Science.gov

Sample records for ribosomal phosphoprotein pfp0

  1. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.

    PubMed

    MacConnell, W P; Kaplan, N O

    1982-05-25

    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes. PMID:6121796

  2. Rabies virus phosphoprotein interacts with ribosomal protein L9 and affects rabies virus replication.

    PubMed

    Li, Youwen; Dong, Wanyu; Shi, Yuejun; Deng, Feng; Chen, Xi; Wan, Chunyun; Zhou, Ming; Zhao, Ling; Fu, Zhen F; Peng, Guiqing

    2016-01-15

    Rabies virus is a highly neurotropic virus that can cause fatal infection of the central nervous system in warm-blooded animals. The RABV phosphoprotein (P), an essential cofactor of the virus RNA-dependent RNA polymerase, is required for virus replication. In this study, the ribosomal protein L9, which has functions in protein translation, is identified as P-interacting cellular factor using phage display analysis. Direct binding between the L9 and P was confirmed by protein pull-down and co-immunoprecipitation analyses. It was further demonstrated that L9 translocates from the nucleus to the cytoplasm, where it colocalizes with P in cells infected with RABV or transfected with P gene. RABV replication was reduced with L9 overexpression and enhanced with L9 knockdown. Thus, we propose that during RABV infection, P binds to L9 that translocates from the nucleus to the cytoplasm, inhibiting the initial stage of RABV transcription. PMID:26655239

  3. An abundant nucleolar phosphoprotein is associated with ribosomal DNA in Tetrahymena macronuclei.

    PubMed Central

    McGrath, K E; Smothers, J F; Dadd, C A; Madireddi, M T; Gorovsky, M A; Allis, C D

    1997-01-01

    An abundant 52-kDa phosphoprotein was identified and characterized from macronuclei of the ciliated protozoan Tetrahymena thermophila. Immunoblot analyses combined with light and electron microscopic immunocytochemistry demonstrate that this polypeptide, termed Nopp52, is enriched in the nucleoli of transcriptionally active macronuclei and missing altogether from transcriptionally inert micronuclei. The cDNA sequence encoding Nopp52 predicts a polypeptide whose amino-terminal half consists of multiple acidic/serine-rich regions alternating with basic/proline-rich regions. Multiple serines located in these acidic stretches lie within casein kinase II consensus motifs, and Nopp52 is an excellent substrate for casein kinase II in vitro. The carboxyl-terminal half of Nopp52 contains two RNA recognition motifs and an extreme carboxyl-terminal domain rich in glycine, arginine, and phenylalanine, motifs common in many RNA processing proteins. A similar combination and order of motifs is found in vertebrate nucleolin and yeast NSR1, suggesting that Nopp52 is a member of a family of related nucleolar proteins. NSR1 and nucleolin have been implicated in transcriptional regulation of rDNA and rRNA processing. Consistent with a role in ribosomal gene metabolism, rDNA and Nopp52 colocalize in situ, as well as by cross-linking and immunoprecipitation experiments, demonstrating an association between Nopp52 and rDNA in vivo. Images PMID:9017598

  4. Ribosomal acidic phosphoproteins P1 and P2 are not required for cell viability but regulate the pattern of protein expression in Saccharomyces cerevisiae.

    PubMed Central

    Remacha, M; Jimenez-Diaz, A; Bermejo, B; Rodriguez-Gabriel, M A; Guarinos, E; Ballesta, J P

    1995-01-01

    Saccharomyces cerevisiae strains with either three inactivated genes (triple disruptants) or four inactivated genes (quadruple disruptants) encoding the four acidic ribosomal phosphoproteins, YP1 alpha, YP1 beta, YP2 alpha, and YP2 beta, present in this species have been obtained. Ribosomes from the triple disruptants and, obviously, those from the quadruple strain do not have bound P proteins. All disrupted strains are viable; however, they show a cold-sensitive phenotype, growing very poorly at 23 degrees C. Cell extracts from the quadruple-disruptant strain are about 30% as active as the control in protein synthesis assays and are stimulated by the addition of free acidic P proteins. Strains lacking acidic proteins do not have a higher suppressor activity than the parental strains, and cell extracts derived from the quadruple disruptant do not show a higher degree of misreading, indicating that the absence of acidic proteins does not affect the accuracy of the ribosomes. However, the patterns of protein expressed in the cells as well as in the cell-free protein system are affected by the absence of P proteins from the particles; a wild-type pattern is restored upon addition of exogenous P proteins to the cell extract. In addition, strains carrying P-protein-deficient ribosomes are unable to sporulate but recover this capacity upon transformation with one of the missing genes. These results indicate that acidic proteins are not an absolute requirement for protein synthesis but regulate the activity of the 60S subunit, affecting the translation of certain mRNAs differently. PMID:7651393

  5. Thylakoid phosphoproteins

    SciTech Connect

    Coughlan, S.J.; Hind, G.

    1986-01-01

    Thylakoid phosphoproteins were successively fractionated by (1) treatment of /sup 32/P-labeled membranes with 1 M NaBr to remove superficial proteins; (2) extraction with octyl glucoside/cholate; (3) precipitation with ammonium sulfate; (4) size exclusion chromatography on BioGel P300, and (5) sucrose density gradient centrifugation. The detergent extract contained <10% of the original membrane-bound /sup 32/P; it was enriched in cytochrome b/f complex and 64-kDa protein kinase. A 20-kDa protein which copurified with the cytochrome complex and was assumed to be the Rieske protein, was partially phosphorylated. The protein kinase, which phosphorylates itself in vitro, appeared on the sucrose gradient as a phosphoprotein, signalling that it had become labeled in the intact thylakoid. A phosphoprotein of approx.10 kDa which is seen as a product of directly radiolabeling the BioGel P300 extract, was found to differ from the well documented phosphoprotein of this approximate mass that appears in labeled thylakoids. 30 refs., 3 figs., 2 tabs.

  6. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  7. The expression of acidic ribosomal phosphoproteins on the surface membrane of different tissues in autoimmune and normal mice which are the target molecules for anti-double-stranded DNA antibodies.

    PubMed Central

    Sun, K H; Liu, W T; Tang, S J; Tsai, C Y; Hsieh, S C; Wu, T H; Han, S H; Yu, C L

    1996-01-01

    Affinity-purified polyclonal anti-double-stranded DNA (anti-dsDNA) antibodies from patients with systemic lupus erythematosus (SLE) exert a cytostatic effect on cultured rat glomerular mesangial cells (MC). The cognate antigens expressed on the surface of MC have been proved to be acidic ribosomal phosphoproteins (P proteins) in our previous study. The mesangial cytostatic effect of anti-dsDNA antibodies is attributed to the cross-reactivity of the antibodies with membrane-expressed P proteins, but not to the effect of minute amounts of anti-ribosomal P proteins antibodies contained in the anti-dsDNA preparations. Immunofluorescence staining of the native cells demonstrated that anti-dsDNA antibodies bound to the surface of rat mesangial cells, rat brain astrocytes (RBA-1) and mouse fibroblasts (3T3). Anti-dsDNA antibodies also exert potent cytostatic effects on these cells in a dose-dependent manner. In addition, the plasma membranes of different cell lines and tissues from normal and autoimmune mice were isolated and probed by anti-dsDNA antibodies in Western blot analysis. We found the actively proliferating cells such as MC, RBA-1 and 3T3 may express both P0 (38,000 MW) and P1 (19,000 MW) on the surface membrane. In addition, the kidney, liver and spleen from either autoimmune MRL-lpr/lpr or BALB/c mice may constantly express P0 protein, but the expression of P1 is inconsistent. In contrast, brain and muscle from either mice failed to express P proteins on their surface. Unexpectedly, a high molecular weight substance (larger than 205,000 MW) with unknown nature appears in the membrane of brain and muscle tissues in both mice. Immunoprecipitation of the surface-biotinylated MC-lysate by anti-dsDNA antibodies further confirmed that P1 (19,000 MW) and P2 (17,000 MW) are really expressed on the cell surface. These results suggest that P proteins expressed on the surface of different tissues become the targets for anti-dsDNA antibodies mediating pleomorphic tissue

  8. Mineral induction by immobilized phosphoproteins

    NASA Technical Reports Server (NTRS)

    Saito, T.; Arsenault, A. L.; Yamauchi, M.; Kuboki, Y.; Crenshaw, M. A.

    1997-01-01

    Dentin phosphoproteins are thought to have a primary role in the deposition of mineral on the collagen of dentin. In this study we determined the type of binding between collagen and phosphoproteins necessary for mineral formation onto collagen fibrils and whether the phosphate esters are required. Bovine dentin phosphophoryn or phosvitin from egg yolk were immobilized on reconstituted skin type I collagen fibrils by adsorption or by covalent cross-linking. In some samples the ester phosphate was removed from the covalently cross-linked phosphoproteins by treatment with acid phosphatase. All samples were incubated at 37 degrees C in metastable solutions that do not spontaneously precipitate. Reconstituted collagen fibrils alone did not induce mineral formation. The phosphoproteins adsorbed to the collagen fibrils desorbed when the mineralization medium was added, and mineral was not induced. The mineral induced by the cross-linked phosphoproteins was apatite, and the crystals were confined to the surface of the collagen fibrils. With decreasing medium saturation the time required for mineral induction increased. The interfacial tensions calculated for apatite formation by either phosphoprotein cross-linked to collagen were about the same as that for phosphatidic acid liposomes and hydroxyapatite. This similarity in values indicates that the nucleation potential of these highly phosphorylated surfaces is about the same. It is concluded that phosphoproteins must be irreversibly bound to collagen fibrils for the mineralization of the collagen network in solutions that do not spontaneously precipitate. The phosphate esters of phosphoproteins are required for mineral induction, and the carboxylate groups are not sufficient.

  9. [Phosphoprotein phosphatase nonspecifically hydrolyzes CoA].

    PubMed

    Reziapkin, V I; Moiseenok, A G

    1988-01-01

    CoA hydrolysis was studied by a homogenous phosphoprotein phosphatase (EC 3.1 3.16) preparation from bovine spleen nuclei at pH 5.8. Phosphoprotein phosphatase catalyzed hydrolysis of the CoA 3'-phosphoester bond to form dephospho-CoA and Pi. The Km value for phosphoprotein phosphatase with CoA as substrate was 3.7 mM, the specific activity - 0.26 mmol Pi.min-1.mg-1. Phosphoprotein phosphatase did not essentially catalyze the calcium pantothenate hydrolysis (not more than 2% as compared with the CoA hydrolysis rate). PMID:2849829

  10. Nucleolin: The most abundant multifunctional phosphoprotein of nucleolus.

    PubMed

    Tajrishi, Marjan M; Tuteja, Renu; Tuteja, Narendra

    2011-05-01

    Nucleolin is a multifunctional phosphoprotein ubiquitously distributed in the nucleolus, nucleus and cytoplasm of the cell. Nucleolin has a bipartite nuclear localization signal sequence and is conserved in animals, plants and yeast. Its levels are correlated with the rate of functional activity of the nucleolus in exponentially growing cells. Nucleolin contains intrinsic DNA and RNA helicase, nucleic-acid-dependent ATPase and self-cleaving activities. It binds RNA through its RNA recognition motifs. It regulates various aspects of DNA and RNA metabolism, chromatin structure, rDNA transcription, rRNA maturation, cytokinesis, nucleogenesis, cell proliferation and growth, the folding, maturation and ribosome assembly and nucleocytoplasmic transport of newly synthesized pre-RNAs. In this review we present an overview on nucleolin, its localization, structure and various functions. We also describe the discovery and important studies of nucleolin in plants. PMID:21980556

  11. Specific Enrichment of Phosphoproteins Using Functionalized Multivalent Nanoparticles

    PubMed Central

    Hwang, Leekyoung; Ayaz-Guner, Serife; Gregorich, Zachery R.; Cai, Wenxuan; Valeja, Santosh G.; Jin, Song; Ge, Ying

    2015-01-01

    Analysis of protein phosphorylation remains a significant challenge due to the low abundance of phosphoproteins and the low stoichiometry of phosphorylation, which requires effective enrichment of phosphoproteins. Here we have developed superparamagnetic nanoparticles (NPs) whose surface is functionalized by multivalent ligand molecules that specifically bind to the phosphate groups on any phosphoproteins. These NPs enrich phosphoproteins from complex cell and tissue lysates with high specificity as confirmed by SDS-PAGE analysis with a phosphoprotein-specific stain and mass spectrometry analysis of the enriched phosphoproteins. This method enables universal and effective capture, enrichment, and detection of intact phosphoproteins towards a comprehensive analysis of the phosphoproteome. PMID:25655481

  12. Oligomerization of Mumps Virus Phosphoprotein

    PubMed Central

    Pickar, Adrian; Elson, Andrew; Yang, Yang; Xu, Pei; Luo, Ming

    2015-01-01

    ABSTRACT The mumps virus (MuV) genome encodes a phosphoprotein (P) that is important for viral RNA synthesis. P forms the viral RNA-dependent RNA polymerase with the large protein (L). P also interacts with the viral nucleoprotein (NP) and self-associates to form a homotetramer. The P protein consists of three domains, the N-terminal domain (PN), the oligomerization domain (PO), and the C-terminal domain (PC). While PN is known to relax the NP-bound RNA genome, the roles of PO and PC are not clear. In this study, we investigated the roles of PO and PC in viral RNA synthesis using mutational analysis and a minigenome system. We found that PN and PC functions can be trans-complemented. However, this complementation requires PO, indicating that PO is essential for P function. Using this trans-complementation system, we found that P forms parallel dimers (PN to PN and PC to PC). Furthermore, we found that residues R231, K238, K253, and K260 in PO are critical for P's functions. We identified PC to be the domain that interacts with L. These results provide structure-function insights into the role of MuV P. IMPORTANCE MuV, a paramyxovirus, is an important human pathogen. The P protein of MuV is critical for viral RNA synthesis. In this work, we established a novel minigenome system that allows the domains of P to be complemented in trans. Using this system, we confirmed that MuV P forms parallel dimers. An understanding of viral RNA synthesis will allow the design of better vaccines and the development of antivirals. PMID:26311887

  13. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  14. NEURONAL PHOSPHOPROTEINS: PHYSIOLOGICAL AND CLINICAL IMPLICATIONS

    EPA Science Inventory

    The presence of a great variety of neuron-specific phosproteins in nervous tissue supports the view that protein phosphorylation plays many roles in neuronal function. The physiological significance of several of these phosphoproteins has already been established. Some neuronal p...

  15. Hypoxic stress-induced changes in ribosomes of maize seedling roots. [Zea mays L

    SciTech Connect

    Bailey-Serres, J.; Freeling, M. )

    1990-11-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with ({sup 35}S)methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with ({sup 32}P)orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress.

  16. Mapping phosphoproteins in Neisseria meningitidis serogroup A.

    PubMed

    Bernardini, Giulia; Laschi, Marcella; Serchi, Tommaso; Arena, Simona; D'Ambrosio, Chiara; Braconi, Daniela; Scaloni, Andrea; Santucci, Annalisa

    2011-04-01

    To investigate the phosphorylation capability of serogroup A Neisseria meningitidis (MenA) and to implement our knowledge in meningococcal biology and in bacterial post-translational modifications, cell extracts were separated by 2-DE and 51 novel phosphoproteins were revealed by the use of the highly specific Ser/Thr/Tyr-phosphorylated proteins staining by Pro-Q Diamond and identified by MALDI-ToF/MS. Our results indicate that phosphorylation in MenA is comparable to that of other bacterial species. A first functional characterization of the identified modified proteins was also given, in order to understand their role in meningococcal physiopathology. PMID:21365747

  17. Modulation of mTOR effector phosphoproteins in blood basophils from allergic patients.

    PubMed

    Gernez, Yael; Tirouvanziam, Rabindra; Reshamwala, Neha; Yu, Grace; Weldon, Brittany C; Galli, Stephen J; Herzenberg, Leonore A; Nadeau, Kari C

    2012-06-01

    The mammalian target of rapamycin (mTOR) pathway contributes to various immunoinflammatory processes. Yet, its potential involvement in basophil responses in allergy remains unclear. In this pilot study, we quantified two key mTOR effector phosphoproteins, the eukaryotic initiation factor 4E (peIF4E) and S6 ribosomal protein (pS6rp), in blood basophils from nut allergy patients (NA, N = 16) and healthy controls (HC, N = 13). Without stimulation in vitro, basophil peIF4E levels were higher in NA than HC subjects (P = 0.014). Stimulation with nut (offending) but not chicken / rice (non-offending) extract increased basophil peIF4E and pS6rp levels (+32%, P = 0.018, and +98%, P = 0.0026, respectively) in NA but not HC subjects, concomitant with increased surface levels of CD203c and CD63, both known to reflect basophil activation. Pre-treatment with the mTOR inhibitor rapamycin decreased pS6rp and CD203c responses in nut extract-stimulated basophils in NA subjects. Thus, basophil responses to offending allergens are associated with modulation of mTOR effector phosphoproteins. PMID:22350221

  18. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  19. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  20. Nucleolin: a multifunctional major nucleolar phosphoprotein.

    PubMed

    Tuteja, R; Tuteja, N

    1998-01-01

    Nucleolin is a major protein of exponentially growing eukaryotic cells where it is present in abundance at the heart of the nucleolus. It is highly conserved during evolution. Nucleolin contains a specific bipartite nuclear localization signal sequence and possesses a number of unusual structural features. It has unique tripartite structure and each domain performs a specific function by interacting with DNA or RNA or proteins. Nucleolin exhibits intrinsic self-cleaving, DNA helicase, RNA helicase and DNA-dependent ATPase activities. Nucleolin also acts as a sequence-specific RNA binding protein, an autoantigen, and as the component of a B cell specific transcription factor. Its phosphorylation by cdc2, CK2, and PKC-zeta modulate some of its activities. This multifunctional protein has been implicated to be involved directly or indirectly in many metabolic processes such as ribosome biogenesis (which includes rDNA transcription, pre-rRNA synthesis, rRNA processing, ribosomal assembly and maturation), cytokinesis, nucleogenesis, cell proliferation and growth, cytoplasmic-nucleolar transport of ribosomal components, transcriptional repression, replication, signal transduction, inducing chromatin decondensation and many more (see text). In plants it is developmentally, cell-cycle, and light regulated. The regulation of all these functions of a single protein seems to be a challenging puzzle. PMID:9918513

  1. Leishmanial phosphatase hydrolyzes phosphoproteins and inositol phosphates

    SciTech Connect

    Saha, A.K.; Das, S.; Glew, R.H.

    1986-05-01

    An extensively purified preparation of the predominant, tartrate-resistant acid phosphatase (ACP) from the external surface of Leishmania donovani promastigotes form catalyzes the dephosphorylation of several phosphoproteins; these include: pyruvate kinase, phosphorylase kinase and histones. However, the protein phosphatase activity of ACP is very low compared with that of other protein phosphates known to be involved in regulating various metabolic pathways. /sup 32/P-labelled inositoltriphosphate (IP3), a well-established second messenger derived from phosphatidylinositol-4,5-diphosphate (PIP2), was a substrate for the leishmanial acid phosphatase; incubation of the IP3 preparation with 13.2 milliunits (1 unit equals 1 ..mu..mol 4-methylumbelliferyl phosphate (MUP) cleaved per min at pH 5.5) of ACP at pH 5.5 for 4 hr resulted in hydrolysis of 75% of the radiolabelled substrate resulting in a mixture of inositoldiphosphate and inositolmonophosphate. In addition PIP2 was hydrolyzed rapidly by ACP at pH 5.5 (V/sub max/, 71 units/mg protein; k/sub m/, 4.16 ..mu..M). In contrast, to MUP which is hydrolzyed most rapidly at pH 5.5, PIP2 hydrolysis was optimal at pH 6.8. These observations raise the possibility that ACP could play a role in the host-phagocyte interaction by degrading the precursor of the second messenger, PIP2 or the second messenger itself, IP3.

  2. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  3. Phosphoproteins and protein kinases of the Golgi apparatus membrane

    SciTech Connect

    Capasso, J.M.; Abeijon, C.; Hirschberg, C.B.

    1985-11-25

    Incubation of a highly purified fraction derived from rat liver Golgi apparatus with (gamma-TSP)ATP results in phosphorylation of several endogenous phosphoproteins. One phosphoprotein with an apparent Mr of 48,300 is radiolabeled to an apparent extent at least 5-fold higher than any other phosphoprotein as part of either the Golgi apparatus or highly purified rat liver fractions derived from the rough endoplasmic reticulum, mitochondria, plasma membrane, coated vesicles, cytosol, and total homogenate. Approximately 70% of the 48.3-kDa phosphoprotein appears to be a specific extrinsic Golgi membrane protein with the phosphorylated amino acid being threonine. The protein kinase which phosphorylates the 48.3-kDa protein is an intrinsic Golgi membrane protein and is dependent on MgS , independent of CaS , calmodulin, and cAMP, and is inhibited by N-ethylmaleimide. Preliminary evidence suggests that there are also intrinsic membrane protein kinases in the Golgi apparatus which are dependent on CaS and cAMP. The physiological role of the above phosphoproteins and protein kinases is not known.

  4. Rapid, Multiplexed Phosphoprotein Profiling Using Silicon Photonic Sensor Arrays

    PubMed Central

    2015-01-01

    Extracellular signaling is commonly mediated through post-translational protein modifications that propagate messages from membrane-bound receptors to ultimately regulate gene expression. Signaling cascades are ubiquitously intertwined, and a full understanding of function can only be gleaned by observing dynamics across multiple key signaling nodes. Importantly, targets within signaling cascades often represent opportunities for therapeutic development or can serve as diagnostic biomarkers. Protein phosphorylation is a particularly important post-translational modification that controls many essential cellular signaling pathways. Not surprisingly, aberrant phosphorylation is found in many human diseases, including cancer, and phosphoprotein-based biomarker signatures hold unrealized promise for disease monitoring. Moreover, phosphoprotein analysis has wide-ranging applications across fundamental chemical biology, as many drug discovery efforts seek to target nodes within kinase signaling pathways. For both fundamental and translational applications, the analysis of phosphoprotein biomarker targets is limited by a reliance on labor-intensive and/or technically challenging methods, particularly when considering the simultaneous monitoring of multiplexed panels of phosphoprotein biomarkers. We have developed a technology based upon arrays of silicon photonic microring resonator sensors that fills this void, facilitating the rapid and automated analysis of multiple phosphoprotein levels from both cell lines and primary human tumor samples requiring only minimal sample preparation. PMID:26539563

  5. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  6. Localization of Phosphoproteins within the Barnacle Adhesive Interface.

    PubMed

    Dickinson, Gary H; Yang, Xu; Wu, Fanghui; Orihuela, Beatriz; Rittschof, Dan; Beniash, Elia

    2016-06-01

    Barnacles permanently adhere to nearly any inert substrate using proteinaceous glue. The glue consists of at least ten major proteins, some of which have been isolated and sequenced. Questions still remain about the chemical mechanisms involved in adhesion and the potential of the glue to serve as a platform for mineralization of the calcified base plate. We tested the hypothesis that barnacle glue contains phosphoproteins, which have the potential to play a role in both adhesion and mineralization. Using a combination of phosphoprotein-specific gel staining and Western blotting with anti-phosphoserine antibody, we identified multiple phosphorylated proteins in uncured glue secretions from the barnacle Amphibalanus amphitrite The protein composition of the glue and the quantity and abundance of phosphoproteins varied distinctly among individual barnacles, possibly due to cyclical changes in the glue secretion over time. We assessed the location of the phosphoproteins within the barnacle glue layer using decalcified barnacle base plates and residual glue deposited by reattached barnacles. Phosphoproteins were found throughout the organic matrix of the base plate and within the residual glue. Staining within the residual glue appeared most intensely in regions where capillary glue ducts, which are involved in cyclical release of glue, had been laid down. Lastly, mineralization studies of glue proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) indicated that proteins identified as phosphorylated possibly induce mineralization of calcium carbonate (CaCO3). These results contribute to our understanding of the protein composition of barnacle glue, and provide new insights into the potential roles of phosphoproteins in underwater bioadhesives. PMID:27365418

  7. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  8. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  9. Identification of phosphoproteins in Arabidopsis thaliana leaves using polyethylene glycol fractionation, immobilized metal-ion affinity chromatography, two-dimensional gel electrophoresis and mass spectrometry.

    PubMed

    Aryal, Uma K; Krochko, Joan E; Ross, Andrew R S

    2012-01-01

    Reversible protein phosphorylation is a key regulatory mechanism in cells. Identification and characterization of phosphoproteins requires specialized enrichment methods, due to the relatively low abundance of these proteins, and is further complicated in plants by the high abundance of Rubisco in green tissues. We present a novel method for plant phosphoproteome analysis that depletes Rubisco using polyethylene glycol fractionation and utilizes immobilized metal-ion affinity chromatography to enrich phosphoproteins. Subsequent protein separation by one- and two-dimensional gel electrophoresis is further improved by extracting the PEG-fractionated protein samples with SDS/phenol and methanol/chloroform to remove interfering compounds. Using this approach, we identified 132 phosphorylated proteins in a partial Arabidopsis leaf extract. These proteins are involved in a range of biological processes, including CO(2) fixation, protein assembly and folding, stress response, redox regulation, and cellular metabolism. Both large and small subunits of Rubisco were phosphorylated at multiple sites, and depletion of Rubisco enhanced detection of less abundant phosphoproteins, including those associated with state transitions between photosystems I and II. The discovery of a phosphorylated form of AtGRP7, a self-regulating RNA-binding protein that affects floral transition, as well as several previously uncharacterized ribosomal proteins confirm the utility of this approach for phosphoproteome analysis and its potential to increase our understanding of growth and development in plants. PMID:22092075

  10. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  11. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  12. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  13. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  14. Crystal Structure of the Nipah Virus Phosphoprotein Tetramerization Domain

    PubMed Central

    Bruhn, Jessica F.; Barnett, Katherine C.; Bibby, Jaclyn; Thomas, Jens M. H.; Keegan, Ronan M.; Rigden, Daniel J.; Bornholdt, Zachary A.

    2014-01-01

    The Nipah virus phosphoprotein (P) is multimeric and tethers the viral polymerase to the nucleocapsid. We present the crystal structure of the multimerization domain of Nipah virus P: a long, parallel, tetrameric, coiled coil with a small, α-helical cap structure. Across the paramyxoviruses, these domains share little sequence identity yet are similar in length and structural organization, suggesting a common requirement for scaffolding or spatial organization of the functions of P in the virus life cycle. PMID:24155387

  15. Enrichment and Analysis of Intact Phosphoproteins in Arabidopsis Seedlings

    PubMed Central

    Aryal, Uma K.; Ross, Andrew R. S.; Krochko, Joan E.

    2015-01-01

    Protein phosphorylation regulates diverse cellular functions and plays a key role in the early development of plants. To complement and expand upon previous investigations of protein phosphorylation in Arabidopsis seedlings we used an alternative approach that combines protein extraction under non-denaturing conditions with immobilized metal-ion affinity chromatography (IMAC) enrichment of intact phosphoproteins in Rubisco-depleted extracts, followed by identification using two-dimensional gel electrophoresis (2-DE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS). In-gel trypsin digestion and analysis of selected gel spots identified 144 phosphorylated peptides and residues, of which only18 phosphopeptides and 8 phosphosites were found in the PhosPhAt 4.0 and P3DB Arabidopsis thaliana phosphorylation site databases. More than half of the 82 identified phosphoproteins were involved in carbohydrate metabolism, photosynthesis/respiration or oxidative stress response mechanisms. Enrichment of intact phosphoproteins prior to 2-DE and LC-MS/MS appears to enhance detection of phosphorylated threonine and tyrosine residues compared with methods that utilize peptide-level enrichment, suggesting that the two approaches are somewhat complementary in terms of phosphorylation site coverage. Comparing results for young seedlings with those obtained previously for mature Arabidopsis leaves identified five proteins that are differentially phosphorylated in these tissues, demonstrating the potential of this technique for investigating the dynamics of protein phosphorylation during plant development. PMID:26158488

  16. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  17. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  18. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  19. Quantitative iTRAQ-based proteomic analysis of phosphoproteins and ABA-regulated phosphoproteins in maize leaves under osmotic stress

    PubMed Central

    Hu, Xiuli; Li, Nana; Wu, Liuji; Li, Chunqi; Li, Chaohai; Zhang, Li; Liu, Tianxue; Wang, Wei

    2015-01-01

    Abscisic acid (ABA) regulates various developmental processes and stress responses in plants. Protein phosphorylation/dephosphorylation is a central post-translational modification (PTM) in ABA signaling. However, the phosphoproteins regulated by ABA under osmotic stress remain unknown in maize. In this study, maize mutant vp5 (deficient in ABA biosynthesis) and wild-type Vp5 were used to identify leaf phosphoproteins regulated by ABA under osmotic stress. Up to 4052 phosphopeptides, corresponding to 3017 phosphoproteins, were identified by Multiplex run iTRAQ-based quantitative proteomic and LC-MS/MS methods. The 4052 phosphopeptides contained 5723 non-redundant phosphosites; 512 phosphopeptides (379 in Vp5, 133 in vp5) displayed at least a 1.5-fold change of phosphorylation level under osmotic stress, of which 40 shared common in both genotypes and were differentially regulated by ABA. Comparing the signaling pathways involved in vp5 response to osmotic stress and those that in Vp5, indicated that ABA played a vital role in regulating these pathways related to mRNA synthesis, protein synthesis and photosynthesis. Our results provide a comprehensive dataset of phosphopeptides and phosphorylation sites regulated by ABA in maize adaptation to osmotic stress. This will be helpful to elucidate the ABA-mediate mechanism of maize endurance to drought by triggering phosphorylation or dephosphorylation cascades. PMID:26503333

  20. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  1. Analysis of Blastocladiella emersonii ribosomal proteins in four two-dimensional gel electrophoresis systems.

    PubMed

    Bonato, M C; Maia, J C; Juliani, M H

    1985-01-01

    Ribosomal proteins of the aquatic fungus Blastocladiella emersonii were isolated and characterized on four different two-dimensional polyacrylamide gel electrophoresis systems. 40S and 60S ribosomal subunit proteins from zoospores were identified. The position of every protein was determined in each electrophoretic system using the "four-corners" method (Madjar et al., Molecular and General Genetics, 171: 121-134, 1979). Thirty-two and 39 proteins were identified in the 40S and 60S ribosomal subunits, respectively. The molecular weights of individual proteins in the 40S subunit ranged from 10 000 to 37 000, with a number-average molecular weight of 20 000. The molecular weight range for the 60S subunit was 13 000-51 000 with a number-average molecular weight of 21 000. Proteins from ribosomes of different cell types were compared and found to be qualitatively indistinguishable. The only consistent difference in the patterns of proteins was in the S6 protein of the 40S subunit, which is the major phosphoprotein of Blastocladiella ribosomes. PMID:3830281

  2. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  3. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  4. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  5. Mammalian Target of Rapamycin (mTOR) Activity Dependent Phospho-Protein Expression in Childhood Acute Lymphoblastic Leukemia (ALL)

    PubMed Central

    Márk, Ágnes; Hajdu, Melinda; Kenessey, István; Sticz, Tamás; Nagy, Eszter; Barna, Gábor; Váradi, Zsófia; Kovács, Gábor; Kopper, László; Csóka, Monika

    2013-01-01

    Modern treatment strategies have improved the prognosis of childhood ALL; however, treatment still fails in 25–30% of patients. Further improvement of treatment may depend on the development of targeted therapies. mTOR kinase, a central mediator of several signaling pathways, has recently attracted remarkable attention as a potential target in pediatric ALL. However, limited data exists about the activity of mTOR. In the present study, the amount of mTOR activity dependent phospho-proteins was characterized by ELISA in human leukemia cell lines and in lymphoblasts from childhood ALL patients (n = 49). Expression was measured before and during chemotherapy and at relapses. Leukemia cell lines exhibited increased mTOR activity, indicated by phospho-S6 ribosomal protein (p-S6) and phosphorylated eukaryotic initiation factor 4E binding protein (p-4EBP1). Elevated p-4EBP1 protein levels were detected in ALL samples at diagnosis; efficacy of chemotherapy was followed by the decrease of mTOR activity dependent protein phosphorylation. Optical density (OD) for p-4EBP1 (ELISA) was significantly higher in patients with poor prognosis at diagnosis, and in the samples of relapsed patients. Our results suggest that measuring mTOR activity related phospho-proteins such as p-4EBP1 by ELISA may help to identify patients with poor prognosis before treatment, and to detect early relapses. Determining mTOR activity in leukemic cells may also be a useful tool for selecting patients who may benefit from future mTOR inhibitor treatments. PMID:23573198

  6. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  7. Studies in pig heart tissue on various 60,000 Da phosphoproteins.

    PubMed

    Guesdon, F; David-Pfeuty, T

    1989-03-01

    Pig heart tissue have been shown to contain 3 different 60,000 Da phosphoproteins. Different purification procedures were used in order to separate them, suggesting that the 3 phosphoproteins differ in their environmental parameters. The 2 major ones appear essentially as peripheral phosphoproteins that are associated with cellular membranes through ionic forces, whereas the third minor phosphoprotein behaves as an integral plasma membrane protein. The three phosphoproteins also differ in their relative amount of phosphorylated serine, threonine and tyrosine residues after in vitro protein kinase assay. Evidence that the 3 phosphoproteins are related arises from the similarity between their respective phosphopeptide maps after partial hydrolysis with proteases, an experiment that also points out relatedness in primary structure between them and the transforming protein of Rous sarcoma virus, pp60v-src. The 3 phosphoproteins, however, do not appear to be immunologically related to pp60v-src since none of them is immunoprecipitated by sera that precipitate pp60v-src. The possibility that the three 60,000 Da phosphoproteins under study represent 3 differentially localized and phosphorylated products of c-src and/or c-src related genes is discussed. PMID:2472841

  8. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia

    1998-01-01

    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  9. Preparation of a novel Zr(4+)-immobilized metal affinity membrane for selective adsorption of phosphoprotein.

    PubMed

    He, Maofang; Wang, Chaozhan; Wei, Yinmao

    2016-09-01

    In this study, a novel phosphate-Zr(4+) immobilized metal affinity membrane (IMAM) was prepared based on the surface initiated-atom transfer radical polymerization technique for the selective adsorption of phosphoprotein. The adsorption capacity and selectivity of the phosphate-Zr(4+) IMAM were evaluated by using the mixture of standard phosphoproteins (β-casein, ovalbumin) and nonphosphoproteins (bovine serum albumin and lysozyme) as model samples. The adsorption isotherms and competitive adsorption results demonstrated that the phosphate-Zr(4+) IMAM had higher binding capacity and selectivity for phosphoproteins over nonphosphoproteins. Moreover, the phosphate-Zr(4+) IMAM exhibited good re-usability and re-productivity. Finally, the phosphate-Zr(4+) IMAM was applied to separate phosphoprotein from real samples with high purity. Therefore, the as-prepared phosphate-Zr(4+) IMAM could be a promising affinity material for the efficient enrichment of phosphoprotein from complex bio-samples. PMID:27433983

  10. Role of presynaptic phosphoprotein synapsin II in schizophrenia

    PubMed Central

    Molinaro, Luke; Hui, Patricia; Tan, Mattea; Mishra, Ram K

    2015-01-01

    Synapsin II is a member of the neuronal phosphoprotein family. These phosphoproteins are evolutionarily conserved across many organisms and are important in a variety of synaptic functions, including synaptogenesis and the regulation of neurotransmitter release. A number of genome-wide scans, meta-analyses, and genetic susceptibility studies have implicated the synapsin II gene (3p25) in the etiology of schizophrenia (SZ) and other psychiatric disorders. Further studies have found a reduction of synapsin II mRNA and protein in the prefrontal cortex in post-mortem samples from schizophrenic patients. Disruptions in the expression of this gene may cause synaptic dysfunction, which can result in neurotransmitter imbalances, likely contributing to the pathogenesis of SZ. SZ is a costly, debilitating psychiatric illness affecting approximately 1.1% of the world’s population, amounting to 51 million people today. The disorder is characterized by positive (hallucinations, paranoia), negative (social withdrawal, lack of motivation), and cognitive (memory impairments, attention deficits) symptoms. This review provides a comprehensive summary of the structure, function, and involvement of the synapsin family, specifically synapsin II, in the pathophysiology of SZ and possible target for therapeutic intervention/implications. PMID:26425441

  11. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  12. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  13. Phosphoprotein Isotope-coded Affinity Tags: Application to the Enrichment and Identification of Low-Abundance Phosphoproteins

    SciTech Connect

    Goshe, Michael; Veenstra, Timothy D. ); Panisko, Ellen A.; Conrads, Thomas P. ); Angell, Nicolas H.; Smith, Richard D. )

    2002-02-01

    A novel approach using different isotopic labeling and biotinylation has been developed for the enrichment and quantitation of phosphoseryl and phosphothreonyl-peptides. The phosphoprotein isotope-coded affinity tag (PhIAT) exploits the high affinity biotin-avidin interaction to isolate modified phosphopeptides from a complex mixture of peptides. The PhIAT strategy for quantifying and enriching mixtures for phosphopeptides was demonstrated using a commercially available sample of the phosphoprotein B-casein. A denatured solution of B-casein was labeled using the PhIAT method and after proteolytic digestion, the labeled peptides were isolated using immobilize avidin. The recovered peptides were separated by capillary reversed-phase liquid chromatography and identified by tandem mass spectrometry. PhIAT-labeled peptides corresponding to known O-phosphorylated peptides from B-casein were identified as were phosphorylated peptides from as1-casein and ase-casein, known low-level (< 5%) contaminants of commercially available B-casein. All of the identified phosphopeptides from these caseins have been previously documented to be phosphorylated at the sites elucidated by the PhIAT approach. The results illustrate the efficancy of the PhIAT-labeling strategy to enrich mixtures for phosphopeptides and permit the detection and identification of low abundance phosphopeptides. In addition, experiments using light and heavy isotopic version of the PhIAT reagents demonstrated that a 10% difference in phosphorylation state could be determined between phosphopeptides in comparative samples.

  14. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  15. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  16. An integrated workflow for characterizing intact phosphoproteins from complex mixtures

    SciTech Connect

    Wu, Si; Yang, Feng; Zhao, Rui; Tolic, Nikola; Robinson, Errol W.; Camp, David G.; Smith, Richard D.; Pasa-Tolic, Ljiljana

    2009-05-08

    The phosphorylation of any site on a given protein can affect its activity, degradation rate, ability to dock with other proteins or bind divalent cations, and/or its localization. These effects can operate within the same protein; in fact, multisite phosphorylation is a key mechanism for achieving signal integration in cells. Hence, knowing the overall phosphorylation signature of a protein is essential for understanding the "state" of a cell. However, current technologies to monitor the phosphorylation status of proteins are inefficient at determining the relative stoichiometries of phosphorylation at multiple sites. Here we report a new capability for comprehensive liquid chromatography-mass spectrometry (LC-MS) analysis of intact phosphoproteins. The technology platform built upon integrated bottom-up and top-down approach that is facilitated by intact protein reversed-phase (RP)LC concurrently coupled with Fourier transform ion cyclotron resonance (FTICR) MS and fraction collection.

  17. Selective adsorption of phosphoproteins on gel-immobilized ferric chelate

    SciTech Connect

    Muszynska, G.; Andersson, L.; Porath, J.

    1986-11-04

    Ferric ions are very strongly adsorbed to iminodiacetic acid substituted agarose. This firmly immobilized complex acts as a selective immobilized metal affinity adsorbent for phosphoproteins. Chromatography based on this principle is illustrated by the adsorption-desorption behavior of egg yolk phosvitin before and after dephosphorylation as well as by the change in the chromatographic pattern before and after enzymic phosphorylation of selected histones. The strength of binding is dependent on the phosphate content. The difference is binding before and after phosphorylation of a single amino acid residue is demonstrated. Affinity elution can be accomplished by inclusion in the buffer of (1) phosphoserine or (2) a displacing metal ion such as Mg/sup 2 +/.

  18. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells

    PubMed Central

    Abbasian, Nima; Burton, James O.; Herbert, Karl E.; Tregunna, Barbara-Emily; Brown, Jeremy R.; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J.; Goodall, Alison H.

    2015-01-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  19. Hyperphosphatemia, Phosphoprotein Phosphatases, and Microparticle Release in Vascular Endothelial Cells.

    PubMed

    Abbasian, Nima; Burton, James O; Herbert, Karl E; Tregunna, Barbara-Emily; Brown, Jeremy R; Ghaderi-Najafabadi, Maryam; Brunskill, Nigel J; Goodall, Alison H; Bevington, Alan

    2015-09-01

    Hyperphosphatemia in patients with advanced CKD is thought to be an important contributor to cardiovascular risk, in part because of endothelial cell (EC) dysfunction induced by inorganic phosphate (Pi). Such patients also have an elevated circulating concentration of procoagulant endothelial microparticles (MPs), leading to a prothrombotic state, which may contribute to acute occlusive events. We hypothesized that hyperphosphatemia leads to MP formation from ECs through an elevation of intracellular Pi concentration, which directly inhibits phosphoprotein phosphatases, triggering a global increase in phosphorylation and cytoskeletal changes. In cultured human ECs (EAhy926), incubation with elevated extracellular Pi (2.5 mM) led to a rise in intracellular Pi concentration within 90 minutes. This was mediated by PiT1/slc20a1 Pi transporters and led to global accumulation of tyrosine- and serine/threonine-phosphorylated proteins, a marked increase in cellular Tropomyosin-3, plasma membrane blebbing, and release of 0.1- to 1-μm-diameter MPs. The effect of Pi was independent of oxidative stress or apoptosis. Similarly, global inhibition of phosphoprotein phosphatases with orthovanadate or fluoride yielded a global protein phosphorylation response and rapid release of MPs. The Pi-induced MPs expressed VE-cadherin and superficial phosphatidylserine, and in a thrombin generation assay, they displayed significantly more procoagulant activity than particles derived from cells incubated in medium with a physiologic level of Pi (1 mM). These data show a mechanism of Pi-induced cellular stress and signaling, which may be widely applicable in mammalian cells, and in ECs, it provides a novel pathologic link between hyperphosphatemia, generation of MPs, and thrombotic risk. PMID:25745026

  20. An integrated workflow for characterizing intact phosphoproteins from complex mixtures

    PubMed Central

    Wu, Si; Yang, Feng; Zhao, Rui; Tolić, Nikola; Robinson, Errol W.; Camp, David; Smith, Richard D.; Paša-Tolić, Ljiljana

    2014-01-01

    The phosphorylation of any site on a given protein can affect its activity, degradation rate, ability to dock with other proteins or bind divalent cations, and/or its localization. These effects can operate within the same protein; in fact, multisite phosphorylation is a key mechanism for achieving signal integration in cells. Hence, knowing the overall phosphorylation signature of a protein is essential for understanding the "state" of a cell. However, current technologies to monitor the phosphorylation status of proteins are inefficient at determining the relative stoichiometries of phosphorylation at multiple sites. Here we report a new capability for comprehensive liquid chromatography mass spectrometry (LC/MS) analysis of intact phosphoproteins. The technology platform built upon integrated bottom-up and top-down approach that is facilitated by intact protein reversed-phase (RP)LC concurrently coupled with Fourier transform ion cyclotron resonance (FTICR) MS and fraction collection. As the use of conventional RPLC systems for phosphopeptide identification has proven challenging due to the formation of metal ion complexes at various metal surfaces during LC/MS and ESI-MS analysis, we have developed a “metal-free” RPLC-ESI-MS platform for phosphoprotein characterization. This platform demonstrated a significant sensitivity enhancement for phosphorylated casein proteins enriched from a standard protein mixture and revealed the presence of over 20 casein isoforms arising from genetic variants with varying numbers of phosphorylation sites. The integrated workflow was also applied to an enriched yeast phosphoproteome to evaluate the feasibility of this strategy for characterizing complex biological systems, and revealed ~16% of the detected yeast proteins to have multiple phosphorylation isoforms. Intact protein LC/MS platform for characterization of combinatorial posttranslational modifications (PTMs), with special emphasis on multisite phosphorylation, holds

  1. Comparison of phosphoprotein isolated from mature and immature human tooth roots.

    PubMed

    McCurdy, S P; Clarkson, B H; Feagin, F F

    1992-12-01

    Mature (average patient age = 29.5 yr, closed apical foramen) and immature (average patient age = 17.5 yr, open apical foramen) root shards were placed in dialysis tubing and demineralized to completion using either 10% disodium EDTA plus protease inhibitors or 0.6 N HCl. The demineralized shards were re-extracted (five times) with 0.05 M tris-HCl, 1.0 M NaCl and then collagenase digested. No major differences were observed in chromatograms of extracts, re-extracts or collagenase digests from root shards demineralized in either way. In contrast, chromatograms of immature and mature roots showed qualitative differences. Chromatograms of mature roots demineralized in either way showed broader protein peaks and less organic phosphorus than those from immature tooth roots. A distinct band amid degraded phosphoprotein (150 K) was found in SDS-PAGE gels (7.5%) from EDTA-extracted immature tooth roots but not from mature tooth roots. Electroelution of this band revealed a typical phosphoprotein amino-acid profile containing increased aspartic acid and serine residues. Comparison of the total phosphoprotein and amino acid composition of extracts, re-extracts and collagenase digests revealed that phosphoprotein, serine and to a lesser extent aspartic acid were recovered in greater quantities from immature roots than mature tooth roots. These data suggest that the degree of maturation is crucial to the isolation of an intact phosphoprotein and provides additional evidence that human dentine phosphoprotein undergoes amino acid compositional changes during maturation. PMID:1471954

  2. A new fluorescent quenching method for the determination of phosphoproteins by using calconcarboxylic acid.

    PubMed

    Zhu, Zhongxin; Zhu, Xinliang; Shen, Jiayi; Zhou, Ayi; Ni, Maowei; Jin, Litai; Cong, Weitao

    2015-03-01

    A fluorescent quenching detection method for phosphoproteins in SDS-PAGE by using calconcarboxylic acid (CCA) was described. In this method, the fluorescence intensity of CCA was greatly increased with the presence of Al(3+) in the gel background, while in zones where phosphoproteins are located this intensity was absent because of fluorescence quenching phenomenon through the formation of CCA-Al(3+) -phosphoprotein appended complex. Approximately 4-8 ng of phosphoproteins can be selectively detected within 1 h (1D SDS-PAGE), which is similar to that of the most commonly used Pro-Q Diamond stain. The specificity of this novel technique for phosphoproteins was confirmed by dephosphorylation, Western blot, and LC-MS/MS analysis, respectively. Furthermore, to better understand the newly developed method, the detection mechanism of CCA stain was explored by fluorescent spectrometry. According to the results, it is believed that CCA stain may provide a new choice for selective, economical, MS compatible, and convenient visualization of gel-separated phosphoproteins. PMID:25546259

  3. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  4. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  5. Transgenic Expression of Dentin Phosphoprotein Inhibits Skeletal Development

    PubMed Central

    Zhang, H.; Liu, P.; Wang, S.; Liu, C.; Jani, P.; Lu, Y.; Qin, C.

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is proteolytically processed into an NH2-terminal fragment called dentin sialoprotein (DSP) and a COOH-terminal fragment known as dentin phosphoprotein (DPP). These two fragments are believed to perform distinct roles in formation of bone and dentin. To investigate the functions of DPP in skeletal development, we generated transgenic mice to overexpress hemagglutinin (HA)-tagged DPP under the control of a 3.6 kb type I collagen (Col1a1) promoter (designated as Col1a1-HA-DPP). The Col1a1-HA-DPP transgenic mice were significantly smaller by weight, had smaller skeletons and shorter long bones than their wild type littermates, as demonstrated by X-ray radiography. They displayed reduced trabecular bone formation and narrower zones of proliferative and hypertrophic chondrocytes in the growth plates of the long bones. Histological analyses showed that the transgenic mice had reduced cell proliferation in the proliferating zone, but lacked obvious defects in the chondrocyte differentiation. In addition, the transgenic mice with a high level of transgene expression developed spontaneous long bone fractures. In conclusion, overexpressing DPP inhibited skeletal development, suggesting that the balanced actions between the NH2- and COOH-terminal fragments of DSPP may be required for normal skeletal development. PMID:26972716

  6. Transgenic expression of dentin phosphoprotein inhibits skeletal development.

    PubMed

    Zhang, H; Liu, P; Wang, S; Liu, C; Jani, P; Lu, Y; Qin, C

    2016-01-01

    Dentin sialophosphoprotein (DSPP) is proteolytically processed into an NH2-terminal fragment called dentin sialoprotein (DSP) and a COOH-terminal fragment known as dentin phosphoprotein (DPP). These two fragments are believed to perform distinct roles in formation of bone and dentin. To investigate the functions of DPP in skeletal development, we generated transgenic mice to overexpress hemagglutinin (HA)-tagged DPP under the control of a 3.6 kb type I collagen (Col1a1) promoter (designated as Col1a1-HA-DPP). The Col1a1-HA-DPP transgenic mice were significantly smaller by weight, had smaller skeletons and shorter long bones than their wild type littermates, as demonstrated by X-ray radiography. They displayed reduced trabecular bone formation and narrower zones of proliferative and hypertrophic chondrocytes in the growth plates of the long bones. Histological analyses showed that the transgenic mice had reduced cell proliferation in the proliferating zone, but lacked obvious defects in the chondrocyte differentiation. In addition, the transgenic mice with a high level of transgene expression developed spontaneous long bone fractures. In conclusion, overexpressing DPP inhibited skeletal development, suggesting that the balanced actions between the NH2- and COOH-terminal fragments of DSPP may be required for normal skeletal development. PMID:26972716

  7. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  8. Proteomic Analysis of Phosphoproteins in the Rice Nucleus During the Early Stage of Seed Germination.

    PubMed

    Li, Ming; Yin, Xiaojian; Sakata, Katsumi; Yang, Pingfang; Komatsu, Setsuko

    2015-07-01

    The early stage of seed germination is the first step in the plant life cycle without visible morphological change. To investigate the mechanism controlling the early stage of rice seed germination, we performed gel-and label-free nuclear phosphoproteomics. A total of 3467 phosphopeptides belonging to 102 nuclear phosphoproteins from rice embryos were identified. Protein-synthesis-related proteins were mainly phosphorylated. During the first 24 h following imbibition, 115 nuclear phosphoproteins were identified, and significant changes in the phosphorylation level over time were observed in 29 phosphoproteins. Cluster analysis indicated that nucleotide-binding proteins and zinc finger CCCH- and BED-type proteins increased in abundance during the first 12 h of imbibition and then decreased. The in silico protein-protein interactions for 29 nuclear phosphoproteins indicated that the Sas10/Utp3 protein, which functions in snoRNA binding and gene silencing, was the center of the phosphoprotein network in nuclei. The germination rate of seeds was significantly slowed with phosphatase inhibitor treatment. The mRNA expression of the zinc finger CCCH-type protein did not change, and the zinc finger BED-type protein was upregulated in rice embryos during the early stage of germination with phosphatase inhibitor treatment. These results suggest that the phosphorylation and dephosphorylation of nuclear proteins are involved in rice seed germination. Furthermore, transcription factors such as zinc finger CCCH- and BED-type proteins might play a key role through nuclear phosphoproteins, and Sas10/Utp3 protein might interact with nuclear phosphoproteins in rice embryos to mediate the early stage of seed germination. PMID:26035336

  9. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  10. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  11. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  12. Lymphocyte phosphatase-associated phosphoprotein proteoforms analyzed using monoclonal antibodies

    PubMed Central

    Filatov, Alexander; Kruglova, Natalia; Meshkova, Tatiana; Mazurov, Dmitriy

    2015-01-01

    Phosphatase CD45 regulates the activation of lymphocytes by controlling the level of receptor and signal molecule phosphorylation. However, it remains unknown which molecules mediate the phosphatase activity of CD45. A candidate for such a molecule is a small transmembrane adapter protein called lymphocyte phosphatase-associated phosphoprotein (LPAP). LPAP forms a supramolecular complex that consists of not only CD45 molecule but also CD4 and Lck kinase. The function of LPAP has not been defined clearly. In our study, we determined the pattern of LPAP expression in various cell types and characterized its proteoforms using new monoclonal antibodies generated against the intracellular portion of the protein. We show that LPAP is a pan-lymphocyte marker, and its expression in cells correlates with the expression of CD45. The majority of T, B and NK cells express high levels of LPAP, whereas monocytes, granulocytes, monocyte-derived dendritic cells, platelets and red blood cells are negative for LPAP. Using one- and two-dimensional protein gel electrophoresis, we demonstrate that LPAP has at least four sites of phosphorylation. The resting cells express at least six different LPAP phosphoforms representing mono-, di- and tri-phosphorylated LPAP. T and B cells differ in the distribution of the protein between phosphoforms. The activation of lymphocytes with PMA reduces the diversity of phosphorylated forms. Our experiments on Lck-deficient Jurkat cells show that Lck kinase is not involved in LPAP phosphorylation. Thus, LPAP is a dynamically phosphorylated protein, the function of which can be understood, when all phosphosites and kinases involved in its phosphorylation will be identified. PMID:26682052

  13. Phosphoprotein Stability in Clinical Tissue and Its Relevance for Reverse Phase Protein Microarray Technology

    PubMed Central

    Espina, Virginia; Mueller, Claudius; Liotta, Lance A.

    2013-01-01

    Phosphorylated proteins reflect the activity of specific cell signaling nodes in biological kinase protein networks. Cell signaling pathways can be either activated or deactivated depending on the phosphorylation state of the constituent proteins. The state of these kinase pathways reflects the in vivo activity of the cells and tissue at any given point in time. As such, cell signaling pathway information can be extrapolated to infer which phosphorylated proteins/pathways are driving an individual tumor’s growth. Reverse Phase Protein Microarrays (RPMA) are a sensitive and precise platform that can be applied to the quantitative measurement of hundreds of phosphorylated signal proteins from a small sample of tissue. Pre-analytical variability originating from tissue procurement and preservation may cause significant variability and bias in downstream molecular analysis. Depending on the ex vivo delay time in tissue processing, and the manner of tissue handling, protein biomarkers such as signal pathway phosphoproteins will be elevated or suppressed in a manner that does not represent the biomarker levels at the time of excision. Consequently, assessment of the state of these kinase networks requires stabilization, or preservation, of the phosphoproteins immediately post tissue procurement. We have employed reverse phase protein microarray analysis of phosphoproteins to study the factors influencing stability of phosphoproteins in tissue following procurement. Based on this analysis we have established tissue procurement guidelines for clinical research with an emphasis on quantifying phosphoproteins by RPMA. PMID:21901591

  14. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  15. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  16. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  17. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  18. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  19. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  20. PCPP-260, PURKINJE CELL-SPECIFIC CYCLE AMP-REGULATED MEMBRANE PHOSPHOPROTEIN OF (M SUB R) 260,000

    EPA Science Inventory

    The present study reports the existence of Purkinje cell-specific phosphoprotein, Mr260,000 (PCPP-260), a neuronal membrance phosphoprotein, in cerebellar Purkinje cells. PCPP-260, which on sodium dodecyl sulfate-polyacrylamide gel electrophoresis has an apparaent molecular mass ...

  1. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  2. Molecular evolution of dentin phosphoprotein among toothed and toothless animals

    PubMed Central

    2009-01-01

    Background Dentin sialophosphoprotein (DSPP) is the largest member of the SIBLING family and is the most abundant noncollagenous protein in dentin. DSPP is also expressed in non-mineralized tissues including metabolically active ductal epithelia and some cancers. Its function, however, is poorly defined. The carboxy-terminal fragment, dentin phosphoprotein (DPP) is encoded predominantly by a large repetitive domain that requires separate cloning/sequencing reactions and is, therefore, often incomplete in genomic databases. Comparison of DPP sequences from at least one member of each major branch in the mammalian evolutionary tree (including some "toothless" mammals) as well as one reptile and bird may help delineate its possible functions in both dentin and ductal epithelia. Results The BMP1-cleavage and translation-termination domains were sufficiently conserved to permit amplification/cloning/sequencing of most species' DPP. While the integrin-binding domain, RGD, was present in about half of species, only vestigial remnants of this tripeptide were identified in the others. The number of tandem repeats of the nominal SerSerAsp phosphorylation motif in toothed mammals (including baleen whale and platypus which lack teeth as adults), ranged from ~75 (elephant) to >230 (human). These repeats were not perfect, however, and patterns of intervening sequences highlight the rapidity of changes among even closely related species. Two toothless anteater species have evolved different sets of nonsense mutations shortly after their BMP1 motifs suggesting that while cleavage may be important for DSPP processing in other tissues, the DPP domain itself may be required only in dentin. The lizard DSPP had an intact BMP1 site, a remnant RGD motif, as well as a distinctly different Ser/Asp-rich domain compared to mammals. Conclusions The DPP domain of DSPP was found to change dramatically within mammals and was lost in two truly toothless animals. The defining aspect of DPP, the

  3. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  4. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  5. Phosphoprotein extraction from the dentine/cementum complex of human tooth roots.

    PubMed

    McCurdy, S P; Clarkson, B H; Speirs, R L; Feagin, F F

    1990-01-01

    Root shards were placed in dialysis tubing and demineralized to completion in either 10% disodium EDTA, pH 7.4, 0.6 M HCl, 0.1 M HCl, 0.5 M acetic or 75 mM-25 mM lactic-acetic acids. The demineralized shards were then re-extracted with 0.05 M tris-HCl, 1.0 M NaCl. DEAE chromatography revealed that the major peak of the 0.6 M CHl and EDTA extracts contained organic phosphorus, whereas much less organic phosphorus was found in the major peak of the 0.1 M HCl extract. Analysis of the re-extracts gave a pattern opposite to that obtained from the initial extractions. Measurements of protein and organic phosphorus released during extraction and re-extraction confirmed these results. Staining of SDS-PAGE gels for phosphoprotein with Stains-All resulted in a blue smear in fractions containing organic phosphorus. Thus the extraction of phosphoproteins from human tooth roots differed depending upon the demineralizing conditions. This ability to remove phosphoprotein differentially will allow further investigation of the role of phosphoprotein in mineralization and remineralization. PMID:2115325

  6. SIMILARITIES BETWEEN PROTEIN IIIA AND PROTEIN IIIB, TWO PROMINENT SYNAPTIC VESICLE-ASSOCIATED PHOSPHOPROTEINS (JOURNAL VERSION)

    EPA Science Inventory

    Protein IIIa (Mr 74,000) and protein IIIb (Mr 55,000) are two major phosphoproteins found in mammalian brain. It was previously shown in intact nerve cells that the phosphorylation state of these two proteins could be increased by electrical stimulation, by depolarizing agents in...

  7. PROTEIN III, A NEURON-SPECIFIC PHOSPHOPROTEIN: VARIANT FORMS FOUND IN HUMAN BRAIN

    EPA Science Inventory

    Recent work in the laboratory has shown the presence of many neuron-specific phosphoproteins in the mammalian nervous system. Two of these proteins, Protein III and Synapsin I, are specifically associated with synaptic vesicles in neurons throughout the brain. Protein III consist...

  8. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  9. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  10. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  11. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  12. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  13. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  14. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  15. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  16. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  17. Three-Dimensional Distribution of UBF and Nopp140 in Relationship to Ribosomal DNA Transcription During Mouse Preimplantation Development.

    PubMed

    Koné, Maïmouna Coura; Fleurot, Renaud; Chebrout, Martine; Debey, Pascale; Beaujean, Nathalie; Bonnet-Garnier, Amélie

    2016-04-01

    The nucleolus is a dynamic nuclear compartment that is mostly involved in ribosome subunit biogenesis; however, it may also play a role in many other biological processes, such as stress response and the cell cycle. Mainly using electron microscopy, several studies have tried to decipher how active nucleoli are set up during early development in mice. In this study, we analyzed nucleologenesis during mouse early embryonic development using 3D-immunofluorescent detection of UBF and Nopp140, two proteins associated with different nucleolar compartments. UBF is a transcription factor that helps maintain the euchromatic state of ribosomal genes; Nopp140 is a phosphoprotein that has been implicated in pre-rRNA processing. First, using detailed image analyses and the in situ proximity ligation assay technique, we demonstrate that UBF and Nopp140 dynamic redistribution between the two-cell and blastocyst stages (time of implantation) is correlated with morphological and structural modifications that occur in embryonic nucleolar compartments. Our results also support the hypothesis that nucleoli develop at the periphery of nucleolar precursor bodies. Finally, we show that the RNA polymerase I inhibitor CX-5461: 1) disrupts transcriptional activity, 2) alters preimplantation development, and 3) leads to a complete reorganization of UBF and Nopp140 distribution. Altogether, our results underscore that highly dynamic changes are occurring in the nucleoli of embryos and confirm a close link between ribosomal gene transcription and nucleologenesis during the early stages of development. PMID:26984997

  18. NEURON-SPECIFIC PHOSPHOPROTEINS AS BIOCHEMICAL INDICATORS OF NEUROTOXICITY: EFFECTS OF ACUTE ADMINISTRATION OF TRIMETHYLTIN TO THE ADULT RAT

    EPA Science Inventory

    The cytoarchitecture of the adult central nervous system is expressed by proteins specific to individual cell types. In this investigation, a subclass of these proteins, the neuron-specific phosphoproteins, was examined after the administration of trimethyltin (TMT), a neurotoxic...

  19. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  20. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  1. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  2. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  3. Critical roles of specimen type and temperature before and during fixation in the detection of phosphoproteins in breast cancer tissues.

    PubMed

    Gündisch, Sibylle; Annaratone, Laura; Beese, Christian; Drecol, Enken; Marchiò, Caterina; Quaglino, Elena; Sapino, Anna; Becker, Karl-Friedrich; Bussolati, Gianni

    2015-05-01

    The most efficient approach for therapy selection to inhibit the deregulated kinases in cancer tissues is to measure their phosphorylation status prior to the treatment. The aim of our study was to evaluate the influence of pre-analytical parameters (cold ischemia time, temperature before and during tissue fixation, and sample type) on the levels of proteins and phosphoproteins in breast cancer tissues, focusing on the PI3 kinase/AKT pathway. The BALB-neuT mouse breast cancer model expressing HER2 and pAKT proteins and human biopsy and resection specimens were analyzed. By using quantitative reverse phase protein arrays (RPPA), 9 proteins and 16 phosphoproteins relevant to breast cancer biology were assessed. Cold temperatures before and during fixation resulted in a marked improvement in the preservation of the reactivity of biological markers (eg, ER, HER2) in general and, specifically, pHER2 and pAKT. Some phosphoproteins, eg, pHER2 and pAKT, were more sensitive to prolonged cold ischemia times than others (eg, pS6RP and pSTAT5). By comparing the phosphoprotein levels in core needle biopsies with those in resection specimens, we found a marked decrease in many phosphoproteins in the latter. Cold conditions can improve the preservation of proteins and phosphoproteins in breast cancer tissues. Biopsies ≤ 1 mm in size are the preferred sample type for assessing the activity of deregulated kinases for personalized cancer treatments because the phosphoprotein levels are better preserved compared with resection specimens. Each potential new (phospho)protein biomarker should be tested for its sensitivity to pre-analytical processing prior to the development of a diagnostic assay. PMID:25730369

  4. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  5. Identification of the 64 kilodalton chloroplast stromal phosphoprotein as phosphoglucomutase. [Pisum sativum

    SciTech Connect

    Salvucci, M.E.; Drake, R.R.; Broadbent, K.P.; Haley, B.E. ); Hanson, K.R.; McHale, N.A. )

    1990-05-01

    Phosphorylation of the 64 kilodalton stromal phosphoprotein by incubation of pea (Pisum sativum) chloroplast extracts with ({gamma}-{sup 32}P)ATP decreased in the presence of Glc-6-P and Glc-1,6-P{sub 2}, but was stimulated by glucose. Two-dimensional gel electrophoresis following incubation of intact chloroplasts and stromal extracts with ({gamma}-{sup 32}P)ATP, or incubation of stromal extracts and partially purified phosphoglucomutase (EC 2.7.5.1) with ({sup 32}P)Glc-1-P showed that the identical 64 kilodalton polypeptide was labeled. A 62 kilodalton polypeptide was phosphorylated by incubation of tobacco (Nicotiana sylvestris) stromal extracts with either ({gamma}-{sup 32}P)ATP or ({sup 32}P)Glc-1-P. In contrast, an analogous polypeptide was not phosphorylated in extracts from a tobacco mutant deficient in plastid phosphoglucomutase activity. The results indicate that the 64 (or 62) kilodalton chloroplast stromal phosphoprotein is phosphoglucomutase.

  6. Atrazine Affects Phosphoprotein and Protein Expression in MCF-10A Human Breast Epithelial Cells

    PubMed Central

    Huang, Peixin; Yang, John; Song, Qisheng; Sheehan, David

    2014-01-01

    Atrazine, a member of the 2-chloro-s-triazine family of herbicides, is the most widely used pesticide in the world and often detected in agriculture watersheds. Although it was generally considered as an endocrine disruptor, posing a potential threat to human health, the molecular mechanisms of atrazine effects remain unclear. Using two-dimensional gel electrophoresis, we identified a panel of differentially expressed phosphoproteins and total proteins in human breast epithelial MCF-10A cells after being exposed to environmentally relevant concentrations of atrazine. Atrazine treatments for 6 h resulted in differential expression of 4 phosphoproteins and 8 total-proteins as compared to the control cells (>1.5-fold, p < 0.05). MALDI-TOF MS/MS analysis revealed that the differentially expressed proteins belong to various cellular compartments (nucleus, cytosol, membrane) and varied in function, including those regulating the stress response such as peroxiredoxin I, HSP70 and HSP27; structural proteins such as tropomyosin and profilin 1; and oncogenesis proteins such as ANP32A. Six of the 12 identified proteins were verified by quantitative PCR for their transcript levels. The most up-regulated phosphoprotein by atrazine treatment, ANP32A, was further analyzed for its expression, distribution and cellular localization using Western blot and immunocytochemical approaches. The results revealed that ANP32 expression after atrazine treatment increased dose and time dependently and was primarily located in the nucleus. This study may provide new evidence on the potential toxicity of atrazine in human cells. PMID:25275270

  7. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    PubMed

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. PMID:26083784

  8. Quantitative Phosphoproteomics Analysis of Nitric Oxide–Responsive Phosphoproteins in Cotton Leaf

    PubMed Central

    Song, Meizhen; Pang, Chaoyou; Wei, Hengling; Liu, Ji; Zhan, Xianjin; Lan, Jiayang; Feng, Changhui; Zhang, Shengxi; Yu, Shuxun

    2014-01-01

    Knowledge of phosphorylation events and their regulation is crucial to understanding the functional biology of plant proteins, but very little is currently known about nitric oxide–responsive phosphorylation in plants. Here, we report the first large-scale, quantitative phosphoproteome analysis of cotton (Gossypium hirsutum) treated with sodium nitroprusside (nitric oxide donor) by utilizing the isobaric tag for relative and absolute quantitation (iTRAQ) method. A total of 1315 unique phosphopeptides, spanning 1528 non-redundant phosphorylation sites, were detected from 1020 cotton phosphoproteins. Among them, 183 phosphopeptides corresponding to 167 phosphoproteins were found to be differentially phosphorylated in response to sodium nitroprusside. Several of the phosphorylation sites that we identified, including RQxS, DSxE, TxxxxSP and SPxT, have not, to our knowledge, been reported to be protein kinase sites in other species. The phosphoproteins identified are involved in a wide range of cellular processes, including signal transduction, RNA metabolism, intracellular transport and so on. This study reveals unique features of the cotton phosphoproteome and provides new insight into the biochemical pathways that are regulated by nitric oxide. PMID:24714030

  9. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana

    PubMed Central

    Lassowskat, Ines; Böttcher, Christoph; Eschen-Lippold, Lennart; Scheel, Dierk; Lee, Justin

    2014-01-01

    Mitogen-activated protein kinases (MAPKs) target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3, and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses) is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phospho)proteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g., WRKY transcription factors and proteins encoded by the genes from the “PEN” pathway required for penetration resistance to filamentous pathogens). Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org). PMID:25368622

  10. Structures of nuclear phosphoproteins characteristic of rapidly growing HeLa cells

    SciTech Connect

    Arezzo, F.; Choi, Y.C.

    1986-05-01

    To study characteristic events of phosphorylation in cell growth, phosphoproteins were labeled with (/sup 32/P)-phosphate at mid-logarithmic phase of HeLa cell proliferation. Among a number of nuclear phosphoproteins isolated, three characteristic classes of most highly labeled phosphoproteins were identified by DEAE-column chromatography (0.2-0.25 M NaCl gradient, pH 6.0), followed by 7.5% SDS polyacrylamide gel electrophoresis. Chemical characterization of their structures showed that they contained three different forms of post-translational modifications: Class I with phosphoserine, Class II with phosphoserine and oligonulceotides (5-10 nucleotides long), and Class III with phosphoserine, 5'-GMP and poly(ADP-ribose). Class I is represented by nucleolar C-23. Class II is represented by nucleolar 125 kDa and nucleoplasmic 50 kDa with GC rich sequences (G = 30%, C = 40%) and 5'-linking pCp. Class III is represented by nucleoplasmic poly(ADP-ribose) proteins (18 different species, MW ranges 30 kDa-200 kDa) with branched poly(ADP-ribose) longer than tRNA. When HeLa cells were labeled at non-mid-logarithmic phase, labeling of these classes were 4 fold less efficient, indicating their functional importance in cell proliferation.

  11. Large-scale comparative phosphoprotein analysis of maize seedling leaves during greening.

    PubMed

    Ning, De-Li; Liu, Ke-Hui; Liu, Chang-Cai; Liu, Jin-Wen; Qian, Chun-Rong; Yu, Yang; Wang, Yue-Feng; Wang, Ying-Chun; Wang, Bai-Chen

    2016-02-01

    MAIN CONCLUSION : Large-scale comparative phosphoprotein analysis in maize seedlings reveals a complicated molecular regulation mechanism at the phosphoproteomic level during de-etiolation. In the present study we report a phosphoproteomic study conducted on Zea mays etiolated leaves harvested at three time points during greening (etiolated seedlings and seedlings exposed to light for 6 or 12 h). We identified a total of 2483 phosphopeptides containing 2389 unambiguous phosphosites from 1339 proteins. The abundance of nearly 692 phosphorylated peptides containing 783 phosphosites was reproducible and profiled with high confidence among treatments. Comparisons with other large-scale phosphoproteomic studies revealed that 473 of the phosphosites are novel to this study. Of the 783 phosphosites identified, 171, 79, and 138 were identified in 0, 6, and 12 h samples, respectively, which suggest that regulation of phosphorylation plays important roles during maize seedling de-etiolation. Our experimental methods included enrichment of phosphoproteins, allowing the identification of a great number of low abundance proteins, such as transcription factors, protein kinases, and photoreceptors. Most of the identified phosphoproteins were involved in gene transcription, post-transcriptional regulation, or signal transduction, and only a few were involved in photosynthesis and carbon metabolism. It is noteworthy that tyrosine phosphorylation and calcium signaling pathways might play important roles during maize seedling de-etiolation. Taken together, we have elucidated a new level of complexity in light-induced reversible protein phosphorylation during maize seedling de-etiolation. PMID:26497871

  12. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  13. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  14. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  15. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  16. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  17. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  18. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  19. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  20. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  1. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  2. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  3. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  4. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  5. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  6. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  7. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  8. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  9. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  10. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  11. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  12. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  13. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  14. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  15. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  16. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  17. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  18. Phosphoproteomes of Strongylocentrotus purpuratus shell and tooth matrix: identification of a major acidic sea urchin tooth phosphoprotein, phosphodontin

    PubMed Central

    2010-01-01

    Background Sea urchin is a major model organism for developmental biology and biomineralization research. However, identification of proteins involved in larval skeleton formation and mineralization processes in the embryo and adult, and the molecular characterization of such proteins, has just gained momentum with the sequencing of the Strongylocentrotus purpuratus genome and the introduction of high-throughput proteomics into the field. Results The present report contains the determination of test (shell) and tooth organic matrix phosphoproteomes. Altogether 34 phosphoproteins were identified in the biomineral organic matrices. Most phosphoproteins were specific for one compartment, only two were identified in both matrices. The sea urchin phosphoproteomes contained several obvious orthologs of mammalian proteins, such as a Src family tyrosine kinase, protein kinase C-delta 1, Dickkopf-1 and other signal transduction components, or nucleobindin. In most cases phosphorylation sites were conserved between sea urchin and mammalian proteins. However, the majority of phosphoproteins had no mammalian counterpart. The most interesting of the sea urchin-specific phosphoproteins, from the perspective of biomineralization research, was an abundant highly phosphorylated and very acidic tooth matrix protein composed of 35 very similar short sequence repeats, a predicted N-terminal secretion signal sequence, and an Asp-rich C-terminal motif, contained in [Glean3:18919]. Conclusions The 64 phosphorylation sites determined represent the most comprehensive list of experimentally identified sea urchin protein phosphorylation sites at present and are an important addition to the recently analyzed Strongylocentrotus purpuratus shell and tooth proteomes. The identified phosphoproteins included a major, highly phosphorylated protein, [Glean3:18919], for which we suggest the name phosphodontin. Although not sequence-related to such highly phosphorylated acidic mammalian dental

  19. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  20. Effects of anti-C23 (nucleolin) antibody on transcription of ribosomal DNA in Chironomus salivary gland cells

    SciTech Connect

    Egyhazi, E.; Pigon, A. ); Chang, Jinhong; Ghaffari, S.H.; Dreesen, T.D.; Wellman, S.E.; Case, S.T.; Olson, M.O.J. )

    1988-10-01

    Protein C23 (also called nucleolin or 100-kDa nucleolar protein) is a major nucleolar phosphoprotein involved in ribosome biogenesis. To determine the effects of protein C23 on preribosomal RNA (pre-rRNA) synthesis anti-C23 antiserum was microinjected into nuclei of Chironomus tentans salivary glands. Transcription was measured by incubation of the glands with {sup 32}P-labeled RNA precursors followed by microdissection of nucleoli, RNA extraction, and electrophoretic analyses. Injection of the anti-C23 antibody caused a 2- to 3.5-fold stimulation of {sup 32}P incorporation into 38 S pre-rRNA. No stimulation was observed in salivary glands injected with preimmune serum or antiserum preabsorbed with protein C23. The stimulatory effect was selective for pre-rRNA as indicated by the lack of stimulation of {sup 32}P incorporation into extranucleolar RNA. Injection of the antiserum produced little or no effect on pre-RNA processing as measured by the relative amounts of {sup 32}P-labeled intermediate cleavage products of pre-rRNA in stimulated versus control glands. These results suggest that protein C23 not only is involved in ribosome assembly but also plays a role in regulating the transcription of the preribosomal RNA.

  1. Robust production of recombinant phosphoproteins using cell-free protein synthesis

    PubMed Central

    Oza, Javin P.; Aerni, Hans R.; Pirman, Natasha L.; Barber, Karl W.; ter Haar, Charlotte M.; Rogulina, Svetlana; Amrofell, Matthew B.; Isaacs, Farren J.; Rinehart, Jesse; Jewett, Michael C.

    2015-01-01

    Understanding the functional and structural consequences of site-specific protein phosphorylation has remained limited by our inability to produce phosphoproteins at high yields. Here we address this limitation by developing a cell-free protein synthesis (CFPS) platform that employs crude extracts from a genomically recoded strain of Escherichia coli for site-specific, co-translational incorporation of phosphoserine into proteins. We apply this system to the robust production of up to milligram quantities of human MEK1 kinase. Then, we recapitulate a physiological signalling cascade in vitro to evaluate the contributions of site-specific phosphorylation of mono- and doubly phosphorylated forms on MEK1 activity. We discover that only one phosphorylation event is necessary and sufficient for MEK1 activity. Our work sets the stage for using CFPS as a rapid high-throughput technology platform for direct expression of programmable phosphoproteins containing multiple phosphorylated residues. This work will facilitate study of phosphorylation-dependent structure–function relationships, kinase signalling networks and kinase inhibitor drugs. PMID:26350765

  2. Growth arrest and differentiation-associated phosphoproteins in mesenchymal stem cells

    SciTech Connect

    Sparks, R.L.; Scott, R.E.

    1986-03-05

    Cancer is thought to result from the expression of defects in the control of both cell proliferation and differentiation. In murine mesenchymal stem cells they have established that differentiation and proliferation can be mediated at a variety of distinct states in the G/sub 1/ phase of the cell cycle. In order to evaluate the role of cellular phosphoprotein (PP) expression in these regulatory processes, five different growth and differentiation-dependent states were compared. Cells in the following states were studied: (1) exponential growth; (2) arrest in serum-deficient medium; (3) arrest at the predifferentiation arrest state; (4) arrest at a state of nonterminal differentiation; and (5) arrest at a state of terminal differentiation. Whole cell lysates from each group were phosphorylated in vitro using (..gamma..-/sup 32/P)ATP and analyzed by SDS-polyacrylamide gel electrophoresis. Two most interesting observations were established. First, a distinct PP with a molecular weight of 37 kD was expressed in all growth arrested cells but was not evident in rapidly growing cells. Second, two distinct differentiation-associated PP with molecular weights of 72 kD and 29 kD were expressed exclusively in nonterminally and terminally differentiated cells. Since the identification of the 37 kD cell cycle-dependent growth arrest-associated PP could be of great significance, they plan to further investigate the functional role of this phosphoprotein in the control of cellular proliferation.

  3. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  4. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  5. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  6. Immunohistochemical localization of a approximately 66 kD glycosylated phosphoprotein during development of the embryonic chick tibia.

    PubMed

    Bruder, S P; Caplan, A I; Gotoh, Y; Gerstenfeld, L C; Glimcher, M J

    1991-06-01

    Localization of a approximately 66 kD glycosylated phosphoprotein during morphogenesis of the embryonic chick tibia has been accomplished using immunohistochemistry. Although initial expression of the tibial osteoblast phenotype is detected as early as stage 28.5, with the deposition of osteoid matrix beginning at stage 30, little or no immunoreactivity against the approximately 66 kD glycosylated phosphoprotein is observed in pre-osteoblasts, osteoblasts, osteocytes, or in the uncalcified osteoid matrix during the early events of tibia development. Immunoreactivity was first observed at stage 32 when mineralization of the osteoid matrix is initiated. At this and all later stages, the phosphoprotein is located almost exclusively in the extracellular matrix at the mineralization front with essentially no detectable staining in the adjacent unmineralized osteoid matrix. Similarly, no cellular staining is observed when even the lightly mineralized extracellular matrix is strongly immunoreactive. Only scant immunostaining is present over the heavily mineralized regions, although demineralization of these areas with EDTA exposes a low intensity, punctate staining pattern. Additionally, cryosections of developing calvaria stained with this antiserum only display reactivity in regions of bone matrix undergoing mineralization. These localization studies support the hypothesis that this phosphoprotein is intimately associated with the process of bone matrix mineralization in the developing chick long bone. PMID:2070278

  7. Intracellular transduction in the regulation of pheromone biosynthesis of the silkworm, Bombyx mori: suggested involvement of calmodulin and phosphoprotein phosphatase.

    PubMed

    Matsumoto, S; Ozawa, R; Nagamine, T; Kim, G H; Uchiumi, K; Shono, T; Mitsui, T

    1995-03-01

    We have tested the effects of chemicals on bombykol production in vitro in the silkworm, Bombyx mori, to probe the biochemical steps as well as underlying mechanisms regulated by PBAN. These results suggest the involvement of calmodulin and phosphoprotein phosphatase in the intracellular signal transduction of PBAN action. PMID:7766202

  8. Identification of nuclear phosphoproteins as novel tobacco markers in mouse lung tissue following short-term exposure to tobacco smoke

    PubMed Central

    Niimori-Kita, Kanako; Ogino, Kiyoshi; Mikami, Sayaka; Kudoh, Shinji; Koizumi, Daikai; Kudoh, Noritaka; Nakamura, Fumiko; Misumi, Masahiro; Shimomura, Tadasuke; Hasegawa, Koki; Usui, Fumihiko; Nagahara, Noriyuki; Ito, Takaaki

    2014-01-01

    Smoking is a risk factor for lung diseases, including chronic obstructive pulmonary disease and lung cancer. However, the molecular mechanisms mediating the progression of these diseases remain unclear. Therefore, we sought to identify signaling pathways activated by tobacco-smoke exposure, by analyzing nuclear phosphoprotein expression using phosphoproteomic analysis of lung tissue from mice exposed to tobacco smoke. Sixteen mice were exposed to tobacco smoke for 1 or 7 days, and the expression of phosphorylated peptides was analyzed by mass spectrometry. A total of 253 phosphoproteins were identified, including FACT complex subunit SPT16 in the 1-day exposure group, keratin type 1 cytoskeletal 18 (K18), and adipocyte fatty acid-binding protein, in the 7-day exposure group, and peroxiredoxin-1 (OSF3) and spectrin β chain brain 1 (SPTBN1), in both groups. Semi-quantitative analysis of the identified phosphoproteins revealed that 33 proteins were significantly differentially expressed between the control and exposed groups. The identified phosphoproteins were classified according to their biological functions. We found that the identified proteins were related to inflammation, regeneration, repair, proliferation, differentiation, morphogenesis, and response to stress and nicotine. In conclusion, we identified proteins, including OSF3 and SPTBN1, as candidate tobacco smoke-exposure markers; our results provide insights into the mechanisms of tobacco smoke-induced diseases. PMID:25349779

  9. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  10. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  11. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  12. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  13. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  14. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  15. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  16. The prolyl isomerase Pin1 as a molecular switch to determine the fate of phosphoproteins

    PubMed Central

    Liou, Yih-Cherng; Zhou, Xiao Zhen; Lu, Kun Ping

    2011-01-01

    Pin1 is a highly conserved enzyme that only isomerizes specific phosphorylated Ser/Thr-Pro bonds in certain proteins, thereby inducing conformational changes. Such conformational changes represent a novel and tightly controlled signaling mechanism regulating a spectrum of protein activities in physiology and disease, often through phosphorylation-dependent, ubiquitin-mediated proteasomal degradation. In this review, we summarize recent advances in elucidating the role and regulation of Pin1 in controlling protein stability. We also propose a mechanism by which Pin1 functions as a molecular switch to control the fates of phosphoproteins. We finally stress the need to develop tools to directly visualize Pin1-catalyzed protein conformational changes as a way to determine their roles in the development and treatment of human diseases. PMID:21852138

  17. Genetic analysis of phosphoprotein and matrix protein of rabies viruses isolated in Brazil.

    PubMed

    Kobayashi, Yuki; Okuda, Hiromi; Nakamura, Kana; Sato, Go; Itou, Takuya; Carvalho, Adolorata A B; Silva, Marlon V; Mota, Carla S; Ito, Fumio H; Sakai, Takeo

    2007-11-01

    To investigate the genetic characteristics of phosphoprotein (P) and matrix protein (M) genes of variable rabies virus (RV) prevalent in Brazil, the authors genetically characterized the P and M genes from 30 Brazilian RV field isolates. Phylogenetic analysis based on the P and M genes revealed the presence of six RV variants that consisted primarily of three insectivorous bats, the vampire bat, dog and fox in Brazil. Specific amino acid substitutions corresponding to these phylogenetic lineages were observed, with Asp(42) and Glu(62) in the P protein found to be characteristic of Brazilian chiroptera- and carnivora-related RVs, respectively. Amino acid sequence motifs predicted to associate with a viral function in the P and M proteins were conserved among Brazilian RV variants. PMID:18057829

  18. Phospho-proteins patial gradients in a cell of spheroidal shape

    NASA Astrophysics Data System (ADS)

    Sosa, Gerardo; Ramirez-Santiago, Guillermo

    2010-03-01

    Many signalling proteins undergo phosphorilated-dephosphorilated cycles at different locations inside the cell. These cycles give rise to spatial gradients of phosphoproteins. In this work we solve the reaction-difussion equation in a spheroidal geometry and investigate the diffusion of the phosphorilated form of the proteins to evaluate the size of the spatial gradients. This is done in terms of diffusion coefficients as well as protein kinase and phosphatase activities. Previous estimations of these gradients have been done for two geometries [1]: (i) a spherical cell and (ii) for a kinase and a protein each one located on two parallel planar membranes. This type of quantitative analyzes may have important implications in the cellular signaling processes [2].[4pt] [1] G.C. Brown, B.N. Kholodenko, FEBS Letters, vol. 457, p. 452-454[0pt] [2] B.N. Kholodenko, G.C. Brown, J.B. Hoek, Biochem. J. vol. 350, p. 901-907.

  19. Focal Adhesion Kinase Is Involved in Rabies Virus Infection through Its Interaction with Viral Phosphoprotein P

    PubMed Central

    Fouquet, Baptiste; Nikolic, Jovan; Larrous, Florence; Bourhy, Hervé; Wirblich, Christoph

    2014-01-01

    ABSTRACT The rabies virus (RABV) phosphoprotein P is a multifunctional protein: it plays an essential role in viral transcription and replication, and in addition, RABV P has been identified as an interferon antagonist. Here, a yeast two-hybrid screen revealed that RABV P interacts with the focal adhesion kinase (FAK). The binding involved the 106-to-131 domain, corresponding to the dimerization domain of P and the C-terminal domain of FAK containing the proline-rich domains PRR2 and PRR3. The P-FAK interaction was confirmed in infected cells by coimmunoprecipitation and colocalization of FAK with P in Negri bodies. By alanine scanning, we identified a single mutation in the P protein that abolishes this interaction. The mutant virus containing a substitution of Ala for Arg in position 109 in P (P.R109A), which did not interact with FAK, is affected at a posttranscriptional step involving protein synthesis and viral RNA replication. Furthermore, FAK depletion inhibited viral protein expression in infected cells. This provides the first evidence of an interaction of RABV with FAK that positively regulates infection. IMPORTANCE Rabies virus exhibits a small genome that encodes a limited number of viral proteins. To maintain efficient virus replication, some of them are multifunctional, such as the phosphoprotein P. We and others have shown that P establishes complex networks of interactions with host cell components. These interactions have revealed much about the role of P and about host-pathogen interactions in infected cells. Here, we identified another cellular partner of P, the focal adhesion kinase (FAK). Our data shed light on the implication of FAK in RABV infection and provide evidence that P-FAK interaction has a proviral function. PMID:25410852

  20. The dynein light chain 8 binding motif of rabies virus phosphoprotein promotes efficient viral transcription

    PubMed Central

    Tan, Gene S.; Preuss, Mirjam A. R.; Williams, John C.; Schnell, Matthias J.

    2007-01-01

    Recent studies indicate that the interaction between rabies virus (RV) phosphoprotein and the dynein light chain 8 (LC8) is essential for RV pathogenesis. Through its association with the dynein motor complex, LC8 has been suggested as a molecular factor that links the viral ribonucleoprotein to the host cell transport system. Recent structural investigations, however, dispute this model. To understand the role of LC8 in RV pathogenesis, we generated recombinant RVs with or without the LC8 binding domain (LC8-BD) deleted from the RV phosphoprotein. Peripheral infection of adult mice showed that removal of the LC8-BD did not inhibit entry into the CNS, although it prevented onset of RV-induced CNS disease. However, deletion of the LC8-BD significantly attenuated viral transcription and replication in the CNS. Studies in RAG2 knockout (KO) mice infected with the same recombinant RVs confirmed this finding and indicated that the adaptive immune system is not a factor in the attenuation of viral replication early in the infection. In cell culture, the deletion of the LC8-BD greatly attenuated growth on neuronal cells whereas the growth pattern on nonneuronal cells remained unchanged. However, deletion of the LC8-BD did not affect production of RV virions. We provide evidence that removal of the LC8-BD decreases primary transcription. In this study, we propose that LC8 does not play a role in the retrograde axonal transport of RV and that the deletion of the LC8-BD impairs the infectivity of the virions by reducing early transcription and replication in neurons. PMID:17438267

  1. In Vitro and In Vivo Attenuation of Vesicular Stomatitis Virus (VSV) by Phosphoprotein Deletion

    PubMed Central

    Wongthida, Phonphimon; Jengarn, Juggragarn; Narkpuk, Jaraspim; Koonyosying, Pongpisid; Srisutthisamphan, Kanjana; Wanitchang, Asawin; Leaungwutiwong, Pornsawan; Teeravechyan, Samaporn; Jongkaewwattana, Anan

    2016-01-01

    Vesicular stomatitis virus (VSV) is highly immunogenic and able to stimulate both innate and adaptive immune responses. However, its ability to induce adverse effects has held back the use of VSV as a potential vaccine vector. In this study we developed VSV-ΔP, a safe yet potent replication-defective recombinant VSV in which the phosphoprotein (P) gene was deleted. VSV-ΔP replicated only in supporting cells expressing P (BHK-P cells) and at levels more than 2 logs lower than VSV. In vivo studies indicated that the moderate replication of VSV-ΔP in vitro was associated with the attenuation of this virus in the mouse model, whereas mice intracranially injected with VSV succumbed to neurotoxicity. Furthermore, we constructed VSV and VSV-ΔP expressing a variety of antigens including hemagglutinin-neuraminidase (HN) from Newcastle disease virus (NDV), hemagglutinin (HA) from either a 2009 H1N1 pandemic influenza virus (pdm/09) or the avian H7N9. VSV and VSV-ΔP incorporated the foreign antigens on their surface resulting in induction of robust neutralizing antibody, serum IgG, and hemagglutination inhibition (HAI) titers against their corresponding viruses. These results indicated that VSV with P gene deletion was attenuated in vitro and in vivo, and possibly expressed the foreign antigen on its surface. Therefore, the P gene-deletion strategy may offer a potentially useful and safer approach for attenuating negative-sense RNA viruses which use phosphoprotein as a cofactor for viral replication. PMID:27315286

  2. Secreted Phosphoprotein 1 and Sex-Specific Differences in Silica-Induced Pulmonary Fibrosis in Mice

    PubMed Central

    Latoche, Joseph D.; Ufelle, Alexander Chukwuma; Fazzi, Fabrizio; Ganguly, Koustav; Leikauf, George D.; Fattman, Cheryl L.

    2016-01-01

    Background: Fibrotic lung diseases occur predominantly in males, and reports describe better survival in affected females. Male mice are more sensitive to silica-induced lung fibrosis than silica-treated female mice. Secreted phosphoprotein 1 (SPP1, also known as osteopontin) increases in pulmonary fibrosis, and Spp1 transcription may be regulated by estrogen or estrogen receptor–related receptors. Objective: We determined whether differences in silica-induced SPP1 levels contribute to sex differences in lung fibrosis. Methods: Male and female mice were treated with 0.2 g/kg intratracheal silica, and lung injury was assessed 1, 3, or 14 days post-exposure. Gene-targeted (Spp1–/–) mice, control Spp1+/+ (C57BL/6J) mice, ovariectomized (OVX) female mice, and estrogen-treated male mice were treated with silica, and lung injury was assessed. Results: Silica-induced SPP1 in lung tissue, bronchoalveolar lavage, and serum increased more in male than in female mice. Following silica treatment, bronchoalveolar lavage cell infiltrates decreased in female Spp1–/– mice compared with female Spp1+/+ mice, and lung hydroxyproline decreased in male Spp1–/– mice compared with male Spp1+/+ mice. OVX female mice had increased lung SPP1 expression in response to silica compared with silica-treated sham female mice. Silica-induced lung collagen and hydroxyproline (markers of fibrosis), and SPP1 levels decreased in estrogen-treated males compared with untreated males. Conclusion: These findings suggest that sex-specific differences in SPP1 levels contribute to the differential sensitivity of male and female mice to the development of silica-induced fibrosis. Citation: Latoche JD, Ufelle AC, Fazzi F, Ganguly K, Leikauf GD, Fattman CL. 2016. Secreted phosphoprotein 1 and sex-specific differences in silica-induced pulmonary fibrosis in mice. Environ Health Perspect 124:1199–1207; http://dx.doi.org/10.1289/ehp.1510335 PMID:26955063

  3. Spatiotemporal phosphoprotein distribution and associated cytokine response of a traumatic injury.

    PubMed

    Han, Alice A; Currie, Holly N; Loos, Matthew S; Vrana, Julie A; Fabyanic, Emily B; Prediger, Maren S; Boyd, Jonathan W

    2016-03-01

    Molecular mechanisms of wound healing have been extensively characterized, providing a better understanding of the processes involved in wound repair and offering advances in treatment methods. Both spatial and temporal investigations of injury biomarkers have helped to pinpoint significant time points and locations during the recovery process, which may be vital in managing the injury and making the appropriate diagnosis. This study addresses spatial and temporal differences of phosphoproteins found in skeletal muscle tissue following a traumatic femur fracture, which were further compared to co-localized cytokine responses. In particular, several proteins (Akt, ERK, c-Jun, CREB, JNK, MEK1, and p38) and post-translational phosphorylations (p-Akt, p-c-Jun, p-CREB, p-ERK1/2, p-MEK1, p-p38, p-GSK3α/β, p-HSP27, p-p70S6K, and p-STAT3) associated with inflammation, new tissue formation, and remodeling were found to exhibit significant spatial and temporal differences in response to the traumatic injury. Quadratic discriminant analysis of all measured responses, including cytokine concentrations from previously published findings, was used to classify temporal and spatial observations at high predictive rates, further confirming that distinct spatiotemporal distributions for total protein, phosphorylation signaling, and cytokine (IL-1α, IL-1ß, IL2, IL6, TNF-α, and MIP-1α) responses exist. Finally, phosphoprotein measurements were found to be significantly correlated to cytokine concentrations, suggesting coordinated intracellular and extracellular activity during crucial periods of repair. This study represents a first attempt to monitor and assess integrated changes in extracellular and intracellular signaling in response to a traumatic injury in muscle tissues, which may provide a framework for future research to improve both our understanding of wounds and their treatment options. PMID:26702931

  4. Viral suppression function of intracellular antibody against C-terminal domain of rabies virus phosphoprotein.

    PubMed

    Liu, Yang; Sun, Lina; Yu, Pengcheng; Li, Aqian; Li, Chuan; Tang, Qing; Li, Dexin; Liang, Mifang

    2015-10-01

    Rabies virus (RV) causes a fatal disease in both human and animals. The disease can be prevented by post-exposure prophylaxis in individuals exposed to RV. However, the neutralization effect is limited after the virus enters into the host cells. So, it is important to identify new targets for rabies therapy. In this study, a human antibody RV1A2 specific to RV phosphoprotein (RV-P) was generated from a human naïve immune antibody library. The antibody recognized all forms of the phosphoproteins including the full length (P1) and short length of the P proteins (P2, P3, P4, and P5). The epitope mapping and the molecular docking of antigen-antibody complex showed that the antibody targets at a conserved epitope of 'VLGWV' ranging from amino acid (aa) 262 to 266 at C-terminal domain of the P protein, which locates at a hydrophobic pocket region in the C-terminal of the RV-P. The aa W265 within the epitope is on the flat surface of the domain, suggesting that it may be a critical amino acid for the functions of the P protein. Our results further showed that intracellular antibody RV1A2 which targets at the C-terminal domain of the P protein could effectively inhibit RV propagation 2-4 days post infection. These results suggest that the conserved C-terminal domain may be used as a new target for drug discovery, which highlights an intracellular inhibition of RV propagation and provides a potential novel way to treat RV infection. PMID:26188200

  5. Clinical application for the preservation of phospho-proteins through in-situ tissue stabilization

    PubMed Central

    2010-01-01

    Background Protein biomarkers will play a pivotal role in the future of personalized medicine for both diagnosis and treatment decision-making. While the results of several pre-clinical and small-scale clinical studies have demonstrated the value of protein biomarkers, there have been significant challenges to translating these findings into routine clinical care. Challenges to the use of protein biomarkers include inter-sample variability introduced by differences in post-collection handling and ex vivo degradation of proteins and protein modifications. Results In this report, we re-create laboratory and clinical scenarios for sample collection and test the utility of a new tissue stabilization technique in preserving proteins and protein modifications. In the laboratory setting, tissue stabilization with the Denator Stabilizor T1 resulted in a significantly higher yield of phospho-protein when compared to standard snap freeze preservation. Furthermore, in a clinical scenario, tissue stabilization at collection resulted in a higher yield of total phospho-protein, total phospho-tyrosine, pErkT202/Y204 and pAktS473 when compared to standard methods. Tissue stabilization did not have a significant effect on other post-translational modifications such as acetylation and glycosylation, which are more stable ex-vivo. Tissue stabilization did decrease total RNA quantity and quality. Conclusion Stabilization at the time of collection offers the potential to better preserve tissue protein and protein modification levels, as well as reduce the variability related to tissue processing delays that are often associated with clinical samples. PMID:21092202

  6. The stathmin phosphoprotein family: intracellular localization and effects on the microtubule network.

    PubMed

    Gavet, O; Ozon, S; Manceau, V; Lawler, S; Curmi, P; Sobel, A

    1998-11-01

    Stathmin is a small regulatory phosphoprotein integrating diverse intracellular signaling pathways. It is also the generic element of a protein family including the neural proteins SCG10, SCLIP, RB3 and its two splice variants RB3' and RB3". Stathmin itself was shown to interact in vitro with tubulin in a phosphorylation-dependent manner, sequestering free tubulin and hence promoting microtubule depolymerization. We investigated the intracellular distribution and tubulin depolymerizing activity in vivo of all known members of the stathmin family. Whereas stathmin is not associated with interphase microtubules in HeLa cells, a fraction of it is concentrated at the mitotic spindle. We generated antisera specific for stathmin phosphoforms, which allowed us to visualize the regulation of phosphorylation-dephosphorylation during the successive stages of mitosis, and the partial localization of stathmin phosphorylated on serine 16 at the mitotic spindle. Results from overexpression experiments of wild-type and novel phosphorylation site mutants of stathmin further suggest that it induces depolymerization of interphase and mitotic microtubules in its unphosphorylated state but is inactivated by phosphorylation in mitosis. Phosphorylation of mutants 16A25A and 38A63A on sites 38 and 63 or 16 and 25, respectively, was sufficient for the formation of a functional spindle, whereas mutant 16A25A38A63E retained a microtubule depolymerizing activity. Transient expression of each of the neural phosphoproteins of the stathmin family showed that they are at least partially associated to the Golgi apparatus and not to other major membrane compartments, probably through their different NH2-terminal domains, as described for SCG10. Most importantly, like stathmin and SCG10, overexpressed SCLIP, RB3 and RB3" were able to depolymerize interphase microtubules. Altogether, our results demonstrate in vivo the functional conservation of the stathmin domain within each protein of the

  7. Stathmin and its phosphoprotein family: general properties, biochemical and functional interaction with tubulin.

    PubMed

    Curmi, P A; Gavet, O; Charbaut, E; Ozon, S; Lachkar-Colmerauer, S; Manceau, V; Siavoshian, S; Maucuer, A; Sobel, A

    1999-10-01

    Stathmin, also referred to as Op18, is a ubiquitous cytosolic phosphoprotein, proposed to be a small regulatory protein and a relay integrating diverse intracellular signaling pathways involved in the control of cell proliferation, differentiation and activities. It interacts with several putative downstream target and/or partner proteins. One major action of stathmin is to interfere with microtubule dynamics, by inhibiting the formation of microtubules and/or favoring their depolymerization. Stathmin (S) interacts directly with soluble tubulin (T), which results in the formation of a T2S complex which sequesters free tubulin and therefore impedes microtubule formation. However, it has been also proposed that stathmin's action on microtubules might result from the direct promotion of catastrophes, which is still controversial. Phosphorylation of stathmin regulates its biological actions: it reduces its affinity for tubulin and hence its action on microtubule dynamics, which allows for example progression of cells through mitosis. Stathmin is also the generic element of a protein family including the neural proteins SCG10, SCLIP and RB3/RB3'/RB3". Interestingly, the stathmin-like domains of these proteins also possess a tubulin binding activity in vitro. In vivo, the transient expression of neural phosphoproteins of the stathmin family leads to their localization at Golgi membranes and, as previously described for stathmin and SCG10, to the depolymerization of interphasic microtubules. Altogether, the same mechanism for microtubule destabilization, that implies tubulin sequestration, is a common feature likely involved in the specific biological roles of each member of the stathmin family. PMID:15216892

  8. Regulation and subcellular localization of the microtubule-destabilizing stathmin family phosphoproteins in cortical neurons.

    PubMed

    Gavet, Olivier; El Messari, Saïd; Ozon, Sylvie; Sobel, André

    2002-06-01

    Stathmin is a ubiquitous cytosolic phosphoprotein, preferentially expressed in the nervous system, and the generic element of a protein family that includes the neural-specific proteins SCG10, SCLIP, and RB3 and its splice variants, RB3' and RB3". All phosphoproteins of the family share with stathmin its tubulin binding and microtubule (MT)-destabilizing activities. To understand better the specific roles of these proteins in neuronal cells, we performed a comparative study of their expression, regulation, and intracellular distribution in embryonic cortical neurons in culture. We found that stathmin is highly expressed ( approximately 0.25% of total proteins) and uniformly present in the various neuronal compartments (cell body, dendrites, axon, growth cones). It appeared mainly unphosphorylated or weakly phosphorylated on one site, and antisera to specific phosphorylated sites (serines 16, 25, or 38) did not reveal a differential regulation of its phosphorylation among neuronal cell compartments. However, they revealed a subpopulation of cells in which stathmin was highly phosphorylated on serine 16, possibly by CaM kinase II also active in a similar subpopulation. The other proteins of the stathmin family are expressed about 100-fold less than stathmin in partially distinct neuronal populations, RB3 being detected in only about 20% of neurons in culture. In contrast to stathmin, they are each mostly concentrated at the Golgi apparatus and are also present along dendrites and axons, including growth cones. Altogether, our results suggest that the different members of the stathmin family have complementary, at least partially distinct functions in neuronal cell regulation, in particular in relation to MT dynamics. PMID:12111843

  9. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  10. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  11. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  14. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  15. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  16. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  17. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  18. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  19. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  20. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  1. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  2. Phosphoprotein Isotope-Coded Solid-Phase Tag Approach for Enrichment and Quantitative Analysis of Phosphopeptides from Complex Mixtures

    SciTech Connect

    Qian, Weijun ); Goshe, Michael B.; Camp, David G. ); Yu, Li-Rong ); Tang, Keqi ); Smith, Richard D. )

    2003-10-15

    Many cellular processes are regulated by reversible protein phosphorylation and the ability to identify and quantify phosphoproteins from proteomes is essential for gaining a better understanding of these dynamic cellular processes. However, a sensitive, efficient and global method capable of addressing the phosphoproteome has yet to be developed. Here we describe an improved stable-isotope labeling method using a Phosphoprotein Isotope-coded Solid-phase Tag (PhIST) for isolating and measuring the relative abundance of phosphorylated peptides from complex peptide mixtures resulting from the enzymatic digestion of extracted proteins. The PhIST approach is an extension of the previously reported Phosphoprotein Isotope-coded Affinity Tag (PhIAT)approach developed by our laboratory1-2, where the O-phosphate moiety on phosphoseryl or phosphothreonyl residues were derivatized by hydroxide ion-medated B-elimination followed by the addition of 1,2-ethanedithiol (EDT). Instead of using the biotin affinity tag, peptides containing the EDT moiety were captured and labeled in one step using isotope-coded solid-phase reagents containing either light (12C6, 14N) or heavy (13C6, 15N) stable isotopes. The captured peptides labeled with the isotope-coded tags were released from the solid-phase support by UV photocleavage and analyzed by capillary LC-MS/MS. The efficiency and sensitivity of the PhIST labeling approach for identification of phosphopeptides from mixtures was demonstrated using casein phosphoproteins. Its utility for proteomic applications is demonstrated by the labeling of soluble proteins from human breast cancer cell line.

  3. A Druggable Pocket at the Nucleocapsid/Phosphoprotein Interaction Site of Human Respiratory Syncytial Virus

    PubMed Central

    Ouizougun-Oubari, Mohamed; Pereira, Nelson; Tarus, Bogdan; Galloux, Marie; Lassoued, Safa; Fix, Jenna; Tortorici, M. Alejandra; Hoos, Sylviane; Baron, Bruno; England, Patrick; Desmaële, Didier; Couvreur, Patrick; Bontems, François; Rey, Félix A.; Eléouët, Jean-François; Slama-Schwok, Anny

    2015-01-01

    ABSTRACT Presently, respiratory syncytial virus (RSV), the main cause of severe respiratory infections in infants, cannot be treated efficiently with antivirals. However, its RNA-dependent polymerase complex offers potential targets for RSV-specific drugs. This includes the recognition of its template, the ribonucleoprotein complex (RNP), consisting of genomic RNA encapsidated by the RSV nucleoprotein, N. This recognition proceeds via interaction between the phosphoprotein P, which is the main polymerase cofactor, and N. The determinant role of the C terminus of P, and more particularly of the last residue, F241, in RNP binding and viral RNA synthesis has been assessed previously. Here, we provide detailed structural insight into this crucial interaction for RSV polymerase activity. We solved the crystallographic structures of complexes between the N-terminal domain of N (N-NTD) and C-terminal peptides of P and characterized binding by biophysical approaches. Our results provide a rationale for the pivotal role of F241, which inserts into a well-defined N-NTD pocket. This primary binding site is completed by transient contacts with upstream P residues outside the pocket. Based on the structural information of the N-NTD:P complex, we identified inhibitors of this interaction, selected by in silico screening of small compounds, that efficiently bind to N and compete with P in vitro. One of the compounds displayed inhibitory activity on RSV replication, thereby strengthening the relevance of N-NTD for structure-based design of RSV-specific antivirals. IMPORTANCE Respiratory syncytial virus (RSV) is a widespread pathogen that is a leading cause of acute lower respiratory infections in infants worldwide. RSV cannot be treated efficiently with antivirals, and no vaccine is presently available, with the development of pediatric vaccines being particularly challenging. Therefore, there is a need for new therapeutic strategies that specifically target RSV. The interaction

  4. Borna Disease Virus Phosphoprotein Modulates Epigenetic Signaling in Neurons To Control Viral Replication

    PubMed Central

    Bonnaud, Emilie M.; Szelechowski, Marion; Bétourné, Alexandre; Foret, Charlotte; Thouard, Anne; Gonzalez-Dunia, Daniel

    2015-01-01

    ABSTRACT Understanding the modalities of interaction of neurotropic viruses with their target cells represents a major challenge that may improve our knowledge of many human neurological disorders for which viral origin is suspected. Borna disease virus (BDV) represents an ideal model to analyze the molecular mechanisms of viral persistence in neurons and its consequences for neuronal homeostasis. It is now established that BDV ensures its long-term maintenance in infected cells through a stable interaction of viral components with the host cell chromatin, in particular, with core histones. This has led to our hypothesis that such an interaction may trigger epigenetic changes in the host cell. Here, we focused on histone acetylation, which plays key roles in epigenetic regulation of gene expression, notably for neurons. We performed a comparative analysis of histone acetylation patterns of neurons infected or not infected by BDV, which revealed that infection decreases histone acetylation on selected lysine residues. We showed that the BDV phosphoprotein (P) is responsible for these perturbations, even when it is expressed alone independently of the viral context, and that this action depends on its phosphorylation by protein kinase C. We also demonstrated that BDV P inhibits cellular histone acetyltransferase activities. Finally, by pharmacologically manipulating cellular acetylation levels, we observed that inhibiting cellular acetyl transferases reduces viral replication in cell culture. Our findings reveal that manipulation of cellular epigenetics by BDV could be a means to modulate viral replication and thus illustrate a fascinating example of virus-host cell interaction. IMPORTANCE Persistent DNA viruses often subvert the mechanisms that regulate cellular chromatin dynamics, thereby benefitting from the resulting epigenetic changes to create a favorable milieu for their latent and persistent states. Here, we reasoned that Borna disease virus (BDV), the only

  5. Sequence of Events in Measles Virus Replication: Role of Phosphoprotein-Nucleocapsid Interactions

    PubMed Central

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia

    2014-01-01

    ABSTRACT The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, PXD and NTAIL is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the PXD F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in PXD-to-NTAIL binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the PXD-NTAIL interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. IMPORTANCE Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼6,700-nucleotide messenger RNAs from six

  6. Yeast has homologs (CNA1 and CNA2 gene products) of mammalian calcineurin, a calmodulin-regulated phosphoprotein phosphatase.

    PubMed Central

    Cyert, M S; Kunisawa, R; Kaim, D; Thorner, J

    1991-01-01

    Calcineurin, or phosphoprotein phosphatase type 2B (PP2B), is a calmodulin-regulated phosphoprotein phosphatase. We isolated a gene encoding a yeast PP2B homolog (CNA1) by screening a yeast genomic DNA library in the expression vector lambda gt11, first with 125I-labeled yeast calmodulin and then with a human cDNA encoding the catalytic (or A) subunit of calcineurin. The predicted CNA1 gene product is 54% identical to its mammalian counterpart. Using the polymerase chain reaction (PCR) with oligonucleotide primers based on sequences conserved between CNA1 and mammalian PP2B genes, we isolated a second gene, CNA2. CNA2 is identical to PP2Bw, a partial cDNA clone previously described by others as originating from rabbit brain tissue. Our findings demonstrate that a unicellular eukaryote contains phosphoprotein phosphatases of the 2B class. Haploid cells containing a single cna1 or cna2 null mutation, or both mutations, were viable. MATa cna1 cna2 double mutants were more sensitive than wild-type cells or either single mutant to growth arrest induced by the mating pheromone alpha factor and failed to resume growth during continuous exposure to alpha factor. Thus, calcineurin action antagonizes the mating-pheromone response pathway. Images PMID:1651503

  7. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  8. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  9. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  10. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  11. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  12. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  13. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  14. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  15. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  16. Retinophilin is a light-regulated phosphoprotein required to suppress photoreceptor dark noise in Drosophila

    PubMed Central

    Mecklenburg, Kirk L.; Takemori, Nobuaki; Komori, Naoka; Chu, Brian; Hardie, Roger C.; Matsumoto, Hiroyuki; O’Tousa, Joseph. E.

    2010-01-01

    Photoreceptor cells achieve high sensitivity, reliably detecting single photons, while limiting the spontaneous activation events responsible for dark noise. We used proteomic, genetic, and electrophysiological approaches to characterize Retinophilin (RTP/CG10233) in Drosophila photoreceptors, and establish its involvement in dark noise suppression. RTP possesses MORN (Membrane Occupation and Recognition Nexus) motifs, a structure shared with mammalian junctophilins and other membrane-associated proteins found within excitable cells. We show the MORN repeats, and both the N- and C-terminal domains, are required for RTP localization in the microvillar light gathering organelle, the rhabdomere. RTP exists in multiple phosphorylated isoforms under dark conditions and is dephosphorylated by light exposure. An RTP deletion mutant exhibits a high rate of spontaneous membrane depolarization events in dark conditions but retains the normal kinetics of the light response. Photoreceptors lacking NINAC myosin III, a motor protein/kinase, also display a similar dark noise phenotype as the RTP deletion. We show that NINAC mutants are depleted for RTP. These results suggest the increase in dark noise in NINAC mutants is due to lack of RTP, and further, defines a novel role for NINAC in the rhabdomere. We propose that RTP is a light-regulated phosphoprotein that organizes rhabdomeric components to suppress random activation of the phototransduction cascade and thus increases the signaling fidelity of dark-adapted photoreceptors. PMID:20107052

  17. Mumps Virus Nucleoprotein Enhances Phosphorylation of the Phosphoprotein by Polo-Like Kinase 1

    PubMed Central

    Pickar, Adrian; Zengel, James; Xu, Pei; Li, Zhuo

    2015-01-01

    ABSTRACT The viral RNA-dependent RNA polymerases (vRdRps) of nonsegmented, negative-sense viruses (NNSVs) consist of the enzymatic large protein (L) and the phosphoprotein (P). P is heavily phosphorylated, and its phosphorylation plays a critical role in viral RNA synthesis. Since NNSVs do not encode kinases, P is phosphorylated by host kinases. In this study, we investigate the roles that viral proteins play in the phosphorylation of mumps virus (MuV) P. We found that nucleoprotein (NP) enhances the phosphorylation of P. We have identified the serine/threonine kinase Polo-like kinase 1 (PLK1) as a host kinase that phosphorylates P and have found that phosphorylation of P by PLK1 is enhanced by NP. The PLK1 binding site in MuV P was mapped to residues 146 to 148 within the S(pS/T)P motif, and the phosphorylation site was identified as residues S292 and S294. IMPORTANCE It has previously been shown that P acts as a chaperone for NP, which encapsidates viral genomic RNA to form the NP-RNA complex, the functional template for viral RNA synthesis. Thus, it is assumed that phosphorylation of P may regulate NP's ability to form the NP-RNA complex, thereby regulating viral RNA synthesis. Our work demonstrates that MuV NP affects phosphorylation of P, suggesting that NP can regulate viral RNA synthesis by regulating phosphorylation of P. PMID:26608325

  18. Neutral Sphingomyelinase 2 (nSMase2) Is a Phosphoprotein Regulated by Calcineurin (PP2B)*

    PubMed Central

    Filosto, Simone; Fry, William; Knowlton, Anne A.; Goldkorn, Tzipora

    2010-01-01

    We previously reported that exposure of human airway epithelial cells to oxidative stress increased ceramide generation via specific activation of neutral sphingomyelinase2 (nSMase2). Here we show that nSMase2 is a phosphoprotein exclusively phosphorylated at serine residues. The level of nSMase2 phosphorylation can be modulated by treatment with anisomycin or phorbol 12-myristate 13-acetate (PMA/12-O-tetradecanoylphorbol-13-acetate), suggesting that p38 mitogen-activated protein kinase (MAPK) and protein kinases Cs are upstream of nSMase2 phosphorylation. Oxidative stress enhances both the activity and phosphorylation of nSMase2. Strikingly, we show here that nSMase2 is bound directly by the phosphatase calcineurin (CaN), which acts as an on/off switch for nSMase2 phosphorylation in the presence or absence of oxidative stress. Specifically, CaN is being inhibited/degraded and therefore does not bind nSMase2 under oxidative stress, and a mutant nSMase2 that lacks the CaN binding site exhibits constitutively elevated phosphorylation and increased activity relative to wild type nSMase2. Importantly, the phosphorylation and activity of the mutant no longer responds to oxidative stress, confirming that CaN is the critical link that allows oxidative stress to modulate nSMase2 phosphorylation and function. PMID:20106976

  19. The measles virus phosphoprotein interacts with the linker domain of STAT1

    SciTech Connect

    Devaux, Patricia Priniski, Lauren; Cattaneo, Roberto

    2013-09-15

    The measles virus (MV) phosphoprotein (P) and V proteins block the interferon (IFN) response by impeding phosphorylation of the signal transducer and activator of transcription 1 (STAT1) by the Janus kinase 1 (JAK1). We characterized how STAT1 mutants interact with P and JAK1 phosphorylation. Certain mutants of the linker, the Src-homology 2 domain (SH2), or the transactivation domain had reduced or abolished phosphorylation through JAK1 after IFN treatment. Other mutants, mainly localized in the linker, failed to interact with P as documented by the lack of interference with nuclear translocation. Thus the functional footprint of P on STAT1 localizes mainly to the linker domain; there is also some overlap with the STAT1 phosphorylation functional footprint on the SH2 domain. Based on these observations, we discuss how the MV-P might operate to inhibit the JAK/STAT pathway. - Highlights: • Residue in the linker and SH2 domains of STAT1 are important for MV-P interaction. • Residue in the linker and SH2 domains of STAT1 are important for STAT1 phosphorylation. • Residues interferring with both functions have similar location on STAT1. • The viral P and V proteins may operate in concert to inhibit the JAK/STAT pathway.

  20. Effects of calcium salts of acidic monomers on mineral induction of phosphoprotein immobilized to agarose beads.

    PubMed

    Ito, Shuichi; Iijima, Masahiro; Motai, Fumiko; Mizoguchi, Itaru; Saito, Takashi

    2012-10-01

    The aim of this study is to evaluate the mineralizing potential of acidic monomers and their calcium salts for mineralization, using an in vitro mineral induction model. Phosvitin (PV) was used as a model phosphoprotein in this study. PV was immobilized on agarose beads with divinyl sulfone. Five aliquots of agarose-immobilized PV, acidic monomers, and their calcium salts were incubated in mineralizing solution at various concentrations. The PV beads and acidic monomers were incubated at 37°C. Samples were taken at several time points during the incubation. Then, the agarose beads were analyzed for bound calcium by atomic absorption spectrometry. The mineral formed on the agarose beads was identified as an apatite by microarea X-ray diffraction. Additionally, the specimens were observed using scanning electron microscopy (SEM). Mineral induction time decreased with increasing solution saturation. 4-METCa salt [calcium salt of 4-methacryloxyethyl trimellitate (CMET)] significantly reduced the mineral induction time. Using these data, the interfacial tension for mineral induction of PV and CMET was determined to be 90.1 and 92.7 ergs/cm(2), respectively. The mineral induced in each specimen after incubation for 24 h was identified by its X-ray diffraction pattern as apatite. SEM observation showed that lath-shaped crystals were formed on the surfaces of the CMET. We conclude that CMET could play a role in dentin remineralization. PMID:22623052

  1. The role of phosphorylation in dentin phosphoprotein peptide absorption to hydroxyapatite surfaces: a molecular dynamics study

    PubMed Central

    Villarreal-Ramirez, Eduardo; Garduño-Juarez, Ramon; Gericke, Arne; Boskey, Adele

    2015-01-01

    Dentin phosphoprotein (DPP) is a protein expressed mainly in dentin and to a lesser extent in bone. DPP has a disordered structure, rich in glutamic acid, aspartic acid and phosphorylated serine/threonine residues. It has a high capacity for binding to calcium ions and to hydroxyapatite (HA) crystal surfaces. We used molecular dynamics (MD) simulations as a method for virtually screening interactions between DPP motifs and HA. The goal was to determine which motifs are absorbed to HA surfaces. For these simulations, we considered five peptides from the human DPP sequence. All-atom MD simulations were performed using GROMACS, the peptides were oriented parallel to the {100} HA crystal surface, the distance between the HA and the peptide was 3 nm. The system was simulated for 20 ns. Preliminary results show that for the unphosphorylated peptides, the acidic amino acids present an electrostatic attraction where their side chains are oriented towards HA. This attraction, however, is slow to facilitate bulk transport to the crystal surface. On the other hand, the phosphorylated (PP) peptides are rapidly absorbed on the surface of the HA with their centers of mass closer to the HA surface. More importantly, the root mean square fluctuation (RMSF) indicates that the average structures of the phosphorylated peptides are very inflexible and elongate, while that of the unphosphorylated peptides are flexible. Radius of gyration (Rg) analysis showed the compactness of un-phosphorylated peptides is lower than phosphorylated peptides. Phosphorylation of the DPP peptides is necessary for binding to HA surfaces. PMID:25158198

  2. Signaling in striatal neurons: the phosphoproteins of reward, addiction, and dyskinesia.

    PubMed

    Girault, Jean-Antoine

    2012-01-01

    The striatum is a deep region of the forebrain involved in action selection, control of movement, and motivation. It receives a convergent excitatory glutamate input from the cerebral cortex and the thalamus, controlled by dopamine (DA) released in response to unexpected rewards and other salient stimuli. Striatal function and its dysfunction in drug addiction or Parkinson's disease depend on the interplay between these neurotransmitters. Signaling cascades in striatal medium-sized spiny neurons (MSNs) involve multiple kinases, phosphatases, and phosphoproteins, some of which are highly enriched in these neurons. They control the properties of ion channels and the plasticity of MSNs, in part through their effects on gene transcription. This chapter summarizes signaling in MSNs and focuses on the regulation of multiple protein phosphatases through DA and glutamate receptors and the role of ERK. It is hypothesized that these pathways are particularly adapted to the specific computing properties of MSNs and the function of the basal ganglia circuits in which they participate. PMID:22340713

  3. Golgi Phosphoprotein 4 (GPP130) is a Sensitive and Selective Cellular Target of Manganese Exposure

    PubMed Central

    Masuda, Melisa; Braun-sommargren, Michelle; Crooks, Dan; Smith, Donald R.

    2014-01-01

    Chronic elevated exposure to manganese (Mn) is associated with neurocognitive and fine motor deficits in children. However, relatively little is understood about cellular responses to Mn spanning the transition between physiologic to toxic levels of exposure. Here, we investigated the specificity, sensitivity, and time course of the Golgi Phosphoprotein 4 (GPP130) response to Mn exposure in AF5 GABAergic neuronal cells, and we determined the extent to which GPP130 degradation occurs in brain cells in vivo in rats subchronically exposed to Mn. Our results show that GPP130 degradation in AF5 cells was specific to Mn, and did not occur following exposure to cobalt, copper, iron, nickel, or zinc. GPP130 degradation occurred without measurable increases in intracellular Mn levels and at Mn exposures as low as 0.54 µM. GPP130 protein was detectable by immunofluorescence in only ~15–30% of cells in striatal and cortical rat brain slices, and Mn-exposed animals exhibited a significant reduction in both the number of GPP130-positive cells, and the overall levels of GPP130 protein, demonstrating the in vivo relevance of this Mn-specific response within the primary target organ of Mn toxicity. These results provide insight into specific mechanism(s) of cellular Mn regulation and toxicity within the brain, including the selective susceptibility of cells to Mn cytotoxicity. PMID:23280773

  4. Structural studies on the authentic mumps virus nucleocapsid showing uncoiling by the phosphoprotein

    PubMed Central

    Cox, Robert; Pickar, Adrian; Qiu, Shihong; Tsao, Jun; Rodenburg, Cynthia; Dokland, Terje; Elson, Andrew; He, Biao; Luo, Ming

    2014-01-01

    Mumps virus (MuV) is a highly contagious pathogen, and despite extensive vaccination campaigns, outbreaks continue to occur worldwide. The virus has a negative-sense, single-stranded RNA genome that is encapsidated by the nucleocapsid protein (N) to form the nucleocapsid (NC). NC serves as the template for both transcription and replication. In this paper we solved an 18-Å–resolution structure of the authentic MuV NC using cryo-electron microscopy. We also observed the effects of phosphoprotein (P) binding on the MuV NC structure. The N-terminal domain of P (PNTD) has been shown to bind NC and appeared to induce uncoiling of the helical NC. Additionally, we solved a 25-Å–resolution structure of the authentic MuV NC bound with the C-terminal domain of P (PCTD). The location of the encapsidated viral genomic RNA was defined by modeling crystal structures of homologous negative strand RNA virus Ns in NC. Both the N-terminal and C-terminal domains of MuV P bind NC to participate in access to the genomic RNA by the viral RNA-dependent-RNA polymerase. These results provide critical insights on the structure-function of the MuV NC and the structural alterations that occur through its interactions with P. PMID:25288750

  5. Characterization of interleukin 2 stimulated 65-kilodalton phosphoprotein in human T cells

    SciTech Connect

    Zu, Youli; Kohno, Michiaki; Namba, Yuziro ); Kohno, Michiaki ); Kubota, Ichiro ); Nishida, Eisuke )

    1990-01-30

    The authors have characterized the cellular proteins which are rapidly phosphorylated by interleukin 2 (IL 2) in a human IL 2 dependent cell line. When treated with IL 2, the phosphorylation of five proteins, 65, 50, 37, 24, and 21 kDa, was found in IL 2 dependent cell lines by two-dimensional gel electrophoretic analysis. After cell conversion from an IL 2 dependent state to an IL 2 independent state, one of the five phosphoproteins, the 65-kDa protein, became constitutively phosphorylated even without addition of IL 2. Also, in other IL 2 independent cell lines, such as KUT-2 and HUT-102, constitutive phosphorylation of the 65-kDa protein occurred without IL 2-stimulation. So our researchers were focused on biochemical characterization of the 65-kDa protein. It was found that the 65-kDa protein was one of the major cellular proteins by comparing the results of two-dimensional gel electrophoretic analysis of ({sup 32}P)P{sub i}-labeled and ({sup 3}H)leucine-labeled cellular proteins and peptide mapping analysis. Subcellular fraction studies indicated that the 65-kDa protein is a cytosol protein. The 65-kDa protein was purified from cytosol of a human T cell line, and its amino acid composition and amino acid sequences of its three oligopeptides were determined. It was found that the 65-kDa protein is identical with 1-plastin.

  6. Dentin phosphoprotein gene locus is not associated with dentinogenesis imperfecta types II and III

    SciTech Connect

    MacDougall, M.; Zeichner-David, M.; Davis, A.; Slavkin, H. ); Murray, J. ); Crall, M. )

    1992-01-01

    Dentinogenesis imperfecta (DGI) is an autosomal dominant inherited dental disease which affects dentin production and mineralization. Genetic linkage studies have been performed on several multigeneration informative kindreds. These studies determined linkage between DGI types II and III and group-specific component (vitamin D-binding protein). This gene locus has been localized to the long arm of human chromosome 4 in the region 4q11-q21. Although this disease has been mapped to chromosome 4, the defective gene product is yet to be determined. Biochemical studies have suggested abnormal levels of dentin phosphoprotein (DPP) associated with DGI type II. This highly acidic protein is the major noncollagenous component of dentin, being solely expressed by the ectomesenchymal derived odontoblast cells of the tooth. The purpose of the present study was to establish whether DPP is associated with DGI types II and III, by using molecular biology techniques. The results indicated that DPP is not localized to any region of human chromosome 4, thus suggesting that the DPP gene is not directly associated with DGI type II or DGI type III. The data do not exclude the possibility that other proteins associated with DPP posttranslational modifications might be responsible for this genetic disease.

  7. Fas-activated serine/threonine phosphoprotein promotes immune-mediated pulmonary inflammation

    PubMed Central

    Simarro, Maria; Giannattasio, Giorgio; De la Fuente, Miguel A; Benarafa, Charaf; Subramanian, Kulandayan K.; Ishizawar, Rumey; Balestrieri, Barbara; Andersson, Emma M; Luo, Hongbo R.; Orduña, Antonio; Boyce, Joshua; Anderson, Paul

    2010-01-01

    We have generated Fas activated serine threonine phosphoprotein-deficient mice (FAST−/−) to study the in vivo role of FAST in immune system function. In a model of house dust mite (HDM)-induced allergic pulmonary inflammation, wild type mice develop a mixed cellular infiltrate composed of eosinophils, lymphocytes and neutrophils. FAST−/− mice develop airway inflammation that is distinguished by the near absence of neutrophils. Similarly, LPS-induced alveolar neutrophil recruitment is markedly reduced in FAST−/− mice compared to wild type controls. This is accompanied by reduced concentrations of cytokines (TNF-α, IL-6 and IL-23) and chemoattractants (MIP-2 and KC) in bronchoalveolar lavage fluids. As FAST−/− neutrophils exhibit normal chemotaxis and survival, impaired neutrophil recruitment is likely to be due to reduced production of chemoattractants within the pulmonary parenchyma. Studies using bone marrow chimeras implicate lung resident hematopoietic cells (e.g. pulmonary dendritic cells and/or alveolar macrophages) in this process. In conclusion, our results introduce FAST as a pro-inflammatory factor that modulates the function of lung resident hematopoietic cells to promote neutrophil recruitment and pulmonary inflammation. PMID:20363972

  8. Solution and Crystallographic Structures of the Central Region of the Phosphoprotein from Human Metapneumovirus

    PubMed Central

    Leyrat, Cedric; Renner, Max; Harlos, Karl; Grimes, Jonathan M.

    2013-01-01

    Human metapneumovirus (HMPV) of the family Paramyxoviridae is a major cause of respiratory illness worldwide. Phosphoproteins (P) from Paramyxoviridae are essential co-factors of the viral RNA polymerase that form tetramers and possess long intrinsically disordered regions (IDRs). We located the central region of HMPV P (Pced) which is involved in tetramerization using disorder analysis and modeled its 3D structure ab initio using Rosetta fold-and-dock. We characterized the solution-structure of Pced using small angle X-ray scattering (SAXS) and carried out direct fitting to the scattering data to filter out incorrect models. Molecular dynamics simulations (MDS) and ensemble optimization were employed to select correct models and capture the dynamic character of Pced. Our analysis revealed that oligomerization involves a compact central core located between residues 169-194 (Pcore), that is surrounded by flexible regions with α-helical propensity. We crystallized this fragment and solved its structure at 3.1 Å resolution by molecular replacement, using the folded core from our SAXS-validated ab initio model. The RMSD between modeled and experimental tetramers is as low as 0.9 Å, demonstrating the accuracy of the approach. A comparison of the structure of HMPV P to existing mononegavirales Pced structures suggests that Pced evolved under weak selective pressure. Finally, we discuss the advantages of using SAXS in combination with ab initio modeling and MDS to solve the structure of small, homo-oligomeric protein complexes. PMID:24224051

  9. Knockdown of Golgi phosphoprotein 2 inhibits hepatocellular carcinoma cell proliferation and motility

    PubMed Central

    Liu, Yiming; Zhang, Xiaodi; Sun, Ting; Jiang, Junchang; Li, Ying; Chen, Mingliang; Wei, Zhen; Jiang, Weiqin; Zhou, Linfu

    2016-01-01

    Golgi phosphoprotein 2 (GP73) is highly expressed in hepatocellular carcinoma (HCC) cells, where it serves as a biomarker and indicator of disease progression. We used MTS assays, anchorage-independent cell colony formation assays and a xenograft tumor model to show that GP73-specific siRNAs inhibit HCC proliferation in HepG2, SMMC-7721, and Huh7 cell lines and in vivo. Following GP73 silencing, levels of p-Rb, a factor related to metastasis, were reduced, but cell cycle progression was unaffected. Our results suggest that GP73 silencing may not directly suppress proliferation, but may instead inhibit cell motility. Results from proliferation assays suggest GP73 reduces expression of epithelial mesenchymal transition (EMT)-related factors and promotes cell motility, while transwell migration and invasion assays indicated a possible role in metastasis. Immunofluorescence co-localization microscopy and immunoblotting showed that GP73 decreases expression of N-cadherin and E-cadherin, two key factors in EMT, which may in turn decrease intracellular adhesive forces and promote cell motility. This study confirmed that GP73 expression leads to increased expression of EMT-related proteins and that GP73 silencing reduces HCC cell migration in vitro. These findings suggest that GP73 silencing through siRNA delivery may provide a novel low-toxicity therapy for the inhibition of tumor proliferation and metastasis. PMID:26870893

  10. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  11. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  12. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  13. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  14. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  15. The herpes simplex virus 1 protein kinase encoded by the US3 gene mediates posttranslational modification of the phosphoprotein encoded by the UL34 gene.

    PubMed Central

    Purves, F C; Spector, D; Roizman, B

    1991-01-01

    Earlier studies have shown that a herpes simplex virus 1 (HSV-1) open reading frame, US3, encodes a novel protein kinase and have characterized the cognate amino acid sequence which is phosphorylated by this enzyme. This report identifies an apparently essential viral phosphoprotein whose posttranslational processing involves the viral protein kinase. Analyses of viral proteins phosphorylated in the course of productive infection revealed a phosphoprotein whose mobility was viral protein kinase and serotype dependent. Thus, the corresponding HSV-1 and HSV-2 phosphoproteins differ in their electrophoretic mobilities, and the phosphoprotein specified by the HSV-1 mutant deleted in US3 (R7041) differs from that of the corresponding HSV-1 and HSV-2 proteins. Analyses of HSV-1 x HSV-2 recombinants mapped the phosphoprotein between 0.42 and 0.47 map units on the prototype HSV-1 DNA map. Within this region, the UL34 open reading frame was predicted to encode a protein of appropriate molecular weight which would also contain the consensus target site for phosphorylation by the viral protein kinase as previously defined with synthetic peptides. Replacement of the native UL34 gene with a UL34 gene tagged with a 17-amino-acid epitope from the alpha 4 protein identified this gene as encoding the phosphoprotein. Finally, mutagenesis of the predicted phosphorylation site on UL34 in the viral genome, and specifically the substitution of threonine or serine with alanine in the product of the UL34 gene, yielded phosphoproteins whose electrophoretic mobilities could not be differentiated from that of the US3- mutant. We conclude that the posttranslational processing of the UL34 gene product to its wild-type phenotype requires the participation of the viral protein kinase. While the viral protein kinase is not essential for viral replication in cells in culture, the UL34 gene product itself may not be dispensable. Images PMID:1656069

  16. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  17. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  18. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  19. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  20. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  1. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  2. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  3. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  4. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  5. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  6. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  7. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  8. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  9. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  10. Atomic resolution description of the interaction between the nucleoprotein and phosphoprotein of Hendra virus.

    PubMed

    Communie, Guillaume; Habchi, Johnny; Yabukarski, Filip; Blocquel, David; Schneider, Robert; Tarbouriech, Nicolas; Papageorgiou, Nicolas; Ruigrok, Rob W H; Jamin, Marc; Jensen, Malene Ringkjøbing; Longhi, Sonia; Blackledge, Martin

    2013-01-01

    Hendra virus (HeV) is a recently emerged severe human pathogen that belongs to the Henipavirus genus within the Paramyxoviridae family. The HeV genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid. Recruitment of the viral polymerase onto the nucleocapsid template relies on the interaction between the C-terminal domain, N(TAIL), of N and the C-terminal X domain, XD, of the polymerase co-factor phosphoprotein (P). Here, we provide an atomic resolution description of the intrinsically disordered N(TAIL) domain in its isolated state and in intact nucleocapsids using nuclear magnetic resonance (NMR) spectroscopy. Using electron microscopy, we show that HeV nucleocapsids form herringbone-like structures typical of paramyxoviruses. We also report the crystal structure of XD of P that consists of a three-helix bundle. We study the interaction between N(TAIL) and XD using NMR titration experiments and provide a detailed mapping of the reciprocal binding sites. We show that the interaction is accompanied by α-helical folding of the molecular recognition element of N(TAIL) upon binding to a hydrophobic patch on the surface of XD. Finally, using solution NMR, we investigate the interaction between intact nucleocapsids and XD. Our results indicate that monomeric XD binds to N(TAIL) without triggering an additional unwinding of the nucleocapsid template. The present results provide a structural description at the atomic level of the protein-protein interactions required for transcription and replication of HeV, and the first direct observation of the interaction between the X domain of P and intact nucleocapsids in Paramyxoviridae. PMID:24086133

  11. Rabies virus phosphoprotein interacts with mitochondrial Complex I and induces mitochondrial dysfunction and oxidative stress.

    PubMed

    Kammouni, Wafa; Wood, Heidi; Saleh, Ali; Appolinario, Camila M; Fernyhough, Paul; Jackson, Alan C

    2015-08-01

    Our previous studies in an experimental model of rabies showed neuronal process degeneration in association with severe clinical disease. Cultured adult rodent dorsal root ganglion neurons infected with challenge virus standard (CVS)-11 strain of rabies virus (RABV) showed axonal swellings and reduced axonal growth with evidence of oxidative stress. We have shown that CVS infection alters a variety of mitochondrial parameters and increases reactive oxygen species (ROS) production and mitochondrial Complex I activity vs. mock infection. We have hypothesized that a RABV protein targets mitochondria and triggers dysfunction. Mitochondrial extracts of mouse neuroblastoma cells were analyzed with a proteomics approach. We have identified peptides belonging to the RABV nucleocapsid protein (N), phosphoprotein (P), and glycoprotein (G), and our data indicate that the extract was most highly enriched with P. P was also detected by immunoblotting in RABV-infected purified mitochondrial extracts and also in Complex I immunoprecipitates from the extracts but not in mock-infected extracts. A plasmid expressing P in cells increased Complex I activity and increased ROS generation, whereas expression of other RABV proteins did not. We have analyzed recombinant plasmids encoding various P gene segments. Expression of a peptide from amino acid 139-172 increased Complex I activity and ROS generation similar to expression of the entire P protein, whereas peptides that did not contain this region did not increase Complex I activity or induce ROS generation. These results indicate that a region of the RABV P interacts with Complex I in mitochondria causing mitochondrial dysfunction, increased generation of ROS, and oxidative stress. PMID:25698500

  12. Protein kinase C regulates the phosphorylation and oligomerization of ERM binding phosphoprotein 50

    SciTech Connect

    Fouassier, Laura; Nichols, Matthew T.; Gidey, Elizabeth; McWilliams, Ryan R.; Robin, Helene; Finnigan, Claire; Howell, Kathryn E.; Housset, Chantal; Doctor, R. Brian . E-mail: brian.doctor@uchsc.edu

    2005-05-15

    Ezrin-Radixin-Moesin (ERM) binding phosphoprotein 50 (EBP50, a.k.a. NHERF-1) is a scaffold protein essential for the localization and coordinated activity of apical transporters, enzymes and receptors in epithelial cells. EBP50 acts via multiple protein binding interactions, including oligomerization through interactions of its PSD95-Dlg-ZO1 (PDZ) domains. EBP50 can be phosphorylated on multiple sites and phosphorylation of specific sites modulates the extent of oligomerization. The aim of the present study was to test the capacity of protein kinase C (PKC) to phosphorylate EBP50 and to regulate its oligomerization. In vitro experiments showed that the catalytic subunit of PKC directly phosphorylates EBP50. In HEK-293 cells transfected with rat EBP50 cDNA, a treatment with 12 myristate 13-acetate (PMA) induced a translocation of PKC{alpha} and {beta} isoforms to the membrane and increased {sup 32}P incorporation into EBP50. In co-transfection/co-precipitation studies, PMA treatment stimulated EBP50 oligomerization. Mass spectrometry analysis of full-length EBP50 and phosphorylation analyses of specific domains, and of mutated or truncated forms of EBP50, indicated that PKC-induced phosphorylation of EBP50 occurred on the Ser{sup 337}/Ser{sup 338} residue within the carboxyl-tail domain of the protein. Truncation of Ser{sup 337}/Ser{sup 338} also diminished PKC-induced oligomerization of EBP50. These results suggest the PKC signaling pathway can impact EBP50-dependent cellular functions by regulating EBP50 oligomerization.

  13. Vasodilator-Stimulated Phosphoprotein Deficiency Potentiates PAR-1-induced Increase in Endothelial Permeability in Mouse Lungs

    PubMed Central

    Profirovic, Jasmina; Han, Jingyan; Andreeva, Alexandra V.; Neamu, Radu F.; Pavlovic, Sasha; Vogel, Stephen M.; Walter, Ulrich; Voyno-Yasenetskaya, Tatyana A.

    2010-01-01

    Vasodilator-stimulated phosphoprotein (VASP) is implicated in the protection of the endothelial barrier in vitro and in vivo. VASP function in thrombin signaling in the endothelial cells (ECs) is not known. For the first time we studied the effects of VASP deficiency on EC permeability and pulmonary vascular permeability in response to thrombin receptor stimulation. We provided the evidence that VASP deficiency potentiates the increase in endothelial permeability induced by activation of thrombin receptor in cultured human umbilical vein endothelial cells (HUVECs) and isolated mouse lungs. Using transendothelial resistance measurement, we showed that siRNA-mediated VASP downregulation in HUVECs leads to a potentiation of thrombin- and protease-activated receptor 1 (PAR-1) agonist-induced increase in endothelial permeability. Compared to control cells, VASP-deficient HUVECs had delayed endothelial junctional reassembly and abrogated VE-cadherin cytoskeletal anchoring in the recovery phase after thrombin stimulation, as demonstrated by immunofluorescence studies and cell fractionation analysis, respectively. Measurement of the capillary filtration coefficient in isolated mouse lungs demonstrated that VASP−/− mice have increased microvascular permeability in response to infusion with PAR-1 agonist compared to wild type mice. Lack of VASP led to decreased Rac1 activation both in VASP-deficient HUVECs after thrombin stimulation and VASP−/− mouse lungs after PAR-1 agonist infusion, indicating that VASP effects on thrombin signaling may correlated with changes in Rac1 activity. This study demonstrates that VASP may play critical and complex role in the regulation of thrombin-dependent disruption of the endothelial barrier function. PMID:20945373

  14. Astacin Proteases Cleave Dentin Sialophosphoprotein (Dspp) to Generate Dentin Phosphoprotein (Dpp)

    PubMed Central

    Tsuchiya, Shuhei; Simmer, James P; Hu, Jan C-C; Richardson, Amelia S; Yamakoshi, Fumiko; Yamakoshi, Yasuo

    2011-01-01

    Dentin sialophosphoprotein (Dspp) is critical for proper dentin biomineralization because genetic defects in DSPP cause dentin dysplasia type II and dentinogenesis imperfecta types II and III. Dspp is processed by proteases into smaller subunits; the initial cleavage releases dentin phosphoprotein (Dpp). We incubated fluorescence resonance energy transfer (FRET) peptides containing the amino acid context of the Dpp cleavage site (YEFDGKSMQGDDPN, designated Dspp-FRET) or a mutant version of that context (YEFDGKSIEGDDPN, designated mutDspp-FRET) with BMP-1, MEP1A, MEP1B, MMP-2, MMP-8, MMP-9, MT1-MMP, MT3-MMP, Klk4, MMP-20, plasmin, or porcine Dpp and characterized the peptide cleavage products. Only BMP-1, MEP1A, and MEP1B cleaved Dspp-FRET at the G–D peptide bond that releases Dpp from Dspp in vivo. We isolated Dspp proteoglycan from dentin power and incubated it with the three enzymes that cleaved Dspp-FRET at the G–D bond. In each case, the released Dpp domain was isolated, and its N-terminus was characterized by Edman degradation. BMP-1 and MEP1A both cleaved native Dspp at the correct site to generate Dpp, making both these enzymes prime candidates for the protease that cleaves Dspp in vivo. MEP1B was able to degrade Dpp when the Dpp was at sufficiently high concentration to deplete free calcium ion concentration. Immunohistochemistry of developing porcine molars demonstrated that astacins are expressed by odontoblasts, a result that is consistent with RT-PCR analyses. We conclude that during odontogenesis, astacins in the predentin matrix cleave Dspp before the DDPN sequence at the N-terminus of Dpp to release Dpp from the parent Dspp protein. © 2011 American Society for Bone and Mineral Research. PMID:20687161

  15. Prognostic significance of peroxiredoxin 1 and ezrin-radixin-moesin-binding phosphoprotein 50 in cholangiocarcinoma

    PubMed Central

    Yonglitthipagon, Ponlapat; Pairojkul, Chawalit; Chamgramol, Yaovalux; Loukas, Alex; Mulvenna, Jason; Bethony, Jeffrey; Sripa, Banchob

    2012-01-01

    Summary We performed a comparative proteomic analysis of protein expression profiles in four cholangiocarcinoma (CCA) cell lines: K100, M156, M213, and M139. The H69 biliary cell line was used as a control. Peroxiredoxin 1 (PRX1) and ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50) were selected for further validation by immunohistochemistry (IHC) using a CCA tissue microarray (n=301) to assess their prognostic value in this cancer. Both PRX1 and EBP50 were overexpressed in CCA tissues compared with normal liver tissues. Of the 301 CCA cases, overexpression of PRX1 in 103 (34.3%) was associated with an age-related effect in young patients (P = 0.011) and the absence of cholangiocarcinoma in lymphatic vessels and perineural tissues (P = 0.004 and P = 0.037, respectively). Expression of EBP50 correlated with histopathologic type, being higher in 180 (59.8%) of moderately or poorly differentiated tumors (P = 0.039) and was associated with the presence of cholangiocarcinoma in lymphatic and vascular vessels (P< 0.001 and P< 0.001, respectively). The high expression of EBP50 and the low expression of PRX1 correlated with reduced survival by univariate analysis (P = 0.017 and P = 0.048, respectively). Moreover, the impact of PRX1 and EBP50 expression on patient survival was an independent predictor in multivariate analyses (P = 0.004 and P = 0.025, respectively). Therefore, altered expression of PRX1 and EBP50 may be used as prognostic markers incholangiocarcinoma. PMID:22446018

  16. Characterization of the major phosphoprotein and its kinase on the surface of the rat adipocyte

    SciTech Connect

    Kang, E.S.; Chiang, T.M.

    1986-12-01

    Intact rat fat cell exposed to 12.5 ..mu..M (..gamma..-32P)ATP incorporate label into specific proteins within minutes. By solubilizing the reaction mixture with SDS which bypasses the subcellular fractionation steps, the labeled proteins can be identified in autoradiographs of SDS-PAGE gels. The most prominently labeled protein has an M/sub r/ of 42,000. Localization of this component to the cell surface can be made on the basis of inhibition of phosphorylation by addition of a protein derived from the rat brain with protein kinase inhibitory property, susceptibility of the phosphorylated protein to the tryptic digestion, inhibition of phosphorylation of this protein after brief exposure to melittin. To rule out the possibility that the cell surface protein might be a mitochondrial contaminant from broken cells, /sup 32/Pi-labeled and (..gamma..-/sup 32/P)ATP-labeled cells were chromatographed on a rabbit anti-pyruvate dehydrogenase antibody-Sepharose 4B column. A single labeled peak was detected upon elution of the bound fraction only in the /sup 32/pi-labeled sample, and not in the (..gamma..-/sup 32/P)ATP-labeled sample. Subcellular fractionation studies of intact cells labeled depending on whether a continuous sucrose gradient or a discontinuous sucrose gradient was used. Finally, comparison of the autoradiographs of two-dimensional (2D) gels show different isoelectric points for 42,000 M/sub r/ components in (..gamma..-/sup 32/P)ATP- and /sup 32/Pi-labeled cells. These and other experiments support the likelihood that phosphoproteins of 42,000 M/sub r/ are present at two sites in the intact rat fat cell, the cell surface and at an intracellular site, most likely the mitochondria.

  17. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  18. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  19. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  20. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  1. Purification of a 53kD pI 4. 8 cytosolic phosphoprotein from HL60

    SciTech Connect

    Biser, P.S.; Spearman, T.N.; Bruzzone, M.; Durham, J.P.

    1987-05-01

    In order to study the potential role of a 53kD pI 4.8 phosphoprotein in the differentiation of HL60 using monoclonal antibodies, a partial purification has been carried out. Cytosol from cells differentiated with 1 M retinoic acid was applied to a DEAE-cellulose column and eluted with a linear NaCl gradient. Fractions were screened by in vitro phosphorylation of aliquots using /sup 32/P ATP and highly purified protein kinase C, SDS-PAGE, and autoradiography. Fraction which showed autoradiographic bands of the correct molecular weight were further analyzed using 2-D electrophoresis involving isolectric focusing over a pH range of 4-6 followed by SDS-PAGE on a 10% slab gel. Autoradiograms of these gels showed the 53 kD pI 4.8 phosphoprotein to elute with a peak at 0.24 NaCl. This 53 kD pI 4.8 protein was identified as the 53kD pI 4.8 phosphoprotein whose synthesis and phosphorylation is induced by retinoic acid by DEAE chromatography of cytosol from cells labelled in vivo with /sup 32/PO/sub 4//sup -2/ followed by 2-D electrophoresis. Fractions containing the 53 kD pI 4.8 protein were concentrated and applied to a chromatofocusing column which was eluted with a gradient from pH 6 to 4. Analysis of fractions via in vitro phosphorylation and SDS PAGE showed the 53 kD pI 4.8 protein eluting with a peak at pH 4.8 as a silver-stained band well separated from contaminating proteins. Experiments are currently in progress to produce monoclonal antibodies to the 53 kD pI 4.8 protein using the partially purified antigen.

  2. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  3. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  4. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  5. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  6. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  7. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  8. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  9. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  10. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321