Science.gov

Sample records for ribosomal phosphoprotein pfp0

  1. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  2. Rabies virus phosphoprotein interacts with ribosomal protein L9 and affects rabies virus replication.

    PubMed

    Li, Youwen; Dong, Wanyu; Shi, Yuejun; Deng, Feng; Chen, Xi; Wan, Chunyun; Zhou, Ming; Zhao, Ling; Fu, Zhen F; Peng, Guiqing

    2016-01-15

    Rabies virus is a highly neurotropic virus that can cause fatal infection of the central nervous system in warm-blooded animals. The RABV phosphoprotein (P), an essential cofactor of the virus RNA-dependent RNA polymerase, is required for virus replication. In this study, the ribosomal protein L9, which has functions in protein translation, is identified as P-interacting cellular factor using phage display analysis. Direct binding between the L9 and P was confirmed by protein pull-down and co-immunoprecipitation analyses. It was further demonstrated that L9 translocates from the nucleus to the cytoplasm, where it colocalizes with P in cells infected with RABV or transfected with P gene. RABV replication was reduced with L9 overexpression and enhanced with L9 knockdown. Thus, we propose that during RABV infection, P binds to L9 that translocates from the nucleus to the cytoplasm, inhibiting the initial stage of RABV transcription. PMID:26655239

  3. An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

    PubMed Central

    McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

    1997-01-01

    An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

  4. Ribosomal acidic phosphoproteins P1 and P2 are not required for cell viability but regulate the pattern of protein expression in Saccharomyces cerevisiae.

    PubMed Central

    Remacha, M; Jimenez-Diaz, A; Bermejo, B; Rodriguez-Gabriel, M A; Guarinos, E; Ballesta, J P

    1995-01-01

    Saccharomyces cerevisiae strains with either three inactivated genes (triple disruptants) or four inactivated genes (quadruple disruptants) encoding the four acidic ribosomal phosphoproteins, YP1 alpha, YP1 beta, YP2 alpha, and YP2 beta, present in this species have been obtained. Ribosomes from the triple disruptants and, obviously, those from the quadruple strain do not have bound P proteins. All disrupted strains are viable; however, they show a cold-sensitive phenotype, growing very poorly at 23 degrees C. Cell extracts from the quadruple-disruptant strain are about 30% as active as the control in protein synthesis assays and are stimulated by the addition of free acidic P proteins. Strains lacking acidic proteins do not have a higher suppressor activity than the parental strains, and cell extracts derived from the quadruple disruptant do not show a higher degree of misreading, indicating that the absence of acidic proteins does not affect the accuracy of the ribosomes. However, the patterns of protein expressed in the cells as well as in the cell-free protein system are affected by the absence of P proteins from the particles; a wild-type pattern is restored upon addition of exogenous P proteins to the cell extract. In addition, strains carrying P-protein-deficient ribosomes are unable to sporulate but recover this capacity upon transformation with one of the missing genes. These results indicate that acidic proteins are not an absolute requirement for protein synthesis but regulate the activity of the 60S subunit, affecting the translation of certain mRNAs differently. PMID:7651393

  5. Thylakoid phosphoproteins

    SciTech Connect

    Coughlan, S.J.; Hind, G.

    1986-01-01

    Thylakoid phosphoproteins were successively fractionated by (1) treatment of /sup 32/P-labeled membranes with 1 M NaBr to remove superficial proteins; (2) extraction with octyl glucoside/cholate; (3) precipitation with ammonium sulfate; (4) size exclusion chromatography on BioGel P300, and (5) sucrose density gradient centrifugation. The detergent extract contained <10% of the original membrane-bound /sup 32/P; it was enriched in cytochrome b/f complex and 64-kDa protein kinase. A 20-kDa protein which copurified with the cytochrome complex and was assumed to be the Rieske protein, was partially phosphorylated. The protein kinase, which phosphorylates itself in vitro, appeared on the sucrose gradient as a phosphoprotein, signalling that it had become labeled in the intact thylakoid. A phosphoprotein of approx.10 kDa which is seen as a product of directly radiolabeling the BioGel P300 extract, was found to differ from the well documented phosphoprotein of this approximate mass that appears in labeled thylakoids. 30 refs., 3 figs., 2 tabs.

  6. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  7. The expression of acidic ribosomal phosphoproteins on the surface membrane of different tissues in autoimmune and normal mice which are the target molecules for anti-double-stranded DNA antibodies.

    PubMed Central

    Sun, K H; Liu, W T; Tang, S J; Tsai, C Y; Hsieh, S C; Wu, T H; Han, S H; Yu, C L

    1996-01-01

    Affinity-purified polyclonal anti-double-stranded DNA (anti-dsDNA) antibodies from patients with systemic lupus erythematosus (SLE) exert a cytostatic effect on cultured rat glomerular mesangial cells (MC). The cognate antigens expressed on the surface of MC have been proved to be acidic ribosomal phosphoproteins (P proteins) in our previous study. The mesangial cytostatic effect of anti-dsDNA antibodies is attributed to the cross-reactivity of the antibodies with membrane-expressed P proteins, but not to the effect of minute amounts of anti-ribosomal P proteins antibodies contained in the anti-dsDNA preparations. Immunofluorescence staining of the native cells demonstrated that anti-dsDNA antibodies bound to the surface of rat mesangial cells, rat brain astrocytes (RBA-1) and mouse fibroblasts (3T3). Anti-dsDNA antibodies also exert potent cytostatic effects on these cells in a dose-dependent manner. In addition, the plasma membranes of different cell lines and tissues from normal and autoimmune mice were isolated and probed by anti-dsDNA antibodies in Western blot analysis. We found the actively proliferating cells such as MC, RBA-1 and 3T3 may express both P0 (38,000 MW) and P1 (19,000 MW) on the surface membrane. In addition, the kidney, liver and spleen from either autoimmune MRL-lpr/lpr or BALB/c mice may constantly express P0 protein, but the expression of P1 is inconsistent. In contrast, brain and muscle from either mice failed to express P proteins on their surface. Unexpectedly, a high molecular weight substance (larger than 205,000 MW) with unknown nature appears in the membrane of brain and muscle tissues in both mice. Immunoprecipitation of the surface-biotinylated MC-lysate by anti-dsDNA antibodies further confirmed that P1 (19,000 MW) and P2 (17,000 MW) are really expressed on the cell surface. These results suggest that P proteins expressed on the surface of different tissues become the targets for anti-dsDNA antibodies mediating pleomorphic tissue

  8. Mineral induction by immobilized phosphoproteins

    NASA Technical Reports Server (NTRS)

    Saito, T.; Arsenault, A. L.; Yamauchi, M.; Kuboki, Y.; Crenshaw, M. A.

    1997-01-01

    Dentin phosphoproteins are thought to have a primary role in the deposition of mineral on the collagen of dentin. In this study we determined the type of binding between collagen and phosphoproteins necessary for mineral formation onto collagen fibrils and whether the phosphate esters are required. Bovine dentin phosphophoryn or phosvitin from egg yolk were immobilized on reconstituted skin type I collagen fibrils by adsorption or by covalent cross-linking. In some samples the ester phosphate was removed from the covalently cross-linked phosphoproteins by treatment with acid phosphatase. All samples were incubated at 37 degrees C in metastable solutions that do not spontaneously precipitate. Reconstituted collagen fibrils alone did not induce mineral formation. The phosphoproteins adsorbed to the collagen fibrils desorbed when the mineralization medium was added, and mineral was not induced. The mineral induced by the cross-linked phosphoproteins was apatite, and the crystals were confined to the surface of the collagen fibrils. With decreasing medium saturation the time required for mineral induction increased. The interfacial tensions calculated for apatite formation by either phosphoprotein cross-linked to collagen were about the same as that for phosphatidic acid liposomes and hydroxyapatite. This similarity in values indicates that the nucleation potential of these highly phosphorylated surfaces is about the same. It is concluded that phosphoproteins must be irreversibly bound to collagen fibrils for the mineralization of the collagen network in solutions that do not spontaneously precipitate. The phosphate esters of phosphoproteins are required for mineral induction, and the carboxylate groups are not sufficient.

  9. [Phosphoprotein phosphatase nonspecifically hydrolyzes CoA].

    PubMed

    Reziapkin, V I; Moiseenok, A G

    1988-01-01

    CoA hydrolysis was studied by a homogenous phosphoprotein phosphatase (EC 3.1 3.16) preparation from bovine spleen nuclei at pH 5.8. Phosphoprotein phosphatase catalyzed hydrolysis of the CoA 3'-phosphoester bond to form dephospho-CoA and Pi. The Km value for phosphoprotein phosphatase with CoA as substrate was 3.7 mM, the specific activity - 0.26 mmol Pi.min-1.mg-1. Phosphoprotein phosphatase did not essentially catalyze the calcium pantothenate hydrolysis (not more than 2% as compared with the CoA hydrolysis rate). PMID:2849829

  10. Nucleolin: The most abundant multifunctional phosphoprotein of nucleolus.

    PubMed

    Tajrishi, Marjan M; Tuteja, Renu; Tuteja, Narendra

    2011-05-01

    Nucleolin is a multifunctional phosphoprotein ubiquitously distributed in the nucleolus, nucleus and cytoplasm of the cell. Nucleolin has a bipartite nuclear localization signal sequence and is conserved in animals, plants and yeast. Its levels are correlated with the rate of functional activity of the nucleolus in exponentially growing cells. Nucleolin contains intrinsic DNA and RNA helicase, nucleic-acid-dependent ATPase and self-cleaving activities. It binds RNA through its RNA recognition motifs. It regulates various aspects of DNA and RNA metabolism, chromatin structure, rDNA transcription, rRNA maturation, cytokinesis, nucleogenesis, cell proliferation and growth, the folding, maturation and ribosome assembly and nucleocytoplasmic transport of newly synthesized pre-RNAs. In this review we present an overview on nucleolin, its localization, structure and various functions. We also describe the discovery and important studies of nucleolin in plants. PMID:21980556

  11. Specific Enrichment of Phosphoproteins Using Functionalized Multivalent Nanoparticles

    PubMed Central

    Hwang, Leekyoung; Ayaz-Guner, Serife; Gregorich, Zachery R.; Cai, Wenxuan; Valeja, Santosh G.; Jin, Song; Ge, Ying

    2015-01-01

    Analysis of protein phosphorylation remains a significant challenge due to the low abundance of phosphoproteins and the low stoichiometry of phosphorylation, which requires effective enrichment of phosphoproteins. Here we have developed superparamagnetic nanoparticles (NPs) whose surface is functionalized by multivalent ligand molecules that specifically bind to the phosphate groups on any phosphoproteins. These NPs enrich phosphoproteins from complex cell and tissue lysates with high specificity as confirmed by SDS-PAGE analysis with a phosphoprotein-specific stain and mass spectrometry analysis of the enriched phosphoproteins. This method enables universal and effective capture, enrichment, and detection of intact phosphoproteins towards a comprehensive analysis of the phosphoproteome. PMID:25655481

  12. Oligomerization of Mumps Virus Phosphoprotein

    PubMed Central

    Pickar, Adrian; Elson, Andrew; Yang, Yang; Xu, Pei; Luo, Ming

    2015-01-01

    ABSTRACT The mumps virus (MuV) genome encodes a phosphoprotein (P) that is important for viral RNA synthesis. P forms the viral RNA-dependent RNA polymerase with the large protein (L). P also interacts with the viral nucleoprotein (NP) and self-associates to form a homotetramer. The P protein consists of three domains, the N-terminal domain (PN), the oligomerization domain (PO), and the C-terminal domain (PC). While PN is known to relax the NP-bound RNA genome, the roles of PO and PC are not clear. In this study, we investigated the roles of PO and PC in viral RNA synthesis using mutational analysis and a minigenome system. We found that PN and PC functions can be trans-complemented. However, this complementation requires PO, indicating that PO is essential for P function. Using this trans-complementation system, we found that P forms parallel dimers (PN to PN and PC to PC). Furthermore, we found that residues R231, K238, K253, and K260 in PO are critical for P's functions. We identified PC to be the domain that interacts with L. These results provide structure-function insights into the role of MuV P. IMPORTANCE MuV, a paramyxovirus, is an important human pathogen. The P protein of MuV is critical for viral RNA synthesis. In this work, we established a novel minigenome system that allows the domains of P to be complemented in trans. Using this system, we confirmed that MuV P forms parallel dimers. An understanding of viral RNA synthesis will allow the design of better vaccines and the development of antivirals. PMID:26311887

  13. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  14. NEURONAL PHOSPHOPROTEINS: PHYSIOLOGICAL AND CLINICAL IMPLICATIONS

    EPA Science Inventory

    The presence of a great variety of neuron-specific phosproteins in nervous tissue supports the view that protein phosphorylation plays many roles in neuronal function. The physiological significance of several of these phosphoproteins has already been established. Some neuronal p...

  15. Hypoxic stress-induced changes in ribosomes of maize seedling roots. [Zea mays L

    SciTech Connect

    Bailey-Serres, J.; Freeling, M. )

    1990-11-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with ({sup 35}S)methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with ({sup 32}P)orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress.

  16. Mapping phosphoproteins in Neisseria meningitidis serogroup A.

    PubMed

    Bernardini, Giulia; Laschi, Marcella; Serchi, Tommaso; Arena, Simona; D'Ambrosio, Chiara; Braconi, Daniela; Scaloni, Andrea; Santucci, Annalisa

    2011-04-01

    To investigate the phosphorylation capability of serogroup A Neisseria meningitidis (MenA) and to implement our knowledge in meningococcal biology and in bacterial post-translational modifications, cell extracts were separated by 2-DE and 51 novel phosphoproteins were revealed by the use of the highly specific Ser/Thr/Tyr-phosphorylated proteins staining by Pro-Q Diamond and identified by MALDI-ToF/MS. Our results indicate that phosphorylation in MenA is comparable to that of other bacterial species. A first functional characterization of the identified modified proteins was also given, in order to understand their role in meningococcal physiopathology. PMID:21365747

  17. Modulation of mTOR effector phosphoproteins in blood basophils from allergic patients.

    PubMed

    Gernez, Yael; Tirouvanziam, Rabindra; Reshamwala, Neha; Yu, Grace; Weldon, Brittany C; Galli, Stephen J; Herzenberg, Leonore A; Nadeau, Kari C

    2012-06-01

    The mammalian target of rapamycin (mTOR) pathway contributes to various immunoinflammatory processes. Yet, its potential involvement in basophil responses in allergy remains unclear. In this pilot study, we quantified two key mTOR effector phosphoproteins, the eukaryotic initiation factor 4E (peIF4E) and S6 ribosomal protein (pS6rp), in blood basophils from nut allergy patients (NA, N = 16) and healthy controls (HC, N = 13). Without stimulation in vitro, basophil peIF4E levels were higher in NA than HC subjects (P = 0.014). Stimulation with nut (offending) but not chicken / rice (non-offending) extract increased basophil peIF4E and pS6rp levels (+32%, P = 0.018, and +98%, P = 0.0026, respectively) in NA but not HC subjects, concomitant with increased surface levels of CD203c and CD63, both known to reflect basophil activation. Pre-treatment with the mTOR inhibitor rapamycin decreased pS6rp and CD203c responses in nut extract-stimulated basophils in NA subjects. Thus, basophil responses to offending allergens are associated with modulation of mTOR effector phosphoproteins. PMID:22350221

  18. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  19. Nucleolin: a multifunctional major nucleolar phosphoprotein.

    PubMed

    Tuteja, R; Tuteja, N

    1998-01-01

    Nucleolin is a major protein of exponentially growing eukaryotic cells where it is present in abundance at the heart of the nucleolus. It is highly conserved during evolution. Nucleolin contains a specific bipartite nuclear localization signal sequence and possesses a number of unusual structural features. It has unique tripartite structure and each domain performs a specific function by interacting with DNA or RNA or proteins. Nucleolin exhibits intrinsic self-cleaving, DNA helicase, RNA helicase and DNA-dependent ATPase activities. Nucleolin also acts as a sequence-specific RNA binding protein, an autoantigen, and as the component of a B cell specific transcription factor. Its phosphorylation by cdc2, CK2, and PKC-zeta modulate some of its activities. This multifunctional protein has been implicated to be involved directly or indirectly in many metabolic processes such as ribosome biogenesis (which includes rDNA transcription, pre-rRNA synthesis, rRNA processing, ribosomal assembly and maturation), cytokinesis, nucleogenesis, cell proliferation and growth, cytoplasmic-nucleolar transport of ribosomal components, transcriptional repression, replication, signal transduction, inducing chromatin decondensation and many more (see text). In plants it is developmentally, cell-cycle, and light regulated. The regulation of all these functions of a single protein seems to be a challenging puzzle. PMID:9918513

  20. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  1. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  2. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  3. Phosphoproteins and protein kinases of the Golgi apparatus membrane

    SciTech Connect

    Capasso, J.M.; Abeijon, C.; Hirschberg, C.B.

    1985-11-25

    Incubation of a highly purified fraction derived from rat liver Golgi apparatus with (gamma-TSP)ATP results in phosphorylation of several endogenous phosphoproteins. One phosphoprotein with an apparent Mr of 48,300 is radiolabeled to an apparent extent at least 5-fold higher than any other phosphoprotein as part of either the Golgi apparatus or highly purified rat liver fractions derived from the rough endoplasmic reticulum, mitochondria, plasma membrane, coated vesicles, cytosol, and total homogenate. Approximately 70% of the 48.3-kDa phosphoprotein appears to be a specific extrinsic Golgi membrane protein with the phosphorylated amino acid being threonine. The protein kinase which phosphorylates the 48.3-kDa protein is an intrinsic Golgi membrane protein and is dependent on MgS , independent of CaS , calmodulin, and cAMP, and is inhibited by N-ethylmaleimide. Preliminary evidence suggests that there are also intrinsic membrane protein kinases in the Golgi apparatus which are dependent on CaS and cAMP. The physiological role of the above phosphoproteins and protein kinases is not known.

  4. Rapid, Multiplexed Phosphoprotein Profiling Using Silicon Photonic Sensor Arrays

    PubMed Central

    2015-01-01

    Extracellular signaling is commonly mediated through post-translational protein modifications that propagate messages from membrane-bound receptors to ultimately regulate gene expression. Signaling cascades are ubiquitously intertwined, and a full understanding of function can only be gleaned by observing dynamics across multiple key signaling nodes. Importantly, targets within signaling cascades often represent opportunities for therapeutic development or can serve as diagnostic biomarkers. Protein phosphorylation is a particularly important post-translational modification that controls many essential cellular signaling pathways. Not surprisingly, aberrant phosphorylation is found in many human diseases, including cancer, and phosphoprotein-based biomarker signatures hold unrealized promise for disease monitoring. Moreover, phosphoprotein analysis has wide-ranging applications across fundamental chemical biology, as many drug discovery efforts seek to target nodes within kinase signaling pathways. For both fundamental and translational applications, the analysis of phosphoprotein biomarker targets is limited by a reliance on labor-intensive and/or technically challenging methods, particularly when considering the simultaneous monitoring of multiplexed panels of phosphoprotein biomarkers. We have developed a technology based upon arrays of silicon photonic microring resonator sensors that fills this void, facilitating the rapid and automated analysis of multiple phosphoprotein levels from both cell lines and primary human tumor samples requiring only minimal sample preparation. PMID:26539563

  5. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  6. Localization of Phosphoproteins within the Barnacle Adhesive Interface.

    PubMed

    Dickinson, Gary H; Yang, Xu; Wu, Fanghui; Orihuela, Beatriz; Rittschof, Dan; Beniash, Elia

    2016-06-01

    Barnacles permanently adhere to nearly any inert substrate using proteinaceous glue. The glue consists of at least ten major proteins, some of which have been isolated and sequenced. Questions still remain about the chemical mechanisms involved in adhesion and the potential of the glue to serve as a platform for mineralization of the calcified base plate. We tested the hypothesis that barnacle glue contains phosphoproteins, which have the potential to play a role in both adhesion and mineralization. Using a combination of phosphoprotein-specific gel staining and Western blotting with anti-phosphoserine antibody, we identified multiple phosphorylated proteins in uncured glue secretions from the barnacle Amphibalanus amphitrite The protein composition of the glue and the quantity and abundance of phosphoproteins varied distinctly among individual barnacles, possibly due to cyclical changes in the glue secretion over time. We assessed the location of the phosphoproteins within the barnacle glue layer using decalcified barnacle base plates and residual glue deposited by reattached barnacles. Phosphoproteins were found throughout the organic matrix of the base plate and within the residual glue. Staining within the residual glue appeared most intensely in regions where capillary glue ducts, which are involved in cyclical release of glue, had been laid down. Lastly, mineralization studies of glue proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) indicated that proteins identified as phosphorylated possibly induce mineralization of calcium carbonate (CaCO3). These results contribute to our understanding of the protein composition of barnacle glue, and provide new insights into the potential roles of phosphoproteins in underwater bioadhesives. PMID:27365418

  7. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  8. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  9. Identification of phosphoproteins in Arabidopsis thaliana leaves using polyethylene glycol fractionation, immobilized metal-ion affinity chromatography, two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Aryal, Uma K; Krochko, Joan E; Ross, Andrew R S

    2012-01-01

    Reversible protein phosphorylation is a key regulatory mechanism in cells. Identification and characterization of phosphoproteins requires specialized enrichment methods, due to the relatively low abundance of these proteins, and is further complicated in plants by the high abundance of Rubisco in green tissues. We present a novel method for plant phosphoproteome analysis that depletes Rubisco using polyethylene glycol fractionation and utilizes immobilized metal-ion affinity chromatography to enrich phosphoproteins. Subsequent protein separation by one- and two-dimensional gel electrophoresis is further improved by extracting the PEG-fractionated protein samples with SDS/phenol and methanol/chloroform to remove interfering compounds. Using this approach, we identified 132 phosphorylated proteins in a partial Arabidopsis leaf extract. These proteins are involved in a range of biological processes, including CO(2) fixation, protein assembly and folding, stress response, redox regulation, and cellular metabolism. Both large and small subunits of Rubisco were phosphorylated at multiple sites, and depletion of Rubisco enhanced detection of less abundant phosphoproteins, including those associated with state transitions between photosystems I and II. The discovery of a phosphorylated form of AtGRP7, a self-regulating RNA-binding protein that affects floral transition, as well as several previously uncharacterized ribosomal proteins confirm the utility of this approach for phosphoproteome analysis and its potential to increase our understanding of growth and development in plants. PMID:22092075

  10. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  11. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  12. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  13. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  14. Crystal Structure of the Nipah Virus Phosphoprotein Tetramerization Domain

    PubMed Central

    Bruhn, Jessica F.; Barnett, Katherine C.; Bibby, Jaclyn; Thomas, Jens M. H.; Keegan, Ronan M.; Rigden, Daniel J.; Bornholdt, Zachary A.

    2014-01-01

    The Nipah virus phosphoprotein (P) is multimeric and tethers the viral polymerase to the nucleocapsid. We present the crystal structure of the multimerization domain of Nipah virus P: a long, parallel, tetrameric, coiled coil with a small, α-helical cap structure. Across the paramyxoviruses, these domains share little sequence identity yet are similar in length and structural organization, suggesting a common requirement for scaffolding or spatial organization of the functions of P in the virus life cycle. PMID:24155387

  15. Enrichment and Analysis of Intact Phosphoproteins in Arabidopsis Seedlings

    PubMed Central

    Aryal, Uma K.; Ross, Andrew R. S.; Krochko, Joan E.

    2015-01-01

    Protein phosphorylation regulates diverse cellular functions and plays a key role in the early development of plants. To complement and expand upon previous investigations of protein phosphorylation in Arabidopsis seedlings we used an alternative approach that combines protein extraction under non-denaturing conditions with immobilized metal-ion affinity chromatography (IMAC) enrichment of intact phosphoproteins in Rubisco-depleted extracts, followed by identification using two-dimensional gel electrophoresis (2-DE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In-gel trypsin digestion and analysis of selected gel spots identified 144 phosphorylated peptides and residues, of which only18 phosphopeptides and 8 phosphosites were found in the PhosPhAt 4.0 and P3DB Arabidopsis thaliana phosphorylation site databases. More than half of the 82 identified phosphoproteins were involved in carbohydrate metabolism, photosynthesis/respiration or oxidative stress response mechanisms. Enrichment of intact phosphoproteins prior to 2-DE and LC-MS/MS appears to enhance detection of phosphorylated threonine and tyrosine residues compared with methods that utilize peptide-level enrichment, suggesting that the two approaches are somewhat complementary in terms of phosphorylation site coverage. Comparing results for young seedlings with those obtained previously for mature Arabidopsis leaves identified five proteins that are differentially phosphorylated in these tissues, demonstrating the potential of this technique for investigating the dynamics of protein phosphorylation during plant development. PMID:26158488

  16. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  17. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  18. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  19. Quantitative iTRAQ-based proteomic analysis of phosphoproteins and ABA-regulated phosphoproteins in maize leaves under osmotic stress

    PubMed Central

    Hu, Xiuli; Li, Nana; Wu, Liuji; Li, Chunqi; Li, Chaohai; Zhang, Li; Liu, Tianxue; Wang, Wei

    2015-01-01

    Abscisic acid (ABA) regulates various developmental processes and stress responses in plants. Protein phosphorylation/dephosphorylation is a central post-translational modification (PTM) in ABA signaling. However, the phosphoproteins regulated by ABA under osmotic stress remain unknown in maize. In this study, maize mutant vp5 (deficient in ABA biosynthesis) and wild-type Vp5 were used to identify leaf phosphoproteins regulated by ABA under osmotic stress. Up to 4052 phosphopeptides, corresponding to 3017 phosphoproteins, were identified by Multiplex run iTRAQ-based quantitative proteomic and LC-MS/MS methods. The 4052 phosphopeptides contained 5723 non-redundant phosphosites; 512 phosphopeptides (379 in Vp5, 133 in vp5) displayed at least a 1.5-fold change of phosphorylation level under osmotic stress, of which 40 shared common in both genotypes and were differentially regulated by ABA. Comparing the signaling pathways involved in vp5 response to osmotic stress and those that in Vp5, indicated that ABA played a vital role in regulating these pathways related to mRNA synthesis, protein synthesis and photosynthesis. Our results provide a comprehensive dataset of phosphopeptides and phosphorylation sites regulated by ABA in maize adaptation to osmotic stress. This will be helpful to elucidate the ABA-mediate mechanism of maize endurance to drought by triggering phosphorylation or dephosphorylation cascades. PMID:26503333

  20. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  1. Analysis of Blastocladiella emersonii ribosomal proteins in four two-dimensional gel electrophoresis systems.

    PubMed

    Bonato, M C; Maia, J C; Juliani, M H

    1985-01-01

    Ribosomal proteins of the aquatic fungus Blastocladiella emersonii were isolated and characterized on four different two-dimensional polyacrylamide gel electrophoresis systems. 40S and 60S ribosomal subunit proteins from zoospores were identified. The position of every protein was determined in each electrophoretic system using the "four-corners" method (Madjar et al., Molecular and General Genetics, 171: 121-134, 1979). Thirty-two and 39 proteins were identified in the 40S and 60S ribosomal subunits, respectively. The molecular weights of individual proteins in the 40S subunit ranged from 10 000 to 37 000, with a number-average molecular weight of 20 000. The molecular weight range for the 60S subunit was 13 000-51 000 with a number-average molecular weight of 21 000. Proteins from ribosomes of different cell types were compared and found to be qualitatively indistinguishable. The only consistent difference in the patterns of proteins was in the S6 protein of the 40S subunit, which is the major phosphoprotein of Blastocladiella ribosomes. PMID:3830281

  2. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  3. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  4. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  5. Mammalian Target of Rapamycin (mTOR) Activity Dependent Phospho-Protein Expression in Childhood Acute Lymphoblastic Leukemia (ALL)

    PubMed Central

    Márk, Ágnes; Hajdu, Melinda; Kenessey, István; Sticz, Tamás; Nagy, Eszter; Barna, Gábor; Váradi, Zsófia; Kovács, Gábor; Kopper, László; Csóka, Monika

    2013-01-01

    Modern treatment strategies have improved the prognosis of childhood ALL; however, treatment still fails in 25–30% of patients. Further improvement of treatment may depend on the development of targeted therapies. mTOR kinase, a central mediator of several signaling pathways, has recently attracted remarkable attention as a potential target in pediatric ALL. However, limited data exists about the activity of mTOR. In the present study, the amount of mTOR activity dependent phospho-proteins was characterized by ELISA in human leukemia cell lines and in lymphoblasts from childhood ALL patients (n = 49). Expression was measured before and during chemotherapy and at relapses. Leukemia cell lines exhibited increased mTOR activity, indicated by phospho-S6 ribosomal protein (p-S6) and phosphorylated eukaryotic initiation factor 4E binding protein (p-4EBP1). Elevated p-4EBP1 protein levels were detected in ALL samples at diagnosis; efficacy of chemotherapy was followed by the decrease of mTOR activity dependent protein phosphorylation. Optical density (OD) for p-4EBP1 (ELISA) was significantly higher in patients with poor prognosis at diagnosis, and in the samples of relapsed patients. Our results suggest that measuring mTOR activity related phospho-proteins such as p-4EBP1 by ELISA may help to identify patients with poor prognosis before treatment, and to detect early relapses. Determining mTOR activity in leukemic cells may also be a useful tool for selecting patients who may benefit from future mTOR inhibitor treatments. PMID:23573198

  6. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  7. Studies in pig heart tissue on various 60,000 Da phosphoproteins.

    PubMed

    Guesdon, F; David-Pfeuty, T

    1989-03-01

    Pig heart tissue have been shown to contain 3 different 60,000 Da phosphoproteins. Different purification procedures were used in order to separate them, suggesting that the 3 phosphoproteins differ in their environmental parameters. The 2 major ones appear essentially as peripheral phosphoproteins that are associated with cellular membranes through ionic forces, whereas the third minor phosphoprotein behaves as an integral plasma membrane protein. The three phosphoproteins also differ in their relative amount of phosphorylated serine, threonine and tyrosine residues after in vitro protein kinase assay. Evidence that the 3 phosphoproteins are related arises from the similarity between their respective phosphopeptide maps after partial hydrolysis with proteases, an experiment that also points out relatedness in primary structure between them and the transforming protein of Rous sarcoma virus, pp60v-src. The 3 phosphoproteins, however, do not appear to be immunologically related to pp60v-src since none of them is immunoprecipitated by sera that precipitate pp60v-src. The possibility that the three 60,000 Da phosphoproteins under study represent 3 differentially localized and phosphorylated products of c-src and/or c-src related genes is discussed. PMID:2472841

  8. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia

    1998-01-01

    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  9. Preparation of a novel Zr(4+)-immobilized metal affinity membrane for selective adsorption of phosphoprotein.

    PubMed

    He, Maofang; Wang, Chaozhan; Wei, Yinmao

    2016-09-01

    In this study, a novel phosphate-Zr(4+) immobilized metal affinity membrane (IMAM) was prepared based on the surface initiated-atom transfer radical polymerization technique for the selective adsorption of phosphoprotein. The adsorption capacity and selectivity of the phosphate-Zr(4+) IMAM were evaluated by using the mixture of standard phosphoproteins (β-casein, ovalbumin) and nonphosphoproteins (bovine serum albumin and lysozyme) as model samples. The adsorption isotherms and competitive adsorption results demonstrated that the phosphate-Zr(4+) IMAM had higher binding capacity and selectivity for phosphoproteins over nonphosphoproteins. Moreover, the phosphate-Zr(4+) IMAM exhibited good re-usability and re-productivity. Finally, the phosphate-Zr(4+) IMAM was applied to separate phosphoprotein from real samples with high purity. Therefore, the as-prepared phosphate-Zr(4+) IMAM could be a promising affinity material for the efficient enrichment of phosphoprotein from complex bio-samples. PMID:27433983

  10. Role of presynaptic phosphoprotein synapsin II in schizophrenia

    PubMed Central

    Molinaro, Luke; Hui, Patricia; Tan, Mattea; Mishra, Ram K

    2015-01-01

    Synapsin II is a member of the neuronal phosphoprotein family. These phosphoproteins are evolutionarily conserved across many organisms and are important in a variety of synaptic functions, including synaptogenesis and the regulation of neurotransmitter release. A number of genome-wide scans, meta-analyses, and genetic susceptibility studies have implicated the synapsin II gene (3p25) in the etiology of schizophrenia (SZ) and other psychiatric disorders. Further studies have found a reduction of synapsin II mRNA and protein in the prefrontal cortex in post-mortem samples from schizophrenic patients. Disruptions in the expression of this gene may cause synaptic dysfunction, which can result in neurotransmitter imbalances, likely contributing to the pathogenesis of SZ. SZ is a costly, debilitating psychiatric illness affecting approximately 1.1% of the world’s population, amounting to 51 million people today. The disorder is characterized by positive (hallucinations, paranoia), negative (social withdrawal, lack of motivation), and cognitive (memory impairments, attention deficits) symptoms. This review provides a comprehensive summary of the structure, function, and involvement of the synapsin family, specifically synapsin II, in the pathophysiology of SZ and possible target for therapeutic intervention/implications. PMID:26425441

  11. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  12. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  13. Phosphoprotein Isotope-coded Affinity Tags: Application to the Enrichment and Identification of Low-Abundance Phosphoproteins

    SciTech Connect

    Goshe, Michael; Veenstra, Timothy D. ); Panisko, Ellen A.; Conrads, Thomas P. ); Angell, Nicolas H.; Smith, Richard D. )

    2002-02-01

    A novel approach using different isotopic labeling and biotinylation has been developed for the enrichment and quantitation of phosphoseryl and phosphothreonyl-peptides. The phosphoprotein isotope-coded affinity tag (PhIAT) exploits the high affinity biotin-avidin interaction to isolate modified phosphopeptides from a complex mixture of peptides. The PhIAT strategy for quantifying and enriching mixtures for phosphopeptides was demonstrated using a commercially available sample of the phosphoprotein B-casein. A denatured solution of B-casein was labeled using the PhIAT method and after proteolytic digestion, the labeled peptides were isolated using immobilize avidin. The recovered peptides were separated by capillary reversed-phase liquid chromatography and identified by tandem mass spectrometry. PhIAT-labeled peptides corresponding to known O-phosphorylated peptides from B-casein were identified as were phosphorylated peptides from as1-casein and ase-casein, known low-level (< 5%) contaminants of commercially available B-casein. All of the identified phosphopeptides from these caseins have been previously documented to be phosphorylated at the sites elucidated by the PhIAT approach. The results illustrate the efficancy of the PhIAT-labeling strategy to enrich mixtures for phosphopeptides and permit the detection and identification of low abundance phosphopeptides. In addition, experiments using light and heavy isotopic version of the PhIAT reagents demonstrated that a 10% difference in phosphorylation state could be determined between phosphopeptides in comparative samples.

  14. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  15. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  16. An integrated workflow for characterizing intact phosphoproteins from complex mixtures

    SciTech Connect

    Wu, Si; Yang, Feng; Zhao, Rui; Tolic, Nikola; Robinson, Errol W.; Camp, David G.; Smith, Richard D.; Pasa-Tolic, Ljiljana

    2009-05-08

    The phosphorylation of any site on a given protein can affect its activity, degradation rate, ability to dock with other proteins or bind divalent cations, and/or its localization. These effects can operate within the same protein; in fact, multisite phosphorylation is a key mechanism for achieving signal integration in cells. Hence, knowing the overall phosphorylation signature of a protein is essential for understanding the "state" of a cell. However, current technologies to monitor the phosphorylation status of proteins are inefficient at determining the relative stoichiometries of phosphorylation at multiple sites. Here we report a new capability for comprehensive liquid chromatography-mass spectrometry (LC-MS) analysis of intact phosphoproteins. The technology platform built upon integrated bottom-up and top-down approach that is facilitated by intact protein reversed-phase (RP)LC concurrently coupled with Fourier transform ion cyclotron resonance (FTICR) MS and fraction collection.

  17. Selective adsorption of phosphoproteins on gel-immobilized ferric chelate

    SciTech Connect

    Muszynska, G.; Andersson, L.; Porath, J.

    1986-11-04

    Ferric ions are very strongly adsorbed to iminodiacetic acid substituted agarose. This firmly immobilized complex acts as a selective immobilized metal affinity adsorbent for phosphoproteins. Chromatography based on this principle is illustrated by the adsorption-desorption behavior of egg yolk phosvitin before and after dephosphorylation as well as by the change in the chromatographic pattern before and after enzymic phosphorylation of selected histones. The strength of binding is dependent on the phosphate content. The difference is binding before and after phosphorylation of a single amino acid residue is demonstrated. Affinity elution can be accomplished by inclusion in the buffer of (1) phosphoserine or (2) a displacing metal ion such as Mg/sup 2 +/.

  18. An integrated workflow for characterizing intact phosphoproteins from complex mixtures

    PubMed Central

    Wu, Si; Yang, Feng; Zhao, Rui; Tolić, Nikola; Robinson, Errol W.; Camp, David; Smith, Richard D.; Paša-Tolić, Ljiljana

    2014-01-01

    The phosphorylation of any site on a given protein can affect its activity, degradation rate, ability to dock with other proteins or bind divalent cations, and/or its localization. These effects can operate within the same protein; in fact, multisite phosphorylation is a key mechanism for achieving signal integration in cells. Hence, knowing the overall phosphorylation signature of a protein is essential for understanding the "state" of a cell. However, current technologies to monitor the phosphorylation status of proteins are inefficient at determining the relative stoichiometries of phosphorylation at multiple sites. Here we report a new capability for comprehensive liquid chromatography mass spectrometry (LC/MS) analysis of intact phosphoproteins. The technology platform built upon integrated bottom-up and top-down approach that is facilitated by intact protein reversed-phase (RP)LC concurrently coupled with Fourier transform ion cyclotron resonance (FTICR) MS and fraction collection. As the use of conventional RPLC systems for phosphopeptide identification has proven challenging due to the formation of metal ion complexes at various metal surfaces during LC/MS and ESI-MS analysis, we have developed a “metal-free” RPLC-ESI-MS platform for phosphoprotein characterization. This platform demonstrated a significant sensitivity enhancement for phosphorylated casein proteins enriched from a standard protein mixture and revealed the presence of over 20 casein isoforms arising from genetic variants with varying numbers of phosphorylation sites. The integrated workflow was also applied to an enriched yeast phosphoproteome to evaluate the feasibility of this strategy for characterizing complex biological systems, and revealed ~16% of the detected yeast proteins to have multiple phosphorylation isoforms. Intact protein LC/MS platform for characterization of combinatorial posttranslational modifications (PTMs), with special emphasis on multisite phosphorylation, holds

  19. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells

    PubMed Central

    Abbasian, Nima; Burton, James O.; Herbert, Karl E.; Tregunna, Barbara-Emily; Brown, Jeremy R.; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J.; Goodall, Alison H.

    2015-01-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  20. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells.

    PubMed

    Abbasian, Nima; Burton, James O; Herbert, Karl E; Tregunna, Barbara-Emily; Brown, Jeremy R; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J; Goodall, Alison H; Bevington, Alan

    2015-09-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  1. Comparison of phosphoprotein isolated from mature and immature human tooth roots.

    PubMed

    McCurdy, S P; Clarkson, B H; Feagin, F F

    1992-12-01

    Mature (average patient age = 29.5 yr, closed apical foramen) and immature (average patient age = 17.5 yr, open apical foramen) root shards were placed in dialysis tubing and demineralized to completion using either 10% disodium EDTA plus protease inhibitors or 0.6 N HCl. The demineralized shards were re-extracted (five times) with 0.05 M tris-HCl, 1.0 M NaCl and then collagenase digested. No major differences were observed in chromatograms of extracts, re-extracts or collagenase digests from root shards demineralized in either way. In contrast, chromatograms of immature and mature roots showed qualitative differences. Chromatograms of mature roots demineralized in either way showed broader protein peaks and less organic phosphorus than those from immature tooth roots. A distinct band amid degraded phosphoprotein (150 K) was found in SDS-PAGE gels (7.5%) from EDTA-extracted immature tooth roots but not from mature tooth roots. Electroelution of this band revealed a typical phosphoprotein amino-acid profile containing increased aspartic acid and serine residues. Comparison of the total phosphoprotein and amino acid composition of extracts, re-extracts and collagenase digests revealed that phosphoprotein, serine and to a lesser extent aspartic acid were recovered in greater quantities from immature roots than mature tooth roots. These data suggest that the degree of maturation is crucial to the isolation of an intact phosphoprotein and provides additional evidence that human dentine phosphoprotein undergoes amino acid compositional changes during maturation. PMID:1471954

  2. A new fluorescent quenching method for the determination of phosphoproteins by using calconcarboxylic acid.

    PubMed

    Zhu, Zhongxin; Zhu, Xinliang; Shen, Jiayi; Zhou, Ayi; Ni, Maowei; Jin, Litai; Cong, Weitao

    2015-03-01

    A fluorescent quenching detection method for phosphoproteins in SDS-PAGE by using calconcarboxylic acid (CCA) was described. In this method, the fluorescence intensity of CCA was greatly increased with the presence of Al(3+) in the gel background, while in zones where phosphoproteins are located this intensity was absent because of fluorescence quenching phenomenon through the formation of CCA-Al(3+) -phosphoprotein appended complex. Approximately 4-8 ng of phosphoproteins can be selectively detected within 1 h (1D SDS-PAGE), which is similar to that of the most commonly used Pro-Q Diamond stain. The specificity of this novel technique for phosphoproteins was confirmed by dephosphorylation, Western blot, and LC-MS/MS analysis, respectively. Furthermore, to better understand the newly developed method, the detection mechanism of CCA stain was explored by fluorescent spectrometry. According to the results, it is believed that CCA stain may provide a new choice for selective, economical, MS compatible, and convenient visualization of gel-separated phosphoproteins. PMID:25546259

  3. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  4. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  5. Transgenic expression of dentin phosphoprotein inhibits skeletal development.

    PubMed

    Zhang, H; Liu, P; Wang, S; Liu, C; Jani, P; Lu, Y; Qin, C

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is proteolytically processed into an NH2-terminal fragment called dentin sialoprotein (DSP) and a COOH-terminal fragment known as dentin phosphoprotein (DPP). These two fragments are believed to perform distinct roles in formation of bone and dentin. To investigate the functions of DPP in skeletal development, we generated transgenic mice to overexpress hemagglutinin (HA)-tagged DPP under the control of a 3.6 kb type I collagen (Col1a1) promoter (designated as Col1a1-HA-DPP). The Col1a1-HA-DPP transgenic mice were significantly smaller by weight, had smaller skeletons and shorter long bones than their wild type littermates, as demonstrated by X-ray radiography. They displayed reduced trabecular bone formation and narrower zones of proliferative and hypertrophic chondrocytes in the growth plates of the long bones. Histological analyses showed that the transgenic mice had reduced cell proliferation in the proliferating zone, but lacked obvious defects in the chondrocyte differentiation. In addition, the transgenic mice with a high level of transgene expression developed spontaneous long bone fractures. In conclusion, overexpressing DPP inhibited skeletal development, suggesting that the balanced actions between the NH2- and COOH-terminal fragments of DSPP may be required for normal skeletal development. PMID:26972716

  6. Transgenic Expression of Dentin Phosphoprotein Inhibits Skeletal Development

    PubMed Central

    Zhang, H.; Liu, P.; Wang, S.; Liu, C.; Jani, P.; Lu, Y.; Qin, C.

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is proteolytically processed into an NH2-terminal fragment called dentin sialoprotein (DSP) and a COOH-terminal fragment known as dentin phosphoprotein (DPP). These two fragments are believed to perform distinct roles in formation of bone and dentin. To investigate the functions of DPP in skeletal development, we generated transgenic mice to overexpress hemagglutinin (HA)-tagged DPP under the control of a 3.6 kb type I collagen (Col1a1) promoter (designated as Col1a1-HA-DPP). The Col1a1-HA-DPP transgenic mice were significantly smaller by weight, had smaller skeletons and shorter long bones than their wild type littermates, as demonstrated by X-ray radiography. They displayed reduced trabecular bone formation and narrower zones of proliferative and hypertrophic chondrocytes in the growth plates of the long bones. Histological analyses showed that the transgenic mice had reduced cell proliferation in the proliferating zone, but lacked obvious defects in the chondrocyte differentiation. In addition, the transgenic mice with a high level of transgene expression developed spontaneous long bone fractures. In conclusion, overexpressing DPP inhibited skeletal development, suggesting that the balanced actions between the NH2- and COOH-terminal fragments of DSPP may be required for normal skeletal development. PMID:26972716

  7. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  8. Proteomic Analysis of Phosphoproteins in the Rice Nucleus During the Early Stage of Seed Germination.

    PubMed

    Li, Ming; Yin, Xiaojian; Sakata, Katsumi; Yang, Pingfang; Komatsu, Setsuko

    2015-07-01

    The early stage of seed germination is the first step in the plant life cycle without visible morphological change. To investigate the mechanism controlling the early stage of rice seed germination, we performed gel-and label-free nuclear phosphoproteomics. A total of 3467 phosphopeptides belonging to 102 nuclear phosphoproteins from rice embryos were identified. Protein-synthesis-related proteins were mainly phosphorylated. During the first 24 h following imbibition, 115 nuclear phosphoproteins were identified, and significant changes in the phosphorylation level over time were observed in 29 phosphoproteins. Cluster analysis indicated that nucleotide-binding proteins and zinc finger CCCH- and BED-type proteins increased in abundance during the first 12 h of imbibition and then decreased. The in silico protein-protein interactions for 29 nuclear phosphoproteins indicated that the Sas10/Utp3 protein, which functions in snoRNA binding and gene silencing, was the center of the phosphoprotein network in nuclei. The germination rate of seeds was significantly slowed with phosphatase inhibitor treatment. The mRNA expression of the zinc finger CCCH-type protein did not change, and the zinc finger BED-type protein was upregulated in rice embryos during the early stage of germination with phosphatase inhibitor treatment. These results suggest that the phosphorylation and dephosphorylation of nuclear proteins are involved in rice seed germination. Furthermore, transcription factors such as zinc finger CCCH- and BED-type proteins might play a key role through nuclear phosphoproteins, and Sas10/Utp3 protein might interact with nuclear phosphoproteins in rice embryos to mediate the early stage of seed germination. PMID:26035336

  9. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  11. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  12. Lymphocyte phosphatase-associated phosphoprotein proteoforms analyzed using monoclonal antibodies

    PubMed Central

    Filatov, Alexander; Kruglova, Natalia; Meshkova, Tatiana; Mazurov, Dmitriy

    2015-01-01

    Phosphatase CD45 regulates the activation of lymphocytes by controlling the level of receptor and signal molecule phosphorylation. However, it remains unknown which molecules mediate the phosphatase activity of CD45. A candidate for such a molecule is a small transmembrane adapter protein called lymphocyte phosphatase-associated phosphoprotein (LPAP). LPAP forms a supramolecular complex that consists of not only CD45 molecule but also CD4 and Lck kinase. The function of LPAP has not been defined clearly. In our study, we determined the pattern of LPAP expression in various cell types and characterized its proteoforms using new monoclonal antibodies generated against the intracellular portion of the protein. We show that LPAP is a pan-lymphocyte marker, and its expression in cells correlates with the expression of CD45. The majority of T, B and NK cells express high levels of LPAP, whereas monocytes, granulocytes, monocyte-derived dendritic cells, platelets and red blood cells are negative for LPAP. Using one- and two-dimensional protein gel electrophoresis, we demonstrate that LPAP has at least four sites of phosphorylation. The resting cells express at least six different LPAP phosphoforms representing mono-, di- and tri-phosphorylated LPAP. T and B cells differ in the distribution of the protein between phosphoforms. The activation of lymphocytes with PMA reduces the diversity of phosphorylated forms. Our experiments on Lck-deficient Jurkat cells show that Lck kinase is not involved in LPAP phosphorylation. Thus, LPAP is a dynamically phosphorylated protein, the function of which can be understood, when all phosphosites and kinases involved in its phosphorylation will be identified. PMID:26682052

  13. Phosphoprotein Stability in Clinical Tissue and Its Relevance for Reverse Phase Protein Microarray Technology

    PubMed Central

    Espina, Virginia; Mueller, Claudius; Liotta, Lance A.

    2013-01-01

    Phosphorylated proteins reflect the activity of specific cell signaling nodes in biological kinase protein networks. Cell signaling pathways can be either activated or deactivated depending on the phosphorylation state of the constituent proteins. The state of these kinase pathways reflects the in vivo activity of the cells and tissue at any given point in time. As such, cell signaling pathway information can be extrapolated to infer which phosphorylated proteins/pathways are driving an individual tumor’s growth. Reverse Phase Protein Microarrays (RPMA) are a sensitive and precise platform that can be applied to the quantitative measurement of hundreds of phosphorylated signal proteins from a small sample of tissue. Pre-analytical variability originating from tissue procurement and preservation may cause significant variability and bias in downstream molecular analysis. Depending on the ex vivo delay time in tissue processing, and the manner of tissue handling, protein biomarkers such as signal pathway phosphoproteins will be elevated or suppressed in a manner that does not represent the biomarker levels at the time of excision. Consequently, assessment of the state of these kinase networks requires stabilization, or preservation, of the phosphoproteins immediately post tissue procurement. We have employed reverse phase protein microarray analysis of phosphoproteins to study the factors influencing stability of phosphoproteins in tissue following procurement. Based on this analysis we have established tissue procurement guidelines for clinical research with an emphasis on quantifying phosphoproteins by RPMA. PMID:21901591

  14. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  15. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  16. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  17. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  18. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  19. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  20. PCPP-260, PURKINJE CELL-SPECIFIC CYCLE AMP-REGULATED MEMBRANE PHOSPHOPROTEIN OF (M SUB R) 260,000

    EPA Science Inventory

    The present study reports the existence of Purkinje cell-specific phosphoprotein, Mr260,000 (PCPP-260), a neuronal membrance phosphoprotein, in cerebellar Purkinje cells. PCPP-260, which on sodium dodecyl sulfate-polyacrylamide gel electrophoresis has an apparaent molecular mass ...

  1. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  2. Molecular evolution of dentin phosphoprotein among toothed and toothless animals

    PubMed Central

    2009-01-01

    Background Dentin sialophosphoprotein (DSPP) is the largest member of the SIBLING family and is the most abundant noncollagenous protein in dentin. DSPP is also expressed in non-mineralized tissues including metabolically active ductal epithelia and some cancers. Its function, however, is poorly defined. The carboxy-terminal fragment, dentin phosphoprotein (DPP) is encoded predominantly by a large repetitive domain that requires separate cloning/sequencing reactions and is, therefore, often incomplete in genomic databases. Comparison of DPP sequences from at least one member of each major branch in the mammalian evolutionary tree (including some "toothless" mammals) as well as one reptile and bird may help delineate its possible functions in both dentin and ductal epithelia. Results The BMP1-cleavage and translation-termination domains were sufficiently conserved to permit amplification/cloning/sequencing of most species' DPP. While the integrin-binding domain, RGD, was present in about half of species, only vestigial remnants of this tripeptide were identified in the others. The number of tandem repeats of the nominal SerSerAsp phosphorylation motif in toothed mammals (including baleen whale and platypus which lack teeth as adults), ranged from ~75 (elephant) to >230 (human). These repeats were not perfect, however, and patterns of intervening sequences highlight the rapidity of changes among even closely related species. Two toothless anteater species have evolved different sets of nonsense mutations shortly after their BMP1 motifs suggesting that while cleavage may be important for DSPP processing in other tissues, the DPP domain itself may be required only in dentin. The lizard DSPP had an intact BMP1 site, a remnant RGD motif, as well as a distinctly different Ser/Asp-rich domain compared to mammals. Conclusions The DPP domain of DSPP was found to change dramatically within mammals and was lost in two truly toothless animals. The defining aspect of DPP, the

  3. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  4. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  5. SIMILARITIES BETWEEN PROTEIN IIIA AND PROTEIN IIIB, TWO PROMINENT SYNAPTIC VESICLE-ASSOCIATED PHOSPHOPROTEINS (JOURNAL VERSION)

    EPA Science Inventory

    Protein IIIa (Mr 74,000) and protein IIIb (Mr 55,000) are two major phosphoproteins found in mammalian brain. It was previously shown in intact nerve cells that the phosphorylation state of these two proteins could be increased by electrical stimulation, by depolarizing agents in...

  6. Phosphoprotein extraction from the dentine/cementum complex of human tooth roots.

    PubMed

    McCurdy, S P; Clarkson, B H; Speirs, R L; Feagin, F F

    1990-01-01

    Root shards were placed in dialysis tubing and demineralized to completion in either 10% disodium EDTA, pH 7.4, 0.6 M HCl, 0.1 M HCl, 0.5 M acetic or 75 mM-25 mM lactic-acetic acids. The demineralized shards were then re-extracted with 0.05 M tris-HCl, 1.0 M NaCl. DEAE chromatography revealed that the major peak of the 0.6 M CHl and EDTA extracts contained organic phosphorus, whereas much less organic phosphorus was found in the major peak of the 0.1 M HCl extract. Analysis of the re-extracts gave a pattern opposite to that obtained from the initial extractions. Measurements of protein and organic phosphorus released during extraction and re-extraction confirmed these results. Staining of SDS-PAGE gels for phosphoprotein with Stains-All resulted in a blue smear in fractions containing organic phosphorus. Thus the extraction of phosphoproteins from human tooth roots differed depending upon the demineralizing conditions. This ability to remove phosphoprotein differentially will allow further investigation of the role of phosphoprotein in mineralization and remineralization. PMID:2115325

  7. PROTEIN III, A NEURON-SPECIFIC PHOSPHOPROTEIN: VARIANT FORMS FOUND IN HUMAN BRAIN

    EPA Science Inventory

    Recent work in the laboratory has shown the presence of many neuron-specific phosphoproteins in the mammalian nervous system. Two of these proteins, Protein III and Synapsin I, are specifically associated with synaptic vesicles in neurons throughout the brain. Protein III consist...

  8. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  9. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  10. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  11. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  12. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  13. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  14. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  15. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  16. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  17. Three-Dimensional Distribution of UBF and Nopp140 in Relationship to Ribosomal DNA Transcription During Mouse Preimplantation Development.

    PubMed

    Koné, Maïmouna Coura; Fleurot, Renaud; Chebrout, Martine; Debey, Pascale; Beaujean, Nathalie; Bonnet-Garnier, Amélie

    2016-04-01

    The nucleolus is a dynamic nuclear compartment that is mostly involved in ribosome subunit biogenesis; however, it may also play a role in many other biological processes, such as stress response and the cell cycle. Mainly using electron microscopy, several studies have tried to decipher how active nucleoli are set up during early development in mice. In this study, we analyzed nucleologenesis during mouse early embryonic development using 3D-immunofluorescent detection of UBF and Nopp140, two proteins associated with different nucleolar compartments. UBF is a transcription factor that helps maintain the euchromatic state of ribosomal genes; Nopp140 is a phosphoprotein that has been implicated in pre-rRNA processing. First, using detailed image analyses and the in situ proximity ligation assay technique, we demonstrate that UBF and Nopp140 dynamic redistribution between the two-cell and blastocyst stages (time of implantation) is correlated with morphological and structural modifications that occur in embryonic nucleolar compartments. Our results also support the hypothesis that nucleoli develop at the periphery of nucleolar precursor bodies. Finally, we show that the RNA polymerase I inhibitor CX-5461: 1) disrupts transcriptional activity, 2) alters preimplantation development, and 3) leads to a complete reorganization of UBF and Nopp140 distribution. Altogether, our results underscore that highly dynamic changes are occurring in the nucleoli of embryos and confirm a close link between ribosomal gene transcription and nucleologenesis during the early stages of development. PMID:26984997

  18. NEURON-SPECIFIC PHOSPHOPROTEINS AS BIOCHEMICAL INDICATORS OF NEUROTOXICITY: EFFECTS OF ACUTE ADMINISTRATION OF TRIMETHYLTIN TO THE ADULT RAT

    EPA Science Inventory

    The cytoarchitecture of the adult central nervous system is expressed by proteins specific to individual cell types. In this investigation, a subclass of these proteins, the neuron-specific phosphoproteins, was examined after the administration of trimethyltin (TMT), a neurotoxic...

  19. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  20. Critical roles of specimen type and temperature before and during fixation in the detection of phosphoproteins in breast cancer tissues.

    PubMed

    Gündisch, Sibylle; Annaratone, Laura; Beese, Christian; Drecol, Enken; Marchiò, Caterina; Quaglino, Elena; Sapino, Anna; Becker, Karl-Friedrich; Bussolati, Gianni

    2015-05-01

    The most efficient approach for therapy selection to inhibit the deregulated kinases in cancer tissues is to measure their phosphorylation status prior to the treatment. The aim of our study was to evaluate the influence of pre-analytical parameters (cold ischemia time, temperature before and during tissue fixation, and sample type) on the levels of proteins and phosphoproteins in breast cancer tissues, focusing on the PI3 kinase/AKT pathway. The BALB-neuT mouse breast cancer model expressing HER2 and pAKT proteins and human biopsy and resection specimens were analyzed. By using quantitative reverse phase protein arrays (RPPA), 9 proteins and 16 phosphoproteins relevant to breast cancer biology were assessed. Cold temperatures before and during fixation resulted in a marked improvement in the preservation of the reactivity of biological markers (eg, ER, HER2) in general and, specifically, pHER2 and pAKT. Some phosphoproteins, eg, pHER2 and pAKT, were more sensitive to prolonged cold ischemia times than others (eg, pS6RP and pSTAT5). By comparing the phosphoprotein levels in core needle biopsies with those in resection specimens, we found a marked decrease in many phosphoproteins in the latter. Cold conditions can improve the preservation of proteins and phosphoproteins in breast cancer tissues. Biopsies ≤ 1 mm in size are the preferred sample type for assessing the activity of deregulated kinases for personalized cancer treatments because the phosphoprotein levels are better preserved compared with resection specimens. Each potential new (phospho)protein biomarker should be tested for its sensitivity to pre-analytical processing prior to the development of a diagnostic assay. PMID:25730369

  1. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  2. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  3. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  4. Identification of the 64 kilodalton chloroplast stromal phosphoprotein as phosphoglucomutase. [Pisum sativum

    SciTech Connect

    Salvucci, M.E.; Drake, R.R.; Broadbent, K.P.; Haley, B.E. ); Hanson, K.R.; McHale, N.A. )

    1990-05-01

    Phosphorylation of the 64 kilodalton stromal phosphoprotein by incubation of pea (Pisum sativum) chloroplast extracts with ({gamma}-{sup 32}P)ATP decreased in the presence of Glc-6-P and Glc-1,6-P{sub 2}, but was stimulated by glucose. Two-dimensional gel electrophoresis following incubation of intact chloroplasts and stromal extracts with ({gamma}-{sup 32}P)ATP, or incubation of stromal extracts and partially purified phosphoglucomutase (EC 2.7.5.1) with ({sup 32}P)Glc-1-P showed that the identical 64 kilodalton polypeptide was labeled. A 62 kilodalton polypeptide was phosphorylated by incubation of tobacco (Nicotiana sylvestris) stromal extracts with either ({gamma}-{sup 32}P)ATP or ({sup 32}P)Glc-1-P. In contrast, an analogous polypeptide was not phosphorylated in extracts from a tobacco mutant deficient in plastid phosphoglucomutase activity. The results indicate that the 64 (or 62) kilodalton chloroplast stromal phosphoprotein is phosphoglucomutase.

  5. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  6. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana

    PubMed Central

    Lassowskat, Ines; Böttcher, Christoph; Eschen-Lippold, Lennart; Scheel, Dierk; Lee, Justin

    2014-01-01

    Mitogen-activated protein kinases (MAPKs) target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3, and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses) is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phospho)proteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g., WRKY transcription factors and proteins encoded by the genes from the “PEN” pathway required for penetration resistance to filamentous pathogens). Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org). PMID:25368622

  7. Atrazine Affects Phosphoprotein and Protein Expression in MCF-10A Human Breast Epithelial Cells

    PubMed Central

    Huang, Peixin; Yang, John; Song, Qisheng; Sheehan, David

    2014-01-01

    Atrazine, a member of the 2-chloro-s-triazine family of herbicides, is the most widely used pesticide in the world and often detected in agriculture watersheds. Although it was generally considered as an endocrine disruptor, posing a potential threat to human health, the molecular mechanisms of atrazine effects remain unclear. Using two-dimensional gel electrophoresis, we identified a panel of differentially expressed phosphoproteins and total proteins in human breast epithelial MCF-10A cells after being exposed to environmentally relevant concentrations of atrazine. Atrazine treatments for 6 h resulted in differential expression of 4 phosphoproteins and 8 total-proteins as compared to the control cells (>1.5-fold, p < 0.05). MALDI-TOF MS/MS analysis revealed that the differentially expressed proteins belong to various cellular compartments (nucleus, cytosol, membrane) and varied in function, including those regulating the stress response such as peroxiredoxin I, HSP70 and HSP27; structural proteins such as tropomyosin and profilin 1; and oncogenesis proteins such as ANP32A. Six of the 12 identified proteins were verified by quantitative PCR for their transcript levels. The most up-regulated phosphoprotein by atrazine treatment, ANP32A, was further analyzed for its expression, distribution and cellular localization using Western blot and immunocytochemical approaches. The results revealed that ANP32 expression after atrazine treatment increased dose and time dependently and was primarily located in the nucleus. This study may provide new evidence on the potential toxicity of atrazine in human cells. PMID:25275270

  8. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    PubMed

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. PMID:26083784

  9. Quantitative Phosphoproteomics Analysis of Nitric Oxide–Responsive Phosphoproteins in Cotton Leaf

    PubMed Central

    Song, Meizhen; Pang, Chaoyou; Wei, Hengling; Liu, Ji; Zhan, Xianjin; Lan, Jiayang; Feng, Changhui; Zhang, Shengxi; Yu, Shuxun

    2014-01-01

    Knowledge of phosphorylation events and their regulation is crucial to understanding the functional biology of plant proteins, but very little is currently known about nitric oxide–responsive phosphorylation in plants. Here, we report the first large-scale, quantitative phosphoproteome analysis of cotton (Gossypium hirsutum) treated with sodium nitroprusside (nitric oxide donor) by utilizing the isobaric tag for relative and absolute quantitation (iTRAQ) method. A total of 1315 unique phosphopeptides, spanning 1528 non-redundant phosphorylation sites, were detected from 1020 cotton phosphoproteins. Among them, 183 phosphopeptides corresponding to 167 phosphoproteins were found to be differentially phosphorylated in response to sodium nitroprusside. Several of the phosphorylation sites that we identified, including RQxS, DSxE, TxxxxSP and SPxT, have not, to our knowledge, been reported to be protein kinase sites in other species. The phosphoproteins identified are involved in a wide range of cellular processes, including signal transduction, RNA metabolism, intracellular transport and so on. This study reveals unique features of the cotton phosphoproteome and provides new insight into the biochemical pathways that are regulated by nitric oxide. PMID:24714030

  10. Large-scale comparative phosphoprotein analysis of maize seedling leaves during greening.

    PubMed

    Ning, De-Li; Liu, Ke-Hui; Liu, Chang-Cai; Liu, Jin-Wen; Qian, Chun-Rong; Yu, Yang; Wang, Yue-Feng; Wang, Ying-Chun; Wang, Bai-Chen

    2016-02-01

    MAIN CONCLUSION : Large-scale comparative phosphoprotein analysis in maize seedlings reveals a complicated molecular regulation mechanism at the phosphoproteomic level during de-etiolation. In the present study we report a phosphoproteomic study conducted on Zea mays etiolated leaves harvested at three time points during greening (etiolated seedlings and seedlings exposed to light for 6 or 12 h). We identified a total of 2483 phosphopeptides containing 2389 unambiguous phosphosites from 1339 proteins. The abundance of nearly 692 phosphorylated peptides containing 783 phosphosites was reproducible and profiled with high confidence among treatments. Comparisons with other large-scale phosphoproteomic studies revealed that 473 of the phosphosites are novel to this study. Of the 783 phosphosites identified, 171, 79, and 138 were identified in 0, 6, and 12 h samples, respectively, which suggest that regulation of phosphorylation plays important roles during maize seedling de-etiolation. Our experimental methods included enrichment of phosphoproteins, allowing the identification of a great number of low abundance proteins, such as transcription factors, protein kinases, and photoreceptors. Most of the identified phosphoproteins were involved in gene transcription, post-transcriptional regulation, or signal transduction, and only a few were involved in photosynthesis and carbon metabolism. It is noteworthy that tyrosine phosphorylation and calcium signaling pathways might play important roles during maize seedling de-etiolation. Taken together, we have elucidated a new level of complexity in light-induced reversible protein phosphorylation during maize seedling de-etiolation. PMID:26497871

  11. Structures of nuclear phosphoproteins characteristic of rapidly growing HeLa cells

    SciTech Connect

    Arezzo, F.; Choi, Y.C.

    1986-05-01

    To study characteristic events of phosphorylation in cell growth, phosphoproteins were labeled with (/sup 32/P)-phosphate at mid-logarithmic phase of HeLa cell proliferation. Among a number of nuclear phosphoproteins isolated, three characteristic classes of most highly labeled phosphoproteins were identified by DEAE-column chromatography (0.2-0.25 M NaCl gradient, pH 6.0), followed by 7.5% SDS polyacrylamide gel electrophoresis. Chemical characterization of their structures showed that they contained three different forms of post-translational modifications: Class I with phosphoserine, Class II with phosphoserine and oligonulceotides (5-10 nucleotides long), and Class III with phosphoserine, 5'-GMP and poly(ADP-ribose). Class I is represented by nucleolar C-23. Class II is represented by nucleolar 125 kDa and nucleoplasmic 50 kDa with GC rich sequences (G = 30%, C = 40%) and 5'-linking pCp. Class III is represented by nucleoplasmic poly(ADP-ribose) proteins (18 different species, MW ranges 30 kDa-200 kDa) with branched poly(ADP-ribose) longer than tRNA. When HeLa cells were labeled at non-mid-logarithmic phase, labeling of these classes were 4 fold less efficient, indicating their functional importance in cell proliferation.

  12. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  13. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  14. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  15. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  16. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  17. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  18. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  19. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  20. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  1. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  2. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  3. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  4. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  5. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  6. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  7. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  8. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  9. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  10. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  11. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  12. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  13. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  14. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  15. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  16. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  17. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  18. Phosphoproteomes of Strongylocentrotus purpuratus shell and tooth matrix: identification of a major acidic sea urchin tooth phosphoprotein, phosphodontin

    PubMed Central

    2010-01-01

    Background Sea urchin is a major model organism for developmental biology and biomineralization research. However, identification of proteins involved in larval skeleton formation and mineralization processes in the embryo and adult, and the molecular characterization of such proteins, has just gained momentum with the sequencing of the Strongylocentrotus purpuratus genome and the introduction of high-throughput proteomics into the field. Results The present report contains the determination of test (shell) and tooth organic matrix phosphoproteomes. Altogether 34 phosphoproteins were identified in the biomineral organic matrices. Most phosphoproteins were specific for one compartment, only two were identified in both matrices. The sea urchin phosphoproteomes contained several obvious orthologs of mammalian proteins, such as a Src family tyrosine kinase, protein kinase C-delta 1, Dickkopf-1 and other signal transduction components, or nucleobindin. In most cases phosphorylation sites were conserved between sea urchin and mammalian proteins. However, the majority of phosphoproteins had no mammalian counterpart. The most interesting of the sea urchin-specific phosphoproteins, from the perspective of biomineralization research, was an abundant highly phosphorylated and very acidic tooth matrix protein composed of 35 very similar short sequence repeats, a predicted N-terminal secretion signal sequence, and an Asp-rich C-terminal motif, contained in [Glean3:18919]. Conclusions The 64 phosphorylation sites determined represent the most comprehensive list of experimentally identified sea urchin protein phosphorylation sites at present and are an important addition to the recently analyzed Strongylocentrotus purpuratus shell and tooth proteomes. The identified phosphoproteins included a major, highly phosphorylated protein, [Glean3:18919], for which we suggest the name phosphodontin. Although not sequence-related to such highly phosphorylated acidic mammalian dental

  19. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  20. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    SciTech Connect

    Egyhazi, E.; Pigon, A. ); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. )

    1988-10-01

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  1. Robust production of recombinant phosphoproteins using cell-free protein synthesis

    PubMed Central

    Oza, Javin P.; Aerni, Hans R.; Pirman, Natasha L.; Barber, Karl W.; ter Haar, Charlotte M.; Rogulina, Svetlana; Amrofell, Matthew B.; Isaacs, Farren J.; Rinehart, Jesse; Jewett, Michael C.

    2015-01-01

    Understanding the functional and structural consequences of site-specific protein phosphorylation has remained limited by our inability to produce phosphoproteins at high yields. Here we address this limitation by developing a cell-free protein synthesis (CFPS) platform that employs crude extracts from a genomically recoded strain of Escherichia coli for site-specific, co-translational incorporation of phosphoserine into proteins. We apply this system to the robust production of up to milligram quantities of human MEK1 kinase. Then, we recapitulate a physiological signalling cascade in vitro to evaluate the contributions of site-specific phosphorylation of mono- and doubly phosphorylated forms on MEK1 activity. We discover that only one phosphorylation event is necessary and sufficient for MEK1 activity. Our work sets the stage for using CFPS as a rapid high-throughput technology platform for direct expression of programmable phosphoproteins containing multiple phosphorylated residues. This work will facilitate study of phosphorylation-dependent structure–function relationships, kinase signalling networks and kinase inhibitor drugs. PMID:26350765

  2. Growth arrest and differentiation-associated phosphoproteins in mesenchymal stem cells

    SciTech Connect

    Sparks, R.L.; Scott, R.E.

    1986-03-05

    Cancer is thought to result from the expression of defects in the control of both cell proliferation and differentiation. In murine mesenchymal stem cells they have established that differentiation and proliferation can be mediated at a variety of distinct states in the G/sub 1/ phase of the cell cycle. In order to evaluate the role of cellular phosphoprotein (PP) expression in these regulatory processes, five different growth and differentiation-dependent states were compared. Cells in the following states were studied: (1) exponential growth; (2) arrest in serum-deficient medium; (3) arrest at the predifferentiation arrest state; (4) arrest at a state of nonterminal differentiation; and (5) arrest at a state of terminal differentiation. Whole cell lysates from each group were phosphorylated in vitro using (..gamma..-/sup 32/P)ATP and analyzed by SDS-polyacrylamide gel electrophoresis. Two most interesting observations were established. First, a distinct PP with a molecular weight of 37 kD was expressed in all growth arrested cells but was not evident in rapidly growing cells. Second, two distinct differentiation-associated PP with molecular weights of 72 kD and 29 kD were expressed exclusively in nonterminally and terminally differentiated cells. Since the identification of the 37 kD cell cycle-dependent growth arrest-associated PP could be of great significance, they plan to further investigate the functional role of this phosphoprotein in the control of cellular proliferation.

  3. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  4. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  5. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  6. Immunohistochemical localization of a approximately 66 kD glycosylated phosphoprotein during development of the embryonic chick tibia.

    PubMed

    Bruder, S P; Caplan, A I; Gotoh, Y; Gerstenfeld, L C; Glimcher, M J

    1991-06-01

    Localization of a approximately 66 kD glycosylated phosphoprotein during morphogenesis of the embryonic chick tibia has been accomplished using immunohistochemistry. Although initial expression of the tibial osteoblast phenotype is detected as early as stage 28.5, with the deposition of osteoid matrix beginning at stage 30, little or no immunoreactivity against the approximately 66 kD glycosylated phosphoprotein is observed in pre-osteoblasts, osteoblasts, osteocytes, or in the uncalcified osteoid matrix during the early events of tibia development. Immunoreactivity was first observed at stage 32 when mineralization of the osteoid matrix is initiated. At this and all later stages, the phosphoprotein is located almost exclusively in the extracellular matrix at the mineralization front with essentially no detectable staining in the adjacent unmineralized osteoid matrix. Similarly, no cellular staining is observed when even the lightly mineralized extracellular matrix is strongly immunoreactive. Only scant immunostaining is present over the heavily mineralized regions, although demineralization of these areas with EDTA exposes a low intensity, punctate staining pattern. Additionally, cryosections of developing calvaria stained with this antiserum only display reactivity in regions of bone matrix undergoing mineralization. These localization studies support the hypothesis that this phosphoprotein is intimately associated with the process of bone matrix mineralization in the developing chick long bone. PMID:2070278

  7. Intracellular transduction in the regulation of pheromone biosynthesis of the silkworm, Bombyx mori: suggested involvement of calmodulin and phosphoprotein phosphatase.

    PubMed

    Matsumoto, S; Ozawa, R; Nagamine, T; Kim, G H; Uchiumi, K; Shono, T; Mitsui, T

    1995-03-01

    We have tested the effects of chemicals on bombykol production in vitro in the silkworm, Bombyx mori, to probe the biochemical steps as well as underlying mechanisms regulated by PBAN. These results suggest the involvement of calmodulin and phosphoprotein phosphatase in the intracellular signal transduction of PBAN action. PMID:7766202

  8. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    PubMed Central

    Niimori-Kita, Kanako; Ogino, Kiyoshi; Mikami, Sayaka; Kudoh, Shinji; Koizumi, Daikai; Kudoh, Noritaka; Nakamura, Fumiko; Misumi, Masahiro; Shimomura, Tadasuke; Hasegawa, Koki; Usui, Fumihiko; Nagahara, Noriyuki; Ito, Takaaki

    2014-01-01

    Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18), and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3) and spectrin β chain brain 1 (SPTBN1), in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases. PMID:25349779

  9. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  10. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  11. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  12. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  13. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  14. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  15. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  16. Genetic analysis of phosphoprotein and matrix protein of rabies viruses isolated in Brazil.

    PubMed

    Kobayashi, Yuki; Okuda, Hiromi; Nakamura, Kana; Sato, Go; Itou, Takuya; Carvalho, Adolorata A B; Silva, Marlon V; Mota, Carla S; Ito, Fumio H; Sakai, Takeo

    2007-11-01

    To investigate the genetic characteristics of phosphoprotein (P) and matrix protein (M) genes of variable rabies virus (RV) prevalent in Brazil, the authors genetically characterized the P and M genes from 30 Brazilian RV field isolates. Phylogenetic analysis based on the P and M genes revealed the presence of six RV variants that consisted primarily of three insectivorous bats, the vampire bat, dog and fox in Brazil. Specific amino acid substitutions corresponding to these phylogenetic lineages were observed, with Asp(42) and Glu(62) in the P protein found to be characteristic of Brazilian chiroptera- and carnivora-related RVs, respectively. Amino acid sequence motifs predicted to associate with a viral function in the P and M proteins were conserved among Brazilian RV variants. PMID:18057829

  17. Phospho-proteins patial gradients in a cell of spheroidal shape

    NASA Astrophysics Data System (ADS)

    Sosa, Gerardo; Ramirez-Santiago, Guillermo

    2010-03-01

    Many signalling proteins undergo phosphorilated-dephosphorilated cycles at different locations inside the cell. These cycles give rise to spatial gradients of phosphoproteins. In this work we solve the reaction-difussion equation in a spheroidal geometry and investigate the diffusion of the phosphorilated form of the proteins to evaluate the size of the spatial gradients. This is done in terms of diffusion coefficients as well as protein kinase and phosphatase activities. Previous estimations of these gradients have been done for two geometries [1]: (i) a spherical cell and (ii) for a kinase and a protein each one located on two parallel planar membranes. This type of quantitative analyzes may have important implications in the cellular signaling processes [2].[4pt] [1] G.C. Brown, B.N. Kholodenko, FEBS Letters, vol. 457, p. 452-454[0pt] [2] B.N. Kholodenko, G.C. Brown, J.B. Hoek, Biochem. J. vol. 350, p. 901-907.

  18. The prolyl isomerase Pin1 as a molecular switch to determine the fate of phosphoproteins

    PubMed Central

    Liou, Yih-Cherng; Zhou, Xiao Zhen; Lu, Kun Ping

    2011-01-01

    Pin1 is a highly conserved enzyme that only isomerizes specific phosphorylated Ser/Thr-Pro bonds in certain proteins, thereby inducing conformational changes. Such conformational changes represent a novel and tightly controlled signaling mechanism regulating a spectrum of protein activities in physiology and disease, often through phosphorylation-dependent, ubiquitin-mediated proteasomal degradation. In this review, we summarize recent advances in elucidating the role and regulation of Pin1 in controlling protein stability. We also propose a mechanism by which Pin1 functions as a molecular switch to control the fates of phosphoproteins. We finally stress the need to develop tools to directly visualize Pin1-catalyzed protein conformational changes as a way to determine their roles in the development and treatment of human diseases. PMID:21852138

  19. Viral suppression function of intracellular antibody against C-terminal domain of rabies virus phosphoprotein.

    PubMed

    Liu, Yang; Sun, Lina; Yu, Pengcheng; Li, Aqian; Li, Chuan; Tang, Qing; Li, Dexin; Liang, Mifang

    2015-10-01

    Rabies virus (RV) causes a fatal disease in both human and animals. The disease can be prevented by post-exposure prophylaxis in individuals exposed to RV. However, the neutralization effect is limited after the virus enters into the host cells. So, it is important to identify new targets for rabies therapy. In this study, a human antibody RV1A2 specific to RV phosphoprotein (RV-P) was generated from a human naïve immune antibody library. The antibody recognized all forms of the phosphoproteins including the full length (P1) and short length of the P proteins (P2, P3, P4, and P5). The epitope mapping and the molecular docking of antigen-antibody complex showed that the antibody targets at a conserved epitope of 'VLGWV' ranging from amino acid (aa) 262 to 266 at C-terminal domain of the P protein, which locates at a hydrophobic pocket region in the C-terminal of the RV-P. The aa W265 within the epitope is on the flat surface of the domain, suggesting that it may be a critical amino acid for the functions of the P protein. Our results further showed that intracellular antibody RV1A2 which targets at the C-terminal domain of the P protein could effectively inhibit RV propagation 2-4 days post infection. These results suggest that the conserved C-terminal domain may be used as a new target for drug discovery, which highlights an intracellular inhibition of RV propagation and provides a potential novel way to treat RV infection. PMID:26188200

  20. Clinical application for the preservation of phospho-proteins through in-situ tissue stabilization

    PubMed Central

    2010-01-01

    Background Protein biomarkers will play a pivotal role in the future of personalized medicine for both diagnosis and treatment decision-making. While the results of several pre-clinical and small-scale clinical studies have demonstrated the value of protein biomarkers, there have been significant challenges to translating these findings into routine clinical care. Challenges to the use of protein biomarkers include inter-sample variability introduced by differences in post-collection handling and ex vivo degradation of proteins and protein modifications. Results In this report, we re-create laboratory and clinical scenarios for sample collection and test the utility of a new tissue stabilization technique in preserving proteins and protein modifications. In the laboratory setting, tissue stabilization with the Denator Stabilizor T1 resulted in a significantly higher yield of phospho-protein when compared to standard snap freeze preservation. Furthermore, in a clinical scenario, tissue stabilization at collection resulted in a higher yield of total phospho-protein, total phospho-tyrosine, pErkT202/Y204 and pAktS473 when compared to standard methods. Tissue stabilization did not have a significant effect on other post-translational modifications such as acetylation and glycosylation, which are more stable ex-vivo. Tissue stabilization did decrease total RNA quantity and quality. Conclusion Stabilization at the time of collection offers the potential to better preserve tissue protein and protein modification levels, as well as reduce the variability related to tissue processing delays that are often associated with clinical samples. PMID:21092202

  1. Focal Adhesion Kinase Is Involved in Rabies Virus Infection through Its Interaction with Viral Phosphoprotein P

    PubMed Central

    Fouquet, Baptiste; Nikolic, Jovan; Larrous, Florence; Bourhy, Hervé; Wirblich, Christoph

    2014-01-01

    ABSTRACT The rabies virus (RABV) phosphoprotein P is a multifunctional protein: it plays an essential role in viral transcription and replication, and in addition, RABV P has been identified as an interferon antagonist. Here, a yeast two-hybrid screen revealed that RABV P interacts with the focal adhesion kinase (FAK). The binding involved the 106-to-131 domain, corresponding to the dimerization domain of P and the C-terminal domain of FAK containing the proline-rich domains PRR2 and PRR3. The P-FAK interaction was confirmed in infected cells by coimmunoprecipitation and colocalization of FAK with P in Negri bodies. By alanine scanning, we identified a single mutation in the P protein that abolishes this interaction. The mutant virus containing a substitution of Ala for Arg in position 109 in P (P.R109A), which did not interact with FAK, is affected at a posttranscriptional step involving protein synthesis and viral RNA replication. Furthermore, FAK depletion inhibited viral protein expression in infected cells. This provides the first evidence of an interaction of RABV with FAK that positively regulates infection. IMPORTANCE Rabies virus exhibits a small genome that encodes a limited number of viral proteins. To maintain efficient virus replication, some of them are multifunctional, such as the phosphoprotein P. We and others have shown that P establishes complex networks of interactions with host cell components. These interactions have revealed much about the role of P and about host-pathogen interactions in infected cells. Here, we identified another cellular partner of P, the focal adhesion kinase (FAK). Our data shed light on the implication of FAK in RABV infection and provide evidence that P-FAK interaction has a proviral function. PMID:25410852

  2. The dynein light chain 8 binding motif of rabies virus phosphoprotein promotes efficient viral transcription

    PubMed Central

    Tan, Gene S.; Preuss, Mirjam A. R.; Williams, John C.; Schnell, Matthias J.

    2007-01-01

    Recent studies indicate that the interaction between rabies virus (RV) phosphoprotein and the dynein light chain 8 (LC8) is essential for RV pathogenesis. Through its association with the dynein motor complex, LC8 has been suggested as a molecular factor that links the viral ribonucleoprotein to the host cell transport system. Recent structural investigations, however, dispute this model. To understand the role of LC8 in RV pathogenesis, we generated recombinant RVs with or without the LC8 binding domain (LC8-BD) deleted from the RV phosphoprotein. Peripheral infection of adult mice showed that removal of the LC8-BD did not inhibit entry into the CNS, although it prevented onset of RV-induced CNS disease. However, deletion of the LC8-BD significantly attenuated viral transcription and replication in the CNS. Studies in RAG2 knockout (KO) mice infected with the same recombinant RVs confirmed this finding and indicated that the adaptive immune system is not a factor in the attenuation of viral replication early in the infection. In cell culture, the deletion of the LC8-BD greatly attenuated growth on neuronal cells whereas the growth pattern on nonneuronal cells remained unchanged. However, deletion of the LC8-BD did not affect production of RV virions. We provide evidence that removal of the LC8-BD decreases primary transcription. In this study, we propose that LC8 does not play a role in the retrograde axonal transport of RV and that the deletion of the LC8-BD impairs the infectivity of the virions by reducing early transcription and replication in neurons. PMID:17438267

  3. In Vitro and In Vivo Attenuation of Vesicular Stomatitis Virus (VSV) by Phosphoprotein Deletion

    PubMed Central

    Wongthida, Phonphimon; Jengarn, Juggragarn; Narkpuk, Jaraspim; Koonyosying, Pongpisid; Srisutthisamphan, Kanjana; Wanitchang, Asawin; Leaungwutiwong, Pornsawan; Teeravechyan, Samaporn; Jongkaewwattana, Anan

    2016-01-01

    Vesicular stomatitis virus (VSV) is highly immunogenic and able to stimulate both innate and adaptive immune responses. However, its ability to induce adverse effects has held back the use of VSV as a potential vaccine vector. In this study we developed VSV-ΔP, a safe yet potent replication-defective recombinant VSV in which the phosphoprotein (P) gene was deleted. VSV-ΔP replicated only in supporting cells expressing P (BHK-P cells) and at levels more than 2 logs lower than VSV. In vivo studies indicated that the moderate replication of VSV-ΔP in vitro was associated with the attenuation of this virus in the mouse model, whereas mice intracranially injected with VSV succumbed to neurotoxicity. Furthermore, we constructed VSV and VSV-ΔP expressing a variety of antigens including hemagglutinin-neuraminidase (HN) from Newcastle disease virus (NDV), hemagglutinin (HA) from either a 2009 H1N1 pandemic influenza virus (pdm/09) or the avian H7N9. VSV and VSV-ΔP incorporated the foreign antigens on their surface resulting in induction of robust neutralizing antibody, serum IgG, and hemagglutination inhibition (HAI) titers against their corresponding viruses. These results indicated that VSV with P gene deletion was attenuated in vitro and in vivo, and possibly expressed the foreign antigen on its surface. Therefore, the P gene-deletion strategy may offer a potentially useful and safer approach for attenuating negative-sense RNA viruses which use phosphoprotein as a cofactor for viral replication. PMID:27315286

  4. Secreted Phosphoprotein 1 and Sex-Specific Differences in Silica-Induced Pulmonary Fibrosis in Mice

    PubMed Central

    Latoche, Joseph D.; Ufelle, Alexander Chukwuma; Fazzi, Fabrizio; Ganguly, Koustav; Leikauf, George D.; Fattman, Cheryl L.

    2016-01-01

    Background: Fibrotic lung diseases occur predominantly in males, and reports describe better survival in affected females. Male mice are more sensitive to silica-induced lung fibrosis than silica-treated female mice. Secreted phosphoprotein 1 (SPP1, also known as osteopontin) increases in pulmonary fibrosis, and Spp1 transcription may be regulated by estrogen or estrogen receptor–related receptors. Objective: We determined whether differences in silica-induced SPP1 levels contribute to sex differences in lung fibrosis. Methods: Male and female mice were treated with 0.2 g/kg intratracheal silica, and lung injury was assessed 1, 3, or 14 days post-exposure. Gene-targeted (Spp1–/–) mice, control Spp1+/+ (C57BL/6J) mice, ovariectomized (OVX) female mice, and estrogen-treated male mice were treated with silica, and lung injury was assessed. Results: Silica-induced SPP1 in lung tissue, bronchoalveolar lavage, and serum increased more in male than in female mice. Following silica treatment, bronchoalveolar lavage cell infiltrates decreased in female Spp1–/– mice compared with female Spp1+/+ mice, and lung hydroxyproline decreased in male Spp1–/– mice compared with male Spp1+/+ mice. OVX female mice had increased lung SPP1 expression in response to silica compared with silica-treated sham female mice. Silica-induced lung collagen and hydroxyproline (markers of fibrosis), and SPP1 levels decreased in estrogen-treated males compared with untreated males. Conclusion: These findings suggest that sex-specific differences in SPP1 levels contribute to the differential sensitivity of male and female mice to the development of silica-induced fibrosis. Citation: Latoche JD, Ufelle AC, Fazzi F, Ganguly K, Leikauf GD, Fattman CL. 2016. Secreted phosphoprotein 1 and sex-specific differences in silica-induced pulmonary fibrosis in mice. Environ Health Perspect 124:1199–1207; http://dx.doi.org/10.1289/ehp.1510335 PMID:26955063

  5. The stathmin phosphoprotein family: intracellular localization and effects on the microtubule network.

    PubMed

    Gavet, O; Ozon, S; Manceau, V; Lawler, S; Curmi, P; Sobel, A

    1998-11-01

    Stathmin is a small regulatory phosphoprotein integrating diverse intracellular signaling pathways. It is also the generic element of a protein family including the neural proteins SCG10, SCLIP, RB3 and its two splice variants RB3' and RB3". Stathmin itself was shown to interact in vitro with tubulin in a phosphorylation-dependent manner, sequestering free tubulin and hence promoting microtubule depolymerization. We investigated the intracellular distribution and tubulin depolymerizing activity in vivo of all known members of the stathmin family. Whereas stathmin is not associated with interphase microtubules in HeLa cells, a fraction of it is concentrated at the mitotic spindle. We generated antisera specific for stathmin phosphoforms, which allowed us to visualize the regulation of phosphorylation-dephosphorylation during the successive stages of mitosis, and the partial localization of stathmin phosphorylated on serine 16 at the mitotic spindle. Results from overexpression experiments of wild-type and novel phosphorylation site mutants of stathmin further suggest that it induces depolymerization of interphase and mitotic microtubules in its unphosphorylated state but is inactivated by phosphorylation in mitosis. Phosphorylation of mutants 16A25A and 38A63A on sites 38 and 63 or 16 and 25, respectively, was sufficient for the formation of a functional spindle, whereas mutant 16A25A38A63E retained a microtubule depolymerizing activity. Transient expression of each of the neural phosphoproteins of the stathmin family showed that they are at least partially associated to the Golgi apparatus and not to other major membrane compartments, probably through their different NH2-terminal domains, as described for SCG10. Most importantly, like stathmin and SCG10, overexpressed SCLIP, RB3 and RB3" were able to depolymerize interphase microtubules. Altogether, our results demonstrate in vivo the functional conservation of the stathmin domain within each protein of the

  6. Stathmin and its phosphoprotein family: general properties, biochemical and functional interaction with tubulin.

    PubMed

    Curmi, P A; Gavet, O; Charbaut, E; Ozon, S; Lachkar-Colmerauer, S; Manceau, V; Siavoshian, S; Maucuer, A; Sobel, A

    1999-10-01

    Stathmin, also referred to as Op18, is a ubiquitous cytosolic phosphoprotein, proposed to be a small regulatory protein and a relay integrating diverse intracellular signaling pathways involved in the control of cell proliferation, differentiation and activities. It interacts with several putative downstream target and/or partner proteins. One major action of stathmin is to interfere with microtubule dynamics, by inhibiting the formation of microtubules and/or favoring their depolymerization. Stathmin (S) interacts directly with soluble tubulin (T), which results in the formation of a T2S complex which sequesters free tubulin and therefore impedes microtubule formation. However, it has been also proposed that stathmin's action on microtubules might result from the direct promotion of catastrophes, which is still controversial. Phosphorylation of stathmin regulates its biological actions: it reduces its affinity for tubulin and hence its action on microtubule dynamics, which allows for example progression of cells through mitosis. Stathmin is also the generic element of a protein family including the neural proteins SCG10, SCLIP and RB3/RB3'/RB3". Interestingly, the stathmin-like domains of these proteins also possess a tubulin binding activity in vitro. In vivo, the transient expression of neural phosphoproteins of the stathmin family leads to their localization at Golgi membranes and, as previously described for stathmin and SCG10, to the depolymerization of interphasic microtubules. Altogether, the same mechanism for microtubule destabilization, that implies tubulin sequestration, is a common feature likely involved in the specific biological roles of each member of the stathmin family. PMID:15216892

  7. Regulation and subcellular localization of the microtubule-destabilizing stathmin family phosphoproteins in cortical neurons.

    PubMed

    Gavet, Olivier; El Messari, Saïd; Ozon, Sylvie; Sobel, André

    2002-06-01

    Stathmin is a ubiquitous cytosolic phosphoprotein, preferentially expressed in the nervous system, and the generic element of a protein family that includes the neural-specific proteins SCG10, SCLIP, and RB3 and its splice variants, RB3' and RB3". All phosphoproteins of the family share with stathmin its tubulin binding and microtubule (MT)-destabilizing activities. To understand better the specific roles of these proteins in neuronal cells, we performed a comparative study of their expression, regulation, and intracellular distribution in embryonic cortical neurons in culture. We found that stathmin is highly expressed ( approximately 0.25% of total proteins) and uniformly present in the various neuronal compartments (cell body, dendrites, axon, growth cones). It appeared mainly unphosphorylated or weakly phosphorylated on one site, and antisera to specific phosphorylated sites (serines 16, 25, or 38) did not reveal a differential regulation of its phosphorylation among neuronal cell compartments. However, they revealed a subpopulation of cells in which stathmin was highly phosphorylated on serine 16, possibly by CaM kinase II also active in a similar subpopulation. The other proteins of the stathmin family are expressed about 100-fold less than stathmin in partially distinct neuronal populations, RB3 being detected in only about 20% of neurons in culture. In contrast to stathmin, they are each mostly concentrated at the Golgi apparatus and are also present along dendrites and axons, including growth cones. Altogether, our results suggest that the different members of the stathmin family have complementary, at least partially distinct functions in neuronal cell regulation, in particular in relation to MT dynamics. PMID:12111843

  8. Spatiotemporal phosphoprotein distribution and associated cytokine response of a traumatic injury.

    PubMed

    Han, Alice A; Currie, Holly N; Loos, Matthew S; Vrana, Julie A; Fabyanic, Emily B; Prediger, Maren S; Boyd, Jonathan W

    2016-03-01

    Molecular mechanisms of wound healing have been extensively characterized, providing a better understanding of the processes involved in wound repair and offering advances in treatment methods. Both spatial and temporal investigations of injury biomarkers have helped to pinpoint significant time points and locations during the recovery process, which may be vital in managing the injury and making the appropriate diagnosis. This study addresses spatial and temporal differences of phosphoproteins found in skeletal muscle tissue following a traumatic femur fracture, which were further compared to co-localized cytokine responses. In particular, several proteins (Akt, ERK, c-Jun, CREB, JNK, MEK1, and p38) and post-translational phosphorylations (p-Akt, p-c-Jun, p-CREB, p-ERK1/2, p-MEK1, p-p38, p-GSK3α/β, p-HSP27, p-p70S6K, and p-STAT3) associated with inflammation, new tissue formation, and remodeling were found to exhibit significant spatial and temporal differences in response to the traumatic injury. Quadratic discriminant analysis of all measured responses, including cytokine concentrations from previously published findings, was used to classify temporal and spatial observations at high predictive rates, further confirming that distinct spatiotemporal distributions for total protein, phosphorylation signaling, and cytokine (IL-1α, IL-1ß, IL2, IL6, TNF-α, and MIP-1α) responses exist. Finally, phosphoprotein measurements were found to be significantly correlated to cytokine concentrations, suggesting coordinated intracellular and extracellular activity during crucial periods of repair. This study represents a first attempt to monitor and assess integrated changes in extracellular and intracellular signaling in response to a traumatic injury in muscle tissues, which may provide a framework for future research to improve both our understanding of wounds and their treatment options. PMID:26702931

  9. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  10. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  11. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  12. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  13. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  14. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  15. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  16. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  17. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  18. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  19. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  20. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  1. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  2. Phosphoprotein Isotope-Coded Solid-Phase Tag Approach for Enrichment and Quantitative Analysis of Phosphopeptides from Complex Mixtures

    SciTech Connect

    Qian, Weijun ); Goshe, Michael B.; Camp, David G. ); Yu, Li-Rong ); Tang, Keqi ); Smith, Richard D. )

    2003-10-15

    Many cellular processes are regulated by reversible protein phosphorylation and the ability to identify and quantify phosphoproteins from proteomes is essential for gaining a better understanding of these dynamic cellular processes. However, a sensitive, efficient and global method capable of addressing the phosphoproteome has yet to be developed. Here we describe an improved stable-isotope labeling method using a Phosphoprotein Isotope-coded Solid-phase Tag (PhIST) for isolating and measuring the relative abundance of phosphorylated peptides from complex peptide mixtures resulting from the enzymatic digestion of extracted proteins. The PhIST approach is an extension of the previously reported Phosphoprotein Isotope-coded Affinity Tag (PhIAT)approach developed by our laboratory1-2, where the O-phosphate moiety on phosphoseryl or phosphothreonyl residues were derivatized by hydroxide ion-medated B-elimination followed by the addition of 1,2-ethanedithiol (EDT). Instead of using the biotin affinity tag, peptides containing the EDT moiety were captured and labeled in one step using isotope-coded solid-phase reagents containing either light (12C6, 14N) or heavy (13C6, 15N) stable isotopes. The captured peptides labeled with the isotope-coded tags were released from the solid-phase support by UV photocleavage and analyzed by capillary LC-MS/MS. The efficiency and sensitivity of the PhIST labeling approach for identification of phosphopeptides from mixtures was demonstrated using casein phosphoproteins. Its utility for proteomic applications is demonstrated by the labeling of soluble proteins from human breast cancer cell line.

  3. A Druggable Pocket at the Nucleocapsid/Phosphoprotein Interaction Site of Human Respiratory Syncytial Virus

    PubMed Central

    Ouizougun-Oubari, Mohamed; Pereira, Nelson; Tarus, Bogdan; Galloux, Marie; Lassoued, Safa; Fix, Jenna; Tortorici, M. Alejandra; Hoos, Sylviane; Baron, Bruno; England, Patrick; Desmaële, Didier; Couvreur, Patrick; Bontems, François; Rey, Félix A.; Eléouët, Jean-François; Slama-Schwok, Anny

    2015-01-01

    ABSTRACT Presently, respiratory syncytial virus (RSV), the main cause of severe respiratory infections in infants, cannot be treated efficiently with antivirals. However, its RNA-dependent polymerase complex offers potential targets for RSV-specific drugs. This includes the recognition of its template, the ribonucleoprotein complex (RNP), consisting of genomic RNA encapsidated by the RSV nucleoprotein, N. This recognition proceeds via interaction between the phosphoprotein P, which is the main polymerase cofactor, and N. The determinant role of the C terminus of P, and more particularly of the last residue, F241, in RNP binding and viral RNA synthesis has been assessed previously. Here, we provide detailed structural insight into this crucial interaction for RSV polymerase activity. We solved the crystallographic structures of complexes between the N-terminal domain of N (N-NTD) and C-terminal peptides of P and characterized binding by biophysical approaches. Our results provide a rationale for the pivotal role of F241, which inserts into a well-defined N-NTD pocket. This primary binding site is completed by transient contacts with upstream P residues outside the pocket. Based on the structural information of the N-NTD:P complex, we identified inhibitors of this interaction, selected by in silico screening of small compounds, that efficiently bind to N and compete with P in vitro. One of the compounds displayed inhibitory activity on RSV replication, thereby strengthening the relevance of N-NTD for structure-based design of RSV-specific antivirals. IMPORTANCE Respiratory syncytial virus (RSV) is a widespread pathogen that is a leading cause of acute lower respiratory infections in infants worldwide. RSV cannot be treated efficiently with antivirals, and no vaccine is presently available, with the development of pediatric vaccines being particularly challenging. Therefore, there is a need for new therapeutic strategies that specifically target RSV. The interaction

  4. Sequence of Events in Measles Virus Replication: Role of Phosphoprotein-Nucleocapsid Interactions

    PubMed Central

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia

    2014-01-01

    ABSTRACT The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, PXD and NTAIL is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the PXD F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in PXD-to-NTAIL binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the PXD-NTAIL interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. IMPORTANCE Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼6,700-nucleotide messenger RNAs from six

  5. Borna Disease Virus Phosphoprotein Modulates Epigenetic Signaling in Neurons To Control Viral Replication

    PubMed Central

    Bonnaud, Emilie M.; Szelechowski, Marion; Bétourné, Alexandre; Foret, Charlotte; Thouard, Anne; Gonzalez-Dunia, Daniel

    2015-01-01

    ABSTRACT Understanding the modalities of interaction of neurotropic viruses with their target cells represents a major challenge that may improve our knowledge of many human neurological disorders for which viral origin is suspected. Borna disease virus (BDV) represents an ideal model to analyze the molecular mechanisms of viral persistence in neurons and its consequences for neuronal homeostasis. It is now established that BDV ensures its long-term maintenance in infected cells through a stable interaction of viral components with the host cell chromatin, in particular, with core histones. This has led to our hypothesis that such an interaction may trigger epigenetic changes in the host cell. Here, we focused on histone acetylation, which plays key roles in epigenetic regulation of gene expression, notably for neurons. We performed a comparative analysis of histone acetylation patterns of neurons infected or not infected by BDV, which revealed that infection decreases histone acetylation on selected lysine residues. We showed that the BDV phosphoprotein (P) is responsible for these perturbations, even when it is expressed alone independently of the viral context, and that this action depends on its phosphorylation by protein kinase C. We also demonstrated that BDV P inhibits cellular histone acetyltransferase activities. Finally, by pharmacologically manipulating cellular acetylation levels, we observed that inhibiting cellular acetyl transferases reduces viral replication in cell culture. Our findings reveal that manipulation of cellular epigenetics by BDV could be a means to modulate viral replication and thus illustrate a fascinating example of virus-host cell interaction. IMPORTANCE Persistent DNA viruses often subvert the mechanisms that regulate cellular chromatin dynamics, thereby benefitting from the resulting epigenetic changes to create a favorable milieu for their latent and persistent states. Here, we reasoned that Borna disease virus (BDV), the only

  6. Yeast has homologs (CNA1 and CNA2 gene products) of mammalian calcineurin, a calmodulin-regulated phosphoprotein phosphatase.

    PubMed Central

    Cyert, M S; Kunisawa, R; Kaim, D; Thorner, J

    1991-01-01

    Calcineurin, or phosphoprotein phosphatase type 2B (PP2B), is a calmodulin-regulated phosphoprotein phosphatase. We isolated a gene encoding a yeast PP2B homolog (CNA1) by screening a yeast genomic DNA library in the expression vector lambda gt11, first with 125I-labeled yeast calmodulin and then with a human cDNA encoding the catalytic (or A) subunit of calcineurin. The predicted CNA1 gene product is 54% identical to its mammalian counterpart. Using the polymerase chain reaction (PCR) with oligonucleotide primers based on sequences conserved between CNA1 and mammalian PP2B genes, we isolated a second gene, CNA2. CNA2 is identical to PP2Bw, a partial cDNA clone previously described by others as originating from rabbit brain tissue. Our findings demonstrate that a unicellular eukaryote contains phosphoprotein phosphatases of the 2B class. Haploid cells containing a single cna1 or cna2 null mutation, or both mutations, were viable. MATa cna1 cna2 double mutants were more sensitive than wild-type cells or either single mutant to growth arrest induced by the mating pheromone alpha factor and failed to resume growth during continuous exposure to alpha factor. Thus, calcineurin action antagonizes the mating-pheromone response pathway. Images PMID:1651503

  7. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  8. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  9. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  10. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  11. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  12. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  13. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  14. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  15. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  16. Effects of calcium salts of acidic monomers on mineral induction of phosphoprotein immobilized to agarose beads.

    PubMed

    Ito, Shuichi; Iijima, Masahiro; Motai, Fumiko; Mizoguchi, Itaru; Saito, Takashi

    2012-10-01

    The aim of this study is to evaluate the mineralizing potential of acidic monomers and their calcium salts for mineralization, using an in vitro mineral induction model. Phosvitin (PV) was used as a model phosphoprotein in this study. PV was immobilized on agarose beads with divinyl sulfone. Five aliquots of agarose-immobilized PV, acidic monomers, and their calcium salts were incubated in mineralizing solution at various concentrations. The PV beads and acidic monomers were incubated at 37°C. Samples were taken at several time points during the incubation. Then, the agarose beads were analyzed for bound calcium by atomic absorption spectrometry. The mineral formed on the agarose beads was identified as an apatite by microarea X-ray diffraction. Additionally, the specimens were observed using scanning electron microscopy (SEM). Mineral induction time decreased with increasing solution saturation. 4-METCa salt [calcium salt of 4-methacryloxyethyl trimellitate (CMET)] significantly reduced the mineral induction time. Using these data, the interfacial tension for mineral induction of PV and CMET was determined to be 90.1 and 92.7 ergs/cm(2), respectively. The mineral induced in each specimen after incubation for 24 h was identified by its X-ray diffraction pattern as apatite. SEM observation showed that lath-shaped crystals were formed on the surfaces of the CMET. We conclude that CMET could play a role in dentin remineralization. PMID:22623052

  17. The role of phosphorylation in dentin phosphoprotein peptide absorption to hydroxyapatite surfaces: a molecular dynamics study

    PubMed Central

    Villarreal-Ramirez, Eduardo; Garduño-Juarez, Ramon; Gericke, Arne; Boskey, Adele

    2015-01-01

    Dentin phosphoprotein (DPP) is a protein expressed mainly in dentin and to a lesser extent in bone. DPP has a disordered structure, rich in glutamic acid, aspartic acid and phosphorylated serine/threonine residues. It has a high capacity for binding to calcium ions and to hydroxyapatite (HA) crystal surfaces. We used molecular dynamics (MD) simulations as a method for virtually screening interactions between DPP motifs and HA. The goal was to determine which motifs are absorbed to HA surfaces. For these simulations, we considered five peptides from the human DPP sequence. All-atom MD simulations were performed using GROMACS, the peptides were oriented parallel to the {100} HA crystal surface, the distance between the HA and the peptide was 3 nm. The system was simulated for 20 ns. Preliminary results show that for the unphosphorylated peptides, the acidic amino acids present an electrostatic attraction where their side chains are oriented towards HA. This attraction, however, is slow to facilitate bulk transport to the crystal surface. On the other hand, the phosphorylated (PP) peptides are rapidly absorbed on the surface of the HA with their centers of mass closer to the HA surface. More importantly, the root mean square fluctuation (RMSF) indicates that the average structures of the phosphorylated peptides are very inflexible and elongate, while that of the unphosphorylated peptides are flexible. Radius of gyration (Rg) analysis showed the compactness of un-phosphorylated peptides is lower than phosphorylated peptides. Phosphorylation of the DPP peptides is necessary for binding to HA surfaces. PMID:25158198

  18. Signaling in striatal neurons: the phosphoproteins of reward, addiction, and dyskinesia.

    PubMed

    Girault, Jean-Antoine

    2012-01-01

    The striatum is a deep region of the forebrain involved in action selection, control of movement, and motivation. It receives a convergent excitatory glutamate input from the cerebral cortex and the thalamus, controlled by dopamine (DA) released in response to unexpected rewards and other salient stimuli. Striatal function and its dysfunction in drug addiction or Parkinson's disease depend on the interplay between these neurotransmitters. Signaling cascades in striatal medium-sized spiny neurons (MSNs) involve multiple kinases, phosphatases, and phosphoproteins, some of which are highly enriched in these neurons. They control the properties of ion channels and the plasticity of MSNs, in part through their effects on gene transcription. This chapter summarizes signaling in MSNs and focuses on the regulation of multiple protein phosphatases through DA and glutamate receptors and the role of ERK. It is hypothesized that these pathways are particularly adapted to the specific computing properties of MSNs and the function of the basal ganglia circuits in which they participate. PMID:22340713

  19. Golgi Phosphoprotein 4 (GPP130) is a Sensitive and Selective Cellular Target of Manganese Exposure

    PubMed Central

    Masuda, Melisa; Braun-sommargren, Michelle; Crooks, Dan; Smith, Donald R.

    2014-01-01

    Chronic elevated exposure to manganese (Mn) is associated with neurocognitive and fine motor deficits in children. However, relatively little is understood about cellular responses to Mn spanning the transition between physiologic to toxic levels of exposure. Here, we investigated the specificity, sensitivity, and time course of the Golgi Phosphoprotein 4 (GPP130) response to Mn exposure in AF5 GABAergic neuronal cells, and we determined the extent to which GPP130 degradation occurs in brain cells in vivo in rats subchronically exposed to Mn. Our results show that GPP130 degradation in AF5 cells was specific to Mn, and did not occur following exposure to cobalt, copper, iron, nickel, or zinc. GPP130 degradation occurred without measurable increases in intracellular Mn levels and at Mn exposures as low as 0.54 µM. GPP130 protein was detectable by immunofluorescence in only ~15–30% of cells in striatal and cortical rat brain slices, and Mn-exposed animals exhibited a significant reduction in both the number of GPP130-positive cells, and the overall levels of GPP130 protein, demonstrating the in vivo relevance of this Mn-specific response within the primary target organ of Mn toxicity. These results provide insight into specific mechanism(s) of cellular Mn regulation and toxicity within the brain, including the selective susceptibility of cells to Mn cytotoxicity. PMID:23280773

  20. The measles virus phosphoprotein interacts with the linker domain of STAT1

    SciTech Connect

    Devaux, Patricia Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  1. Knockdown of Golgi phosphoprotein 2 inhibits hepatocellular carcinoma cell proliferation and motility

    PubMed Central

    Liu, Yiming; Zhang, Xiaodi; Sun, Ting; Jiang, Junchang; Li, Ying; Chen, Mingliang; Wei, Zhen; Jiang, Weiqin; Zhou, Linfu

    2016-01-01

    Golgi phosphoprotein 2 (GP73) is highly expressed in hepatocellular carcinoma (HCC) cells, where it serves as a biomarker and indicator of disease progression. We used MTS assays, anchorage-independent cell colony formation assays and a xenograft tumor model to show that GP73-specific siRNAs inhibit HCC proliferation in HepG2, SMMC-7721, and Huh7 cell lines and in vivo. Following GP73 silencing, levels of p-Rb, a factor related to metastasis, were reduced, but cell cycle progression was unaffected. Our results suggest that GP73 silencing may not directly suppress proliferation, but may instead inhibit cell motility. Results from proliferation assays suggest GP73 reduces expression of epithelial mesenchymal transition (EMT)-related factors and promotes cell motility, while transwell migration and invasion assays indicated a possible role in metastasis. Immunofluorescence co-localization microscopy and immunoblotting showed that GP73 decreases expression of N-cadherin and E-cadherin, two key factors in EMT, which may in turn decrease intracellular adhesive forces and promote cell motility. This study confirmed that GP73 expression leads to increased expression of EMT-related proteins and that GP73 silencing reduces HCC cell migration in vitro. These findings suggest that GP73 silencing through siRNA delivery may provide a novel low-toxicity therapy for the inhibition of tumor proliferation and metastasis. PMID:26870893

  2. Solution and Crystallographic Structures of the Central Region of the Phosphoprotein from Human Metapneumovirus

    PubMed Central

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Grimes, Jonathan M.

    2013-01-01

    Human metapneumovirus (HMPV) of the family Paramyxoviridae is a major cause of respiratory illness worldwide. Phosphoproteins (P) from Paramyxoviridae are essential co-factors of the viral RNA polymerase that form tetramers and possess long intrinsically disordered regions (IDRs). We located the central region of HMPV P (Pced) which is involved in tetramerization using disorder analysis and modeled its 3D structure ab initio using Rosetta fold-and-dock. We characterized the solution-structure of Pced using small angle X-ray scattering (SAXS) and carried out direct fitting to the scattering data to filter out incorrect models. Molecular dynamics simulations (MDS) and ensemble optimization were employed to select correct models and capture the dynamic character of Pced. Our analysis revealed that oligomerization involves a compact central core located between residues 169-194 (Pcore), that is surrounded by flexible regions with α-helical propensity. We crystallized this fragment and solved its structure at 3.1 Å resolution by molecular replacement, using the folded core from our SAXS-validated ab initio model. The RMSD between modeled and experimental tetramers is as low as 0.9 Å, demonstrating the accuracy of the approach. A comparison of the structure of HMPV P to existing mononegavirales Pced structures suggests that Pced evolved under weak selective pressure. Finally, we discuss the advantages of using SAXS in combination with ab initio modeling and MDS to solve the structure of small, homo-oligomeric protein complexes. PMID:24224051

  3. Characterization of interleukin 2 stimulated 65-kilodalton phosphoprotein in human T cells

    SciTech Connect

    Zu, Youli; Kohno, Michiaki; Namba, Yuziro ); Kohno, Michiaki ); Kubota, Ichiro ); Nishida, Eisuke )

    1990-01-30

    The authors have characterized the cellular proteins which are rapidly phosphorylated by interleukin 2 (IL 2) in a human IL 2 dependent cell line. When treated with IL 2, the phosphorylation of five proteins, 65, 50, 37, 24, and 21 kDa, was found in IL 2 dependent cell lines by two-dimensional gel electrophoretic analysis. After cell conversion from an IL 2 dependent state to an IL 2 independent state, one of the five phosphoproteins, the 65-kDa protein, became constitutively phosphorylated even without addition of IL 2. Also, in other IL 2 independent cell lines, such as KUT-2 and HUT-102, constitutive phosphorylation of the 65-kDa protein occurred without IL 2-stimulation. So our researchers were focused on biochemical characterization of the 65-kDa protein. It was found that the 65-kDa protein was one of the major cellular proteins by comparing the results of two-dimensional gel electrophoretic analysis of ({sup 32}P)P{sub i}-labeled and ({sup 3}H)leucine-labeled cellular proteins and peptide mapping analysis. Subcellular fraction studies indicated that the 65-kDa protein is a cytosol protein. The 65-kDa protein was purified from cytosol of a human T cell line, and its amino acid composition and amino acid sequences of its three oligopeptides were determined. It was found that the 65-kDa protein is identical with 1-plastin.

  4. Dentin phosphoprotein gene locus is not associated with dentinogenesis imperfecta types II and III

    SciTech Connect

    MacDougall, M.; Zeichner-David, M.; Davis, A.; Slavkin, H. ); Murray, J. ); Crall, M. )

    1992-01-01

    Dentinogenesis imperfecta (DGI) is an autosomal dominant inherited dental disease which affects dentin production and mineralization. Genetic linkage studies have been performed on several multigeneration informative kindreds. These studies determined linkage between DGI types II and III and group-specific component (vitamin D-binding protein). This gene locus has been localized to the long arm of human chromosome 4 in the region 4q11-q21. Although this disease has been mapped to chromosome 4, the defective gene product is yet to be determined. Biochemical studies have suggested abnormal levels of dentin phosphoprotein (DPP) associated with DGI type II. This highly acidic protein is the major noncollagenous component of dentin, being solely expressed by the ectomesenchymal derived odontoblast cells of the tooth. The purpose of the present study was to establish whether DPP is associated with DGI types II and III, by using molecular biology techniques. The results indicated that DPP is not localized to any region of human chromosome 4, thus suggesting that the DPP gene is not directly associated with DGI type II or DGI type III. The data do not exclude the possibility that other proteins associated with DPP posttranslational modifications might be responsible for this genetic disease.

  5. Structural studies on the authentic mumps virus nucleocapsid showing uncoiling by the phosphoprotein

    PubMed Central

    Cox, Robert; Pickar, Adrian; Qiu, Shihong; Tsao, Jun; Rodenburg, Cynthia; Dokland, Terje; Elson, Andrew; He, Biao; Luo, Ming

    2014-01-01

    Mumps virus (MuV) is a highly contagious pathogen, and despite extensive vaccination campaigns, outbreaks continue to occur worldwide. The virus has a negative-sense, single-stranded RNA genome that is encapsidated by the nucleocapsid protein (N) to form the nucleocapsid (NC). NC serves as the template for both transcription and replication. In this paper we solved an 18-Å–resolution structure of the authentic MuV NC using cryo-electron microscopy. We also observed the effects of phosphoprotein (P) binding on the MuV NC structure. The N-terminal domain of P (PNTD) has been shown to bind NC and appeared to induce uncoiling of the helical NC. Additionally, we solved a 25-Å–resolution structure of the authentic MuV NC bound with the C-terminal domain of P (PCTD). The location of the encapsidated viral genomic RNA was defined by modeling crystal structures of homologous negative strand RNA virus Ns in NC. Both the N-terminal and C-terminal domains of MuV P bind NC to participate in access to the genomic RNA by the viral RNA-dependent-RNA polymerase. These results provide critical insights on the structure-function of the MuV NC and the structural alterations that occur through its interactions with P. PMID:25288750

  6. Mumps Virus Nucleoprotein Enhances Phosphorylation of the Phosphoprotein by Polo-Like Kinase 1

    PubMed Central

    Pickar, Adrian; Zengel, James; Xu, Pei; Li, Zhuo

    2015-01-01

    ABSTRACT The viral RNA-dependent RNA polymerases (vRdRps) of nonsegmented, negative-sense viruses (NNSVs) consist of the enzymatic large protein (L) and the phosphoprotein (P). P is heavily phosphorylated, and its phosphorylation plays a critical role in viral RNA synthesis. Since NNSVs do not encode kinases, P is phosphorylated by host kinases. In this study, we investigate the roles that viral proteins play in the phosphorylation of mumps virus (MuV) P. We found that nucleoprotein (NP) enhances the phosphorylation of P. We have identified the serine/threonine kinase Polo-like kinase 1 (PLK1) as a host kinase that phosphorylates P and have found that phosphorylation of P by PLK1 is enhanced by NP. The PLK1 binding site in MuV P was mapped to residues 146 to 148 within the S(pS/T)P motif, and the phosphorylation site was identified as residues S292 and S294. IMPORTANCE It has previously been shown that P acts as a chaperone for NP, which encapsidates viral genomic RNA to form the NP-RNA complex, the functional template for viral RNA synthesis. Thus, it is assumed that phosphorylation of P may regulate NP's ability to form the NP-RNA complex, thereby regulating viral RNA synthesis. Our work demonstrates that MuV NP affects phosphorylation of P, suggesting that NP can regulate viral RNA synthesis by regulating phosphorylation of P. PMID:26608325

  7. Neutral Sphingomyelinase 2 (nSMase2) Is a Phosphoprotein Regulated by Calcineurin (PP2B)*

    PubMed Central

    Filosto, Simone; Fry, William; Knowlton, Anne A.; Goldkorn, Tzipora

    2010-01-01

    We previously reported that exposure of human airway epithelial cells to oxidative stress increased ceramide generation via specific activation of neutral sphingomyelinase2 (nSMase2). Here we show that nSMase2 is a phosphoprotein exclusively phosphorylated at serine residues. The level of nSMase2 phosphorylation can be modulated by treatment with anisomycin or phorbol 12-myristate 13-acetate (PMA/12-O-tetradecanoylphorbol-13-acetate), suggesting that p38 mitogen-activated protein kinase (MAPK) and protein kinases Cs are upstream of nSMase2 phosphorylation. Oxidative stress enhances both the activity and phosphorylation of nSMase2. Strikingly, we show here that nSMase2 is bound directly by the phosphatase calcineurin (CaN), which acts as an on/off switch for nSMase2 phosphorylation in the presence or absence of oxidative stress. Specifically, CaN is being inhibited/degraded and therefore does not bind nSMase2 under oxidative stress, and a mutant nSMase2 that lacks the CaN binding site exhibits constitutively elevated phosphorylation and increased activity relative to wild type nSMase2. Importantly, the phosphorylation and activity of the mutant no longer responds to oxidative stress, confirming that CaN is the critical link that allows oxidative stress to modulate nSMase2 phosphorylation and function. PMID:20106976

  8. Fas-activated serine/threonine phosphoprotein promotes immune-mediated pulmonary inflammation

    PubMed Central

    Simarro, Maria; Giannattasio, Giorgio; De la Fuente, Miguel A; Benarafa, Charaf; Subramanian, Kulandayan K.; Ishizawar, Rumey; Balestrieri, Barbara; Andersson, Emma M; Luo, Hongbo R.; Orduña, Antonio; Boyce, Joshua; Anderson, Paul

    2010-01-01

    We have generated Fas activated serine threonine phosphoprotein-deficient mice (FAST−/−) to study the in vivo role of FAST in immune system function. In a model of house dust mite (HDM)-induced allergic pulmonary inflammation, wild type mice develop a mixed cellular infiltrate composed of eosinophils, lymphocytes and neutrophils. FAST−/− mice develop airway inflammation that is distinguished by the near absence of neutrophils. Similarly, LPS-induced alveolar neutrophil recruitment is markedly reduced in FAST−/− mice compared to wild type controls. This is accompanied by reduced concentrations of cytokines (TNF-α, IL-6 and IL-23) and chemoattractants (MIP-2 and KC) in bronchoalveolar lavage fluids. As FAST−/− neutrophils exhibit normal chemotaxis and survival, impaired neutrophil recruitment is likely to be due to reduced production of chemoattractants within the pulmonary parenchyma. Studies using bone marrow chimeras implicate lung resident hematopoietic cells (e.g. pulmonary dendritic cells and/or alveolar macrophages) in this process. In conclusion, our results introduce FAST as a pro-inflammatory factor that modulates the function of lung resident hematopoietic cells to promote neutrophil recruitment and pulmonary inflammation. PMID:20363972

  9. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila

    PubMed Central

    Mecklenburg, Kirk L.; Takemori, Nobuaki; Komori, Naoka; Chu, Brian; Hardie, Roger C.; Matsumoto, Hiroyuki; O’Tousa, Joseph. E.

    2010-01-01

    Photoreceptor cells achieve high sensitivity, reliably detecting single photons, while limiting the spontaneous activation events responsible for dark noise. We used proteomic, genetic, and electrophysiological approaches to characterize Retinophilin (RTP/CG10233) in Drosophila photoreceptors, and establish its involvement in dark noise suppression. RTP possesses MORN (Membrane Occupation and Recognition Nexus) motifs, a structure shared with mammalian junctophilins and other membrane-associated proteins found within excitable cells. We show the MORN repeats, and both the N- and C-terminal domains, are required for RTP localization in the microvillar light gathering organelle, the rhabdomere. RTP exists in multiple phosphorylated isoforms under dark conditions and is dephosphorylated by light exposure. An RTP deletion mutant exhibits a high rate of spontaneous membrane depolarization events in dark conditions but retains the normal kinetics of the light response. Photoreceptors lacking NINAC myosin III, a motor protein/kinase, also display a similar dark noise phenotype as the RTP deletion. We show that NINAC mutants are depleted for RTP. These results suggest the increase in dark noise in NINAC mutants is due to lack of RTP, and further, defines a novel role for NINAC in the rhabdomere. We propose that RTP is a light-regulated phosphoprotein that organizes rhabdomeric components to suppress random activation of the phototransduction cascade and thus increases the signaling fidelity of dark-adapted photoreceptors. PMID:20107052

  10. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  11. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  12. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  13. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  14. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  15. The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene.

    PubMed Central

    Purves, F C; Spector, D; Roizman, B

    1991-01-01

    Earlier studies have shown that a herpes simplex virus 1 (HSV-1) open reading frame, US3, encodes a novel protein kinase and have characterized the cognate amino acid sequence which is phosphorylated by this enzyme. This report identifies an apparently essential viral phosphoprotein whose posttranslational processing involves the viral protein kinase. Analyses of viral proteins phosphorylated in the course of productive infection revealed a phosphoprotein whose mobility was viral protein kinase and serotype dependent. Thus, the corresponding HSV-1 and HSV-2 phosphoproteins differ in their electrophoretic mobilities, and the phosphoprotein specified by the HSV-1 mutant deleted in US3 (R7041) differs from that of the corresponding HSV-1 and HSV-2 proteins. Analyses of HSV-1 x HSV-2 recombinants mapped the phosphoprotein between 0.42 and 0.47 map units on the prototype HSV-1 DNA map. Within this region, the UL34 open reading frame was predicted to encode a protein of appropriate molecular weight which would also contain the consensus target site for phosphorylation by the viral protein kinase as previously defined with synthetic peptides. Replacement of the native UL34 gene with a UL34 gene tagged with a 17-amino-acid epitope from the alpha 4 protein identified this gene as encoding the phosphoprotein. Finally, mutagenesis of the predicted phosphorylation site on UL34 in the viral genome, and specifically the substitution of threonine or serine with alanine in the product of the UL34 gene, yielded phosphoproteins whose electrophoretic mobilities could not be differentiated from that of the US3- mutant. We conclude that the posttranslational processing of the UL34 gene product to its wild-type phenotype requires the participation of the viral protein kinase. While the viral protein kinase is not essential for viral replication in cells in culture, the UL34 gene product itself may not be dispensable. Images PMID:1656069

  16. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  17. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  18. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  19. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  20. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  1. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  2. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  3. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  4. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  5. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  6. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  7. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  8. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  9. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  10. Astacin Proteases Cleave Dentin Sialophosphoprotein (Dspp) to Generate Dentin Phosphoprotein (Dpp)

    PubMed Central

    Tsuchiya, Shuhei; Simmer, James P; Hu, Jan C-C; Richardson, Amelia S; Yamakoshi, Fumiko; Yamakoshi, Yasuo

    2011-01-01

    Dentin sialophosphoprotein (Dspp) is critical for proper dentin biomineralization because genetic defects in DSPP cause dentin dysplasia type II and dentinogenesis imperfecta types II and III. Dspp is processed by proteases into smaller subunits; the initial cleavage releases dentin phosphoprotein (Dpp). We incubated fluorescence resonance energy transfer (FRET) peptides containing the amino acid context of the Dpp cleavage site (YEFDGKSMQGDDPN, designated Dspp-FRET) or a mutant version of that context (YEFDGKSIEGDDPN, designated mutDspp-FRET) with BMP-1, MEP1A, MEP1B, MMP-2, MMP-8, MMP-9, MT1-MMP, MT3-MMP, Klk4, MMP-20, plasmin, or porcine Dpp and characterized the peptide cleavage products. Only BMP-1, MEP1A, and MEP1B cleaved Dspp-FRET at the G–D peptide bond that releases Dpp from Dspp in vivo. We isolated Dspp proteoglycan from dentin power and incubated it with the three enzymes that cleaved Dspp-FRET at the G–D bond. In each case, the released Dpp domain was isolated, and its N-terminus was characterized by Edman degradation. BMP-1 and MEP1A both cleaved native Dspp at the correct site to generate Dpp, making both these enzymes prime candidates for the protease that cleaves Dspp in vivo. MEP1B was able to degrade Dpp when the Dpp was at sufficiently high concentration to deplete free calcium ion concentration. Immunohistochemistry of developing porcine molars demonstrated that astacins are expressed by odontoblasts, a result that is consistent with RT-PCR analyses. We conclude that during odontogenesis, astacins in the predentin matrix cleave Dspp before the DDPN sequence at the N-terminus of Dpp to release Dpp from the parent Dspp protein. © 2011 American Society for Bone and Mineral Research. PMID:20687161

  11. Prognostic significance of peroxiredoxin 1 and ezrin-radixin-moesin-binding phosphoprotein 50 in cholangiocarcinoma

    PubMed Central

    Yonglitthipagon, Ponlapat; Pairojkul, Chawalit; Chamgramol, Yaovalux; Loukas, Alex; Mulvenna, Jason; Bethony, Jeffrey; Sripa, Banchob

    2012-01-01

    Summary We performed a comparative proteomic analysis of protein expression profiles in four cholangiocarcinoma (CCA) cell lines: K100, M156, M213, and M139. The H69 biliary cell line was used as a control. Peroxiredoxin 1 (PRX1) and ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50) were selected for further validation by immunohistochemistry (IHC) using a CCA tissue microarray (n=301) to assess their prognostic value in this cancer. Both PRX1 and EBP50 were overexpressed in CCA tissues compared with normal liver tissues. Of the 301 CCA cases, overexpression of PRX1 in 103 (34.3%) was associated with an age-related effect in young patients (P = 0.011) and the absence of cholangiocarcinoma in lymphatic vessels and perineural tissues (P = 0.004 and P = 0.037, respectively). Expression of EBP50 correlated with histopathologic type, being higher in 180 (59.8%) of moderately or poorly differentiated tumors (P = 0.039) and was associated with the presence of cholangiocarcinoma in lymphatic and vascular vessels (P< 0.001 and P< 0.001, respectively). The high expression of EBP50 and the low expression of PRX1 correlated with reduced survival by univariate analysis (P = 0.017 and P = 0.048, respectively). Moreover, the impact of PRX1 and EBP50 expression on patient survival was an independent predictor in multivariate analyses (P = 0.004 and P = 0.025, respectively). Therefore, altered expression of PRX1 and EBP50 may be used as prognostic markers incholangiocarcinoma. PMID:22446018

  12. Rabies virus phosphoprotein interacts with mitochondrial Complex I and induces mitochondrial dysfunction and oxidative stress.

    PubMed

    Kammouni, Wafa; Wood, Heidi; Saleh, Ali; Appolinario, Camila M; Fernyhough, Paul; Jackson, Alan C

    2015-08-01

    Our previous studies in an experimental model of rabies showed neuronal process degeneration in association with severe clinical disease. Cultured adult rodent dorsal root ganglion neurons infected with challenge virus standard (CVS)-11 strain of rabies virus (RABV) showed axonal swellings and reduced axonal growth with evidence of oxidative stress. We have shown that CVS infection alters a variety of mitochondrial parameters and increases reactive oxygen species (ROS) production and mitochondrial Complex I activity vs. mock infection. We have hypothesized that a RABV protein targets mitochondria and triggers dysfunction. Mitochondrial extracts of mouse neuroblastoma cells were analyzed with a proteomics approach. We have identified peptides belonging to the RABV nucleocapsid protein (N), phosphoprotein (P), and glycoprotein (G), and our data indicate that the extract was most highly enriched with P. P was also detected by immunoblotting in RABV-infected purified mitochondrial extracts and also in Complex I immunoprecipitates from the extracts but not in mock-infected extracts. A plasmid expressing P in cells increased Complex I activity and increased ROS generation, whereas expression of other RABV proteins did not. We have analyzed recombinant plasmids encoding various P gene segments. Expression of a peptide from amino acid 139-172 increased Complex I activity and ROS generation similar to expression of the entire P protein, whereas peptides that did not contain this region did not increase Complex I activity or induce ROS generation. These results indicate that a region of the RABV P interacts with Complex I in mitochondria causing mitochondrial dysfunction, increased generation of ROS, and oxidative stress. PMID:25698500

  13. Protein kinase C regulates the phosphorylation and oligomerization of ERM binding phosphoprotein 50

    SciTech Connect

    Fouassier, Laura; Nichols, Matthew T.; Gidey, Elizabeth; McWilliams, Ryan R.; Robin, Helene; Finnigan, Claire; Howell, Kathryn E.; Housset, Chantal; Doctor, R. Brian . E-mail: brian.doctor@uchsc.edu

    2005-05-15

    Ezrin-Radixin-Moesin (ERM) binding phosphoprotein 50 (EBP50, a.k.a. NHERF-1) is a scaffold protein essential for the localization and coordinated activity of apical transporters, enzymes and receptors in epithelial cells. EBP50 acts via multiple protein binding interactions, including oligomerization through interactions of its PSD95-Dlg-ZO1 (PDZ) domains. EBP50 can be phosphorylated on multiple sites and phosphorylation of specific sites modulates the extent of oligomerization. The aim of the present study was to test the capacity of protein kinase C (PKC) to phosphorylate EBP50 and to regulate its oligomerization. In vitro experiments showed that the catalytic subunit of PKC directly phosphorylates EBP50. In HEK-293 cells transfected with rat EBP50 cDNA, a treatment with 12 myristate 13-acetate (PMA) induced a translocation of PKC{alpha} and {beta} isoforms to the membrane and increased {sup 32}P incorporation into EBP50. In co-transfection/co-precipitation studies, PMA treatment stimulated EBP50 oligomerization. Mass spectrometry analysis of full-length EBP50 and phosphorylation analyses of specific domains, and of mutated or truncated forms of EBP50, indicated that PKC-induced phosphorylation of EBP50 occurred on the Ser{sup 337}/Ser{sup 338} residue within the carboxyl-tail domain of the protein. Truncation of Ser{sup 337}/Ser{sup 338} also diminished PKC-induced oligomerization of EBP50. These results suggest the PKC signaling pathway can impact EBP50-dependent cellular functions by regulating EBP50 oligomerization.

  14. Vasodilator-Stimulated Phosphoprotein Deficiency Potentiates PAR-1-induced Increase in Endothelial Permeability in Mouse Lungs

    PubMed Central

    Profirovic, Jasmina; Han, Jingyan; Andreeva, Alexandra V.; Neamu, Radu F.; Pavlovic, Sasha; Vogel, Stephen M.; Walter, Ulrich; Voyno-Yasenetskaya, Tatyana A.

    2010-01-01

    Vasodilator-stimulated phosphoprotein (VASP) is implicated in the protection of the endothelial barrier in vitro and in vivo. VASP function in thrombin signaling in the endothelial cells (ECs) is not known. For the first time we studied the effects of VASP deficiency on EC permeability and pulmonary vascular permeability in response to thrombin receptor stimulation. We provided the evidence that VASP deficiency potentiates the increase in endothelial permeability induced by activation of thrombin receptor in cultured human umbilical vein endothelial cells (HUVECs) and isolated mouse lungs. Using transendothelial resistance measurement, we showed that siRNA-mediated VASP downregulation in HUVECs leads to a potentiation of thrombin- and protease-activated receptor 1 (PAR-1) agonist-induced increase in endothelial permeability. Compared to control cells, VASP-deficient HUVECs had delayed endothelial junctional reassembly and abrogated VE-cadherin cytoskeletal anchoring in the recovery phase after thrombin stimulation, as demonstrated by immunofluorescence studies and cell fractionation analysis, respectively. Measurement of the capillary filtration coefficient in isolated mouse lungs demonstrated that VASP−/− mice have increased microvascular permeability in response to infusion with PAR-1 agonist compared to wild type mice. Lack of VASP led to decreased Rac1 activation both in VASP-deficient HUVECs after thrombin stimulation and VASP−/− mouse lungs after PAR-1 agonist infusion, indicating that VASP effects on thrombin signaling may correlated with changes in Rac1 activity. This study demonstrates that VASP may play critical and complex role in the regulation of thrombin-dependent disruption of the endothelial barrier function. PMID:20945373

  15. Characterization of the major phosphoprotein and its kinase on the surface of the rat adipocyte

    SciTech Connect

    Kang, E.S.; Chiang, T.M.

    1986-12-01

    Intact rat fat cell exposed to 12.5 ..mu..M (..gamma..-32P)ATP incorporate label into specific proteins within minutes. By solubilizing the reaction mixture with SDS which bypasses the subcellular fractionation steps, the labeled proteins can be identified in autoradiographs of SDS-PAGE gels. The most prominently labeled protein has an M/sub r/ of 42,000. Localization of this component to the cell surface can be made on the basis of inhibition of phosphorylation by addition of a protein derived from the rat brain with protein kinase inhibitory property, susceptibility of the phosphorylated protein to the tryptic digestion, inhibition of phosphorylation of this protein after brief exposure to melittin. To rule out the possibility that the cell surface protein might be a mitochondrial contaminant from broken cells, /sup 32/Pi-labeled and (..gamma..-/sup 32/P)ATP-labeled cells were chromatographed on a rabbit anti-pyruvate dehydrogenase antibody-Sepharose 4B column. A single labeled peak was detected upon elution of the bound fraction only in the /sup 32/pi-labeled sample, and not in the (..gamma..-/sup 32/P)ATP-labeled sample. Subcellular fractionation studies of intact cells labeled depending on whether a continuous sucrose gradient or a discontinuous sucrose gradient was used. Finally, comparison of the autoradiographs of two-dimensional (2D) gels show different isoelectric points for 42,000 M/sub r/ components in (..gamma..-/sup 32/P)ATP- and /sup 32/Pi-labeled cells. These and other experiments support the likelihood that phosphoproteins of 42,000 M/sub r/ are present at two sites in the intact rat fat cell, the cell surface and at an intracellular site, most likely the mitochondria.

  16. Atomic resolution description of the interaction between the nucleoprotein and phosphoprotein of Hendra virus.

    PubMed

    Communie, Guillaume; Habchi, Johnny; Yabukarski, Filip; Blocquel, David; Schneider, Robert; Tarbouriech, Nicolas; Papageorgiou, Nicolas; Ruigrok, Rob W H; Jamin, Marc; Jensen, Malene Ringkjøbing; Longhi, Sonia; Blackledge, Martin

    2013-01-01

    Hendra virus (HeV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The HeV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid. Recruitment of the viral polymerase onto the nucleocapsid template relies on the interaction between the C-terminal domain, N(TAIL), of N and the C-terminal X domain, XD, of the polymerase co-factor phosphoprotein (P). Here, we provide an atomic resolution description of the intrinsically disordered N(TAIL) domain in its isolated state and in intact nucleocapsids using nuclear magnetic resonance (NMR) spectroscopy. Using electron microscopy, we show that HeV nucleocapsids form herringbone-like structures typical of paramyxoviruses. We also report the crystal structure of XD of P that consists of a three-helix bundle. We study the interaction between N(TAIL) and XD using NMR titration experiments and provide a detailed mapping of the reciprocal binding sites. We show that the interaction is accompanied by α-helical folding of the molecular recognition element of N(TAIL) upon binding to a hydrophobic patch on the surface of XD. Finally, using solution NMR, we investigate the interaction between intact nucleocapsids and XD. Our results indicate that monomeric XD binds to N(TAIL) without triggering an additional unwinding of the nucleocapsid template. The present results provide a structural description at the atomic level of the protein-protein interactions required for transcription and replication of HeV, and the first direct observation of the interaction between the X domain of P and intact nucleocapsids in Paramyxoviridae. PMID:24086133

  17. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  18. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  19. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  20. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  1. Purification of a 53kD pI 4. 8 cytosolic phosphoprotein from HL60

    SciTech Connect

    Biser, P.S.; Spearman, T.N.; Bruzzone, M.; Durham, J.P.

    1987-05-01

    In order to study the potential role of a 53kD pI 4.8 phosphoprotein in the differentiation of HL60 using monoclonal antibodies, a partial purification has been carried out. Cytosol from cells differentiated with 1 M retinoic acid was applied to a DEAE-cellulose column and eluted with a linear NaCl gradient. Fractions were screened by in vitro phosphorylation of aliquots using /sup 32/P ATP and highly purified protein kinase C, SDS-PAGE, and autoradiography. Fraction which showed autoradiographic bands of the correct molecular weight were further analyzed using 2-D electrophoresis involving isolectric focusing over a pH range of 4-6 followed by SDS-PAGE on a 10% slab gel. Autoradiograms of these gels showed the 53 kD pI 4.8 phosphoprotein to elute with a peak at 0.24 NaCl. This 53 kD pI 4.8 protein was identified as the 53kD pI 4.8 phosphoprotein whose synthesis and phosphorylation is induced by retinoic acid by DEAE chromatography of cytosol from cells labelled in vivo with /sup 32/PO/sub 4//sup -2/ followed by 2-D electrophoresis. Fractions containing the 53 kD pI 4.8 protein were concentrated and applied to a chromatofocusing column which was eluted with a gradient from pH 6 to 4. Analysis of fractions via in vitro phosphorylation and SDS PAGE showed the 53 kD pI 4.8 protein eluting with a peak at pH 4.8 as a silver-stained band well separated from contaminating proteins. Experiments are currently in progress to produce monoclonal antibodies to the 53 kD pI 4.8 protein using the partially purified antigen.

  2. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  3. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  4. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  5. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  6. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  7. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  8. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  9. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  10. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  11. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  12. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  13. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  14. Radioautographic visualization and biochemical identification of O-phosphoserine- and O-phosphothreonine-containing phosphoproteins in mineralizing embryonic chick bone

    SciTech Connect

    Landis, W.J.; Sanzone, C.F.; Brickley-Parsons, D.; Glimcher, M.J.

    1984-03-01

    The authors injected NaH/sub 2//sup 33/PO/sub 4/ into normal 14-d-old embryonic chicks and examined the long bones by both radioautography and biochemical analyses from 10 to 240 min after the injection was completed. At 30 min, determination of the radiographic grain density revealed that /sup 33/P was concentrated principally in fibroblasts, preosteoblasts, and osteoblasts. With time, there was a progressive increase in the density of silver grains located over both the osteogenic cells and the regions of uncalcified (osteoid) and calcified extracellular organic matrices. Biochemical analyses identified /sup 33/P-O-phosphoserine as the major /sup 33/P component in glutaraldehyde-treated whole demineralized bone tissue and in EDTA-soluble, nondiffusible proteins extracted from the bones, both at the same time periods that /sup 33/P-induced silver grains were visualized by radioautography. /sup 33/-P-O-phosphothreonine was also identified in experiments using a dosage of 10 mCi per embryo. The results provide the first combined direct biochemical and radioautographic identification that phosphoproteins are synthesized in bone and are located morphologically at the sites of mineralization. The data provide further evidence that phosphoproteins play a critical role in the biological calcification of vertebrate tissues.

  15. A rapid and simple 8-quinolinol-based fluorescent stain of phosphoproteins in polyacrylamide gel after electrophoresis.

    PubMed

    Wang, Xu; Hwang, Sun-Young; Cong, Wei-Tao; Jin, Li-Tai; Choi, Jung-Kap

    2015-10-01

    In order to obtain an easy and rapid protocol to visualize phosphoproteins in SDS-PAGE, a fluorescent detection method named 8-Quinolinol (8-Q) stain is described. 8-Q can form ternary complexes in the gel matrix contributed by the affinity of aluminum ion (Al(3+) ) to the phosphate groups on the proteins and the metal chelating property of 8-Quinolinol, exhibiting strong fluorescence in ultraviolet light. It can visualize as little as 4∼8 ng of α-casein and β-casein, 16∼32 ng of ovalbumin and κ-casein which is more sensitive than Stains-All but less sensitive than Pro-Q Diamond. The protocol of 8-Q requires only 70 min in 0.75 mm mini-size or 1.0 mm large-size gels with five changes of solutions without destaining step; Pro-Q takes at least 250 min with 11 changes of solutions. In addition, the new method was confirmed by the study of dephosphorylation and LC-MS/MS, respectively. The approach to visualize phosphoprotein utilizing 8-Q could be an alternative to simplify the analytical operations for phosphoproteomics research. PMID:26177935

  16. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  17. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  18. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  19. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  20. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  1. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  2. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  3. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  4. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  5. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  6. Stochastic kinetics of ribosomes: Single motor properties and collective behavior

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debanjan; Chowdhury, Debashish; Ramakrishnan, T. V.

    2009-07-01

    Syntheses of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an exact analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a “Michaelis-Menten-type” equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechanochemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a copy of the same protein. We extend the model of a single ribosome by incorporating steric exclusion of different individuals on the same track. We draw the phase diagram of this model of ribosome traffic in three-dimensional spaces spanned by experimentally controllable parameters. We suggest new experimental tests of our theoretical predictions.

  7. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  8. Ribosomal crystallography: peptide bond formation and its inhibition.

    PubMed

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  9. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  10. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  11. Quantitative assessment of ribosome drop-off in E. coli.

    PubMed

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-04-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength inE. coli Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  12. Whither Ribosome Structure and Dynamics Research? (A Perspective).

    PubMed

    Frank, Joachim

    2016-09-11

    As high-resolution cryogenic electron microscopy (cryo-EM) structures of ribosomes proliferate, at resolutions that allow atomic interactions to be visualized, this article attempts to give a perspective on the way research on ribosome structure and dynamics may be headed, and particularly the new opportunities we have gained through recent advances in cryo-EM. It is pointed out that single-molecule FRET and cryo-EM form natural complements in the characterization of ribosome dynamics and transitions among equilibrating states of in vitro translational systems. PMID:27178840

  13. Quantitative assessment of ribosome drop-off in E. coli

    PubMed Central

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-01-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength in E. coli. Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  14. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  15. Crystal Structure of the Measles Virus Nucleoprotein Core in Complex with an N-Terminal Region of Phosphoprotein

    PubMed Central

    Guryanov, Sergey G.; Liljeroos, Lassi; Kasaragod, Prasad; Kajander, Tommi

    2015-01-01

    ABSTRACT The enveloped negative-stranded RNA virus measles virus (MeV) is an important human pathogen. The nucleoprotein (N0) assembles with the viral RNA into helical ribonucleocapsids (NC) which are, in turn, coated by a helical layer of the matrix protein. The viral polymerase complex uses the NC as its template. The N0 assembly onto the NC and the activity of the polymerase are regulated by the viral phosphoprotein (P). In this study, we pulled down an N01-408 fragment lacking most of its C-terminal tail domain by several affinity-tagged, N-terminal P fragments to map the N0-binding region of P to the first 48 amino acids. We showed biochemically and using P mutants the importance of the hydrophobic interactions for the binding. We fused an N0 binding peptide, P1-48, to the C terminus of an N021-408 fragment lacking both the N-terminal peptide and the C-terminal tail of N protein to reconstitute and crystallize the N0-P complex. We solved the X-ray structure of the resulting N0-P chimeric protein at a resolution of 2.7 Å. The structure reveals the molecular details of the conserved N0-P interface and explains how P chaperones N0, preventing both self-assembly of N0 and its binding to RNA. Finally, we propose a model for a preinitiation complex for RNA polymerization. IMPORTANCE Measles virus is an important, highly contagious human pathogen. The nucleoprotein N binds only to viral genomic RNA and forms the helical ribonucleocapsid that serves as a template for viral replication. We address how N is regulated by another protein, the phosphoprotein (P), to prevent newly synthesized N from binding to cellular RNA. We describe the atomic model of an N-P complex and compare it to helical ribonucleocapsid. We thus provide insight into how P chaperones N and helps to start viral RNA synthesis. Our results provide a new insight into mechanisms of paramyxovirus replication. New data on the mechanisms of phosphoprotein chaperone action allows better understanding of

  16. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  17. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  18. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  19. Cotranslational protein folding on the ribosome monitored in real time.

    PubMed

    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V

    2015-11-27

    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  20. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  1. Cotranslational Protein Folding inside the Ribosome Exit Tunnel.

    PubMed

    Nilsson, Ola B; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D; O'Brien, Edward P; Beckmann, Roland; von Heijne, Gunnar

    2015-09-01

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  2. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar

    2015-01-01

    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  3. Direct ribosomal binding by a cellular inhibitor of translation

    PubMed Central

    Colón-Ramos, Daniel A; Shenvi, Christina L; Weitzel, Douglas H; Gan, Eugene C; Matts, Robert; Cate, Jamie; Kornbluth, Sally

    2009-01-01

    During apoptosis and under conditions of cellular stress, several signaling pathways promote inhibition of cap-dependent translation while allowing continued translation of specific messenger RNAs encoding regulatory and stress-response proteins. We report here that the apoptotic regulator Reaper inhibits protein synthesis by binding directly to the 40S ribosomal subunit. This interaction does not affect either ribosomal association of initiation factors or formation of 43S or 48S complexes. Rather, it interferes with late initiation events upstream of 60S subunit joining, apparently modulating start-codon recognition during scanning. CrPV IRES–driven translation, involving direct ribosomal recruitment to the start site, is relatively insensitive to Reaper. Thus, Reaper is the first known cellular ribosomal binding factor with the potential to allow selective translation of mRNAs initiating at alternative start codons or from certain IRES elements. This function of Reaper may modulate gene expression programs to affect cell fate. PMID:16429152

  4. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; Chapelle, S; De Wachter, R

    1994-01-01

    A database on large ribosomal subunit RNA is made available. It contains 258 sequences. It provides sequence, alignment and secondary structure information in computer-readable formats. Files can be obtained using ftp. PMID:7524023

  5. A process yields large quantities of pure ribosome subunits

    NASA Technical Reports Server (NTRS)

    Friedman, M.; Lu, P.; Rich, A.

    1972-01-01

    Development of process for in-vitro protein synthesis from living cells followed by dissociation of ribosomes into subunits is discussed. Process depends on dialysis or use of chelating agents. Operation of process and advantages over previous methods are outlined.

  6. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  7. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  8. Nonenzymatic microorganism identification based on ribosomal RNA

    NASA Astrophysics Data System (ADS)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  9. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  10. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  11. The 16S ribosomal RNA mutation database (16SMDB).

    PubMed Central

    Triman, K L

    1996-01-01

    The 16S ribosomal RNA mutation database (16SMDB) provides a list of mutated positions in 16S ribosomal RNA from Escherichia coli and the identity of each alteration. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation; (ii) whether a mutant phenotype has been detected by in vivo or in vitro methods; (iii) relevant literature citations. The database is available via ftp and on the World Wide Web. PMID:8594570

  12. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment.

    PubMed

    Habchi, Johnny; Longhi, Sonia

    2015-01-01

    We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N) and phosphoprotein (P) from three paramyxoviruses, namely the measles (MeV), Nipah (NiV) and Hendra (HeV) viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL) of their N proteins undergoes upon binding to the C-terminal X domain (PXD) of the homologous P proteins. We also show that NTAIL-PXD complexes are "fuzzy", i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N-P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses. PMID:26184170

  13. PP1-mediated dephosphorylation of phosphoproteins at mitotic exit is controlled by inhibitor-1 and PP1 phosphorylation

    PubMed Central

    Wu, Judy Qiju; Guo, Jessie Yanxiang; Tang, Wanli; Yang, Chih-Sheng; Freel, Christopher D.; Chen, Chen; Nairn, Angus C.; Kornbluth, Sally

    2009-01-01

    Loss of Cdc2 activity following Cyclin B degradation is necessary, but not sufficient, for mitotic exit. Proteins phosphorylated by Cdc2 and downstream mitotic kinases must also be dephosphorylated. We report here that protein phosphatase-1 (PP1) is the major catalyst of mitotic phosphoprotein dephosphorylation. Suppression of PP1 during early mitosis is maintained through the dual inhibition of PP1 by Cdc2 phosphorylation and the binding of Inhibitor-1 (I1), which is facilitated by PKA-mediated I1 phosphorylation. As Cdc2 levels drop following Cyclin B degradation, autodephosphorylation of PP1 at the site of Cdc2 phosphorylation (T320) allows partial PP1 activation. This promotes PP1-regulated dephosphorylation of I1 at its activating site (T35), dissociation of the I1-PP1 complex, and full PP1 activation to promote mitotic exit. Thus, Cdc2 both phosphorylates multiple mitotic substrates and inhibits their PP1-mediated dephosphorylation. PMID:19396163

  14. Structural Disorder within Paramyxoviral Nucleoproteins and Phosphoproteins in Their Free and Bound Forms: From Predictions to Experimental Assessment

    PubMed Central

    Habchi, Johnny; Longhi, Sonia

    2015-01-01

    We herein review available computational and experimental data pointing to the abundance of structural disorder within the nucleoprotein (N) and phosphoprotein (P) from three paramyxoviruses, namely the measles (MeV), Nipah (NiV) and Hendra (HeV) viruses. We provide a detailed molecular description of the mechanisms governing the disorder-to-order transition that the intrinsically disordered C-terminal domain (NTAIL) of their N proteins undergoes upon binding to the C-terminal X domain (PXD) of the homologous P proteins. We also show that NTAIL–PXD complexes are “fuzzy”, i.e., they possess a significant residual disorder, and discuss the possible functional significance of this fuzziness. Finally, we emphasize the relevance of N–P interactions involving intrinsically disordered proteins as promising targets for new antiviral approaches, and end up summarizing the general functional advantages of disorder for viruses. PMID:26184170

  15. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    SciTech Connect

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  16. Fine Mapping and Characterization of the L-Polymerase-Binding Domain of the Respiratory Syncytial Virus Phosphoprotein

    PubMed Central

    Sourimant, Julien; Rameix-Welti, Marie-Anne; Gaillard, Anne-Laure; Chevret, Didier; Galloux, Marie; Gault, Elyanne

    2015-01-01

    ABSTRACT The minimum requirement for an active RNA-dependent RNA polymerase of respiratory syncytial virus (RSV) is a complex made of two viral proteins, the polymerase large protein (L) and the phosphoprotein (P). Here we have investigated the domain on P that is responsible for this critical P-L interaction. By use of recombinant proteins and serial deletions, an L binding site was mapped in the C-terminal region of P, just upstream of the N-RNA binding site. The role of this molecular recognition element of about 30 amino acid residues in the L-P interaction and RNA polymerase activity was evaluated in cellula using an RSV minigenome system and site-directed mutagenesis. The results highlighted the critical role of hydrophobic residues located in this region. IMPORTANCE Respiratory syncytial virus (RSV) is the leading cause of lower respiratory tract illness in infants. Since no vaccine and no good antivirals against RSV are available, it is essential to better understand how the viral machinery functions in order to develop new antiviral strategies. Like all negative-strand RNA viruses, RSV codes for its own machinery to replicate and transcribe its genome. The core of this machinery is composed of two proteins, the phosphoprotein (P) and the large protein (L). Here, using recombinant proteins, we have mapped and characterized the P domain responsible for this L-P interaction and the formation of an active L-P complex. These findings extend our understanding of the mechanism of action of RSV RNA polymerase and allow us to define a new target for the development of drugs against RSV. PMID:25653447

  17. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  18. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  19. GTPases mechanisms and functions of translation factors on the ribosome.

    PubMed

    Rodnina, M V; Stark, H; Savelsbergh, A; Wieden, H J; Mohr, D; Matassova, N B; Peske, F; Daviter, T; Gualerzi, C O; Wintermeyer, W

    2000-01-01

    The elongation factors (EF) Tu and G and initiation factor 2 (IF2) from bacteria are multidomain GTPases with essential functions in the elongation and initiation phases of translation. They bind to the same site on the ribosome where their low intrinsic GTPase activities are strongly stimulated. The factors differ fundamentally from each other, and from the majority of GTPases, in the mechanisms of GTPase control, the timing of Pi release, and the functional role of GTP hydrolysis. EF-Tu x GTP forms a ternary complex with aminoacyl-tRNA, which binds to the ribosome. Only when a matching codon is recognized, the GTPase of EF-Tu is stimulated, rapid GTP hydrolysis and Pi release take place, EF-Tu rearranges to the GDP form, and aminoacyl-tRNA is released into the peptidyltransferase center. In contrast, EF-G hydrolyzes GTP immediately upon binding to the ribosome, stimulated by ribosomal protein L7/12. Subsequent translocation is driven by the slow dissociation of Pi, suggesting a mechano-chemical function of EF-G. Accordingly, different conformations of EF-G on the ribosome are revealed by cryo-electron microscopy. GTP hydrolysis by IF2 is triggered upon formation of the 70S initiation complex, and the dissociation of Pi and/or IF2 follows a rearrangement of the ribosome into the elongation-competent state. PMID:10937868

  20. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  1. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  2. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  3. Increased ribosome density associated to positively charged residues is evident in ribosome profiling experiments performed in the absence of translation inhibitors.

    PubMed

    Requião, Rodrigo D; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana; Palhano, Fernando L

    2016-06-01

    It has been proposed that polybasic peptides cause slower movement of ribosomes through an electrostatic interaction with the highly negative ribosome exit tunnel. Ribosome profiling data-the sequencing of short ribosome-bound fragments of mRNA-is a powerful tool for the analysis of mRNA translation. Using the yeast Saccharomyces cerevisiae as a model, we showed that reduced translation efficiency associated with polybasic protein sequences could be inferred from ribosome profiling. However, an increase in ribosome density at polybasic sequences was evident only when the commonly used translational inhibitors cycloheximide and anisomycin were omitted during mRNA isolation. Since ribosome profiling performed without inhibitors agrees with experimental evidence obtained by other methods, we conclude that cycloheximide and anisomycin must be avoided in ribosome profiling experiments. PMID:27064519

  4. Chemical probing of the tRNA--ribosome complex.

    PubMed Central

    Peattie, D A; Herr, W

    1981-01-01

    We probed the (Escherichia coli) tRNAPhe--ribosome interaction with the chemical reagents dimethyl sulfate and diethyl pyrocarbonate. This monitored the higher-order structure of the tRNA in this biological complex and identified critical sites in the tRNA molecule involved in binding to the ribosome. The methylation of the N-7 position of guanosine and the N-3 position of cytidine as well as diethyl pyrocarbonate attack on adenosines are sensitive to secondary and tertiary interactions. Here we identify specific bases in E. coli Phe-tRNAPhe affected by the interaction with the ribosome. The 70S ribosome protects the N-3 position of cytidine-74 and 75 in the 3'-terminal C-C-A, suggesting a strong, possibly base pairing, interaction between the ribosome and that universal sequence. The ribosome also induces strong reactivities at the N-7 positions of G-24 and G-46 in the central region of the tRNA molecule near the variable-loop domain as well as less significant reactivities at 11 other guanosines. Two of these, G-10 and G-44, are close to G-24 and G-46 in the center of the molecule; the others (guanosines 1, 5, 6, 18, 19, 63, 65, 69, and 71) are in the coaxial acceptor stem-T stem helix. All of the effects are ribosome induced and occur in the presence or absence of the messenger poly(U). Prior chemical modification of the anticodon bases as well as the two adjacent 3' purines and, less effectively, four purines in the anticodon stem prevent stable poly(U)-directed ribosome binding. Thus, we identify the 3' terminal C-C-A sequence, near the peptidyl transferase site, and the anticodon stem and loop of tRNAPhe as forming critical contacts with the ribosome. Other regions of the molecule become reactive on ribosome binding, but these do not suggest a significant conformational change being more likely due to a change of environment. Images PMID:6166006

  5. The role of GTP in transient splitting of 70S ribosomes by RRF (ribosome recycling factor) and EF-G (elongation factor G)

    PubMed Central

    Hirokawa, Go; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko

    2008-01-01

    Ribosome recycling factor (RRF), elongation factor G (EF-G) and GTP split 70S ribosomes into subunits. Here, we demonstrated that the splitting was transient and the exhaustion of GTP resulted in re-association of the split subunits into 70S ribosomes unless IF3 (initiation factor 3) was present. However, the splitting was observed with sucrose density gradient centrifugation (SDGC) without IF3 if RRF, EF-G and GTP were present in the SDGC buffer. The splitting of 70S ribosomes causes the decrease of light scattering by ribosomes. Kinetic constants obtained from the light scattering studies are sufficient to account for the splitting of 70S ribosomes by RRF and EF-G/GTP during the lag phase for activation of ribosomes for the log phase. As the amount of 70S ribosomes increased, more RRF, EF-G and GTP were necessary to split 70S ribosomes. In the presence of a physiological amount of polyamines, GTP and factors, even 0.6 μM 70S ribosomes (12 times higher than the 70S ribosomes for routine assay) were split. Spermidine (2 mM) completely inhibited anti-association activity of IF3, and the RRF/EF-G/GTP-dependent splitting of 70S ribosomes. PMID:18948280

  6. Development of a Newcastle disease virus vector expressing a foreign gene through an internal ribosomal entry site provides direct proof for a sequential transcription mechanism.

    PubMed

    Zhang, Zhenyu; Zhao, Wei; Li, Deshan; Yang, Jinlong; Zsak, Laszlo; Yu, Qingzhong

    2015-08-01

    In the present study, we developed a novel approach for foreign gene expression by Newcastle disease virus (NDV) from a second ORF through an internal ribosomal entry site (IRES). Six NDV LaSota strain-based recombinant viruses vectoring the IRES and a red fluorescence protein (RFP) gene behind the nucleocapsid (NP), phosphoprotein (P), matrix (M), fusion (F), haemagglutinin-neuraminidase (HN) or large polymerase (L) gene ORF were generated using reverse genetics technology. The insertion of the second ORF slightly attenuated virus pathogenicity, but did not affect ability of the virus to grow. Quantitative measurements of RFP expression in virus-infected DF-1 cells revealed that the abundance of viral mRNAs and red fluorescence intensity were positively correlated with the gene order of NDV, 3'-NP-P-M-F-HN-L-5', proving the sequential transcription mechanism for NDV. The results herein suggest that the level of foreign gene expression could be regulated by selecting the second ORF insertion site to maximize the efficacy of vaccine and gene therapy. PMID:25872740

  7. Fission yeast TORC1 regulates phosphorylation of ribosomal S6 proteins in response to nutrients and its activity is inhibited by rapamycin

    PubMed Central

    Nakashima, Akio; Sato, Tatsuhiro; Tamanoi, Fuyuhiko

    2010-01-01

    Cellular activities are regulated by environmental stimuli through protein phosphorylation. Target of rapamycin (TOR), a serine/threonine kinase, plays pivotal roles in cell proliferation and cell growth in response to nutrient status. In Schizosaccharomyces pombe, TORC1, which contains Tor2, plays crucial roles in nutrient response. Here we find a nitrogen-regulated phosphoprotein, p27, in S. pombe using the phospho-Akt substrate antibody. Response of p27 phosphorylation to nitrogen availability is mediated by TORC1 and the TSC-Rhb1 signaling, but not by TORC2 or other nutrient stress-related pathways. Database and biochemical analyses indicate that p27 is identical to ribosomal protein S6 (Rps6). Ser235 and Ser236 in Rps6 are necessary for Rps6 phosphorylation by TORC1. These Rps6 phosphorylations are dispensable for cell viability. Rps6 phosphorylation by TORC1 also responds to availability of glucose and is inhibited by osmotic and oxidative stresses. Rapamycin inhibits the ability of TORC1 to phosphorylate Rps6, owing to interaction of the rapamycin-FKBP12 complex with the FRB domain in Tor2. Rapamycin also leads to a decrease in cell size in a TORC1-dependent manner. Our findings demonstrate that the nutrient-responsive and rapamycin-sensitive TORC1-S6 signaling exists in S. pombe, and that this pathway plays a role in cell size control. PMID:20144990

  8. Humoral and Cell-mediated Autoimmune Reactions to Human Acidic Ribosomal P2 Protein in Individuals Sensitized to Aspergillus fumigatus P2 Protein

    PubMed Central

    Mayer, Christina; Appenzeller, Ulrich; Seelbach, Heike; Achatz, Gernot; Oberkofler, Hannes; Breitenbach, Michael; Blaser, Kurt; Crameri, Reto

    1999-01-01

    A panel of cDNAs encoding allergenic proteins was isolated from an Aspergillus fumigatus cDNA library displayed on the surface of filamentous phage. Solid phase–immobilized serum immunoglobulin E (IgE) from A. fumigatus–allergic individuals was used to enrich phage displaying IgE-binding molecules. One of the cDNAs encoded a 11.1-kD protein that was identified as acidic ribosomal phosphoprotein type 2 (P2 protein). The allergen, formally termed rAsp f 8, shares >62% sequence identity and >84% sequence homology to corresponding eukaryotic P2 proteins, including human P2 protein. The sequences encoding human and fungal P2 protein were subcloned, expressed in Escherichia coli as His6-tagged fusion proteins, and purified by Ni2+–chelate affinity chromatography. Both recombinant P2 proteins were recognized by IgE antibodies from allergic individuals sensitized to the A. fumigatus P2 protein and elicited strong type 1–specific skin reactions in these individuals. Moreover, human and fungal P2 proteins induced proliferative responses in peripheral blood mononuclear cells of A. fumigatus– allergic subjects sensitized to the fungal P2 protein. These data provide strong evidence for in vitro and in vivo humoral and cell-mediated autoreactivity to human P2 protein in patients suffering from chronic A. fumigatus allergy. PMID:10224291

  9. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  10. The immunogenic activity of ribosomal fractions derived from Brucella abortus.

    PubMed Central

    Corbel, M. J.

    1976-01-01

    The immunizing activity of ribosome preparations derived from Brucella abortus strain 19 cells was examined in guinea-pigs and mice. After subcutaneous injections of Br. abortus ribosomes in Freund's incomplete adjuvant, both mice and guinea-pigs developed immunity to challenge by virulent Br. abortus 544 organisms which was at least as effective as the protection conferred by live strain 19 vaccine. Both mice and guinea-pigs also developed agglutinating and complement-fixing antibodies and delayed hypersensitivity to Br. Abortus antigens. Conversely, ribosome preparations elicited delayed hypersensitivity reactions on intracutaneous injection into guinea-pigs chronically infected with Br. abortus or Br. melitensis. On injection into rabbits, Br. abortus ribosomes incorporated in incomplete adjuvant induced high titres of agglutinins, complement fxing antibodies and precipitins for Br. abortus antigens. On immunochemical examination, the ribosome preparations were not grossly contaminated with antigens derived from the cell surface. They were chemically complex, however, and in addition to RNA contained numerous protein components identified by disk electrophoresis. The nature of the components responsible for conferring protection against Br. abortus was not determined. Images Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 PMID:812900

  11. Aminoglycoside activity observed on single pre-translocation ribosome complexes

    PubMed Central

    Feldman, Michael B; Terry, Daniel S; Altman, Roger B; Blanchard, Scott C

    2010-01-01

    Aminoglycoside-class antibiotics bind directly to ribosomal RNA, imparting pleiotropic effects on ribosome function. Despite in-depth structural investigations of aminoglycoside–RNA oligonucleotide and aminoglycoside-ribosome interactions, mechanisms explaining the unique ribosome inhibition profiles of chemically similar aminoglycosides remain elusive. Here, using single-molecule fluorescence resonance energy transfer (smFRET) methods, we show that high-affinity aminoglycoside binding to the conserved decoding site region of the functional pre-translocation ribosome complex specifically remodels the nature of intrinsic dynamic processes within the particle. The extents of these effects, which are distinct for each member of the aminoglycoside class, strongly correlate with their inhibition of EF-G–catalyzed translocation. Neomycin, a 4,5-linked amino-glycoside, binds with lower affinity to one or more secondary binding sites, mediating distinct structural and dynamic perturbations that further enhance translocation inhibition. These new insights help explain why closely related aminoglycosides elicit pleiotropic translation activities and demonstrate the potential utility of smFRET as a tool for dissecting the mechanisms of antibiotic action. PMID:19946275

  12. Recycling of eukaryotic post-termination ribosomal complexes

    PubMed Central

    Pisarev, Andrey V.; Hellen, Christopher U. T.; Pestova, Tatyana V.

    2007-01-01

    SUMMARY After translational termination, mRNA and P site deacylated tRNA remain associated with ribosomes in post-termination complexes (post-TCs), which must therefore be recycled by releasing mRNA and deacylated tRNA and by dissociating ribosomes into subunits. Recycling of bacterial post-TCs requires elongation factor EF-G and a ribosome recycling factor RRF. Eukaryotes do not encode a RRF homologue and their mechanism of ribosomal recycling is unknown. We investigated eukaryotic recycling using post-TCs assembled on a model mRNA encoding a tetrapeptide followed by a UAA stop codon and report that initiation factors eIF3, eIF1, eIF1A and eIF3j, a loosely associated subunit of eIF3, can promote recycling of eukaryotic post-TCs. eIF3 is the principal factor that promotes splitting of post-termination ribosomes into 60S subunits and tRNA- and mRNA-bound 40S subunits. Its activity is enhanced by eIF3j, eIF1 and eIF1A. eIF1 also mediates release of P-site tRNA, whereas eIF3j ensures subsequent dissociation of mRNA. PMID:17956730

  13. Amino acid incorporation by ribosomes and polyribosomes from wheat chloroplasts.

    PubMed

    Hadziyev, D; Zalik, S

    1970-01-01

    Sucrose-gradient and analytical ultracentrifugation showed that chloroplast polyribosomes from 4-day-old seedlings had mono-, di-, tri-, tetra- and traces of penta-ribosomes, in contrast with those from 7-day-old seedlings in which only the mono-, di- and traces of tri-ribosomes were present. Without Mg(2+) the polyribosomes dissociated into ribosomal subunits. The rate of l-[U-(14)C]phenylalanine incorporation was threefold greater for preparations from 4- than from 7-day-old seedlings. Incorporation by the latter was stimulated by polyuridylic acid. The rates of incorporation were similar whether the reaction mixture contained chloroplast or wheat-germ transfer RNA and amino acid synthetases purified on methylated albumin-on-kieselguhr and Sephadex G-75 columns respectively. The cofactor requirement was the same as for isolated intact chloroplasts. Osmotic rupture of chloroplasts with and without Triton X-100 revealed the presence of free and bound ribosomes. Free single ribosomes isolated by osmotic shrinkage or prepared by pancreatic ribonuclease digestion of chloroplast polyribosomes had negligible incorporation activity. This activity was increased by washing or by polyuridylic acid, but was still only a fraction of that given by polyribosomes. A comparison of incorporation activity of chloroplast polyribosomes with those from the surrounding cytoplasm showed the former to be 20 times more active. PMID:5411422

  14. Structures of the Ribosome in Intermediate States of Ratcheting

    SciTech Connect

    Zhang, Wen; Dunkle, Jack A.; Cate, Jamie H.D.

    2009-10-21

    Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other, and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here, we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo-form (3.5 angstrom resolution) or with one (4.0 angstrom resolution) or two (4.0 angstrom resolution) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation.

  15. Ribosomal Dynamics: Intrinsic Instability of a Molecular Machine

    NASA Astrophysics Data System (ADS)

    Gao, Haixiao; Le Barron, Jamie; Frank, Joachim

    Ribosomes are molecular machines that translate genetic message into nascent peptides, through a complex dynamics interplay with mRNAs, tRNAs, and various protein factors. A prominent example of ribosomal dynamics is the rotation of small ribosomal subunit with respect to a large subunit, characterized as the "ratchet motion," which is triggered by the binding of several translation factors. Here, we analyze two kinds of ribosomal ratchet motions, induced by the binding of EF-G and RF3, respectively, as previously observed by cryo-electron microscopy. Using the flexible fitting technique (real-space refinement) and an RNA secondary structure display tool (coloRNA), we obtained quasi-atomic models of the ribosome in these ratchet-motion-related functional states and mapped the observed differences onto the highly conserved RNA secondary structure. Comparisons between two sets of ratchet motions revealed that, while the overall patterns of the RNA displacement are very similar, several local regions stand out in their differential behavior, including the highly conserved GAC (GTPase-associated-center) region. We postulate that these regions are important in modulating general ratchet motion and bestowing it with the dynamic characteristics required for the specific function.

  16. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  17. Assessing the translational landscape of myogenic differentiation by ribosome profiling

    PubMed Central

    de Klerk, Eleonora; Fokkema, Ivo F.A.C.; Thiadens, Klaske A.M.H.; Goeman, Jelle J.; Palmblad, Magnus; den Dunnen, Johan T.; von Lindern, Marieke; ‘t Hoen, Peter A.C.

    2015-01-01

    The formation of skeletal muscles is associated with drastic changes in protein requirements known to be safeguarded by tight control of gene transcription and mRNA processing. The contribution of regulation of mRNA translation during myogenesis has not been studied so far. We monitored translation during myogenic differentiation of C2C12 myoblasts, using a simplified protocol for ribosome footprint profiling. Comparison of ribosome footprints to total RNA showed that gene expression is mostly regulated at the transcriptional level. However, a subset of transcripts, enriched for mRNAs encoding for ribosomal proteins, was regulated at the level of translation. Enrichment was also found for specific pathways known to regulate muscle biology. We developed a dedicated pipeline to identify translation initiation sites (TISs) and discovered 5333 unannotated TISs, providing a catalog of upstream and alternative open reading frames used during myogenesis. We identified 298 transcripts with a significant switch in TIS usage during myogenesis, which was not explained by alternative promoter usage, as profiled by DeepCAGE. Also these transcripts were enriched for ribosomal protein genes. This study demonstrates that differential mRNA translation controls protein expression of specific subsets of genes during myogenesis. Experimental protocols, analytical workflows, tools and data are available through public repositories (http://lumc.github.io/ribosome-profiling-analysis-framework/). PMID:25873627

  18. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating.

    PubMed Central

    Singh, I; Helenius, A

    1992-01-01

    The mechanism by which Semliki Forest virus nucleocapsids are uncoated was analyzed in living cells and in vitro. In BHK-21 cells, uncoating occurred with virtually complete efficiency within 1 to 2 min after the nucleocapsids entered the cytoplasm. It was inhibited by monensin, which blocks nucleocapsid penetration from endosomes. As previously shown for Sindbis virus (G. Wengler and G. Wengler, Virology 134:435-442, 1984), the capsid proteins from incoming nucleocapsids became associated with ribosomes. The ribosome-bound capsid proteins were distributed throughout the cytoplasm, while the viral RNA remained associated with vacuolar membranes. Using purified nucleocapsids and ribosomes in vitro, we established that ribosomes alone were sufficient for uncoating. Their role was to release the capsid proteins from nucleocapsids and irreversibly sequester them, in a process independent of energy and translation. The process was stoichiometric rather than catalytic, with a maximum of three to six capsid proteins bound to each ribosome. More than 80% of the capsid proteins could thus be removed from the viral RNA, resulting in the formation of nucleocapsid remnants whose sedimentation coefficients progressively decreased from 140S to 80S as uncoating proceeded. Images PMID:1433506

  19. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  20. Cyclic nucleotide-independent protein kinases from ribosomes and phosphorylation of a single 40S ribosomal subunit protein in zoospores of Blastocladiella emersonii.

    PubMed

    Bonato, M C; da Costa Maia, J C; Juliani, M H

    1983-06-01

    Cyclic nucleotide-independent protein kinase (EC 2.7.1.37) activity was found in the nuclear cap organelle, within which ribosomes of zoospores of Blastocladiella emersonii are sequestered. Two protein kinase activities were resolved from the high-salt wash fraction of zoospore ribosomes by selective adsorption to DEAE-cellulose. Both enzymes phosphorylated in vitro a 32,000 Mr protein of the 40S ribosomal subunit. Phosphorylation of this ribosomal protein, which exhibits electrophoretic properties similar to those of mammalian ribosomal protein S6, was also observed in vivo in 32P-labeled zoospores. PMID:6853450

  1. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. PMID:25837512

  2. Ultraviolet light-induced crosslinking of two major phosphoproteins and poly(A)+RNA from free polyribosomes; changes in phosphorylation by inhibitors of transcription and translation

    SciTech Connect

    Schweiger, A.; Kostka, G.; Weiss, E.

    1986-04-14

    Polyribosomes were isolated without the use of detergents, irradiated with ultraviolet light and labelled in the presence of (gamma-/sup 32/P) adenosine 5'-triphosphate. Poly(A)+RNA-protein structures separated by chromatography on oligo (dT)-cellulose contained up to 1o crosslinked proteins as shown by SDS-polyacrylamide gel electrophoresis. These included a 71 kDa poly(A)-bound species and two major phosphoproteins of 66 and 13o kDa. Pretreatment of rats with inhibitors of transcription and translation caused different and significant alterations in the labelling of the two phosphoproteins, suggesting that phosphorylation of proteins closely associated with mRNA may be involved in the regulation of the stability of this RNA or its binding to structural elements in the cell.

  3. Stability of the inner structure constituting a 'kernel' in ribosomal cores probed by dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Blasi, M.; Bonincontro, A.; Calandrini, V.; Onori, G.; Risuleo, G.

    2001-05-01

    In this communication we present an investigation on ribosomal cores, i.e. ribosomes deprived of a select group of ribosomal proteins by LiCl treatment. This study was conducted by dielectric spectroscopy technique. The aim was to elucidate the role of ribosomal proteins in the stabilization of a very stable structural nucleus previously observed within the ribosome. The results show that this structure withstands relatively high concentrations of LiCl and is demolished within a limited range of salt concentration. The data discussed here corroborate the idea that this structure constitutes the ribosomal kernel.

  4. Proteomic Alterations in Heat Shock Protein 27 and Identification of Phosphoproteins in Ascending Aortic Aneurysm Associated with Bicuspid and Tricuspid Aortic Valve

    PubMed Central

    Matt, Peter; Fu, Zongming; Carrel, Thierry; Huso, David L.; Dirnhofer, Stefan; Lefkovits, Ivan; Zerkowski, Hans-Reinhard; Van Eyk, Jennifer

    2014-01-01

    Whether or not there are molecular differences, at the intra- and extracellular level, between aortic dilatation in patients with bicuspid (BAV) and those with a tricuspid aortic valve (TAV) has remained controversial for years. We have performed 2-dimensional gelelectrophoresis and mass spectrometry coupled with dephosphorylation and phosphostaining experiments to reveal and define protein alterations and the high abundant structural phosphoproteins in BAV compared to TAV aortic aneurysm samples. 2-D gel patterns showed a high correlation in protein expression between BAV and TAV specimens (n=10). Few proteins showed significant differences, among those a phosphorylated form of heat shock protein (HSP) 27 with significantly lower expression in BAV compared to TAV aortic samples (p=0.02). The phosphoprotein tracing revealed four different phosphoproteins including Rho GDP dissociation inhibitor 1, calponin 3, myosin regulatory light chain 2 and four differentially phosphorylated forms of HSP27. Levels of total HSP27 and dually phosphorylated HSP27 (S78/S82) were investigated in an extended patient cohort (n=15) using ELISA. Total HSP27 was significantly lower in BAV compared to TAV patients (p=0.03), with no correlation in levels of phospho-HSP27 (S78/S82) (p=0.4). Western blots analysis showed a trend towards lower levels of phospho-HSP27 (S78) in BAV patients (p=0.07). Immunohistochemical analysis revealed that differences in HSP27 occur in the cytoplasma of VSMC’s and not extracellularly. Alterations in HSP27 may give early evidence for intracellular differences in aortic aneurysm of patients with BAV and TAV. Whether HSP27 and the defined phosphoproteins have a specific role in BAV associated aortic dilatation remains to be elucidated. PMID:17949744

  5. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    PubMed

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  6. Identification of Two Distinct Hybrid State Intermediates On the Ribosome

    PubMed Central

    Munro, James B.; Altman, Roger B.; O’Connor, Nathan; Blanchard, Scott C.

    2007-01-01

    SUMMARY High-spatial and –time resolution single-molecule fluorescence resonance energy transfer measurements have been used to probe the structural and kinetic parameters of transfer RNA (tRNA) movements within the aminoacyl (A) and peptidyl (P) sites of the ribosome. Our investigation of tRNA motions, quantified on wild-type, mutant, and L1-depleted ribosome complexes, reveals a dynamic exchange between three metastable tRNA configurations, one of which is a previously unidentified hybrid state in which only deacylated-tRNA adopts its hybrid (P/E) configuration. These new dynamic information suggests a framework in which the formation of intermediate states in the translocation process is achieved through global conformational rearrangements of the ribosome particle. PMID:17317624

  7. [Mechanism of tRNA translocation on the ribosome].

    PubMed

    Rodnina, M V; Semenkov, Iu P; Savelsbergh, A; Katunin, V I; Peske, F; Wilden, B; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle of peptide synthesis two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. Translocation is catalyzed by the elongation factor G (EF-G) and requires GTP hydrolysis. The fundamental biochemical features of the process were worked out in the 1970-80s, to a large part by A.S. Spirin and his colleagues. Recent results from pre-steady-state kinetic analysis and cryoelectron microscopy suggest that translocation is a multistep dynamic process that entails large-scale structural rearrangements of both ribosome and EF-G. Kinetic and thermodynamic data, together with the structural information on the conformational changes of the ribosome and of EF-G, provide a detailed mechanistic model of translocation and suggest a mechanism of translocation catalysis by EF-G. PMID:11524952

  8. RNA structures regulating ribosomal protein biosynthesis in bacilli

    PubMed Central

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.

    2013-01-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  9. The bacterial translocon SecYEG opens upon ribosome binding.

    PubMed

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  10. A Ribosome Flow Model for Analyzing Translation Elongation

    NASA Astrophysics Data System (ADS)

    Reuveni, Shlomi; Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan; Tuller, Tamir

    We describe the first genome wide analysis of translation based on a model aimed at capturing the physical and dynamical aspects of this process. The Ribosomal Flow Model (RFM) is a computationally efficient approximation of the Totally Asymmetric Exclusion Process (TASEP) model (e.g. see [1]). The RFM is sensitive to the order of codons in the coding sequence, the tRNA pool of the organism, interactions between ribosomes and their size (see Figure [1]). The RFM predicts fundamental outcomes of the translation process, including translation rates, protein abundance and ribosomal densities [2] and the relation between all these variables, better than alternative ('non-physical') approaches (e.g. see [3,4]). In addition, we show that the RFM model can be used for accurate inference of initiation rates, the effect of codon order on protein abundance and the cost of translation. All these variables could not be inferred by previous predictors.

  11. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  12. Small protein domains fold inside the ribosome exit tunnel.

    PubMed

    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland

    2016-03-01

    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. PMID:26879042

  13. Imprints of the genetic code in the ribosome

    PubMed Central

    Johnson, David B. F.; Wang, Lei

    2010-01-01

    The establishment of the genetic code remains elusive nearly five decades after the code was elucidated. The stereochemical hypothesis postulates that the code developed from interactions between nucleotides and amino acids, yet supporting evidence in a biological context is lacking. We show here that anticodons are selectively enriched near their respective amino acids in the ribosome, and that such enrichment is significantly correlated with the canonical code over random codes. Ribosomal anticodon-amino acid enrichment further reveals that specific codons were reassigned during code evolution, and that the code evolved through a two-stage transition from ancient amino acids without anticodon interaction to newer additions with anticodon interaction. The ribosome thus serves as a molecular fossil, preserving biological evidence that anticodon-amino acid interactions shaped the evolution of the genetic code. PMID:20385807

  14. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    PubMed

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  15. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    PubMed Central

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  16. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  17. Ribosomal RNAs in translation termination: facts and hypotheses.

    PubMed

    Arkov, A L; Murgola, E J

    1999-12-01

    It is now well established that ribosomal RNAs (rRNAs) play an active role in every aspect of translation. This review focuses on recent evidence for the involvement of rRNAs from both subunits of the ribosome in translation termination. This evidence comprises data obtained with rRNA mutants both in vivo and in vitro. In particular, mutations in specific regions of rRNAs caused readthrough of nonsense codons in vivo. Consistent with their in vivo characteristics, the mutations decreased the productive association of the ribosome with release factor 2 (RF2) and the efficiency of catalysis of peptidyl-tRNA hydrolysis in the presence of RF2 in realistic in vitro termination systems. It is now evident that genetic selections for termination-defective mutants in vivo and their characterization in realistic in vitro termination assays will rapidly advance our understanding of the mechanism of termination. PMID:10648958

  18. Identification and Characterization of the Binding Site of the Respiratory Syncytial Virus Phosphoprotein to RNA-Free Nucleoprotein

    PubMed Central

    Galloux, Marie; Gabiane, Gaëlle; Sourimant, Julien; Richard, Charles-Adrien; England, Patrick; Moudjou, Mohammed; Aumont-Nicaise, Magali; Fix, Jenna; Rameix-Welti, Marie-Anne

    2015-01-01

    ABSTRACT The RNA genome of respiratory syncytial virus (RSV) is constitutively encapsidated by the viral nucleoprotein N, thus forming a helical nucleocapsid. Polymerization of N along the genomic and antigenomic RNAs is concomitant to replication and requires the preservation of an unassembled monomeric nucleoprotein pool. To this end, and by analogy with Paramyxoviridae and Rhabdoviridae, it is expected that the viral phosphoprotein P acts as a chaperone protein, forming a soluble complex with the RNA-free form of N (N0-P complex). Here, we have engineered a mutant form of N that is monomeric, is unable to bind RNA, still interacts with P, and could thus mimic the N0 monomer. We used this N mutant, designated Nmono, as a substitute for N0 in order to characterize the P regions involved in the N0-P complex formation. Using a series of P fragments, we determined by glutathione S-transferase (GST) pulldown assays that the N and C termini of P are able to interact with Nmono. We analyzed the functional role of amino-terminal residues of P by site-directed mutagenesis, using an RSV polymerase activity assay based on a human RSV minireplicon, and found that several residues were critical for viral RNA synthesis. Using GST pulldown and surface plasmon resonance assays, we showed that these critical residues are involved in the interaction between P[1-40] peptide and Nmono in vitro. Finally, we showed that overexpression of the peptide P[1-29] can inhibit the polymerase activity in the context of the RSV minireplicon, thus demonstrating that targeting the N0-P interaction could constitute a potential antiviral strategy. IMPORTANCE Respiratory syncytial virus (RSV) is the leading cause of lower respiratory tract illness in infants. Since no vaccine or efficient antiviral treatment is available against RSV, it is essential to better understand how the viral machinery functions in order to develop new antiviral strategies. RSV phosphoprotein P, the main RNA polymerase

  19. Broad-Scale Phosphoprotein Profiling of Beta Adrenergic Receptor (β-AR) Signaling Reveals Novel Phosphorylation and Dephosphorylation Events

    PubMed Central

    Chruscinski, Andrzej J.; Singh, Harvir; Chan, Steven M.; Utz, Paul J.

    2013-01-01

    β-adrenergic receptors (β-ARs) are model G-protein coupled receptors that mediate signal transduction in the sympathetic nervous system. Despite the widespread clinical use of agents that target β-ARs, the signaling pathways that operate downstream of β-AR stimulation have not yet been completely elucidated. Here, we utilized a lysate microarray approach to obtain a broad-scale perspective of phosphoprotein signaling downstream of β-AR. We monitored the time course of phosphorylation states of 54 proteins after β-AR activation mouse embryonic fibroblast (MEF) cells. In response to stimulation with the non-selective β-AR agonist isoproterenol, we observed previously described phosphorylation events such as ERK1/2(T202/Y204) and CREB(S133), but also novel phosphorylation events such as Cdc2(Y15) and Pyk2(Y402). All of these events were mediated through cAMP and PKA as they were reproduced by stimulation with the adenylyl cyclase activator forskolin and were blocked by treatment with H89, a PKA inhibitor. In addition, we also observed a number of novel isoproterenol-induced protein dephosphorylation events in target substrates of the PI3K/AKT pathway: GSK3β(S9), 4E-BP1(S65), and p70s6k(T389). These dephosphorylations were dependent on cAMP, but were independent of PKA and correlated with reduced PI3K/AKT activity. Isoproterenol stimulation also led to a cAMP-dependent dephosphorylation of PP1α(T320), a modification known to correlate with enhanced activity of this phosphatase. Dephosphorylation of PP1α coincided with the secondary decline in phosphorylation of some PKA-phosphorylated substrates, suggesting that PP1α may act in a feedback loop to return these phosphorylations to baseline. In summary, lysate microarrays are a powerful tool to profile phosphoprotein signaling and have provided a broad-scale perspective of how β-AR signaling can regulate key pathways involved in cell growth and metabolism. PMID:24340001

  20. Structural Basis for the Rescue of Stalled Ribosomes: Structure of YaeJ Bound to the Ribosome

    SciTech Connect

    Gagnon, Matthieu G.; Seetharaman, Sai V.; Bulkley, David; Steitz, Thomas A.

    2012-06-19

    In bacteria, the hybrid transfer-messenger RNA (tmRNA) rescues ribosomes stalled on defective messenger RNAs (mRNAs). However, certain gram-negative bacteria have evolved proteins that are capable of rescuing stalled ribosomes in a tmRNA-independent manner. Here, we report a 3.2 angstrom-resolution crystal structure of the rescue factor YaeJ bound to the Thermus thermophilus 70S ribosome in complex with the initiator tRNA{sub i}{sup fMet} and a short mRNA. The structure reveals that the C-terminal tail of YaeJ functions as a sensor to discriminate between stalled and actively translating ribosomes by binding in the mRNA entry channel downstream of the A site between the head and shoulder of the 30S subunit. This allows the N-terminal globular domain to sample different conformations, so that its conserved GGQ motif is optimally positioned to catalyze the hydrolysis of peptidyl-tRNA. This structure gives insights into the mechanism of YaeJ function and provides a basis for understanding how it rescues stalled ribosomes.

  1. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  2. A novel phosphoprotein analysis scheme for assessing changes in premalignant and malignant breast cell lines using 2D liquid separations, protein microarrays and tandem mass spectrometry

    PubMed Central

    Patwa, Tasneem H.; Wang, Yanfei; Miller, Fred R.; Goodison, Steve; Pennathur, Subramaniam; Barder, Timothy J.; Lubman, David M.

    2008-01-01

    An analysis of phosphorylation changes that occur during cancer progression would provide insights into the molecular pathways responsible for a malignant phenotype. In this study we employed a novel coupling of 2D-liquid separations and protein microarray technology to reveal changes in phosphoprotein status between premalignant (AT1) and malignant (CA1a) cell lines derived from the human MCF10A breast cell lines. Intact proteins were first separated according to their isoelectric point and hydrophobicities, then arrayed on SuperAmine glass slides. Phosphoproteins were detected using the universal, inorganic phospho-sensor dye, ProQ Diamond. Using this dye, out of 140 spots that were positive for phosphorylation, a total of 85 differentially expressed spots were detected over a pH range of 7.2 to 4.0. Proteins were identified and their peptides sequenced by mass spectrometry. The strategy enabled the identification of 75 differentially expressed phosphoproteins, from which 51 phosphorylation sites in 27 unique proteins were confirmed. Interestingly, the majority of differentially expressed phosphorylated proteins observed were nuclear proteins. Three regulators of apoptosis, Bad, Bax and Acinus, were also differentially phosphorylated in the two cell lines. Further development of this strategy will facilitate an understanding of the mechanisms involved in malignancy progression and other disease-related phenotypes. PMID:19194518

  3. Time-resolved binding of azithromycin to Escherichia coli ribosomes.

    PubMed

    Petropoulos, Alexandros D; Kouvela, Ekaterini C; Starosta, Agata L; Wilson, Daniel N; Dinos, George P; Kalpaxis, Dimitrios L

    2009-01-30

    Azithromycin is a semisynthetic derivative of erythromycin that inhibits bacterial protein synthesis by binding within the peptide exit tunnel of the 50S ribosomal subunit. Nevertheless, there is still debate over what localization is primarily responsible for azithromycin binding and as to how many molecules of the drug actually bind per ribosome. In the present study, kinetic methods and footprinting analysis are coupled together to provide time-resolved details of the azithromycin binding process. It is shown that azithromycin binds to Escherichia coli ribosomes in a two-step process: The first-step involves recognition of azithromycin by the ribosomal machinery and places the drug in a low-affinity site located in the upper part of the exit tunnel. The second step corresponds to the slow formation of a final complex that is both much tighter and more potent in hindering the progression of the nascent peptide through the exit tunnel. Substitution of uracil by cytosine at nucleoside 2609 of 23S rRNA, a base implicated in the high-affinity site, facilitates the shift of azithromycin to this site. In contrast, mutation U754A hardly affects the binding process. Binding of azithromycin to both sites is hindered by high concentrations of Mg(2+) ions. Unlike Mg(2+) ions, polyamines do not significantly affect drug binding to the low-affinity site but attenuate the formation of the final complex. The low- and high-affinity sites of azithromycin binding are mutually exclusive, which means that one molecule of the drug binds per E. coli ribosome at a time. In contrast, kinetic and binding data indicate that in Deinococcus radiodurans, two molecules of azithromycin bind cooperatively to the ribosome. This finding confirms previous crystallographic results and supports the notion that species-specific structural differences may primarily account for the apparent discrepancies between the antibiotic binding modes obtained for different organisms. PMID:19071138

  4. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  5. Ribosomal Translocation: One Step Closer to the Molecular Mechanism

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2010-01-01

    Protein synthesis occurs in ribosomes, the targets of numerous antibiotics. How these large and complex machines read and move along mRNA have proven to be challenging questions. In this Review, we focus on translocation, the last step of the elongation cycle in which movement of tRNA and mRNA is catalyzed by elongation factor G. Translocation entails large-scale movements of the tRNAs and conformational changes in the ribosome that require numerous tertiary contacts to be disrupted and reformed. We highlight recent progress toward elucidating the molecular basis of translocation and how various antibiotics influence tRNA–mRNA movement. PMID:19173642

  6. Ribosome Dwell Times and the Protein Copy Number Distribution

    NASA Astrophysics Data System (ADS)

    Gorissen, Mieke; Vanderzande, Carlo

    2012-09-01

    Translation is the cellular process in which ribosomes make proteins from information encoded on messenger RNA (mRNA). We model translation with an exclusion process taking into account the experimentally determined, non-exponential, waiting time between steps of a ribosome. From numerical simulations using realistic parameter values, we determine the distribution P( E) of the number of proteins E produced by one mRNA. We find that for small E this distribution is not geometric. We present a simplified and analytically solvable model that relates P( E) to the distributions of the times to produce the first E proteins.

  7. Ribosomal crystallography: from crystal growth to initial phasing

    NASA Astrophysics Data System (ADS)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  8. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  9. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  10. Phosphoprotein network analysis of white adipose tissues unveils deregulated pathways in response to high-fat diet

    PubMed Central

    Asfa, Alli Shaik; Qiu, Beiying; Wee, Sheena; Choi, Hyungwon; Gunaratne, Jayantha; Tergaonkar, Vinay

    2016-01-01

    Despite efforts in the last decade, signaling aberrations associated with obesity remain poorly understood. To dissect molecular mechanisms that define this complex metabolic disorder, we carried out global phosphoproteomic analysis of white adipose tissue (WAT) from mice fed on low-fat diet (LFD) and high-fat diet (HFD). We quantified phosphorylation levels on 7696 peptides, and found significant differential phosphorylation levels in 282 phosphosites from 191 proteins, including various insulin-responsive proteins and metabolic enzymes involved in lipid homeostasis in response to high-fat feeding. Kinase-substrate prediction and integrated network analysis of the altered phosphoproteins revealed underlying signaling modulations during HFD-induced obesity, and suggested deregulation of lipogenic and lipolytic pathways. Mutation of the differentially-regulated novel phosphosite on cytoplasmic acetyl-coA forming enzyme ACSS2 (S263A) upon HFD-induced obesity led to accumulation of serum triglycerides and reduced insulin-responsive AKT phosphorylation as compared to wild type ACSS2, thus highlighting its role in obesity. Altogether, our study presents a comprehensive map of adipose tissue phosphoproteome in obesity and reveals many previously unknown candidate phosphorylation sites for future functional investigation. PMID:27180971

  11. Spatial Phosphoprotein Profiling Reveals a Compartmentalized Extracellular Signal-regulated Kinase Switch Governing Neurite Growth and Retraction

    SciTech Connect

    Wang, Yingchun; Yang, Feng; Fu, Yi; Huang, Xiahe; Wang, Wei; Jiang, Xining; Gritsenko, Marina A.; Zhao, Rui; Monroe, Matthew E.; Pertz, Olivier C.; Purvine, Samuel O.; Orton, Daniel J.; Jacobs, Jon M.; Camp, David G.; Smith, Richard D.; Klemke, Richard L.

    2011-05-20

    Abstract - Brain development and spinal cord regeneration require neurite sprouting and growth cone navigation in response to extension and collapsing factors present in the extracellular environment. These external guidance cues control neurite growth cone extension and retraction processes through intracellular protein phosphorylation of numerous cytoskeletal, adhesion, and polarity complex signaling proteins. However, the complex kinase/substrate signaling networks that mediate neuritogenesis have not been investigated. Here, we compare the neurite phosphoproteome under growth and retraction conditions using neurite purification methodology combined with mass spectrometry. More than 4000 non-redundant phosphorylation sites from 1883 proteins have been annotated and mapped to signaling pathways that control kinase/phosphatase networks, cytoskeleton remodeling, and axon/dendrite specification. Comprehensive informatics and functional studies revealed a compartmentalized ERK activation/deactivation cytoskeletal switch that governs neurite growth and retraction, respectively. Our findings provide the first system-wide analysis of the phosphoprotein signaling networks that enable neurite growth and retraction and reveal an important molecular switch that governs neuritogenesis.

  12. Depsidones from Lichens as Natural Product Inhibitors of M-Phase Phosphoprotein 1, a Human Kinesin Required for Cytokinesis.

    PubMed

    Talapatra, Sandeep K; Rath, Oliver; Clayton, Eddie; Tomasi, Sophie; Kozielski, Frank

    2016-06-24

    M-Phase Phosphoprotein 1 (MPP1), a microtubule plus end directed kinesin, is required for the completion of cytokinesis. Previous studies have shown that MPP1 is upregulated in various types of bladder cancer. This article describes inhibitor screening leading to the identification of a new class of natural product inhibitors of MPP1. Two compounds with structural similarity, norlobaridone (1) and physodic acid (2), were found to inhibit MPP1. Physodic acid is not competitive with ATP, indicating the presence of an allosteric inhibitor-binding pocket. Initial drug-like property screening indicates that physodic acid is more soluble than norlobaridone and has more favorable lipophilicity. However, both suffer from high clearance in human microsomal stability assays mediated by the lability of the lactone ring as well as hydroxylation of the alkyl chains as shown by metabolite identification studies. In cell-based assays physodic acid is a weak inhibitor with EC50 values of about 30 μM in a range of tumor cell lines. The two depsidones identified and characterized here could be used for future improvement of their activity against MPP1 and will be useful chemical probes for studying this unique molecular motor in more depth. PMID:27300079

  13. The co-chaperone Cdc37 regulates the rabies virus phosphoprotein stability by targeting to Hsp90AA1 machinery.

    PubMed

    Xu, Yunbin; Liu, Fei; Liu, Juan; Wang, Dandan; Yan, Yan; Ji, Senlin; Zan, Jie; Zhou, Jiyong

    2016-01-01

    Cdc37, as a kinase-specific co-chaperone of the chaperone Hsp90AA1 (Hsp90), actively aids with the maturation, stabilization and activation of the cellular or viral kinase/kinase-like targets. Phosphoprotein (P) of rabies virus (RABV) is a multifunctional, non-kinase protein involved in interferon antagonism, viral transcription and replication. Here, we demonstrated that the RABV non-kinase P is chaperoned by Cdc37 and Hsp90 during infection. We found that Cdc37 and Hsp90 affect the RABV life cycle directly. Activity inhibition and knockdown of Cdc37 and Hsp90 increased the instability of the viral P protein. Overexpression of Cdc37 and Hsp90 maintained P's stability but did not increase the yield of infectious RABV virions. We further demonstrated that the non-enzymatic polymerase cofactor P protein of all the genotypes of lyssaviruses is a target of the Cdc37/Hsp90 complex. Cdc37, phosphorylated or unphosphorylated on Ser13, aids the P protein to load onto the Hsp90 machinery, with or without Cdc37 binding to Hsp90. However, the interaction between Cdc37 and Hsp90 appears to have additional allosteric regulation of the conformational switch of Hsp90. Our study highlighted a novel mechanism in which Cdc37/Hsp90 chaperones a non-kinase target, which has significant implications for designing therapeutic targets against Rabies. PMID:27251758

  14. Potential of liquid-isoelectric-focusing protein fractionation to improve phosphoprotein characterization of Pseudomonas aeruginosa PA14.

    PubMed

    Ouidir, Tassadit; Jarnier, Frédérique; Cosette, Pascal; Jouenne, Thierry; Hardouin, Julie

    2014-10-01

    Protein phosphorylation on serine, threonine, and tyrosine is known to be involved in a wide variety of cellular processes and signal transduction in bacteria. Bacterial-proteome analysis is required to determine which proteins have been conditionally expressed and whether any post-translational modifications are present. One of the greatest challenges of proteome analysis is the fractionation of these complex protein mixtures to detect low-abundance phosphoproteins. Liquid-phase isoelectric focusing (IEF) is a promising analytical tool in proteomics, but as far as we are aware no work has studied the reproducibility of this approach. In this study, we investigated the phosphoproteome of Pseudomonas aeruginosa strain PA14. We first tested in-solution IEF protein fractionation, and then used this technique to fractionate the proteins in the complex mixture. Next, phosphopeptides were enriched with titanium dioxide and analyzed by high-resolution, high-accuracy liquid chromatography-mass spectrometry. With this approach, we succeeded in characterizing 73 unique phosphorylated peptides belonging to 63 proteins. Interestingly, we observed a higher percentage of modified tyrosine, revealing the importance of this phosphorylated residue in bacteria. PMID:25096199

  15. The co-chaperone Cdc37 regulates the rabies virus phosphoprotein stability by targeting to Hsp90AA1 machinery

    PubMed Central

    Xu, Yunbin; Liu, Fei; Liu, Juan; Wang, Dandan; Yan, Yan; Ji, Senlin; Zan, Jie; Zhou, Jiyong

    2016-01-01

    Cdc37, as a kinase-specific co-chaperone of the chaperone Hsp90AA1 (Hsp90), actively aids with the maturation, stabilization and activation of the cellular or viral kinase/kinase-like targets. Phosphoprotein (P) of rabies virus (RABV) is a multifunctional, non-kinase protein involved in interferon antagonism, viral transcription and replication. Here, we demonstrated that the RABV non-kinase P is chaperoned by Cdc37 and Hsp90 during infection. We found that Cdc37 and Hsp90 affect the RABV life cycle directly. Activity inhibition and knockdown of Cdc37 and Hsp90 increased the instability of the viral P protein. Overexpression of Cdc37 and Hsp90 maintained P’s stability but did not increase the yield of infectious RABV virions. We further demonstrated that the non-enzymatic polymerase cofactor P protein of all the genotypes of lyssaviruses is a target of the Cdc37/Hsp90 complex. Cdc37, phosphorylated or unphosphorylated on Ser13, aids the P protein to load onto the Hsp90 machinery, with or without Cdc37 binding to Hsp90. However, the interaction between Cdc37 and Hsp90 appears to have additional allosteric regulation of the conformational switch of Hsp90. Our study highlighted a novel mechanism in which Cdc37/Hsp90 chaperones a non-kinase target, which has significant implications for designing therapeutic targets against Rabies. PMID:27251758

  16. Phosphorylation of the vasodilator-stimulated phosphoprotein (VASP) by the anti-platelet drug, cilostazol, in platelets.

    PubMed

    Sudo, Toshiki; Ito, Hideki; Kimura, Yukio

    2003-09-01

    Vasodilator-stimulated phosphoprotein (VASP) is a regulator of actin dynamics in platelets and a common substrate of both cAMP- and cGMP-dependent protein kinases (PKA and PKG). Elevations of the cAMP and cGMP concentration have been shown to inhibit platelet aggregation. Intracellular levels of cAMP and cGMP are regulated by the synthesizing system of adenylate cyclases, and hydrolysis by cyclic nucleotide phosphodiesterases (PDEs). The present study examined the effect of the anti-platelet drug, cilostazol, which inhibits PDE3 activity, on VASP phosphorylation in platelets. VASP phosphorylation was examined by immunoblotting with an anti-VASP antibody, M4, and an anti-phospho-VASP antibody, 16C2. Cilostazol phosphorylated VASP at both Ser157 and Ser239 in a concentration-dependent manner, but EHNA (PDE2 inhibitor), dipyridamole and zaprinast (PDE5 inhibitors) did not. Forskolin (adenylate cyclase activator) and sodium nitroprusside (SNP, NO donor) resulted in the VASP phosphorylation, with increase in the cAMP and cGMP level, respectively. Cilostazol increased cAMP, but not cGMP levels, in platelets. EHNA, zaprinast and dipyridamole, had no effect on cAMP and cGMP levels. The PKA/PKG inhibitor, H-89, inhibited VASP phosphorylation by cilostazol. These results demonstrated that cilostazol phosphorylates VASP through the PDE3 inhibition, increase of cAMP level, and PKA activation in platelets. PMID:14602552

  17. Phosphoprotein network analysis of white adipose tissues unveils deregulated pathways in response to high-fat diet.

    PubMed

    Asfa, Alli Shaik; Qiu, Beiying; Wee, Sheena; Choi, Hyungwon; Gunaratne, Jayantha; Tergaonkar, Vinay

    2016-01-01

    Despite efforts in the last decade, signaling aberrations associated with obesity remain poorly understood. To dissect molecular mechanisms that define this complex metabolic disorder, we carried out global phosphoproteomic analysis of white adipose tissue (WAT) from mice fed on low-fat diet (LFD) and high-fat diet (HFD). We quantified phosphorylation levels on 7696 peptides, and found significant differential phosphorylation levels in 282 phosphosites from 191 proteins, including various insulin-responsive proteins and metabolic enzymes involved in lipid homeostasis in response to high-fat feeding. Kinase-substrate prediction and integrated network analysis of the altered phosphoproteins revealed underlying signaling modulations during HFD-induced obesity, and suggested deregulation of lipogenic and lipolytic pathways. Mutation of the differentially-regulated novel phosphosite on cytoplasmic acetyl-coA forming enzyme ACSS2 (S263A) upon HFD-induced obesity led to accumulation of serum triglycerides and reduced insulin-responsive AKT phosphorylation as compared to wild type ACSS2, thus highlighting its role in obesity. Altogether, our study presents a comprehensive map of adipose tissue phosphoproteome in obesity and reveals many previously unknown candidate phosphorylation sites for future functional investigation. PMID:27180971

  18. Cloning of the VASP (Vasodilator-Stimulated Phosphoprotein) genes in human and mouse: Structure, sequence, and chromosomal localization

    SciTech Connect

    Zimmer, M.; Fischer, L.; Hauser, W.

    1996-09-01

    The genes encoding the vasodilator-stimulated phosphoprotein (VASP) in human and mouse were isolated, and major parts were sequenced. In both species the gene is composed of 13 exons with conserved exon-intron positions. The mouse VASP cDNA sequence was deduced from the genomic sequence. The predicted amino acid sequence is 89% identical to the human protein. The high nucleotide sequence homology extends not only over the coding regions but also into the 3{prime}-UTRs, indicating a possible function in mRNA targeting or regulation of translation. Prominent 5{prime} CpG islands including multiple SP1 sites indicate a housekeeping function of VASP. Using cosmid DNA as a probe for fluorescence in situ hybridization, the human VASP gene was assigned to chromosome 19q13.2-q13.3, an extended region with homology to mouse chromosome 7. A sequence overlap of the VASP 5{prime}-region with the telomeric end of a cosmid contig physically links the VASP gene with ERCC1. VASP is located about 92 kb distal to ERCC1 and about 300 kb proximal to the myotonic dystrophy protein kinase gene. 43 refs., 6 figs.

  19. Effects of thyrotropin on the phosphorylation of histones and nonhistone phosphoproteins in micrococcal nuclease-sensitive and resistant thyroid chromatin

    SciTech Connect

    Cooper, E.; Spaulding, S.W.

    1983-05-01

    Actively transcribed regions of chromatin are more susceptible than bulk chromatin to digestion by nucleases, and useful information about the composition and structure of active chromatin may be obtained by studying the chromatin fragments released from nuclei by limited nuclease digestion. In the present study, we have used micrococcal nuclease to investigate the effects of TSH on protein phosphorylation in nuclease-sensitive fractions of calf thyroid chromatin. Batches of calf thyroid slices were incubated for 2 h with /sup 32/Pi, with or without 50 mU/ml TSH. Nuclei were then prepared and the distribution of /sup 32/P-labeled histones, high mobility group (HMG) proteins, and other acid-soluble phosphoproteins between micrococcal nuclease-sensitive and resistant fractions of chromatin was examined. TSH increased the amount of /sup 32/P incorporated into HMG 14 and the histones H1 and H3. Hormone-dependent increases in the /sup 32/P-labeling of H1 and H3 were not selectively associated with micrococcal nuclease-sensitive chromatin. In contrast, (/sup 32/P) HMG-14 was preferentially solubilized from nuclei by micrococcal nuclease. This lends support to the view that TSH-induced effects on the structure and function of transcriptionally active chromatin may be mediated in part by phosphorylation of HMG 14.

  20. Insights into the coiled-coil organization of the Hendra virus phosphoprotein from combined biochemical and SAXS studies.

    PubMed

    Beltrandi, Matilde; Blocquel, David; Erales, Jenny; Barbier, Pascale; Cavalli, Andrea; Longhi, Sonia

    2015-03-01

    Nipah and Hendra viruses are recently emerged paramyxoviruses belonging to the Henipavirus genus. The Henipavirus phosphoprotein (P) consists of a large intrinsically disordered domain and a C-terminal domain (PCT) containing alternating disordered and ordered regions. Among these latter is the P multimerization domain (PMD). Using biochemical, analytical ultracentrifugation and small-angle X-ray scattering (SAXS) studies, we show that Hendra virus (HeV) PMD forms an elongated coiled-coil homotrimer in solution, in agreement with our previous findings on Nipah virus (NiV) PMD. However, the orientation of the N-terminal region differs from that observed in solution for NiV PMD, consistent with the ability of this region to adopt different conformations. SAXS studies provided evidence for a trimeric organization also in the case of PCT, thus extending and strengthening our findings on PMD. The present results are discussed in light of conflicting reports in the literature pointing to a tetrameric organization of paramyxoviral P proteins. PMID:25637789

  1. The non-pathogenic Henipavirus Cedar paramyxovirus phosphoprotein has a compromised ability to target STAT1 and STAT2.

    PubMed

    Lieu, Kim G; Marsh, Glenn A; Wang, Lin-Fa; Netter, Hans J

    2015-12-01

    Immune evasion by the lethal henipaviruses, Hendra (HeV) and Nipah virus, is mediated by its interferon (IFN) antagonist P gene products, phosphoprotein (P), and the related V and W proteins, which can target the signal transducer and activator of transcription 1 (STAT1) and STAT2 proteins to inhibit IFN/STAT signaling. However, it is not clear if the recently identified non-pathogenic Henipavirus, Cedar paramyxovirus (CedPV), is also able to antagonize the STAT proteins. We performed comparative studies between the HeV P gene products (P/V/W) and CedPV-P (CedPV does not encode V or W) and demonstrate that differences exist in their ability to engage the STAT proteins using immunoprecipitation and quantitative confocal microscopic analysis. In contrast to HeV-P gene encoded proteins, the ability of CedPV-P to interact with and relocalize STAT1 or STAT2 is compromised, correlating with a reduced capacity to inhibit the mRNA synthesis of IFN-inducible gene MxA. Furthermore, infection studies with HeV and CedPV demonstrate that HeV is more potent than CedPV in inhibiting the IFN-α-mediated nuclear accumulation of STAT1. These results strongly suggest that the ability of CedPV to counteract the IFN/STAT response is compromised compared to HeV. PMID:26526590

  2. Golgi phosphoprotein3 overexpression is associated with poor survival in patients with solid tumors: a meta-analysis

    PubMed Central

    Jiang, Yaqi; Su, Yuqi; Zhao, Yang; Pan, Changqie; Chen, Li

    2015-01-01

    Golgi phosphoprotein3 (GOLPH3) is known as an oncoprotein and may be a prognostic biomarker in various tumors. Here we performed a meta-analysis on the association of GOLPH3 expression and survival in solid tumors. All eligible studies were identified in Embase, PubMed and Web of Science Databases up to November 2014. Data about overall survival (OS), and disease-free survival (DFS) were extracted and pooled hazard ratios (HRs) of GOLPH3 for survival were calculated by using a random-effect model. Heterogeneity and publication bias were also assessed. A total of 15 eligible studies which comprised of 2529 cases were included in this global analysis: 14 were dealing with overall survival (OS) and 6 were with disease-free survival (DFS). We found that GOLPH3 overexpression was associated with shorter OS (HR 2.487, 95% CI 1.897-3.258, P < 0.001) and DFS (HR 1.911, 95% CI 1.245-2.932, P = 0.003) in general carcinomas. Importantly, subgroup analysis suggested that overexpression of GOLPH3 correlated with shorter OS in urogenital system cancers (HR 4.258, 95% CI 1.81-4.91, P < 0.001). Moreover, publication bias was not significant (P > 0.05). In conclusion, the present meta-analysis showed that overexpression of GOLPH3 predicts poor prognosis in solid tumors. PMID:26617771

  3. Intrinsic Disorder to Order Transitions in the Scaffold Phosphoprotein P from the Respiratory Syncytial Virus RNA Polymerase Complex.

    PubMed

    Noval, María G; Esperante, Sebastian A; Molina, Ivana G; Chemes, Lucía B; Prat-Gay, Gonzalo de

    2016-03-15

    Intrinsic disorder is at the center of biochemical regulation and is particularly overrepresented among the often multifunctional viral proteins. Replication and transcription of the respiratory syncytial virus (RSV) relies on a RNA polymerase complex with a phosphoprotein cofactor P as the structural scaffold, which consists of a four-helix bundle tetramerization domain flanked by two domains predicted to be intrinsically disordered. Because intrinsic disorder cannot be reduced to a defined atomic structure, we tackled the experimental dissection of the disorder-order transitions of P by a domain fragmentation approach. P remains as a tetramer above 70 °C but shows a pronounced reversible secondary structure transition between 10 and 60 °C. While the N-terminal module behaves as a random coil-like IDP in a manner independent of tetramerization, the isolated C-terminal module displays a cooperative and reversible metastable transition. When linked to the tetramerization domain, the C-terminal module becomes markedly more structured and stable, with strong ANS binding. Therefore, the tertiary structure in the C-terminal module is not compact, conferring "late" molten globule-like IDP properties, stabilized by interactions favored by tetramerization. The presence of a folded structure highly sensitive to temperature, reversibly and almost instantly formed and broken, suggests a temperature sensing activity. The marginal stability allows for exposure of protein binding sites, offering a thermodynamic and kinetic fine-tuning in order-disorder transitions, essential for the assembly and function of the RSV RNA polymerase complex. PMID:26901160

  4. Phosphoric acid esters cannot replace polyvinylphosphonic acid as phosphoprotein analogs in biomimetic remineralization of resin-bonded dentin.

    PubMed

    Mai, Sui; Kim, Young Kyung; Toledano, Manuel; Breschi, Lorenzo; Ling, Jun Qi; Pashley, David H; Tay, Franklin R

    2009-10-01

    Polyvinylphosphonic acid (PVPA), a biomimetic analog of phosphoproteins, is crucial for recruiting polyacrylic acid (PAA)-stabilized amorphous calcium phosphate nanoprecursors during biomimetic remineralization of dentin collagen matrices. This study tested the null hypothesis that phosphoric acid esters of methacrylates in dentin adhesives cannot replace PVPA during bimimetic remineralization of resin-dentin interfaces. Human dentin specimens were bonded with: (I) XP Bond, an etch-and-rinse adhesive using moist bonding; (II) XP Bond using dry bonding; (III) Adper Prompt L-Pop, a self-etching adhesive. The control medium contained only set Portland cement and a simulated body fluid (SBF) without any biomimetic analog. Two experimental Portland cement/SBF remineralization media were evaluated: the first contained PAA as the sole biomimetic analog, the second contained PAA and PVPA as dual biomimetic analogs. No remineralization of the resin-dentin interfaces could be identified from specimens immersed in the control medium. After 2-4 months in the first experimental medium, specimens exhibited either no remineralization or large crystal formation within hybrid layers. Only specimens immersed in the second remineralization medium produced nanocrystals that accounted for intrafibrillar remineralization within hybrid layers. The null hypothesis could not be rejected; phosphoric acid esters in dentin adhesives cannot replace PVPA during biomimetic remineralization of adhesive-bonded dentin. PMID:19481792

  5. Modeling the Overproduction of Ribosomes when Antibacterial Drugs Act on Cells.

    PubMed

    Maitra, Arijit; Dill, Ken A

    2016-02-01

    Bacteria that are subjected to ribosome-inhibiting antibiotic drugs show an interesting behavior: Although the drug slows down cell growth, it also paradoxically increases the cell's concentration of ribosomes. We combine our earlier nonlinear model of the energy-biomass balance in undrugged Escherichia coli cells with Michaelis-Menten binding of drugs that inactivate ribosomes. Predictions are in good agreement with experiments on ribosomal concentrations and synthesis rates versus drug concentrations and growth rates. The model indicates that the added drug drives the cell to overproduce ribosomes, keeping roughly constant the level of ribosomes producing ribosomal proteins, an important quantity for cell growth. The model also predicts that ribosomal production rates should increase and then decrease with added drug. This model gives insights into the driving forces in cells and suggests new experiments. PMID:26840738

  6. Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?

    PubMed Central

    Nikkari, Simo; McLaughlin, Ian J.; Bi, Wanli; Dodge, Deborah E.; Relman, David A.

    2001-01-01

    Real-time PCR methods with primers and a probe targeting conserved regions of the bacterial 16S ribosomal DNA (rDNA) revealed a larger amount of rDNA in blood specimens from healthy individuals than in matched reagent controls. However, the origins and identities of these blood-associated bacterial rDNA sequences remain obscure. PMID:11326021

  7. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  8. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer.

    PubMed

    Baker, Nicholas E; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  9. The ABC of Ribosome-Related Antibiotic Resistance

    PubMed Central

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  10. Protein folding on the ribosome studied using NMR spectroscopy

    PubMed Central

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  11. Differential expression of ribosomal proteins in myelodysplastic syndromes.

    PubMed

    Rinker, Elizabeth B; Dueber, Julie C; Qualtieri, Julianne; Tedesco, Jason; Erdogan, Begum; Bosompem, Amma; Kim, Annette S

    2016-02-01

    Aberrations of ribosomal biogenesis have been implicated in several congenital bone marrow failure syndromes, such as Diamond-Blackfan anaemia, Shwachman-Diamond syndrome and Dyskeratosis Congenita. Recent studies have identified haploinsufficiency of RPS14 in the acquired bone marrow disease isolated 5q minus syndrome, a subtype of myelodysplastic syndromes (MDS). However, the expression of various proteins comprising the ribosomal subunits and other proteins enzymatically involved in the synthesis of the ribosome has not been explored in non-5q minus MDS. Furthermore, differences in the effects of these expression alterations among myeloid, erythroid and megakaryocyte lineages have not been well elucidated. We examined the expression of several proteins related to ribosomal biogenesis in bone marrow biopsy specimens from patients with MDS (5q minus patients excluded) and controls with no known myeloid disease. Specifically, we found that there is overexpression of RPS24, DKC1 and SBDS in MDS. This overexpression is in contrast to the haploinsufficiency identified in the congenital bone marrow failure syndromes and in acquired 5q minus MDS. Potential mechanisms for these differences and aetiology for these findings in MDS are discussed. PMID:26408650

  12. Conformation of the signal recognition particle in ribosomal targeting complexes

    PubMed Central

    Buskiewicz, Iwona A.; Jöckel, Johannes; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2009-01-01

    The bacterial signal recognition particle (SRP) binds to ribosomes synthesizing inner membrane proteins and, by interaction with the SRP receptor, FtsY, targets them to the translocon at the membrane. Here we probe the conformation of SRP and SRP protein, Ffh, at different stages of targeting by measuring fluorescence resonance energy transfer (FRET) between fluorophores placed at various positions within SRP. Distances derived from FRET indicate that SRP binding to nontranslating ribosomes triggers a global conformational change of SRP that facilitates binding of the SRP receptor, FtsY. Binding of SRP to a signal-anchor sequence exposed on a ribosome-nascent chain complex (RNC) causes a further change of the SRP conformation, involving the flexible part of the Ffh(M) domain, which increases the affinity for FtsY of ribosome-bound SRP up to the affinity exhibited by the isolated NG domain of Ffh. This indicates that in the RNC–SRP complex the Ffh(NG) domain is fully exposed for binding FtsY to form the targeting complex. Binding of FtsY to the RNC–SRP complex results in a limited conformational change of SRP, which may initiate subsequent targeting steps. PMID:19029307

  13. Dependency Map of Proteins in the Small Ribosomal Subunit

    PubMed Central

    Hamacher, Kay; Trylska, Joanna; McCammon, J. Andrew

    2006-01-01

    The assembly of the ribosome has recently become an interesting target for antibiotics in several bacteria. In this work, we extended an analytical procedure to determine native state fluctuations and contact breaking to investigate the protein stability dependence in the 30S small ribosomal subunit of Thermus thermophilus. We determined the causal influence of the presence and absence of proteins in the 30S complex on the binding free energies of other proteins. The predicted dependencies are in overall agreement with the experimentally determined assembly map for another organism, Escherichia coli. We found that the causal influences result from two distinct mechanisms: one is pure internal energy change, the other originates from the entropy change. We discuss the implications on how to target the ribosomal assembly most effectively by suggesting six proteins as targets for mutations or other hindering of their binding. Our results show that by blocking one out of this set of proteins, the association of other proteins is eventually reduced, thus reducing the translation efficiency even more. We could additionally determine the binding dependency of THX—a peptide not present in the ribosome of E. coli—and suggest its assembly path. PMID:16485038

  14. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  15. Ribosomal proteins of the Asian citrus psyllid, Diaphornia citri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed and sequenced 88 ribosomal protein sequences for their use as genetic markers to monitor and identify current and exotic introductions of psyllids into the U.S.A. The sequences were produced and submitted as a psyllid specific dataset into the National Center for Biotechnology Informati...

  16. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  17. Protein-guided RNA dynamics during early ribosome assembly

    NASA Astrophysics Data System (ADS)

    Kim, Hajin; Abeysirigunawarden, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.

    2014-02-01

    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  18. The Structure of LepA, the Ribosomal Back Translocase

    SciTech Connect

    Evans,R.; Blaha, G.; Bailey, S.; Steitz, T.

    2008-01-01

    LepA is a highly conserved elongation factor that promotes the back translocation of tRNAs on the ribosome during the elongation cycle. We have determined the crystal structure of LepA from Escherichia coli at 2.8- Angstroms resolution. The high degree of sequence identity between LepA and EF-G is reflected in the structural similarity between the individual homologous domains of LepA and EF-G. However, the orientation of domains III and V in LepA differs from their orientations in EF-G. LepA also contains a C-terminal domain (CTD) not found in EF-G that has a previously unobserved protein fold. The high structural similarity between LepA and EF-G enabled us to derive a homology model for LepA bound to the ribosome using a 7.3- Angstroms cryo-EM structure of a complex between EF-G and the 70S ribosome. In this model, the very electrostatically positive CTD of LepA is placed in the direct vicinity of the A site of the large ribosomal subunit, suggesting a possible interaction between the CTD and the back translocated tRNA or 23S rRNA.

  19. Affinity labeling of the ribosomal P site in Drosophila melanogaster

    SciTech Connect

    North, D.

    1987-01-01

    Several recent studies have probed the peptidyl transferase region of the Drosophila ribosome via the use of reactive site specific analogues (affinity labels). P site proteins adjacent to the 3' end of the amino acid bearing tRNA strand were labeled with modified tRNA fragments. Drugs affecting the binding of these agents were used to further clarify the nature of the region. The nascent peptide region of the P site was not labeled in previous experiments. To label that region radioactive Bromoacetylphenylalanyl-tRNA (BrAcphe-tRNA) was synthesized. The alpha-bromoacetyl group of this analogue is potentially reactive with nucleophiles present in either proteins or RNAs. Charged tRNAs and tRNA analogues bearing a peptide bond on the N-terminus of their amino acid are recognized as having affinity for the ribosomal P site. Specific labeling of the P site by BrAcphe-tRNA was confirmed by its ability to radioactively label proteins indirectly. As many as 8 ribosomal proteins may be labeled under these conditions, however, the majority of the bound label is associated with 3 large subunit proteins and 2 small subunit proteins. Overlaps between the proteins labeled by BrAcphe-tRNA and those labeled by other affinity labels are examined and a model of the peptidyl transferase region of Drosophila ribosomes is presented.

  20. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer

    PubMed Central

    Baker, Nicholas E.; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  1. Ribosomal protein L3: Gatekeeper to the A-site

    PubMed Central

    2007-01-01

    Summary Ribosomal protein L3 (L3) is an essential and indispensable component for formation of the peptidyltransferase center. Atomic resolution ribosome structures reveal two extensions of L3 protruding deep into the core of the large subunit. The central extension of L3 in Saccharomyces cerevisiae was investigated using a combination of molecular genetic, biochemical, chemical probing and molecular modeling methods. A reciprocal relationship between ribosomal affinity for eEF-1A stimulated binding of aa-tRNA and for eEF2 suggests that the central extension of L3 may function as an allosteric switch in coordinating binding of the elongation factors. Opening of the aa-tRNA accommodation corridor promoted resistance to the A-site specific translational inhibitor anisomycin, suggesting a competitive model for anisomycin resistance. These changes were also found to inhibit peptidyltransferase activity, stimulating programmed -1 ribosomal frameshifting, and promoting virus propagation defects. These studies provide a basis for deeper insight for rational design of small molecule antiviral therapeutics. PMID:17386264

  2. N-terminal sequence of some ribosome-inactivating proteins.

    PubMed

    Montecucchi, P C; Lazzarini, A M; Barbieri, L; Stirpe, F; Soria, M; Lappi, D

    1989-04-01

    The N-terminal portion of some type 1 ribosome-inactivating proteins (RIPs) isolated from the seeds of Gelonium multiflorum, Momordica charantia, Bryonia dioica, Saponaria officinalis and from the leaves of Saponaria officinalis are reported in the present paper. Their relationship with other RIPs is discussed. PMID:2753596

  3. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  4. Reverse Translocation of tRNA in the Ribosome

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2009-01-01

    Summary A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation. PMID:17189194

  5. The ribosome-associated complex antagonizes prion formation in yeast

    PubMed Central

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M

    2015-01-01

    Abstract The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI+] prion – an alternative conformer of Sup35 protein – and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome. PMID:25739058

  6. Two orthogonal cleavages separate subunit RNAs in mouse ribosome biogenesis

    PubMed Central

    Wang, Minshi; Anikin, Leonid; Pestov, Dimitri G.

    2014-01-01

    Ribosome biogenesis is a dynamic multistep process, many features of which are still incompletely documented. Here, we show that changes in this pathway can be captured and annotated by means of a graphic set of pre-rRNA ratios, a technique we call Ratio Analysis of Multiple Precursors (RAMP). We find that knocking down a ribosome synthesis factor produces a characteristic RAMP profile that exhibits consistency across a range of depletion levels. This facilitates the inference of affected steps and simplifies comparative analysis. We applied RAMP to examine how endonucleolytic cleavages of the mouse pre-rRNA transcript in the internal transcribed spacer 1 (ITS1) are affected by depletion of factors required for maturation of the small ribosomal subunit (Rcl1, Fcf1/Utp24, Utp23) and the large subunit (Pes1, Nog1). The data suggest that completion of early maturation in a subunit triggers its release from the common pre-rRNA transcript by stimulating cleavage at the proximal site in ITS1. We also find that splitting of pre-rRNA in the 3′ region of ITS1 is prevalent in adult mouse tissues and quiescent cells, as it is in human cells. We propose a model for subunit separation during mammalian ribosome synthesis and discuss its implications for understanding pre-rRNA processing pathways. PMID:25190460

  7. A model for competition for ribosomes in the cell.

    PubMed

    Raveh, Alon; Margaliot, Michael; Sontag, Eduardo D; Tuller, Tamir

    2016-03-01

    A single mammalian cell includes an order of 10(4)-10(5) mRNA molecules and as many as 10(5)-10(6) ribosomes. Large-scale simultaneous mRNA translation induces correlations between the mRNA molecules, as they all compete for the finite pool of available ribosomes. This has important implications for the cell's functioning and evolution. Developing a better understanding of the intricate correlations between these simultaneous processes, rather than focusing on the translation of a single isolated transcript, should help in gaining a better understanding of mRNA translation regulation and the way elongation rates affect organismal fitness. A model of simultaneous translation is specifically important when dealing with highly expressed genes, as these consume more resources. In addition, such a model can lead to more accurate predictions that are needed in the interconnection of translational modules in synthetic biology. We develop and analyse a general dynamical model for large-scale simultaneous mRNA translation and competition for ribosomes. This is based on combining several ribosome flow models (RFMs) interconnected via a pool of free ribosomes. We use this model to explore the interactions between the various mRNA molecules and ribosomes at steady state. We show that the compound system always converges to a steady state and that it always entrains or phase locks to periodically time-varying transition rates in any of the mRNA molecules. We then study the effect of changing the transition rates in one mRNA molecule on the steady-state translation rates of the other mRNAs that results from the competition for ribosomes. We show that increasing any of the codon translation rates in a specific mRNA molecule yields a local effect, an increase in the translation rate of this mRNA, and also a global effect, the translation rates in the other mRNA molecules all increase or all decrease. These results suggest that the effect of codon decoding rates of endogenous and

  8. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  9. Visualization of the joining of ribosomal subunits reveals the presence of 80S ribosomes in the nucleus

    PubMed Central

    Al-Jubran, Khalid; Wen, Jikai; Abdullahi, Akilu; Roy Chaudhury, Subhendu; Li, Min; Ramanathan, Preethi; Matina, Annunziata; De, Sandip; Piechocki, Kim; Rugjee, Kushal Nivriti; Brogna, Saverio

    2013-01-01

    In eukaryotes the 40S and 60S ribosomal subunits are assembled in the nucleolus, but there appear to be mechanisms preventing mRNA binding, 80S formation, and initiation of translation in the nucleus. To visualize association between ribosomal subunits, we tagged pairs of Drosophila ribosomal proteins (RPs) located in different subunits with mutually complementing halves of fluorescent proteins. Pairs of tagged RPs expected to interact, or be adjacent in the 80S structure, showed strong fluorescence, while pairs that were not in close proximity did not. Moreover, the complementation signal is found in ribosomal fractions and it was enhanced by translation elongation inhibitors and reduced by initiation inhibitors. Our technique achieved 80S visualization both in cultured cells and in fly tissues in vivo. Notably, while the main 80S signal was in the cytoplasm, clear signals were also seen in the nucleolus and at other nuclear sites. Furthermore, we detected rapid puromycin incorporation in the nucleolus and at transcription sites, providing an independent indication of functional 80S in the nucleolus and 80S association with nascent transcripts. PMID:24129492

  10. The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments

    PubMed Central

    Ingolia, Nicholas T.; Brar, Gloria A.; Rouskin, Silvia; McGeachy, Anna M.; Weissman, Jonathan S.

    2012-01-01

    Recent studies highlight the importance of translational control in determining protein abundance, underscoring the value of measuring gene expression at the level of translation. We present a protocol for genome-wide, quantitative analysis of in vivo translation by deep sequencing. This ribosome profiling approach maps the exact positions of ribosomes on transcripts by nuclease footprinting. The nuclease-protected mRNA fragments are converted into a DNA library suitable for deep sequencing using a strategy that minimizes bias. The abundance of different footprint fragments in deep sequencing data reports on the amount of translation of a gene. Additionally, footprints reveal the exact regions of the transcriptome that are translated. To better define translated reading frames, we describe an adaptation that reveals the sites of translation initiation by pre-treating cells with harringtonine to immobilize initiating ribosomes. The protocol we describe requires 5–7 days to generate a completed ribosome profiling sequencing library. Sequencing and data analysis requires a further 4 – 5 days. PMID:22836135

  11. Differential effects of ribosomal proteins and Mg2+ ions on a conformational switch during 30S ribosome 5'-domain assembly.

    PubMed

    Abeysirigunawardena, Sanjaya C; Woodson, Sarah A

    2015-11-01

    Ribosomal protein S4 nucleates assembly of the 30S ribosome 5' and central domains, which is crucial for the survival of cells. Protein S4 changes the structure of its 16S rRNA binding site, passing through a non-native intermediate complex before forming native S4-rRNA contacts. Ensemble FRET was used to measure the thermodynamic stability of non-native and native S4 complexes in the presence of Mg(2+) ions and other 5'-domain proteins. Equilibrium titrations of Cy3-labeled 5'-domain RNA with Cy5-labeled protein S4 showed that Mg(2+) ions preferentially stabilize the native S4-rRNA complex. In contrast, ribosomal proteins S20 and S16 act by destabilizing the non-native S4-rRNA complex. The full cooperative switch to the native complex requires S4, S16, and S20 and is achieved to a lesser degree by S4 and S16. The resulting thermodynamic model for assembly of the 30S body illustrates how ribosomal proteins selectively bias the equilibrium between alternative rRNA conformations, increasing the cooperativity of rRNA folding beyond what can be achieved by Mg(2+) ions alone. PMID:26354770

  12. EttA regulates translation by binding to the ribosomal E site and restricting ribosome-tRNA dynamics

    PubMed Central

    Chen, Bo; Boël, Grégory; Hashem, Yaser; Ning, Wei; Fei, Jingyi; Wang, Chi; Gonzalez, Ruben L.; Hunt, John F.; Frank, Joachim

    2014-01-01

    Cells express many ribosome-interacting factors whose functions and molecular mechanisms remain unknown. Here, we elucidate the mechanism of a newly characterized regulatory translation factor, Energy-dependent Translational Throttle A (EttA), which is an Escherichia coli representative of the ATP-binding cassette F (ABC-F) protein family. Using cryo-EM, we demonstrate that the ATP-bound form of EttA binds to the ribosomal tRNA exit (E) site, where it forms bridging interactions between the ribosomal L1 stalk and the tRNA bound in the peptidyl-tRNA binding (P) site. Using single-molecule fluorescence resonance energy transfer (smFRET), we show that the ATP-bound form of EttA restricts ribosome and tRNA dynamics required for protein synthesis. This work represents the first example, to our knowledge, where the detailed molecular mechanism of any ABC-F family protein has been determined and establishes a framework for elucidating the mechanisms of other regulatory translation factors. PMID:24389465

  13. Attachment of UDP-hexosamines to the ribosomes isolated from rat liver

    SciTech Connect

    Kopacz-Jodczyk, T.; Paszkiewicz-Gadek, A.; Galasinski, W.

    1988-06-01

    The binding of UDP-N-acetylhexosamines with purified ribosomes was studied and it was found that the radioactive nucleotides can be attached to these particles. The radioactivity of the purified ribosomal pellet depends on the amounts of ribosomes and UDP-N-acetylhexosamines. Some characteristics of the binding system indicate that the attachment of UDP-sugar to ribosome does not require the participation of glycosyltransferases. The results of the competition experiment would suggest that there are specific sites on ribosomes for the binding of UDP-N-acetylglucosamine.

  14. Vasodilator-stimulated phosphoprotein restricts cell-to-cell spread of Shigella flexneri at the cell periphery.

    PubMed

    Lee, Soo Young; Gertler, Frank B; Goldberg, Marcia B

    2015-11-01

    Shigella spp. are intracellular bacterial pathogens that cause diarrhoeal disease in humans. Shigella utilize the host actin cytoskeleton to enter cells, move through the cytoplasm of cells and pass into adjacent cells. Ena/VASP family proteins are highly conserved proteins that participate in actin-dependent dynamic cellular processes. We tested whether Ena/VASP family members VASP (vasodilator-stimulated phosphoprotein), Mena (mammalian-enabled) or EVL (Ena-VASP-like) contribute to Shigella flexneri spread through cell monolayers. VASP and EVL restricted cell-to-cell spread without significantly altering actin-based motility, whereas Mena had no effect on these processes. Phosphorylation of VASP on Ser153, Ser235 and Thr274 regulated its subcellular distribution and function. VASP derivatives that lack the Ena/VASP homology 1 (EVH1) domain or contain a phosphoablative mutation of Ser153 were defective in restricting S. flexneri spread, indicating that the EVH1 domain and phosphorylation on Ser153 are required for this process. The EVH1 domain and Ser153 of VASP were required for VASP localization to focal adhesions, and localization of VASP to focal adhesions and/or the leading edge was required for restriction of spread. The contribution of the EVH1 domain was from both the donor and the recipient cell, whereas the contribution of Ser153 phosphorylation was only from the donor cell. Thus, unlike host proteins characterized in Shigella pathogenesis that promote bacterial spread, VASP and EVL function to limit it. The ability of VASP and EVL to limit spread highlights the critical role of focal adhesion complexes and/or the leading edge in bacterial passage between cells. PMID:26358985

  15. Ensemble Structure of the Highly Flexible Complex Formed between Vesicular Stomatitis Virus Unassembled Nucleoprotein and its Phosphoprotein Chaperone.

    PubMed

    Yabukarski, Filip; Leyrat, Cedric; Martinez, Nicolas; Communie, Guillaume; Ivanov, Ivan; Ribeiro, Euripedes A; Buisson, Marlyse; Gerard, Francine C; Bourhis, Jean-Marie; Jensen, Malene Ringkjøbing; Bernadó, Pau; Blackledge, Martin; Jamin, Marc

    2016-07-01

    Nucleocapsid assembly is an essential process in the replication of the non-segmented, negative-sense RNA viruses (NNVs). Unassembled nucleoprotein (N(0)) is maintained in an RNA-free and monomeric form by its viral chaperone, the phosphoprotein (P), forming the N(0)-P complex. Our earlier work solved the structure of vesicular stomatitis virus complex formed between an N-terminally truncated N (NΔ21) and a peptide of P (P60) encompassing the N(0)-binding site, but how the full-length P interacts with N(0) remained unknown. Here, we combine several experimental biophysical methods including size exclusion chromatography with detection by light scattering and refractometry, small-angle X-ray and neutron scattering and nuclear magnetic resonance spectroscopy with molecular dynamics simulation and computational modeling to characterize the NΔ21(0)-PFL complex formed with dimeric full-length P. We show that for multi-molecular complexes, simultaneous multiple-curve fitting using small-angle neutron scattering data collected at varying contrast levels provides additional information and can help refine structural ensembles. We demonstrate that (a) vesicular stomatitis virus PFL conserves its high flexibility within the NΔ21(0)-PFL complex and interacts with NΔ21(0) only through its N-terminal extremity; (b) each protomer of P can chaperone one N(0) client protein, leading to the formation of complexes with stoichiometries 1N:P2 and 2N:P2; and (c) phosphorylation of residues Ser60, Thr62 and Ser64 provides no additional interactions with N(0) but creates a metal binding site in PNTR. A comparison with the structures of Nipah virus and Ebola virus N(0)-P core complex suggests a mechanism for the control of nucleocapsid assembly that is common to all NNVs. PMID:27107640

  16. Regulation of Stress-Inducible Phosphoprotein 1 Nuclear Retention by Protein Inhibitor of Activated STAT PIAS1

    PubMed Central

    Soares, Iaci N.; Caetano, Fabiana A.; Pinder, Jordan; Rodrigues, Bruna Roz; Beraldo, Flavio H.; Ostapchenko, Valeriy G.; Durette, Chantal; Pereira, Grace Schenatto; Lopes, Marilene H.; Queiroz-Hazarbassanov, Nicolle; Cunha, Isabela W.; Sanematsu, Paulo I.; Suzuki, Sergio; Bleggi-Torres, Luiz F.; Schild-Poulter, Caroline; Thibault, Pierre; Dellaire, Graham; Martins, Vilma R.; Prado, Vania F.; Prado, Marco A. M.

    2013-01-01

    Stress-inducible phosphoprotein 1 (STI1), a cochaperone for Hsp90, has been shown to regulate multiple pathways in astrocytes, but its contributions to cellular stress responses are not fully understood. We show that in response to irradiation-mediated DNA damage stress STI1 accumulates in the nucleus of astrocytes. Also, STI1 haploinsufficiency decreases astrocyte survival after irradiation. Using yeast two-hybrid screenings we identified several nuclear proteins as STI1 interactors. Overexpression of one of these interactors, PIAS1, seems to be specifically involved in STI1 nuclear retention and in directing STI1 and Hsp90 to specific sub-nuclear regions. PIAS1 and STI1 co-immunoprecipitate and PIAS1 can function as an E3 SUMO ligase for STI. Using mass spectrometry we identified five SUMOylation sites in STI1. A STI1 mutant lacking these five sites is not SUMOylated, but still accumulates in the nucleus in response to increased expression of PIAS1, suggesting the possibility that a direct interaction with PIAS1 could be responsible for STI1 nuclear retention. To test this possibility, we mapped the interaction sites between PIAS1 and STI1 using yeast-two hybrid assays and surface plasmon resonance and found that a large domain in the N-terminal region of STI1 interacts with high affinity with amino acids 450–480 of PIAS1. Knockdown of PIAS1 in astrocytes impairs the accumulation of nuclear STI1 in response to irradiation. Moreover, a PIAS1 mutant lacking the STI1 binding site is unable to increase STI1 nuclear retention. Interestingly, in human glioblastoma multiforme PIAS1 expression is increased and we found a significant correlation between increased PIAS1 expression and STI1 nuclear localization. These experiments provide evidence that direct interaction between STI1 and PIAS1 is involved in the accumulation of nuclear STI1. This retention mechanism could facilitate nuclear chaperone activity. PMID:23938469

  17. Hyperactivity and attention deficits in mice with decreased levels of stress-inducible phosphoprotein 1 (STIP1)

    PubMed Central

    Beraldo, Flavio H.; Thomas, Anu; Kolisnyk, Benjamin; Hirata, Pedro H.; De Jaeger, Xavier; Martyn, Amanda C.; Fan, Jue; Goncalves, Daniela F.; Cowan, Matthew F.; Masood, Talal; Martins, Vilma R.; Gros, Robert; Prado, Vania F.; Prado, Marco A. M.

    2015-01-01

    ABSTRACT Stress-inducible phosphoprotein I (STIP1, STI1 or HOP) is a co-chaperone intermediating Hsp70/Hsp90 exchange of client proteins, but it can also be secreted to trigger prion protein-mediated neuronal signaling. Some mothers of children with autism spectrum disorders (ASD) present antibodies against certain brain proteins, including antibodies against STIP1. Maternal antibodies can cross the fetus blood-brain barrier during pregnancy, suggesting the possibility that they can interfere with STIP1 levels and, presumably, functions. However, it is currently unknown whether abnormal levels of STIP1 have any impact in ASD-related behavior. Here, we used mice with reduced (50%) or increased STIP1 levels (fivefold) to test for potential ASD-like phenotypes. We found that increased STIP1 regulates the abundance of Hsp70 and Hsp90, whereas reduced STIP1 does not affect Hsp70, Hsp90 or the prion protein. Interestingly, BAC transgenic mice presenting fivefold more STIP1 show no major phenotype when examined in a series of behavioral tasks, including locomotor activity, elevated plus maze, Morris water maze and five-choice serial reaction time task (5-CSRTT). In contrast, mice with reduced STIP1 levels are hyperactive and have attentional deficits on the 5-CSRTT, but exhibit normal performance for the other tasks. We conclude that reduced STIP1 levels can contribute to phenotypes related to ASD. However, future experiments are needed to define whether it is decreased chaperone capacity or impaired prion protein signaling that contributes to these phenotypes. PMID:26398952

  18. Characterization of a Peptide Domain within the GB Virus C NS5A Phosphoprotein that Inhibits HIV Replication

    PubMed Central

    Xiang, Jinhua; McLinden, James H.; Chang, Qing; Jordan, Emma L.; Stapleton, Jack T.

    2008-01-01

    Background GBV-C infection is associated with prolonged survival in HIV-infected people and GBV-C inhibits HIV replication in co-infection models. Expression of the GBV-C nonstructural phosphoprotein 5A (NS5A) decreases surface levels of the HIV co-receptor CXCR4, induces the release of SDF-1 and inhibits HIV replication in Jurkat CD4+ T cell lines. Methodology/Principal Findings Jurkat cell lines stably expressing NS5A protein and peptides were generated and HIV replication in these cell lines assessed. HIV replication was significantly inhibited in all cell lines expressing NS5A amino acids 152–165. Substitution of an either alanine or glycine for the serine at position 158 (S158A or S158G) resulted in a significant decrease in the HIV inhibitory effect. In contrast, substituting a phosphomimetic amino acid (glutamic acid; S158E) inhibited HIV as well as the parent peptide. HIV inhibition was associated with lower levels of surface expression of the HIV co-receptor CXCR4 and increased release of the CXCR4 ligand, SDF-1 compared to control cells. Incubation of CD4+ T cell lines with synthetic peptides containing amino acids 152–167 or the S158E mutant peptide prior to HIV infection resulted in HIV replication inhibition compared to control peptides. Conclusions/Significance Expression of GBV-C NS5A amino acids 152–165 are sufficient to inhibit HIV replication in vitro, and the serine at position 158 appears important for this effect through either phosphorylation or structural changes in this peptide. The addition of synthetic peptides containing 152–167 or the S158E substitution to Jurkat cells resulted in HIV replication inhibition in vitro. These data suggest that GBV-C peptides or a peptide mimetic may offer a novel, cellular-based approach to antiretroviral therapy. PMID:18596910

  19. Differential Expression of Secreted Phosphoprotein 1 in the Motor Cortex among Primate Species and during Postnatal Development and Functional Recovery

    PubMed Central

    Yamamoto, Tatsuya; Oishi, Takao; Higo, Noriyuki; Murayama, Shigeo; Sato, Akira; Takashima, Ichiro; Sugiyama, Yoko; Nishimura, Yukio; Murata, Yumi; Yoshino-Saito, Kimika; Isa, Tadashi; Kojima, Toshio

    2013-01-01

    We previously reported that secreted phosphoprotein 1 (SPP1) mRNA is expressed in neurons whose axons form the corticospinal tract (CST) of the rhesus macaque, but not in the corresponding neurons of the marmoset and rat. This suggests that SPP1 expression is involved in the functional or structural specialization of highly developed corticospinal systems in certain primate species. To further examine this hypothesis, we evaluated the expression of SPP1 mRNA in the motor cortex from three viewpoints: species differences, postnatal development, and functional/structural changes of the CST after a lesion of the lateral CST (l-CST) at the mid-cervical level. The density of SPP1-positive neurons in layer V of the primary motor cortex (M1) was much greater in species with highly developed corticospinal systems (i.e., rhesus macaque, capuchin monkey, and humans) than in those with less developed corticospinal systems (i.e., squirrel monkey, marmoset, and rat). SPP1-positive neurons in the macaque monkey M1 increased logarithmically in layer V during postnatal development, following a time course consistent with the increase in conduction velocity of the CST. After an l-CST lesion, SPP1-positive neurons increased in layer V of the ventral premotor cortex, in which compensatory changes in CST function/structure may occur, which positively correlated with the extent of finger dexterity recovery. These results further support the concept that the expression of SPP1 may reflect functional or structural specialization of highly developed corticospinal systems in certain primate species. PMID:23741508

  20. The impact of transcriptional tuning on in vitro integrated rRNA transcription and ribosome construction

    PubMed Central

    Fritz, Brian R.; Jewett, Michael C.

    2014-01-01

    In vitro ribosome construction could enable studies of ribosome assembly and function, provide a route toward constructing minimal cells for synthetic biology, and permit the construction of ribosome variants with new functions. Toward these long-term goals, we recently reported on an integrated, one-pot ribosomal RNA synthesis (rRNA), ribosome assembly, and translation technology (termed iSAT) for the construction of Escherichia coli ribosomes in crude ribosome-free S150 extracts. Here, we aimed to improve the activity of iSAT through transcriptional tuning. Specifically, we increased transcriptional efficiency through 3′ modifications to the rRNA gene sequences, optimized plasmid and polymerase concentrations, and demonstrated the use of a T7-promoted rRNA operon for stoichiometrically balanced rRNA synthesis and native rRNA processing. Our modifications produced a 45-fold improvement in iSAT protein synthesis activity, enabling synthesis of 429 ± 15 nmol/l green fluorescent protein in 6 h batch reactions. Further, we show that the translational activity of ribosomes purified from iSAT reactions is about 20% the activity of native ribosomes purified directly from E. coli cells. Looking forward, we believe iSAT will enable unique studies to unravel the systems biology of ribosome biogenesis and open the way to new methods for making and studying ribosomal variants. PMID:24792158

  1. Ribosomal Oxygenases are Structurally Conserved from Prokaryotes to Humans

    PubMed Central

    Chowdhury, Rasheduzzaman; Krojer, Tobias; Ho, Chia-hua; Ng, Stanley S.; Clifton, Ian J.; Ge, Wei; Kershaw, Nadia J.; Fox, Gavin C.; Muniz, Joao R. C.; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S.; Kavanagh, Kathryn L.; von Delft, Frank; Oppermann, Udo; McDonough, Michael A.; Doherty, Aiden J.; Schofield, Christopher J.

    2014-01-01

    2-Oxoglutarate (2OG)-dependent oxygenases play important roles in the regulation of gene expression via demethylation of N-methylated chromatin components1,2, hydroxylation of transcription factors3, and of splicing factor proteins4. Recently, 2OG-oxygenases that catalyze hydroxylation of tRNA5-7 and ribosomal proteins8, have been shown to play roles in translation relating to cellular growth, TH17-cell differentiation and translational accuracy9-12. The finding that the ribosomal oxygenases (ROX) occur in organisms ranging from prokaryotes to humans8 raises questions as to their structural and evolutionary relationships. In Escherichia coli, ycfD catalyzes arginine-hydroxylation in the ribosomal protein L16; in humans, Mina53 (MYC-induced nuclear antigen) and NO66 (Nucleolar protein 66) catalyze histidine-hydroxylation in ribosomal proteins rpL27a and rpL8, respectively. The functional assignments of the ROX open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in residue- and protein-selectivities of prokaryotic and eukaryotic ROX, crystal structures of ycfD and ycfDRM from E. coli and Rhodothermus marinus with those of human Mina53 and NO66 (hROX) reveal highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-oxygenases. ROX structures in complex with/without their substrates, support their functional assignments as hydroxylases, but not demethylases and reveal how the subfamily has evolved to catalyze the hydroxylation of different residue sidechains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-hydroxylases including the hypoxia-inducible factor asparaginyl-hydroxylase (FIH) and histone Nε-methyl lysine demethylases (KDMs) identifies branchpoints in 2OG-oxygenase evolution and distinguishes between JmjC-hydroxylases and -demethylases catalyzing modifications of translational and transcriptional machinery. The

  2. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    PubMed

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  3. Single-Molecule Study of Ribosome Hierarchic Dynamics at the Peptidyl Transferase Center

    PubMed Central

    Altuntop, Mediha Esra; Ly, Cindy Tu; Wang, Yuhong

    2010-01-01

    During protein biosynthesis the ribosome moves along mRNA in steps of precisely three nucleotides. The mechanism for this ribosome motion remains elusive. Using a classification algorithm to sort single-molecule fluorescence resonance energy transfer data into subpopulations, we found that the ribosome dynamics detected at the peptidyl transferase center are highly inhomogeneous. The pretranslocation complex has at least four subpopulations that sample two hybrid states, whereas the posttranslocation complex is mainly static. We observed transitions among the ribosome subpopulations under various conditions, including 1), in the presence of EF-G; 2), spontaneously; 3), in different buffers, and 4), bound to antibiotics. Therefore, these subpopulations represent biologically active ribosomes. One key observation indicates that the Hy2 hybrid state only exists in a fluctuating ribosome subpopulation, which prompts us to propose that ribosome dynamics are hierarchically arranged. This proposal may have important implications for the regulation of cellular translation rates. PMID:21044598

  4. Interplay between trigger factor and other protein biogenesis factors on the ribosome

    NASA Astrophysics Data System (ADS)

    Bornemann, Thomas; Holtkamp, Wolf; Wintermeyer, Wolfgang

    2014-06-01

    Nascent proteins emerging from translating ribosomes in bacteria are screened by a number of ribosome-associated protein biogenesis factors, among them the chaperone trigger factor (TF), the signal recognition particle (SRP) that targets ribosomes synthesizing membrane proteins to the membrane and the modifying enzymes, peptide deformylase (PDF) and methionine aminopeptidase (MAP). Here, we examine the interplay between these factors both kinetically and at equilibrium. TF rapidly scans the ribosomes until it is stabilized on ribosomes presenting TF-specific nascent chains. SRP binding to those complexes is strongly impaired. Thus, TF in effect prevents SRP binding to the majority of ribosomes, except those presenting SRP-specific signal sequences, explaining how the small amount of SRP in the cell can be effective in membrane targeting. PDF and MAP do not interfere with TF or SRP binding to translating ribosomes, indicating that nascent-chain processing can take place before or in parallel with TF or SRP binding.

  5. Structure of Vibrio cholerae ribosome hibernation promoting factor

    PubMed Central

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding. PMID:23519794

  6. Structure of the large ribosomal subunit from human mitochondria

    PubMed Central

    Bai, Xiao-chen; Sugimoto, Yoichiro; Edwards, Patricia C.; Murshudov, Garib; Scheres, Sjors H. W.; Ramakrishnan, V.

    2014-01-01

    Human mitochondrial ribosomes are highly divergent from all other known ribosomes and are specialized to exclusively translate membrane proteins. They are linked with hereditary mitochondrial diseases, and are often the unintended targets of various clinically useful antibiotics. Using single-particle electron cryo-microscopy we have determined the structure of its large subunit to 3.4 angstrom resolution, revealing 48 proteins, 21 of which are specific to mitochondria. The structure unveils an adaptation of the exit tunnel for hydrophobic nascent peptides, extensive remodeling of the central protuberance including recruitment of mitochondrial tRNAVal to play an integral structural role, and changes in the tRNA binding sites related to the unusual characteristics of mitochondrial tRNAs. PMID:25278503

  7. Size matters: a view of selenocysteine incorporation from the ribosome.

    PubMed

    Caban, K; Copeland, P R

    2006-01-01

    This review focuses on the known factors required for selenocysteine (Sec) incorporation in eukaryotes and highlights recent findings that have compelled us to propose a new model for the mechanism of Sec incorporation. In light of this data we also review the controversial aspects of the previous model specifically regarding the proposed interaction between SBP2 and eEFSec. In addition, the relevance of two recently discovered factors in the recoding of Sec are reviewed. The role of the ribosome in this process is emphasized along with a detailed analysis of kinkturn structures present in the ribosome and the L7Ae RNA-binding motif present in SBP2 and other proteins. PMID:16416259

  8. Evaluation of phylogenetic relationships in Lemnaceae using nuclear ribosomal data.

    PubMed

    Tippery, N P; Les, D H; Crawford, D J

    2015-01-01

    Nuclear DNA sequence data are essential for obtaining a complete understanding of plant species relationships, yet these data have been conspicuously absent from phylogenetic analyses of Lemnaceae (duckweeds). Using a modified Sanger sequencing protocol, we obtained DNA sequences of duckweed nuclear ribosomal regions, including 18S and 26S rDNA genes, the external transcribed spacer (ETS) and the frequently used internal transcribed spacer (ITS). After obtaining sequence data for all Lemnaceae species, we ascertained that prior difficulty in sequencing the ITS regions likely resulted from extremely rigid secondary structures, precipitated by a high proportion of G/C nucleotides. In phylogenetic analyses, nuclear ribosomal data largely supported relationships that had been inferred using chloroplast DNA sequence data. PMID:24942778

  9. Ribosomal Slowdown Mediates Translational Arrest during Cellular Division▿

    PubMed Central

    Sivan, Gilad; Kedersha, Nancy; Elroy-Stein, Orna

    2007-01-01

    Global mRNA translation is transiently inhibited during cellular division. We demonstrate that mitotic cells contain heavy polysomes, but these are significantly less translationally active than polysomes in cycling cells. Several observations indicate that mitotic translational attenuation occurs during the elongation stage: (i) in cycling nonsynchronized cultures, only mitotic cells fail to assemble stress granules when treated with agents that inhibit translational initiation; (ii) mitotic cells contain fewer free 80S complexes, which are less sensitive to high salt disassembly; (iii) mitotic polysomes are more resistant to enforced disassembly using puromycin; and (iv) ribosome transit time increases during mitosis. Elongation slowdown guarantees that polysomes are retained even if initiation is inhibited at the same time. Stalling translating ribosomes during mitosis may protect mRNAs and allow rapid resumption of translation immediately upon entry into the G1 phase. PMID:17664278

  10. Effect of ribosome shielding on mRNA stability

    NASA Astrophysics Data System (ADS)

    Deneke, Carlus; Lipowsky, Reinhard; Valleriani, Angelo

    2013-08-01

    Based on the experimental evidence that translating ribosomes stabilize the mRNAs, we introduce and study a theoretical model for the dynamic shielding of mRNA by ribosomes. We present an improved fitting of published decay assay data in E. coli and show that only one third of the decay patterns are exponential. Our new transcriptome-wide estimate of the average lifetimes and mRNA half-lives shows that these timescales are considerably shorter than previous estimates. We also explain why there is a negative correlation between mRNA length and average lifetime when the mRNAs are subdivided in classes sharing the same degradation parameters. As a by-product, our model indicates that co-transcriptional translation in E. coli may be less common than previously believed.

  11. Structural Basis for Translation Termination on the 70S Ribosome

    SciTech Connect

    Laurberg, M.; Asahara, H.; Korostelev, A.; Zhu, J.; Trakhanov, S.; Noller, H.F.

    2009-05-20

    At termination of protein synthesis, type I release factors promote hydrolysis of the peptidyl-transfer RNA linkage in response to recognition of a stop codon. Here we describe the crystal structure of the Thermus thermophilus 70S ribosome in complex with the release factor RF1, tRNA and a messenger RNA containing a UAA stop codon, at 3.2 {angstrom} resolution. The stop codon is recognized in a pocket formed by conserved elements of RF1, including its PxT recognition motif, and 16S ribosomal RNA. The codon and the 30S subunit A site undergo an induced fit that results in stabilization of a conformation of RF1 that promotes its interaction with the peptidyl transferase centre. Unexpectedly, the main-chain amide group of Gln 230 in the universally conserved GGQ motif of the factor is positioned to contribute directly to peptidyl-tRNA hydrolysis.

  12. A streamlined ribosome profiling protocol for the characterization of microorganisms.

    PubMed

    Latif, Haythem; Szubin, Richard; Tan, Justin; Brunk, Elizabeth; Lechner, Anna; Zengler, Karsten; Palsson, Bernhard O

    2015-06-01

    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps, in particular size-selection steps during library construction. Furthermore, the abundance of rRNAs and tRNAs in the final library is drastically reduced. Our streamlined workflow enables greater throughput, cuts the time from harvest to the final library in half (down to 3-4 days), and generates a high fraction of informative reads, all while retaining the high quality standards of the existing protocol. PMID:26054770

  13. Ribosome Patterns in Escherichia coli Growing at Various Rates

    PubMed Central

    Varricchio, Frederick; Monier, Roger

    1971-01-01

    The distribution of ribosomes, 30 and 50S subunits and polysomes, at three different growth rates of Escherichia coli strains B and K-12 has been studied. The usual percentage of subunits is about 20%. However, at the lowest growth rate (μ = generations/hour), μ = 0.45 at 30C, the proportion of subunits is about 30%. An exceptional situation exists in K-12 strains growing at maximum growth rate, μ = 1.35, where the percentage of subunits is 45%. Several points of control over ribosome production are thus indicated. It is suggested that “subunit pool” is essentially a reserve. Furthermore, the polysome content when related to deoxyribonucleic acid content varies directly with the growth rate, which indicates the average efficiency of polysomes in protein synthesis does not vary over the range of growth rates tested. PMID:5001192

  14. Hierarchical RNA Processing Is Required for Mitochondrial Ribosome Assembly.

    PubMed

    Rackham, Oliver; Busch, Jakob D; Matic, Stanka; Siira, Stefan J; Kuznetsova, Irina; Atanassov, Ilian; Ermer, Judith A; Shearwood, Anne-Marie J; Richman, Tara R; Stewart, James B; Mourier, Arnaud; Milenkovic, Dusanka; Larsson, Nils-Göran; Filipovska, Aleksandra

    2016-08-16

    The regulation of mitochondrial RNA processing and its importance for ribosome biogenesis and energy metabolism are not clear. We generated conditional knockout mice of the endoribonuclease component of the RNase P complex, MRPP3, and report that it is essential for life and that heart and skeletal-muscle-specific knockout leads to severe cardiomyopathy, indicating that its activity is non-redundant. Transcriptome-wide parallel analyses of RNA ends (PARE) and RNA-seq enabled us to identify that in vivo 5' tRNA cleavage precedes 3' tRNA processing, and this is required for the correct biogenesis of the mitochondrial ribosomal subunits. We identify that mitoribosomal biogenesis proceeds co-transcriptionally because large mitoribosomal proteins can form a subcomplex on an unprocessed RNA containing the 16S rRNA. Taken together, our data show that RNA processing links transcription to translation via assembly of the mitoribosome. PMID:27498866

  15. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  16. Kinetoplast DNA-encoded ribosomal protein S12

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A; Aphasizhev, Ruslan

    2013-01-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, which are encoded by the kinetoplast genome, and more than 150 proteins encoded in the nucleus and imported from the cytoplasm. However, a single ribosomal protein RPS12 is encoded by the kinetoplast DNA (kDNA) in all trypanosomatid species examined. As typical for these organisms, the gene itself is cryptic and its transcript undergoes an extensive U-insertion/deletion editing. An evolutionary trend to reduce or eliminate RNA editing could be traced with other cryptogenes, but the invariably pan-edited RPS12 cryptogene is apparently spared. Here we inquired whether editing of RPS12 mRNA is essential for mitochondrial translation. By RNAi-mediated knockdowns of RNA editing complexes and inducible knock-in of a key editing enzyme in procyclic parasites, we could reversibly downregulate production of edited RPS12 mRNA and, by inference, synthesis of this protein. While inhibition of editing decreased edited mRNA levels, the translation of edited (Cyb) and unedited (COI) mRNAs was blocked. Furthermore, the population of SSU-related 45S complexes declined upon inactivation of editing and so did the amount of mRNA-bound ribosomes. In bloodstream parasites, which lack active electron transport chain but still require translation of ATP synthase subunit 6 mRNA (A6), both edited RPS12 and A6 mRNAs were detected in translation complexes. Collectively, our results indicate that a single ribosomal protein gene retained by the kinetoplast mitochondrion serves as a possible functional link between editing and translation processes and provide the rationale for the evolutionary conservation of RPS12 pan-editing. PMID:24270388

  17. Ribosome biogenesis in replicating cells: Integration of experiment and theory.

    PubMed

    Earnest, Tyler M; Cole, John A; Peterson, Joseph R; Hallock, Michael J; Kuhlman, Thomas E; Luthey-Schulten, Zaida

    2016-10-01

    Ribosomes-the primary macromolecular machines responsible for translating the genetic code into proteins-are complexes of precisely folded RNA and proteins. The ways in which their production and assembly are managed by the living cell is of deep biological importance. Here we extend a recent spatially resolved whole-cell model of ribosome biogenesis in a fixed volume [Earnest et al., Biophys J 2015, 109, 1117-1135] to include the effects of growth, DNA replication, and cell division. All biological processes are described in terms of reaction-diffusion master equations and solved stochastically using the Lattice Microbes simulation software. In order to determine the replication parameters, we construct and analyze a series of Escherichia coli strains with fluorescently labeled genes distributed evenly throughout their chromosomes. By measuring these cells' lengths and number of gene copies at the single-cell level, we could fit a statistical model of the initiation and duration of chromosome replication. We found that for our slow-growing (120 min doubling time) E. coli cells, replication was initiated 42 min into the cell cycle and completed after an additional 42 min. While simulations of the biogenesis model produce the correct ribosome and mRNA counts over the cell cycle, the kinetic parameters for transcription and degradation are lower than anticipated from a recent analytical time dependent model of in vivo mRNA production. Describing expression in terms of a simple chemical master equation, we show that the discrepancies are due to the lack of nonribosomal genes in the extended biogenesis model which effects the competition of mRNA for ribosome binding, and suggest corrections to parameters to be used in the whole-cell model when modeling expression of the entire transcriptome. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 735-751, 2016. PMID:27294303

  18. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes.

    PubMed

    van der Sluis, Eli O; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M; Beckmann, Roland

    2015-05-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  19. Structural Insights into tRNA Dynamics on the Ribosome

    PubMed Central

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  20. Structural Insights into tRNA Dynamics on the Ribosome.

    PubMed

    Agirrezabala, Xabier; Valle, Mikel

    2015-01-01

    High-resolution structures at different stages, as well as biochemical, single molecule and computational approaches have highlighted the elasticity of tRNA molecules when bound to the ribosome. It is well acknowledged that the inherent structural flexibility of the tRNA lies at the heart of the protein synthesis process. Here, we review the recent advances and describe considerations that the conformational changes of the tRNA molecules offer about the mechanisms grounded in translation. PMID:25941930

  1. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes

    PubMed Central

    van der Sluis, Eli O.; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M.; Beckmann, Roland

    2015-01-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  2. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Caers, A; De Rijk, P; De Wachter, R

    1998-01-01

    About 8600 complete or nearly complete sequences are now available from the Antwerp database on small ribosomal subunit RNA. All these sequences are aligned with one another on the basis of the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Literature references, accession numbers and detailed taxonomic information are also compiled. The database can be consulted via the World Wide Web at URL http://rrna.uia.ac.be/ssu/ PMID:9399829

  3. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; De Wachter, R

    1996-01-01

    Our database on large ribosomal subunit RNA contained 334 sequences in July, 1995. All sequences in the database are aligned, taking into account secondary structure. The aligned sequences are provided, together with incorporated secondary structure information, in several computer-readable formats. These data can easily be obtained through the World Wide Web. The files in the database are also available via anonymous ftp. PMID:8594610

  4. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Caers, A; Van de Peer, Y; De Wachter, R

    1998-01-01

    The rRNA WWW Server at URL http://rrna.uia.ac.be/ now provides a database of 496 large subunit ribosomal RNA sequences. All these sequences are aligned, incorporate secondary structure information, and can be obtained in a number of formats. Other information about the sequences, such as literature references, accession numbers and taxonomic information is also available and searchable. If necessary, the data on the server can also be obtained by anonymous ftp. PMID:9399830

  5. Analysis of the interactome of ribosomal protein S19 mutants.

    PubMed

    Caterino, Marianna; Aspesi, Anna; Pavesi, Elisa; Imperlini, Esther; Pagnozzi, Daniela; Ingenito, Laura; Santoro, Claudio; Dianzani, Irma; Ruoppolo, Margherita

    2014-10-01

    Diamond-Blackfan anemia, characterized by defective erythroid progenitor maturation, is caused in one-fourth of cases by mutations of ribosomal protein S19 (RPS19), which is a component of the ribosomal 40S subunit. Our previous work described proteins interacting with RPS19 with the aim to determine its functions. Here, two RPS19 mutants, R62W and R101H, have been selected to compare their interactomes versus the wild-type protein one, using the same functional proteomic approach that we employed to characterize RPS19 interactome. Mutations R62W and R101H impair RPS19 ability to associate with the ribosome. Results presented in this paper highlight the striking differences between the interactomes of wild-type and mutant RPS19 proteins. In particular, mutations abolish interactions with proteins having splicing, translational and helicase activity, thus confirming the role of RPS19 in RNA processing/metabolism and translational control. The data have been deposited to the ProteomeXchange with identifier PXD000640 (http://proteomecentral.proteomexchange.org/dataset/PXD000640). PMID:25069755

  6. Positive modulation of RNA polymerase III transcription by ribosomal proteins

    SciTech Connect

    Dieci, Giorgio; Carpentieri, Andrea; Amoresano, Angela; Ottonello, Simone

    2009-02-06

    A yeast nuclear fraction of unknown composition, named TFIIIE, was reported previously to enhance transcription of tRNA and 5S rRNA genes in vitro. We show that TFIIIE activity co-purifies with a specific subset of ribosomal proteins (RPs) which, as revealed by chromatin immunoprecipitation analysis, generally interact with tRNA and 5S rRNA genes, but not with a Pol II-specific promoter. Only Rpl6Ap and Rpl6Bp, among the tested RPs, were found associated to a TATA-containing tRNA{sup Ile}(TAT) gene. The RPL6A gene also emerged as a strong multicopy suppressor of a conditional mutation in the basal transcription factor TFIIIC, while RPL26A and RPL14A behaved as weak suppressors. The data delineate a novel extra-ribosomal role for one or a few RPs which, by influencing 5S rRNA and tRNA synthesis, could play a key role in the coordinate regulation of the different sub-pathways required for ribosome biogenesis and functionality.

  7. Further characterization of ribosome binding to thylakoid membranes. [Pisum sativum

    SciTech Connect

    Hurewitz, J.; Jagendorf, A.T.

    1987-05-01

    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of (/sup 3/H)leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins.

  8. Eukaryotic rpL10 drives ribosomal rotation

    PubMed Central

    Sulima, Sergey O.; Gülay, Suna P.; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W.; Dinman, Jonathan D.

    2014-01-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a ‘test drive’ before final maturation. PMID:24214990

  9. Eukaryotic rpL10 drives ribosomal rotation.

    PubMed

    Sulima, Sergey O; Gülay, Suna P; Anjos, Margarida; Patchett, Stephanie; Meskauskas, Arturas; Johnson, Arlen W; Dinman, Jonathan D

    2014-02-01

    Ribosomes transit between two conformational states, non-rotated and rotated, through the elongation cycle. Here, we present evidence that an internal loop in the essential yeast ribosomal protein rpL10 is a central controller of this process. Mutations in this loop promote opposing effects on the natural equilibrium between these two extreme conformational states. rRNA chemical modification analyses reveals allosteric interactions involved in coordinating intersubunit rotation originating from rpL10 in the core of the large subunit (LSU) through both subunits, linking all the functional centers of the ribosome. Mutations promoting rotational disequilibria showed catalytic, biochemical and translational fidelity defects. An rpL3 mutation promoting opposing structural and biochemical effects, suppressed an rpL10 mutant, re-establishing rotational equilibrium. The rpL10 loop is also involved in Sdo1p recruitment, suggesting that rotational status is important for ensuring late-stage maturation of the LSU, supporting a model in which pre-60S subunits undergo a 'test drive' before final maturation. PMID:24214990

  10. PROTEOFORMER: deep proteome coverage through ribosome profiling and MS integration

    PubMed Central

    Crappé, Jeroen; Ndah, Elvis; Koch, Alexander; Steyaert, Sandra; Gawron, Daria; De Keulenaer, Sarah; De Meester, Ellen; De Meyer, Tim; Van Criekinge, Wim; Van Damme, Petra; Menschaert, Gerben

    2015-01-01

    An increasing amount of studies integrate mRNA sequencing data into MS-based proteomics to complement the translation product search space. However, several factors, including extensive regulation of mRNA translation and the need for three- or six-frame-translation, impede the use of mRNA-seq data for the construction of a protein sequence search database. With that in mind, we developed the PROTEOFORMER tool that automatically processes data of the recently developed ribosome profiling method (sequencing of ribosome-protected mRNA fragments), resulting in genome-wide visualization of ribosome occupancy. Our tool also includes a translation initiation site calling algorithm allowing the delineation of the open reading frames (ORFs) of all translation products. A complete protein synthesis-based sequence database can thus be compiled for mass spectrometry-based identification. This approach increases the overall protein identification rates with 3% and 11% (improved and new identifications) for human and mouse, respectively, and enables proteome-wide detection of 5′-extended proteoforms, upstream ORF translation and near-cognate translation start sites. The PROTEOFORMER tool is available as a stand-alone pipeline and has been implemented in the galaxy framework for ease of use. PMID:25510491

  11. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  12. Epigeneitc silencing of ribosomal RNA genes by Mybbp1a

    PubMed Central

    2012-01-01

    Background Transcription of the ribosomal RNA gene repeats by Pol I occurs in the nucleolus and is a fundamental step in ribosome biogenesis and protein translation. Due to tight coordination between ribosome biogenesis and cell proliferation, transcription of rRNA and stable maintenance of rDNA clusters are thought to be under intricate control by intercalated mechanisms, particularly at the epigenetic level. Methods and Results Here we identify the nucleolar protein Myb-binding protein 1a (Mybbp1a) as a novel negative regulator of rRNA expression. Suppression of rDNA transcription by Mybbp1a was linked to promoter regulation as illustrated by its binding to the chromatin around the hypermethylated, inactive rDNA gene promoters. Our data further showed that downregulation of Mybbp1a abrogated the local DNA methylation levels and histone marks associated with gene silencing, and altered the promoter occupancy of various factors such UBF and HDACs, consequently leading to elevated rRNA expression. Mechanistically, we propose that Mybbp1a maintains rDNA repeats in a silenced state while in association with the negative epigenetic modifiers HDAC1/2. Conclusions Results from our present work reveal a previously unrecognized co-repressor role of Mybbp1a in rRNA expression. They are further consistent with the scenario that Mybbp1a is an integral constituent of the rDNA epigenetic regulation that underlies the balanced state of rDNA clusters. PMID:22686419

  13. Simulation and analysis of single-ribosome translation

    NASA Astrophysics Data System (ADS)

    Tinoco, Ignacio Jr; Wen, Jin-Der

    2009-06-01

    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation.

  14. tRNA dynamics on the ribosome during translation

    PubMed Central

    Blanchard, Scott C.; Kim, Harold D.; Gonzalez, Ruben L.; Puglisi, Joseph D.; Chu, Steven

    2004-01-01

    Using single-molecule fluorescence spectroscopy, time-resolved conformational changes between fluorescently labeled tRNA have been characterized within surface-immobilized ribosomes proceeding through a complete cycle of translation elongation. Fluorescence resonance energy transfer was used to observe aminoacyl-tRNA (aa-tRNA) stably accommodating into the aminoacyl site (A site) of the ribosome via a multistep, elongation factor-Tu dependent process. Subsequently, tRNA molecules, bound at the peptidyl site and A site, fluctuate between two configurations assigned as classical and hybrid states. The lifetime of classical and hybrid states, measured for complexes carrying aa-tRNA and peptidyl-tRNA at the A site, shows that peptide bond formation decreases the lifetime of the classical-state tRNA configuration by ≈6-fold. These data suggest that the growing peptide chain plays a role in modulating fluctuations between hybrid and classical states. Single-molecule fluorescence resonance energy transfer was also used to observe aa-tRNA accommodation coupled with elongation factor G-mediated translocation. Dynamic rearrangements in tRNA configuration are also observed subsequent to the translocation reaction. This work underscores the importance of dynamics in ribosome function and demonstrates single-particle enzymology in a system of more than two components. PMID:15317937

  15. Trajectories of the ribosome as a Brownian nanomachine

    PubMed Central

    Dashti, Ali; Schwander, Peter; Langlois, Robert; Fung, Russell; Li, Wen; Hosseinizadeh, Ahmad; Liao, Hstau Y.; Pallesen, Jesper; Sharma, Gyanesh; Stupina, Vera A.; Simon, Anne E.; Dinman, Jonathan D.; Frank, Joachim; Ourmazd, Abbas

    2014-01-01

    A Brownian machine, a tiny device buffeted by the random motions of molecules in the environment, is capable of exploiting these thermal motions for many of the conformational changes in its work cycle. Such machines are now thought to be ubiquitous, with the ribosome, a molecular machine responsible for protein synthesis, increasingly regarded as prototypical. Here we present a new analytical approach capable of determining the free-energy landscape and the continuous trajectories of molecular machines from a large number of snapshots obtained by cryogenic electron microscopy. We demonstrate this approach in the context of experimental cryogenic electron microscope images of a large ensemble of nontranslating ribosomes purified from yeast cells. The free-energy landscape is seen to contain a closed path of low energy, along which the ribosome exhibits conformational changes known to be associated with the elongation cycle. Our approach allows model-free quantitative analysis of the degrees of freedom and the energy landscape underlying continuous conformational changes in nanomachines, including those important for biological function. PMID:25422471

  16. A new version of the RDP (Ribosomal Database Project)

    NASA Technical Reports Server (NTRS)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; Pramanik, S.; Schmidt, T. M.; Tiedje, J. M.; Woese, C. R.

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  17. Detecting actively translated open reading frames in ribosome profiling data.

    PubMed

    Calviello, Lorenzo; Mukherjee, Neelanjan; Wyler, Emanuel; Zauber, Henrik; Hirsekorn, Antje; Selbach, Matthias; Landthaler, Markus; Obermayer, Benedikt; Ohler, Uwe

    2016-02-01

    RNA-sequencing protocols can quantify gene expression regulation from transcription to protein synthesis. Ribosome profiling (Ribo-seq) maps the positions of translating ribosomes over the entire transcriptome. We have developed RiboTaper (available at https://ohlerlab.mdc-berlin.de/software/), a rigorous statistical approach that identifies translated regions on the basis of the characteristic three-nucleotide periodicity of Ribo-seq data. We used RiboTaper with deep Ribo-seq data from HEK293 cells to derive an extensive map of translation that covered open reading frame (ORF) annotations for more than 11,000 protein-coding genes. We also found distinct ribosomal signatures for several hundred upstream ORFs and ORFs in annotated noncoding genes (ncORFs). Mass spectrometry data confirmed that RiboTaper achieved excellent coverage of the cellular proteome. Although dozens of novel peptide products were validated in this manner, few of the currently annotated long noncoding RNAs appeared to encode stable polypeptides. RiboTaper is a powerful method for comprehensive de novo identification of actively used ORFs from Ribo-seq data. PMID:26657557

  18. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors.

    PubMed

    Ohmayer, Uli; Gil-Hernández, Álvaro; Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  19. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  20. The N-terminal extension of Escherichia coli ribosomal protein L20 is important for ribosome assembly, but dispensable for translational feedback control

    PubMed Central

    GUILLIER, MAUDE; ALLEMAND, FRÉDÉRIC; GRAFFE, MONIQUE; RAIBAUD, SOPHIE; DARDEL, FRÉDÉRIC; SPRINGER, MATHIAS; CHIARUTTINI, CLAUDE

    2005-01-01

    The Escherichia coli autoregulatory ribosomal protein L20 consists of two structurally distinct domains. The C-terminal domain is globular and sits on the surface of the large ribosomal subunit whereas the N-terminal domain has an extended shape and penetrates deep into the RNA-rich core of the subunit. Many other ribosomal proteins have analogous internal or terminal extensions. However, the biological functions of these extended domains remain obscure. Here we show that the N-terminal tail of L20 is important for ribosome assembly in vivo. Indeed, a truncated version of L20 without its N-terminal tail is unable to complement the deletion of rplT, the gene encoding L20. In addition, this L20 truncation confers a lethal-dominant phenotype, suggesting that the N-terminal domain is essential for cell growth because it could be required for ribosome assembly. Supporting this hypothesis, partial deletions of the N-terminal tail of the protein are shown to cause a slow-growth phenotype due to altered ribosome assembly in vivo as large amounts of intermediate 40S ribosomal particles accumulate. In addition to being a ribosomal protein, L20 also acts as an autogenous repressor. Using L20 truncations, we also show that the N-terminal tail of L20 is dispensable for autogenous control. PMID:15840820

  1. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation.

    PubMed

    Lawrence, Marlon G; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M; Lindahl, Lasse

    2016-07-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the ONLY: sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlA(crb) pause peptide. PMID:27257065

  2. Yeast ribosomal protein L7 and its homologue Rlp7 are simultaneously present at distinct sites on pre-60S ribosomal particles

    PubMed Central

    Babiano, Reyes; Badis, Gwenael; Saveanu, Cosmin; Namane, Abdelkader; Doyen, Antonia; Díaz-Quintana, Antonio; Jacquier, Alain; Fromont-Racine, Micheline; de la Cruz, Jesús

    2013-01-01

    Ribosome biogenesis requires >300 assembly factors in Saccharomyces cerevisiae. Ribosome assembly factors Imp3, Mrt4, Rlp7 and Rlp24 have sequence similarity to ribosomal proteins S9, P0, L7 and L24, suggesting that these pre-ribosomal factors could be placeholders that prevent premature assembly of the corresponding ribosomal proteins to nascent ribosomes. However, we found L7 to be a highly specific component of Rlp7-associated complexes, revealing that the two proteins can bind simultaneously to pre-ribosomal particles. Cross-linking and cDNA analysis experiments showed that Rlp7 binds to the ITS2 region of 27S pre-rRNAs, at two sites, in helix III and in a region adjacent to the pre-rRNA processing sites C1 and E. However, L7 binds to mature 25S and 5S rRNAs and cross-linked predominantly to helix ES7Lb within 25S rRNA. Thus, despite their predicted structural similarity, our data show that Rlp7 and L7 clearly bind at different positions on the same pre-60S particles. Our results also suggest that Rlp7 facilitates the formation of the hairpin structure of ITS2 during 60S ribosomal subunit maturation. PMID:23945946

  3. The extended loops of ribosomal proteins uL4 and uL22 of Escherichia coli contribute to ribosome assembly and protein translation

    PubMed Central

    Lawrence, Marlon G.; Shamsuzzaman, Md; Kondopaka, Maithri; Pascual, Clarence; Zengel, Janice M.; Lindahl, Lasse

    2016-01-01

    Nearly half of ribosomal proteins are composed of a domain on the ribosome surface and a loop or extension that penetrates into the organelle's RNA core. Our previous work showed that ribosomes lacking the loops of ribosomal proteins uL4 or uL22 are still capable of entering polysomes. However, in those experiments we could not address the formation of mutant ribosomes, because we used strains that also expressed wild-type uL4 and uL22. Here, we have focused on ribosome assembly and function in strains in which loop deletion mutant genes are the only sources of uL4 or uL22 protein. The uL4 and uL22 loop deletions have different effects, but both mutations result in accumulation of immature particles that do not accumulate in detectable amounts in wild-type strains. Thus, our results suggest that deleting the loops creates kinetic barriers in the normal assembly pathway, possibly resulting in assembly via alternate pathway(s). Furthermore, deletion of the uL4 loop results in cold-sensitive ribosome assembly and function. Finally, ribosomes carrying either of the loop-deleted proteins responded normally to the secM translation pausing peptide, but the uL4 mutant responded very inefficiently to the cmlAcrb pause peptide. PMID:27257065

  4. Highly efficient ribosome display selection by use of purified components for in vitro translation.

    PubMed

    Villemagne, Denis; Jackson, Ronald; Douthwaite, Julie A

    2006-06-30

    Ribosome display is a powerful in vitro technology for the selection and directed evolution of proteins. The ribosome display process exploits cell-free translation to achieve coupling of phenotype and genotype by the production of stabilised ribosome complexes in which translated proteins and their encoding mRNA remain attached to the ribosome. Current ribosome display systems that are well proven, by the evolution of high affinity antibodies and the optimisation of defined protein characteristics, use an Escherichia coli cell extract for in vitro translation and display of an mRNA library. Recently, a cell-free translation system has been produced by combining recombinant E. coli protein factors with purified 70S ribosomes. We have applied this development in cell-free translation technology to ribosome display by using the reconstituted system to generate stabilised ribosome complexes for selection. We show that higher cDNA yields are recovered from ribosome display selections when using a reconstituted translation system and the degree of improvement seen is selection specific. These effects are likely to reflect higher mRNA and protein stability and potentially other advantages that may include protein specific improvements in expression. Reconstituted translation systems therefore enable a highly efficient, robust and accessible prokaryotic ribosome display technology. PMID:16730021

  5. PIM1 destabilization activates a p53-dependent response to ribosomal stress in cancer cells.

    PubMed

    Sagar, Vinay; Caldarola, Sara; Aria, Valentina; Monteleone, Valentina; Fuoco, Claudia; Gargioli, Cesare; Cannata, Stefano; Loreni, Fabrizio

    2016-04-26

    Defects in ribosome biogenesis triggers a stress response (ribosomal stress) that can lead to growth arrest and apoptosis. Signaling pathways activated by ribosomal stress are specifically involved in the pathological mechanism of a group of disorders defined as ribosomopathies. However, more generally, the quality control of ribosome synthesis is part of the regulatory circuits that control cell metabolism. A number of studies identified tumor suppressor p53 as a central player in ribosomal stress. We have previously reported that the kinase PIM1 plays a role as a sensor for ribosome deficiency. In this report we address the relationship between PIM1 and p53 in cancer cell lines after depletion of a ribosomal protein. We identified a novel signaling pathway that includes the kinase AKT and the ubiquitin ligase MDM2. In fact, our results indicate that the lower level of PIM1, induced by ribosomal stress, causes inactivation of AKT, inhibition of MDM2 and a consequent p53 stabilization. Therefore, we propose that activation of p53 in response to ribosomal stress, is dependent on the pathway PIM1-AKT-MDM2. In addition, we report evidence that PIM1 level may be relevant to assess the sensitivity of cancer cells to chemotherapeutic drugs that induce ribosomal stress. PMID:26993775

  6. Distinct functions of elongation factor G in ribosome recycling and translocation

    PubMed Central

    Savelsbergh, Andreas; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2009-01-01

    Elongation factor G (EF-G) promotes the translocation step in bacterial protein synthesis and, together with ribosome recycling factor (RRF), the disassembly of the post-termination ribosome. Unlike translocation, ribosome disassembly strictly requires GTP hydrolysis by EF-G. Here we report that ribosome disassembly is strongly inhibited by vanadate, an analog of inorganic phosphate (Pi), indicating that Pi release is required for ribosome disassembly. In contrast, the function of EF-G in single-round translocation is not affected by vanadate, while the turnover reaction is strongly inhibited. We also show that the antibiotic fusidic acid blocks ribosome disassembly by EF-G/RRF at a 1000-fold lower concentration than required for the inhibition of EF-G turnover in vitro and close to the effective inhibitory concentration in vivo, suggesting that the antimicrobial activity of fusidic acid is primarily due to the direct inhibition of ribosome recycling. Our results indicate that conformational coupling between EF-G and the ribosome is principally different in translocation and ribosome disassembly. Pi release is not required for the mechanochemical function of EF-G in translocation, whereas the interactions between RRF and EF-G introduce tight coupling between the conformational change of EF-G induced by Pi release and ribosome disassembly. PMID:19324963

  7. Assembly and nuclear export of pre-ribosomal particles in budding yeast.

    PubMed

    Gerhardy, Stefan; Menet, Anna Maria; Peña, Cohue; Petkowski, Janusz Jurand; Panse, Vikram Govind

    2014-08-01

    The ribosome is responsible for the final step of decoding genetic information into proteins. Therefore, correct assembly of ribosomes is a fundamental task for all living cells. In eukaryotes, the construction of the ribosome which begins in the nucleolus requires coordinated efforts of >350 specialized factors that associate with pre-ribosomal particles at distinct stages to perform specific assembly steps. On their way through the nucleus, diverse energy-consuming enzymes are thought to release assembly factors from maturing pre-ribosomal particles after accomplishing their task(s). Subsequently, recruitment of export factors prepares pre-ribosomal particles for transport through nuclear pore complexes. Pre-ribosomes are exported into the cytoplasm in a functionally inactive state, where they undergo final maturation before initiating translation. Accumulating evidence indicates a tight coupling between nuclear export, cytoplasmic maturation, and final proofreading of the ribosome. In this review, we summarize our current understanding of nuclear export of pre-ribosomal subunits and cytoplasmic maturation steps that render pre-ribosomal subunits translation-competent. PMID:24817020

  8. Ribosomal proteins produced in excess are degraded by the ubiquitin-proteasome system.

    PubMed

    Sung, Min-Kyung; Reitsma, Justin M; Sweredoski, Michael J; Hess, Sonja; Deshaies, Raymond J

    2016-09-01

    Ribosome assembly is an essential process that consumes prodigious quantities of cellular resources. Ribosomal proteins cannot be overproduced in Saccharomyces cerevisiae because the excess proteins are rapidly degraded. However, the responsible quality control (QC) mechanisms remain poorly characterized. Here we demonstrate that overexpression of multiple proteins of the small and large yeast ribosomal subunits is suppressed. Rpl26 overexpressed from a plasmid can be detected in the nucleolus and nucleoplasm, but it largely fails to assemble into ribosomes and is rapidly degraded. However, if the endogenous RPL26 loci are deleted, plasmid-encoded Rpl26 assembles into ribosomes and localizes to the cytosol. Chemical and genetic perturbation studies indicate that overexpressed ribosomal proteins are degraded by the ubiquitin-proteasome system and not by autophagy. Inhibition of the proteasome led to accumulation of multiple endogenous ribosomal proteins in insoluble aggregates, consistent with the operation of this QC mechanism in the absence of ribosomal protein overexpression. Our studies reveal that ribosomal proteins that fail to assemble into ribosomes are rapidly distinguished from their assembled counterparts and ubiquitinated and degraded within the nuclear compartment. PMID:27385339

  9. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process

    SciTech Connect

    Khanna-Gupta, A.; Ware, V.C. )

    1989-03-01

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope.

  10. Preparation of ribosomes for smFRET studies: A simplified approach.

    PubMed

    Shebl, Bassem; Menke, Drew E; Pennella, Min; Poudyal, Raghav R; Burke, Donald H; Cornish, Peter V

    2016-08-01

    During the past decade, single-molecule studies of the ribosome have significantly advanced our understanding of protein synthesis. The broadest application of these methods has been towards the investigation of ribosome conformational dynamics using single-molecule Förster resonance energy transfer (smFRET). The recent advances in fluorescently labeled ribosomes and translation components have resulted in success of smFRET experiments. Various methods have been employed to target fluorescent dyes to specific locations within the ribosome. Primarily, these methods have involved additional steps including subunit dissociation and/or full reconstitution, which could result in ribosomes of reduced activity and translation efficiency. In addition, substantial time and effort are required to produce limited quantities of material. To enable rapid and large-scale production of highly active, fluorescently labeled ribosomes, we have developed a procedure that combines partial reconstitution with His-tag purification. This allows for a homogeneous single-step purification of mutant ribosomes and subsequent integration of labeled proteins. Ribosomes produced with this method are shown to be as active as ribosomes purified using classical methods. While we have focused on two labeling sites in this report, the method is generalizable and can in principle be extended to any non-essential ribosomal protein. PMID:27208427

  11. Ezrin-radixin-moesin-binding phosphoprotein-50 regulates EGF-induced AKT activation through interaction with EGFR and PTEN.

    PubMed

    Zheng, Junfang; Dai, Yuanping; Yang, Zhiyu; Yang, Longyan; Peng, Zhiqiang; Meng, Ran; Xiong, Ying; He, Junqi

    2016-01-01

    Dysregulated epidermal growth factor receptor (EGFR) signaling, especially EGFR/AKT signaling, plays important roles in tumorigenesis and progression, the study on intracellular regulation of this signaling pathway has great clinical significance. Phosphatase and tensin homolog deleted on chromosome ten (PTEN) is an important antagonist of AKT activity. Its regulation of AKT activity can be enhanced by ezrin-radixin-moesin-binding phosphoprotein-50 (EBP50)-mediated PTEN/EBP50/platelet-derived growth factor receptor (PDGFR) complex. EBP50 was reported to bind to EGFR, and that it may also mediate the formation of PTEN/EGFR complex to regulate EGFR/AKT signaling. In this study, experiments were performed to verify the hypothesis. Results showed that PTEN co-immunoprecipitated with EGFR, demonstrating PTEN/EGFR complex can form in tissue. Further studies showed that EBP50 knockdown decreased the amount of PTEN/EGFR complex by GST pull-down assay, and EBP50 overexpression increased the amount of PTEN/EGFR complex in a dose-dependent manner. While PTEN mutant (V403A), which can not bind with EBP50, only slightly mediated the formation of PTEN/EGFR complex, confirming that EBP50 specifically mediated the formation of the PTEN/EGFR complex. Both PTEN (V403A) and EGFR (L1043/1063F) mutants can not bind with EBP50. The expression of PTEN (V403A) or EGFR (L1043/1063F) mutant in cells resulted in higher AKT activation level than their respective wild-types by EGF stimulation, indicating that EBP50-mediated PTEN/EGFR complex can effectively inhibit EGF-induced AKT activation. EGF stimulation of siEBP50 cells induced higher AKT activation level compared with control cells, further confirming EBP50-mediated PTEN/EGFR complex can more effectively inhibit EGF-induced AKT activation. These results demonstrated the PTEN/EGFR complex formed under the mediation of EBP50, revealing a novel mechanism for negative regulation of EGF-induced AKT pathway, which may be an important molecular

  12. Cell cycle-dependent translocations of a major nucleolar phosphoprotein, B23, and some characteristics of its variants.

    PubMed

    Zatsepina, O V; Todorov, I T; Philipova, R N; Krachmarov, C P; Trendelenburg, M F; Jordan, E G

    1997-05-01

    A major nucleolar phosphoprotein, B23, is thought to play several apparently unrelated roles and appears to be associated with other cell compartments besides the nucleolus. However, characteristic properties of B23 variants still remain to be established. Here, we raised a new monoclonal antibody against B23 (20B2) and used it to address the issue particularly focusing on the events during mitosis. Also, we made an attempt to generalize the data on the cell cycle-dependent translocations of B23 by the use of three mammalian cell lines (HeLa, PK, RAMT) which were found to be immunoreactive for 20B2. In all the cell strains studied, B23 was chiefly located within the nucleolus at interphase, and was associated with a few cellular domains during mitosis. They were: the nucleoplasm (at prophase before the nuclear envelope breakdown), the cytoplasm (from prometaphase until mid telophase), the perichromosomal layer (from prometaphase till early telophase), cytoplasmic B23-containing bodies (at anaphase and telophase) and prenucleolar bodies, PNBs (at telophase). On Western blots, electrophoretic mobility of B23 was found to be the same at G1, S and G2 periods of interphase, but became slower at mitosis. In situ and cell extraction experiments showed that like the nucleolar B23, B23 of the perichromosomal layer and that of PNBs was highly resistant to extraction with Triton X-100, but could be released with Triton X-100/RNase A. These findings indicated that these portions of B23 were most likely to be associated with RNA. The cytoplasmic B23 was the major intracellular variant of B23 during mitosis. It had a slightly lower electrophoretic mobility than the perichromosomal B23 and could readily be extracted with Triton X-100 without addition of RNase A, a fact indicating that the cytoplasmic B23 was mainly in an RNA-free state. Mitosis-like translocations of B23 from the nucleolus to the nucleoplasm induced by actinomycin D increased its extractability but did not affect

  13. A systems toxicology approach identifies Lyn as a key signaling phosphoprotein modulated by mercury in a B lymphocyte cell model

    SciTech Connect

    Caruso, Joseph A.; Stemmer, Paul M.; Dombkowski, Alan; Caruthers, Nicholas J.; Gill, Randall; Rosenspire, Allen J.

    2014-04-01

    Network and protein–protein interaction analyses of proteins undergoing Hg{sup 2+}-induced phosphorylation and dephosphorylation in Hg{sup 2+}-intoxicated mouse WEHI-231 B cells identified Lyn as the most interconnected node. Lyn is a Src family protein tyrosine kinase known to be intimately involved in the B cell receptor (BCR) signaling pathway. Under normal signaling conditions the tyrosine kinase activity of Lyn is controlled by phosphorylation, primarily of two well known canonical regulatory tyrosine sites, Y-397 and Y-508. However, Lyn has several tyrosine residues that have not yet been determined to play a major role under normal signaling conditions, but are potentially important sites for phosphorylation following mercury exposure. In order to determine how Hg{sup 2+} exposure modulates the phosphorylation of additional residues in Lyn, a targeted MS assay was developed. Initial mass spectrometric surveys of purified Lyn identified 7 phosphorylated tyrosine residues. A quantitative assay was developed from these results using the multiple reaction monitoring (MRM) strategy. WEHI-231 cells were treated with Hg{sup 2+}, pervanadate (a phosphatase inhibitor), or anti-Ig antibody (to stimulate the BCR). Results from these studies showed that the phosphoproteomic profile of Lyn after exposure of the WEHI-231 cells to a low concentration of Hg{sup 2+} closely resembled that of anti-Ig antibody stimulation, whereas exposure to higher concentrations of Hg{sup 2+} led to increases in the phosphorylation of Y-193/Y-194, Y-501 and Y-508 residues. These data indicate that mercury can disrupt a key regulatory signal transduction pathway in B cells and point to phospho-Lyn as a potential biomarker for mercury exposure. - Highlights: • Inorganic mercury (Hg{sup 2+}) induces changes in the WEHI-231 B cell phosphoproteome. • The B cell receptor (BCR) signaling pathway was the pathway most affected by Hg{sup 2+}. • The Src family phosphoprotein kinase Lyn was the

  14. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  15. The 46/50 kDa phosphoprotein VASP purified from human platelets is a novel protein associated with actin filaments and focal contacts.

    PubMed Central

    Reinhard, M; Halbrügge, M; Scheer, U; Wiegand, C; Jockusch, B M; Walter, U

    1992-01-01

    Vasoactive agents which elevate either cGMP or cAMP inhibit platelet activation by pathways sharing at least one component, the 46/50 kDa vasodilator-stimulated phosphoprotein (VASP). VASP is stoichiometrically phosphorylated by both cGMP-dependent and cAMP-dependent protein kinases in intact human platelets, and its phosphorylation correlates very well with platelet inhibition caused by cGMP- and cAMP-elevating agents. Here we report that in human platelets spread on glass, VASP is associated predominantly with the distal parts of radial microfilament bundles and with microfilaments outlining the periphery, whereas less VASP is associated with a central microfilamentous ring. VASP is also detectable in a variety of different cell types including fibroblasts and epithelial cells. In fibroblasts, VASP is concentrated at focal contact areas, along microfilament bundles (stress fibres) in a punctate pattern, in the periphery of protruding lamellae, and is phosphorylated by cGMP- and cAMP-dependent protein kinases in response to appropriate stimuli. Evidence for the direct binding of VASP to F-actin is also presented. The data demonstrate that VASP is a novel phosphoprotein associated with actin filaments and focal contact areas, i.e. transmembrane junctions between microfilaments and the extracellular matrix. Images PMID:1318192

  16. A panel of monoclonal antibodies targeting the rabies virus phosphoprotein identifies a highly variable epitope of value for sensitive strain discrimination.

    PubMed

    Nadin-Davis, S A; Sheen, M; Abdel-Malik, M; Elmgren, L; Armstrong, J; Wandeler, A I

    2000-04-01

    A recombinant rabies virus phosphoprotein fusion product (GST-P) was used to generate a series of monoclonal antibodies (MAbs) with anti-P reactivity. Competitive binding assays classified 27 of these MAbs into four groups (I to IV), and 24 of them were deemed to recognize linear epitopes, as judged by their reaction in immunoblots. The linear epitope recognized in each case was mapped by using two series of N- and C-terminally deleted recombinant phosphoproteins. Assessment of the reactivities of representative MAbs to a variety of lyssavirus isolates by an indirect fluorescent antibody test indicated that group I MAbs, which recognized a highly conserved N-terminal epitope, were broadly cross-reactive with all lyssaviruses assayed, while group III MAbs, which reacted with a site overlapping that of group I MAbs, exhibited variable reactivities and group IV MAbs reacted with most isolates of genotypes 1, 6, and 7 only. In contrast, group II MAbs, which recognized an epitope located within a highly divergent central portion of the protein, were exquisitely strain specific. These anti-P MAbs are potentially useful tools for lyssavirus identification and discrimination. PMID:10747114

  17. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation

    PubMed Central

    Filbin, Megan E.; Vollmar, Breanna S.; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S.

    2012-01-01

    The hepatitis C virus (HCV) internal ribosome entry site (IRES) drives non-canonical initiation of protein synthesis necessary for viral replication. HCV IRES functional studies have focused on 80S ribosome formation, but have not explored roles after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit’s decoding groove and cause only a local perturbation in IRES structure result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, we find the mutation decreases IRES activity by inhibiting the first ribosome translocation event, and modeling suggests that this effect is through an interaction with a single ribosomal protein. The HCV IRES’ ability to manipulate the ribosome provides insight into how the ribosome’s structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  18. The fail-safe system to rescue the stalled ribosomes in Escherichia coli

    PubMed Central

    Abo, Tatsuhiko; Chadani, Yuhei

    2014-01-01

    Translation terminates at stop codon. Without stop codon, ribosome cannot terminate translation properly and reaches and stalls at the 3′-end of the mRNA lacking stop codon. Bacterial tmRNA-mediated trans-translation releases such stalled ribosome and targets the protein product to degradation by adding specific “degradation tag.” Recently two alternative ribosome rescue factors, ArfA (YhdL) and ArfB (YaeJ), have been found in Escherichia coli. These three ribosome rescue systems are different each other in terms of molecular mechanism of ribosome rescue and their activity, but they are mutually related and co-operate to maintain the translation system in shape. This suggests the biological significance of ribosome rescue. PMID:24782844

  19. A structural view on the mechanism of the ribosome-catalyzed peptide bond formation

    PubMed Central

    Simonović, Miljan; Steitz, Thomas A.

    2009-01-01

    The ribosome is a large ribonucleoprotein particle that translates zgenetic information encoded in mRNA into specific proteins. Its highly conserved active site, the peptidyl-transferase center (PTC), is located on the large (50S) ribosomal subunit and is comprised solely of rRNA, which makes the ribosome the only natural ribozyme with polymerase activity. The last decade witnessed a rapid accumulation of atomic-resolution structural data on both ribosomal subunits as well as on the entire ribosome. This has allowed studies on the mechanism of peptide bond formation at a level of detail that surpasses that for the classical protein enzymes. A current understanding of the mechanism of the ribosome-catalyzed peptide bond formation is the focus of this review. Implications on the mechanism of peptide release are discussed as well. PMID:19595805

  20. Senescent changes in the ribosomes of animal cells in vivo and in vitro

    NASA Technical Reports Server (NTRS)

    Miquel, J.; Johnson, J. E., Jr.

    1979-01-01

    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  1. Structures of the Bacterial Ribosome in Classical and Hybrid States of tRNA Binding

    SciTech Connect

    Dunkle, Jack A.; Wang, Leyi; Feldman, Michael B.; Pulk, Arto; Chen, Vincent B.; Kapral, Gary J.; Noeske, Jonas; Richardson, Jane S.; Blanchard, Scott C.; Cate, Jamie H. Doudna

    2011-09-06

    During protein synthesis, the ribosome controls the movement of tRNA and mRNA by means of large-scale structural rearrangements. We describe structures of the intact bacterial ribosome from Escherichia coli that reveal how the ribosome binds tRNA in two functionally distinct states, determined to a resolution of {approx}3.2 angstroms by means of x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit site. The structures help to explain how the ratchet-like motion of the two ribosomal subunits contributes to the mechanisms of translocation, termination, and ribosome recycling.

  2. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  3. All-atom homology model of the Escherichia coli 30S ribosomal subunit.

    PubMed

    Tung, Chang-Shung; Joseph, Simpson; Sanbonmatsu, Kevin Y

    2002-10-01

    Understanding the structural basis of ribosomal function requires close comparison between biochemical and structural data. Although a large amount of biochemical data are available for the Escherichia coli ribosome, the structure has not been solved to atomic resolution. Using a new RNA homology procedure, we have modeled the all-atom structure of the E. coli 30S ribosomal subunit. We find that the tertiary structure of the ribosome core, including the A-, P- and E-sites, is highly conserved. The hypervariable regions in our structure, which differ from the structure of the 30S ribosomal subunit from Thermus thermophilus, are consistent with the cryo-EM map of the E. coli ribosome. PMID:12244297

  4. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    PubMed Central

    Pnueli, Lilach; Arava, Yoav

    2007-01-01

    Background The yeast ribosomal protein S9 (S9) is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4) has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM) along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination. PMID:17711575

  5. LOCAL TRANSLATION. Comment on "Principles of ER cotranslational translocation revealed by proximity-specific ribosome profiling".

    PubMed

    Reid, David W; Nicchitta, Christopher V

    2015-06-12

    Jan et al. (Research Articles, 7 November 2014, p. 716) propose that ribosomes translating secretome messenger RNAs (mRNAs) traffic from the cytosol to the endoplasmic reticulum (ER) upon emergence of the signal peptide and return to the cytosol after termination. An accounting of controls demonstrates that mRNAs initiate translation on ER-bound ribosomes and that ribosomes are retained on the ER through many cycles of translation. PMID:26068841

  6. Reduced expression of the mouse ribosomal protein Rpl17 alters the diversity of mature ribosomes by enhancing production of shortened 5.8S rRNA

    PubMed Central

    Wang, Minshi; Parshin, Andrey V.; Shcherbik, Natalia; Pestov, Dimitri G.

    2015-01-01

    Processing of rRNA during ribosome assembly can proceed through alternative pathways but it is unclear whether this could affect the structure of the ribosome. Here, we demonstrate that shortage of a ribosomal protein can change pre-rRNA processing in a way that over time alters ribosome diversity in the cell. Reducing the amount of Rpl17 in mouse cells led to stalled 60S subunit maturation, causing degradation of most of the synthesized precursors. A fraction of pre-60S subunits, however, were able to complete maturation, but with a 5′-truncated 5.8S rRNA, which we named 5.8SC. The 5′ exoribonuclease Xrn2 is involved in the generation of both 5.8SC and the canonical long form of 5.8S rRNA. Ribosomes containing 5.8SC rRNA are present in various mouse and human cells and engage in translation. These findings uncover a previously undescribed form of mammalian 5.8S rRNA and demonstrate that perturbations in ribosome assembly can be a source of heterogeneity in mature ribosomes. PMID:25995445

  7. Ribosome biogenesis: emerging evidence for a central role in the regulation of skeletal muscle mass†

    PubMed Central

    Chaillou, Thomas; Kirby, Tyler J.; McCarthy, John J.

    2016-01-01

    The ribosome is a supramolecular ribonucleoprotein complex that functions at the heart of the translation machinery to convert mRNA into protein. Ribosome biogenesis is the primary determinant of translational capacity of the cell and accordingly has an essential role in the control of cell growth in eukaryotes. Cumulative evidence supports the hypothesis that ribosome biogenesis has an important role in the regulation of skeletal muscle mass. The purpose of this review is to, first, summarize the main mechanisms known to regulate ribosome biogenesis and, second, put forth the hypothesis that ribosome biogenesis is a central mechanism used by skeletal muscle to regulate protein synthesis and control skeletal muscle mass in response to anabolic and catabolic stimuli. The mTORC1 and Wnt/β-catenin/c-myc signaling pathways are discussed as the major pathways that work in concert with each of the three RNA polymerases (RNA Pol I, II and III) in regulating ribosome biogenesis. Consistent with our hypothesis, activation of these two pathways has been shown to be associated with ribosome biogenesis during skeletal muscle hypertrophy. Although further study is required, the finding that ribosome biogenesis is altered under catabolic states, in particular during disuse atrophy, suggests that its activation represents a novel therapeutic target to reduce or prevent muscle atrophy. Lastly, the emerging field of ribosome specialization is discussed and its potential role in the regulation of gene expression during periods of skeletal muscle plasticity. PMID:24604615

  8. Direct and high throughput (HT) interactions on the ribosomal surface by iRIA

    PubMed Central

    Pesce, Elisa; Minici, Claudia; Baβler, Jochen; Hurt, Ed; Degano, Massimo; Calamita, Piera; Biffo, Stefano

    2015-01-01

    Ribosomes function as platforms for binding of other molecules, but technologies for studying this process are lacking. Therefore we developed iRIA (in vitro Ribosomes Interaction Assay). In approach I, Artemia salina ribosomes spotted on solid phase are used for binding picomoles of analytes; in approach II, cellular extracts allow the measurement of ribosome activity in different conditions. We apply the method to analyze several features of eIF6 binding to 60S subunits. By approach I, we show that the off-rate of eIF6 from preribosomes is slower than from mature ribosomes and that its binding to mature 60S occurs in the nM affinity range. By approach II we show that eIF6 binding sites on 60S are increased with mild eIF6 depletion and decreased in cells that are devoid of SBDS, a ribosomal factor necessary for 60S maturation and involved in Swachman Diamond syndrome. We show binding conditions to immobilized ribosomes adaptable to HT and quantify free ribosomes in cell extracts. In conclusion, we suggest that iRIA will greatly facilitate the study of interactions on the ribosomal surface. PMID:26486184

  9. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    SciTech Connect

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.

    1986-01-20

    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of (/sup 14/C)CH/sub 3/-methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination.

  10. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics

    NASA Astrophysics Data System (ADS)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  11. Modeling of ribosome dynamics on a ds-mRNA under an external load

    NASA Astrophysics Data System (ADS)

    Shakiba, Bahareh; Dayeri, Maryam; Mohammad-Rafiee, Farshid

    2016-07-01

    Protein molecules in cells are synthesized by macromolecular machines called ribosomes. According to the recent experimental data, we reduce the complexity of the ribosome and propose a model to express its activity in six main states. Using our model, we study the translation rate in different biological relevant situations in the presence of external force and the translation through the RNA double stranded region in the absence or presence of the external force. In the present study, we give a quantitative theory for translation rate and show that the ribosome behaves more like a Brownian Ratchet motor. Our findings could shed some light on understanding behaviors of the ribosome in biological conditions.

  12. Effects of ribosome-inactivating proteins on Escherichia coli and Agrobacterium tumefaciens translation systems.

    PubMed Central

    Girbés, T; Barbieri, L; Ferreras, M; Arias, F J; Rojo, M A; Iglesias, R; Alegre, C; Escarmis, C; Stirpe, F

    1993-01-01

    The effects of 30 type 1 and of 2 (ricin and volkensin) type 2 ribosome-inactivating proteins (RIPs) on Escherichia coli and Agrobacterium tumefaciens cell-free translation systems were compared with the effects on a rabbit reticulocyte translation system. The depurinating activity of RIPs on E. coli ribosomes was also evaluated. Only six type 1 RIPs inhibited endogenous mRNA-directed translational activity of E. coli lysates, with submicromolar 50% inhibitory concentrations. Four RIPs had similar activities on poly(U)-directed phenylalanine polymerization by E. coli ribosomes, and three RIPs inhibited poly(U)-directed polyphenylalanine synthesis by A. tumefaciens ribosomes, with submicromolar 50% inhibitory concentrations. Images PMID:8407849

  13. Atomic model of the Thermus thermophilus 70S ribosome developed in silico.

    PubMed

    Tung, Chang-Shung; Sanbonmatsu, Kevin Y

    2004-10-01

    The ribosome is a large molecular complex that consists of at least three ribonucleic acid molecules and a large number of proteins. It translates genetic information from messenger ribonucleic acid and makes protein accordingly. To better understand ribosomal function and provide information for designing biochemical experiments require knowledge of the complete structure of the ribosome. For expanding the structural information of the ribosome, we took on the challenge of developing a detailed Thermus thermophilus ribosomal structure computationally. By combining information derived from the low-resolution x-ray structure of the 70S ribosome (providing the overall fold), high-resolution structures of the ribosomal subunits (providing the local structure), sequences, and secondary structures, we have developed an atomic model of the T. thermophilus ribosome using a homology modeling approach. Our model is stereochemically sound with a consistent single-species sequence. The overall folds of the three ribosomal ribonucleic acids in our model are consistent with those in the low-resolution crystal structure (root mean-square differences are all <1.9 angstroms). The large overall interface area (approximately 2500 angstroms2) of intersubunit bridges B2a, B3, and B5, and the inherent flexibility in regions connecting the contact residues are consistent with these bridges serving as anchoring patches for the ratcheting and rolling motions between the two subunits during translocation. PMID:15454463

  14. A vestige of a prebiotic bonding machine is functioning within the contemporary ribosome.

    PubMed

    Krupkin, Miri; Matzov, Donna; Tang, Hua; Metz, Markus; Kalaora, Rinat; Belousoff, Matthew J; Zimmerman, Ella; Bashan, Anat; Yonath, Ada

    2011-10-27

    Based on the presumed capability of a prebiotic pocket-like entity to accommodate substrates whose stereochemistry enables the creation of chemical bonds, it is suggested that a universal symmetrical region identified within all contemporary ribosomes originated from an entity that we term the 'proto-ribosome'. This 'proto-ribosome' could have evolved from an earlier machine that was capable of performing essential tasks in the RNA world, called here the 'pre-proto-ribosome', which was adapted for producing proteins. PMID:21930590

  15. A fluorescence-based screen for ribosome binding antibiotics

    PubMed Central

    Watkins, Derrick; Norris, F.A.; Kumar, Sunil; Arya, Dev P.

    2014-01-01

    The development of new antibacterial agents has become necessary to treat the large number of emerging bacterial strains resistant to current antibiotics. Despite the different methods of resistance developed by these new strains, the A-site of the bacterial ribosome remains an attractive target for new antibiotics. To develop new drugs that target the ribosomal A-site, a high-throughput screen is necessary to identify compounds that bind to the target with high affinity. To this end, we present an assay that uses a novel fluorescein-conjugated neomycin (F-neo) molecule as a binding probe to determine the relative binding affinity of a drug library. We show here that the binding of F-neo to a model Escherichia coli ribosomal A-site results in a large decrease in the fluorescence of the molecule. Furthermore, we have determined that the change in fluorescence is due to the relative change in the pKa of the probe resulting from the change in the electrostatic environment that occurs when the probe is taken from the solvent and localized into the negative potential of the A-site major groove. Finally, we demonstrate that F-neo can be used in a robust, highly reproducible assay, determined by a Z′-factor greater than 0.80 for 3 consecutive days. The assay is capable of rapidly determining the relative binding affinity of a compound library in a 96-well plate format using a single channel electronic pipette. The current assay format will be easily adaptable to a high-throughput format with the use of a liquid handling robot for large drug libraries currently available and under development. PMID:23262284

  16. Analysis of interactions between ribosomal proteins and RNA structural motifs

    PubMed Central

    2010-01-01

    Background One important goal of structural bioinformatics is to recognize and predict the interactions between protein binding sites and RNA. Recently, a comprehensive analysis of ribosomal proteins and their interactions with rRNA has been done. Interesting results emerged from the comparison of r-proteins within the small subunit in T. thermophilus and E. coli, supporting the idea of a core made by both RNA and proteins, conserved by evolution. Recent work showed also that ribosomal RNA is modularly composed. Motifs are generally single-stranded sequences of consecutive nucleotides (ssRNA) with characteristic folding. The role of these motifs in protein-RNA interactions has been so far only sparsely investigated. Results This work explores the role of RNA structural motifs in the interaction of proteins with ribosomal RNA (rRNA). We analyze composition, local geometries and conformation of interface regions involving motifs such as tetraloops, kink turns and single extruded nucleotides. We construct an interaction map of protein binding sites that allows us to identify the common types of shared 3-D physicochemical binding patterns for tetraloops. Furthermore, we investigate the protein binding pockets that accommodate single extruded nucleotides either involved in kink-turns or in arbitrary RNA strands. This analysis reveals a new structural motif, called tripod. It corresponds to small pockets consisting of three aminoacids arranged at the vertices of an almost equilateral triangle. We developed a search procedure for the recognition of tripods, based on an empirical tripod fingerprint. Conclusion A comparative analysis with the overall RNA surface and interfaces shows that contact surfaces involving RNA motifs have distinctive features that may be useful for the recognition and prediction of interactions. PMID:20122215

  17. Transactivation of programmed ribosomal frameshifting by a viral protein.

    PubMed

    Li, Yanhua; Treffers, Emmely E; Napthine, Sawsan; Tas, Ali; Zhu, Longchao; Sun, Zhi; Bell, Susanne; Mark, Brian L; van Veelen, Peter A; van Hemert, Martijn J; Firth, Andrew E; Brierley, Ian; Snijder, Eric J; Fang, Ying

    2014-05-27

    Programmed -1 ribosomal frameshifting (-1 PRF) is a widely used translational mechanism facilitating the expression of two polypeptides from a single mRNA. Commonly, the ribosome interacts with an mRNA secondary structure that promotes -1 frameshifting on a homopolymeric slippery sequence. Recently, we described an unusual -2 frameshifting (-2 PRF) signal directing efficient expression of a transframe protein [nonstructural protein 2TF (nsp2TF)] of porcine reproductive and respiratory syndrome virus (PRRSV) from an alternative reading frame overlapping the viral replicase gene. Unusually, this arterivirus PRF signal lacks an obvious stimulatory RNA secondary structure, but as confirmed here, can also direct the occurrence of -1 PRF, yielding a third, truncated nsp2 variant named "nsp2N." Remarkably, we now show that both -2 and -1 PRF are transactivated by a protein factor, specifically a PRRSV replicase subunit (nsp1β). Embedded in nsp1β's papain-like autoproteinase domain, we identified a highly conserved, putative RNA-binding motif that is critical for PRF transactivation. The minimal RNA sequence required for PRF was mapped within a 34-nt region that includes the slippery sequence and a downstream conserved CCCANCUCC motif. Interaction of nsp1β with the PRF signal was demonstrated in pull-down assays. These studies demonstrate for the first time, to our knowledge, that a protein can function as a transactivator of ribosomal frameshifting. The newly identified frameshifting determinants provide potential antiviral targets for arterivirus disease control and prevention. Moreover, protein-induced transactivation of frameshifting may be a widely used mechanism, potentially including previously undiscovered viral strategies to regulate viral gene expression and/or modulate host cell translation upon infection. PMID:24825891

  18. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  19. Structure of psoralen-crosslinked ribosomal RNA from Drosophila melanogaster.

    PubMed Central

    Wollenzien, P L; Youvan, D C; Hearst, J E

    1978-01-01

    Ribosomal RNA from Drosophila melanogaster photoreacted with hydroxymethyltrioxsalen has been examined by electron microscopy. Reproducible patterns of hairpins were found in both the 26S and 18S RNA. The frequency of these hairpins and the amount of incorporated drug were dependent upon the conditions under which the crosslinking was performed. A prominent central hairpin occurs in the 26S RNA and the break that interrupts the continuity of the RNA chain is located within it. In addition to several small hairpins, the crosslinked 18S RNA contains a large open loop. Images PMID:417342

  20. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Jansen, J; De Rijk, P; De Wachter, R

    1997-01-01

    The Antwerp database on small ribosomal subunit RNA now offers more than 6000 nucleotide sequences (August 1996). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. For ease of use, the complete database is made available to the scientific community via World Wide Web at URL http://rrna.uia.ac.be/ssu/ . PMID:9016516

  1. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Van den Broeck, I; De Rijk, P; De Wachter, R

    1994-01-01

    The database on small ribosomal subunit RNA structure contains (June 1994) 2824 nucleotide sequences. All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. The complete database is made available to the scientific community through anonymous ftp on our server in Antwerp. A special effort was made to improve electronic retrieval and a program is supplied that allows to create different file formats. The database can also be obtained from the EMBL nucleotide sequence library. PMID:7524022

  2. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Nicolaï, S; De Rijk, P; De Wachter, R

    1996-01-01

    The Antwerp database on small ribosomal subunit RNA offers over 4300 nucleotide sequences (August 1995). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. The complete database is made available to the scientific community through anonymous ftp and World Wide Web(WWW). PMID:8594609

  3. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; De Wachter, R

    1997-01-01

    The latest release of the large ribosomal subunit RNA database contains 429 sequences. All these sequences are aligned, and incorporate secondary structure information. The rRNA WWW Server at URL http://rrna.uia.ac.be/ provides researchers with an easily accessible resource to obtain the data in this database in a number of computer-readable formats. A new query interface has been added to the server. If necessary, the data can also be obtained by anonymous ftp from the same site. PMID:9016517

  4. Proteins of rough microsomal membranes related to ribosome binding. II. Cross-linking of bound ribosomes to specific membrane proteins exposed at the binding sites

    PubMed Central

    1978-01-01

    Two proteins (ribophorins I and II), which are integral components of rough microsomal membranes and appear to be related to the bound ribosomes, were shown to be exposed on the surface of rat liver rough microsomes (RM) and to be in close proximity to the bound ribosomes. Both proteins were labeled when intact RM were incubated with a lactoperoxidase iodinating system, but only ribophorin I was digested during mild trypsinization of intact RM. Ribophorin II (63,000 daltons) was only proteolyzed when the luminal face of the microsomal vesicles was made accessible to trypsin by the addition of sublytical detergent concentrations. Only 30--40% of the bound ribosomes were released during trypsinization on intact RM, but ribosome release was almost complete in the presence of low detergent concentrations. Very low glutaraldehyde concentrations (0.005--0.02%) led to the preferential cross-linking of large ribosomal subunits of bound ribosomes to the microsomal membranes. This cross-linking prevented the release of subunits caused by puromycin in media of high ionic strength, but not the incorporation of [3H]puromycin into nascent polypeptide chains. SDS- acrylamide gel electrophoresis of cross-linked samples a preferential reduction in the intensity of the bands representing the ribophorins and the formation of aggregates which did not penetrate into the gels. At low methyl-4-mercaptobutyrimidate (MMB) concentrations (0.26 mg/ml) only 30% of the ribosomes were cross-linked to the microsomal membranes, as shown by the puromycin-KCl test, but membranes could still be solubilized with 1% DOC. This allowed the isolation of the ribophorins together with the sedimentable ribosomes, as was shown by electrophoresis of the sediments after disruption of the cross-links by reduction. Experiments with RM which contained only inactive ribosomes showed that the presence of nascent chains was not necessary for the reversible cross-linking of ribosomes to the membranes. These

  5. Development of pre-implantation porcine embryos cultured within a three-dimensional alginate hydrogel system either conjugated with Arg-Gly-Asp (RGD) peptide or supplemented with secreted phosphoprotein 1 (SPP1)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many uterine specific factors have been shown to be increased within the uterine milieu as the porcine embryo initiates elongation. Secreted phosphoprotein 1 (SPP1) is increased during this time and contains an Arg-Gly-Asp (RGD) peptide sequence that has been shown to bind to cell surface integrins ...

  6. Ribosomal protein S14 negatively regulates c-Myc activity.

    PubMed

    Zhou, Xiang; Hao, Qian; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2013-07-26

    The ribosomal gene RPS14 is associated with the cancer-prone 5q-syndrome, which is caused by an interstitial deletion of the long arm of human chromosome 5. Previously, we found that ribosomal protein S14 (RPS14) binds to and inactivates MDM2, consequently leading to p53-dependent cell-cycle arrest and growth inhibition. However, it remains elusive whether RPS14 regulates cell proliferation in a p53-independent manner. Here, we show that RPS14 interacts with the Myc homology box II (MBII) and the C-terminal basic helix-loop-helix leucine zipper (bHLH-LZ) domains of the oncoprotein c-Myc. Further, RPS14 inhibited c-Myc transcriptional activity by preventing the recruitment of c-Myc and its cofactor, TRRAP, to the target gene promoters, as thus suppressing c-Myc-induced cell proliferation. Also, siRNA-mediated RPS14 depletion elevated c-Myc transcriptional activity determined by its target gene, Nucleolin, expression. Interestingly, RPS14 depletion also resulted in the induction of c-Myc mRNA and subsequent protein levels. Consistent with this, RPS14 promoted c-Myc mRNA turnover through an Argonaute 2 (Ago2)- and microRNA-mediated pathway. Taken together, our study demonstrates that RPS14 negates c-Myc functions by directly inhibiting its transcriptional activity and mediating its mRNA degradation via miRNA. PMID:23775087

  7. Ribosomal small subunit domains radiate from a central core.

    PubMed

    Gulen, Burak; Petrov, Anton S; Okafor, C Denise; Vander Wood, Drew; O'Neill, Eric B; Hud, Nicholas V; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2'OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  8. Ribosomal small subunit domains radiate from a central core

    NASA Astrophysics Data System (ADS)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  9. Ribosomal small subunit domains radiate from a central core

    PubMed Central

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  10. The Thioredoxin System Protects Ribosomes against Stress-induced Aggregation

    PubMed Central

    Rand, Jonathan D.; Grant, Chris M.

    2006-01-01

    We previously showed that thioredoxins are required for dithiothreitol (DTT) tolerance, suggesting they maintain redox homeostasis in response to both oxidative and reductive stress conditions. In this present study, we screened the complete set of viable deletion strains in Saccharomyces cerevisiae for sensitivity to DTT to identify cell functions involved in resistance to reductive stress. We identified 195 mutants, whose gene products are localized throughout the cell. DTT-sensitive mutants were distributed among most major biological processes, but they particularly affected gene expression, metabolism, and the secretory pathway. Strikingly, a mutant lacking TSA1, encoding a peroxiredoxin, showed a similar sensitivity to DTT as a thioredoxin mutant. Epistasis analysis indicated that thioredoxins function upstream of Tsa1 in providing tolerance to DTT. Our data show that the chaperone function of Tsa1, rather than its peroxidase function, is required for this activity. Cells lacking TSA1 were found to accumulate aggregated proteins, and this was exacerbated by exposure to DTT. Analysis of the protein aggregates revealed that they are predominantly composed of ribosomal proteins. Furthermore, aggregation was found to correlate with an inhibition of translation initiation. We propose that Tsa1 normally functions to chaperone misassembled ribosomal proteins, preventing the toxicity that arises from their aggregation. PMID:16251355

  11. Phylogeny of Porphyromonas gingivalis by Ribosomal Intergenic Spacer Region Analysis

    PubMed Central

    Rumpf, Robert W.; Griffen, Ann L.; Leys, Eugene J.

    2000-01-01

    Periodontitis has been associated with the presence of Porphyromonas gingivalis, and previous studies have shown phenotypic differences in the pathogenicities of strains of P. gingivalis. An accurate and comprehensive phylogeny of strains of P. gingivalis would be useful in determining if there is an evolutionary basis to pathogenicity in this species. Previous phylogenies of P. gingivalis strains based on random amplified polymorphic DNA (RAPD) analysis and multilocus enzyme electrophoresis (MLEE) show little agreement. While the 16S ribosomal gene is the standard for phylogenetic reconstruction among bacterial species, it is insufficiently variable for this purpose. In the present study, the phylogeny of P. gingivalis was constructed on the basis of the sequence of the most variable region of the ribosomal operon, the intergenic spacer region (ISR). Heteroduplex analysis of the ISR has been used to study the variability of P. gingivalis strains in periodontitis. In the present study, typing by heteroduplex analysis was compared to ISR sequence-based phylogeny and close agreement was observed. The two strains of P. gingivalis whose heteroduplex types are strongly associated with periodontitis were found to be closely related and were well separated from strains whose heteroduplex types are less strongly associated with disease, suggesting a relationship between pathogenicity and phylogeny. PMID:10790104

  12. Nuclear and nucleolar targeting of human ribosomal protein S6.

    PubMed Central

    Schmidt, C; Lipsius, E; Kruppa, J

    1995-01-01

    Chimeric proteins were constructed to define the nuclear localization signals (NLSs) of human ribosomal protein S6. The complete cDNA sequence, different cDNA fragments and oligonucleotides of the human ribosomal proteins S6, respectively, were joined to the 5' end of the entire LacZ gene of Escherichia coli by using recombinant techniques. The hybrid genes were transfected into L cells, transiently expressed, and the intracellular location of the fusion proteins was determined by their beta-galactosidase activity. Three NLSs were identified in the C-terminal half of the S6 protein. Deletion mutagenesis demonstrated that a single NLS is sufficient for targeting the corresponding S6-beta-galactosidase chimera into the nucleus. Removal of all three putative NLSs completely blocked the nuclear import of the resulting S6-beta-galactosidase fusion protein, which instead became evenly distributed in the cytoplasm. Chimeras containing deletion mutants of S6 with at least one single NLS or unmodified S6 accumulated in the nucleolus. Analysis of several constructs reveals the existence of a specific domain that is essential but not sufficient for nucleolar accumulation of S6. Images PMID:8590812

  13. Genomic architecture and inheritance of human ribosomal RNA gene clusters

    PubMed Central

    Stults, Dawn M.; Killen, Michael W.; Pierce, Heather H.; Pierce, Andrew J.

    2008-01-01

    The finishing of the Human Genome Project largely completed the detailing of human euchromatic sequences; however, the most highly repetitive regions of the genome still could not be assembled. The 12 gene clusters producing the structural RNA components of the ribosome are critically important for cellular viability, yet fall into this unassembled region of the Human Genome Project. To determine the extent of human variation in ribosomal RNA gene content (rDNA) and patterns of rDNA cluster inheritance, we have determined the physical lengths of the rDNA clusters in peripheral blood white cells of healthy human volunteers. The cluster lengths exhibit striking variability between and within human individuals, ranging from 50 kb to >6 Mb, manifest essentially complete heterozygosity, and provide each person with their own unique rDNA electrophoretic karyotype. Analysis of these rDNA fingerprints in multigenerational human families demonstrates that the rDNA clusters are subject to meiotic rearrangement at a frequency >10% per cluster, per meiosis. With this high intrinsic recombinational instability, the rDNA clusters may serve as a unique paradigm of potential human genomic plasticity. PMID:18025267

  14. Dopamine- and cAMP-regulated phosphoprotein (DARPP-32) and dopamine DA1 agonist-sensitive Na+,K+-ATPase in renal tubule cells.

    PubMed Central

    Meister, B; Fryckstedt, J; Schalling, M; Cortés, R; Hökfelt, T; Aperia, A; Hemmings, H C; Nairn, A C; Ehrlich, M; Greengard, P

    1989-01-01

    The cellular localization of DARPP-32, a dopamine- and cAMP-regulated phosphoprotein of Mr 32,000 that appears to mediate certain actions of dopamine in the mammalian brain by acting as an inhibitor of protein phosphatase 1, was studied in the kidney of several species. DARPP-32 mRNA and DARPP-32-like immunoreactivity were found in the cytoplasm of cells in the thick ascending limb of the loop of Henle. The specific dopamine DA1 agonist SKF 82526 caused a dose-dependent inhibition of Na+,K+-ATPase activity, which could be blocked by SCH 23390, a specific DA1 antagonist, and by PKI-(5-24) amide, a specific inhibitor of cAMP-dependent protein kinase. The results indicate that DA1 dopamine receptors and DARPP-32, an intracellular third messenger for dopamine, are part of the signal-transduction process for dopamine acting on renal tubule cells. Images PMID:2573060

  15. Biochemical and structural studies of the oligomerization domain of the Nipah virus phosphoprotein: evidence for an elongated coiled-coil homotrimer.

    PubMed

    Blocquel, David; Beltrandi, Matilde; Erales, Jenny; Barbier, Pascale; Longhi, Sonia

    2013-11-01

    Nipah virus (NiV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The NiV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that is the substrate used by the polymerase for transcription and replication. The polymerase is recruited onto the nucleocapsid via its cofactor, the phosphoprotein (P). The NiV P protein has a modular organization, with alternating disordered and ordered domains. Among these latter, is the P multimerization domain (PMD) that was predicted to adopt a coiled-coil conformation. Using both biochemical and biophysical approaches, we show that NiV PMD forms a highly stable and elongated coiled-coil trimer, a finding in striking contrast with respect to the PMDs of Paramyxoviridae members investigated so far that were all found to tetramerize. The present results therefore represent the first report of a paramyxoviral P protein forming trimers. PMID:24074578

  16. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3' end of nonstop mRNA.

    PubMed

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3' ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3' end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3' end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  17. Characterization of the ribosomal binding site in rat liver rough microsomes: ribophorins I and II, two integral membrane proteins related to ribosome binding.

    PubMed

    Kreibich, G; Czakó-Graham, M; Grebenau, R; Mok, W; Rodriguez-Boulan, E; Sabatini, D D

    1978-01-01

    Rat liver rough endoplasmic reticulum membranes (ER) contain two characteristic transmembrane glycoproteins which have been designated ribophorins I and II and are absent from smooth ER membranes. These proteins (MW 65,000 and 63,000 respectively) are related to the binding sites for ribosomes, as suggested by the following findings: i) The ribophorin content of the rough ER membranes corresponds stoichiometrically to the number of bound ribosomes; ii) ribophorins are quantitatively recovered with the bound polysomes after most other ER membrane proteins are dissolved with the nonionic detergent Kyro EOB; iii) in intact rough microsomes ribophorins can be cross-linked chemically to the ribosomes and therefore are in close proximity to them. Treatment of rough microsomes with a low Triton-X-100 concentration leads to the lateral displacement of ribosomes on the microsomal surface and to the formation of aggregates of bound ribosomes in areas of membranes which frequently invaginate into the microsomal lumen. Subfractionation of Triton-treated microsomes containing invaginations led to the recovery of smooth and "rough-inverted" vesicles. Ribophorins were present only in the latter fraction, indicating that both proteins are displaced together with the ribosomes when these aggregate without detaching. Measurements of the ribosome-binding capacity of rough and smooth microsomal membranes reconstituted after solubilization with detergents suggest that ribophorins are necessary for in vitro ribosome binding. Ribophorin-like proteins were found in rough microsomes obtained from secretory tissues of several animal species. The two proteins present in rat lacrimal gland microsomes have the same mobility as hepatocyte ribophorins and cross-react with antisera against them. PMID:723266

  18. Ribosome-associated Asc1/RACK1 is required for endonucleolytic cleavage induced by stalled ribosome at the 3′ end of nonstop mRNA

    PubMed Central

    Ikeuchi, Ken; Inada, Toshifumi

    2016-01-01

    Dom34-Hbs1 stimulates degradation of aberrant mRNAs lacking termination codons by dissociating ribosomes stalled at the 3′ ends, and plays crucial roles in Nonstop Decay (NSD) and No-Go Decay (NGD). In the dom34Δ mutant, nonstop mRNA is degraded by sequential endonucleolytic cleavages induced by a stalled ribosome at the 3′ end. Here, we report that ribosome-associated Asc1/RACK1 is required for the endonucleolytic cleavage of nonstop mRNA by stalled ribosome at the 3′ end of mRNA in dom34Δ mutant cells. Asc1/RACK1 facilitates degradation of truncated GFP-Rz mRNA in the absence of Dom34 and exosome-dependent decay. Asc1/RACK1 is required for the sequential endonucleolytic cleavages by the stalled ribosome in the dom34Δ mutant, depending on its ribosome-binding activity. The levels of peptidyl-tRNA derived from nonstop mRNA were elevated in dom34Δasc1Δ mutant cells, and overproduction of nonstop mRNA inhibited growth of mutant cells. E3 ubiquitin ligase Ltn1 degrades the arrest products from truncated GFP-Rz mRNA in dom34Δ and dom34Δasc1Δ mutant cells, and Asc1/RACK1 represses the levels of substrates for Ltn1-dependent degradation. These indicate that ribosome-associated Asc1/RACK1 facilitates endonucleolytic cleavage of nonstop mRNA by stalled ribosomes and represses the levels of aberrant products even in the absence of Dom34. We propose that Asc1/RACK1 acts as a fail-safe in quality control for nonstop mRNA. PMID:27312062

  19. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  20. Ribosomes in the balance: structural equilibrium ensures translational fidelity and proper gene expression

    PubMed Central

    Musalgaonkar, Sharmishtha; Moomau, Christine A.; Dinman, Jonathan D.

    2014-01-01

    At equilibrium, empty ribosomes freely transit between the rotated and un-rotated states. In the cell, the binding of two translation elongation factors to the same general region of the ribosome stabilizes one state over the other. These stabilized states are resolved by expenditure of energy in the form of GTP hydrolysis. A prior study employing mutants of a late assembling peripheral ribosomal protein suggested that ribosome rotational status determines its affinity for elongation factors, and hence translational fidelity and gene expression. Here, mutants of the early assembling integral ribosomal protein uL2 are used to test the generality of this hypothesis. rRNA structure probing analyses reveal that mutations in the uL2 B7b bridge region shift the equilibrium toward the rotated state, propagating rRNA structural changes to all of the functional centers of ribosome. Structural disequilibrium unbalances ribosome biochemically: rotated ribosomes favor binding of the eEF2 translocase and disfavor that of the elongation ternary complex. This manifests as specific translational fidelity defects, impacting the expression of genes involved in telomere maintenance. A model is presented describing how cyclic intersubunit rotation ensures the unidirectionality of translational elongation, and how perturbation of rotational equilibrium affects specific aspects of translational fidelity and cellular gene expression. PMID:25389262