disease. While substantial advances were made in the recent past, few of the known functions of IFN-inducible GTPases have been explored in any depth, and new functions await discovery. This review will therefore highlight key areas of future exploration that promise to advance our understanding of the role of IFN-inducible GTPases in human diseases. PMID:27181197

  8. Timing Is Everything: GTPase Regulation in Phototransduction

    PubMed Central

    Arshavsky, Vadim Y.; Wensel, Theodore G.

    2013-01-01

    As the molecular mechanisms of vertebrate phototransduction became increasingly clear in the 1980s, a persistent problem was the discrepancy between the slow GTP hydrolysis catalyzed by the phototransduction G protein, transducin, and the much more rapid physiological recovery of photoreceptor cells from light stimuli. Beginning with a report published in 1989, a series of studies revealed that transducin GTPase activity could approach the rate needed to explain physiological recovery kinetics in the presence of one or more factors present in rod outer segment membranes. One by one, these factors were identified, beginning with PDEγ, the inhibitory subunit of the cGMP phosphodiesterase activated by transducin. There followed the discovery of the crucial role played by the regulator of G protein signaling, RGS9, a member of a ubiquitous family of GTPase-accelerating proteins, or GAPs, for heterotrimeric G proteins. Soon after, the G protein β isoform Gβ5 was identified as an obligate partner subunit, followed by the discovery or R9AP, a transmembrane protein that anchors the RGS9 GAP complex to the disk membrane, and is essential for the localization, stability, and activity of this complex in vivo. The physiological importance of all of the members of this complex was made clear first by knockout mouse models, and then by the discovery of a human visual defect, bradyopsia, caused by an inherited deficiency in one of the GAP components. Further insights have been gained by high-resolution crystal structures of subcomplexes, and by extensive mechanistic studies both in vitro and in animal models. PMID:24265205

  9. Synchronous tRNA movements during translocation on the ribosome are orchestrated by elongation factor G and GTP hydrolysis.

    PubMed

    Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-10-01

    The translocation of tRNAs through the ribosome proceeds through numerous small steps in which tRNAs gradually shift their positions on the small and large ribosomal subunits. The most urgent questions are: (i) whether these intermediates are important; (ii) how the ribosomal translocase, the GTPase elongation factor G (EF-G), promotes directed movement; and (iii) how the energy of GTP hydrolysis is coupled to movement. In the light of recent advances in biophysical and structural studies, we argue that intermediate states of translocation are snapshots of dynamic fluctuations that guide the movement. In contrast to current models of stepwise translocation, kinetic evidence shows that the tRNAs move synchronously on the two ribosomal subunits in a rapid reaction orchestrated by EF-G and GTP hydrolysis. EF-G combines the energy regimes of a GTPase and a motor protein and facilitates tRNA movement by a combination of directed Brownian ratchet and power stroke mechanisms. PMID:25118068

  10. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia

    1998-01-01

    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  11. Analysis of the Small GTPase Gene Superfamily of Arabidopsis1

    PubMed Central

    Vernoud, Vanessa; Horton, Amy C.; Yang, Zhenbiao; Nielsen, Erik

    2003-01-01

    Small GTP-binding proteins regulate diverse processes in eukaryotic cells such as signal transduction, cell proliferation, cytoskeletal organization, and intracellular membrane trafficking. These proteins function as molecular switches that cycle between “active” and “inactive” states, and this cycle is linked to the binding and hydrolysis of GTP. The Arabidopsis genome contains 93 genes that encode small GTP-binding protein homologs. Phylogenetic analysis of these genes shows that plants contain Rab, Rho, Arf, and Ran GTPases, but no Ras GTPases. We have assembled complete lists of these small GTPases families, as well as accessory proteins that control their activity, and review what is known of the functions of individual members of these families in Arabidopsis. We also discuss the possible roles of these GTPases in relation to their similarity to orthologs with known functions and localizations in yeast and/or animal systems. PMID:12644670

  12. Rag GTPases are cardioprotective by regulating lysosomal function

    PubMed Central

    Kim, Young Chul; Mo, Jung-Soon; Jewell, Jenna L.; Russell, Ryan C.; Wu, Xiaohui; Sadoshima, Junichi; Guan, Kun-Liang

    2014-01-01

    The Rag family proteins are Ras-like small GTPases that play a critical role in amino acid-stimulated mTORC1 activation by recruiting mTORC1 to lysosome. Despite progress in the mechanistic understanding of Rag GTPases in mTORC1 activation, little is known about the physiological function of Rag GTPases in vivo. Here, we show that loss of RagA and RagB (RagA/B) in cardiomyocytes results in hypertrophic cardiomyopathy and phenocopies lysosomal storage diseases although mTORC1 activity is not substantially impaired in vivo. We demonstrate that despite upregulation of lysosomal protein expression by constitutive activation of the transcription factor EB (TFEB) in RagA/B knockout mouse embryonic fibroblasts, lysosomal acidification is compromised due to decreased v-ATPase level in the lysosome fraction. Our study uncovers RagA/B GTPases as key regulators of lysosomal function and cardiac protection. PMID:24980141

  13. Exploring potassium-dependent GTP hydrolysis in TEES family GTPases.

    PubMed

    Rafay, Abu; Majumdar, Soneya; Prakash, Balaji

    2012-01-01

    GTPases are important regulatory proteins that hydrolyze GTP to GDP. A novel GTP-hydrolysis mechanism is employed by MnmE, YqeH and FeoB, where a potassium ion plays a role analogous to the Arginine finger of the Ras-RasGAP system, to accelerate otherwise slow GTP hydrolysis rates. In these proteins, two conserved asparagines and a 'K-loop' present in switch-I, were suggested as attributes of GTPases employing a K(+)-mediated mechanism. Based on their conservation, a similar mechanism was suggested for TEES family GTPases. Recently, in Dynamin, Fzo1 and RbgA, which also conserve these attributes, a similar mechanism was shown to be operative. Here, we probe K(+)-activated GTP hydrolysis in TEES (TrmE-Era-EngA-YihA-Septin) GTPases - Era, EngB and the two contiguous G-domains, GD1 and GD2 of YphC (EngA homologue) - and also in HflX, another GTPase that also conserves the same attributes. While GD1-YphC and Era exhibit a K(+)-mediated activation of GTP hydrolysis, surprisingly GD2-YphC, EngB and HflX do not. Therefore, the attributes identified thus far, do not necessarily predict a K(+)-mechanism in GTPases and hence warrant extensive structural investigations. PMID:23650596

  14. Reverse engineering GTPase programming languages with reconstituted signaling networks.

    PubMed

    Coyle, Scott M

    2016-07-01

    The Ras superfamily GTPases represent one of the most prolific signaling currencies used in Eukaryotes. With these remarkable molecules, evolution has built GTPase networks that control diverse cellular processes such as growth, morphology, motility and trafficking. (1-4) Our knowledge of the individual players that underlie the function of these networks is deep; decades of biochemical and structural data has provided a mechanistic understanding of the molecules that turn GTPases ON and OFF, as well as how those GTPase states signal by controlling the assembly of downstream effectors. However, we know less about how these different activities work together as a system to specify complex dynamic signaling outcomes. Decoding this molecular "programming language" would help us understand how different species and cell types have used the same GTPase machinery in different ways to accomplish different tasks, and would also provide new insights as to how mutations to these networks can cause disease. We recently developed a bead-based microscopy assay to watch reconstituted H-Ras signaling systems at work under arbitrary configurations of regulators and effectors. (5) Here we highlight key observations and insights from this study and propose extensions to our method to further study this and other GTPase signaling systems. PMID:27128855

  15. The C-terminal α-helix of YsxC is essential for its binding to 50S ribosome and rRNAs.

    PubMed

    Wicker-Planquart, Catherine; Ceres, Nicoletta; Jault, Jean-Michel

    2015-07-22

    YsxC is an essential P-loop GTPase that interacts with the 50S subunit of the ribosome. The putative implication in ribosome binding of two basic clusters of YsxC, a conserved positively charged patch including R31, R116, H117 and K146 lying adjacent to the nucleotide-binding site, and the C-terminal alpha helix, was investigated. C-terminal truncation variants of YsxC were unable to bind to both ribosome and rRNAs, whereas mutations in the other cluster did not affect YsxC binding. Our results indicate that the basic C-terminal region of YsxC is required for its binding to the 50S ribosomal subunit. PMID:26103561

  16. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu

    PubMed Central

    Agirrezabala, Xabier; Frank, Joachim

    2010-01-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 Å, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as elongation factors EF-Tu and EF-G – GTPases that catalyze tRNA delivery and translocation, respectively. This review focuses on the structural data related to the dynamics of the ribosomal machinery, which are the basis, in conjunction with existing biochemical, kinetic, and fluorescence resonance energy transfer data, of our knowledge of the decoding and translocation steps of protein elongation. PMID:20025795

  17. Elongation in translation as a dynamic interaction among the ribosome, tRNA, and elongation factors EF-G and EF-Tu.

    PubMed

    Agirrezabala, Xabier; Frank, Joachim

    2009-08-01

    The ribosome is a complex macromolecular machine that translates the message encoded in the messenger RNA and synthesizes polypeptides by linking the individual amino acids carried by the cognate transfer RNAs (tRNAs). The protein elongation cycle, during which the tRNAs traverse the ribosome in a coordinated manner along a path of more than 100 A, is facilitated by large-scale rearrangements of the ribosome. These rearrangements go hand in hand with conformational changes of tRNA as well as elongation factors EF-Tu and EF-G - GTPases that catalyze tRNA delivery and translocation, respectively. This review focuses on the structural data related to the dynamics of the ribosomal machinery, which are the basis, in conjunction with existing biochemical, kinetic, and fluorescence resonance energy transfer data, of our knowledge of the decoding and translocation steps of protein elongation. PMID:20025795

  18. RAC/ROP GTPases and auxin signaling.

    PubMed

    Wu, Hen-ming; Hazak, Ora; Cheung, Alice Y; Yalovsky, Shaul

    2011-04-01

    Auxin functions as a key morphogen in regulating plant growth and development. Studies on auxin-regulated gene expression and on the mechanism of polar auxin transport and its asymmetric distribution within tissues have provided the basis for realizing the molecular mechanisms underlying auxin function. In eukaryotes, members of the Ras and Rho subfamilies of the Ras superfamily of small GTPases function as molecular switches in many signaling cascades that regulate growth and development. Plants do not have Ras proteins, but they contain Rho-like small G proteins called RACs or ROPs that, like fungal and metazoan Rhos, are regulators of cell polarity and may also undertake some Ras functions. Here, we discuss the advances made over the last decade that implicate RAC/ROPs as mediators for auxin-regulated gene expression, rapid cell surface-located auxin signaling, and directional auxin transport. We also describe experimental data indicating that auxin-RAC/ROP crosstalk may form regulatory feedback loops and theoretical modeling that attempts to connect local auxin gradients with RAC/ROP regulation of cell polarity. We hope that by discussing these experimental and modeling studies, this perspective will stimulate efforts to further refine our understanding of auxin signaling via the RAC/ROP molecular switch. PMID:21478442

  19. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  20. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  1. The Era GTPase recognizes the GAUCACCUCC sequence and binds helix 45 near the 3; end of 16S rRNA

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tarasov, Sergey G.; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2012-03-26

    Era, composed of a GTPase domain and a K homology domain, is essential for bacterial cell viability. It is required for the maturation of 16S rRNA and assembly of the 30S ribosomal subunit. We showed previously that the protein recognizes nine nucleotides (1531{sup AUCACCUCC}1539) near the 3{prime} end of 16S rRNA, and that this recognition stimulates GTP-hydrolyzing activity of Era. In all three kingdoms of life, the 1530{sup GAUCA}1534 sequence and helix 45 (h45) (nucleotides 1506-1529) are highly conserved. It has been shown that the 1530{sup GA}1531 to 1530{sup AG}1531 double mutation severely affects the viability of bacteria. However, whether Era interacts with G1530 and/or h45 and whether such interactions (if any) contribute to the stimulation of Era's GTPase activity were not known. Here, we report two RNA structures that contain nucleotides 1506-1542 (RNA301), one in complex with Era and GDPNP (GNP), a nonhydrolysable GTP-analogue, and the other in complex with Era, GNP, and the KsgA methyltransferase. The structures show that Era recognizes 10 nucleotides, including G1530, and that Era also binds h45. Moreover, GTPase assay experiments show that G1530 does not stimulate Era's GTPase activity. Rather, A1531 and A1534 are most important for stimulation and h45 further contributes to the stimulation. Although G1530 does not contribute to the intrinsic GTPase activity of Era, its interaction with Era is important for binding and is essential for the protein to function, leading to the discovery of a new cold-sensitive phenotype of Era.

  2. ppGpp negatively impacts ribosome assembly affecting growth and antimicrobial tolerance in Gram-positive bacteria

    PubMed Central

    Corrigan, Rebecca M.; Bellows, Lauren E.; Wood, Alison

    2016-01-01

    The stringent response is a survival mechanism used by bacteria to deal with stress. It is coordinated by the nucleotides guanosine tetraphosphate and pentaphosphate [(p)ppGpp], which interact with target proteins to promote bacterial survival. Although this response has been well characterized in proteobacteria, very little is known about the effectors of this signaling system in Gram-positive species. Here, we report on the identification of seven target proteins for the stringent response nucleotides in the Gram-positive bacterium Staphylococcus aureus. We demonstrate that the GTP synthesis enzymes HprT and Gmk bind with a high affinity, leading to an inhibition of GTP production. In addition, we identified five putative GTPases—RsgA, RbgA, Era, HflX, and ObgE—as (p)ppGpp target proteins. We show that RsgA, RbgA, Era, and HflX are functional GTPases and that their activity is promoted in the presence of ribosomes but strongly inhibited by the stringent response nucleotides. By characterizing the function of RsgA in vivo, we ascertain that this protein is involved in ribosome assembly, with an rsgA deletion strain, or a strain inactivated for GTPase activity, displaying decreased growth, a decrease in the amount of mature 70S ribosomes, and an increased level of tolerance to antimicrobials. We additionally demonstrate that the interaction of ppGpp with cellular GTPases is not unique to the staphylococci, as homologs from Bacillus subtilis and Enterococcus faecalis retain this ability. Taken together, this study reveals ribosome inactivation as a previously unidentified mechanism through which the stringent response functions in Gram-positive bacteria. PMID:26951678

  3. Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome.

    PubMed

    Melnikov, Sergey V; Söll, Dieter; Steitz, Thomas A; Polikanov, Yury S

    2016-06-01

    Cisplatin is a widely prescribed anticancer drug, which triggers cell death by covalent binding to a broad range of biological molecules. Among cisplatin targets, cellular RNAs remain the most poorly characterized molecules. Although cisplatin was shown to inactivate essential RNAs, including ribosomal, spliceosomal and telomeric RNAs, cisplatin binding sites in most RNA molecules are unknown, and therefore it remains challenging to study how modifications of RNA by cisplatin contributes to its toxicity. Here we report a 2.6Å-resolution X-ray structure of cisplatin-modified 70S ribosome, which describes cisplatin binding to the ribosome and provides the first nearly atomic model of cisplatin-RNA complex. We observe nine cisplatin molecules bound to the ribosome and reveal consensus structural features of the cisplatin-binding sites. Two of the cisplatin molecules modify conserved functional centers of the ribosome-the mRNA-channel and the GTPase center. In the mRNA-channel, cisplatin intercalates between the ribosome and the messenger RNA, suggesting that the observed inhibition of protein synthesis by cisplatin is caused by impaired mRNA-translocation. Our structure provides an insight into RNA targeting and inhibition by cisplatin, which can help predict cisplatin-binding sites in other cellular RNAs and design studies to elucidate a link between RNA modifications by cisplatin and cisplatin toxicity. PMID:27079977

  4. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  5. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  6. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  7. Mechanism of eIF6 release from the nascent 60S ribosomal subunit.

    PubMed

    Weis, Félix; Giudice, Emmanuel; Churcher, Mark; Jin, Li; Hilcenko, Christine; Wong, Chi C; Traynor, David; Kay, Robert R; Warren, Alan J

    2015-11-01

    SBDS protein (deficient in the inherited leukemia-predisposition disorder Shwachman-Diamond syndrome) and the GTPase EFL1 (an EF-G homolog) activate nascent 60S ribosomal subunits for translation by catalyzing eviction of the antiassociation factor eIF6 from nascent 60S ribosomal subunits. However, the mechanism is completely unknown. Here, we present cryo-EM structures of human SBDS and SBDS-EFL1 bound to Dictyostelium discoideum 60S ribosomal subunits with and without endogenous eIF6. SBDS assesses the integrity of the peptidyl (P) site, bridging uL16 (mutated in T-cell acute lymphoblastic leukemia) with uL11 at the P-stalk base and the sarcin-ricin loop. Upon EFL1 binding, SBDS is repositioned around helix 69, thus facilitating a conformational switch in EFL1 that displaces eIF6 by competing for an overlapping binding site on the 60S ribosomal subunit. Our data reveal the conserved mechanism of eIF6 release, which is corrupted in both inherited and sporadic leukemias. PMID:26479198

  8. Mechanism of eIF6 release from the nascent 60S ribosomal subunit

    PubMed Central

    Weis, Félix; Giudice, Emmanuel; Churcher, Mark; Jin, Li; Hilcenko, Christine; Wong, Chi C; Traynor, David; Kay, Robert R; Warren, Alan J

    2016-01-01

    SBDS protein (deficient in the inherited leukemia-predisposition disorder Shwachman-Diamond syndrome) and the GTPase EFL1 (an EF-G homolog) activate nascent 60S ribosomal subunits for translation by catalyzing eviction of the antiassociation factor eIF6 from nascent 60S ribosomal subunits. However, the mechanism is completely unknown. Here, we present cryo-EM structures of human SBDS and SBDS–EFL1 bound to Dictyostelium discoideum 60S ribosomal subunits with and without endogenous eIF6. SBDS assesses the integrity of the peptidyl (P) site, bridging uL16 (mutated in T-cell acute lymphoblastic leukemia) with uL11 at the P-stalk base and the sarcin-ricin loop. Upon EFL1 binding, SBDS is repositioned around helix 69, thus facilitating a conformational switch in EFL1 that displaces eIF6 by competing for an overlapping binding site on the 60S ribosomal subunit. Our data reveal the conserved mechanism of eIF6 release, which is corrupted in both inherited and sporadic leukemias. PMID:26479198

  9. The Caulobacter crescentus CgtAC Protein Cosediments with the Free 50S Ribosomal Subunit

    PubMed Central

    Lin, Bin; Thayer, Desiree A.; Maddock, Janine R.

    2004-01-01

    The Obg family of GTPases is widely conserved and predicted to play an as-yet-unknown role in translation. Recent reports provide circumstantial evidence that both eukaryotic and prokaryotic Obg proteins are associated with the large ribosomal subunit. Here we provide direct evidence that the Caulobacter crescentus CgtAC protein is associated with the free large (50S) ribosomal subunit but not with 70S monosomes or with translating ribosomes. In contrast to the Bacillus subtilis and Escherichia coli proteins, CgtAC does not fractionate in a large complex by gel filtration, indicating a moderately weak association with the 50S subunit. Moreover, binding of CgtAC to the 50S particle is sensitive to salt concentration and buffer composition but not guanine nucleotide occupancy of CgtAC. Assays of epitope-tagged wild-type and mutant variants of CgtAC indicate that the C terminus of CgtAC is critical for 50S association. Interestingly, the addition of a C-terminal epitope tag also affected the ability of various cgtAC alleles to function in vivo. Depletion of CgtAC led to perturbations in the polysome profile, raising the possibility that CgtAC is involved in ribosome assembly or stability. PMID:14702318

  10. Correlated conformational events in EF-G and the ribosome regulate translocation

    PubMed Central

    Munro, James B.; Wasserman, Michael R.; Altman, Roger B.; Wang, Leyi; Blanchard, Scott C.

    2010-01-01

    In bacteria, the translocation of tRNA and mRNA with respect to the ribosome is catalyzed by the conserved GTPase, elongation factor-G (EF-G). In order to probe the rate determining features in this process, EF-G-catalyzed translocation was imaged from two unique structural perspectives using single-molecule fluorescence resonance energy transfer. The data reveal that the rate at which the ribosome spontaneously achieves a transient, “unlocked” state is closely correlated with the rate at which the tRNA-like, domain IV/V element of EF-G engages the A site. Following these structural transitions, translocation occurs comparatively fast, suggesting that conformational processes intrinsic to the ribosome determine the rate of translocation. Experiments performed in the presence of non-hydrolyzable GTP analogues and specific antibiotics further reveal that allosterically linked conformational events in EF-G and the ribosome mediate rapid, directional substrate movement and EF-G release. PMID:21057527

  11. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  12. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  13. Ral-GTPases: approaching their 15 minutes of fame.

    PubMed

    Feig, Larry A

    2003-08-01

    Andy Warhol, the famous pop artist, once claimed that "in the future everyone will be famous for 15 minutes". The same, it seems, can be said of proteins, because at any given time some proteins become more "fashionable" to study than others. But most proteins have been highly conserved throughout millions of years of evolution, which implies that they all have essential roles in cell biology. Thus, each one will no doubt enter the limelight if the right experiment in the right cell type is done. A good example of this is the Ras-like GTPases (Ral-GTPases), which until recently existed in the shadow of their close cousins--the Ras proto-oncogenes. Recent studies have yielded insights into previously unappreciated roles for Ral-GTPases in intensively investigated disciplines such as vesicle trafficking, cell morphology, transcription and possibly even human oncogenesis. PMID:12888294

  14. Structural Basis for Translation Termination on the 70S Ribosome

    SciTech Connect

    Laurberg, M.; Asahara, H.; Korostelev, A.; Zhu, J.; Trakhanov, S.; Noller, H.F.

    2009-05-20

    At termination of protein synthesis, type I release factors promote hydrolysis of the peptidyl-transfer RNA linkage in response to recognition of a stop codon. Here we describe the crystal structure of the Thermus thermophilus 70S ribosome in complex with the release factor RF1, tRNA and a messenger RNA containing a UAA stop codon, at 3.2 {angstrom} resolution. The stop codon is recognized in a pocket formed by conserved elements of RF1, including its PxT recognition motif, and 16S ribosomal RNA. The codon and the 30S subunit A site undergo an induced fit that results in stabilization of a conformation of RF1 that promotes its interaction with the peptidyl transferase centre. Unexpectedly, the main-chain amide group of Gln 230 in the universally conserved GGQ motif of the factor is positioned to contribute directly to peptidyl-tRNA hydrolysis.

  15. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  16. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  17. Ribosomal RNA analysis in the diagnosis of Diamond-Blackfan Anaemia.

    PubMed

    Quarello, Paola; Garelli, Emanuela; Carando, Adriana; Mancini, Cecilia; Foglia, Luiselda; Botto, Carlotta; Farruggia, Piero; De Keersmaecker, Kim; Aspesi, Anna; Ellis, Steve R; Dianzani, Irma; Ramenghi, Ugo

    2016-03-01

    Diamond-Blackfan anaemia (DBA) is an inherited disease characterized by pure erythroid aplasia that has been tagged as a 'ribosomopathy'. We report a multi-centre study focused on the analysis of rRNA processing of 53 Italian DBA patients using capillary electrophoresis analysis of rRNA maturation of the 40S and 60S ribosomal subunits. The ratio of 28S/18S rRNA was higher in patients with mutated ribosomal proteins (RPs) of the small ribosomal subunit. In contrast, patients with mutated RPs of the large ribosomal subunit (RPLs) had a lower 28S/18S ratio. The assay reported here would be amenable for development as a diagnostic tool. PMID:26763766

  18. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  19. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  20. EF-Tu dynamics during pre-translocation complex formation: EF-Tu·GDP exits the ribosome via two different pathways

    PubMed Central

    Liu, Wei; Chen, Chunlai; Kavaliauskas, Darius; Knudsen, Charlotte R.; Goldman, Yale E.; Cooperman, Barry S.

    2015-01-01

    The G-protein EF-Tu, which undergoes a major conformational change when EF-Tu·GTP is converted to EF-Tu·GDP, forms part of an aminoacyl(aa)-tRNA·EF-Tu·GTP ternary complex (TC) that accelerates the binding of aa-tRNA to the ribosome during peptide elongation. Such binding, placing a portion of EF-Tu in contact with the GTPase Associated Center (GAC), is followed by GTP hydrolysis and Pi release, and results in formation of a pretranslocation (PRE) complex. Although tRNA movement through the ribosome during PRE complex formation has been extensively studied, comparatively little is known about the dynamics of EF-Tu interaction with either the ribosome or aa-tRNA. Here we examine these dynamics, utilizing ensemble and single molecule assays employing fluorescent labeled derivatives of EF-Tu, tRNA, and the ribosome to measure changes in either FRET efficiency or fluorescence intensity during PRE complex formation. Our results indicate that ribosome-bound EF-Tu separates from the GAC prior to its full separation from aa-tRNA, and suggest that EF-Tu·GDP dissociates from the ribosome by two different pathways. These pathways correspond to either reversible EF-Tu·GDP dissociation from the ribosome prior to the major conformational change in EF-Tu that follows GTP hydrolysis, or irreversible dissociation after or concomitant with this conformational change. PMID:26338772

  1. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  2. Insights into RNA binding by the anticancer drug cisplatin from the crystal structure of cisplatin-modified ribosome

    PubMed Central

    Melnikov, Sergey V.; Söll, Dieter; Steitz, Thomas A.; Polikanov, Yury S.

    2016-01-01

    Cisplatin is a widely prescribed anticancer drug, which triggers cell death by covalent binding to a broad range of biological molecules. Among cisplatin targets, cellular RNAs remain the most poorly characterized molecules. Although cisplatin was shown to inactivate essential RNAs, including ribosomal, spliceosomal and telomeric RNAs, cisplatin binding sites in most RNA molecules are unknown, and therefore it remains challenging to study how modifications of RNA by cisplatin contributes to its toxicity. Here we report a 2.6Å-resolution X-ray structure of cisplatin-modified 70S ribosome, which describes cisplatin binding to the ribosome and provides the first nearly atomic model of cisplatin–RNA complex. We observe nine cisplatin molecules bound to the ribosome and reveal consensus structural features of the cisplatin-binding sites. Two of the cisplatin molecules modify conserved functional centers of the ribosome—the mRNA-channel and the GTPase center. In the mRNA-channel, cisplatin intercalates between the ribosome and the messenger RNA, suggesting that the observed inhibition of protein synthesis by cisplatin is caused by impaired mRNA-translocation. Our structure provides an insight into RNA targeting and inhibition by cisplatin, which can help predict cisplatin-binding sites in other cellular RNAs and design studies to elucidate a link between RNA modifications by cisplatin and cisplatin toxicity. PMID:27079977

  3. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  4. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  5. RhoGAPs and Rho GTPases in platelets.

    PubMed

    Elvers, Margitta

    2016-08-01

    Platelet cytoskeletal reorganization is essential for platelet adhesion and thrombus formation in hemostasis and thrombosis. The Rho GTPases RhoA, Rac1 and Cdc42 are the main players in cytoskeletal dynamics of platelets responsible for the formation of filopodia and lamellipodia to strongly increase the platelet surface upon activation. They are involved in platelet activation and aggregate formation including platelet secretion, integrin activation and arterial thrombus formation. The activity of Rho GTPases is tightly controlled by different proteins such as GTPase-activating proteins (GAPs). GAPs stimulate GTP hydrolysis to terminate Rho signaling. The role and impact of GAPs in platelets is not well-defined and many of the RhoGAPs identified are not known to be present in platelets or to have any function in platelets. The recently identified RhoGAPs Oligophrenin1 (OPHN1) and Nadrin regulate the activity of RhoA, Rac1 and Cdc42 and subsequent platelet cytoskeletal reorganization, platelet activation and thrombus formation. In the last years, the analysis of genetically modified mice helped to gain the understanding of Rho GTPases and their regulators in cytoskeletal rearrangements and other Rho mediated cellular processes in platelets. PMID:25639730

  6. The interdependence of the Rho GTPases and apicobasal cell polarity

    PubMed Central

    Mack, Natalie Ann; Georgiou, Marios

    2014-01-01

    Signaling via the Rho GTPases provides crucial regulation of numerous cell polarization events, including apicobasal (AB) polarity, polarized cell migration, polarized cell division and neuronal polarity. Here we review the relationships between the Rho family GTPases and epithelial AB polarization events, focusing on the 3 best-characterized members: Rho, Rac and Cdc42. We discuss a multitude of processes that are important for AB polarization, including lumen formation, apical membrane specification, cell-cell junction assembly and maintenance, as well as tissue polarity. Our discussions aim to highlight the immensely complex regulatory mechanisms that encompass Rho GTPase signaling during AB polarization. More specifically, in this review we discuss several emerging common themes, that include: 1) the need for Rho GTPase activities to be carefully balanced in both a spatial and temporal manner through a multitude of mechanisms; 2) the existence of signaling feedback loops and crosstalk to create robust cellular responses; and 3) the frequent multifunctionality that exists among AB polarity regulators. Regarding this latter theme, we provide further discussion of the potential plasticity of the cell polarity machinery and as a result the possible implications for human disease. PMID:25469537

  7. G domain dimerization controls dynamin's assembly-stimulated GTPase activity

    SciTech Connect

    Chappie, Joshua S.; Acharya, Sharmistha; Leonard, Marilyn; Schmid, Sandra L.; Dyda, Fred

    2010-06-14

    Dynamin is an atypical GTPase that catalyses membrane fission during clathrin-mediated endocytosis. The mechanisms of dynamin's basal and assembly-stimulated GTP hydrolysis are unknown, though both are indirectly influenced by the GTPase effector domain (GED). Here we present the 2.0 {angstrom} resolution crystal structure of a human dynamin 1-derived minimal GTPase-GED fusion protein, which was dimeric in the presence of the transition state mimic GDP.AlF{sub 4}{sup -}. The structure reveals dynamin's catalytic machinery and explains how assembly-stimulated GTP hydrolysis is achieved through G domain dimerization. A sodium ion present in the active site suggests that dynamin uses a cation to compensate for the developing negative charge in the transition state in the absence of an arginine finger. Structural comparison to the rat dynamin G domain reveals key conformational changes that promote G domain dimerization and stimulated hydrolysis. The structure of the GTPase-GED fusion protein dimer provides insight into the mechanisms underlying dynamin-catalysed membrane fission.

  8. Structural Mechanisms and Drug Discovery Prospects of Rho GTPases

    PubMed Central

    Smithers, Cameron C.; Overduin, Michael

    2016-01-01

    Rho GTPases regulate cellular morphology and dynamics, and some are key drivers of cancer progression. This superfamily offers attractive potential targets for therapeutic intervention, with RhoA, Rac1 and Cdc42 being prime examples. The challenges in developing agents that act on these signaling enzymes include the lack of obvious druggable pockets and their membrane-bound activities. However, progress in targeting the similar Ras protein is illuminating new strategies for specifically inhibiting oncogenic GTPases. The structures of multiple signaling and regulatory states of Rho proteins have been determined, and the post-translational modifications including acylation and phosphorylation points have been mapped and their functional effects examined. The development of inhibitors to probe the significance of overexpression and mutational hyperactivation of these GTPases underscores their importance in cancer progression. The ability to integrate in silico, in vitro, and in vivo investigations of drug-like molecules indicates the growing tractability of GTPase systems for lead optimization. Although no Rho-targeted drug molecules have yet been clinically approved, this family is clearly showing increasing promise for the development of precision medicine and combination cancer therapies. PMID:27304967

  9. Pattern formation of Rho GTPases in single cell wound healing

    PubMed Central

    Simon, Cory M.; Vaughan, Emily M.; Bement, William M.; Edelstein-Keshet, Leah

    2013-01-01

    The Rho GTPases—Rho, Rac, and Cdc42—control an enormous variety of processes, many of which reflect activation of these GTPases in spatially confined and mutually exclusive zones. By using mathematical models and experimental results to establish model parameters, we analyze the formation and segregation of Rho and Cdc42 zones during Xenopus oocyte wound repair and the role played by Abr, a dual guanine nucleotide exchange factor–GTPase-activating protein, in this process. The Rho and Cdc42 zones are found to be best represented as manifestations of spatially modulated bistability, and local positive feedback between Abr and Rho can account for the maintenance and dynamic properties of the Rho zone. In contrast, the invocation of an Abr-independent positive feedback loop is required to account for Cdc42 spatial bistability. In addition, the model replicates the results of previous in vivo experiments in which Abr activity is manipulated. Further, simulating the model with two closely spaced wounds made nonintuitive predictions about the Rho and Cdc42 patterns; these predictions were confirmed by experiment. We conclude that the model is a useful tool for analysis of Rho GTPase signaling and that the Rho GTPases can be fruitfully considered as components of intracellular pattern formation systems. PMID:23264464

  10. MIRO GTPases in Mitochondrial Transport, Homeostasis and Pathology

    PubMed Central

    Tang, Bor Luen

    2015-01-01

    The evolutionarily-conserved mitochondrial Rho (MIRO) small GTPase is a Ras superfamily member with three unique features. It has two GTPase domains instead of the one found in other small GTPases, and it also has two EF hand calcium binding domains, which allow Ca2+-dependent modulation of its activity and functions. Importantly, it is specifically associated with the mitochondria and via a hydrophobic transmembrane domain, rather than a lipid-based anchor more commonly found in other small GTPases. At the mitochondria, MIRO regulates mitochondrial homeostasis and turnover. In metazoans, MIRO regulates mitochondrial transport and organization at cellular extensions, such as axons, and, in some cases, intercellular transport of the organelle through tunneling nanotubes. Recent findings have revealed a myriad of molecules that are associated with MIRO, particularly the kinesin adaptor Milton/TRAK, mitofusin, PINK1 and Parkin, as well as the endoplasmic reticulum-mitochondria encounter structure (ERMES) complex. The mechanistic aspects of the roles of MIRO and its interactors in mitochondrial homeostasis and transport are gradually being revealed. On the other hand, MIRO is also increasingly associated with neurodegenerative diseases that have roots in mitochondrial dysfunction. In this review, I discuss what is currently known about the cellular physiology and pathophysiology of MIRO functions. PMID:26729171

  11. The interdependence of the Rho GTPases and apicobasal cell polarity.

    PubMed

    Mack, Natalie Ann; Georgiou, Marios

    2014-01-01

    Signaling via the Rho GTPases provides crucial regulation of numerous cell polarization events, including apicobasal (AB) polarity, polarized cell migration, polarized cell division and neuronal polarity. Here we review the relationships between the Rho family GTPases and epithelial AB polarization events, focusing on the 3 best-characterized members: Rho, Rac and Cdc42. We discuss a multitude of processes that are important for AB polarization, including lumen formation, apical membrane specification, cell-cell junction assembly and maintenance, as well as tissue polarity. Our discussions aim to highlight the immensely complex regulatory mechanisms that encompass Rho GTPase signaling during AB polarization. More specifically, in this review we discuss several emerging common themes, that include: 1) the need for Rho GTPase activities to be carefully balanced in both a spatial and temporal manner through a multitude of mechanisms; 2) the existence of signaling feedback loops and crosstalk to create robust cellular responses; and 3) the frequent multifunctionality that exists among AB polarity regulators. Regarding this latter theme, we provide further discussion of the potential plasticity of the cell polarity machinery and as a result the possible implications for human disease. PMID:25469537

  12. Epithelial junctions and Rho family GTPases: the zonular signalosome

    PubMed Central

    Citi, Sandra; Guerrera, Diego; Spadaro, Domenica; Shah, Jimit

    2014-01-01

    The establishment and maintenance of epithelial cell-cell junctions is crucially important to regulate adhesion, apico-basal polarity and motility of epithelial cells, and ultimately controls the architecture and physiology of epithelial organs. Junctions are supported, shaped and regulated by cytoskeletal filaments, whose dynamic organization and contractility are finely tuned by GTPases of the Rho family, primarily RhoA, Rac1 and Cdc42. Recent research has identified new molecular mechanisms underlying the cross-talk between these GTPases and epithelial junctions. Here we briefly summarize the current knowledge about the organization, molecular evolution and cytoskeletal anchoring of cell-cell junctions, and we comment on the most recent advances in the characterization of the interactions between Rho GTPases and junctional proteins, and their consequences with regards to junction assembly and regulation of cell behavior in vertebrate model systems. The concept of “zonular signalosome” is proposed, which highlights the close functional relationship between proteins of zonular junctions (zonulae occludentes and adhaerentes) and the control of cytoskeletal organization and signaling through Rho GTPases, transcription factors, and their effectors. PMID:25483301

  13. Structural Mechanisms and Drug Discovery Prospects of Rho GTPases.

    PubMed

    Smithers, Cameron C; Overduin, Michael

    2016-01-01

    Rho GTPases regulate cellular morphology and dynamics, and some are key drivers of cancer progression. This superfamily offers attractive potential targets for therapeutic intervention, with RhoA, Rac1 and Cdc42 being prime examples. The challenges in developing agents that act on these signaling enzymes include the lack of obvious druggable pockets and their membrane-bound activities. However, progress in targeting the similar Ras protein is illuminating new strategies for specifically inhibiting oncogenic GTPases. The structures of multiple signaling and regulatory states of Rho proteins have been determined, and the post-translational modifications including acylation and phosphorylation points have been mapped and their functional effects examined. The development of inhibitors to probe the significance of overexpression and mutational hyperactivation of these GTPases underscores their importance in cancer progression. The ability to integrate in silico, in vitro, and in vivo investigations of drug-like molecules indicates the growing tractability of GTPase systems for lead optimization. Although no Rho-targeted drug molecules have yet been clinically approved, this family is clearly showing increasing promise for the development of precision medicine and combination cancer therapies. PMID:27304967

  14. Control of T lymphocyte morphology by the GTPase Rho

    NASA Technical Reports Server (NTRS)

    Woodside, Darren G.; Wooten, David K.; Teague, T. Kent; Miyamoto, Yuko J.; Caudell, Eva G.; Udagawa, Taturo; Andruss, Bernard F.; McIntyre, Bradley W.

    2003-01-01

    BACKGROUND: Rho family GTPase regulation of the actin cytoskeleton governs a variety of cell responses. In this report, we have analyzed the role of the GTPase Rho in maintenance of the T lymphocyte actin cytoskeleton. RESULTS: Inactivation of the GTPase Rho in the human T lymphocytic cell line HPB-ALL does not inhibit constitutively high adhesion to the integrin beta1 substrate fibronectin. It did however result in the aberrant extension of finger-like dendritic processes on the substrates VCAM-1, Fn, and mAb specific to beta1 integrins. Time-lapse video microscopy demonstrated that C3 induced extensions were primarily the result of an altered pseudopod elongation rather than retraction. Once the stellate pseudopodia extended, none retracted, and cells became completely immobile. Filipodial structures were absent and the dendritic-like processes in C3 treated cells were rich in filamentous actin. Immunolocalization of RhoA in untreated HPB-ALL cells spreading on fibronectin demonstrated a diffuse staining pattern within the pseudopodia. In C3 treated cells, clusters of RhoA were pronounced and localized within the altered extensions. CONCLUSIONS: GTPase Rho is actively involved in the regulation of T lymphocyte morphology and motility.

  15. Transglutaminase 2 Regulates the GTPase-activating Activity of Bcr*

    PubMed Central

    Yi, Sun-Ju; Groffen, John; Heisterkamp, Nora

    2009-01-01

    Transglutaminase 2 (TG2) is a multifunctional protein that has been implicated in numerous pathologies including that of neurodegeneration and celiac disease, but the molecular interactions that mediate its diverse activities are largely unknown. Bcr and the closely related Abr negatively regulate the small G-protein Rac: loss of their combined function in vivo results in increased reactivity of innate immune cells. Bcr and Abr are GTPase-activating proteins that catalyze the hydrolysis of the GTP bound to Rac. However, how the Bcr and Abr GTPase-activating activity is regulated is not precisely understood. We here report a novel mechanism of regulation through direct protein-protein interaction with TG2. TG2 bound to the Rac-binding pocket in the GTPase-activating domains of Bcr and Abr, blocked Bcr activity and, through this mechanism, increased levels of active GTP-bound Rac and EGF-stimulated membrane ruffling. TG2 exists in at least two different conformations. Interestingly, experiments using TG2 mutants showed that Bcr exhibits preferential binding to the non-compacted conformation of TG2, in which its catalytic domain is exposed, but transamidation is not needed for the interaction. Thus, TG2 regulates levels of cellular GTP-bound Rac and actin cytoskeletal reorganization through a new mechanism involving direct inhibition of Bcr GTPase-activating activity. PMID:19840940

  16. AMPylation of Rho GTPases Subverts Multiple Host Signaling Processes*

    PubMed Central

    Woolery, Andrew R.; Yu, Xiaobo; LaBaer, Joshua; Orth, Kim

    2014-01-01

    Rho GTPases are frequent targets of virulence factors as they are keystone signaling molecules. Herein, we demonstrate that AMPylation of Rho GTPases by VopS is a multifaceted virulence mechanism that counters several host immunity strategies. Activation of NFκB, Erk, and JNK kinase signaling pathways were inhibited in a VopS-dependent manner during infection with Vibrio parahaemolyticus. Phosphorylation and degradation of IKBα were inhibited in the presence of VopS as was nuclear translocation of the NFκB subunit p65. AMPylation also prevented the generation of superoxide by the phagocytic NADPH oxidase complex, potentially by inhibiting the interaction of Rac and p67. Furthermore, the interaction of GTPases with the E3 ubiquitin ligases cIAP1 and XIAP was hindered, leading to decreased degradation of Rac and RhoA during infection. Finally, we screened for novel Rac1 interactions using a nucleic acid programmable protein array and discovered that Rac1 binds to the protein C1QA, a protein known to promote immune signaling in the cytosol. Interestingly, this interaction was disrupted by AMPylation. We conclude that AMPylation of Rho Family GTPases by VopS results in diverse inhibitory consequences during infection beyond the most obvious phenotype, the collapse of the actin cytoskeleton. PMID:25301945

  17. Osteoblast differentiation and migration are regulated by dynamin GTPase activity.

    PubMed

    Eleniste, Pierre P; Huang, Su; Wayakanon, Kornchanok; Largura, Heather W; Bruzzaniti, Angela

    2014-01-01

    Bone formation is controlled by osteoblasts, but the signaling proteins that control osteoblast differentiation and function are still unclear. We examined if the dynamin GTPase, which is associated with actin remodeling and migration in other cells, plays a role in osteoblast differentiation and migration. Dynamin mRNA was expressed in primary osteoblasts throughout differentiation (0-21 days). However, alkaline phosphatase (ALP) activity, a marker of osteoblast differentiation, was decreased in osteoblasts over-expressing dynamin. Conversely, ALP activity was increased following shRNA-mediated knockdown of dynamin and in osteoblasts treated with the dynamin inhibitor, dynasore. Dynasore also reduced c-fos and osterix expression, markers of early osteoblasts, suggesting a role for dynamin in pre-osteoblast to osteoblast differentiation. Since dynamin GTPase activity is regulated by tyrosine phosphorylation, we examined the mechanism of dynamin dephosphorylation in osteoblasts. Dynamin formed a protein complex with the tyrosine phosphatase PTP-PEST and inhibition of phosphatase activity increased the level of phosphorylated dynamin. Further, PTP-PEST blocked the Src-mediated increase in the phosphorylation and GTPase activity of wild-type dynamin but not the phosphorylation mutant dynY231F/Y597F. Although ALP activity was increased in osteoblasts expressing GTPase-defective dynK44A, and to a lesser extent dynY231F/Y597F, osteoblast migration was significantly inhibited by dynK44A and dynY231F/Y597F. These studies demonstrate a novel role for dynamin GTPase activity and phosphorylation in osteoblast differentiation and migration, which may be important for bone formation. PMID:24387844

  18. Osteoblast differentiation and migration are regulated by Dynamin GTPase activity

    PubMed Central

    Eleniste, Pierre P.; Huang, Su; Wayakanon, Kornchanok; Largura, Heather W.; Bruzzaniti, Angela

    2013-01-01

    Bone formation is controlled by osteoblasts but the signaling proteins that control osteoblast differentiation and function are still unclear. We examined if the dynamin GTPase, which is associated with actin remodeling and migration in other cells, plays a role in osteoblast differentiation and migration. Dynamin mRNA was expressed in primary osteoblasts throughout differentiation (0–21 days). However, alkaline phosphatase (ALP) activity, a marker of osteoblast differentiation, was decreased in osteoblasts over-expressing dynamin. Conversely, ALP activity was increased following shRNA-mediated knockdown of dynamin and in osteoblasts treated with the dynamin inhibitor, dynasore. Dynasore also reduced c-fos and osterix expression, markers of early osteoblasts, suggesting a role for dynamin in pre-osteoblast to osteoblast differentiation. Since dynamin GTPase activity is regulated by tyrosine phosphorylation, we examined the mechanism of dynamin dephosphorylation in osteoblasts. Dynamin formed a protein complex with the tyrosine phosphatase PTP-PEST and inhibition of phosphatase activity increased the level of phosphorylated dynamin. Further, PTP-PEST blocked the Src-mediated increase in the phosphorylation and GTPase activity of wild-type dynamin but not the phosphorylation mutant dynY231F/Y597F. Although ALP activity was increased in osteoblasts expressing GTPase-defective dynK44A, and to a lesser extent dynY231F/Y597F, osteoblast migration was significantly inhibited by dynK44A and dynY231F/Y597F. These studies demonstrate a novel role for dynamin GTPase activity and phosphorylation in osteoblast differentiation and migration, which may be important for bone formation. PMID:24387844

  19. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  20. The dynamics of spatio-temporal Rho GTPase signaling: formation of signaling patterns

    PubMed Central

    Fritz, Rafael Dominik; Pertz, Olivier

    2016-01-01

    Rho GTPases are crucial signaling molecules that regulate a plethora of biological functions. Traditional biochemical, cell biological, and genetic approaches have founded the basis of Rho GTPase biology. The development of biosensors then allowed measuring Rho GTPase activity with unprecedented spatio-temporal resolution. This revealed that Rho GTPase activity fluctuates on time and length scales of tens of seconds and micrometers, respectively. In this review, we describe Rho GTPase activity patterns observed in different cell systems. We then discuss the growing body of evidence that upstream regulators such as guanine nucleotide exchange factors and GTPase-activating proteins shape these patterns by precisely controlling the spatio-temporal flux of Rho GTPase activity. Finally, we comment on additional mechanisms that might feed into the regulation of these signaling patterns and on novel technologies required to dissect this spatio-temporal complexity. PMID:27158467

  1. The function of RhoGTPases in axon ensheathment and myelination

    PubMed Central

    Feltri, M. Laura; Suter, Ueli; Relvas, João B.

    2008-01-01

    RhoGTPases are molecular switches that integrate extracellular signals to perform diverse cellular responses. This ability relies on the network of proteins regulating RhoGTPases activity and localization, and on the interaction of RhoGTPases with many different cellular effectors. Myelination is an ideal place for RhoGTPases regulation, as it is the result of fine orchestration of many stimuli from at least two cell types. Recent work has revealed that RhoGTPases are required for Schwann cells to sort, ensheath and myelinate axons. Here we will review recent advances showing the critical roles for RhoGTPases in various aspects of Schwann development and myelination, including the recent discovery of their involvement in Charcot-Marie-Tooth disease. Comparison with potential roles of RhoGTPases in central nervous system myelination will be drawn. PMID:18803320

  2. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  3. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  4. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  5. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  6. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs

    PubMed Central

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  7. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  8. Modelling Rho GTPase biochemistry to predict collective cell migration

    NASA Astrophysics Data System (ADS)

    Merchant, Brian; Feng, James

    The collective migration of cells, due to individual cell polarization and intercellular contact inhibition of locomotion, features prominently in embryogenesis and metastatic cancers. Existing methods for modelling collectively migrating cells tend to rely either on highly abstracted agent-based models, or on continuum approximations of the group. Both of these frameworks represent intercellular interactions such as contact inhibition of locomotion as hard-coded rules defining model cells. In contrast, we present a vertex-dynamics framework which predicts polarization and contact inhibition of locomotion naturally from an underlying model of Rho GTPase biochemistry and cortical mechanics. We simulate the interaction between many such model cells, and study how modulating Rho GTPases affects migratory characteristics of the group, in the context of long-distance collective migration of neural crest cells during embryogenesis.

  9. Immune control of phagosomal bacteria by p47 GTPases.

    PubMed

    MacMicking, John D

    2005-02-01

    Sequestered from the action of complement, antibody and lytic peptides, phagosomal pathogens pose a unique problem for the innate immune system both in terms of detection and disposal. An immunologically induced 47-kDa (p47) GTPase family recruited to nascent phagosomes (PGs) has provided new insights into how vertebrates deal with facultative bacteria occupying a vacuolar niche. Research over the past 2 years in particular has identified several molecular determinants that underlie the membrane trafficking functions of LRG-47 and other p47 GTPases as part of a PG remodeling program. When coupled to signals issuing from pathogen-specific Toll-like receptors, the p47 proteins may constitute a novel sensory system enlisted by mammals, birds and fish to decode the language of immune recognition against this particular class of infectious agents. PMID:15694860

  10. Regulation of autophagy by the Rab GTPase network

    PubMed Central

    Ao, X; Zou, L; Wu, Y

    2014-01-01

    Autophagy (macroautophagy) is a highly conserved intracellular and lysosome-dependent degradation process in which autophagic substrates are enclosed and degraded by a double-membrane vesicular structure in a continuous and dynamic vesicle transport process. The Rab protein is a small GTPase that belongs to the Ras-like GTPase superfamily and regulates the vesicle traffic process. Numerous Rab proteins have been shown to be involved in various stages of autophagy. Rab1, Rab5, Rab7, Rab9A, Rab11, Rab23, Rab32, and Rab33B participate in autophagosome formation, whereas Rab9 is required in non-canonical autophagy. Rab7, Rab8B, and Rab24 have a key role in autophagosome maturation. Rab8A and Rab25 are also involved in autophagy, but their role is unknown. Here, we summarize new findings regarding the involvement of Rabs in autophagy and provide insights regarding future research on the mechanisms of autophagy regulation. PMID:24440914

  11. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  12. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  13. Emerging nexus between RAB GTPases, autophagy and neurodegeneration.

    PubMed

    Jain, Navodita; Ganesh, Subramaniam

    2016-05-01

    The RAB class of small GTPases includes the major regulators of intracellular communication, which are involved in vesicle generation through fusion and fission, and vesicular trafficking. RAB proteins also play an imperative role in neuronal maintenance and survival. Recent studies in the field of neurodegeneration have also highlighted the process of autophagy as being essential for neuronal maintenance. Here we review the emerging roles of RAB proteins in regulating macroautophagy and its impact in the context of neurodegenerative diseases. PMID:26985808

  14. Targeting Rho-GTPases in immune cell migration and inflammation

    PubMed Central

    Biro, Maté; Munoz, Marcia A; Weninger, Wolfgang

    2014-01-01

    Leukocytes are unmatched migrators capable of traversing barriers and tissues of remarkably varied structural composition. An effective immune response relies on the ability of its constituent cells to infiltrate target sites. Yet, unwarranted mobilization of immune cells can lead to inflammatory diseases and tissue damage ranging in severity from mild to life-threatening. The efficacy and plasticity of leukocyte migration is driven by the precise spatiotemporal regulation of the actin cytoskeleton. The small GTPases of the Rho family (Rho-GTPases), and their immediate downstream effector kinases, are key regulators of cellular actomyosin dynamics and are therefore considered prime pharmacological targets for stemming leukocyte motility in inflammatory disorders. This review describes advances in the development of small-molecule inhibitors aimed at modulating the Rho-GTPase-centric regulatory pathways governing motility, many of which stem from studies of cancer invasiveness. These inhibitors promise the advent of novel treatment options with high selectivity and potency against immune-mediated pathologies. Linked Articles This article is part of a themed section on Cytoskeleton, Extracellular Matrix, Cell Migration, Wound Healing and Related Topics. To view the other articles in this section visit http://dx.doi.org/10.1111/bph.2014.171.issue-24 PMID:24571448

  15. Ral GTPases regulate exocyst assembly through dual subunit interactions.

    PubMed

    Moskalenko, Serge; Tong, Chao; Rosse, Carine; Mirey, Gladys; Formstecher, Etienne; Daviet, Laurent; Camonis, Jacques; White, Michael A

    2003-12-19

    Ral GTPases have been implicated in the regulation of a variety of dynamic cellular processes including proliferation, oncogenic transformation, actin-cytoskeletal dynamics, endocytosis, and exocytosis. Recently the Sec6/8 complex, or exocyst, a multisubunit complex facilitating post-Golgi targeting of distinct subclasses of secretory vesicles, has been identified as a bona fide Ral effector complex. Ral GTPases regulate exocyst-dependent vesicle trafficking and are required for exocyst complex assembly. Sec5, a membrane-associated exocyst subunit, has been identified as a direct target of activated Ral; however, the mechanism by which Ral can modulate exocyst assembly is unknown. Here we report that an additional component of the exocyst, Exo84, is a direct target of activated Ral. We provide evidence that mammalian exocyst components are present as distinct subcomplexes on vesicles and the plasma membrane and that Ral GTPases regulate the assembly interface of a full octameric exocyst complex through interaction with Sec5 and Exo84. PMID:14525976

  16. Interaction of LRRK2 with kinase and GTPase signaling cascades

    PubMed Central

    Boon, Joon Y.; Dusonchet, Julien; Trengrove, Chelsea; Wolozin, Benjamin

    2014-01-01

    LRRK2 is a protein that interacts with a plethora of signaling molecules, but the complexity of LRRK2 function presents a challenge for understanding the role of LRRK2 in the pathophysiology of Parkinson’s disease (PD). Studies of LRRK2 using over-expression in transgenic mice have been disappointing, however, studies using invertebrate systems have yielded a much clearer picture, with clear effects of LRRK2 expression, knockdown or deletion in Caenorhabditis elegans and Drosophila on modulation of survival of dopaminergic neurons. Recent studies have begun to focus attention on particular signaling cascades that are a target of LRRK2 function. LRRK2 interacts with members of the mitogen activated protein kinase (MAPK) pathway and might regulate the pathway action by acting as a scaffold that directs the location of MAPK pathway activity, without strongly affecting the amount of MAPK pathway activity. Binding to GTPases, GTPase-activating proteins and GTPase exchange factors are another strong theme in LRRK2 biology, with LRRK2 binding to rac1, cdc42, rab5, rab7L1, endoA, RGS2, ArfGAP1, and ArhGEF7. All of these molecules appear to feed into a function output for LRRK2 that modulates cytoskeletal outgrowth and vesicular dynamics, including autophagy. These functions likely impact modulation of α-synuclein aggregation and associated toxicity eliciting the disease processes that we term PD. PMID:25071441

  17. Modulation of Rab GTPase function by a protein phosphocholine transferase.

    PubMed

    Mukherjee, Shaeri; Liu, Xiaoyun; Arasaki, Kohei; McDonough, Justin; Galán, Jorge E; Roy, Craig R

    2011-09-01

    The intracellular pathogen Legionella pneumophila modulates the activity of host GTPases to direct the transport and assembly of the membrane-bound compartment in which it resides. In vitro studies have indicated that the Legionella protein DrrA post-translationally modifies the GTPase Rab1 by a process called AMPylation. Here we used mass spectrometry to investigate post-translational modifications to Rab1 that occur during infection of host cells by Legionella. Consistent with in vitro studies, DrrA-mediated AMPylation of a conserved tyrosine residue in the switch II region of Rab1 was detected during infection. In addition, a modification to an adjacent serine residue in Rab1 was discovered, which was independent of DrrA. The Legionella effector protein AnkX was required for this modification. Biochemical studies determined that AnkX directly mediates the covalent attachment of a phosphocholine moiety to Rab1. This phosphocholine transferase activity used CDP-choline as a substrate and required a conserved histidine residue located in the FIC domain of the AnkX protein. During infection, AnkX modified both Rab1 and Rab35, which explains how this protein modulates membrane transport through both the endocytic and exocytic pathways of the host cell. Thus, phosphocholination of Rab GTPases represents a mechanism by which bacterial FIC-domain-containing proteins can alter host-cell functions. PMID:21822290

  18. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  19. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  20. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  1. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  2. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  3. Regulation of vesicular trafficking and leukocyte function by Rab27 GTPases and their effectors

    PubMed Central

    Catz, Sergio Daniel

    2013-01-01

    The Rab27 family of GTPases regulates the efficiency and specificity of exocytosis in hematopoietic cells, including neutrophils, CTLs, NK cells, and mast cells. However, the mechanisms regulated by Rab27 GTPases are cell-specific, as they depend on the differential expression and function of particular effector molecules that are recruited by the GTPases. In addition, Rab27 GTPases participate in multiple steps of the regulation of the secretory process, including priming, tethering, docking, and fusion through sequential interaction with multiple effector molecules. Finally, recent reports suggest that Rab27 GTPases and their effectors regulate vesicular trafficking mechanisms other than exocytosis, including endocytosis and phagocytosis. This review focuses on the latest discoveries on the function of Rab27 GTPases and their effectors Munc13-4 and Slp1 in neutrophil function comparatively to their functions in other leukocytes. PMID:23378593

  4. Beyond Rab GTPases Legionella activates the small GTPase Ran to promote microtubule polymerization, pathogen vacuole motility, and infection

    PubMed Central

    Hilbi, Hubert; Rothmeier, Eva; Hoffmann, Christine; Harrison, Christopher F

    2014-01-01

    Legionella spp. are amoebae-resistant environmental bacteria that replicate in free-living protozoa in a distinct compartment, the Legionella-containing vacuole (LCV). Upon transmission of Legionella pneumophila to the lung, the pathogens employ an evolutionarily conserved mechanism to grow in LCVs within alveolar macrophages, thus triggering a severe pneumonia termed Legionnaires’ disease. LCV formation is a complex and robust process, which requires the bacterial Icm/Dot type IV secretion system and involves the amazing number of 300 different translocated effector proteins. LCVs interact with the host cell's endosomal and secretory vesicle trafficking pathway. Accordingly, in a proteomics approach as many as 12 small Rab GTPases implicated in endosomal and secretory vesicle trafficking were identified and validated as LCV components. Moreover, the small GTPase Ran and its effector protein RanBP1 have been found to decorate the pathogen vacuole. Ran regulates nucleo-cytoplasmic transport, spindle assembly, and cytokinesis, as well as the organization of non-centrosomal microtubules. In L. pneumophila-infected amoebae or macrophages, Ran and RanBP1 localize to LCVs, and the small GTPase is activated by the Icm/Dot substrate LegG1. Ran activation by LegG1 leads to microtubule stabilization and promotes intracellular pathogen vacuole motility and bacterial growth, as well as chemotaxis and migration of Legionella-infected cells. PMID:25496424

  5. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  6. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  7. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  8. Established and emerging fluorescence-based assays for G-protein function: Ras-superfamily GTPases.

    PubMed

    Rojas, Rafael J; Kimple, Randall J; Rossman, Kent L; Siderovski, David P; Sondek, John

    2003-06-01

    Ras and Rho GTPases are signaling proteins that regulate a variety of physiological events and are intimately linked to the progression of cancer. Recently, a variety of fluorescence-based assays have been refined to monitor activation of these GTPases. This review summarizes current fluorescence-based techniques for studying Ras superfamily GTPases with an emphasis on practical examples and high-throughput applications. These techniques are not only useful for biochemical characterization of Ras superfamily members, but will also facilitate the discovery of small molecule therapeutics designed to inhibit signal transduction mediated by GTPases. PMID:12769685

  9. Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration

    PubMed Central

    Stankiewicz, Trisha R.; Linseman, Daniel A.

    2014-01-01

    The Rho family of GTPases belongs to the Ras superfamily of low molecular weight (∼21 kDa) guanine nucleotide binding proteins. The most extensively studied members are RhoA, Rac1, and Cdc42. In the last few decades, studies have demonstrated that Rho family GTPases are important regulatory molecules that link surface receptors to the organization of the actin and microtubule cytoskeletons. Indeed, Rho GTPases mediate many diverse critical cellular processes, such as gene transcription, cell–cell adhesion, and cell cycle progression. However, Rho GTPases also play an essential role in regulating neuronal morphology. In particular, Rho GTPases regulate dendritic arborization, spine morphogenesis, growth cone development, and axon guidance. In addition, more recent efforts have underscored an important function for Rho GTPases in regulating neuronal survival and death. Interestingly, Rho GTPases can exert either a pro-survival or pro-death signal in neurons depending upon both the cell type and neurotoxic insult involved. This review summarizes key findings delineating the involvement of Rho GTPases and their effectors in the regulation of neuronal survival and death. Collectively, these results suggest that dysregulation of Rho family GTPases may potentially underscore the etiology of some forms of neurodegenerative disease such as amyotrophic lateral sclerosis. PMID:25339865

  10. Rho family GTPases: key players in neuronal development, neuronal survival, and neurodegeneration.

    PubMed

    Stankiewicz, Trisha R; Linseman, Daniel A

    2014-01-01

    The Rho family of GTPases belongs to the Ras superfamily of low molecular weight (∼21 kDa) guanine nucleotide binding proteins. The most extensively studied members are RhoA, Rac1, and Cdc42. In the last few decades, studies have demonstrated that Rho family GTPases are important regulatory molecules that link surface receptors to the organization of the actin and microtubule cytoskeletons. Indeed, Rho GTPases mediate many diverse critical cellular processes, such as gene transcription, cell-cell adhesion, and cell cycle progression. However, Rho GTPases also play an essential role in regulating neuronal morphology. In particular, Rho GTPases regulate dendritic arborization, spine morphogenesis, growth cone development, and axon guidance. In addition, more recent efforts have underscored an important function for Rho GTPases in regulating neuronal survival and death. Interestingly, Rho GTPases can exert either a pro-survival or pro-death signal in neurons depending upon both the cell type and neurotoxic insult involved. This review summarizes key findings delineating the involvement of Rho GTPases and their effectors in the regulation of neuronal survival and death. Collectively, these results suggest that dysregulation of Rho family GTPases may potentially underscore the etiology of some forms of neurodegenerative disease such as amyotrophic lateral sclerosis. PMID:25339865

  11. Science Learning Centres Roundup

    ERIC Educational Resources Information Center

    Education in Science, 2010

    2010-01-01

    The national network of Science Learning Centres aims to raise the quality of science teaching from Key Stage 1 through post-16 (ages 5-19). Short courses are provided locally through the regional Science Learning Centres and longer, more intensive programmes are available at the National Science Learning Centre in York. There are a growing number…

  12. Ribosome hijacking: a role for small protein B during trans-translation

    PubMed Central

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-01-01

    Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006

  13. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  14. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  15. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  16. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  17. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  18. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  19. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  20. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  1. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  2. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  3. Isoprenoids, Small GTPases and Alzheimer’s Disease

    PubMed Central

    Hooff, Gero P.; Wood, W. Gibson; Müller, Walter E.; Eckert, Gunter P.

    2010-01-01

    The mevalonate-pathway is a crucial metabolic pathway for most eukaryotic cells. Cholesterol is a highly recognized product of this pathway but growing interest is being given to the synthesis and functions of isoprenoids. Isoprenoids are a complex class of biologically active lipids including for example, dolichol, ubiquinone, farnesylpyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP). Early work had shown that the long-chain isoprenoid dolichol is decreased, but that dolichyl-phosphate and ubiquinone are elevated in brains of Alzheimer´s diseased (AD) patients. Until recently, levels of their biological active precursors FPP and GGPP were unknown. These short-chain isoprenoids are critical in the post translational modification of certain proteins which function as molecular switches in numerous, signaling pathways. The major protein families belong to the superfamily of small GTPases, consisting of roughly 150 members. Recent experimental evidence indicated that members of the small GTPases are involved in AD pathogenesis and stimulated interest in the role of FPP and GGPP in protein prenylation and cell function. A straightforward prediction derived from those studies was that FPP and GGPP levels would be elevated in AD brains as compared with normal neurological controls. For the first time, recent evidence shows significantly elevated levels of FPP and GGPP in human AD brain tissue. Cholesterol levels did not differ between AD and control samples. One obvious conclusion is that homeostasis of FPP and GGPP but not of cholesterol is specifically targeted in AD. Since prenylation of small GTPases by FPP or GGPP is indispensable for their proper function we are proposing that these two isoprenoids are up-regulated in AD resulting in an over abundance of certain prenylated proteins which contributes to neuronal dysfunction. PMID:20382260

  4. Phospholipases as GTPase activity accelerating proteins (GAPs) in plants.

    PubMed

    Pandey, Sona

    2016-05-01

    GTPase activity accelerating proteins (GAPs) are key regulators of the G-protein signaling cycle. By facilitating effective hydrolysis of the GTP bound on Gα proteins, GAPs control the timing and amplitude of the signaling cycle and ascertain the availability of the inactive heterotrimer for the next round of activation. Until very recently, the studies of GAPs in plants were focused exclusively on the regulator of G-protein signaling (RGS) protein. We now show that phospholipase Dα1 (PLDα1) is also a bona fide GAP in plants and together with the RGS protein controls the level of active Gα protein. PMID:27124090

  5. Rho GTPase Transcriptome Analysis Reveals Oncogenic Roles for Rho GTPase-Activating Proteins in Basal-like Breast Cancers.

    PubMed

    Lawson, Campbell D; Fan, Cheng; Mitin, Natalia; Baker, Nicole M; George, Samuel D; Graham, David M; Perou, Charles M; Burridge, Keith; Der, Channing J; Rossman, Kent L

    2016-07-01

    The basal-like breast cancer (BLBC) subtype accounts for a disproportionately high percentage of overall breast cancer mortality. The current therapeutic options for BLBC need improvement; hence, elucidating signaling pathways that drive BLBC growth may identify novel targets for the development of effective therapies. Rho GTPases have previously been implicated in promoting tumor cell proliferation and metastasis. These proteins are inactivated by Rho-selective GTPase-activating proteins (RhoGAP), which have generally been presumed to act as tumor suppressors. Surprisingly, RNA-Seq analysis of the Rho GTPase signaling transcriptome revealed high expression of several RhoGAP genes in BLBC tumors, raising the possibility that these genes may be oncogenic. To evaluate this, we examined the roles of two of these RhoGAPs, ArhGAP11A (also known as MP-GAP) and RacGAP1 (also known as MgcRacGAP), in promoting BLBC. Both proteins were highly expressed in human BLBC cell lines, and knockdown of either gene resulted in significant defects in the proliferation of these cells. Knockdown of ArhGAP11A caused CDKN1B/p27-mediated arrest in the G1 phase of the cell cycle, whereas depletion of RacGAP1 inhibited growth through the combined effects of cytokinesis failure, CDKN1A/p21-mediated RB1 inhibition, and the onset of senescence. Random migration was suppressed or enhanced by the knockdown of ArhGAP11A or RacGAP1, respectively. Cell spreading and levels of GTP-bound RhoA were increased upon depletion of either RhoGAP. We have established that, via the suppression of RhoA, ArhGAP11A and RacGAP1 are both critical drivers of BLBC growth, and propose that RhoGAPs can act as oncogenes in cancer. Cancer Res; 76(13); 3826-37. ©2016 AACR. PMID:27216196

  6. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  7. TBC-Domain GAPs for Rab GTPases Accelerate GTP Hydrolysis by a Dual-Finger Mechanism

    SciTech Connect

    Pan,X.; Eathiraj, S.; Lambright, D.

    2006-01-01

    Rab GTPases regulate membrane trafficking by cycling between inactive (GDP-bound) and active (GTP-bound) conformations. The duration of the active state is limited by GTPase-activating proteins (GAPs), which accelerate the slow intrinsic rate of GTP hydrolysis. Proteins containing TBC (Tre-2, Bub2 and Cdc16) domains are broadly conserved in eukaryotic organisms and function as GAPs for Rab GTPases as well as GTPases that control cytokinesis. An exposed arginine residue is a critical determinant of GAP activity in vitro and in vivo. It has been expected that the catalytic mechanism of TBC domains would parallel that of Ras and Rho family GAPs. Here we report crystallographic, mutational and functional analyses of complexes between Rab GTPases and the TBC domain of Gyp1p. In the crystal structure of a TBC-domain-Rab-GTPase-aluminium fluoride complex, which approximates the transition-state intermediate for GTP hydrolysis, the TBC domain supplies two catalytic residues in trans, an arginine finger analogous to Ras/Rho family GAPs and a glutamine finger that substitutes for the glutamine in the DxxGQ motif of the GTPase. The glutamine from the Rab GTPase does not stabilize the transition state as expected but instead interacts with the TBC domain. Strong conservation of both catalytic fingers indicates that most TBC-domain GAPs may accelerate GTP hydrolysis by a similar dual-finger mechanism.

  8. Review: Ras GTPases and myosin: Qualitative conservation and quantitative diversification in signal and energy transduction.

    PubMed

    Mueller, Matthias P; Goody, Roger S

    2016-08-01

    Most GTPases and many ATPases belong to the P-loop class of proteins with significant structural and mechanistic similarities. Here we compare and contrast the basic properties of the Ras family GTPases and myosin, and conclude that there are fundamental similarities but also distinct differences related to their specific roles. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 422-430, 2016. PMID:27018658

  9. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  10. Regulators and Effectors of Arf GTPases in Neutrophils

    PubMed Central

    Gamara, Jouda; Chouinard, François; Davis, Lynn; Aoudjit, Fawzi; Bourgoin, Sylvain G.

    2015-01-01

    Polymorphonuclear neutrophils (PMNs) are key innate immune cells that represent the first line of defence against infection. They are the first leukocytes to migrate from the blood to injured or infected sites. This process involves molecular mechanisms that coordinate cell polarization, delivery of receptors, and activation of integrins at the leading edge of migrating PMNs. These phagocytes actively engulf microorganisms or form neutrophil extracellular traps (NETs) to trap and kill pathogens with bactericidal compounds. Association of the NADPH oxidase complex at the phagosomal membrane for production of reactive oxygen species (ROS) and delivery of proteolytic enzymes into the phagosome initiate pathogen killing and removal. G protein-dependent signalling pathways tightly control PMN functions. In this review, we will focus on the small monomeric GTPases of the Arf family and their guanine exchange factors (GEFs) and GTPase activating proteins (GAPs) as components of signalling cascades regulating PMN responses. GEFs and GAPs are multidomain proteins that control cellular events in time and space through interaction with other proteins and lipids inside the cells. The number of Arf GAPs identified in PMNs is expanding, and dissecting their functions will provide important insights into the role of these proteins in PMN physiology. PMID:26609537

  11. Cdc42 GTPase dynamics control directional growth responses

    PubMed Central

    Brand, Alexandra C.; Morrison, Emma; Milne, Stephen; Gonia, Sara; Gale, Cheryl A.; Gow, Neil A. R.

    2014-01-01

    Polarized cells reorient their direction of growth in response to environmental cues. In the fungus Candida albicans, the Rho-family small GTPase, Cdc42, is essential for polarized hyphal growth and Ca2+ influx is required for the tropic responses of hyphae to environmental cues, but the regulatory link between these systems is unclear. In this study, the interaction between Ca2+ influx and Cdc42 polarity-complex dynamics was investigated using hyphal galvanotropic and thigmotropic responses as reporter systems. During polarity establishment in an applied electric field, cathodal emergence of hyphae was lost when either of the two Cdc42 apical recycling pathways was disrupted by deletion of Rdi1, a guanine nucleotide dissociation inhibitor, or Bnr1, a formin, but was completely restored by extracellular Ca2+. Loss of the Cdc42 GTPase activating proteins, Rga2 and Bem3, also abolished cathodal polarization, but this was not rescued by Ca2+. Expression of GTP-locked Cdc42 reversed the polarity of hypha emergence from cathodal to anodal, an effect augmented by Ca2+. The cathodal directional cue therefore requires Cdc42 GTP hydrolysis. Ca2+ influx amplifies Cdc42-mediated directional growth signals, in part by augmenting Cdc42 apical trafficking. The Ca2+-binding EF-hand motif in Cdc24, the Cdc42 activator, was essential for growth in yeast cells but not in established hyphae. The Cdc24 EF-hand motif is therefore essential for polarity establishment but not for polarity maintenance. PMID:24385582

  12. Novel peptide recognized by RhoA GTPase.

    PubMed

    Drulis-Fajdasz, Dominika; Jelen, Filip; Oleksy, Arkadiusz; Otlewski, Jacek

    2006-01-01

    A phage-displayed random 7-mer disulfide bridge-constrained peptide library was used to map the surface of the RhoA GTPase and to find peptides able to recognize RhoA switch regions. Several peptide sequences were selected after four rounds of enrichment, giving a high signal in ELISA against RhoA-GDP. A detailed analysis of one such selected peptide, called R2 (CWSFPGYAC), is reported. The RhoA-R2 interaction was investigated using fluorescence spectroscopy, chemical denaturation, and determination of the kinetics of nucleotide exchange and GTP hydrolysis in the presence of RhoA regulatory proteins. All measurements indicate that the affinity of the R2 peptide for RhoA is in the micromolar range and that R2 behaves as an inhibitor of: i) GDP binding to the apo form of RhoA (Mg2+-and nucleotide-free form of the GTPase), ii) nucleotide exchange stimulated by GEF (DH/PH tandem from PDZRhoGEF), and iii) GTP hydrolysis stimulated by the BH domain of GrafGAP protein. PMID:17019437

  13. Regulation of Neurotrophin-Induced Axonal Responses via Rho GTPases

    PubMed Central

    HANDEÖZDINLER, P.; ERZURUMLU, REHA S.

    2014-01-01

    Nerve growth factor (NGF) and related neurotrophins induce differential axon growth patterns from embryonic sensory neurons. In wholemount explant cultures of embryonic rat trigeminal ganglion and brainstem or in dissociated cell cultures of the trigeminal ganglion, exogenous supply of NGF leads to axonal elongation, whereas neurotrophin-3 (NT-3) treatment leads to short branching and arborization. Axonal responses to neurotrophins might be mediated via the Rho GTPases. To investigate this possibility, we prepared wholemount trigeminal pathway cultures from E15 rats. We infected the ganglia with recombinant vaccinia viruses that express GFP-tagged dominant negative Rac, Rho, or constitutively active Rac or treated the cultures with lysophosphatitic acid (LPA) to activate Rho. We then examined axonal responses to NGF by use of the lipophilic tracer DiI. Rac activity induced longer axonal growth from the central trigeminal tract, whereas the dominant negative construct of Rac eliminated NGF-induced axon outgrowth. Rho activity also significantly reduced, and the Rho dominant negative construct increased, axon growth from the trigeminal tract. Similar alterations in axonal responses to NT-3 and brain-derived neurotrophic factor were also noted. Our results demonstrate that Rho GTPases play a major role in neurotrophin-induced axonal differentiation of embryonic trigeminal axons. PMID:11559894

  14. Dendritic spine geometry can localize GTPase signaling in neurons

    PubMed Central

    Ramirez, Samuel A.; Raghavachari, Sridhar; Lew, Daniel J.

    2015-01-01

    Dendritic spines are the postsynaptic terminals of most excitatory synapses in the mammalian brain. Learning and memory are associated with long-lasting structural remodeling of dendritic spines through an actin-mediated process regulated by the Rho-family GTPases RhoA, Rac, and Cdc42. These GTPases undergo sustained activation after synaptic stimulation, but whereas Rho activity can spread from the stimulated spine, Cdc42 activity remains localized to the stimulated spine. Because Cdc42 itself diffuses rapidly in and out of the spine, the basis for the retention of Cdc42 activity in the stimulated spine long after synaptic stimulation has ceased is unclear. Here we model the spread of Cdc42 activation at dendritic spines by means of reaction-diffusion equations solved on spine-like geometries. Excitable behavior arising from positive feedback in Cdc42 activation leads to spreading waves of Cdc42 activity. However, because of the very narrow neck of the dendritic spine, wave propagation is halted through a phenomenon we term geometrical wave-pinning. We show that this can account for the localization of Cdc42 activity in the stimulated spine, and, of interest, retention is enhanced by high diffusivity of Cdc42. Our findings are broadly applicable to other instances of signaling in extreme geometries, including filopodia and primary cilia. PMID:26337387

  15. Ras Family Small GTPase-mediated Neuroprotective Signaling in Stroke

    PubMed Central

    Shi, Geng-Xian; Andres, Douglas A.; Cai, Weikang

    2012-01-01

    Selective neuronal cell death is one of the major causes of neuronal damage following stroke, and cerebral cells naturally mobilize diverse survival signaling pathways to protect against ischemia. Importantly, therapeutic strategies designed to improve endogenous anti-apoptotic signaling appear to hold great promise in stroke treatment. While a variety of complex mechanisms have been implicated in the pathogenesis of stroke, the overall mechanisms governing the balance between cell survival and death are not well-defined. Ras family small GTPases are activated following ischemic insults, and in turn, serve as intrinsic switches to regulate neuronal survival and regeneration. Their ability to integrate diverse intracellular signal transduction pathways makes them critical regulators and potential therapeutic targets for neuronal recovery after stroke. This article highlights the contribution of Ras family GTPases to neuroprotective signaling cascades, including mitogen-activated protein kinase (MAPK) family protein kinase- and AKT/PKB-dependent signaling pathways as well as the regulation of cAMP response element binding (CREB), Forkhead box O (FoxO) and hypoxia-inducible factor 1(HIF1) transcription factors, in stroke. PMID:21521171

  16. RhoA GTPase inhibition organizes contraction during epithelial morphogenesis.

    PubMed

    Mason, Frank M; Xie, Shicong; Vasquez, Claudia G; Tworoger, Michael; Martin, Adam C

    2016-08-29

    During morphogenesis, contraction of the actomyosin cytoskeleton within individual cells drives cell shape changes that fold tissues. Coordination of cytoskeletal contractility is mediated by regulating RhoA GTPase activity. Guanine nucleotide exchange factors (GEFs) activate and GTPase-activating proteins (GAPs) inhibit RhoA activity. Most studies of tissue folding, including apical constriction, have focused on how RhoA is activated by GEFs to promote cell contractility, with little investigation as to how GAPs may be important. Here, we identify a critical role for a RhoA GAP, Cumberland GAP (C-GAP), which coordinates with a RhoA GEF, RhoGEF2, to organize spatiotemporal contractility during Drosophila melanogaster apical constriction. C-GAP spatially restricts RhoA pathway activity to a central position in the apical cortex. RhoGEF2 pulses precede myosin, and C-GAP is required for pulsation, suggesting that contractile pulses result from RhoA activity cycling. Finally, C-GAP expression level influences the transition from reversible to irreversible cell shape change, which defines the onset of tissue shape change. Our data demonstrate that RhoA activity cycling and modulating the ratio of RhoGEF2 to C-GAP are required for tissue folding. PMID:27551058

  17. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  18. Ribosome origins: The relative age of 23S rRNA Domains

    NASA Astrophysics Data System (ADS)

    Hury, James; Nagaswamy, Uma; Larios-Sanz, Maia; Fox, George E.

    2006-08-01

    The modern ribosome and its component RNAs are quite large and it is likely that at an earlier time they were much smaller. Hence, not all regions of the modern ribosomal RNAs (rRNA) are likely to be equally old. In the work described here, it is hypothesized that the oldest regions of the RNAs will usually be highly integrated into the machinery. When this is the case, an examination of the interconnectivity between local RNA regions can provide insight to the relative age of the various regions. Herein, we describe an analysis of all known long-range RNA/RNA interactions within the 23S rRNA and between the 23S rRNA and the 16S rRNA in order to assess the interconnectivity between the usual Domains as defined by secondary structure. Domain V, which contains the peptidyl transferase center is centrally located, extensively connected, and therefore likely to be the oldest region. Domain IV and Domain II are extensively interconnected with both themselves and Domain V. A portion of Domain IV is also extensively connected with the 30S subunit and hence Domain IV may be older than Domain II. These results are consistent with other evidence relating to the relative age of RNA regions. Although the relative time of addition of the GTPase center can not be reliably deduced it is pointed out that the development of this may have dramatically affected the progenotes that preceded the last common ancestor.

  19. Neurolastin, a dynamin family GTPase, regulates excitatory synapses and spine density

    PubMed Central

    Madan Lomash, Richa; Gu, Xinglong; Youle, Richard J.; Lu, Wei; Roche, Katherine W.

    2015-01-01

    SUMMARY Membrane trafficking and spinogenesis contribute significantly to changes in synaptic strength during development and in various paradigms of synaptic plasticity. GTPases of the dynamin family are key players regulating membrane trafficking. Here, we identify a brain-specific dynamin family GTPase, neurolastin (RNF112/Znf179), with closest homology to atlastin. We demonstrate that neurolastin has functional GTPase and RING domains, making it a unique protein identified with this multi-enzymatic domain organization. We also show that neurolastin is a peripheral membrane protein, which localizes to endosomes and affects endosomal membrane dynamics via its RING domain. In addition, neurolastin knockout mice have fewer dendritic spines, and rescue of the wildtype phenotype requires both the GTPase and RING domains. Furthermore, we find fewer functional synapses and reduced paired pulse facilitation in neurolastin knockout mice. Thus, we identify neurolastin as a dynamin family GTPase that affects endosome size and spine density. PMID:26212327

  20. High Throughput Flow Cytometry Bead-based Multiplex Assay for Identification of Rho GTPase Inhibitors

    PubMed Central

    Surviladze, Zurab; Young, Susan M; Sklar, Larry A

    2015-01-01

    Summary Rho family GTPases and their effector proteins regulate a wide range of cell signaling pathways. In normal physiological conditions their activity is tightly controlled and it is not surprising that their aberrant activation contributes to tumorigenesis or other diseases. For this reason, the identification of small, cell permeable molecules capable of inhibition of Rho GTPases can be extraordinarily useful, particularly if they are specific and act reversibly. Herein we describe a flow cytometric assay, which allows us to measure the activity of six small GTPases simultaneously. GST-tagged small GTPases are bound to six glutathione bead sets each set having a different intensity of red fluorescence at a fixed wavelength. The coated bead sets were washed, combined, and dispensed into 384-well plates with test compounds, and fluorescent-GTP binding was used as the read-out. This multiplex bead-based assay was successfully used for to identify both general and selective inhibitors of Rho family GTPases. PMID:22144280

  1. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  2. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  3. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  4. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  5. A Competitive Nucleotide Binding Inhibitor: In vitro Characterization of Rab7 GTPase Inhibition

    PubMed Central

    Agola, Jacob O.; Hong, Lin; Surviladze, Zurab; Ursu, Oleg; Waller, Anna; Strouse, J. Jacob; Simpson, Denise S.; Schroeder, Chad E.; Oprea, Tudor I.; Golden, Jennifer E.; Aubé, Jeffrey; Buranda, Tione; Sklar, Larry A.; Wandinger-Ness, Angela

    2012-01-01

    Mapping the functionality of GTPases through small molecule inhibitors represents an underexplored area in large part due to the lack of suitable compounds. Here we report on the small chemical molecule 2-(benzoylcarbamothioylamino)-5,5-dimethyl-4,7-dihydrothieno[2,3-c]pyran-3-carboxylic acid (PubChem CID 1067700) as an inhibitor of nucleotide binding by Ras-related GTPases. The mechanism of action of this pan-GTPase inhibitor was characterized in the context of the Rab7 GTPase as there are no known inhibitors of Rab GTPases. Bead-based flow cytometry established that CID 1067700 has significant inhibitory potency on Rab7 nucleotide binding with nanomolar inhibitor (Ki) values and an inhibitory response of ≥97% for BODIPY-GTP and BODIPY-GDP binding. Other tested GTPases exhibited significantly lower responses. The compound behaves as a competitive inhibitor of Rab7 nucleotide binding based on both equilibrium binding and dissociation assays. Molecular docking analyses are compatible with CID 1067700 fitting into the nucleotide binding pocket of the GTP-conformer of Rab7. On the GDP-conformer, the molecule has greater solvent exposure and significantly less protein interaction relative to GDP, offering a molecular rationale for the experimental results. Structural features pertinent to CID 1067700 inhibitory activity have been identified through initial structure activity analyses and identified a molecular scaffold that may serve in the generation of more selective probes for Rab7 and other GTPases. Taken together, our study has identified the first competitive GTPase inhibitor and demonstrated the potential utility of the compound for dissecting the enzymology of the Rab7 GTPase as well as serving as a model for other small molecular weight GTPase inhibitors. PMID:22486388

  6. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  7. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  8. Structure of ERA in complex with the 3′ end of 16S rRNA: Implications for ribosome biogenesis

    SciTech Connect

    Tu, Chao; Zhou, Xiaomei; Tropea, Joseph E.; Austin, Brian P.; Waugh, David S.; Court, Donald L.; Ji, Xinhua

    2009-10-09

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the {sub 1531}AUCACCUCCUUA{sub 1542} sequence at the 3' end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  9. Structure of ERA in Complex with the 3 End of 16s rRNBA Implications for Ribosome Biogenesis

    SciTech Connect

    Tu, C.; Zhou, X; Tropea, J; Austin, B; Waugh, D; Court, D; Ji, X

    2009-01-01

    ERA, composed of an N-terminal GTPase domain followed by an RNA-binding KH domain, is essential for bacterial cell viability. It binds to 16S rRNA and the 30S ribosomal subunit. However, its RNA-binding site, the functional relationship between the two domains, and its role in ribosome biogenesis remain unclear. We have determined two crystal structures of ERA, a binary complex with GDP and a ternary complex with a GTP-analog and the 1531AUCACCUCCUUA1542 sequence at the 3? end of 16S rRNA. In the ternary complex, the first nine of the 12 nucleotides are recognized by the protein. We show that GTP binding is a prerequisite for RNA recognition by ERA and that RNA recognition stimulates its GTP-hydrolyzing activity. Based on these and other data, we propose a functional cycle of ERA, suggesting that the protein serves as a chaperone for processing and maturation of 16S rRNA and a checkpoint for assembly of the 30S ribosomal subunit. The AUCA sequence is highly conserved among bacteria, archaea, and eukaryotes, whereas the CCUCC, known as the anti-Shine-Dalgarno sequence, is conserved in noneukaryotes only. Therefore, these data suggest a common mechanism for a highly conserved ERA function in all three kingdoms of life by recognizing the AUCA, with a 'twist' for noneukaryotic ERA proteins by also recognizing the CCUCC.

  10. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  11. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  12. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  13. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  14. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  15. Centres of excellence.

    PubMed

    Watson, J M

    1980-05-16

    The present Government may not be enthusiastic about health centres. But Dr Joyce M. Watson, of Glasgow University Department of General Practice and based at Woodside Health Centre in Glasgow, writes with enthusiasm of their advantages for the practice of medicine and the care of patients. PMID:10247174

  16. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  17. Chromosome segregation control by Escherichia coli ObgE GTPase.

    PubMed

    Foti, James J; Persky, Nicole S; Ferullo, Daniel J; Lovett, Susan T

    2007-07-01

    Escherichia coli cells depleted of the conserved GTPase, ObgE, show early chromosome-partitioning defects and accumulate replicated chromosomes in which the terminus regions are colocalized. Cells lacking ObgE continue to initiate replication, with a normal ratio of the origin to terminus. Localization of the SeqA DNA binding protein, normally seen as punctate foci, however, was disturbed. Depletion of ObgE also results in cell filamentation, with polyploid DNA content. Depletion of ObgE did not cause lethality, and cells recovered fully after expression of ObgE was restored. We propose a model in which ObgE is required to license chromosome segregation and subsequent cell cycle events. PMID:17578452

  18. Coevolution of RAC Small GTPases and their Regulators GEF Proteins

    PubMed Central

    Jiménez-Sánchez, Alejandro

    2016-01-01

    RAC proteins are small GTPases involved in important cellular processes in eukaryotes, and their deregulation may contribute to cancer. Activation of RAC proteins is regulated by DOCK and DBL protein families of guanine nucleotide exchange factors (GEFs). Although DOCK and DBL proteins act as GEFs on RAC proteins, DOCK and DBL family members are evolutionarily unrelated. To understand how DBL and DOCK families perform the same function on RAC proteins despite their unrelated primary structure, phylogenetic analyses of the RAC, DBL, and DOCK families were implemented, and interaction patterns that may suggest a coevolutionary process were searched. Interestingly, while RAC and DOCK proteins are very well conserved in humans and among eukaryotes, DBL proteins are highly divergent. Moreover, correlation analyses of the phylogenetic distances of RAC and GEF proteins and covariation analyses between residues in the interacting domains showed significant coevolution rates for both RAC–DOCK and RAC–DBL interactions. PMID:27226705

  19. Mycobacteriophage putative GTPase-activating protein can potentiate antibiotics.

    PubMed

    Yan, Shuangquan; Xu, Mengmeng; Duan, Xiangke; Yu, Zhaoxiao; Li, Qiming; Xie, Longxiang; Fan, Xiangyu; Xie, Jianping

    2016-09-01

    The soaring incidences of infection by antimicrobial resistant (AR) pathogens and shortage of effective antibiotics with new mechanisms of action have renewed interest in phage therapy. This scenario is exemplified by resistant tuberculosis (TB), caused by resistant Mycobacterium tuberculosis. Mycobacteriophage SWU1 A321_gp67 encodes a putative GTPase-activating protein. Mycobacterium smegmatis with gp67 overexpression showed changed colony formation and biofilm morphology and supports the efficacy of streptomycin and capreomycin against Mycobacterium. gp67 down-regulated the transcription of genes involved in cell wall and biofilm development. To our knowledge, this is the first report to show that phage protein in addition to lysin or recombination components can synergize with existing antibiotics. Phage components might represent a promising new clue for better antibiotic potentiators. PMID:27345061

  20. Multiple Roles of the Small GTPase Rab7.

    PubMed

    Guerra, Flora; Bucci, Cecilia

    2016-01-01

    Rab7 is a small GTPase that belongs to the Rab family and controls transport to late endocytic compartments such as late endosomes and lysosomes. The mechanism of action of Rab7 in the late endocytic pathway has been extensively studied. Rab7 is fundamental for lysosomal biogenesis, positioning and functions, and for trafficking and degradation of several signaling receptors, thus also having implications on signal transduction. Several Rab7 interacting proteins have being identified leading to the discovery of a number of different important functions, beside its established role in endocytosis. Furthermore, Rab7 has specific functions in neurons. This review highlights and discusses the role and the importance of Rab7 on different cellular pathways and processes. PMID:27548222

  1. Modulation of osteoclast differentiation and bone resorption by Rho GTPases

    PubMed Central

    Touaitahuata, Heiani; Blangy, Anne; Vives, Virginie

    2014-01-01

    Bone is a dynamic tissue constantly renewed through a regulated balance between bone formation and resorption. Excessive bone degradation by osteoclasts leads to pathological decreased bone density characteristic of osteolytic diseases such as post-menopausal osteoporosis or bone metastasis. Osteoclasts are multinucleated cells derived from hematopoietic stem cells via a complex differentiation process. Their unique ability to resorb bone is dependent on the formation of the actin-rich sealing zone. Within this adhesion structure, the plasma membrane differentiates into the ruffled border where protons and proteases are secreted to demineralize and degrade bone, respectively. On the bone surface, mature osteoclasts alternate between stationary resorptive and migratory phases. These are associated with profound actin cytoskeleton reorganization, until osteoclasts die of apoptosis. In this review, we highlight the role of Rho GTPases in all the steps of osteoclasts differentiation, function, and death and conclude on their interest as targets for treatment of osteolytic pathologies. PMID:24614674

  2. Functional Mapping of Human Dynamin-1-Like GTPase Domain Based on X-ray Structure Analyses

    PubMed Central

    Fröhlich, Chris; Eibl, Clarissa; Gimeno, Ana; Hessenberger, Manuel; Puehringer, Sandra; Daumke, Oliver; Goettig, Peter

    2013-01-01

    Human dynamin-1-like protein (DNM1L) is a GTP-driven molecular machine that segregates mitochondria and peroxisomes. To obtain insights into its catalytic mechanism, we determined crystal structures of a construct comprising the GTPase domain and the bundle signaling element (BSE) in the nucleotide-free and GTP-analogue-bound states. The GTPase domain of DNM1L is structurally related to that of dynamin and binds the nucleotide 5′-Guanylyl-imidodiphosphate (GMP-PNP) via five highly conserved motifs, whereas the BSE folds into a pocket at the opposite side. Based on these structures, the GTPase center was systematically mapped by alanine mutagenesis and kinetic measurements. Thus, residues essential for the GTPase reaction were characterized, among them Lys38, Ser39 and Ser40 in the phosphate binding loop, Thr59 from switch I, Asp146 and Gly149 from switch II, Lys216 and Asp218 in the G4 element, as well as Asn246 in the G5 element. Also, mutated Glu81 and Glu82 in the unique 16-residue insertion of DNM1L influence the activity significantly. Mutations of Gln34, Ser35, and Asp190 in the predicted assembly interface interfered with dimerization of the GTPase domain induced by a transition state analogue and led to a loss of the lipid-stimulated GTPase activity. Our data point to related catalytic mechanisms of DNM1L and dynamin involving dimerization of their GTPase domains. PMID:23977156

  3. New insights in the regulation of Rab GTPases by G protein-coupled receptors

    PubMed Central

    Lachance, Véronik; Angers, Stéphane; Parent, Jean-Luc

    2014-01-01

    Cargo-mediated regulation of vesicular transport has received great attention lately. Rab GTPases, forming the largest branch of the Ras GTPase superfamily, regulate almost every step of vesicle-mediated trafficking. Growing evidence suggests that mutations, aberrant expression, and altered post-translational modifications of Rab GTPases are associated with human diseases. However, their regulatory mechanisms and how they are connected to cargo proteins are still poorly understood. Accumulating data indicate that G protein-coupled receptors (GPCRs) directly associate with Rab GTPases and that these interactions dictate receptor trafficking. Yet, it remained unclear whether the receptors could regulate the targeting and activity of Rab GTPases in various cell compartments. It is only in recent years that experimental studies showed that GPCR signaling and interaction with Rab-associated regulatory proteins modulate the localization and activity of Rab GTPases. This research is revealing novel regulatory mechanisms of these small GTPases and should contribute to the progress in effective drug development. Recently published in the Journal of Cell Science, Lachance et al. present a novel role for ubiquitylation of Rab11a by a β2AR/HACE1 complex in regulating Rab11a activity and β2AR trafficking. PMID:24950538

  4. Poliovirus protein 2C has ATPase and GTPase activities.

    PubMed

    Rodríguez, P L; Carrasco, L

    1993-04-15

    Poliovirus protein 2C belongs to an expanding group of proteins containing a nucleotide binding motif in their sequence. We present evidence that poliovirus 2C has nucleoside triphosphatase (NTPase) activity and binds to RNA. Poliovirus 2C was expressed in Escherichia coli cells as a fusion protein with the maltose binding protein (MBP). The fusion protein MBP-2C is efficiently cut by protease Xa within the 2C region. Thus, the fusion protein as such was used to assay for the putative activities of poliovirus 2C. Deletion mutants were constructed which lacked different portions of the 2C carboxyl terminus: mutant 2C delta 1 lacked the last 169 amino acids, whereas mutant 2C delta 2 had the last 74 amino acids deleted. The fusion proteins MBP-2C, MBP-2BC, and the mutant MBP-2C delta 2 that contained the first 255 amino acids of 2C had NTPase activity. Both ATPase and GTPase activities are inhibited by antibodies directed against the MBP-2C protein. Analysis of the ability of the different proteins to bind to labeled RNA indicates that MBP-2C and MBP-2BC form a complex, whereas none of the mutants interacted with RNA, indicating that the RNA binding domain lies beyond amino acid 255. None of the fusion proteins had detectable helicase activity. We suggest that poliovirus protein 2C shows similarities to the GTPases group involved in vesicular traffic and transports the viral RNA replication complexes. These results provide the first experimental evidence that poliovirus protein 2C is an NTPase and that this protein has affinity for nucleic acids. PMID:8385138

  5. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria

    2015-01-01

    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  6. ELMO Domains, Evolutionary and Functional Characterization of a Novel GTPase-activating Protein (GAP) Domain for Arf Protein Family GTPases*

    PubMed Central

    East, Michael P.; Bowzard, J. Bradford; Dacks, Joel B.; Kahn, Richard A.

    2012-01-01

    The human family of ELMO domain-containing proteins (ELMODs) consists of six members and is defined by the presence of the ELMO domain. Within this family are two subclassifications of proteins, based on primary sequence conservation, protein size, and domain architecture, deemed ELMOD and ELMO. In this study, we used homology searching and phylogenetics to identify ELMOD family homologs in genomes from across eukaryotic diversity. This demonstrated not only that the protein family is ancient but also that ELMOs are potentially restricted to the supergroup Opisthokonta (Metazoa and Fungi), whereas proteins with the ELMOD organization are found in diverse eukaryotes and thus were likely the form present in the last eukaryotic common ancestor. The segregation of the ELMO clade from the larger ELMOD group is consistent with their contrasting functions as unconventional Rac1 guanine nucleotide exchange factors and the Arf family GTPase-activating proteins, respectively. We used unbiased, phylogenetic sorting and sequence alignments to identify the most highly conserved residues within the ELMO domain to identify a putative GAP domain within the ELMODs. Three independent but complementary assays were used to provide an initial characterization of this domain. We identified a highly conserved arginine residue critical for both the biochemical and cellular GAP activity of ELMODs. We also provide initial evidence of the function of human ELMOD1 as an Arf family GAP at the Golgi. These findings provide the basis for the future study of the ELMOD family of proteins and a new avenue for the study of Arf family GTPases. PMID:23014990

  7. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  8. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  9. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  10. The ribosome triggers the stringent response by RelA via a highly distorted tRNA

    PubMed Central

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-01-01

    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  11. The ribosome triggers the stringent response by RelA via a highly distorted tRNA.

    PubMed

    Agirrezabala, Xabier; Fernández, Israel S; Kelley, Ann C; Cartón, David Gil; Ramakrishnan, Venki; Valle, Mikel

    2013-09-01

    The bacterial stringent response links nutrient starvation with the transcriptional control of genes. This process is initiated by the stringent factor RelA, which senses the presence of deacylated tRNA in the ribosome as a symptom of amino-acid starvation to synthesize the alarmone (p)ppGpp. Here we report a cryo-EM study of RelA bound to ribosomes bearing cognate, deacylated tRNA in the A-site. The data show that RelA on the ribosome stabilizes an unusual distorted form of the tRNA, with the acceptor arm making contact with RelA and far from its normal location in the peptidyl transferase centre. PMID:23877429

  12. Pretoria Centre Reaches Out

    NASA Astrophysics Data System (ADS)

    Bosman, Olivier

    2014-08-01

    On 5 July 2014 six members of the Pretoria Centre of ASSA braved the light pollution of one of the shopping malls in Centurion to reach out to shoppers a la John Dobson and to show them the moon, Mars and Saturn. Although the centre hosts regular monthly public observing evenings, it was felt that we should take astronomy to the people rather than wait for the people to come to us.

  13. The Pallbearer E3 Ligase Promotes Actin Remodeling via RAC in Efferocytosis by Degrading the Ribosomal Protein S6

    PubMed Central

    Xiao, Hui; Wang, Hui; Silva, Elizabeth; Thompson, James; Guillou, Aurélien; Yates, John R.; Buchon, Nicolas; Franc, Nathalie C.

    2014-01-01

    Clearance of apoptotic cells (efferocytosis) is achieved through phagocytosis by professional or amateur phagocytes. It is critical for tissue homeostasis and remodeling in all animals. Failure in this process can contribute to the development of inflammatory autoimmune or neurodegenerative diseases. We previously found that the PALL-SCF E3-Ubiquitin ligase complex promotes apoptotic cell clearance, yet it remained unclear as to how it did so. Here, we show that the F-Box protein PALL interacts with phosphorylated Ribosomal protein S6 (RpS6) to promote its ubiquitylation and proteasomal degradation. This leads to RAC2 GTPase up-regulation and activation and F-actin remodeling that promotes efferocytosis. We further show that the specific role of PALL in efferocytosis is driven by its apoptotic cell-induced nuclear export. Finding a role for RpS6 in negatively regulating efferocytosis provides the opportunity to develop new strategies to regulate this process. PMID:25533207

  14. The Pallbearer E3 ligase promotes actin remodeling via RAC in efferocytosis by degrading the ribosomal protein S6.

    PubMed

    Xiao, Hui; Wang, Hui; Silva, Elizabeth A; Thompson, James; Guillou, Aurélien; Yates, John R; Buchon, Nicolas; Franc, Nathalie C

    2015-01-12

    Clearance of apoptotic cells (efferocytosis) is achieved through phagocytosis by professional or amateur phagocytes. It is critical for tissue homeostasis and remodeling in all animals. Failure in this process can contribute to the development of inflammatory autoimmune or neurodegenerative diseases. We found previously that the PALL-SCF E3-ubiquitin ligase complex promotes apoptotic cell clearance, but it remained unclear how it did so. Here we show that the F-box protein PALL interacts with phosphorylated ribosomal protein S6 (RpS6) to promote its ubiquitylation and proteasomal degradation. This leads to RAC2 GTPase upregulation and activation and F-actin remodeling that promotes efferocytosis. We further show that the specific role of PALL in efferocytosis is driven by its apoptotic cell-induced nuclear export. Finding a role for RpS6 in the negative regulation of efferocytosis provides the opportunity to develop new strategies to regulate this process. PMID:25533207

  15. The Regulation of Cellular Responses to Mechanical Cues by Rho GTPases

    PubMed Central

    Hoon, Jing Ling; Tan, Mei Hua; Koh, Cheng-Gee

    2016-01-01

    The Rho GTPases regulate many cellular signaling cascades that modulate cell motility, migration, morphology and cell division. A large body of work has now delineated the biochemical cues and pathways, which stimulate the GTPases and their downstream effectors. However, cells also respond exquisitely to biophysical and mechanical cues such as stiffness and topography of the extracellular matrix that profoundly influence cell migration, proliferation and differentiation. As these cellular responses are mediated by the actin cytoskeleton, an involvement of Rho GTPases in the transduction of such cues is not unexpected. In this review, we discuss an emerging role of Rho GTPase proteins in the regulation of the responses elicited by biophysical and mechanical stimuli. PMID:27058559

  16. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  17. Molecular mechanisms of Sar/Arf GTPases in vesicular trafficking in yeast and plants

    PubMed Central

    Yorimitsu, Tomohiro; Sato, Ken; Takeuchi, Masaki

    2014-01-01

    Small GTPase proteins play essential roles in the regulation of vesicular trafficking systems in eukaryotic cells. Two types of small GTPases, secretion-associated Ras-related protein (Sar) and ADP-ribosylation factor (Arf), act in the biogenesis of transport vesicles. Sar/Arf GTPases function as molecular switches by cycling between active, GTP-bound and inactive, GDP-bound forms, catalyzed by guanine nucleotide exchange factors and GTPase-activating proteins, respectively. Activated Sar/Arf GTPases undergo a conformational change, exposing the N-terminal amphipathic α-helix for insertion into membranes. The process triggers the recruitment and assembly of coat proteins to the membranes, followed by coated vesicle formation and scission. In higher plants, Sar/Arf GTPases also play pivotal roles in maintaining the dynamic identity of organelles in the secretory pathway. Sar1 protein strictly controls anterograde transport from the endoplasmic reticulum (ER) through the recruitment of plant COPII coat components onto membranes. COPII vesicle transport is responsible for the organization of highly conserved polygonal ER networks. In contrast, Arf proteins contribute to the regulation of multiple trafficking routes, including transport through the Golgi complex and endocytic transport. These transport systems have diversified in the plant kingdom independently and exhibit several plant-specific features with respect to Golgi organization, endocytic cycling, cell polarity and cytokinesis. The functional diversification of vesicular trafficking systems ensures the multicellular development of higher plants. This review focuses on the current knowledge of Sar/Arf GTPases, highlighting the molecular details of GTPase regulation in vesicle formation in yeast and advances in knowledge of the characteristics of vesicle trafficking in plants. PMID:25191334

  18. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  19. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  20. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  1. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  2. Individual Rac GTPases Mediate Aspects of Prostate Cancer Cell and Bone Marrow Endothelial Cell Interactions

    PubMed Central

    Chatterjee, Moumita; Sequeira, Linda; Jenkins-Kabaila, Mashariki; Dubyk, Cara W.; Pathak, Surabhi; van Golen, Kenneth L.

    2011-01-01

    The Rho GTPases organize the actin cytoskeleton and are involved in cancer metastasis. Previously, we demonstrated that RhoC GTPase was required for PC-3 prostate cancer cell invasion. Targeted down-regulation of RhoC led to sustained activation of Rac1 GTPase and morphological, molecular and phenotypic changes reminiscent of epithelial to mesenchymal transition. We also reported that Rac1 is required for PC-3 cell diapedesis across a bone marrow endothelial cell layer. In the current study, we queried whether Rac3 and RhoG GTPases also have a role in prostate tumor cell diapedesis. Using specific siRNAs we demonstrate roles for each protein in PC-3 and C4-2 cell adhesion and diapedesis. We have shown that the chemokine CCL2 induces tumor cell diapedesis via Rac1 activation. Here we find that RhoG partially contributes to CCL2-induced tumor cell diapedesis. We also find that Rac1 GTPase mediates tight binding of prostate cancer cells to bone marrow endothelial cells and promotes retraction of endothelial cells required for tumor cell diapedesis. Finally, Rac1 leads to β1 integrin activation, suggesting a mechanism that Rac1 can mediate tight binding with endothelial cells. Together, our data suggest that Rac1 GTPase is key mediator of prostate cancer cell-bone marrow endothelial cell interactions. PMID:21776386

  3. Bacterial factors exploit eukaryotic Rho GTPase signaling cascades to promote invasion and proliferation within their host

    PubMed Central

    Popoff, Michel R

    2014-01-01

    Actin cytoskeleton is a main target of many bacterial pathogens. Among the multiple regulation steps of the actin cytoskeleton, bacterial factors interact preferentially with RhoGTPases. Pathogens secrete either toxins which diffuse in the surrounding environment, or directly inject virulence factors into target cells. Bacterial toxins, which interfere with RhoGTPases, and to some extent with RasGTPases, catalyze a covalent modification (ADPribosylation, glucosylation, deamidation, adenylation, proteolysis) blocking these molecules in their active or inactive state, resulting in alteration of epithelial and/or endothelial barriers, which contributes to dissemination of bacteria in the host. Injected bacterial virulence factors preferentially manipulate the RhoGTPase signaling cascade by mimicry of eukaryotic regulatory proteins leading to local actin cytoskeleton rearrangement, which mediates bacterial entry into host cells or in contrast escape to phagocytosis and immune defense. Invasive bacteria can also manipulate RhoGTPase signaling through recognition and stimulation of cell surface receptor(s). Changes in RhoGTPase activation state is sensed by the innate immunity pathways and allows the host cell to adapt an appropriate defense response. PMID:25203748

  4. Rap2B GTPase: structure, functions, and regulation.

    PubMed

    Zhu, Zhesi; Di, Jiehui; Lu, Zheng; Gao, Keyu; Zheng, Junnian

    2016-06-01

    Rap2B GTPase, a member of Ras-related protein superfamily, was first discovered from a platelet cDNA library in the early 1990s. Since then, it has been reported to play an important role in regulating cellular processes including cytoskeletal organization, cell growth, and proliferation. It can be stimulated and suppressed by a wide range of external and internal inducers, circulating between GTP-bound active state and GDP-bound inactive state. Increasing focus on Ras signaling pathway reveals critical effects of Rap2B on tumorigenesis. In particular, Rap2B behaves in a p53-dependent manner in regulation of apoptosis and migration. Apart from being an oncogenic activator, Rap2B has been found to participate in many other physiological events via diverse downstream effectors. In this review, we present recent studies on the structure, regulation, and multiple biological functions of Rap2B, shedding light on its potential status in treatment of cancer as well as other diseases. PMID:27012552

  5. The small GTPase Arf1 modulates mitochondrial morphology and function

    PubMed Central

    Ackema, Karin B; Hench, Jürgen; Böckler, Stefan; Wang, Shyi Chyi; Sauder, Ursula; Mergentaler, Heidi; Westermann, Benedikt; Bard, Frédéric; Frank, Stephan; Spang, Anne

    2014-01-01

    The small GTPase Arf1 plays critical roles in membrane traffic by initiating the recruitment of coat proteins and by modulating the activity of lipid-modifying enzymes. Here, we report an unexpected but evolutionarily conserved role for Arf1 and the ArfGEF GBF1 at mitochondria. Loss of function of ARF-1 or GBF-1 impaired mitochondrial morphology and activity in Caenorhabditis elegans. Similarly, mitochondrial defects were observed in mammalian and yeast cells. In Saccharomyces cerevisiae, aberrant clusters of the mitofusin Fzo1 accumulated in arf1-11 mutants and were resolved by overexpression of Cdc48, an AAA-ATPase involved in ER and mitochondria-associated degradation processes. Yeast Arf1 co-fractionated with ER and mitochondrial membranes and interacted genetically with the contact site component Gem1. Furthermore, similar mitochondrial abnormalities resulted from knockdown of either GBF-1 or contact site components in worms, suggesting that the role of Arf1 in mitochondrial functioning is linked to ER–mitochondrial contacts. Thus, Arf1 is involved in mitochondrial homeostasis and dynamics, independent of its role in vesicular traffic. PMID:25190516

  6. The pseudo GTPase CENP-M drives human kinetochore assembly

    PubMed Central

    Basilico, Federica; Maffini, Stefano; Weir, John R; Prumbaum, Daniel; Rojas, Ana M; Zimniak, Tomasz; De Antoni, Anna; Jeganathan, Sadasivam; Voss, Beate; van Gerwen, Suzan; Krenn, Veronica; Massimiliano, Lucia; Valencia, Alfonso; Vetter, Ingrid R; Herzog, Franz; Raunser, Stefan; Pasqualato, Sebastiano; Musacchio, Andrea

    2014-01-01

    Kinetochores, multi-subunit complexes that assemble at the interface with centromeres, bind spindle microtubules to ensure faithful delivery of chromosomes during cell division. The configuration and function of the kinetochore–centromere interface is poorly understood. We report that a protein at this interface, CENP-M, is structurally and evolutionarily related to small GTPases but is incapable of GTP-binding and conformational switching. We show that CENP-M is crucially required for the assembly and stability of a tetramer also comprising CENP-I, CENP-H, and CENP-K, the HIKM complex, which we extensively characterize through a combination of structural, biochemical, and cell biological approaches. A point mutant affecting the CENP-M/CENP-I interaction hampers kinetochore assembly and chromosome alignment and prevents kinetochore recruitment of the CENP-T/W complex, questioning a role of CENP-T/W as founder of an independent axis of kinetochore assembly. Our studies identify a single pathway having CENP-C as founder, and CENP-H/I/K/M and CENP-T/W as CENP-C-dependent followers. DOI: http://dx.doi.org/10.7554/eLife.02978.001 PMID:25006165

  7. Optogenetic oligomerization of Rab GTPases regulates intracellular membrane trafficking.

    PubMed

    Nguyen, Mai Khanh; Kim, Cha Yeon; Kim, Jin Man; Park, Byung Ouk; Lee, Sangkyu; Park, Hyerim; Heo, Won Do

    2016-06-01

    Intracellular membrane trafficking, which is involved in diverse cellular processes, is dynamic and difficult to study in a spatiotemporal manner. Here we report an optogenetic strategy, termed light-activated reversible inhibition by assembled trap of intracellular membranes (IM-LARIAT), that uses various Rab GTPases combined with blue-light-induced hetero-interaction between cryptochrome 2 and CIB1. In this system, illumination induces a rapid and reversible intracellular membrane aggregation that disrupts the dynamics and functions of the targeted membrane. We applied IM-LARIAT to specifically perturb several Rab-mediated trafficking processes, including receptor transport, protein sorting and secretion, and signaling initiated from endosomes. We finally used this tool to reveal different functions of local Rab5-mediated and Rab11-mediated membrane trafficking in growth cones and soma of young hippocampal neurons. Our results show that IM-LARIAT is a versatile tool that can be used to dissect spatiotemporal functions of intracellular membranes in diverse systems. PMID:27065232

  8. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  9. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  10. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  11. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  12. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  13. Lidar Calibration Centre

    NASA Astrophysics Data System (ADS)

    Pappalardo, Gelsomina; Freudenthaler, Volker; Nicolae, Doina; Mona, Lucia; Belegante, Livio; D'Amico, Giuseppe

    2016-06-01

    This paper presents the newly established Lidar Calibration Centre, a distributed infrastructure in Europe, whose goal is to offer services for complete characterization and calibration of lidars and ceilometers. Mobile reference lidars, laboratories for testing and characterization of optics and electronics, facilities for inspection and debugging of instruments, as well as for training in good practices are open to users from the scientific community, operational services and private sector. The Lidar Calibration Centre offers support for trans-national access through the EC HORIZON2020 project ACTRIS-2.

  14. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  15. Isoform-specific roles of the GTPase activating protein Nadrin in cytoskeletal reorganization of platelets.

    PubMed

    Beck, S; Fotinos, A; Lang, F; Gawaz, M; Elvers, M

    2013-01-01

    Cytoskeletal reorganization of activated platelets plays a crucial role in hemostasis and thrombosis and implies activation of Rho GTPases. Rho GTPases are important regulators of cytoskeletal dynamics and function as molecular switches that cycle between an inactive and an active state. They are regulated by GTPase activating proteins (GAPs) that stimulate GTP hydrolysis to terminate Rho signaling. The regulation of Rho GTPases in platelets is not explored. A detailed characterization of Rho regulation is necessary to understand activation and inactivation of Rho GTPases critical for platelet activation and aggregation. Nadrin is a RhoGAP regulating cytoplasmic protein explored in the central nervous system. Five Nadrin isoforms are known that share a unique GAP domain, a serine/threonine/proline-rich domain, a SH3-binding motif and an N-terminal BAR domain but differ in their C-terminus. Here we identified Nadrin in platelets where it co-localizes to actin-rich regions and Rho GTPases. Different Nadrin isoforms selectively regulate Rho GTPases (RhoA, Cdc42 and Rac1) and cytoskeletal reorganization suggesting that - beside the GAP domain - the C-terminus of Nadrin determines Rho specificity and influences cell physiology. Furthermore, Nadrin controls RhoA-mediated stress fibre and focal adhesion formation. Spreading experiments on fibrinogen revealed strongly reduced cell adhesion upon Nadrin overexpression. Unexpectedly, the Nadrin BAR domain controls Nadrin-GAP activity and acts as a guidance domain to direct this GAP to its substrate at the plasma membrane. Our results suggest a critical role for Nadrin in the regulation of RhoA, Cdc42 and Rac1 in platelets and thus for platelet adhesion and aggregation. PMID:22975681

  16. Unique Structural and Nucleotide Exchange Features of the Rho1 GTPase of Entamoeba histolytica

    SciTech Connect

    Bosch, Dustin E.; Wittchen, Erika S.; Qiu, Connie; Burridge, Keith; Siderovski, David P.

    2012-08-10

    The single-celled human parasite Entamoeba histolytica possesses a dynamic actin cytoskeleton vital for its intestinal and systemic pathogenicity. The E. histolytica genome encodes several Rho family GTPases known to regulate cytoskeletal dynamics. EhRho1, the first family member identified, was reported to be insensitive to the Rho GTPase-specific Clostridium botulinum C3 exoenzyme, raising the possibility that it may be a misclassified Ras family member. Here, we report the crystal structures of EhRho1 in both active and inactive states. EhRho1 is activated by a conserved switch mechanism, but diverges from mammalian Rho GTPases in lacking a signature Rho insert helix. EhRho1 engages a homolog of mDia, EhFormin1, suggesting a role in mediating serum-stimulated actin reorganization and microtubule formation during mitosis. EhRho1, but not a constitutively active mutant, interacts with a newly identified EhRhoGDI in a prenylation-dependent manner. Furthermore, constitutively active EhRho1 induces actin stress fiber formation in mammalian fibroblasts, thereby identifying it as a functional Rho family GTPase. EhRho1 exhibits a fast rate of nucleotide exchange relative to mammalian Rho GTPases due to a distinctive switch one isoleucine residue reminiscent of the constitutively active F28L mutation in human Cdc42, which for the latter protein, is sufficient for cellular transformation. Nonconserved, nucleotide-interacting residues within EhRho1, revealed by the crystal structure models, were observed to contribute a moderating influence on fast spontaneous nucleotide exchange. Collectively, these observations indicate that EhRho1 is a bona fide member of the Rho GTPase family, albeit with unique structural and functional aspects compared with mammalian Rho GTPases.

  17. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  18. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  19. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  20. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  1. Conserved charged residues in the leucine-rich repeat domain of the Ran GTPase activating protein are required for Ran binding and GTPase activation.

    PubMed Central

    Haberland, J; Gerke, V

    1999-01-01

    GTPase activating proteins (GAPs) for Ran, a Ras-related GTPase participating in nucleocytoplasmic transport, have been identified in different species ranging from yeast to man. All RanGAPs are characterized by a conserved domain consisting of eight leucine-rich repeats (LRRs) interrupted at two positions by so-called separating regions, the latter being unique for RanGAPs within the family of LRR proteins. The cytosolic RanGAP activity is essential for the Ran GTPase cycle which in turn provides directionality in nucleocytoplasmic transport, but the structural basis for the interaction between Ran and its GAP has not been elucidated. In order to gain a better understanding of this interaction we generated a number of mutant RanGAPs carrying amino acid substitutions in the LRR domain and analysed their complex formation with Ran as well as their ability to stimulate the intrinsic GTPase activity of the G protein. We show that conserved charged residues present in the separating regions of the LRR domain are indispensable for efficient Ran binding and GAP activity. These separating regions contain three conserved arginines which could possibly serve as catalytic residues similar to the arginine fingers identified in GAPs for other small GTPases. However, mutations in two of these arginines do not affect the GAP activity and replacement of the third conserved arginine (Arg91 in human RanGAP) severely interferes not only with GAP activity but also with Ran binding. This indicates that RanGAP-stimulated GTP hydrolysis on Ran does not involve a catalytic arginine residue but requires certain charged residues of the LRR domain of the GAP for mediating the protein-protein interaction. PMID:10527945

  2. Implementing Responsibility Centre Budgeting

    ERIC Educational Resources Information Center

    Vonasek, Joseph

    2011-01-01

    Recently, institutes of higher education (universities) have shown a renewed interest in organisational structures and operating methodologies that generate productivity and innovation; responsibility centre budgeting (RCB) is one such process. This paper describes the underlying principles constituting RCB, its origin and structural elements, and…

  3. Maple Leaf Outdoor Centre.

    ERIC Educational Resources Information Center

    Maguire, Molly; Gunton, Ric

    2000-01-01

    Maple Leaf Outdoor Centre (Ontario) has added year-round outdoor education facilities and programs to help support its summer camp for disadvantaged children. Schools, youth centers, religious groups, and athletic teams conduct their own programs, collaborate with staff, or use staff-developed programs emphasizing adventure education and personal…

  4. Winnipeg Centre Project.

    ERIC Educational Resources Information Center

    Manitoba Dept. of Education, Winnipeg.

    The Winnipeg Centre Project is a field-based, work-study program that attempts to create more appropriate education for the inner-city child. Sponsored by the Planning and Research Branch of the Department of Colleges and Universities Affairs and administered by Brandon University in consultation with the Winnipeg School Division, the project is…

  5. The GSO Data Centre

    NASA Astrophysics Data System (ADS)

    Paletou, F.; Glorian, J.-M.; Génot, V.; Rouillard, A.; Petit, P.; Palacios, A.; Caux, E.; Wakelam, V.

    2015-12-01

    Hereafter we describe the activities of the Grand Sud-Ouest Data Centre operated for INSU (CNRS) by the OMP--IRAP and the Université Paul Sabatier in Toulouse, in a collaboration with the OASU--LAB in Bordeaux and OREME--LUPM in Montpellier.

  6. Wycheproof Education Centre.

    ERIC Educational Resources Information Center

    Sweetnam and Godfrey, Melbourne (Australia).

    The Wycheproof township in New South Wales (Australia) is the regional center for a grain farming community. The Wycheproof Education Centre was formed by the merger of a separate primary and secondary school (on one site with existing buildings), into a single governing body that is educationally structured into junior, middle, and senior…

  7. Thousands of Rab GTPases for the Cell Biologist

    PubMed Central

    Diekmann, Yoan; Seixas, Elsa; Gouw, Marc; Tavares-Cadete, Filipe; Seabra, Miguel C.; Pereira-Leal, José B.

    2011-01-01

    Rab proteins are small GTPases that act as essential regulators of vesicular trafficking. 44 subfamilies are known in humans, performing specific sets of functions at distinct subcellular localisations and tissues. Rab function is conserved even amongst distant orthologs. Hence, the annotation of Rabs yields functional predictions about the cell biology of trafficking. So far, annotating Rabs has been a laborious manual task not feasible for current and future genomic output of deep sequencing technologies. We developed, validated and benchmarked the Rabifier, an automated bioinformatic pipeline for the identification and classification of Rabs, which achieves up to 90% classification accuracy. We cataloged roughly 8.000 Rabs from 247 genomes covering the entire eukaryotic tree. The full Rab database and a web tool implementing the pipeline are publicly available at www.RabDB.org. For the first time, we describe and analyse the evolution of Rabs in a dataset covering the whole eukaryotic phylogeny. We found a highly dynamic family undergoing frequent taxon-specific expansions and losses. We dated the origin of human subfamilies using phylogenetic profiling, which enlarged the Rab repertoire of the Last Eukaryotic Common Ancestor with Rab14, 32 and RabL4. Furthermore, a detailed analysis of the Choanoflagellate Monosiga brevicollis Rab family pinpointed the changes that accompanied the emergence of Metazoan multicellularity, mainly an important expansion and specialisation of the secretory pathway. Lastly, we experimentally establish tissue specificity in expression of mouse Rabs and show that neo-functionalisation best explains the emergence of new human Rab subfamilies. With the Rabifier and RabDB, we provide tools that easily allows non-bioinformaticians to integrate thousands of Rabs in their analyses. RabDB is designed to enable the cell biology community to keep pace with the increasing number of fully-sequenced genomes and change the scale at which we perform

  8. Thousands of rab GTPases for the cell biologist.

    PubMed

    Diekmann, Yoan; Seixas, Elsa; Gouw, Marc; Tavares-Cadete, Filipe; Seabra, Miguel C; Pereira-Leal, José B

    2011-10-01

    Rab proteins are small GTPases that act as essential regulators of vesicular trafficking. 44 subfamilies are known in humans, performing specific sets of functions at distinct subcellular localisations and tissues. Rab function is conserved even amongst distant orthologs. Hence, the annotation of Rabs yields functional predictions about the cell biology of trafficking. So far, annotating Rabs has been a laborious manual task not feasible for current and future genomic output of deep sequencing technologies. We developed, validated and benchmarked the Rabifier, an automated bioinformatic pipeline for the identification and classification of Rabs, which achieves up to 90% classification accuracy. We cataloged roughly 8.000 Rabs from 247 genomes covering the entire eukaryotic tree. The full Rab database and a web tool implementing the pipeline are publicly available at www.RabDB.org. For the first time, we describe and analyse the evolution of Rabs in a dataset covering the whole eukaryotic phylogeny. We found a highly dynamic family undergoing frequent taxon-specific expansions and losses. We dated the origin of human subfamilies using phylogenetic profiling, which enlarged the Rab repertoire of the Last Eukaryotic Common Ancestor with Rab14, 32 and RabL4. Furthermore, a detailed analysis of the Choanoflagellate Monosiga brevicollis Rab family pinpointed the changes that accompanied the emergence of Metazoan multicellularity, mainly an important expansion and specialisation of the secretory pathway. Lastly, we experimentally establish tissue specificity in expression of mouse Rabs and show that neo-functionalisation best explains the emergence of new human Rab subfamilies. With the Rabifier and RabDB, we provide tools that easily allows non-bioinformaticians to integrate thousands of Rabs in their analyses. RabDB is designed to enable the cell biology community to keep pace with the increasing number of fully-sequenced genomes and change the scale at which we perform

  9. Brassica napus Rop GTPases and their expression in microspore cultures.

    PubMed

    Chan, John; Peter Pauls, K

    2007-01-01

    Androgenesis in plants involves a shift in development that causes cultured microspore cells to form embryos rather than continue to develop pollen. In Brassica napus microspore culture a mild heat stress is used to switch on embryo development. An early hallmark of embryogenesis in this system is a symmetrical division of the nucleus instead of the asymmetric division that occurs during pollen formation. ROP GTPases act as molecular switches in a variety of developmental processes; therefore, the current study was initiated to examine whether they might be involved in androgenesis. Five distinct Rop genes with nucleic acid similarities ranging from 82 to 93% to Arabidopsis Rop1 were isolated from B. napus cv Topas. A Southern blot hybridization with a BnRop sequence probe suggested that there are 11-15 ROP gene family members in B. napus. RT-PCR reactions with PCR primers specific to BnRop5, BnRop6, BnRop9 and BnRop10 showed that expression of the BnRop5 was restricted to pollen but the others were detected in leaf, root, stem and pollen tissue. Pollen-like cells obtained from 3-day-old cultures by flow cytometric sorting had BnRop5 transcript levels that were 2.8 times higher than in flow sorted embryogenic microspores. Conversely, the BnRop9 transcript levels were 2.5-fold higher in the embryogenic cells than in the pollen-like cells. The potential involvement of specific ROPs in early stage microspore culture responses is discussed. PMID:16896789

  10. Activation and Involvement of Ral GTPases in Colorectal Cancer

    PubMed Central

    Martin, Timothy D.; Samuel, Jonathan C.; Routh, Elizabeth D.; Der, Channing J.; Yeh, Jen Jen

    2010-01-01

    Current approaches to block KRAS oncogene function focus on inhibition of K-Ras downstream effector signaling. We evaluated the anti-tumor activity of selumetinib (AZD6244, ARRY-142886), a potent and selective MEK1/2 inhibitor, on a panel of colorectal carcinoma (CRC) cells and found no inhibition of KRAS mutant CRC cell anchorage-independent growth. While AKT activity was elevated in KRAS mutant cells, and PI3K inhibition did impair the growth of MEK inhibitor-insensitive CRC cell lines, concurrent treatment with selumetinib did not provide additional anti-tumor activity. Therefore, we speculated that inhibition of the Ral guanine exchange factor (RalGEF) effector pathway may be a more effective approach for blocking CRC growth. RalGEFs are activators of the related RalA and RalB small GTPases and we found activation of both in CRC cell lines and patient tumors. Interfering RNA stable suppression of RalA expression reduced CRC tumor cell anchorage-independent growth, but surprisingly, stable suppression of RalB greatly enhanced soft agar colony size and formation frequency. Despite their opposing activities, both RalA and RalB regulation of anchorage-independent growth required interaction with RalBP1/RLIP76 and components of the exocyst complex. Interestingly, RalA interaction with the Exo84 but not Sec5 exocyst component was necessary for supporting anchorage-independent growth, whereas RalB interaction with Sec5 but not Exo84 was necessary for inhibition of anchorage-independent growth. We suggest that anti-RalA-selective therapies may provide an effective approach for KRAS mutant CRC. PMID:21199803

  11. Effects of phosphorylation on function of the Rad GTPase.

    PubMed Central

    Moyers, J S; Zhu, J; Kahn, C R

    1998-01-01

    Rad, Gem and Kir possess unique structural features in comparison with other Ras-like GTPases, including a C-terminal 31-residue extension that lacks typical prenylation motifs. We have recently shown that Rad and Gem bind calmodulin in a Ca2+-dependent manner via this C-terminal extension, involving residues 278-297 in human Rad. This domain also contains several consensus sites for serine phosphorylation, and Rad is complexed with calmodulin-dependent protein kinase II (CaMKII) in C2C12 cells. Here we show that Rad serves as a substrate for phosphorylation by CaMKII, cAMP-dependent protein kinase (PKA), protein kinase C (PKC) and casein kinase II (CKII) with stoichiometries in vitro of 0.2-1.3 mol of phosphate/mol of Rad. By deletion and point mutation analysis we show that phosphorylation by CaMKII and PKA occurs on a single serine residue at position 273, whereas PKC and CKII phosphorylate multiple C-terminal serine residues, including Ser214, Ser257, Ser273, Ser290 and Ser299. Incubation of Rad with PKA decreases GTP binding by 60-70%, but this effect seems to be independent of phosphorylation, as it is observed with the Ser273-->Ala mutant of Rad containing a mutation at the site of PKA phosphorylation. The remainder of the serine kinases have no effect on Rad GTP binding, intrinsic GTP hydrolysis or GTP hydrolysis stimulated by the putative tumour metastasis suppressor nm23. However, phosphorylation of Rad by PKC and CKII abolishes the interaction of Rad with calmodulin. These findings suggest that the binding of Rad to calmodulin, as well as its ability to bind GTP, might be regulated by the activation of several serine kinases. PMID:9677319

  12. Effects of phosphorylation on function of the Rad GTPase.

    PubMed

    Moyers, J S; Zhu, J; Kahn, C R

    1998-08-01

    Rad, Gem and Kir possess unique structural features in comparison with other Ras-like GTPases, including a C-terminal 31-residue extension that lacks typical prenylation motifs. We have recently shown that Rad and Gem bind calmodulin in a Ca2+-dependent manner via this C-terminal extension, involving residues 278-297 in human Rad. This domain also contains several consensus sites for serine phosphorylation, and Rad is complexed with calmodulin-dependent protein kinase II (CaMKII) in C2C12 cells. Here we show that Rad serves as a substrate for phosphorylation by CaMKII, cAMP-dependent protein kinase (PKA), protein kinase C (PKC) and casein kinase II (CKII) with stoichiometries in vitro of 0.2-1.3 mol of phosphate/mol of Rad. By deletion and point mutation analysis we show that phosphorylation by CaMKII and PKA occurs on a single serine residue at position 273, whereas PKC and CKII phosphorylate multiple C-terminal serine residues, including Ser214, Ser257, Ser273, Ser290 and Ser299. Incubation of Rad with PKA decreases GTP binding by 60-70%, but this effect seems to be independent of phosphorylation, as it is observed with the Ser273-->Ala mutant of Rad containing a mutation at the site of PKA phosphorylation. The remainder of the serine kinases have no effect on Rad GTP binding, intrinsic GTP hydrolysis or GTP hydrolysis stimulated by the putative tumour metastasis suppressor nm23. However, phosphorylation of Rad by PKC and CKII abolishes the interaction of Rad with calmodulin. These findings suggest that the binding of Rad to calmodulin, as well as its ability to bind GTP, might be regulated by the activation of several serine kinases. PMID:9677319

  13. The exocyst and regulatory GTPases in urinary exosomes.

    PubMed

    Chacon-Heszele, Maria F; Choi, Soo Young; Zuo, Xiaofeng; Baek, Jeong-In; Ward, Chris; Lipschutz, Joshua H

    2014-08-01

    Cilia, organelles that function as cellular antennae, are central to the pathogenesis of "ciliopathies", including various forms of polycystic kidney disease (PKD). To date, however, the molecular mechanisms controlling ciliogenesis and ciliary function remain incompletely understood. A recently proposed model of cell-cell communication, called "urocrine signaling", hypothesizes that a subset of membrane bound vesicles that are secreted into the urinary stream (termed exosome-like vesicles, or ELVs), carry cilia-specific proteins as cargo, interact with primary cilia, and affect downstream cellular functions. This study was undertaken to determine the role of the exocyst, a highly conserved eight-protein trafficking complex, in the secretion and/or retrieval of ELVs. We used Madin-Darby canine kidney (MDCK) cells expressing either Sec10-myc (a central component of the exocyst complex) or Smoothened-YFP (a ciliary protein found in ELVs) in experiments utilizing electron gold microscopy and live fluorescent microscopy, respectively. Additionally, human urinary exosomes were isolated via ultracentrifugation and subjected to mass-spectrometry-based proteomics analysis to determine the composition of ELVs. We found, as determined by EM, that the exocyst localizes to primary cilia, and is present in vesicles attached to the cilium. Furthermore, the entire exocyst complex, as well as most of its known regulatory GTPases, are present in human urinary ELVs. Finally, in living MDCK cells, ELVs appear to interact with primary cilia using spinning disc confocal microscopy. These data suggest that the exocyst complex, in addition to its role in ciliogenesis, is centrally involved in the secretion and/or retrieval of urinary ELVs. PMID:25138791

  14. Specific Conformational States of Ras GTPase upon Effector Binding

    PubMed Central

    2012-01-01

    To uncover the structural and dynamical determinants involved in the highly specific binding of Ras GTPase to its effectors, the conformational states of Ras in uncomplexed form and complexed to the downstream effectors Byr2, PI3Kγ, PLCε, and RalGDS were investigated using molecular dynamics and cross-comparison of the trajectories. The subtle changes in the dynamics and conformations of Ras upon effector binding require an analysis that targets local changes independent of global motions. Using a structural alphabet, a computational procedure is proposed to quantify local conformational changes. Positions detected by this approach were characterized as either specific for a particular effector, specific for an effector domain type, or as effector unspecific. A set of nine structurally connected residues (Ras residues 5–8, 32–35, 39–42, 55–59, 73–78, and 161–165), which link the effector binding site to the distant C-terminus, changed dynamics upon effector binding, indicating a potential effector-unspecific signaling route within the Ras structure. Additional conformational changes were detected along the N-terminus of the central β-sheet. Besides the Ras residues at the effector interface (e.g., D33, E37, D38, and Y40), which adopt effector-specific local conformations, the binding signal propagates from the interface to distant hot-spot residues, in particular to Y5 and D57. The results of this study reveal possible conformational mechanisms for the stabilization of the active state of Ras upon downstream effector binding and for the structural determinants responsible for effector specificity. PMID:23316125

  15. The exocyst and regulatory GTPases in urinary exosomes

    PubMed Central

    Chacon‐Heszele, Maria F.; Choi, Soo Young; Zuo, Xiaofeng; Baek, Jeong‐In; Ward, Chris; Lipschutz, Joshua H.

    2014-01-01

    Abstract Cilia, organelles that function as cellular antennae, are central to the pathogenesis of “ciliopathies”, including various forms of polycystic kidney disease (PKD). To date, however, the molecular mechanisms controlling ciliogenesis and ciliary function remain incompletely understood. A recently proposed model of cell–cell communication, called “urocrine signaling”, hypothesizes that a subset of membrane bound vesicles that are secreted into the urinary stream (termed exosome‐like vesicles, or ELVs), carry cilia‐specific proteins as cargo, interact with primary cilia, and affect downstream cellular functions. This study was undertaken to determine the role of the exocyst, a highly conserved eight‐protein trafficking complex, in the secretion and/or retrieval of ELVs. We used Madin–Darby canine kidney (MDCK) cells expressing either Sec10‐myc (a central component of the exocyst complex) or Smoothened‐YFP (a ciliary protein found in ELVs) in experiments utilizing electron gold microscopy and live fluorescent microscopy, respectively. Additionally, human urinary exosomes were isolated via ultracentrifugation and subjected to mass‐spectrometry‐based proteomics analysis to determine the composition of ELVs. We found, as determined by EM, that the exocyst localizes to primary cilia, and is present in vesicles attached to the cilium. Furthermore, the entire exocyst complex, as well as most of its known regulatory GTPases, are present in human urinary ELVs. Finally, in living MDCK cells, ELVs appear to interact with primary cilia using spinning disc confocal microscopy. These data suggest that the exocyst complex, in addition to its role in ciliogenesis, is centrally involved in the secretion and/or retrieval of urinary ELVs. PMID:25138791

  16. Computer vision profiling of neurite outgrowth dynamics reveals spatiotemporal modularity of Rho GTPase signaling.

    PubMed

    Fusco, Ludovico; Lefort, Riwal; Smith, Kevin; Benmansour, Fethallah; Gonzalez, German; Barillari, Caterina; Rinn, Bernd; Fleuret, Francois; Fua, Pascal; Pertz, Olivier

    2016-01-01

    Rho guanosine triphosphatases (GTPases) control the cytoskeletal dynamics that power neurite outgrowth. This process consists of dynamic neurite initiation, elongation, retraction, and branching cycles that are likely to be regulated by specific spatiotemporal signaling networks, which cannot be resolved with static, steady-state assays. We present NeuriteTracker, a computer-vision approach to automatically segment and track neuronal morphodynamics in time-lapse datasets. Feature extraction then quantifies dynamic neurite outgrowth phenotypes. We identify a set of stereotypic neurite outgrowth morphodynamic behaviors in a cultured neuronal cell system. Systematic RNA interference perturbation of a Rho GTPase interactome consisting of 219 proteins reveals a limited set of morphodynamic phenotypes. As proof of concept, we show that loss of function of two distinct RhoA-specific GTPase-activating proteins (GAPs) leads to opposite neurite outgrowth phenotypes. Imaging of RhoA activation dynamics indicates that both GAPs regulate different spatiotemporal Rho GTPase pools, with distinct functions. Our results provide a starting point to dissect spatiotemporal Rho GTPase signaling networks that regulate neurite outgrowth. PMID:26728857

  17. G2385R and I2020T Mutations Increase LRRK2 GTPase Activity

    PubMed Central

    Jang, Jihoon; Joe, Eun-hye; Son, Ilhong; Seol, Wongi

    2016-01-01

    The LRRK2 mutation is a major causal mutation in familial Parkinson's disease. Although LRRK2 contains functional GTPase and kinase domains and their activities are altered by pathogenic mutations, most studies focused on LRRK2 kinase activity because the most prevalent mutant, G2019S, enhances kinase activity. However, the G2019S mutation is extremely rare in the Asian population. Instead, the G2385R mutation was reported as a major risk factor in the Asian population. Similar to other LRRK2 studies, G2385R studies have also focused on kinase activity. Here, we investigated GTPase activities of G2385R with other LRRK2 mutants, such as G2019S, R1441C, and I2020T, as well as wild type (WT). Our results suggest that both I2020T and G2385R contain GTPase activities stronger than that of WT. A kinase assay using the commercial recombinant proteins showed that I2020T harbored stronger activity, whereas G2385R had weaker activity than that of WT, as reported previously. This is the first report of LRRK2 I2020T and G2385R GTPase activities and shows that most of the LRRK2 mutations that are pathogenic or a risk factor altered either kinase or GTPase activity, suggesting that their physiological consequences are caused by altered enzyme activities. PMID:27314038

  18. Elevated Intraocular Pressure Induces Rho GTPase Mediated Contractile Signaling in the Trabecular Meshwork

    PubMed Central

    Pattabiraman, Padmanabhan P; Inoue, Toshihiro; Rao, P. Vasantha

    2015-01-01

    Rho GTPase regulated contractile signaling in the trabecular meshwork (TM) has been shown to modulate aqueous humor (AH) outflow and intraocular pressure (IOP). To explore whether elevated IOP, a major risk factor for primary open angle glaucoma (POAG) influences Rho GTPase signaling in the TM, we recorded AH outflow in enucleated contralateral porcine eyes perfused for 4–5 hours at either 15 mm or 50 mm Hg pressure. After perfusion, TM tissue extracted from perfused eyes was evaluated for the activation status of Rho GTPase, myosin light chain (MLC), myosin phosphatase target substrate 1 (MYPT1), myristoylated alanine-rich C-kinase substrate (MARCKS) and paxillin. Eyes perfused at 50 mm Hg exhibited a significant decrease in AH outflow facility compared with those perfused at 15 mm Hg. Additionally, TM tissue from eyes perfused at 50 mm Hg revealed significantly increased levels of activated RhoA and phosphorylated MLC, MYPT1, MARCKS and paxillin compared to TM tissue derived from eyes perfused at 15 mm Hg. Taken together, these observations indicate that elevated IOP-induced activation of Rho GTPase-dependent contractile signaling in the TM is associated with increased resistance to AH outflow through the trabecular pathway, and demonstrate the sensitivity of Rho GTPase signaling to mechanical force in the AH outflow pathway. PMID:25956210

  19. Dynamin GTPase Regulation is Altered by PH Domain Mutations Found in Centronuclear Myopathy Patients

    SciTech Connect

    Kenniston, J.; Lemmon, M

    2010-01-01

    The large GTPase dynamin has an important membrane scission function in receptor-mediated endocytosis and other cellular processes. Self-assembly on phosphoinositide-containing membranes stimulates dynamin GTPase activity, which is crucial for its function. Although the pleckstrin-homology (PH) domain is known to mediate phosphoinositide binding by dynamin, it remains unclear how this promotes activation. Here, we describe studies of dynamin PH domain mutations found in centronuclear myopathy (CNM) that increase dynamin's GTPase activity without altering phosphoinositide binding. CNM mutations in the PH domain C-terminal {alpha}-helix appear to cause conformational changes in dynamin that alter control of the GTP hydrolysis cycle. These mutations either 'sensitize' dynamin to lipid stimulation or elevate basal GTPase rates by promoting self-assembly and thus rendering dynamin no longer lipid responsive. We also describe a low-resolution structure of dimeric dynamin from small-angle X-ray scattering that reveals conformational changes induced by CNM mutations, and defines requirements for domain rearrangement upon dynamin self-assembly at membrane surfaces. Our data suggest that changes in the PH domain may couple lipid binding to dynamin GTPase activation at sites of vesicle invagination.

  20. A pull-down procedure for the identification of unknown GEFs for small GTPases

    PubMed Central

    Koch, Daniel; Rai, Amrita; Ali, Imtiaz; Bleimling, Nathalie; Friese, Timon; Brockmeyer, Andreas; Janning, Petra; Goud, Bruno; Itzen, Aymelt; Müller, Matthias P.; Goody, Roger S.

    2016-01-01

    ABSTRACT Members of the family of small GTPases regulate a variety of important cellular functions. In order to accomplish this, tight temporal and spatial regulation is absolutely necessary. The two most important factors for this regulation are GTPase activating proteins (GAPs) and guanine nucleotide exchange factors (GEFs), the latter being responsible for the activation of the GTPase downstream pathways at the correct location and time. Although a large number of exchange factors have been identified, it is likely that a similarly large number remains unidentified. We have therefore developed a procedure to specifically enrich GEF proteins from biological samples making use of the high affinity binding of GEFs to nucleotide-free GTPases. In order to verify the results of these pull-down experiments, we have additionally developed two simple validation procedures: An in vitro transcription/translation system coupled with a GEF activity assay and a yeast two-hybrid screen for detection of GEFs. Although the procedures were established and tested using the Rab protein Sec4, the similar basic principle of action of all nucleotide exchange factors will allow the method to be used for identification of unknown GEFs of small GTPases in general. PMID:26918858

  1. Therapeutic effects of the Rho GTPase modulator CNF1 in a model of Parkinson's disease.

    PubMed

    Musilli, Marco; Ciotti, Maria Teresa; Pieri, Massimo; Martino, Assunta; Borrelli, Sonia; Dinallo, Vincenzo; Diana, Giovanni

    2016-10-01

    Recent evidence suggests an early involvement of dopaminergic (DA) processes and terminals in Parkinson's disease (PD). The arborization of neurons depends on the actin cytoskeleton, which in turn is regulated by small GTPases of the Rho family, encompassing Rho, Rac and Cdc42 subfamilies. Indeed, some reports point to a role for Rac and Cdc42 signaling in the pathophysiology of inherited parkinsonisms. We thus investigated the potential therapeutic effect of the modulation of cerebral Rho GTPases in PD. Cytotoxic necrotizing factor 1 (CNF1), a 114 kDa protein toxin produced by Escherichia coli, permanently activates RhoA, Rac1 and Cdc42 in intact cells. We report that the modulation of Rho GTPases by CNF1 results in hypertrophy of DA cell processes of cultured substantia nigra neurons, including increase in length, branching and varicosity. In vivo, the treatment corrects long-standing motor and biochemical asymmetries and restores degenerated nigrostriatal DA tissue after 6-hydroxydopamine lesion. We conclude that the pharmacological modulation of Rho GTPases shows neurorestorative potential and represents a promising avenue in the treatment PD. The study also suggests that naturally occurring molecules acting on Rho GTPase signaling, such as some bacterial protein toxins, might play a role in the development of PD. PMID:27350290

  2. Computer vision profiling of neurite outgrowth dynamics reveals spatiotemporal modularity of Rho GTPase signaling

    PubMed Central

    Fusco, Ludovico; Lefort, Riwal; Smith, Kevin; Benmansour, Fethallah; Gonzalez, German; Barillari, Caterina; Rinn, Bernd; Fleuret, Francois; Fua, Pascal

    2016-01-01

    Rho guanosine triphosphatases (GTPases) control the cytoskeletal dynamics that power neurite outgrowth. This process consists of dynamic neurite initiation, elongation, retraction, and branching cycles that are likely to be regulated by specific spatiotemporal signaling networks, which cannot be resolved with static, steady-state assays. We present NeuriteTracker, a computer-vision approach to automatically segment and track neuronal morphodynamics in time-lapse datasets. Feature extraction then quantifies dynamic neurite outgrowth phenotypes. We identify a set of stereotypic neurite outgrowth morphodynamic behaviors in a cultured neuronal cell system. Systematic RNA interference perturbation of a Rho GTPase interactome consisting of 219 proteins reveals a limited set of morphodynamic phenotypes. As proof of concept, we show that loss of function of two distinct RhoA-specific GTPase-activating proteins (GAPs) leads to opposite neurite outgrowth phenotypes. Imaging of RhoA activation dynamics indicates that both GAPs regulate different spatiotemporal Rho GTPase pools, with distinct functions. Our results provide a starting point to dissect spatiotemporal Rho GTPase signaling networks that regulate neurite outgrowth. PMID:26728857

  3. Interferon-inducible GTPase: a novel viral response protein involved in rabies virus infection.

    PubMed

    Li, Ling; Wang, Hualei; Jin, Hongli; Cao, Zengguo; Feng, Na; Zhao, Yongkun; Zheng, Xuexing; Wang, Jianzhong; Li, Qian; Zhao, Guoxing; Yan, Feihu; Wang, Lina; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Yang, Songtao; Xia, Xianzhu

    2016-05-01

    Rabies virus infection is a major public health concern because of its wide host-interference spectrum and nearly 100 % lethality. However, the interactions between host and virus remain unclear. To decipher the authentic response in the central nervous system after rabies virus infection, a dynamic analysis of brain proteome alteration was performed. In this study, 104 significantly differentially expressed proteins were identified, and intermediate filament, interferon-inducible GTPases, and leucine-rich repeat-containing protein 16C were the three outstanding groups among these proteins. Interferon-inducible GTPases were prominent because of their strong upregulation. Moreover, quantitative real-time PCR showed distinct upregulation of interferon-inducible GTPases at the level of transcription. Several studies have shown that interferon-inducible GTPases are involved in many biological processes, such as viral infection, endoplasmic reticulum stress response, and autophagy. These findings indicate that interferon-inducible GTPases are likely to be a potential target involved in rabies pathogenesis or the antiviral process. PMID:26906695

  4. Rab35 GTPase couples cell division with initiation of epithelial apico-basal polarity and lumen opening

    PubMed Central

    Klinkert, Kerstin; Rocancourt, Murielle; Houdusse, Anne; Echard, Arnaud

    2016-01-01

    Establishment and maintenance of apico-basal polarity in epithelial organs must be tightly coupled with cell division, but the underlying molecular mechanisms are largely unknown. Using 3D cultures of renal MDCK cells (cysts), we found that the Rab35 GTPase plays a crucial role in polarity initiation and apical lumen positioning during the first cell division of cyst development. At the molecular level, Rab35 physically couples cytokinesis with the initiation of apico-basal polarity by tethering intracellular vesicles containing key apical determinants at the cleavage site. These vesicles transport aPKC, Cdc42, Crumbs3 and the lumen-promoting factor Podocalyxin, and are tethered through a direct interaction between Rab35 and the cytoplasmic tail of Podocalyxin. Consequently, Rab35 inactivation leads to complete inversion of apico-basal polarity in 3D cysts. This novel and unconventional mode of Rab-dependent vesicle targeting provides a simple mechanism for triggering both initiation of apico-basal polarity and lumen opening at the centre of cysts. PMID:27040773

  5. Rab35 GTPase couples cell division with initiation of epithelial apico-basal polarity and lumen opening.

    PubMed

    Klinkert, Kerstin; Rocancourt, Murielle; Houdusse, Anne; Echard, Arnaud

    2016-01-01

    Establishment and maintenance of apico-basal polarity in epithelial organs must be tightly coupled with cell division, but the underlying molecular mechanisms are largely unknown. Using 3D cultures of renal MDCK cells (cysts), we found that the Rab35 GTPase plays a crucial role in polarity initiation and apical lumen positioning during the first cell division of cyst development. At the molecular level, Rab35 physically couples cytokinesis with the initiation of apico-basal polarity by tethering intracellular vesicles containing key apical determinants at the cleavage site. These vesicles transport aPKC, Cdc42, Crumbs3 and the lumen-promoting factor Podocalyxin, and are tethered through a direct interaction between Rab35 and the cytoplasmic tail of Podocalyxin. Consequently, Rab35 inactivation leads to complete inversion of apico-basal polarity in 3D cysts. This novel and unconventional mode of Rab-dependent vesicle targeting provides a simple mechanism for triggering both initiation of apico-basal polarity and lumen opening at the centre of cysts. PMID:27040773

  6. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  7. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  8. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  9. SPOT4 Management Centre

    NASA Technical Reports Server (NTRS)

    Labrune, Yves; Labbe, X.; Roussel, A.; Vielcanet, P.

    1994-01-01

    In the context of the CNES SPOT4 program CISI is particularly responsible for the development of the SPOT4 Management Centre, part of the SPOT4 ground control system located at CNES Toulouse (France) designed to provide simultaneous control over two satellites. The main operational activities are timed to synchronize with satellite visibilities (ten usable passes per day). The automatic capability of this system is achieved through agenda services (sequence of operations as defined and planned by operator). Therefore, the SPOT4 Management Centre offers limited, efficient and secure human interventions for supervision and decision making. This paper emphasizes the main system characteristics as degree of automation, level of dependability and system parameterization.

  10. Elderly Care Centre

    NASA Astrophysics Data System (ADS)

    Wagiman, Aliani; Haja Bava Mohidin, Hazrina; Ismail, Alice Sabrina

    2016-02-01

    The demand for elderly centre has increased tremendously abreast with the world demographic change as the number of senior citizens rose in the 21st century. This has become one of the most crucial problems of today's era. As the world progress into modernity, more and more people are occupied with daily work causing the senior citizens to lose the care that they actually need. This paper seeks to elucidate the best possible design of an elderly care centre with new approach in order to provide the best service for them by analysing their needs and suitable activities that could elevate their quality of life. All these findings will then be incorporated into design solutions so as to enhance the living environment for the elderly especially in Malaysian context.

  11. SPOT4 Management Centre

    NASA Astrophysics Data System (ADS)

    Labrune, Yves; Labbe, X.; Roussel, A.; Vielcanet, P.

    1994-11-01

    In the context of the CNES SPOT4 program CISI is particularly responsible for the development of the SPOT4 Management Centre, part of the SPOT4 ground control system located at CNES Toulouse (France) designed to provide simultaneous control over two satellites. The main operational activities are timed to synchronize with satellite visibilities (ten usable passes per day). The automatic capability of this system is achieved through agenda services (sequence of operations as defined and planned by operator). Therefore, the SPOT4 Management Centre offers limited, efficient and secure human interventions for supervision and decision making. This paper emphasizes the main system characteristics as degree of automation, level of dependability and system parameterization.

  12. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  13. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  14. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  15. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  16. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  17. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  18. RhoGTPases as Key Players in Mammalian Cell Adaptation to Microgravity

    PubMed Central

    Deroanne, Christophe; Nusgens, Betty; Vico, Laurence; Guignandon, Alain

    2015-01-01

    A growing number of studies are revealing that cells reorganize their cytoskeleton when exposed to conditions of microgravity. Most, if not all, of the structural changes observed on flown cells can be explained by modulation of RhoGTPases, which are mechanosensitive switches responsible for cytoskeletal dynamics control. This review identifies general principles defining cell sensitivity to gravitational stresses. We discuss what is known about changes in cell shape, nucleus, and focal adhesions and try to establish the relationship with specific RhoGTPase activities. We conclude by considering the potential relevance of live imaging of RhoGTPase activity or cytoskeletal structures in order to enhance our understanding of cell adaptation to microgravity-related conditions. PMID:25649831

  19. Invited review: MnmE, a GTPase that drives a complex tRNA modification reaction.

    PubMed

    Fislage, Marcus; Wauters, Lina; Versées, Wim

    2016-08-01

    MnmE is a multi-domain GTPase that is conserved from bacteria to man. Together with its partner protein MnmG it is involved in the synthesis of a tRNA wobble uridine modification. The orthologues of these proteins in eukaryotes are targeted to mitochondria and mutations in the encoding genes are associated with severe mitochondrial diseases. While classical small GTP-binding proteins are regulated via auxiliary GEFs and GAPs, the GTPase activity of MnmE is activated via potassium-dependent homodimerization of its G domains. In this review we focus on the catalytic mechanism of GTP hydrolysis by MnmE and the large scale conformational changes that are triggered throughout the GTPase cycle. We also discuss how these conformational changes might be used to drive and tune the complex tRNA modification reaction. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 568-579, 2016. PMID:26832457

  20. Site–Specific Monoubiquitination Activates Ras by Impeding GTPase Activating Protein Function

    PubMed Central

    Baker, Rachael; Lewis, Steven M.; Sasaki, Atsuo T.; Wilkerson, Emily M.; Locasale, Jason W.; Cantley, Lewis C.; Kuhlman, Brian; Dohlman, Henrik G.; Campbell, Sharon L.

    2012-01-01

    SUMMARY Cell growth and differentiation are controlled by growth factor receptors coupled to the GTPase Ras. Oncogenic mutations disrupt GTPase activity leading to persistent Ras signaling and cancer progression. Recent evidence indicates that monoubiquitination of Ras leads to Ras activation. Mutation of the primary site of monoubiquitination impairs the ability of activated K–Ras to promote tumor growth. To determine the mechanism of human Ras activation we chemically ubiquitinated the protein and analyzed its function by NMR, computational modeling, and biochemical activity measurements. We established that monoubiquitination has little effect on Ras GTP binding, GTP hydrolysis, or exchange factor activation, but severely abrogates the response to GTPase activating proteins in a site–specific manner. These findings reveal a new mechanism by which Ras can trigger persistent signaling in the absence of receptor activation or an oncogenic mutation. PMID:23178454

  1. Detection Of Ras GTPase Protein Radicals Through Immuno-Spin Trapping*

    PubMed Central

    Davis, Michael F.; Zhou, Li; Ehrenshaft, Marilyn; Ranguelova, Kalina; Gunawardena, Harsha P.; Chen, Xian; Bonini, Marcelo; Mason, Ronald P.; Campbell, Sharon L.

    2012-01-01

    Over the past decade immuno-spin trapping (IST) has been used to detect and identify protein radical sites in numerous heme and metalloproteins. To date, however, the technique has had little application toward non-metalloproteins. In this study, we demonstrate the successful application of IST in a system free of transition metals and present the first conclusive evidence of ·NO-mediated protein radical formation in the HRas GTPase. HRas is a non-metalloprotein that plays a critical role in regulating cell growth control. Protein radical formation in Ras GTPases has long been suspected of initiating premature release of bound guanine nucleotide. This action results in altered Ras activity both in vitro and in vivo. As described herein, successful application of IST may provide a means for detecting and identifying radical-mediated Ras activation in many different cancers and disease states where Ras GTPases play an important role. PMID:22819983

  2. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  3. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  4. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  5. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  6. Can Chemistry Teachers' Centres Survive?

    ERIC Educational Resources Information Center

    Garforth, F. M.

    1972-01-01

    The difficulties faced by the Hull Chemistry Teachers' Centre in England are discussed. The lack of finances and time, as well as organizational difficulties in relationship with Science Centres and universities are among the problems. (TS)

  7. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  8. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  9. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  10. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  11. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  12. Hyphal Guidance and Invasive Growth in Candida albicans Require the Ras-Like GTPase Rsr1p and Its GTPase-Activating Protein Bud2p

    PubMed Central

    Hausauer, Danielle L.; Gerami-Nejad, Maryam; Kistler-Anderson, Cassandra; Gale, Cheryl A.

    2005-01-01

    Candida albicans, the most prevalent fungal pathogen of humans, causes superficial mycoses, invasive mucosal infections, and disseminated systemic disease. Many studies have shown an intriguing association between C. albicans morphogenesis and the pathogenesis process. For example, hyphal cells have been observed to penetrate host epithelial cells at sites of wounds and between cell junctions. Ras- and Rho-type GTPases regulate many morphogenetic processes in eukaryotes, including polarity establishment, cell proliferation, and directed growth in response to extracellular stimuli. We found that the C. albicans Ras-like GTPase Rsr1p and its predicted GTPase-activating protein Bud2p localized to the cell cortex, at sites of incipient daughter cell growth, and provided landmarks for the positioning of daughter yeast cells and hyphal cell branches, similar to the paradigm in the model yeast Saccharomyces cerevisiae. However, in contrast to S. cerevisiae, CaRsr1p and CaBud2p were important for morphogenesis: C. albicans strains lacking Rsr1p or Bud2p had abnormal yeast and hyphal cell shapes and frequent bends and promiscuous branching along the hypha and were unable to invade agar. These defects were associated with abnormal actin patch polarization, unstable polarisome localization at hyphal tips, and mislocalized septin rings, consistent with the idea that GTP cycling of Rsr1p stabilizes the axis of polarity primarily to a single focus, thus ensuring normal cell shape and a focused direction of polarized growth. We conclude that the Rsr1p GTPase functions as a polarity landmark for hyphal guidance and may be an important mediator of extracellular signals during processes such as host invasion. PMID:16002653

  13. Role of Nucleotide Binding and GTPase Domain Dimerization in Dynamin-like Myxovirus Resistance Protein A for GTPase Activation and Antiviral Activity*

    PubMed Central

    Dick, Alexej; Graf, Laura; Olal, Daniel; von der Malsburg, Alexander; Gao, Song; Kochs, Georg; Daumke, Oliver

    2015-01-01

    Myxovirus resistance (Mx) GTPases are induced by interferon and inhibit multiple viruses, including influenza and human immunodeficiency viruses. They have the characteristic domain architecture of dynamin-related proteins with an N-terminal GTPase (G) domain, a bundle signaling element, and a C-terminal stalk responsible for self-assembly and effector functions. Human MxA (also called MX1) is expressed in the cytoplasm and is partly associated with membranes of the smooth endoplasmic reticulum. It shows a protein concentration-dependent increase in GTPase activity, indicating regulation of GTP hydrolysis via G domain dimerization. Here, we characterized a panel of G domain mutants in MxA to clarify the role of GTP binding and the importance of the G domain interface for the catalytic and antiviral function of MxA. Residues in the catalytic center of MxA and the nucleotide itself were essential for G domain dimerization and catalytic activation. In pulldown experiments, MxA recognized Thogoto virus nucleocapsid proteins independently of nucleotide binding. However, both nucleotide binding and hydrolysis were required for the antiviral activity against Thogoto, influenza, and La Crosse viruses. We further demonstrate that GTP binding facilitates formation of stable MxA assemblies associated with endoplasmic reticulum membranes, whereas nucleotide hydrolysis promotes dynamic redistribution of MxA from cellular membranes to viral targets. Our study highlights the role of nucleotide binding and hydrolysis for the intracellular dynamics of MxA during its antiviral action. PMID:25829498

  14. Role of nucleotide binding and GTPase domain dimerization in dynamin-like myxovirus resistance protein A for GTPase activation and antiviral activity.

    PubMed

    Dick, Alexej; Graf, Laura; Olal, Daniel; von der Malsburg, Alexander; Gao, Song; Kochs, Georg; Daumke, Oliver

    2015-05-15

    Myxovirus resistance (Mx) GTPases are induced by interferon and inhibit multiple viruses, including influenza and human immunodeficiency viruses. They have the characteristic domain architecture of dynamin-related proteins with an N-terminal GTPase (G) domain, a bundle signaling element, and a C-terminal stalk responsible for self-assembly and effector functions. Human MxA (also called MX1) is expressed in the cytoplasm and is partly associated with membranes of the smooth endoplasmic reticulum. It shows a protein concentration-dependent increase in GTPase activity, indicating regulation of GTP hydrolysis via G domain dimerization. Here, we characterized a panel of G domain mutants in MxA to clarify the role of GTP binding and the importance of the G domain interface for the catalytic and antiviral function of MxA. Residues in the catalytic center of MxA and the nucleotide itself were essential for G domain dimerization and catalytic activation. In pulldown experiments, MxA recognized Thogoto virus nucleocapsid proteins independently of nucleotide binding. However, both nucleotide binding and hydrolysis were required for the antiviral activity against Thogoto, influenza, and La Crosse viruses. We further demonstrate that GTP binding facilitates formation of stable MxA assemblies associated with endoplasmic reticulum membranes, whereas nucleotide hydrolysis promotes dynamic redistribution of MxA from cellular membranes to viral targets. Our study highlights the role of nucleotide binding and hydrolysis for the intracellular dynamics of MxA during its antiviral action. PMID:25829498

  15. The RalB Small GTPase Mediates Formation of Invadopodia through a GTPase-Activating Protein-Independent Function of the RalBP1/RLIP76 Effector

    PubMed Central

    Neel, Nicole F.; Rossman, Kent L.; Martin, Timothy D.; Hayes, Tikvah K.; Yeh, Jen Jen

    2012-01-01

    Our recent studies implicated key and distinct roles for the highly related RalA and RalB small GTPases (82% sequence identity) in pancreatic ductal adenocarcinoma (PDAC) tumorigenesis and invasive and metastatic growth, respectively. How RalB may promote PDAC invasion and metastasis has not been determined. In light of known Ral effector functions in regulation of actin organization and secretion, we addressed a possible role for RalB in formation of invadopodia, actin-rich membrane protrusions that contribute to tissue invasion and matrix remodeling. We determined that a majority of KRAS mutant PDAC cell lines exhibited invadopodia and that expression of activated K-Ras is both necessary and sufficient for invadopodium formation. Invadopodium formation was not dependent on the canonical Raf-MEK-ERK effector pathway and was instead dependent on the Ral effector pathway. However, this process was more dependent on RalB than on RalA. Surprisingly, RalB-mediated invadopodium formation was dependent on RalBP1/RLIP76 but not Sec5 and Exo84 exocyst effector function. Unexpectedly, the requirement for RalBP1 was independent of its best known function as a GTPase-activating protein for Rho small GTPases. Instead, disruption of the ATPase function of RalBP1 impaired invadopodium formation. Our results identify a novel RalB-mediated biochemical and signaling mechanism for invadopodium formation. PMID:22331470

  16. The DESY Grid Centre

    NASA Astrophysics Data System (ADS)

    Haupt, A.; Gellrich, A.; Kemp, Y.; Leffhalm, K.; Ozerov, D.; Wegner, P.

    2012-12-01

    DESY is one of the world-wide leading centers for research with particle accelerators, synchrotron light and astroparticles. DESY participates in LHC as a Tier-2 center, supports on-going analyzes of HERA data, is a leading partner for ILC, and runs the National Analysis Facility (NAF) for LHC and ILC in the framework of the Helmholtz Alliance, Physics at the Terascale. For the research with synchrotron light major new facilities are operated and built (FLASH, PETRA-III, and XFEL). DESY furthermore acts as Data-Tier1 centre for the Neutrino detector IceCube. Established within the EGI-project DESY operates a grid infrastructure which supports a number of virtual Organizations (VO), incl. ATLAS, CMS, and LHCb. Furthermore, DESY hosts some of HEP and non-HEP VOs, such as the HERA experiments and ILC as well as photon science communities. The support of the new astroparticle physics VOs IceCube and CTA is currently set up. As the global structure of the grid offers huge resources which are perfect for batch-like computing, DESY has set up the National Analysis Facility (NAF) which complements the grid to allow German HEP users for efficient data analysis. The grid infrastructure and the NAF use the same physics data which is distributed via the grid. We call the conjunction of grid and NAF the DESY Grid Centre. In the contribution to CHEP2012 we will in depth discuss the conceptional and operational aspects of our multi-VO and multi-community Grid Centre and present the system setup. We will in particular focus on the interplay of Grid and NAF and present experiences of the operations.

  17. Synthesis of fusogenic lipids through activation of phospholipase D1 by GTPases and the kinase RSK2 is required for calcium-regulated exocytosis in neuroendocrine cells.

    PubMed

    Vitale, Nicolas

    2010-02-01

    Exocytosis of hormones occurs through the fusion of large dense-core secretory vesicles with the plasma membrane. This highly regulated process involves key proteins such as SNAREs (soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors) and also specific lipids at the site of membrane fusion. Among the different lipids required for exocytosis, our recent observations have highlighted the crucial role of PA (phosphatidic acid) in the late stages of membrane fusion in various exocytotic events. An RNAi (RNA interference) strategy coupled with the detection of PA in living cells has pointed to plasma membrane-associated PLD1 (phospholipase D(1)) as the main producer of PA in response to secretagogue stimulation. We have identified several GTPases which regulate the activation level of PLD(1) in neuroendocrine cells. Finally, RSK2 (ribosomal S6 kinase 2) appears to phosphorylate and regulate the activity of PLD(1) in a calcium-dependent manner. Altogether our results have unravelled a complex set of regulatory pathways controlling the synthesis of fusogenic lipids at the secretory granule fusion site by PLD(1). PMID:20074053

  18. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  19. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  20. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  1. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  2. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  3. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  4. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  5. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  6. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  7. The Role of Rho GTPases in Toxicity of Clostridium difficile Toxins

    PubMed Central

    Chen, Shuyi; Sun, Chunli; Wang, Haiying; Wang, Jufang

    2015-01-01

    Clostridium difficile (C. difficile) is the main cause of antibiotic-associated diarrhea prevailing in hospital settings. In the past decade, the morbidity and mortality of C. difficile infection (CDI) has increased significantly due to the emergence of hypervirulent strains. Toxin A (TcdA) and toxin B (TcdB), the two exotoxins of C. difficile, are the major virulence factors of CDI. The common mode of action of TcdA and TcdB is elicited by specific glucosylation of Rho-GTPase proteins in the host cytosol using UDP-glucose as a co-substrate, resulting in the inactivation of Rho proteins. Rho proteins are the key members in many biological processes and signaling pathways, inactivation of which leads to cytopathic and cytotoxic effects and immune responses of the host cells. It is supposed that Rho GTPases play an important role in the toxicity of C. difficile toxins. This review focuses on recent progresses in the understanding of functional consequences of Rho GTPases glucosylation induced by C. difficile toxins and the role of Rho GTPases in the toxicity of TcdA and TcdB. PMID:26633511

  8. Rho GTPase Recognition by C3 Exoenzyme Based on C3-RhoA Complex Structure.

    PubMed

    Toda, Akiyuki; Tsurumura, Toshiharu; Yoshida, Toru; Tsumori, Yayoi; Tsuge, Hideaki

    2015-08-01

    C3 exoenzyme is a mono-ADP-ribosyltransferase (ART) that catalyzes transfer of an ADP-ribose moiety from NAD(+) to Rho GTPases. C3 has long been used to study the diverse regulatory functions of Rho GTPases. How C3 recognizes its substrate and how ADP-ribosylation proceeds are still poorly understood. Crystal structures of C3-RhoA complex reveal that C3 recognizes RhoA via the switch I, switch II, and interswitch regions. In C3-RhoA(GTP) and C3-RhoA(GDP), switch I and II adopt the GDP and GTP conformations, respectively, which explains why C3 can ADP-ribosylate both nucleotide forms. Based on structural information, we successfully changed Cdc42 to an active substrate with combined mutations in the C3-Rho GTPase interface. Moreover, the structure reflects the close relationship among Gln-183 in the QXE motif (C3), a modified Asn-41 residue (RhoA) and NC1 of NAD(H), which suggests that C3 is the prototype ART. These structures show directly for the first time that the ARTT loop is the key to target protein recognition, and they also serve to bridge the gaps among independent studies of Rho GTPases and C3. PMID:26067270

  9. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.

    2016-01-01

    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  10. ELMOD2 is an Arl2 GTPase-activating protein that also acts on Arfs.

    PubMed

    Bowzard, J Bradford; Cheng, Dongmei; Peng, Junmin; Kahn, Richard A

    2007-06-15

    Regulatory GTPases in the Ras superfamily employ a cycle of alternating GTP binding and hydrolysis, controlled by guanine nucleotide exchange factors and GTPase-activating proteins (GAPs), as essential features of their actions in cells. Studies of these GAPs and guanine nucleotide exchange factors have provided important insights into our understanding of GTPase signaling and biology. Within the Ras superfamily, the Arf family is composed of 30 members in mammals, including 22 Arf-like (Arl) proteins. Much less is known about the mechanisms of cell regulation by Arls than by Arfs. We report the purification from bovine testis of an Arl2 GAP and its identity as ELMOD2, a protein with no previously described function. ELMOD2 is one of six human proteins that contain an ELMO domain, and a second member, ELMOD1, was also found to have Arl2 GAP activity. Surprisingly, ELMOD2 also exhibited GAP activity against Arf proteins even though it does not contain the canonical Arf GAP sequence signature. The broader specificity of ELMOD2, as well as the previously described role for ELMO1 and ELMO2 in linking Arf6 and Rac1 signaling, suggests that ELMO family members may play a more general role in integrating signaling pathways controlled by Arls and other GTPases. PMID:17452337

  11. Mitochondrial Fusion in Yeast Requires the Transmembrane GTPase Fzo1p

    PubMed Central

    Hermann, Greg J.; Thatcher, John W.; Mills, John P.; Hales, Karen G.; Fuller, Margaret T.; Nunnari, Jodi; Shaw, Janet M.

    1998-01-01

    Membrane fusion is required to establish the morphology and cellular distribution of the mitochondrial compartment. In Drosophila, mutations in the fuzzy onions (fzo) GTPase block a developmentally regulated mitochondrial fusion event during spermatogenesis. Here we report that the yeast orthologue of fuzzy onions, Fzo1p, plays a direct and conserved role in mitochondrial fusion. A conditional fzo1 mutation causes the mitochondrial reticulum to fragment and blocks mitochondrial fusion during yeast mating. Fzo1p is a mitochondrial integral membrane protein with its GTPase domain exposed to the cytoplasm. Point mutations that alter conserved residues in the GTPase domain do not affect Fzo1p localization but disrupt mitochondrial fusion. Suborganellar fractionation suggests that Fzo1p spans the outer and is tightly associated with the inner mitochondrial membrane. This topology may be required to coordinate the behavior of the two mitochondrial membranes during the fusion reaction. We propose that the fuzzy onions family of transmembrane GTPases act as molecular switches to regulate a key step in mitochondrial membrane docking and/or fusion. PMID:9786948

  12. An ARF6/Rab35 GTPase cascade for endocytic recycling and successful cytokinesis.

    PubMed

    Chesneau, Laurent; Dambournet, Daphné; Machicoane, Mickaël; Kouranti, Ilektra; Fukuda, Mitsunori; Goud, Bruno; Echard, Arnaud

    2012-01-24

    Cytokinesis bridge instability leads to binucleated cells that can promote tumorigenesis in vivo. Membrane trafficking is crucial for animal cell cytokinesis, and several endocytic pathways regulated by distinct GTPases (Rab11, Rab21, Rab35, ARF6, RalA/B) contribute to the postfurrowing steps of cytokinesis. However, little is known about how these pathways are coordinated for successful cytokinesis. The Rab35 GTPase controls a fast endocytic recycling pathway and must be activated for SEPTIN cytoskeleton localization at the intercellular bridge, and thus for completion of cytokinesis. Here, we report that the ARF6 GTPase negatively regulates Rab35 activation and hence the Rab35 pathway. Human cells expressing a constitutively activated, GTP-bound ARF6 mutant display identical endocytic recycling and cytokinesis defects as those observed upon overexpression of the inactivated, GDP-bound Rab35 mutant. As a molecular mechanism, we identified the Rab35 GAP EPI64B as an effector of ARF6 in negatively regulating Rab35 activation. Unexpectedly, this regulation takes place at clathrin-coated pits, and activated ARF6 reduces Rab35 loading into the endocytic pathway. Thus, an effector of an ARF protein is a GAP for a downstream Rab protein, and we propose that this hierarchical ARF/Rab GTPase cascade controls the proper activation of a common endocytic pathway essential for cytokinesis. PMID:22226746

  13. Rho guanine nucleotide exchange factors: regulators of Rho GTPase activity in development and disease

    PubMed Central

    Cook, Danielle R.; Rossman, Kent L.; Der, Channing J.

    2016-01-01

    The aberrant activity of Ras homologous (Rho) family small GTPases (20 human members) has been implicated in cancer and other human diseases. However, in contrast to the direct mutational activation of Ras found in cancer and developmental disorders, Rho GTPases are activated most commonly by indirect mechanisms in disease. One prevalent mechanism involves aberrant Rho activation via the deregulated expression and/or activity of Rho family guanine nucleotide exchange factors (RhoGEFs). RhoGEFs promote formation of the active GTP-bound state of Rho GTPases. The largest family of RhoGEFs is comprised of the Dbl family RhoGEFs with 70 human members. The multitude of RhoGEFs that activate a single Rho GTPase reflect the very specific role of each RhoGEF in controlling distinct signaling mechanisms involved in Rho activation. In this review, we summarize the role of Dbl RhoGEFs in development and disease, with a focus on Ect2, Tiam1, Vav and P-Rex1/2. PMID:24037532

  14. Small GTPases and Stress Responses of vvran1 in the Straw Mushroom Volvariella volvacea.

    PubMed

    Yan, Jun-Jie; Xie, Bin; Zhang, Lei; Li, Shao-Jie; van Peer, Arend F; Wu, Ta-Ju; Chen, Bing-Zhi; Xie, Bao-Gui

    2016-01-01

    Small GTPases play important roles in the growth, development and environmental responses of eukaryotes. Based on the genomic sequence of the straw mushroom Volvariella volvacea, 44 small GTPases were identified. A clustering analysis using human small GTPases as the references revealed that V. volvacea small GTPases can be grouped into five families: nine are in the Ras family, 10 are in the Rho family, 15 are in the Rab family, one is in the Ran family and nine are in the Arf family. The transcription of vvran1 was up-regulated upon hydrogen peroxide (H₂O₂) stress, and could be repressed by diphenyleneiodonium chloride (DPI), a NADPH oxidase-specific inhibitor. The number of vvran1 transcripts also increased upon cold stress. Diphenyleneiodonium chloride, but not the superoxide dismutase (SOD) inhibitor diethy dithiocarbamate (DDC), could suppress the up-regulation of vvran1 gene expression to cold stress. These results combined with the high correlations between gene expression and superoxide anion (O₂(-)) generation indicated that vvran1 could be one of the candidate genes in the downstream of O₂(-) mediated pathways that are generated by NADPH oxidase under low temperature and oxidative stresses. PMID:27626406

  15. A C-terminal domain of GAP is sufficient to stimulate ras p21 GTPase activity.

    PubMed Central

    Marshall, M S; Hill, W S; Ng, A S; Vogel, U S; Schaber, M D; Scolnick, E M; Dixon, R A; Sigal, I S; Gibbs, J B

    1989-01-01

    The cDNA for bovine ras p21 GTPase activating protein (GAP) has been cloned and the 1044 amino acid polypeptide encoded by the clone has been shown to bind the GTP complexes of both normal and oncogenic Harvey (Ha) ras p21. To identify the regions of GAP critical for the catalytic stimulation of ras p21 GTPase activity, a series of truncated forms of GAP protein were expressed in Escherichia coli. The C-terminal 343 amino acids of GAP (residues 702-1044) were observed to bind Ha ras p21-GTP and stimulate Ha ras p21 GTPase activity with the same efficiency (kcat/KM congruent to 1 x 10(6) M-1 s-1 at 24 degrees C) as GAP purified from bovine brain or full-length GAP expressed in E. coli. Deletion of the final 61 amino acid residues of GAP (residues 986-1044) rendered the protein insoluble upon expression in E. coli. These results define a distinct catalytic domain at the C terminus of GAP. In addition, GAP contains amino acid similarity with the B and C box domains conserved among phospholipase C-II, the crk oncogene product, and the non-receptor tyrosine kinase oncogene products. This homologous region is located in the N-terminal half of GAP outside of the catalytic domain that stimulates ras p21 GTPase activity and may constitute a distinct structural or functional domain within the GAP protein. Images PMID:2545441

  16. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  17. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  18. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  19. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  20. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  1. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  2. Analysis of a minimal Rho-GTPase circuit regulating cell shape

    NASA Astrophysics Data System (ADS)

    Holmes, William R.; Edelstein-Keshet, Leah

    2016-08-01

    Networks of Rho-family GTPases regulate eukaryotic cell polarization and motility by controlling assembly and contraction of the cytoskeleton. The mutually inhibitory Rac–Rho circuit is emerging as a central, regulatory hub that can affect the shape and motility phenotype of eukaryotic cells. Recent experimental manipulation of the amounts of Rac and Rho or their regulators (guanine nucleotide-exchange factors, GTPase-activating proteins, guanine nucleotide dissociation inhibitors) have been shown to bias the prevalence of these different states and promote transitions between them. Here we show that part of this data can be understood in terms of inherent Rac–Rho mutually inhibitory dynamics. We analyze a spatio-temporal mathematical model of Rac–Rho dynamics to produce a detailed set of predictions of how parameters such as GTPase rates of activation and total amounts affect cell decisions (such as Rho-dominated contraction, Rac-dominated spreading, and spatially segregated Rac–Rho polarization). We find that in some parameter regimes, a cell can take on any of these three fates depending on its environment or stimuli. We also predict how experimental manipulations (corresponding to parameter variations) can affect cell shapes observed. Our methods are based on local perturbation analysis (a kind of nonlinear stability analysis), and an approximation of nonlinear feedback by sharp switches. We compare the Rac–Rho model to an even simpler single-GTPase (‘wave-pinning’) model and demonstrate that the overall behavior is inherent to GTPase properties, rather than stemming solely from network topology.

  3. Protective LRRK2 R1398H Variant Enhances GTPase and Wnt Signaling Activity

    PubMed Central

    Nixon-Abell, Jonathon; Berwick, Daniel C.; Grannó, Simone; Spain, Victoria A.; Blackstone, Craig; Harvey, Kirsten

    2016-01-01

    Mutations in LRRK2 are a common cause of familial and idiopathic Parkinson’s disease (PD). Recently, the LRRK2 GTPase domain R1398H variant was suggested in genetic studies to confer protection against PD but mechanistic data supporting this is lacking. Here, we present evidence that R1398H affects GTPase function, axon outgrowth, and Wnt signaling in a manner opposite to pathogenic LRRK2 mutations. LRRK2 R1398H GTPase domain dimerization and GTP hydrolysis were increased whereas GTP binding was reduced, leading to a decrease in active GTP-bound LRRK2. This protective variant also increased axon length of primary cortical neurones in comparison to wild-type LRRK2, whereas the R1441G LRRK2 pathogenic mutant decreased axon outgrowth. Importantly, R1398H enhanced the stimulatory effect of LRRK2 on canonical Wnt signaling whereas the G2385R risk variant, in accordance with all previously tested pathogenic LRRK2 mutants, had the opposite effect. Molecular modeling placed R1398H in close proximity to PD-causing mutations suggesting that this protective LRRK2 variant, like familial mutations, affects intramolecular RocCOR domain interactions. Thus, our data suggest that R1398H LRRK2 is a bona fide protective variant. The opposite effects of protective versus PD associated LRRK2 variants on GTPase function and canonical Wnt signaling activity also suggests that regulation of these two basic signaling mechanisms is important for neuronal function. We conclude that LRRK2 mediated Wnt signaling and GTPase function are fundamental in conferring disease susceptibility and have clear implications for therapeutic target identification. PMID:27013965

  4. The Rho GTPase Family Genes in Bivalvia Genomes: Sequence, Evolution and Expression Analysis

    PubMed Central

    Li, Xue; Wang, Ruijia; Xun, Xiaogang; Jiao, Wenqian; Zhang, Mengran; Wang, Shuyue; Wang, Shi; Zhang, Lingling; Huang, Xiaoting; Hu, Xiaoli; Bao, Zhenmin

    2015-01-01

    Background Rho GTPases are important members of the Ras superfamily, which represents the largest signaling protein family in eukaryotes, and function as key molecular switches in converting and amplifying external signals into cellular responses. Although numerous analyses of Rho family genes have been reported, including their functions and evolution, a systematic analysis of this family has not been performed in Mollusca or in Bivalvia, one of the most important classes of Mollusca. Results In this study, we systematically identified and characterized a total set (Rho, Rac, Mig, Cdc42, Tc10, Rnd, RhoU, RhoBTB and Miro) of thirty Rho GTPase genes in three bivalve species, including nine in the Yesso scallop Patinopecten yessoensis, nine in the Zhikong scallop Chlamys farreri, and twelve in the Pacific oyster Crassostrea gigas. Phylogenetic analysis and interspecies comparison indicated that bivalves might possess the most complete types of Rho genes in invertebrates. A multiple RNA-seq dataset was used to investigate the expression profiles of bivalve Rho genes, revealing that the examined scallops share more similar Rho expression patterns than the oyster, whereas more Rho mRNAs are expressed in C. farreri and C. gigas than in P. yessoensis. Additionally, Rho, Rac and Cdc42 were found to be duplicated in the oyster but not in the scallops. Among the expanded Rho genes of C. gigas, duplication pairs with high synonymous substitution rates (Ks) displayed greater differences in expression. Conclusion A comprehensive analysis of bivalve Rho GTPase family genes was performed in scallop and oyster species, and Rho genes in bivalves exhibit greater conservation than those in any other invertebrate. This is the first study focusing on a genome-wide characterization of Rho GTPase genes in bivalves, and the findings will provide a valuable resource for a better understanding of Rho evolution and Rho GTPase function in Bivalvia. PMID:26633655

  5. Rho GTPases have diverse effects on the organization of the actin filament system.

    PubMed Central

    Aspenström, Pontus; Fransson, Asa; Saras, Jan

    2004-01-01

    The Rho GTPases are related to the Ras proto-oncogenes and consist of 22 family members. These proteins have important roles in regulating the organization of the actin filament system, and thereby the morphogenesis of vertebrate cells as well as their ability to migrate. In an effort to compare the effects of all members of the Rho GTPase family, active Rho GTPases were transfected into porcine aortic endothelial cells and the effects on the actin filament system were monitored. Cdc42, TCL (TC10-like), Rac1-Rac3 and RhoG induced the formation of lamellipodia, whereas Cdc42, Rac1 and Rac2 also induced the formation of thick bundles of actin filaments. In contrast, transfection with TC10 or Chp resulted in the formation of focal adhesion-like structures, whereas Wrch-1 induced long and thin filopodia. Transfection with RhoA, RhoB or RhoC induced the assembly of stress fibres, whereas Rnd1-Rnd3 resulted in the loss of stress fibres, but this effect was associated with the formation of actin- and ezrin-containing dorsal microvilli. Cells expressing RhoD and Rif had extremely long and flexible filopodia. None of the RhoBTB or Miro GTPases had any major influence on the organization of the actin filament system; instead, RhoBTB1 and RhoBTB2 were present in vesicular structures, and Miro-1 and Miro-2 were present in mitochondria. Collectively, the data obtained in this study to some extent confirm earlier observations, but also allow the identification of previously undetected roles of the different members of the Rho GTPases. PMID:14521508

  6. Analysis of a minimal Rho-GTPase circuit regulating cell shape.

    PubMed

    Holmes, William R; Edelstein-Keshet, Leah

    2016-01-01

    Networks of Rho-family GTPases regulate eukaryotic cell polarization and motility by controlling assembly and contraction of the cytoskeleton. The mutually inhibitory Rac-Rho circuit is emerging as a central, regulatory hub that can affect the shape and motility phenotype of eukaryotic cells. Recent experimental manipulation of the amounts of Rac and Rho or their regulators (guanine nucleotide-exchange factors, GTPase-activating proteins, guanine nucleotide dissociation inhibitors) have been shown to bias the prevalence of these different states and promote transitions between them. Here we show that part of this data can be understood in terms of inherent Rac-Rho mutually inhibitory dynamics. We analyze a spatio-temporal mathematical model of Rac-Rho dynamics to produce a detailed set of predictions of how parameters such as GTPase rates of activation and total amounts affect cell decisions (such as Rho-dominated contraction, Rac-dominated spreading, and spatially segregated Rac-Rho polarization). We find that in some parameter regimes, a cell can take on any of these three fates depending on its environment or stimuli. We also predict how experimental manipulations (corresponding to parameter variations) can affect cell shapes observed. Our methods are based on local perturbation analysis (a kind of nonlinear stability analysis), and an approximation of nonlinear feedback by sharp switches. We compare the Rac-Rho model to an even simpler single-GTPase ('wave-pinning') model and demonstrate that the overall behavior is inherent to GTPase properties, rather than stemming solely from network topology. PMID:27434017

  7. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  8. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  9. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  10. [The primary healthcare centres].

    PubMed

    Brambilla, Antonio; Maciocco, Gavino

    2014-04-01

    The central attributes of primary care are: first contact (accessibility), longitudinality (person- focused preventive and curative care overtime), patient-oriented comprehensiveness and coordination (including navigation towards secondary and tertiary care). Besides taking care of the needs of the individuals, primary health care teams are also looking at the community, especially when addressing social determinants of health. The rationale for the benefits for primary care for health has been found in: 1) greater access to needed services; 2) better quality of care; 3) a greater focus on prevention; 4) early management of health problems; 5) organizing and delivering high quality care for chronic non-communicable diseases. This paper describes the role of primary healthcare centres in strengthening community primary services and in reducing health inequalities. Furthemore, the experiences of Regional Health Services from Tuscany and Emilia-Romagna are discussed, with a brief overview of the literature. PMID:24770539

  11. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  12. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  13. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  14. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  15. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  16. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  17. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  18. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  19. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  20. Genetic interactions in yeast between Ypt GTPases and Arf guanine nucleotide exchangers.

    PubMed Central

    Jones, S; Jedd, G; Kahn, R A; Franzusoff, A; Bartolini, F; Segev, N

    1999-01-01

    Two families of GTPases, Arfs and Ypt/rabs, are key regulators of vesicular transport. While Arf proteins are implicated in vesicle budding from the donor compartment, Ypt/rab proteins are involved in the targeting of vesicles to the acceptor compartment. Recently, we have shown a role for Ypt31/32p in exit from the yeast trans-Golgi, suggesting a possible function for Ypt/rab proteins in vesicle budding as well. Here we report the identification of a new member of the Sec7-domain family, SYT1, as a high-copy suppressor of a ypt31/32 mutation. Several proteins that belong to the Sec7-domain family, including the yeast Gea1p, have recently been shown to stimulate nucleotide exchange by Arf GTPases. Nucleotide exchange by Arf GTPases, the switch from the GDP- to the GTP-bound form, is thought to be crucial for their function. Sec7p itself has an important role in the yeast secretory pathway. However, its mechanism of action is not yet understood. We show that all members of the Sec7-domain family exhibit distinct genetic interactions with the YPT genes. Biochemical assays demonstrate that, although the homology between the members of the Sec7-domain family is relatively low (20-35%) and limited to a small domain, they all can act as guanine nucleotide exchange factors (GEFs) for Arf proteins, but not for Ypt GTPases. The Sec7-domain of Sec7p is sufficient for this activity. Interestingly, the Sec7 domain activity is inhibited by brefeldin A (BFA), a fungal metabolite that inhibits some of the Arf-GEFs, indicating that this domain is a target for BFA. These results demonstrate that the ability to act as Arf-GEFs is a general property of all Sec7-domain proteins in yeast. The genetic interactions observed between Arf GEFs and Ypt GTPases suggest the existence of a Ypt-Arf GTPase cascade in the secretory pathway. PMID:10430582

  1. Novel Activities of Select NSAID R-Enantiomers against Rac1 and Cdc42 GTPases.

    PubMed

    Oprea, Tudor I; Sklar, Larry A; Agola, Jacob O; Guo, Yuna; Silberberg, Melina; Roxby, Joshua; Vestling, Anna; Romero, Elsa; Surviladze, Zurab; Murray-Krezan, Cristina; Waller, Anna; Ursu, Oleg; Hudson, Laurie G; Wandinger-Ness, Angela

    2015-01-01

    Rho family GTPases (including Rac, Rho and Cdc42) collectively control cell proliferation, adhesion and migration and are of interest as functional therapeutic targets in numerous epithelial cancers. Based on high throughput screening of the Prestwick Chemical Library® and cheminformatics we identified the R-enantiomers of two approved drugs (naproxen and ketorolac) as inhibitors of Rac1 and Cdc42. The corresponding S-enantiomers are considered the active component in racemic drug formulations, acting as non-steroidal anti-inflammatory drugs (NSAIDs) with selective activity against cyclooxygenases. Here, we show that the S-enantiomers of naproxen and ketorolac are inactive against the GTPases. Additionally, more than twenty other NSAIDs lacked inhibitory action against the GTPases, establishing the selectivity of the two identified NSAIDs. R-naproxen was first identified as a lead compound and tested in parallel with its S-enantiomer and the non-chiral 6-methoxy-naphthalene acetic acid (active metabolite of nabumetone, another NSAID) as a structural series. Cheminformatics-based substructure analyses-using the rotationally constrained carboxylate in R-naproxen-led to identification of racemic [R/S] ketorolac as a suitable FDA-approved candidate. Cell based measurement of GTPase activity (in animal and human cell lines) demonstrated that the R-enantiomers specifically inhibit epidermal growth factor stimulated Rac1 and Cdc42 activation. The GTPase inhibitory effects of the R-enantiomers in cells largely mimic those of established Rac1 (NSC23766) and Cdc42 (CID2950007/ML141) specific inhibitors. Docking predicts that rotational constraints position the carboxylate moieties of the R-enantiomers to preferentially coordinate the magnesium ion, thereby destabilizing nucleotide binding to Rac1 and Cdc42. The S-enantiomers can be docked but are less favorably positioned in proximity to the magnesium. R-naproxen and R-ketorolac have potential for rapid translation and

  2. Structural Basis of Rnd1 Binding to Plexin Rho GTPase Binding Domains (RBDs)

    SciTech Connect

    Wang, Hui; Hota, Prasanta K.; Tong, Yufeng; Li, Buren; Shen, Limin; Nedyalkova, Lyudmila; Borthakur, Susmita; Kim, SoonJeung; Tempel, Wolfram; Buck, Matthias; Park, Hee-Won

    2011-09-20

    Plexin receptors regulate cell adhesion, migration, and guidance. The Rho GTPase binding domain (RBD) of plexin-A1 and -B1 can bind GTPases, including Rnd1. By contrast, plexin-C1 and -D1 reportedly bind Rnd2 but associate with Rnd1 only weakly. The structural basis of this differential Rnd1 GTPase binding to plexin RBDs remains unclear. Here, we solved the structure of the plexin-A2 RBD in complex with Rnd1 and the structures of the plexin-C1 and plexin-D1 RBDs alone, also compared with the previously determined plexin-B1 RBD.Rnd1 complex structure. The plexin-A2 RBD {center_dot} Rnd1 complex is a heterodimer, whereas plexin-B1 and -A2 RBDs homodimerize at high concentration in solution, consistent with a proposed model for plexin activation. Plexin-C1 and -D1 RBDs are monomeric, consistent with major residue changes in the homodimerization loop. In plexin-A2 and -B1, the RBD {beta}3-{beta}4 loop adjusts its conformation to allow Rnd1 binding, whereas minimal structural changes occur in Rnd1. The plexin-C1 and -D1 RBDs lack several key non-polar residues at the corresponding GTPase binding surface and do not significantly interact with Rnd1. Isothermal titration calorimetry measurements on plexin-C1 and -D1 mutants reveal that the introduction of non-polar residues in this loop generates affinity for Rnd1. Structure and sequence comparisons suggest a similar mode of Rnd1 binding to the RBDs, whereas mutagenesis suggests that the interface with the highly homologous Rnd2 GTPase is different in detail. Our results confirm, from a structural perspective, that Rnd1 does not play a role in the activation of plexin-C1 and -D1. Plexin functions appear to be regulated by subfamily-specific mechanisms, some of which involve different Rho family GTPases.

  3. Novel Activities of Select NSAID R-Enantiomers against Rac1 and Cdc42 GTPases

    PubMed Central

    Oprea, Tudor I.; Sklar, Larry A.; Agola, Jacob O.; Guo, Yuna; Silberberg, Melina; Roxby, Joshua; Vestling, Anna; Romero, Elsa; Surviladze, Zurab; Murray-Krezan, Cristina; Waller, Anna; Ursu, Oleg; Hudson, Laurie G.; Wandinger-Ness, Angela

    2015-01-01

    Rho family GTPases (including Rac, Rho and Cdc42) collectively control cell proliferation, adhesion and migration and are of interest as functional therapeutic targets in numerous epithelial cancers. Based on high throughput screening of the Prestwick Chemical Library® and cheminformatics we identified the R-enantiomers of two approved drugs (naproxen and ketorolac) as inhibitors of Rac1 and Cdc42. The corresponding S-enantiomers are considered the active component in racemic drug formulations, acting as non-steroidal anti-inflammatory drugs (NSAIDs) with selective activity against cyclooxygenases. Here, we show that the S-enantiomers of naproxen and ketorolac are inactive against the GTPases. Additionally, more than twenty other NSAIDs lacked inhibitory action against the GTPases, establishing the selectivity of the two identified NSAIDs. R-naproxen was first identified as a lead compound and tested in parallel with its S-enantiomer and the non-chiral 6-methoxy-naphthalene acetic acid (active metabolite of nabumetone, another NSAID) as a structural series. Cheminformatics-based substructure analyses—using the rotationally constrained carboxylate in R-naproxen—led to identification of racemic [R/S] ketorolac as a suitable FDA-approved candidate. Cell based measurement of GTPase activity (in animal and human cell lines) demonstrated that the R-enantiomers specifically inhibit epidermal growth factor stimulated Rac1 and Cdc42 activation. The GTPase inhibitory effects of the R-enantiomers in cells largely mimic those of established Rac1 (NSC23766) and Cdc42 (CID2950007/ML141) specific inhibitors. Docking predicts that rotational constraints position the carboxylate moieties of the R-enantiomers to preferentially coordinate the magnesium ion, thereby destabilizing nucleotide binding to Rac1 and Cdc42. The S-enantiomers can be docked but are less favorably positioned in proximity to the magnesium. R-naproxen and R-ketorolac have potential for rapid translation and

  4. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  5. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  6. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  7. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  8. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  9. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  10. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  11. Structural coupling of the EF hand and C-terminal GTPase domains in the mitochondrial protein Miro

    PubMed Central

    Klosowiak, Julian L; Focia, Pamela J; Chakravarthy, Srinivas; Landahl, Eric C; Freymann, Douglas M; Rice, Sarah E

    2013-01-01

    Miro is a highly conserved calcium-binding GTPase at the regulatory nexus of mitochondrial transport and autophagy. Here we present crystal structures comprising the tandem EF hand and carboxy terminal GTPase (cGTPase) domains of Drosophila Miro. The structures reveal two previously unidentified ‘hidden' EF hands, each paired with a canonical EF hand. Each EF hand pair is bound to a helix that structurally mimics an EF hand ligand. A key nucleotide-sensing element and a Pink1 phosphorylation site both lie within an extensive EF hand–cGTPase interface. Our results indicate structural mechanisms for calcium, nucleotide and phosphorylation-dependent regulation of mitochondrial function by Miro. PMID:24071720

  12. Structural coupling of the EF hand and C-terminal GTPase domains in the mitochondrial protein Miro.

    PubMed

    Klosowiak, Julian L; Focia, Pamela J; Chakravarthy, Srinivas; Landahl, Eric C; Freymann, Douglas M; Rice, Sarah E

    2013-11-01

    Miro is a highly conserved calcium-binding GTPase at the regulatory nexus of mitochondrial transport and autophagy. Here we present crystal structures comprising the tandem EF hand and carboxy terminal GTPase (cGTPase) domains of Drosophila Miro. The structures reveal two previously unidentified 'hidden' EF hands, each paired with a canonical EF hand. Each EF hand pair is bound to a helix that structurally mimics an EF hand ligand. A key nucleotide-sensing element and a Pink1 phosphorylation site both lie within an extensive EF hand-cGTPase interface. Our results indicate structural mechanisms for calcium, nucleotide and phosphorylation-dependent regulation of mitochondrial function by Miro. PMID:24071720

  13. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  14. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  15. Patient-centred care: making cancer treatment centres accountable.

    PubMed

    Zucca, Alison; Sanson-Fisher, Rob; Waller, Amy; Carey, Mariko

    2014-07-01

    Patient-centred care is argued to be an essential component in the delivery of quality health and cancer care. This manuscript discusses the need to generate credible data which indicates the quality of patient-centred care provided by cancer treatment centres. Patient-centred care covers six domains including physical comfort; emotional support; respect for patients' preferences and values; integration and coordination; involvement of family and friends; and the provision of information, communication and education to enable patients to understand and make informed decisions about their care. First, we identify priority areas within each domain. Next, we propose three questions that should be asked of every patient across the six domains of patient-centred care. The first question explores whether patients were specifically asked by a healthcare provider at the cancer treatment centre about their concerns, values and preferences. Research indicates that it cannot be assumed that clinicians are aware of patient's needs or preferences in these six areas. Second, if the answer from the patient suggests that they would like assistance, then it would be expected that this would be offered. Thirdly, if the patient indicates that they would like such assistance and it is provided, then it might be expected that the patient would report that the provided assistance did relieve their suffering, or the assistance provided was consistent with their preferences, needs and values. Regular measurement and reporting of these aspects of patient-centred cancer care has the potential to identify deficits and inequities in care delivery, allow for comparisons across treatment centres and stimulate an improvement in the patient-centred care provided to cancer patients. PMID:24696084

  16. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  17. CMCC Data Distribution Centre

    NASA Astrophysics Data System (ADS)

    Aloisio, Giovanni; Fiore, Sandro; Negro, A.

    2010-05-01

    The CMCC Data Distribution Centre (DDC) is the primary entry point (web gateway) to the CMCC. It is a Data Grid Portal providing a ubiquitous and pervasive way to ease data publishing, climate metadata search, datasets discovery, metadata annotation, data access, data aggregation, sub-setting, etc. The grid portal security model includes the use of HTTPS protocol for secure communication with the client (based on X509v3 certificates that must be loaded into the browser) and secure cookies to establish and maintain user sessions. The CMCC DDC is now in a pre-production phase and it is currently used only by internal users (CMCC researchers and climate scientists). The most important component already available in the CMCC DDC is the Search Engine which allows users to perform, through web interfaces, distributed search and discovery activities by introducing one or more of the following search criteria: horizontal extent (which can be specified by interacting with a geographic map), vertical extent, temporal extent, keywords, topics, creation date, etc. By means of this page the user submits the first step of the query process on the metadata DB, then, she can choose one or more datasets retrieving and displaying the complete XML metadata description (from the browser). This way, the second step of the query process is carried out by accessing to a specific XML document of the metadata DB. Finally, through the web interface, the user can access to and download (partially or totally) the data stored on the storage device accessing to OPeNDAP servers and to other available grid storage interfaces. Requests concerning datasets stored in deep storage will be served asynchronously.

  18. Ral small GTPase signaling and oncogenesis: More than just 15minutes of fame.

    PubMed

    Gentry, Leanna R; Martin, Timothy D; Reiner, David J; Der, Channing J

    2014-12-01

    Since their discovery in 1986, Ral (Ras-like) GTPases have emerged as critical regulators of diverse cellular functions. Ral-selective guanine nucleotide exchange factors (RalGEFs) function as downstream effectors of the Ras oncoprotein, and the RalGEF-Ral signaling network comprises the third best characterized effector of Ras-dependent human oncogenesis. Because of this, Ral GTPases as well as their effectors are being explored as possible therapeutic targets in the treatment of RAS mutant cancer. The two Ral isoforms, RalA and RalB, interact with a variety of downstream effectors and have been found to play key and distinct roles in both normal and neoplastic cell physiology including regulation of vesicular trafficking, migration and invasion, tumor formation, metastasis, and gene expression. In this review we provide an overview of Ral biochemistry and biology, and we highlight recent discoveries. PMID:25219551

  19. Ral small GTPase signaling and oncogenesis: more than just 15 minutes of fame

    PubMed Central

    Gentry, Leanna R.; Martin, Timothy D.; Reiner, David J.; Der, Channing J.

    2014-01-01

    Since their discovery in 1986, Ral (Ras-like) GTPases have emerged as critical regulators of diverse cellular functions. Ral-selective guanine nucleotide exchange factors (RalGEFs) function as downstream effectors of the Ras oncoprotein, and the RalGEF-Ral signaling network comprises the third best characterized effector of Ras-dependent human oncogenesis. Because of this, Ral GTPases as well as their effectors are being explored as possible therapeutic targets in the treatment of RAS mutant cancer. The two Ral isoforms, RalA and RalB, interact with a variety of downstream effectors and have been found to play key and distinct roles in both normal and neoplastic cell physiology including regulation of vesicular trafficking, migration and invasion, tumor formation, metastasis, and gene expression. In this review we provide an overview of Ral biochemistry and biology, and we highlight recent discoveries. PMID:25219551

  20. Structural Basis for Rab GTPase Activation by VPS9 Domain Exchange Factors

    SciTech Connect

    Delprato,A.; Lambright, D.

    2007-01-01

    RABEX-5 and other exchange factors with VPS9 domains regulate endocytic trafficking through activation of the Rab family GTPases RAB5, RAB21 and RAB22. Here we report the crystal structure of the RABEX-5 catalytic core in complex with nucleotide-free RAB21, a key intermediate in the exchange reaction pathway. The structure reveals how VPS9 domain exchange factors recognize Rab GTPase substrates, accelerate GDP release and stabilize the nucleotide-free conformation. We further identify an autoinhibitory element in a predicted amphipathic helix located near the C terminus of the VPS9 domain. The autoinhibitory element overlaps with the binding site for the multivalent effector RABAPTIN-5 and potently suppresses the exchange activity of RABEX-5. Autoinhibition can be partially reversed by mutation of conserved residues on the nonpolar face of the predicted amphipathic helix or by assembly of the complex with RABAPTIN-5.

  1. Regulation of cerebral cortex development by Rho GTPases: insights from in vivo studies

    PubMed Central

    Azzarelli, Roberta; Kerloch, Thomas; Pacary, Emilie

    2015-01-01

    The cerebral cortex is the site of higher human cognitive and motor functions. Histologically, it is organized into six horizontal layers, each containing unique populations of molecularly and functionally distinct excitatory projection neurons and inhibitory interneurons. The stereotyped cellular distribution of cortical neurons is crucial for the formation of functional neural circuits and it is predominantly established during embryonic development. Cortical neuron development is a multiphasic process characterized by sequential steps of neural progenitor proliferation, cell cycle exit, neuroblast migration and neuronal differentiation. This series of events requires an extensive and dynamic remodeling of the cell cytoskeleton at each step of the process. As major regulators of the cytoskeleton, the family of small Rho GTPases has been shown to play essential functions in cerebral cortex development. Here we review in vivo findings that support the contribution of Rho GTPases to cortical projection neuron development and we address their involvement in the etiology of cerebral cortex malformations. PMID:25610373

  2. Expression, purification, crystallization and preliminary crystallographic analysis of human Rad GTPase

    SciTech Connect

    Yanuar, Arry; Sakurai, Shigeru; Kitano, Ken; Hakoshima, Toshio

    2005-11-01

    Human Rad has been crystallized. A diffraction data set was collected to a resolution of 1.8 Å. Human Rad is a new member of the Ras GTPase superfamily and is overexpressed in human skeletal muscle of individuals with type II diabetes. The GTPase core domain was overexpressed in Escherichia coli and purified for crystallization. Crystals were obtained at 293 K by vapour diffusion using a crystallization robot. The crystals were found to belong to space group P2{sub 1}, with unit-cell parameters a = 52.2, b = 58.6, c = 53.4 Å, β = 97.9°, and contained two Rad molecules in the crystallographic asymmetric unit. A diffraction data set was collected to a resolution of 1.8 Å using synchrotron radiation at SPring-8.

  3. Rational design of small molecule inhibitors targeting RhoA subfamily Rho GTPases

    PubMed Central

    Shang, Xun; Marchioni, Fillipo; Sipes, Nisha; Evelyn, Chris R.; Jerabek-Willemsen, Moran; Duhr, Stefan; Seibel, William; Wortman, Matthew; Zheng, Yi

    2012-01-01

    SUMMARY Rho GTPases have been implicated in diverse cellular functions and are potential therapeutic targets. By virtual screening, we have identified a Rho specific inhibitor, Rhosin. Rhosin contains two-aromatic rings tethered by a linker, and it binds to the surface area sandwiching Trp58 of RhoA with a submicromolar Kd and effectively inhibits GEF-catalyzed RhoA activation. In cells Rhosin specifically inhibited RhoA activity and RhoA-mediated cellular function without affecting Cdc42 or Rac1 signaling activities. By suppressing RhoA or RhoC activity Rhosin could inhibit mammary sphere formation by breast cancer cells, suppress invasion of mammary epithelial cells, and induce neurite outgrowth of PC12 cells in synergy with NGF. Thus, the rational designed RhoA subfamily specific small molecule inhibitor is useful for studying the physiological and pathologic roles of Rho GTPase. PMID:22726684

  4. The GTPase-Activating Protein Rga1 Interacts with Rho3 GTPase and May Regulate Its Function in Polarized Growth in Budding Yeast

    PubMed Central

    He, Fei; Nie, Wen-Chao; Tong, Zongtian; Yuan, Si-Min; Gong, Ting; Liao, Yuan; Bi, Erfei; Gao, Xiang-Dong

    2015-01-01

    In budding yeast, Rga1 negatively regulates the Rho GTPase Cdc42 by acting as a GTPase-activating protein (GAP) for Cdc42. To gain insight into the function and regulation of Rga1, we overexpressed Rga1 and an N-terminally truncated Rga1-C538 (a.a. 538-1007) segment. Overexpression of Rga1-C538 but not full-length Rga1 severely impaired growth and cell morphology in wild-type cells. We show that Rga1 is phosphorylated during the cell cycle. The lack of phenotype for full-length Rga1 upon overexpression may result from a negative regulation by G1-specific Pho85, a cyclin-dependent kinase (CDK). From a high-copy suppressor screen, we isolated RHO3, SEC9, SEC1, SSO1, SSO2, and SRO7, genes involved in exocytosis, as suppressors of the growth defect caused by Rga1-C538 overexpression. Moreover, we detected that Rga1 interacts with Rho3 in two-hybrid and bimolecular fluorescence complementation (BiFC) assays. Rga1 preferentially interacts with the GTP-bound form of Rho3 and the interaction requires the GAP domain and additional sequence upstream of the GAP domain. Our data suggest that the interaction of Rga1 with Rho3 may regulate Rho3’s function in polarized bud growth. PMID:25860339

  5. Rab-family GTPase regulates TOR complex 2 signaling in fission yeast

    PubMed Central

    Tatebe, Hisashi; Morigasaki, Susumu; Murayama, Shinichi; Zeng, Cui Tracy; Shiozaki, Kazuhiro

    2010-01-01

    Summary Background From yeast to human, TOR (Target Of Rapamycin) kinase plays pivotal roles in coupling extracellular stimuli to cell growth and metabolism. TOR kinase functions in two distinct protein complexes, TOR complex 1 (TORC1) and 2 (TORC2), which phosphorylate and activate different AGC-family protein kinases. TORC1 is controlled by the small GTPase Rheb, but little is known about TORC2 regulators. Results We have identified the Ryh1 GTPase, a human Rab6 ortholog, as an activator of TORC2 signaling in the fission yeast Schizosaccharomyces pombe. Mutational inactivation of Ryh1 or its guanine nucleotide exchange factor compromises the TORC2-dependent phosphorylation of the AGC-family Gad8 kinase. In addition, the effector domain of Ryh1 is important for its physical interaction with TORC2 and for stimulation of TORC2 signaling. Thus, GTP-bound Ryh1 is likely to be the active form stimulatory to TORC2–Gad8 signaling. Consistently, expression of the GTP-locked mutant Ryh1 is sufficient to promote interaction between TORC2 and Gad8 and to induce Gad8 hyper-phosphorylation. The loss of functional Ryh1, TORC2 or Gad8 brings about similar vacuolar fragmentation and stress sensitivity, further corroborating their involvement in a common cellular process. Human Rab6 can substitute Ryh1 in S. pombe and therefore, Rab6 may be a potential activator of TORC2 in mammals. Conclusions In its GTP-bound form, Ryh1, an evolutionarily conserved Rab GTPase, activates TORC2 signaling to the AGC kinase Gad8. The Ryh1 GTPase and the TORC2–Gad8 pathway are required for vacuolar integrity and cellular stress resistance in S. pombe. PMID:21035342

  6. Caspases indirectly regulate cleavage of the mitochondrial fusion GTPase OPA1 in neurons undergoing apoptosis

    PubMed Central

    Loucks, F. Alexandra; Schroeder, Emily K.; Zommer, Amelia E.; Hilger, Shea; Kelsey, Natalie A.; Bouchard, Ron J.; Blackstone, Craig; Brewster, Jay L.; Linseman, Daniel A.

    2009-01-01

    The critical processes of mitochondrial fission and fusion are regulated by members of the dynamin family of GTPases. Imbalances in mitochondrial fission and fusion contribute to neuronal cell death. For example, increased fission mediated by the dynamin-related GTPase, Drp1, or decreased fusion resulting from inactivating mutations in the OPA1 GTPase, cause neuronal apoptosis and/or neurodegeneration. Recent studies indicate that post-translational processing regulates OPA1 function in non-neuronal cells and moreover, aberrant processing of OPA1 is induced during apoptosis. To date, the post-translational processing of OPA1 during neuronal apoptosis has not been examined. Here, we show that cerebellar granule neurons (CGNs) or neuroblastoma cells exposed to pro-apoptotic stressors display a novel N-terminal cleavage of OPA1 which is blocked by either pan-caspase or caspase-8 selective inhibitors. OPA1 cleavage occurs concurrently with mitochondrial fragmentation and cytochrome c release in CGNs deprived of depolarizing potassium (5K condition). Although a caspase-8 selective inhibitor prevents both 5K-induced OPA1 cleavage and mitochondrial fragmentation, recombinant caspase-8 fails to cleave OPA1 in vitro. In marked contrast, either caspase-8 or caspase-3 stimulates OPA1 cleavage in digitonin-permeabilized rat brain mitochondria, suggesting that OPA1 is cleaved by an intermembrane space protease which is regulated by active caspases. Finally, the N-terminal truncation of OPA1 induced during neuronal apoptosis removes an essential residue (K301) within the GTPase domain. These data are the first to demonstrate OPA1 cleavage during neuronal apoptosis and they implicate caspases as indirect regulators of OPA1 processing in degenerating neurons. PMID:19046944

  7. RhoGTPases--NODes for effector-triggered immunity in animals.

    PubMed

    Stuart, Lynda M; Boyer, Laurent

    2013-08-01

    A recent study published in Nature by Keestra and colleagues addresses how the immune system detects the pathogenic potential of microbes and provides evidence that one strategy involves NOD1, which monitors the activation state of the RhoGTPases that are targeted by virulence effectors produced by pathogenic microbes. Interestingly, their findings reveal striking similarities with previous observations made in flies and plants, establishing the evolutionary conservation of this detection system in the innate immune arsenal in many taxa. PMID:23689278

  8. RhoA GTPase interacts with beta-catenin signaling in clinorotated osteoblasts

    PubMed Central

    Wan, Qiaoqiao; Cho, Eunhye; Yokota, Hiroki; Na, Sungsoo

    2014-01-01

    Bone is a dynamic tissue under constant remodeling in response to various signals including mechanical loading. A lack of proper mechanical loading induces disuse osteoporosis that reduces bone mass and structural integrity. β-catenin signaling together with a network of GTPases is known to play a primary role in load-driven bone formation, but little is known about potential interactions of β-catenin signaling and GTPases in bone loss. In this study, we addressed a question: Does unloading suppress an activation level of RhoA GTPase and β-catenin signaling in osteoblasts? If yes, what is the role of RhoA GTPase and actin filaments in osteoblasts in regulating β-catenin signaling? Using a fluorescence resonance energy transfer (FRET) technique with a biosensor for RhoA together with a fluorescent T-cell factor/lymphoid enhancer factor (TCF/LEF) reporter, we examined the effects of clinostat-driven simulated unloading. The results revealed that both RhoA activity and TCF/LEF activity were downregulated by unloading. Reduction in RhoA activity was correlated to a decrease in cytoskeletal organization of actin filaments. Inhibition of β-catenin signaling blocked unloading-induced RhoA suppression, and dominant negative RhoA inhibited TCF/LEF suppression. On the other hand, a constitutively active RhoA enhanced unloading-induced reduction of TCF/LEF activity. The TCF/LEF suppression by unloading was enhanced by co-culture with osteocytes, but it was independent on organization of actin filaments, myosin II activity, or a myosin light chain kinase. Collectively, the results suggest that β-catenin signaling is required for unloading-driven regulation of RhoA, and RhoA, but not actin cytoskeleton or intracellular tension, mediates the responsiveness of β-catenin signaling to unloading. PMID:23529802

  9. TbFRP, a novel FYVE-domain containing phosphoinositide-binding Ras-like GTPase from trypanosomes

    PubMed Central

    Adung’a, Vincent O.; Field, Mark C.

    2013-01-01

    Ras-like small GTPases are regulatory proteins that control multiple aspects of cellular function, and are particularly prevalent in vesicular transport. A proportion of GTPase paralogs appear restricted to certain eukaryote lineages, suggesting roles specific to a restricted lineage, and hence potentially reflecting adaptation to individual lifestyles or ecological niche. Here we describe the role of a GTPase, TbFRP, a FYVE domain N-terminally fused to a Ras-like GTPase, originally identified in Trypanosoma brucei. As FYVE-domains specifically bind phosphoinositol 3-phosphate (PI3P), which associates with endosomes, we suggest that TbFRP may unite phosphoinositide and small G protein endosomal signaling in trypanosomatids. TbFRP orthologs are present throughout the Euglenazoa suggesting that FRP has functions throughout the group. We show that the FYVE domain of TbFRP is functional in PI3P-dependent membrane targeting and localizes at the endosomal region. Further, while TbFRP is apparently non-essential, knockdown and immunochemical evidence indicates that TbFRP is rapidly cleaved upon synthesis, releasing the GTPase and FYVE-domains. Finally, TbFRP expression at both mRNA and protein levels is cell density-dependent. Together, these data suggest that TbFRP is an endocytic GTPase with a highly unusual mechanism of action that involves proteolysis of the nascent protein and membrane targeting via PI3P. PMID:23220323

  10. Molecular Analysis and Localization of CaARA7 a Conventional RAB5 GTPase from Characean Algae

    PubMed Central

    Hoepflinger, Marion C.; Geretschlaeger, Anja; Sommer, Aniela; Hoeftberger, Margit; Hametner, Christina; Ueda, Takashi; Foissner, Ilse

    2015-01-01

    RAB5 GTPases are important regulators of endosomal membrane traffic. Among them Arabidopsis thaliana ARA7/RABF2b is highly conserved and homologues are present in fungal, animal and plant kingdoms. In land plants ARA7 and its homologues are involved in endocytosis and transport towards the vacuole. Here we report on the isolation of an ARA7 homologue (CaARA7/CaRABF2) in the highly evolved characean green alga Chara australis. It encodes a polypeptide of 202 amino acids with a calculated molecular mass of 22.2 kDa and intrinsic GTPase activity. Immunolabelling of internodal cells with a specific antibody reveals CaARA7 epitopes at multivesicular endosomes (MVEs) and at MVE-containing wortmannin (WM) compartments. When transiently expressed in epidermal cells of Nicotiana benthamiana leaves, fluorescently tagged CaARA7 localizes to small organelles (putative MVEs) and WM compartments, and partially colocalizes with AtARA7 and CaARA6, a plant specific RABF1 GTPase. Mutations in membrane anchoring and GTP binding sites alter localization of CaARA7 and affect GTPase activity, respectively. This first detailed study of a conventional RAB5 GTPase in green algae demonstrates that CaARA7 is similar to RAB5 GTPases from land plants and other organisms and shows conserved structure and localization. PMID:25639563

  11. Involvement of geranylgeranylation of Rho and Rac GTPases in adipogenic and RANKL expression, which was inhibited by simvastatin.

    PubMed

    Baba, T T; Ohara-Nemoto, Y; Miyazaki, T; Nemoto, T K

    2013-12-01

    Simvastatin suppresses myoblast differentiation via inhibition of Rac GTPase, which is involved in the mevalonic acid pathway that produces cholesterol. Statins also inhibit adipogenic differentiation and receptor activator of NFκB ligand (RANKL) expression, possibly through the mevalonic acid pathway, although the involvement of that pathway and effector proteins in these cellular events has not been fully clarified. In the present study, we aimed to elucidate the mechanism of the effects of simvastatin on adipogenic differentiation and calcitriol-induced RANKL expression in bone marrow stromal ST2 cells. Adipogenesis and mRNA up-regulation of peroxisome proliferator-activated receptor γ and adipocyte fatty acid-binding protein were induced by troglitazone, and those events were efficiently inhibited by simvastatin. In addition, RANKL expression induced by calcitriol was abrogated by simvastatin in ST2 cells. The inhibitory effects of simvastatin were adequately compensated by the addition of either mevalonic acid or an intermediate of the mevalonic acid pathway, geranylgeranyl pyrophosphate, but not by another intermediate, farnesyl pyrophosphate. These findings suggest that protein geranylgeranylation is related to cellular differentiation in those two directions. Furthermore, inhibitor analysis demonstrated that Rac GTPase is involved in adipogenic differentiation, whereas Rho GTPase was found to be involved in RANKL expression. Taken together, the present findings suggest that geranylgeranylation of Rho family GTPase is involved in both adipogenesis and RANKL expression of stromal cells, while Rac GTPase is involved in adipogenesis and Rho GTPase in RANKL expression. PMID:23339033

  12. Molecular Analysis and Localization of CaARA7 a Conventional RAB5 GTPase from Characean Algae.

    PubMed

    Hoepflinger, Marion C; Geretschlaeger, Anja; Sommer, Aniela; Hoeftberger, Margit; Hametner, Christina; Ueda, Takashi; Foissner, Ilse

    2015-05-01

    RAB5 GTPases are important regulators of endosomal membrane traffic. Among them Arabidopsis thaliana ARA7/RABF2b is highly conserved and homologues are present in fungal, animal and plant kingdoms. In land plants ARA7 and its homologues are involved in endocytosis and transport towards the vacuole. Here we report on the isolation of an ARA7 homologue (CaARA7/CaRABF2) in the highly evolved characean green alga Chara australis. It encodes a polypeptide of 202 amino acids with a calculated molecular mass of 22.2 kDa and intrinsic GTPase activity. Immunolabelling of internodal cells with a specific antibody reveals CaARA7 epitopes at multivesicular endosomes (MVEs) and at MVE-containing wortmannin (WM) compartments. When transiently expressed in epidermal cells of Nicotiana benthamiana leaves, fluorescently tagged CaARA7 localizes to small organelles (putative MVEs) and WM compartments, and partially colocalizes with AtARA7 and CaARA6, a plant specific RABF1 GTPase. Mutations in membrane anchoring and GTP binding sites alter localization of CaARA7 and affect GTPase activity, respectively. This first detailed study of a conventional RAB5 GTPase in green algae demonstrates that CaARA7 is similar to RAB5 GTPases from land plants and other organisms and shows conserved structure and localization. PMID:25639563

  13. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  14. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  15. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  16. Stochastic kinetics of ribosomes: Single motor properties and collective behavior

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debanjan; Chowdhury, Debashish; Ramakrishnan, T. V.

    2009-07-01

    Syntheses of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an exact analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a “Michaelis-Menten-type” equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechanochemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a copy of the same protein. We extend the model of a single ribosome by incorporating steric exclusion of different individuals on the same track. We draw the phase diagram of this model of ribosome traffic in three-dimensional spaces spanned by experimentally controllable parameters. We suggest new experimental tests of our theoretical predictions.

  17. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  18. Influence of bacterial toxins on the GTPase activity of transducin from bovine retinal rod outer segments

    SciTech Connect

    Rybin, V.O.; Gureeva, A.A.

    1986-05-10

    The action of cholera toxin, capable of ADP-ribosylation of the activator N/sub s/ protein, and pertussis toxin, capable of ADP-ribosylation of the inhibitor N/sub i/ protein of the adenylate cyclase complex, on transducin, the GTP-binding protein of the rod outer segments of the retina, was investigated. It was shown that under the action of pertussis and cholera toxins, the GTPase activity of transducin is inhibited. Pertussin toxin inhibits the GTPase of native retinal rod outer segments by 30-40%, while GTPase of homogeneous transducin produces a 70-80% inhibition. The action of toxins on transducin depends on the presence and nature of the guanylic nucleotide with which incubation is performed. On the basis of the data obtained it is suggested that pertussis toxin interacts with pretransducin and with the transducin-GDP complex, while cholera toxin ADP-ribosylates the transducin-GTP complex and does not act on transducin lacking GTP.

  19. RhoGTPase-binding proteins, the exocyst complex and polarized vesicle trafficking.

    PubMed

    Mukherjee, Debarati; Sen, Arpita; Aguilar, R Claudio

    2014-01-01

    Cell polarity, the asymmetric distribution of proteins and lipids, is essential for a variety of cellular functions. One mechanism orchestrating cell polarity is polarized vesicle trafficking; whereby cargo loaded secretory vesicles are specifically transported to predetermined areas of the cell. The evolutionarily conserved exocyst complex and its small GTPase regulators play crucial roles in spatiotemporal control of polarized vesicle trafficking. In studies on neuronal membrane remodeling and synaptic plasticity, conserved mechanisms of exocyst regulation and cargo recycling during polarized vesicle trafficking are beginning to emerge as well. Recently, our lab demonstrated that RhoGTPase-binding proteins in both yeast (Bem3) and mammals (Ocrl1) are also required for the efficient traffic of secretory vesicles to sites of polarized growth and signaling. Together with our studies, we highlight the evolutionary conservation of the basic elements essential for polarized vesicle traffic across different cellular functions and model systems. In conclusion, we emphasize that studies on RhoGTPase-binding proteins in these processes should be included in the next level of investigation, for a more complete understanding of their hitherto unknown roles in polarized membrane traffic and exocyst regulation. PMID:24691289

  20. A new role for the dynamin GTPase in the regulation of fusion pore expansion

    PubMed Central

    Anantharam, Arun; Bittner, Mary A.; Aikman, Rachel L.; Stuenkel, Edward L.; Schmid, Sandra L.; Axelrod, Daniel; Holz, Ronald W.

    2011-01-01

    Dynamin is a master regulator of membrane fission in endocytosis. However, a function for dynamin immediately upon fusion has also been suspected from a variety of experiments that measured release of granule contents. The role of dynamin guanosine triphosphate hydrolase (GTPase) activity in controlling fusion pore expansion and postfusion granule membrane topology was investigated using polarization optics and total internal reflection fluorescence microscopy (pTIRFM) and amperometry. A dynamin-1 (Dyn1) mutant with increased GTPase activity resulted in transient deformations consistent with rapid fusion pore widening after exocytosis; a Dyn1 mutant with decreased activity slowed fusion pore widening by stabilizing postfusion granule membrane deformations. The experiments indicate that, in addition to its role in endocytosis, GTPase activity of dynamin regulates the rapidity of fusion pore expansion from tens of milliseconds to seconds after fusion. These findings expand the membrane-sculpting repertoire of dynamin to include the regulation of immediate postfusion events in exocytosis that control the rate of release of soluble granule contents. PMID:21460182

  1. Nitric oxide promotes epidermal stem cell migration via cGMP-Rho GTPase signalling

    PubMed Central

    Zhan, Rixing; He, Weifeng; Wang, Fan; Yao, Zhihui; Tan, Jianglin; Xu, Rui; Zhou, Junyi; Wang, Yuzhen; Li, Haisheng; Wu, Jun; LUO, Gaoxing

    2016-01-01

    The migration and reepithelization of epidermal stem cells (ESCs) are the most critical processes in wound healing. The gaseous messenger nitric oxide (NO) has multiple biological effects, but its actions on ESCs are poorly understood. In this study, an NO donor, S-nitroso-N-acetylpenicillamine (SNAP), was found to facilitate the in vitro migration of human ESCs (huESCs) in both live-imaging and scratch models. In addition, pull-down assays demonstrated that SNAP could activate the small GTPases RhoA and Rac1 of the Rho family, but not Cdc42. Moreover, the effects of SNAP on the migration and F-actin polymerization of ESCs could be blocked by inhibitors of cGMP, PKG, RhoA or Rac1, and by a specific siRNA of RhoA or Rac1, but not by a Cdc42 inhibitor or siRNA. Furthermore, the roles of NO in ESC migration via cGMP-Rho GTPase signalling in vivo were confirmed by tracing 5-bromo-2-deoxyuridine (BrdU)-labelled cells in a superficial, partial-thickness scald mouse model. Thus, the present study demonstrated that the NO donor SNAP could promote huESC migration in vitro. Furthermore, NO was found to induce ESC migration via cGMP-Rho GTPase RhoA and Rac1 signalling, but not Cdc42 signalling, both in vivo and in vitro. PMID:27469024

  2. Conserved regulators of Rag GTPases orchestrate amino acid-dependent TORC1 signaling

    PubMed Central

    Powis, Katie; De Virgilio, Claudio

    2016-01-01

    The highly conserved target of rapamycin complex 1 (TORC1) is the central component of a signaling network that couples a vast range of internal and external stimuli to cell growth, proliferation and metabolism. TORC1 deregulation is associated with a number of human pathologies, including many cancers and metabolic disorders, underscoring its importance in cellular and organismal growth control. The activity of TORC1 is modulated by multiple inputs; however, the presence of amino acids is a stimulus that is essential for its activation. Amino acid sufficiency is communicated to TORC1 via the highly conserved family of Rag GTPases, which assemble as heterodimeric complexes on lysosomal/vacuolar membranes and are regulated by their guanine nucleotide loading status. Studies in yeast, fly and mammalian model systems have revealed a multitude of conserved Rag GTPase modulators, which have greatly expanded our understanding of amino acid sensing by TORC1. Here we review the major known modulators of the Rag GTPases, focusing on recent mechanistic insights that highlight the evolutionary conservation and divergence of amino acid signaling to TORC1. PMID:27462445

  3. Nucleotide-binding flexibility in ultrahigh-resolution structures of the SRP GTPase Ffh

    SciTech Connect

    Ramirez, Ursula D.; Focia, Pamela J.; Freymann, Douglas M.

    2008-10-01

    Crystal structures of the Ffh NG GTPase domain at < 1.24 Å resolution reveal multiple overlapping nucleotide binding modes. Two structures of the nucleotide-bound NG domain of Ffh, the GTPase subunit of the bacterial signal recognition particle (SRP), have been determined at ultrahigh resolution in similar crystal forms. One is GDP-bound and one is GMPPCP-bound. The asymmetric unit of each structure contains two protein monomers, each of which exhibits differences in nucleotide-binding conformation and occupancy. The GDP-bound Ffh NG exhibits two binding conformations in one monomer but not the other and the GMPPCP-bound protein exhibits full occupancy of the nucleotide in one monomer but only partial occupancy in the other. Thus, under the same solution conditions, each crystal reveals multiple binding states that suggest that even when nucleotide is bound its position in the Ffh NG active site is dynamic. Some differences in the positioning of the bound nucleotide may arise from differences in the crystal-packing environment and specific factors that have been identified include the relative positions of the N and G domains, small conformational changes in the P-loop, the positions of waters buried within the active site and shifts in the closing loop that packs against the guanine base. However, ‘loose’ binding may have biological significance in promoting facile nucleotide exchange and providing a mechanism for priming the SRP GTPase prior to its activation in its complex with the SRP receptor.

  4. APP anterograde transport requires Rab3A GTPase activity for assembly of the transport vesicle

    PubMed Central

    Szodorai, A; Kuan, Y-H; Hunzelmann, S; Engel, U; Sakane, A; Sasaki, T; Takai, Y; Kirsch, J; Müller, U; Beyreuther, K; Brady, S; Morfini, G; Kins, S

    2010-01-01

    The amyloid precursor protein (APP) may be sequentially cleaved by β- and γ-secretases leading to accumulation of Aβ peptides in brains of Alzheimer’s Disease patients. Cleavage by α-secretase prevents Aβ generation. APP is anterogradely transported by conventional kinesin in a distinct transport vesicle, but both the biochemical composition of such a vesicle as well as the specific kinesin-1 motor responsible for transport are poorly defined. Here, we demonstrate by time-lapse analysis and immunoisolations that APP is a cargo of a vesicle containing the kinesin heavy chain isoform kinesin-1C, the small GTPase Rab3A and a specific subset of presynaptic protein components. Moreover, we report that assembly of kinesin-1C and APP in this vesicle type requires Rab3A GTPase activity. Finally, we show cleavage of APP in the analyzed transport vesicles by α-secretase activity, likely mediated by ADAM10. Together, these data indicate for the first time that maturation of transport vesicles, including coupling of conventional kinesin, requires Rab GTPase activity. PMID:19923287

  5. A Burkholderia Type VI Effector Deamidates Rho GTPases to Activate the Pyrin Inflammasome and Trigger Inflammation.

    PubMed

    Aubert, Daniel F; Xu, Hao; Yang, Jieling; Shi, Xuyan; Gao, Wenqing; Li, Lin; Bisaro, Fabiana; Chen, She; Valvano, Miguel A; Shao, Feng

    2016-05-11

    Burkholderia cenocepacia is an opportunistic pathogen of the cystic fibrosis lung that elicits a strong inflammatory response. B. cenocepacia employs a type VI secretion system (T6SS) to survive in macrophages by disarming Rho-type GTPases, causing actin cytoskeletal defects. Here, we identified TecA, a non-VgrG T6SS effector responsible for actin disruption. TecA and other bacterial homologs bear a cysteine protease-like catalytic triad, which inactivates Rho GTPases by deamidating a conserved asparagine in the GTPase switch-I region. RhoA deamidation induces caspase-1 inflammasome activation, which is mediated by the familial Mediterranean fever disease protein Pyrin. In mouse infection, the deamidase activity of TecA is necessary and sufficient for B. cenocepacia-triggered lung inflammation and also protects mice from lethal B. cenocepacia infection. Therefore, Burkholderia TecA is a T6SS effector that modifies a eukaryotic target through an asparagine deamidase activity, which in turn elicits host cell death and inflammation through activation of the Pyrin inflammasome. PMID:27133449

  6. Rho GTPase activity in the honey bee mushroom bodies is correlated with age and foraging experience

    PubMed Central

    Dobrin, Scott E.; Fahrbach, Susan E.

    2011-01-01

    Foraging experience is correlated with structural plasticity of the mushroom bodies of the honey bee brain. While several neurotransmitter and intracellular signaling pathways have been previously implicated as mediators of these structural changes, none interact directly with the cytoskeleton, the ultimate effector of changes in neuronal morphology. The Rho family of GTPases are small, monomeric G proteins that, when activated, initiate a signaling cascade that reorganizes the neuronal cytoskeleton. In this study, we measured activity of two members of the Rho family of GTPases, Rac and RhoA, in the mushroom bodies of bees with different durations of foraging experience. A transient increase in Rac activity coupled with a transient decrease in RhoA activity was found in honey bees with 4 days foraging experience compared with same-aged new foragers. These observations are in accord with previous reports based on studies of other species of a growth supporting role for Rac and a growth opposing role for RhoA. This is the first report of Rho GTPase activation in the honey bee brain. PMID:22108023

  7. Rac1 GTPase silencing counteracts microgravity-induced effects on osteoblastic cells.

    PubMed

    Guignandon, Alain; Faure, Céline; Neutelings, Thibaut; Rattner, Aline; Mineur, Pierre; Linossier, Marie-Thérèse; Laroche, Norbert; Lambert, Charles; Deroanne, Christophe; Nusgens, Betty; Demets, René; Colige, Alain; Vico, Laurence

    2014-09-01

    Bone cells exposed to real microgravity display alterations of their cytoskeleton and focal adhesions, two major mechanosensitive structures. These structures are controlled by small GTPases of the Ras homology (Rho) family. We investigated the effects of RhoA, Rac1, and Cdc42 modulation of osteoblastic cells under microgravity conditions. Human MG-63 osteoblast-like cells silenced for RhoGTPases were cultured in the automated Biobox bioreactor (European Space Agency) aboard the Foton M3 satellite and compared to replicate ground-based controls. The cells were fixed after 69 h of microgravity exposure for postflight analysis of focal contacts, F-actin polymerization, vascular endothelial growth factor (VEGF) expression, and matrix targeting. We found that RhoA silencing did not affect sensitivity to microgravity but that Rac1 and, to a lesser extent, Cdc42 abrogation was particularly efficient in counteracting the spaceflight-related reduction of the number of focal contacts [-50% in silenced, scrambled (SiScr) controls vs. -15% for SiRac1], the number of F-actin fibers (-60% in SiScr controls vs. -10% for SiRac1), and the depletion of matrix-bound VEGF (-40% in SiScr controls vs. -8% for SiRac1). Collectively, these data point out the role of the VEGF/Rho GTPase axis in mechanosensing and validate Rac1-mediated signaling pathways as potential targets for counteracting microgravity effects. PMID:24903274

  8. The GTPase ARFRP1 controls the lipidation of chylomicrons in the Golgi of the intestinal epithelium.

    PubMed

    Jaschke, Alexander; Chung, Bomee; Hesse, Deike; Kluge, Reinhart; Zahn, Claudia; Moser, Markus; Petzke, Klaus-Jürgen; Brigelius-Flohé, Regina; Puchkov, Dmytro; Koepsell, Hermann; Heeren, Joerg; Joost, Hans-Georg; Schürmann, Annette

    2012-07-15

    The uptake and processing of dietary lipids by the small intestine is a multistep process that involves several steps including vesicular and protein transport. The GTPase ADP-ribosylation factor-related protein 1 (ARFRP1) controls the ARF-like 1 (ARL1)-mediated Golgi recruitment of GRIP domain proteins which in turn bind several Rab-GTPases. Here, we describe the essential role of ARFRP1 and its interaction with Rab2 in the assembly and lipidation of chylomicrons in the intestinal epithelium. Mice lacking Arfrp1 specifically in the intestine (Arfrp1(vil-/-)) exhibit an early post-natal growth retardation with reduced plasma triacylglycerol and free fatty acid concentrations. Arfrp1(vil-/-) enterocytes as well as Arfrp1 mRNA depleted Caco-2 cells absorbed fatty acids normally but secreted chylomicrons with a markedly reduced triacylglycerol content. In addition, the release of apolipoprotein A-I (ApoA-I) was dramatically decreased, and ApoA-I accumulated in the Arfrp1(vil-/-) epithelium, where it predominantly co-localized with Rab2. The release of chylomicrons from Caco-2 was markedly reduced after the suppression of Rab2, ARL1 and Golgin-245. Thus, the GTPase ARFRP1 and its downstream proteins are required for the lipidation of chylo-microns and the assembly of ApoA-I to these particles in the Golgi of intestinal epithelial cells. PMID:22505585

  9. Atypical Rho GTPases of the RhoBTB Subfamily: Roles in Vesicle Trafficking and Tumorigenesis

    PubMed Central

    Ji, Wei; Rivero, Francisco

    2016-01-01

    RhoBTB proteins constitute a subfamily of atypical Rho GTPases represented in mammals by RhoBTB1, RhoBTB2, and RhoBTB3. Their characteristic feature is a carboxyl terminal extension that harbors two BTB domains capable of assembling cullin 3-dependent ubiquitin ligase complexes. The expression of all three RHOBTB genes has been found reduced or abolished in a variety of tumors. They are considered tumor suppressor genes and recent studies have strengthened their implication in tumorigenesis through regulation of the cell cycle and apoptosis. RhoBTB3 is also involved in retrograde transport from endosomes to the Golgi apparatus. One aspect that makes RhoBTB proteins atypical among the Rho GTPases is their proposed mechanism of activation. No specific guanine nucleotide exchange factors or GTPase activating proteins are known. Instead, RhoBTB might be activated through interaction with other proteins that relieve their auto-inhibited conformation and inactivated through auto-ubiquitination and destruction in the proteasome. In this review we discuss our current knowledge on the molecular mechanisms of action of RhoBTB proteins and the implications for tumorigenesis and other pathologic conditions. PMID:27314390

  10. Biological characterization of Drosophila Rapgap1, a GTPase activating protein for Rap1

    PubMed Central

    Chen, Fangli; Barkett, Margaret; Ram, Kavitha T.; Quintanilla, Adrian; Hariharan, Iswar K.

    1997-01-01

    The activity of Ras family proteins is modulated in vivo by the function of GTPase activating proteins, which increase their intrinsic rate of GTP hydrolysis. We have isolated cDNAs encoding a GAP for the Drosophila Rap1 GTPase. Drosophila Rapgap1 encodes an 850-amino acid protein with a central region that displays substantial sequence similarity to human RapGAP. This domain, when expressed in Escherichia coli, potently stimulates Rap1 GTPase activity in vitro. Unlike Rap1, which is ubiquitously expressed, Rapgap1 expression is highly restricted. Rapgap1 is expressed at high levels in the developing photoreceptor cells and in the optic lobe. Rapgap1 mRNA is also localized in the pole plasm in an oskar-dependent manner. Although mutations that completely abolish Rapgap1 function display no obvious phenotypic abnormalities, overexpression of Rapgap1 induces a rough eye phenotype that is exacerbated by reducing Rap1 gene dosage. Thus, Rapgap1 can function as a negative regulator of Rap1-mediated signaling in vivo. PMID:9356476

  11. Small Rho GTPases and Cholesterol Biosynthetic Pathway Intermediates in African Swine Fever Virus Infection

    PubMed Central

    Quetglas, Jose I.; Hernáez, Bruno; Galindo, Inmaculada; Muñoz-Moreno, Raquel; Cuesta-Geijo, Miguel A.

    2012-01-01

    The integrity of the cholesterol biosynthesis pathway is required for efficient African swine fever virus (ASFV) infection. Incorporation of prenyl groups into Rho GTPases plays a key role in several stages of ASFV infection, since both geranylgeranyl and farnesyl pyrophosphates are required at different infection steps. We found that Rho GTPase inhibition impaired virus morphogenesis and resulted in an abnormal viral factory size with the accumulation of envelope precursors and immature virions. Furthermore, abundant defective virions reached the plasma membrane, and filopodia formation in exocytosis was abrogated. Rac1 was activated at early ASFV infection stages, coincident with microtubule acetylation, a process that stabilizes microtubules for virus transport. Rac1 inhibition did not affect the viral entry step itself but impaired subsequent virus production. We found that specific Rac1 inhibition impaired viral induced microtubule acetylation and viral intracellular transport. These findings highlight that viral infection is the result of a carefully orchestrated modulation of Rho family GTPase activity within the host cell; this modulation results critical for virus morphogenesis and in turn, triggers cytoskeleton remodeling, such as microtubule stabilization for viral transport during early infection. PMID:22114329

  12. Roles of Aspergillus nidulans Cdc42/Rho GTPase regulators in hyphal morphogenesis and development.

    PubMed

    Si, Haoyu; Rittenour, William R; Harris, Steven D

    2016-01-01

    The Rho-related family of GTPases are pivotal regulators of morphogenetic processes in diverse eukaryotic organisms. In the filamentous fungi two related members of this family, Cdc42 and Rac1, perform particularly important roles in the establishment and maintenance of hyphal polarity. The activity of these GTPases is tightly controlled by two sets of regulators: guanine nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). Despite the importance of Cdc42 and Rac1 in polarized hyphal growth, the morphogenetic functions of their cognate GEFs and GAPs have not been widely characterized in filamentous fungi outside the Saccharomycotina. Here we present a functional analysis of the Aspergillus nidulans homologs of the yeast GEF Cdc24 and the yeast GAP Rga1. We show that Cdc24 is required for the establishment of hyphal polarity and localizes to hyphal tips. We also show that Rga1 is necessary for the suppression of branching in developing conidiophores. During asexual development Rga1 appears to act primarily via Cdc42 and in doing so serves as a critical determinant of conidiophore architecture. Our results provide new insight into the roles of Cdc42 during development in A nidulans. PMID:26932184

  13. Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum.

    PubMed

    Yang, Yurong; Zheng, Jing; Chen, Jiaxin

    2012-12-01

    CDC-42 is a member of the Rho GTPase subfamily that is involved in many signaling pathways, including mitosis, cell polarity, cell migration and cytoskeleton remodeling. Here, we present the first characterization of a full-length cDNA encoding the small GTPase cdc-42, designated as Accdc-42, isolated from the parasitic nematode Ancylostoma caninum. The encoded protein contains 191 amino acid residues with a predicted molecular weight of 21 kDa and displays a high level of identity with the Rho-family GTPase protein CDC-42. Phylogenetic analysis revealed that Accdc-42 was most closely related to Caenorhabditis briggsae cdc-42. Comparison with selected sequences from the free-living nematode Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, Danio rerio, Mus musculus and human genomes showed that Accdc-42 is highly conserved. AcCDC-42 demonstrates the highest identity to CDC-42 from C. briggsae (94.2%), and it also exhibits 91.6% identity to CDC-42 from C. elegans and 91.1% from Brugia malayi. Additionally, the transcript of Accdc-42 was analyzed during the different developmental stages of the worm. Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adults of A. caninum. PMID:23000556

  14. The conserved GTPase Gem1 regulates endoplasmic reticulum–mitochondria connections

    PubMed Central

    Kornmann, Benoît; Osman, Christof; Walter, Peter

    2011-01-01

    Mitochondria are connected to the endoplasmic reticulum (ER) through specialized protein complexes. We recently identified the ER–mitochondria encounter structure (ERMES) tethering complex, which plays a role in phospholipid exchange between the two organelles. ERMES also has been implicated in the coordination of mitochondrial protein import, mitochondrial DNA replication, and mitochondrial dynamics, suggesting that these interorganelle contact sites play central regulatory roles in coordinating various aspects of the physiology of the two organelles. Here we purified ERMES complexes and identified the Ca2+-binding Miro GTPase Gem1 as an integral component of ERMES. Gem1 regulates the number and size of the ERMES complexes. In vivo, association of Gem1 to ERMES required the first of Gem1’s two GTPase domains and the first of its two functional Ca2+-binding domains. In contrast, Gem1’s second GTPase domain was required for proper ERMES function in phospholipid exchange. Our results suggest that ERMES is not a passive conduit for interorganellar lipid exchange, but that it can be regulated in response to physiological needs. Furthermore, we provide evidence that the metazoan Gem1 ortholog Miro-1 localizes to sites of ER–mitochondrial contact, suggesting that some of the features ascribed to Gem1 may be evolutionarily conserved. PMID:21825164

  15. SNX9 promotes metastasis by enhancing cancer cell invasion via differential regulation of RhoGTPases

    PubMed Central

    Bendris, Nawal; Williams, Karla C.; Reis, Carlos R.; Welf, Erik S.; Chen, Ping-Hung; Lemmers, Bénédicte; Hahne, Michael; Leong, Hon Sing; Schmid, Sandra L.

    2016-01-01

    Despite current advances in cancer research, metastasis remains the leading factor in cancer-related deaths. Here we identify sorting nexin 9 (SNX9) as a new regulator of breast cancer metastasis. We detect an increase in SNX9 expression in human breast cancer metastases compared with primary tumors and demonstrate that SNX9 expression in MDA-MB-231 breast cancer cells is necessary to maintain their ability to metastasize in a chick embryo model. Conversely, SNX9 knockdown impairs this process. In vitro studies using several cancer cell lines derived from a variety of human tumors reveal a role for SNX9 in cell invasion and identify mechanisms responsible for this novel function. We show that SNX9 controls the activation of RhoA and Cdc42 GTPases and also regulates cell motility via the modulation of well-known molecules involved in metastasis, namely RhoA-ROCK and N-WASP. In addition, we find that SNX9 is required for RhoGTPase-dependent, clathrin-independent endocytosis, and in this capacity can functionally substitute to the bona fide Rho GAP, GTPase regulator associated with focal adhesion kinase (GRAF1). Taken together, our data establish novel roles for SNX9 as a multifunctional protein scaffold that regulates, and potentially coordinates, several cellular processes that together can enhance cancer cell metastasis. PMID:26960793

  16. Ribosomal crystallography: peptide bond formation and its inhibition.

    PubMed

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  17. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  18. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  19. Quantitative assessment of ribosome drop-off in E. coli.

    PubMed

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-04-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength inE. coli Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  20. Whither Ribosome Structure and Dynamics Research? (A Perspective).

    PubMed

    Frank, Joachim

    2016-09-11

    As high-resolution cryogenic electron microscopy (cryo-EM) structures of ribosomes proliferate, at resolutions that allow atomic interactions to be visualized, this article attempts to give a perspective on the way research on ribosome structure and dynamics may be headed, and particularly the new opportunities we have gained through recent advances in cryo-EM. It is pointed out that single-molecule FRET and cryo-EM form natural complements in the characterization of ribosome dynamics and transitions among equilibrating states of in vitro translational systems. PMID:27178840

  1. Quantitative assessment of ribosome drop-off in E. coli

    PubMed Central

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-01-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength in E. coli. Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  2. Minister unveils new nanotech centres

    NASA Astrophysics Data System (ADS)

    Dumé, Belle

    2009-06-01

    Three new nanotechnology research centres are to be set up in France as part of a €70m government plan to help French companies in the sector. Researchers at the new centres, which will be located in Grenoble, Saclay (near Paris) and Toulouse, will be encouraged to collaborate with industry to develop new nanotech-based products. Dubbed NANO-INNOV, the new plan includes €46m for two new buildings at Saclay, with the rest being used to buy new equipment at the three centres and to fund grant proposals from staff to the French National Research Agency (ANR).

  3. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  4. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  5. Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

    PubMed Central

    Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

    2015-01-01

    Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

  6. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  7. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  8. Contemporary design for 'landmark' centre.

    PubMed

    2009-08-01

    As one of the UK's largest builders of healthcare facilities, construction company Morgan Ashurst is accustomed to delivering complex, challenging hospital projects. The construction of a new oncology centre at Musgrove Park Hospital, Taunton for Taunton and Somerset NHS Foundation Trust-- said to be the first new stand-alone radiotherapy centre to be built in the UK for almost 20 years--was no exception. Health Estate Journal reports. PMID:19711668

  9. Cotranslational protein folding on the ribosome monitored in real time.

    PubMed

    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V

    2015-11-27

    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  10. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  11. Cotranslational Protein Folding inside the Ribosome Exit Tunnel.

    PubMed

    Nilsson, Ola B; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D; O'Brien, Edward P; Beckmann, Roland; von Heijne, Gunnar

    2015-09-01

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  12. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar

    2015-01-01

    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  13. Direct ribosomal binding by a cellular inhibitor of translation

    PubMed Central

    Colón-Ramos, Daniel A; Shenvi, Christina L; Weitzel, Douglas H; Gan, Eugene C; Matts, Robert; Cate, Jamie; Kornbluth, Sally

    2009-01-01

    During apoptosis and under conditions of cellular stress, several signaling pathways promote inhibition of cap-dependent translation while allowing continued translation of specific messenger RNAs encoding regulatory and stress-response proteins. We report here that the apoptotic regulator Reaper inhibits protein synthesis by binding directly to the 40S ribosomal subunit. This interaction does not affect either ribosomal association of initiation factors or formation of 43S or 48S complexes. Rather, it interferes with late initiation events upstream of 60S subunit joining, apparently modulating start-codon recognition during scanning. CrPV IRES–driven translation, involving direct ribosomal recruitment to the start site, is relatively insensitive to Reaper. Thus, Reaper is the first known cellular ribosomal binding factor with the potential to allow selective translation of mRNAs initiating at alternative start codons or from certain IRES elements. This function of Reaper may modulate gene expression programs to affect cell fate. PMID:16429152

  14. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; Chapelle, S; De Wachter, R

    1994-01-01

    A database on large ribosomal subunit RNA is made available. It contains 258 sequences. It provides sequence, alignment and secondary structure information in computer-readable formats. Files can be obtained using ftp. PMID:7524023

  15. A process yields large quantities of pure ribosome subunits

    NASA Technical Reports Server (NTRS)

    Friedman, M.; Lu, P.; Rich, A.

    1972-01-01

    Development of process for in-vitro protein synthesis from living cells followed by dissociation of ribosomes into subunits is discussed. Process depends on dialysis or use of chelating agents. Operation of process and advantages over previous methods are outlined.

  16. RTEMS Centre - Support and Maintenance Centre to RTEMS Operating System

    NASA Astrophysics Data System (ADS)

    Silva, H.; Constantino, A.; Freitas, D.; Coutinho, M.; Faustino, S.; Mota, M.; Colaço, P.; Sousa, J.; Dias, L.; Damjanovic, B.; Zulianello, M.; Rufino, J.

    2009-05-01

    RTEMS CENTRE - Support and Maintenance Centre to RTEMS Operating System is a joint ESA/Portuguese Task Force initiative to develop a support and maintenance centre to the Real-Time Executive for Multiprocessor Systems (RTEMS). This paper gives a high level visibility of the progress, the results obtained and the future work in the RTEMS CENTRE [6] and in the RTEMS Improvement [7] projects. RTEMS CENTRE started officially in November 2006, with the RTEMS 4.6.99.2 version. A full analysis of RTEMS operating system was produced. The architecture was analysed in terms of conceptual, organizational and operational concepts. The original objectives [1] of the centre were primarily to create and maintain technical expertise and competences in this RTOS, to develop a website to provide the European Space Community an entry point for obtaining support (http://rtemscentre.edisoft.pt), to design, develop, maintain and integrate some RTEMS support tools (Timeline Tool, Configuration and Management Tools), to maintain flight libraries and Board Support Packages, to develop a strong relationship with the World RTEMS Community and finally to produce some considerations in ARINC-653, DO-178B and ECSS E-40 standards. RTEMS Improvement is the continuation of the RTEMS CENTRE. Currently the RTEMS, version 4.8.0, is being facilitated for a future qualification. In this work, the validation material is being produced following the Galileo Software Standards Development Assurance Level B [5]. RTEMS is being completely tested, errors analysed, dead and deactivated code removed and tests produced to achieve 100% statement and decision coverage of source code [2]. The SW to exploit the LEON Memory Management Unit (MMU) hardware will be also added. A brief description of the expected implementations will be given.

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  18. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  19. Nonenzymatic microorganism identification based on ribosomal RNA

    NASA Astrophysics Data System (ADS)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  20. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  1. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  2. The 16S ribosomal RNA mutation database (16SMDB).

    PubMed Central

    Triman, K L

    1996-01-01

    The 16S ribosomal RNA mutation database (16SMDB) provides a list of mutated positions in 16S ribosomal RNA from Escherichia coli and the identity of each alteration. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation; (ii) whether a mutant phenotype has been detected by in vivo or in vitro methods; (iii) relevant literature citations. The database is available via ftp and on the World Wide Web. PMID:8594570

  3. Crystallization and preliminary X-ray analysis of RabX3, a tandem GTPase from Entamoeba histolytica.

    PubMed

    Kumar Srivastava, Vijay; Chandra, Mintu; Datta, Sunando

    2014-07-01

    Ras superfamily GTPases regulate signalling pathways that control multiple biological processes by modulating the GTP/GDP cycle. Various Rab GTPases, which are the key regulators of vesicular trafficking pathways, play a vital role in the survival and virulence of the enteric parasite Entamoeba histolytica. The Rab GTPases act as binary molecular switches that utilize the conformational changes associated with the GTP/GDP cycle to elicit responses from target proteins and thereby regulate a broad spectrum of cellular processes including cell proliferation, cytoskeletal assembly, nuclear transport and intracellular membrane trafficking in eukaryotes. Entamoeba histolytica RabX3 (EhRabX3) is a unique GTPase in the amoebic genome, the only member in the eukaryotic Ras superfamily that harbours tandem G-domains and shares only 8-16% sequence identity with other GTPases. Recent studies suggested that EhRabX3 binds to a single guanine nucleotide through its N-terminal G-domain (NTD), while the C-terminal G-domain (CTD) plays a potential role in binding of the nucleotide to the NTD. Thus, understanding the intermolecular regulation between the two GTPase domains is expected to reveal valuable information on the overall action of EhRabX3. To provide structural insights into the inclusive action of this unique GTPase, EhRabX3 was crystallized by successive micro-seeding using the vapour-diffusion method. A complete data set was collected to 3.3 Å resolution using a single native EhRabX3 crystal at 100 K on BM14 at the ESRF, Grenoble, France. The crystal belonged to monoclinic space group C2, with unit-cell parameters a=198.6, b=119.3, c=89.2 Å, β=103.1°. Preliminary analysis of the data using the Matthews Probability Calculator suggested the presence of four to six molecules in the asymmetric unit. PMID:25005092

  4. Regulation of Adherens Junctions in Trabecular Meshwork Cells by Rac GTPase and their influence on Intraocular Pressure

    PubMed Central

    Pattabiraman, Padmanabhan P; Epstein, David L; Rao, Ponugoti Vasantha

    2013-01-01

    Intercellular adherens junctions and cell-extracellular matrix interactions are presumed to influence aqueous humor (AH) drainage via the conventional route, however, their direct role in modulation of intraocular pressure (IOP) is not well understood. Here, we investigated the role of Rac GTPase signaling in basal and growth factor-induced formation of adherens junctions in human trabecular meshwork (HTM) cells as compared to human umbilical vascular endothelial cells, and evaluated the effects of inhibition of Rac GTPase activity on IOP in rabbits. Expression of a constitutively active Rac1 GTPase or treatment with platelet derived growth factor (PDGF), a known activator of Rac GTPase, induced formation of β-catenin-based adherens junctions, actin cytoskeletal reorganization and membrane ruffle in HTM cells. In contrast, treatment of HTM cells with inhibitors of Rac GTPase caused cell-cell separation, a decrease in adherens junctions, and reorganization of actin stress fibers to the cell cortical regions and focal adhesion to the cell leading edges. Both, constitutively active Rac1 and PDGF stimulated generation of Reactive Oxygen Species (ROS) in HTM cells, and ROS were found to increase adherens junction formation and transendothelial electrical resistance (TEER) in HTM cells. Topical application of Rac GTPase inhibitors (EHT1864 and NSC23766), however, only marginally influenced IOP in rabbit eyes. Taken together, these data reveal that while Rac GTPase signaling plays a significant role in regulation of adherens junctions, ROS production and TEER in cells of the AH outflow pathway, Rac inhibitors showed only a marginal influence on IOP in live rabbits. PMID:24932460

  5. Regulation of Adherens Junctions in Trabecular Meshwork Cells by Rac GTPase and their influence on Intraocular Pressure.

    PubMed

    Pattabiraman, Padmanabhan P; Epstein, David L; Rao, Ponugoti Vasantha

    2013-06-01

    Intercellular adherens junctions and cell-extracellular matrix interactions are presumed to influence aqueous humor (AH) drainage via the conventional route, however, their direct role in modulation of intraocular pressure (IOP) is not well understood. Here, we investigated the role of Rac GTPase signaling in basal and growth factor-induced formation of adherens junctions in human trabecular meshwork (HTM) cells as compared to human umbilical vascular endothelial cells, and evaluated the effects of inhibition of Rac GTPase activity on IOP in rabbits. Expression of a constitutively active Rac1 GTPase or treatment with platelet derived growth factor (PDGF), a known activator of Rac GTPase, induced formation of β-catenin-based adherens junctions, actin cytoskeletal reorganization and membrane ruffle in HTM cells. In contrast, treatment of HTM cells with inhibitors of Rac GTPase caused cell-cell separation, a decrease in adherens junctions, and reorganization of actin stress fibers to the cell cortical regions and focal adhesion to the cell leading edges. Both, constitutively active Rac1 and PDGF stimulated generation of Reactive Oxygen Species (ROS) in HTM cells, and ROS were found to increase adherens junction formation and transendothelial electrical resistance (TEER) in HTM cells. Topical application of Rac GTPase inhibitors (EHT1864 and NSC23766), however, only marginally influenced IOP in rabbit eyes. Taken together, these data reveal that while Rac GTPase signaling plays a significant role in regulation of adherens junctions, ROS production and TEER in cells of the AH outflow pathway, Rac inhibitors showed only a marginal influence on IOP in live rabbits. PMID:24932460

  6. Extensive in silico analysis of Mimivirus coded Rab GTPase homolog suggests a possible role in virion membrane biogenesis

    PubMed Central

    Zade, Amrutraj; Sengupta, Malavi; Kondabagil, Kiran

    2015-01-01

    Rab GTPases are the key regulators of intracellular membrane trafficking in eukaryotes. Many viruses and intracellular bacterial pathogens have evolved to hijack the host Rab GTPase functions, mainly through activators and effector proteins, for their benefit. Acanthamoeba polyphaga mimivirus (APMV) is one of the largest viruses and belongs to the monophyletic clade of nucleo-cytoplasmic large DNA viruses (NCLDV). The inner membrane lining is integral to the APMV virion structure. APMV assembly involves extensive host membrane modifications, like vesicle budding and fusion, leading to the formation of a membrane sheet that is incorporated into the virion. Intriguingly, APMV and all group I members of the Mimiviridae family code for a putative Rab GTPase protein. APMV is the first reported virus to code for a Rab GTPase (encoded by R214 gene). Our thorough in silico analysis of the subfamily specific (SF) region of Mimiviridae Rab GTPase sequences suggests that they are related to Rab5, a member of the group II Rab GTPases, of lower eukaryotes. Because of their high divergence from the existing three isoforms, A, B, and C of the Rab5-family, we suggest that Mimiviridae Rabs constitute a new isoform, Rab5D. Phylogenetic analysis indicated probable horizontal acquisition from a lower eukaryotic ancestor followed by selection and divergence. Furthermore, interaction network analysis suggests that vps34 (a Class III PI3K homolog, coded by APMV L615), Atg-8 and dynamin (host proteins) are recruited by APMV Rab GTPase during capsid assembly. Based on these observations, we hypothesize that APMV Rab plays a role in the acquisition of inner membrane during virion assembly. PMID:26441866

  7. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  8. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  9. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  10. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  11. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  12. The inhibition of the GTPase activating protein-Ha-ras interaction by acidic lipids is due to physical association of the C-terminal domain of the GTPase activating protein with micellar structures.

    PubMed Central

    Serth, J; Lautwein, A; Frech, M; Wittinghofer, A; Pingoud, A

    1991-01-01

    The effects of fatty acids and phospholipids on the interaction of the full-length GTPase activating protein (GAP) as well as its isolated C-terminal domain and the Ha-ras proto-oncogene product p21 were studied by various methods, viz. GTPase activity measurements, fluorescence titrations and gel permeation chromatography. It is shown that all fatty acids and acidic phospholipids tested, provided the critical micellar concentration and the critical micellar temperature are reached, inhibit the GAP stimulated p21 GTPase activity. This is interpreted to mean that it is not the molecular structure of acidic lipid molecules per se but rather their physical state of aggregation which is responsible for the inhibitory effect of lipids on the GTPase activity. The relative inhibitory potency of various lipids was measured under defined conditions with mixed Triton X-100 micelles to follow the order: unsaturated fatty acids greater than saturated acids approximately phosphatidic acids greater than or equal to phosphatidylinositol phosphates much greater than phosphatidylinositol and phosphatidylserine. GTPase experiments with varying concentrations of p21 and constant concentrations of GAP and lipids indicate that the binding of GAP by the lipid micelles is responsible for the inhibition, a finding which was confirmed by fluorescence titrations and gel filtrations which show that the C-terminal domain of GAP is bound by lipid micelles. PMID:2026138

  13. Bem3, a Cdc42 GTPase-activating protein, traffics to an intracellular compartment and recruits the secretory Rab GTPase Sec4 to endomembranes

    PubMed Central

    Mukherjee, Debarati; Sen, Arpita; Boettner, Douglas R.; Fairn, Gregory D.; Schlam, Daniel; Bonilla Valentin, Fernando J.; Michael McCaffery, J.; Hazbun, Tony; Staiger, Chris J.; Grinstein, Sergio; Lemmon, Sandra K.; Claudio Aguilar, R.

    2013-01-01

    Summary Cell polarity is essential for many cellular functions including division and cell-fate determination. Although RhoGTPase signaling and vesicle trafficking are both required for the establishment of cell polarity, the mechanisms by which they are coordinated are unclear. Here, we demonstrate that the yeast RhoGAP (GTPase activating protein), Bem3, is targeted to sites of polarized growth by the endocytic and recycling pathways. Specifically, deletion of SLA2 or RCY1 led to mislocalization of Bem3 to depolarized puncta and accumulation in intracellular compartments, respectively. Bem3 partitioned between the plasma membrane and an intracellular membrane-bound compartment. These Bem3-positive structures were polarized towards sites of bud emergence and were mostly observed during the pre-mitotic phase of apical growth. Cell biological and biochemical approaches demonstrated that this intracellular Bem3 compartment contained markers for both the endocytic and secretory pathways, which were reminiscent of the Spitzenkörper present in the hyphal tips of growing fungi. Importantly, Bem3 was not a passive cargo, but recruited the secretory Rab protein, Sec4, to the Bem3-containing compartments. Moreover, Bem3 deletion resulted in less efficient localization of Sec4 to bud tips during early stages of bud emergence. Surprisingly, these effects of Bem3 on Sec4 were independent of its GAP activity, but depended on its ability to efficiently bind endomembranes. This work unveils unsuspected and important details of the relationship between vesicle traffic and elements of the cell polarity machinery: (1) Bem3, a cell polarity and peripherally associated membrane protein, relies on vesicle trafficking to maintain its proper localization; and (2) in turn, Bem3 influences secretory vesicle trafficking. PMID:23943876

  14. Increased ribosome density associated to positively charged residues is evident in ribosome profiling experiments performed in the absence of translation inhibitors.

    PubMed

    Requião, Rodrigo D; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana; Palhano, Fernando L

    2016-06-01

    It has been proposed that polybasic peptides cause slower movement of ribosomes through an electrostatic interaction with the highly negative ribosome exit tunnel. Ribosome profiling data-the sequencing of short ribosome-bound fragments of mRNA-is a powerful tool for the analysis of mRNA translation. Using the yeast Saccharomyces cerevisiae as a model, we showed that reduced translation efficiency associated with polybasic protein sequences could be inferred from ribosome profiling. However, an increase in ribosome density at polybasic sequences was evident only when the commonly used translational inhibitors cycloheximide and anisomycin were omitted during mRNA isolation. Since ribosome profiling performed without inhibitors agrees with experimental evidence obtained by other methods, we conclude that cycloheximide and anisomycin must be avoided in ribosome profiling experiments. PMID:27064519

  15. Chemical probing of the tRNA--ribosome complex.

    PubMed Central

    Peattie, D A; Herr, W

    1981-01-01

    We probed the (Escherichia coli) tRNAPhe--ribosome interaction with the chemical reagents dimethyl sulfate and diethyl pyrocarbonate. This monitored the higher-order structure of the tRNA in this biological complex and identified critical sites in the tRNA molecule involved in binding to the ribosome. The methylation of the N-7 position of guanosine and the N-3 position of cytidine as well as diethyl pyrocarbonate attack on adenosines are sensitive to secondary and tertiary interactions. Here we identify specific bases in E. coli Phe-tRNAPhe affected by the interaction with the ribosome. The 70S ribosome protects the N-3 position of cytidine-74 and 75 in the 3'-terminal C-C-A, suggesting a strong, possibly base pairing, interaction between the ribosome and that universal sequence. The ribosome also induces strong reactivities at the N-7 positions of G-24 and G-46 in the central region of the tRNA molecule near the variable-loop domain as well as less significant reactivities at 11 other guanosines. Two of these, G-10 and G-44, are close to G-24 and G-46 in the center of the molecule; the others (guanosines 1, 5, 6, 18, 19, 63, 65, 69, and 71) are in the coaxial acceptor stem-T stem helix. All of the effects are ribosome induced and occur in the presence or absence of the messenger poly(U). Prior chemical modification of the anticodon bases as well as the two adjacent 3' purines and, less effectively, four purines in the anticodon stem prevent stable poly(U)-directed ribosome binding. Thus, we identify the 3' terminal C-C-A sequence, near the peptidyl transferase site, and the anticodon stem and loop of tRNAPhe as forming critical contacts with the ribosome. Other regions of the molecule become reactive on ribosome binding, but these do not suggest a significant conformational change being more likely due to a change of environment. Images PMID:6166006

  16. Protease-Resistant and Cell-Permeable Double-Stapled Peptides Targeting the Rab8a GTPase.

    PubMed

    Cromm, Philipp M; Spiegel, Jochen; Küchler, Philipp; Dietrich, Laura; Kriegesmann, Julia; Wendt, Mathias; Goody, Roger S; Waldmann, Herbert; Grossmann, Tom N

    2016-08-19

    Small GTPases comprise a family of highly relevant targets in chemical biology and medicinal chemistry research and have been considered "undruggable" due to the persisting lack of effective synthetic modulators and suitable binding pockets. As molecular switches, small GTPases control a multitude of pivotal cellular functions, and their dysregulation is associated with many human diseases such as various forms of cancer. Rab-GTPases represent the largest subfamily of small GTPases and are master regulators of vesicular transport interacting with various proteins via flat and extensive protein-protein interactions (PPIs). The only reported synthetic inhibitor of a PPI involving an activated Rab GTPase is the hydrocarbon stapled peptide StRIP3. However, this macrocyclic peptide shows low proteolytic stability and cell permeability. Here, we report the design of a bioavailable StRIP3 analogue that harbors two hydrophobic cross-links and exhibits increased binding affinity, combined with robust cellular uptake and extremely high proteolytic stability. Localization experiments reveal that this double-stapled peptide and its target protein Rab8a accumulate in the same cellular compartments. The reported approach offers a strategy for the implementation of biostability into conformationally constrained peptides while supporting cellular uptake and target affinity, thereby conveying drug-like properties. PMID:27336832

  17. An N-terminally acetylated Arf-like GTPase is localised to lysosomes and affects their motility.

    PubMed

    Hofmann, Irmgard; Munro, Sean

    2006-04-15

    Small GTPases of the Arf and Rab families play key roles in the function of subcellular organelles. Each GTPase is usually found on only one compartment and, hence, they confer organelle specificity to many intracellular processes. However, there has so far been little evidence for specific GTPases present on lysosomes. Here, we report that two closely related human Arf-like GTPases, Arl8a and Arl8b (also known as Arl10b/c and Gie1/2), localise to lysosomes in mammalian cells, with the single homologue in Drosophila cells having a similar location. Conventionally, membrane binding of Arf and Arl proteins is mediated by both an N-terminal myristoyl group and an N-terminal amphipathic helix that is inserted into the lipid bilayer upon activation of the GTPase. Arl8a and Arl8b do not have N-terminal myristoylation sites, and we find that Arl8b is instead N-terminally acetylated, and an acetylated methionine is necessary for its lysosomal localization. Overexpression of Arl8a or Arl8b results in a microtubule-dependent redistribution of lysosomes towards the cell periphery. Live cell imaging shows that lysosomes move more frequently both toward and away from the cell periphery, suggesting a role for Arl8a and Arl8b as positive regulators of lysosomal transport. PMID:16537643

  18. Crystal structure of a dynamin GTPase domain in both nucleotide-free and GDP-bound forms

    PubMed Central

    Niemann, Hartmut H.; Knetsch, Menno L.W.; Scherer, Anna; Manstein, Dietmar J.; Kull, F.Jon

    2001-01-01

    Dynamins form a family of multidomain GTPases involved in endocytosis, vesicle trafficking and maintenance of mitochondrial morphology. In contrast to the classical switch GTPases, a force-generating function has been suggested for dynamins. Here we report the 2.3 Å crystal structure of the nucleotide-free and GDP-bound GTPase domain of Dictyostelium discoideum dynamin A. The GTPase domain is the most highly conserved region among dynamins. The globular structure contains the G-protein core fold, which is extended from a six-stranded β-sheet to an eight-stranded one by a 55 amino acid insertion. This topologically unique insertion distinguishes dynamins from other subfamilies of GTP-binding proteins. An additional N-terminal helix interacts with the C-terminal helix of the GTPase domain, forming a hydrophobic groove, which could be occupied by C-terminal parts of dynamin not present in our construct. The lack of major conformational changes between the nucleotide-free and the GDP-bound state suggests that mechanochemical rearrangements in dynamin occur during GTP binding, GTP hydrolysis or phosphate release and are not linked to loss of GDP. PMID:11689422

  19. The role of GTP in transient splitting of 70S ribosomes by RRF (ribosome recycling factor) and EF-G (elongation factor G)

    PubMed Central

    Hirokawa, Go; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko

    2008-01-01

    Ribosome recycling factor (RRF), elongation factor G (EF-G) and GTP split 70S ribosomes into subunits. Here, we demonstrated that the splitting was transient and the exhaustion of GTP resulted in re-association of the split subunits into 70S ribosomes unless IF3 (initiation factor 3) was present. However, the splitting was observed with sucrose density gradient centrifugation (SDGC) without IF3 if RRF, EF-G and GTP were present in the SDGC buffer. The splitting of 70S ribosomes causes the decrease of light scattering by ribosomes. Kinetic constants obtained from the light scattering studies are sufficient to account for the splitting of 70S ribosomes by RRF and EF-G/GTP during the lag phase for activation of ribosomes for the log phase. As the amount of 70S ribosomes increased, more RRF, EF-G and GTP were necessary to split 70S ribosomes. In the presence of a physiological amount of polyamines, GTP and factors, even 0.6 μM 70S ribosomes (12 times higher than the 70S ribosomes for routine assay) were split. Spermidine (2 mM) completely inhibited anti-association activity of IF3, and the RRF/EF-G/GTP-dependent splitting of 70S ribosomes. PMID:18948280

  20. Mechanism and rate constants of the Cdc42 GTPase binding with intrinsically disordered effectors.

    PubMed

    Pang, Xiaodong; Zhou, Huan-Xiang

    2016-05-01

    Intrinsically disordered proteins (IDPs) are often involved in signaling and regulatory functions, through binding to cellular targets. Many IDPs undergo disorder-to-order transitions upon binding. Both the binding mechanisms and the magnitudes of the binding rate constants can have functional importance. Previously we have found that the coupled binding and folding of any IDP generally follows a sequential mechanism that we term dock-and-coalesce, whereby one segment of the IDP first docks to its subsite on the target surface and the remaining segments subsequently coalesce around their respective subsites. Here we applied our TransComp method within the framework of the dock-and-coalesce mechanism to dissect the binding kinetics of two Rho-family GTPases, Cdc42 and TC10, with two intrinsically disordered effectors, WASP and Pak1. TransComp calculations identified the basic regions preceding the GTPase binding domains (GBDs) of the effectors as the docking segment. For Cdc42 binding with both WASP and Pak1, the calculated docking rate constants are close to the observed overall binding rate constants, suggesting that basic-region docking is the rate-limiting step and subsequent conformational coalescence of the GBDs on the Cdc42 surface is fast. The possibility that conformational coalescence of the WASP GBD on the TC10 surface is slow warrants further experimental investigation. The account for the differences in binding rate constants among the three GTPase-effector systems and mutational effects therein yields deep physical and mechanistic insight into the binding processes. Our approach may guide the selection of mutations that lead to redesigned binding pathways. Proteins 2016; 84:674-685. © 2016 Wiley Periodicals, Inc. PMID:26879470

  1. Morelloflavone, a biflavonoid, inhibits tumor angiogenesis by targeting Rho GTPases and ERK signaling pathways

    PubMed Central

    Pang, Xiufeng; Yi, Tingfang; Yi, Zhengfang; Cho, Sung Gook; Qu, Weijing; Pinkaew, Decha; Fujise, Ken; Liu, Mingyao

    2009-01-01

    Morelloflavone, a biflavonoid extracted from Garcinia dulcis, has shown anti-oxidative, antiviral, and anti-inflammatory properties. However, the function and the mechanism of this compound in cancer treatment and tumor angiogenesis have not been elucidated to date. In this study, we postulated that morelloflavone might have the ability to inhibit angiogenesis, the pivotal step in tumor growth, invasiveness and metastasis. We demonstrated that morelloflavone could inhibit vascular endothelial growth factor (VEGF)-induced cell proliferation, migration, invasion, and capillary-like tube formation of primary cultured human umbilical endothelial cells (HUVECs) in a dose-dependent manner. Morelloflavone effectively inhibited microvessel sprouting of endothelial cells in the rat aortic ring assay and the formation of new blood microvessels induced by VEGF in the mouse Matrigel plug assay. Furthermore, morelloflavone inhibited tumor growth and tumor angiogenesis of prostate cancer cells (PC-3) in xenograft mouse tumor model in vivo, suggesting that morelloflavone inhibited tumorigenesis by targeting angiogenesis. To understand the underlying mechanism of morelloflavone on the inhibitory effect of tumor growth and angiogenesis, we demonstrated that morelloflavone could inhibit the activation of both RhoA and Rac1 GTPases, but have little effect on the activation of Cdc42 GTPase. Additionally, morelloflavone inhibited the phosphorylation and activation of Raf/MEK/ERK pathway kinases without affecting VEGFR2 activity. Together, our results indicate that morelloflavone exerts anti-angiogenic action by targeting the activation of Rho-GTPases and ERK signaling pathways. These findings are the first to reveal the novel functions of morelloflavone in tumor angiogenesis and its molecular basis for the anticancer action. PMID:19147565

  2. Sar1 GTPase Activity Is Regulated by Membrane Curvature*♦

    PubMed Central

    Hanna, Michael G.; Mela, Ioanna; Wang, Lei; Henderson, Robert M.; Chapman, Edwin R.; Edwardson, J. Michael; Audhya, Anjon

    2016-01-01

    The majority of biosynthetic secretory proteins initiate their journey through the endomembrane system from specific subdomains of the endoplasmic reticulum. At these locations, coated transport carriers are generated, with the Sar1 GTPase playing a critical role in membrane bending, recruitment of coat components, and nascent vesicle formation. How these events are appropriately coordinated remains poorly understood. Here, we demonstrate that Sar1 acts as the curvature-sensing component of the COPII coat complex and highlight the ability of Sar1 to bind more avidly to membranes of high curvature. Additionally, using an atomic force microscopy-based approach, we further show that the intrinsic GTPase activity of Sar1 is necessary for remodeling lipid bilayers. Consistent with this idea, Sar1-mediated membrane remodeling is dramatically accelerated in the presence of its guanine nucleotide-activating protein (GAP), Sec23-Sec24, and blocked upon addition of guanosine-5′-[(β,γ)-imido]triphosphate, a poorly hydrolysable analog of GTP. Our results also indicate that Sar1 GTPase activity is stimulated by membranes that exhibit elevated curvature, potentially enabling Sar1 membrane scission activity to be spatially restricted to highly bent membranes that are characteristic of a bud neck. Taken together, our data support a stepwise model in which the amino-terminal amphipathic helix of GTP-bound Sar1 stably penetrates the endoplasmic reticulum membrane, promoting local membrane deformation. As membrane bending increases, Sar1 membrane binding is elevated, ultimately culminating in GTP hydrolysis, which may destabilize the bilayer sufficiently to facilitate membrane fission. PMID:26546679

  3. Cyclin D1 interacts and collaborates with Ral GTPases enhancing cell detachment and motility.

    PubMed

    Fernández, R M H; Ruiz-Miró, M; Dolcet, X; Aldea, M; Garí, E

    2011-04-21

    Alterations in the levels of adhesion and motility of cells are critical events in the development of metastasis. Cyclin D1 (CycD1) is one of the most frequently amplified oncogenes in many types of cancers and it is also associated with the development of metastasis. Despite this, we still do not know which are all the relevant pathways by which CycD1 induces oncogenic processes. CycD1 functions can be either dependent or independent of the cyclin-dependent kinase Cdk4, and they affect several cellular aspects such as proliferation, cell attachment and migration. In this work, we reveal a novel function of CycD1 that fosters our understanding of the oncogenic potential of CycD1. We show that CycD1 binds to the small GTPases Ral A and B, which are involved, through exocyst regulation, in the progression of metastatic cancers, inducing anchorage-independent growth and cell survival of transformed cells. We show that CycD1 binds active Ral complexes and the exocyst protein Sec6, and co-localizes with Ral GTPases in trans-Golgi and exocyst-rich regions. We have also observed that CycD1-Cdk4 phosphorylates the Ral GEF Rgl2 'in vitro' and that CycD1-Cdk4 activity stimulates accumulation of the Ral GTP active forms. In accordance with this, our data suggest that CycD1-Cdk4 enhances cell detachment and motility in collaboration with Ral GTPases. This new function may help explain the contribution of CycD1 to tumor spreading. PMID:21242975

  4. Control of postnatal apoptosis in the neocortex by RhoA-subfamily GTPases determines neuronal density.

    PubMed

    Sanno, Hitomi; Shen, Xiao; Kuru, Nilgün; Bormuth, Ingo; Bobsin, Kristin; Gardner, Humphrey A R; Komljenovic, Dorde; Tarabykin, Victor; Erzurumlu, Reha S; Tucker, Kerry L

    2010-03-24

    Apoptosis of neurons in the maturing neocortex has been recorded in a wide variety of mammals, but very little is known about its effects on cortical differentiation. Recent research has implicated the RhoA GTPase subfamily in the control of apoptosis in the developing nervous system and in other tissue types. Rho GTPases are important components of the signaling pathways linking extracellular signals to the cytoskeleton. To investigate the role of the RhoA GTPase subfamily in neocortical apoptosis and differentiation, we have engineered a mouse line in which a dominant-negative RhoA mutant (N19-RhoA) is expressed from the Mapt locus, such that all neurons of the developing nervous system are expressing the N19-RhoA inhibitor. Postnatal expression of N19-RhoA led to no major changes in neocortical anatomy. Six layers of the neocortex developed and barrels (whisker-related neural modules) formed in layer IV. However, the density and absolute number of neurons in the somatosensory cortex increased by 12-26% compared with wild-type littermates. This was not explained by a change in the migration of neurons during the formation of cortical layers but rather by a large decrease in the amount of neuronal apoptosis at postnatal day 5, the developmental maximum of cortical apoptosis. In addition, overexpression of RhoA in cortical neurons was seen to cause high levels of apoptosis. These results demonstrate that RhoA-subfamily members play a major role in developmental apoptosis in postnatal neocortex of the mouse but that decreased apoptosis does not alter cortical cytoarchitecture and patterning. PMID:20335457

  5. Control of postnatal apoptosis in the neocortex by RhoA-subfamily GTPases determines neuronal density

    PubMed Central

    Sanno, Hitomi; Shen, Xiao; Kuru, Nilgün; Bormuth, Ingo; Bobsin, Kristin; Komljenovic, Dorde; Tarabykin, Victor; Erzurumlu, Reha S.; Tucker, Kerry L.

    2010-01-01

    Apoptosis of neurons in the maturing neocortex has been recorded in a wide variety of mammals, but very little is known about its effects on cortical differentiation. Recent research has implicated the RhoA GTPase subfamily in the control of apoptosis in the developing nervous system and in other tissue types. Rho GTPases are important components of the signaling pathways linking extracellular signals to the cytoskeleton. To investigate the role of the RhoA GTPase subfamily in neocortical apoptosis and differentiation, we have engineered a mouse line in which a dominant-negative RhoA mutant (N19-RhoA) is expressed from the Mapt locus, such that all neurons of the developing nervous system are expressing the N19-RhoA inhibitor. Postnatal expression of N19-RhoA led to no major changes in neocortical anatomy. Six layers of the neocortex developed and barrels (whisker-related neural modules) formed in layer IV. However, the density and absolute number of neurons in the somatosensory cortex increased by 12 - 26%, as compared to wildtype littermates. This was not explained by a change in the migration of neurons during the formation of cortical layers, but rather by a large decrease in the amount of neuronal apoptosis at P5, the developmental maximum of cortical apoptosis. In addition, overexpression of RhoA in cortical neurons was seen to cause high levels of apoptosis. These results demonstrate that RhoA-subfamily members play a major role in developmental apoptosis in postnatal neocortex of the mouse, but that decreased apoptosis does not alter cortical cytoarchitecture and patterning. PMID:20335457

  6. Small rho GTPases mediate tumor-induced inhibition of endocytic activity of dendritic cells.

    PubMed

    Tourkova, Irina L; Shurin, Galina V; Wei, Sheng; Shurin, Michael R

    2007-06-15

    The generation, maturation, and function of dendritic cells (DC) have been shown to be markedly compromised in the tumor microenvironment in animals and humans. However, the molecular mechanisms and intracellular pathways involved in the regulation of the DC system in cancer are not yet fully understood. Recently, we have reported on the role of the small Rho GTPase family members Cdc42, Rac1, and RhoA in regulating DC adherence, motility, and Ag presentation. To investigate involvement of small Rho GTPases in dysregulation of DC function by tumors, we next evaluated how Cdc42, Rac1, and RhoA regulated endocytic activity of DC in the tumor microenvironment. We revealed a decreased uptake of dextran 40 and polystyrene beads by DC generated in the presence of different tumor cell lines, including RM1 prostate, MC38 colon, 3LL lung, and B7E3 oral squamous cell carcinomas in vitro and by DC prepared from tumor-bearing mice ex vivo. Impaired endocytic activity of DC cocultured with tumor cells was associated with decreased levels of active Cdc42 and Rac1. Transduction of DC with the dominant negative Cdc42 and Rac1 genes also led to reduced phagocytosis and receptor-mediated endocytosis. Furthermore, transduction of DC with the constitutively active Cdc42 and Rac1 genes restored endocytic activity of DC that was inhibited by the tumors. Thus, our results suggest that tumor-induced dysregulation of endocytic activity of DC is mediated by reduced activity of several members of the small Rho GTPase family, which might serve as new targets for improving the efficacy of DC vaccines. PMID:17548616

  7. Mitofusin 1 and 2 play distinct roles in mitochondrial fusion reactions via GTPase activity.

    PubMed

    Ishihara, Naotada; Eura, Yuka; Mihara, Katsuyoshi

    2004-12-15

    The mammalian homologues of yeast and Drosophila Fzo, mitofusin (Mfn) 1 and 2, are both essential for mitochondrial fusion and maintenance of mitochondrial morphology. Though the GTPase domain is required for Mfn protein function, the molecular mechanisms of the GTPase-dependent reaction as well as the functional division of the two Mfn proteins are unknown. To examine the function of Mfn proteins, tethering of mitochondrial membranes was measured in vitro by fluorescence microscopy using green fluorescence protein- or red fluorescent protein-tagged and Mfn1-expressing mitochondria, or by immunoprecipitation using mitochondria harboring HA- or FLAG-tagged Mfn proteins. These experiments revealed that Mfn1-harboring mitochondria were efficiently tethered in a GTP-dependent manner, whereas Mfn2-harboring mitochondria were tethered with only low efficiency. Sucrose density gradient centrifugation followed by co-immunoprecipitation revealed that Mfn1 produced oligomerized approximately 250 kDa and approximately 450 kDa complexes in a GTP-dependent manner. The approximately 450 kDa complex contained oligomerized Mfn1 from distinct apposing membranes (docking complex), whereas the approximately 250 kDa complex was composed of Mfn1 present on the same membrane or in the membrane-solubilized state (cis complex). These results were also confirmed using blue-native PAGE. Mfn1 exhibited higher activity for this reaction than Mfn2. Purified recombinant Mfn1 exhibited approximately eightfold higher GTPase activity than Mfn2. These findings indicate that the two Mfn proteins have distinct activities, and suggest that Mfn1 is mainly responsible for GTP-dependent membrane tethering. PMID:15572413

  8. Extracellular Superoxide Dismutase Regulates the Expression of Small GTPase Regulatory Proteins GEFs, GAPs, and GDI

    PubMed Central

    Laukkanen, Mikko O.; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D.

    2015-01-01

    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3–induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3–driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  9. Extracellular superoxide dismutase regulates the expression of small gtpase regulatory proteins GEFs, GAPs, and GDI.

    PubMed

    Laukkanen, Mikko O; Cammarota, Francesca; Esposito, Tiziana; Salvatore, Marco; Castellone, Maria D

    2015-01-01

    Extracellular superoxide dismutase (SOD3), which catalyzes the dismutation of superoxide anions to hydrogen peroxide at the cell membranes, regulates the cellular growth in a dose-dependent manner. This enzyme induces primary cell proliferation and immortalization at low expression levels whereas it activates cancer barrier signaling through the p53-p21 pathway at high expression levels, causing growth arrest, senescence, and apoptosis. Because previous reports suggested that the SOD3-induced reduction in the rates of cellular growth and migration also occurred in the absence of functional p53 signaling, in the current study we investigated the SOD3-induced growth-suppressive mechanisms in anaplastic thyroid cancer cells. Based on our data, the robust over-expression of SOD3 increased the level of phosphorylation of the EGFR, ERBB2, RYK, ALK, FLT3, and EPHA10 receptor tyrosine kinases with the consequent downstream activation of the SRC, FYN, YES, HCK, and LYN kinases. However, pull-down experiments focusing on the small GTPase RAS, RAC, CDC42, and RHO revealed a reduced level of growth and migration signal transduction, such as the lack of stimulation of the mitogen pathway, in the SOD3 over-expressing cells, which was confirmed by MEK1/2 and ERK1/2 Western blotting analysis. Interestingly, the mRNA expression analyses indicated that SOD3 regulated the expression of guanine nucleotide-exchange factors (RHO GEF16, RAL GEF RGL1), GTPase-activating proteins (ARFGAP ADAP2, RAS GAP RASAL1, RGS4), and a Rho guanine nucleotide-disassociation inhibitor (RHO GDI 2) in a dose dependent manner, thus controlling signaling through the small G protein GTPases. Therefore, our current data may suggest the occurrence of dose-dependent SOD3-driven control of the GTP loading of small G proteins indicating a novel growth regulatory mechanism of this enzyme. PMID:25751262

  10. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  11. Phosphoproteomic screening identifies Rab GTPases as novel downstream targets of PINK1.

    PubMed

    Lai, Yu-Chiang; Kondapalli, Chandana; Lehneck, Ronny; Procter, James B; Dill, Brian D; Woodroof, Helen I; Gourlay, Robert; Peggie, Mark; Macartney, Thomas J; Corti, Olga; Corvol, Jean-Christophe; Campbell, David G; Itzen, Aymelt; Trost, Matthias; Muqit, Miratul Mk

    2015-11-12

    Mutations in the PTEN-induced kinase 1 (PINK1) are causative of autosomal recessive Parkinson's disease (PD). We have previously reported that PINK1 is activated by mitochondrial depolarisation and phosphorylates serine 65 (Ser(65)) of the ubiquitin ligase Parkin and ubiquitin to stimulate Parkin E3 ligase activity. Here, we have employed quantitative phosphoproteomics to search for novel PINK1-dependent phosphorylation targets in HEK (human embryonic kidney) 293 cells stimulated by mitochondrial depolarisation. This led to the identification of 14,213 phosphosites from 4,499 gene products. Whilst most phosphosites were unaffected, we strikingly observed three members of a sub-family of Rab GTPases namely Rab8A, 8B and 13 that are all phosphorylated at the highly conserved residue of serine 111 (Ser(111)) in response to PINK1 activation. Using phospho-specific antibodies raised against Ser(111) of each of the Rabs, we demonstrate that Rab Ser(111) phosphorylation occurs specifically in response to PINK1 activation and is abolished in HeLa PINK1 knockout cells and mutant PINK1 PD patient-derived fibroblasts stimulated by mitochondrial depolarisation. We provide evidence that Rab8A GTPase Ser(111) phosphorylation is not directly regulated by PINK1 in vitro and demonstrate in cells the time course of Ser(111) phosphorylation of Rab8A, 8B and 13 is markedly delayed compared to phosphorylation of Parkin at Ser(65). We further show mechanistically that phosphorylation at Ser(111) significantly impairs Rab8A activation by its cognate guanine nucleotide exchange factor (GEF), Rabin8 (by using the Ser111Glu phosphorylation mimic). These findings provide the first evidence that PINK1 is able to regulate the phosphorylation of Rab GTPases and indicate that monitoring phosphorylation of Rab8A/8B/13 at Ser(111) may represent novel biomarkers of PINK1 activity in vivo. Our findings also suggest that disruption of Rab GTPase-mediated signalling may represent a major mechanism

  12. Structure of the catalytic domain of Plasmodium falciparum ARF GTPase-activating protein (ARFGAP)

    SciTech Connect

    Cook, William J.; Senkovich, Olga; Chattopadhyay, Debasish

    2012-03-26

    The crystal structure of the catalytic domain of the ADP ribosylation factor GTPase-activating protein (ARFGAP) from Plasmodium falciparum has been determined and refined to 2.4 {angstrom} resolution. Multiwavelength anomalous diffraction (MAD) data were collected utilizing the Zn{sup 2+} ion bound at the zinc-finger domain and were used to solve the structure. The overall structure of the domain is similar to those of mammalian ARFGAPs. However, several amino-acid residues in the area where GAP interacts with ARF1 differ in P. falciparum ARFGAP. Moreover, a number of residues that form the dimer interface in the crystal structure are unique in P. falciparum ARFGAP.

  13. Regulation of Cancer Cell Behavior by the Small GTPase Rab13.

    PubMed

    Ioannou, Maria S; McPherson, Peter S

    2016-05-01

    The members of the Rab family of GTPases are master regulators of cellular membrane trafficking. With ∼70 members in humans, Rabs have been implicated in all steps of membrane trafficking ranging from vesicle formation and transport to vesicle docking/tethering and fusion. Vesicle trafficking controls the localization and levels of a myriad of proteins, thus regulating cellular functions including proliferation, metabolism, cell-cell adhesion, and cell migration. It is therefore not surprising that impairment of Rab pathways is associated with diseases including cancer. In this review, we highlight evidence supporting the role of Rab13 as a potent driver of cancer progression. PMID:27044746

  14. RAB and RHO GTPases regulate intestinal crypt cell homeostasis and enterocyte function.

    PubMed

    Zhang, Xiao; Gao, Nan

    2016-04-01

    Recent human and mouse genetic studies have highlighted important contributions of several small GTPases, in particular Rab8a, (1) Cdc42, (2-4) and Rab11a, (5-8) to the proper morphogenesis and function of the mature intestinal epithelia. Additional insights about the involvement of these factors in maintaining intestinal stem cell homeostasis have also been obtained. (9,10) These studies suggest a conserved vesicular and membrane trafficking program utilized by the gastrointestinal tissue to support the rapid epithelial cell turnover and the highly sophisticated physiology of mature epithelial cells. PMID:27142493

  15. Regulation of hematopoietic stem cell aging by the small RhoGTPase Cdc42

    PubMed Central

    Geiger, Hartmut; Zheng, Yi

    2015-01-01

    Summary Aging of stem cells might be the underlying cause of tissue aging in tissue that in the adult heavily rely on stem cell activity, like the blood forming system. Hematopoiesis, the generation of blood forming cells, is sustained by hematopoietic stem cells. In this review article, we introduce the canonical set of phenotypes associated with aged HSCs, focus on the novel aging-associated phenotype apolarity caused by elevated activity of the small RhoGTPase in aged HSCs, disuccs the role of Cdc42 in hematopoiesis and describe that pharmacological inhibition of Cdc42 activity in aged HSCs results in functionally young and thus rejuvenated HSCs. PMID:25220425

  16. P-cadherin-mediated Rho GTPase regulation during collective cell migration

    PubMed Central

    Plutoni, Cédric; Bazellières, Elsa; Gauthier-Rouvière, Cécile

    2016-01-01

    ABSTRACT This commentary addresses the role of P-cadherin in collective cell migration (CCM), a cooperative and coordinated migration mode, used by cells during normal and pathological migration processes. We discuss how cadherin-mediated cell-cell junctions (CCJs) play a critical role in CCM through their ability to regulate Rho GTPase-dependent pathways and how this leads to the generation and orientation of mechanical forces. We will also highlight the key function of P-cadherin (a poor prognostic marker in several tumors) in promoting collective cell movement in epithelial and mesenchymal cells. PMID:27152729

  17. Neutron Crystal Structure of RAS GTPase Puts in Question the Protonation State of the GTP γ-Phosphate.

    PubMed

    Knihtila, Ryan; Holzapfel, Genevieve; Weiss, Kevin; Meilleur, Flora; Mattos, Carla

    2015-12-25

    RAS GTPase is a prototype for nucleotide-binding proteins that function by cycling between GTP and GDP, with hydrogen atoms playing an important role in the GTP hydrolysis mechanism. It is one of the most well studied proteins in the superfamily of small GTPases, which has representatives in a wide range of cellular functions. These proteins share a GTP-binding pocket with highly conserved motifs that promote hydrolysis to GDP. The neutron crystal structure of RAS presented here strongly supports a protonated γ-phosphate at physiological pH. This counters the notion that the phosphate groups of GTP are fully deprotonated at the start of the hydrolysis reaction, which has colored the interpretation of experimental and computational data in studies of the hydrolysis mechanism. The neutron crystal structure presented here puts in question our understanding of the pre-catalytic state associated with the hydrolysis reaction central to the function of RAS and other GTPases. PMID:26515069

  18. Purification, crystallization and preliminary X-ray crystallographic analysis of mammalian MSS4–Rab8 GTPase protein complex

    SciTech Connect

    Itzen, Aymelt; Bleimling, Nathalie; Ignatev, Alexander; Pylypenko, Olena; Rak, Alexey

    2006-02-01

    The MSS4 (mammalian suppressor of Sec4) protein in complex with nucleotide-free Rab8 GTPase has been purified and crystallized in a form suitable for structure analysis and a complete data set has been collected to 2 Å resolution. Rab GTPases function as ubiquitous key regulators of membrane-vesicle transport in eukaryotic cells. MSS4 is an evolutionarily conserved protein that binds to exocytotic Rabs and facilitates nucleotide release. The MSS4 protein in complex with nucleotide-free Rab8 GTPase has been purified and crystallized in a form suitable for structure analysis. The crystals belonged to space group P1, with unit-cell parameters a = 40.92, b = 49.85, c = 83.48 Å, α = 102.88, β = 97.46, γ = 90.12°. A complete data set has been collected to 2 Å resolution.

  19. A historical perspective on the lateral diffusion model of GTPase activation and related coupling of membrane signaling proteins

    PubMed Central

    Liebman, Paul A

    2014-01-01

    Aspects of our discovery of lateral diffusion of the G protein coupled receptor (GPCR) rhodopsin and that a single activated rhodopsin can non-covalently catalyze GTP binding to thousands of GTPases per second on rod disk membranes via this diffusion are summarized herein. Rapid GTPase coupling to membrane-bound phosphodiesterase (PDE) further amplifies the signal via cGMP hydrolysis, essential to visual transduction. Important generalizations from this work are that biomembranes can uniquely concentrate, orient for reaction and provide a solvent appropriate to rapid, powerful and appropriately controlled sequential interaction of signaling proteins. Of equal importance to function is timely control and termination of such powerful amplification via receptor phosphorylation (quenching) and arrestin binding. Downstream kinetic modulation by GTPase activating proteins (GAPs) and regulators of G protein signaling (RGS) and related mechanisms as well as limitations set by membrane domain fencing, structural protein binding etc. can be essential in relevant systems. PMID:25279248

  20. New insights into the dimerization of small GTPase Rac/ROP guanine nucleotide exchange factors in rice

    PubMed Central

    Akamatsu, Akira; Uno, Kazumi; Kato, Midori; Wong, Hann Ling; Shimamoto, Ko; Kawano, Yoji

    2015-01-01

    Molecular links between receptor-kinases and Rac/ROP family small GTPases mediated by activator guanine nucleotide exchange factors (GEFs) govern diverse biological processes. However, it is unclear how the Rac/ROP GTPases orchestrate such a wide variety of activities. Here, we show that rice OsRacGEF1 forms homodimers, and heterodimers with OsRacGEF2, at the plasma membrane (PM) and the endoplasmic reticulum (ER). OsRacGEF2 does not bind directly to the receptor-like kinase (RLK) OsCERK1, but forms a complex with OsCERK1 through OsRacGEF1 at the ER. This complex is transported from ER to the PM and there associates with OsRac1, resulting in the formation of a stable immune complex. Such RLK-GEF heterodimer complexes may explain the diversity of Rac/ROP family GTPase signalings. PMID:26251883